WorldWideScience

Sample records for p16 gene mutations

  1. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    Science.gov (United States)

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  2. p16 mutation spectrum in the premalignant condition Barrett's esophagus.

    Directory of Open Access Journals (Sweden)

    Thomas G Paulson

    Full Text Available BACKGROUND: Mutation, promoter hypermethylation and loss of heterozygosity involving the tumor suppressor gene p16 (CDKN2a/INK4a have been detected in a wide variety of human cancers, but much less is known concerning the frequency and spectrum of p16 mutations in premalignant conditions. METHODS AND FINDINGS: We have determined the p16 mutation spectrum for a cohort of 304 patients with Barrett's esophagus, a premalignant condition that predisposes to the development of esophageal adenocarcinoma. Forty seven mutations were detected by sequencing of p16 exon 2 in 44 BE patients (14.5% with a mutation spectrum consistent with that caused by oxidative damage and chronic inflammation. The percentage of patients with p16 mutations increased with increasing histologic grade. In addition, samples from 3 out of 19 patients (15.8% who underwent esophagectomy were found to have mutations. CONCLUSIONS: The results of this study suggest the environment of the esophagus in BE patients can both generate and select for clones with p16 mutations.

  3. Expression of the p16{sup INK4a} tumor suppressor gene in rodent lung tumors

    Energy Technology Data Exchange (ETDEWEB)

    Swafford, D.S.; Tesfaigzi, J.; Belinsky, S.A.

    1995-12-01

    Aberrations on the short arm of chromosome 9 are among the earliest genetic changes in human cancer. p16{sup INK4a} is a candidate tumor suppressor gene that lies within human 9p21, a chromosome region associated with frequent loss of heterozygosity in human lung tumors. The p16{sup INK4a} protein functions as an inhibitor of cyclin D{sub 1}-dependent kinases that phosphorylate the retinoblastoma (Rb) tumor suppressor gene product enabling cell-cycle progression. Thus, overexpression of cyclin D{sub 1}, mutation of cyclin-dependent kinase genes, or loss of p16{sup INK4a} function, can all result in functional inactivation of Rb. Inactivation of Rb by mutation or deletion can result in an increase in p16{sup INK4a} transcription, suggesting that an increased p16{sup INK4a} expression in a tumor cell signals dysfunction of the pathway. The p16{sup (INK4a)} gene, unlike some tumor suppressor genes, is rarely inactivated by mutation. Instead, the expression of this gene is suppressed in some human cancers by hypermethylation of the CpG island within the first exon or by homozygous deletion: 686. Chromosome losses have been observed at 9p21 syntenic loci in tumors of the mouse and rat, two species often used as animal models for pulmonary carcinogenesis. Expression of p16{sup INK4a} is lost in some mouse tumor cell lines, often due to homozygous deletion. These observations indicate that p16{sup INK4a} dysfunction may play a role in the development of neoplasia in rodents as well as humans. The purpose of the current investigation was to define the extent to which p16{sup INK4a} dysfunction contributes to the development of rodent lung tumors and to determine the mechanism of inactivation of the gene. There is no evidence to suggest a loss of function of the p16{sup INK4a} tumor suppressor gene in these primary murine lung tumors by mutation, deletion, or methylation.

  4. Germline CDKN2A/P16INK4A mutations contribute to genetic determinism of sarcoma.

    Science.gov (United States)

    Jouenne, Fanélie; Chauvot de Beauchene, Isaure; Bollaert, Emeline; Avril, Marie-Françoise; Caron, Olivier; Ingster, Olivier; Lecesne, Axel; Benusiglio, Patrick; Terrier, Philippe; Caumette, Vincent; Pissaloux, Daniel; de la Fouchardière, Arnaud; Cabaret, Odile; N'Diaye, Birama; Velghe, Amélie; Bougeard, Gaelle; Mann, Graham J; Koscielny, Serge; Barrett, Jennifer H; Harland, Mark; Newton-Bishop, Julia; Gruis, Nelleke; Van Doorn, Remco; Gauthier-Villars, Marion; Pierron, Gaelle; Stoppa-Lyonnet, Dominique; Coupier, Isabelle; Guimbaud, Rosine; Delnatte, Capucine; Scoazec, Jean-Yves; Eggermont, Alexander M; Feunteun, Jean; Tchertanov, Luba; Demoulin, Jean-Baptiste; Frebourg, Thierry; Bressac-de Paillerets, Brigitte

    2017-09-01

    Sarcomas are rare mesenchymal malignancies whose pathogenesis is poorly understood; both environmental and genetic risk factors could contribute to their aetiology. We performed whole-exome sequencing (WES) in a familial aggregation of three individuals affected with soft-tissue sarcoma (STS) without TP53 mutation (Li-Fraumeni-like, LFL) and found a shared pathogenic mutation in CDKN2A tumour suppressor gene. We searched for individuals with sarcoma among 474 melanoma-prone families with a CDKN2A -/+ genotype and for CDKN2A mutations in 190 TP53 -negative LFL families where the index case was a sarcoma. Including the initial family, eight independent sarcoma cases carried a germline mutation in the CDKN2A /p16 INK4A gene. In five out of seven formalin-fixed paraffin-embedded sarcomas, heterozygosity was lost at germline CDKN2A mutations sites demonstrating complete loss of function. As sarcomas are rare in CDKN2A /p16 INK4A carriers, we searched in constitutional WES of nine carriers for potential modifying rare variants and identified three in platelet-derived growth factor receptor ( PDGFRA ) gene. Molecular modelling showed that two never-described variants could impact the PDGFRA extracellular domain structure. Germline mutations in CDKN2A /P16 INK4A , a gene known to predispose to hereditary melanoma, pancreatic cancer and tobacco-related cancers, account also for a subset of hereditary sarcoma. In addition, we identified PDGFRA as a candidate modifier gene. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  5. The correlations between alteration of p16 gene and clinicopathological factors and prognosis in squamous cell carcinomas of the buccal mucosa.

    Science.gov (United States)

    Dong, Yuying; Wang, Jie; Dong, Fusheng; Wang, Xu; Zhang, Yinghuai

    2012-07-01

    To evaluate relationships between the alteration of p16 gene and the clinical status and prognosis of the patients with squamous cell carcinoma of the buccal mucosa. Thirty buccal cancers were included in the analysis. Deletion analysis was performed by PCR. Point mutation analysis was used by PCR-SSCP and direct sequencing. Methylation-specific PCR methods were adopted for the evaluation of p16 methylation. The correlation between alteration of p16 gene and clinicopathological factors buccal cancer was evaluated by Fisher's exact test. Kaplan-Meier and Cox regression were used to investigate the relationship between p16 alteration and survival time. The frequency of p16 alteration was 63.3% in buccal carcinomas. P16 deletion was associated significantly with tumor size (P = 0.01). P16 point mutation was associated significantly with differentiation (P = 0.006). P16 methylation was associated significantly with nodes metastasis (P = 0.027). The overall survival rate of 30 buccal carcinomas was 53.3%. The Log-rank test (P = 0.021) and univariate Cox regression analysis (P = 0.030) revealed that p16 methylation was significantly associated with the overall survival rate. Multivariate analysis showed that p16 deletion, p16 mutation, and p16 methylation were not statistically significant. The alterations of p16 gene may play a major role in malignancy and development and metastases of buccal carcinoma and may be an excellent marker of aggressive clinical behavior. P16 methylation has a prognostic value in buccal carcinoma but not an independent prognosis factor. P16 point mutation and p16 deletion have not prognostic significance in buccal carcinoma. © 2012 John Wiley & Sons A/S.

  6. A novel aberrant splicing mutation of the PEX16 gene in two patients with Zellweger syndrome

    NARCIS (Netherlands)

    Shimozawa, Nobuyuki; Nagase, Tomoko; Takemoto, Yasuhiko; Suzuki, Yasuyuki; Fujiki, Yukio; Wanders, Ronald J. A.; Kondo, Naomi

    2002-01-01

    Human Pex16p, a peroxisomal membrane protein composed of 336 amino acids, plays a central role in peroxisomal membrane biogenesis. A nonsense mutation (R176ter) in the PEX16 gene has been reported in the case of only one patient (D-01) belonging to complementation group D of the peroxisome

  7. Exogenous And Endogenous Factors Connected With P16 Gene Alteration In Egyptian Patients With Oesophageal Cancer

    International Nuclear Information System (INIS)

    EL-KASHEF, H.S.; KAYED, A.; ELMAGHRABY, T.K.; EL-GANZURI, M.A.; SELIEM, A.H.

    2010-01-01

    Certain areas of Egypt have a high incidence of oesophageal cancer which is one of the most common causes of cancer related deaths in the world. Comparisons of the dietary and cultural habits of people from geographically distinct high-incidence areas in the world have revealed very few similarities to suggest a common induction mechanism. The present study aimed to investigate the effects of sex, age and smoking on some biochemical parameters, p16 gene mutations, methylation and incidence of oesophageal cancer. The study included 50 Egyptian patients with oesophageal cancer with average age 55.6 years (aged between 23-79 years). The results showed significant decrease in superoxide dismutase (SOD), increase in glutathione reductase (GR), increase in lipid peroxidation end product (malonaldehyde) and incidence of oesophageal cancer. Moreover, two mutations were detected in exon 2 of gene p16 and significant increase in p16 methylation in tissues and plasma of oesophageal cancer patients, as compared to healthy control, were observed.

  8. The Creatine Transporter Gene Paralogous at 16p11.2 Is Expressed in Human Brain

    Directory of Open Access Journals (Sweden)

    Nadia Bayou

    2008-01-01

    We report on the clinical, cytogenetic, and molecular findings in a boy with autism carrying a de novo translocation t(7;16(p22.1;p11.2. The chromosome 16 breakpoint disrupts the paralogous SLC6A8 gene also called SLC6A10 or CT2. Predicted translation of exons and RT-PCR analysis reveal specific expression of the creatine transporter paralogous in testis and brain. Several studies reported on the role of X-linked creatine transporter mutations in individuals with mental retardation, with or without autism. The existence of disruption in SLC6A8 paralogous gene associated with idiopathic autism suggests that this gene may be involved in the autistic phenotype in our patient.

  9. P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

    International Nuclear Information System (INIS)

    Mukh-Syaifudin

    2006-01-01

    Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

  10. Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

    Science.gov (United States)

    Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

    2018-01-01

    Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

  11. Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

    International Nuclear Information System (INIS)

    Irshad, S.; Nawaz, T.

    2008-01-01

    Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

  12. Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

    2014-01-01

    Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

  13. Spectrum of CFTR gene mutations in Ecuadorian cystic fibrosis patients: the second report of the p.H609R mutation.

    Science.gov (United States)

    Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian

    2017-11-01

    High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  14. Distinct pattern of p53 mutations in bladder cancer

    DEFF Research Database (Denmark)

    Spruck, C H; Rideout, W M; Olumi, A F

    1993-01-01

    A distinct mutational spectrum for the p53 tumor suppressor gene in bladder carcinomas was established in patients with known exposures to cigarette smoke. Single-strand conformational polymorphism analysis of exons 5 through 8 of the p53 gene showed inactivating mutations in 16 of 40 (40%) bladder...... tumors from smokers and 13 of 40 (33%) tumors from lifetime nonsmokers. Overall, 13 of the 50 (26%) total point mutations discovered in this and previous work were G:C-->C:G transversions, a relatively rare mutational type in human tumors. In six tumors, identical AGA (Arg)-->ACA (Thr) point mutations...... double mutations, four of which were tandem mutations on the same allele. No double mutations were found in tumors from nonsmoking patients. None of the mutations in smokers were G:C-->T:A transversions, which would be anticipated for exposure to the suspected cigarette smoke carcinogen 4-aminobiphenyl...

  15. Rapid detection of single nucleotide mutation in p53 gene based on ...

    Indian Academy of Sciences (India)

    mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

  16. Analysis of P gene mutations in patients with type II (tyrosinase-positive) oculocutaneous albinism (OCA2)

    Energy Technology Data Exchange (ETDEWEB)

    Lee, S.T.; Nicholls, R.D.; Schnur, R. [Univ. of Wisconsin, Madison, WI (United States)]|[Case Western Reserve Univ., Cleveland, OH (United States)]|[Children`s Hospital of Philadelphia, PA (United States)] [and others

    1994-09-01

    OCA2 is an autosomal recessive disorder in which the biosynthesis of melanin pigment is greatly reduced in the skin, hair, and eyes. Recently, we showed that OCA2 results from mutations of the P gene, in chromosome segment 15q11-q13. In addition to OCA2, mutations of P account for OCA associated with the Prader-Willi syndrome and some cases of {open_quotes}autosomal recessive ocular albinism{close_quotes} (AROA). We have now studied 38 unrelated patients with various forms of OCA2 or AROA from a variety of different ethnic groups. None of these patients had detectable abnormalities of the tyrosinase (TYR) gene. Among 8 African-American patients with OCA2 we observed apparent locus homogeneity. We detected abnormalities of the P gene in all 8 patients, including 12 different mutations and deletions, most of which are unique to this group and none of which is predominant. In contrast, OCA2 in other populations appears to be genetically heterogeneous. Among 21 Caucasian patients we detected abnormalities of the P gene in only 8, comprising 9 different point mutations and deletions, some of which also occurred among the African-American patients. Among 3 Middle-Eastern, 3 Indo-Pakistani, and 3 Asian patients we detected mutations of the P gene in only one from each group. In a large Indo-Pakistani kindred with OCA2 we have excluded both the TYR and P genes on the basis of genetic linkage. The prevalence of mutations of the P gene thus appears to be much higher among African-Americans with OCA2 than among patients from other ethnic groups. The incidence of OCA2 in some parts of equatorial Africa is extremely high, as frequent as 1 per 1100, and the disease has been linked to P in South African Bantu. The eventual characterization of P gene mutations in Africans will be informative with regard to the origins of P gene mutations in African-American patients.

  17. Glaucoma and Cytochrome P4501B1 Gene Mutations

    Directory of Open Access Journals (Sweden)

    Mukesh Tanwar

    2010-01-01

    Full Text Available Developmental anomalies of the ocular anterior chamber angle may lead to an incomplete development of the structures that form the conventional aqueous outflow pathway. Thus, disorders that present with such dysfunction tend to be associated with glaucoma. Among them, Axenfeld-Rieger (ARS malformation is a rare clinical entity with an estimated prevalence of one in every 200,000 individuals. The changes in eye morphogenesis in ARS are highly penetrant and are associated with 50% risk of development of glaucoma. Mutations in the cytochrome P4501B1 (CYP1B1 gene have been reported to be associated with primary congenital glaucoma and other forms of glaucoma and mutations in pituitary homeobox 2 (PITX2 gene have been identified in ARS in various studies. This case was negative for PITX2 mutations and compound heterozygote for CYP1B1 mutations. Clinical manifestations of this patient include bilateral elevated intraocular pressure (>40 mmHg with increased corneal diameter (>14 mm and corneal opacity. Patient also had iridocorneal adhesions, anteriorly displaced Schwalbe line, anterior insertion of iris, broad nasal bridge and protruding umbilicus. This is the first study from north India reporting CYP1B1 mutations in Axenfeld-Rieger syndrome with bilateral buphthalmos and early onset glaucoma. Result of this study supports the role of CYP1B1 as a causative gene in ASD disorders and its role in oculogenesis.

  18. High CpG island methylation ofp16 gene and loss of p16 protein ...

    Indian Academy of Sciences (India)

    Navya

    employed to detect CpG island methylation in p16 promoter region and ... of Fallot;p16 gene;p16 protein;CpG islands;Methylation;Promoter regions ..... Our findings that p16 has a role in heart development is ... Asian Pac J Cancer Prev 15, 75-84. .... phenotype in colorectal cancer using a large population-based sample.

  19. Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors

    International Nuclear Information System (INIS)

    Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.

    2010-01-01

    Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)

  20. High Resolution Melting Analysis for Detecting p53 Gene Mutations in Patients with Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Zhihong CHEN

    2011-10-01

    Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.

  1. Survey of familial glioma and role of germline p16INK4A/p14ARF and p53 mutation

    DEFF Research Database (Denmark)

    Robertson, Lindsay B; Armstrong, Georgina N; Olver, Bianca D

    2010-01-01

    There is increasing recognition of familial propensity to glioma as a distinct clinical entity beyond a few rare syndromes; however its genetic basis is poorly understood. The role of p16(INK4A)/p14(ARF) and p53 mutations in sporadic glioma provides a strong rationale for investigating germline m...

  2. High CpG island methylation ofp16 gene and loss of p16 protein ...

    Indian Academy of Sciences (India)

    Navya

    :Tetralogy of Fallot;p16 gene;p16 protein;CpG islands;Methylation;Promoter regions ... of congenital heart disease, as well as the exclusion of previous history of ..... malignant progression of oral epithelial dysplasia: a prospective cohort study.

  3. Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

    Directory of Open Access Journals (Sweden)

    Simon Leuchs

    Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

  4. MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1

    Directory of Open Access Journals (Sweden)

    Olsson Hans

    2013-01-01

    Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in

  5. p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation

    International Nuclear Information System (INIS)

    Ikehata, Hironobu

    1998-01-01

    Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)

  6. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  7. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  8. A novel HSF4 gene mutation (p.R405X causing autosomal recessive congenital cataracts in a large consanguineous family from Pakistan

    Directory of Open Access Journals (Sweden)

    Cheema Abdul

    2008-11-01

    Full Text Available Abstract Background Hereditary cataracts are most frequently inherited as autosomal dominant traits, but can also be inherited in an autosomal recessive or X-linked fashion. To date, 12 loci for autosomal recessive cataracts have been mapped including a locus on chromosome 16q22 containing the disease-causing gene HSF4 (Genbank accession number NM_001040667. Here, we describe a family from Pakistan with the first nonsense mutation in HSF4 thus expanding the mutational spectrum of this heat shock transcription factor gene. Methods A large consanguineous Pakistani family with autosomal recessive cataracts was collected from Quetta. Genetic linkage analysis was performed for the common known autosomal recessive cataracts loci and linkage to a locus containing HSF4 (OMIM 602438 was found. All exons and adjacent splice sites of the heat shock transcription factor 4 gene (HSF4 were sequenced. A mutation-specific restriction enzyme digest (HphI was performed for all family members and unrelated controls. Results The disease phenotype perfectly co-segregated with markers flanking the known cataract gene HSF4, whereas other autosomal recessive loci were excluded. A maximum two-point LOD score with a Zmax = 5.6 at θ = 0 was obtained for D16S421. Direct sequencing of HSF4 revealed the nucleotide exchange c.1213C > T in this family predicting an arginine to stop codon exchange (p.R405X. Conclusion We identified the first nonsense mutation (p.R405X in exon 11 of HSF4 in a large consanguineous Pakistani family with autosomal recessive cataract.

  9. A common FGFR3 gene mutation is present in achondroplasia but not in hypochondroplasia

    Energy Technology Data Exchange (ETDEWEB)

    Stoilov, I.; Kilpatrick, M.W.; Tsipouras, P. [Univ. of Connecticut Health Center, Farmington, CT (United States)

    1995-01-02

    Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In contrast, the G380R mutation was not found in any of the 8 hypochondroplasia chromosomes studied. Futhermore, linkage studies in a 3-generation family with hypochondroplasia show discordant segregation with markers in the 4p16.3 region suggesting that at least some cases of hypochondroplasia are caused by mutations in a gene other than FGFR3. 27 refs., 2 figs.

  10. Paroxysmal Kinesigenic Dyskinesia Caused by 16p11.2 Microdeletion

    Directory of Open Access Journals (Sweden)

    Pichet Termsarasab

    2014-11-01

    Full Text Available Background: Four cases of paroxysmal kinesigenic dyskinesia (PKD have been reported in individuals with proximal 16p11.2 microdeletions that include PRRT2. Case Report: We describe a fifth patient with PKD, features of Asperger’s syndrome, and mild language delays. Sanger sequencing of the PRRT2 gene did not identify any mutations implicated in PKD. However, microarray‐based comparative genomic hybridization (aCGH detected a 533.9‐kb deletion on chromosome 16, encompassing over 20 genes and transcripts. Discussion: This case underscores the importance of aCGH testing for individuals with PKD who do not have PRRT2 mutations, particularly when developmental delays, speech problems, intellectual disability, and/or autism spectrum disorder are present.

  11. Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento

    Directory of Open Access Journals (Sweden)

    Li Ma

    2013-08-01

    Full Text Available AIM: To screen mutations in the retinitis pigmentosa 1 (RP1 gene and the rhodopsin (RHO gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP and describe the genotype-phenotype relationship of the mutations.METHODS:Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations.RESULTS: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800 and one non-coding variant (rs56340615 were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.CONCLUSION: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

  12. Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento.

    Science.gov (United States)

    Ma, Li; Sheng, Xun-Lun; Li, Hui-Ping; Zhang, Fang-Xia; Liu, Ya-Ni; Rong, Wei-Ning; Zhang, Jian-Ling

    2013-01-01

    To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

  13. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    International Nuclear Information System (INIS)

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P

    2009-01-01

    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  14. Biochemical Diagnosis of Common Gene Mutations in Galactosemia

    Directory of Open Access Journals (Sweden)

    Farzaneh Mirzajani

    2005-04-01

    Full Text Available Objective: Galactosemia is an inborn error of galactose metabolism that is inherited in an autosomal recessive trait. Classical galactosemia is caused by deficient activity of the galactose-1-phosphate uridyltransferase (GALT enzyme that can result in galactosemia complications. Materials & Methods: 135 unrelated families, clinically suspected to galactosemia, were screened by qualitative measurement of galactose-1-phosphate uridyl transferase (GALT activity in blood RBCs by using Beutler method. Results: Deficient enzyme activity (classical galactosemia were confirmed in 16 families. All of these 16 families were submitted to the diagnosis of six common mutations in GALT gene including Q188R, K285N, S135L, L195P, X380R and Q169K by using PCR-RFLP method which resulted in detection of 68% of the mutated alleles. Eight patients were homozygote for Q188R mutation, while one patient homozygote for S135L mutation and one heterozygote for K285N mutation. Conclusion: Biochemnical diagnosis of Galactosemia in Grand infant hospital is very important and necessary.

  15. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  16. Gene mutations in children with chronic pancreatitis.

    Science.gov (United States)

    Witt, H

    2001-01-01

    In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.

  17. Severe Hypertriglyceridemia due to a novel p.Q240H mutation in the Lipoprotein Lipase gene.

    Science.gov (United States)

    Soto, Angela Ganan; McIntyre, Adam; Agrawal, Sungeeta; Bialo, Shara R; Hegele, Robert A; Boney, Charlotte M

    2015-09-04

    Lipoprotein Lipase (LPL) deficiency is a rare autosomal recessive disorder with a heterogeneous clinical presentation. Several mutations in the LPL gene have been identified to cause decreased activity of the enzyme. An 11-week-old, exclusively breastfed male presented with coffee-ground emesis, melena, xanthomas, lipemia retinalis and chylomicronemia. Genomic DNA analysis identified lipoprotein lipase deficiency due to compound heterozygosity including a novel p.Q240H mutation in exon 5 of the lipoprotein lipase (LPL) gene. His severe hypertriglyceridemia, including xanthomas, resolved with dietary long-chain fat restriction. We describe a novel mutation of the LPL gene causing severe hypertriglyceridemia and report the response to treatment. A review of the current literature regarding LPL deficiency syndrome reveals a few potential new therapies under investigation.

  18. Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome

    Directory of Open Access Journals (Sweden)

    Jose Miguel Moreno-Ortiz

    2016-01-01

    Full Text Available Background. Lynch Syndrome (LS is characterized by germline mutations in the DNA mismatch repair (MMR genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC, and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del and c.1852_1853delinsGC (p.K618A in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel.

  19. Clonal expansion to anaplasia in Wilms` tumors is associated with p53 mutations

    Energy Technology Data Exchange (ETDEWEB)

    Pelletier, J.; Beckwith, B.; Bardeesy, N. [Loma Linda Univ., CA (United States)]|[McGill Univ., Montreal (Canada)

    1994-09-01

    The genetics of Wilms` tumor (WT), a pediatric malignancy of the kidney, is complex. Three loci are implicated in WT initiation and include the WT1 tumor suppressor gene (residing at 11p13), an 11p15 locus, and a non-11p locus. As well, allelic loss at 16q24 in {approximately}20% of sporadic WTs suggests the location of (an) additional gene(s) involved in tumor progression. Initiation and progression in WTs is associated with multiple histological variants. Anaplasia is a rare WT subtype associated with poor prognosis and defined by enlarged and multipolar mitotic figures, a threefold nuclear enlargement (compared with adjacent nuclei of the same cell type), and hyperchromasia of the enlarged nuclei. We have previously demonstrated that p53 gene mutations are exclusively associated with anaplastic WTs, being absent from a large number of non-anaplastic WTs analyzed. To determine if such mutations are involved in clonal progression to anaplasia, we performed a retrospective analysis of histologically defined sections from tumor specimens. Six of ten WTs demonstrated p53 mutations by PCR-single stranded conformational polymorphism analysis. Two of these samples were paired, consisting of geographically demarcated anaplastic cells embedded within a non-anaplastic tumor bed. In these cases, p53 mutations were only present in the anaplastic region of the tumor. An overall decrease in the number of apoptotic cells was found associated with the anaplastic tumor region, compared to adjacent non-anaplastic tumor bed. These results indicate that p53 mutations arise during progression to anaplasia late in Wilms` tumor etiology and are associated with a more aggressive form of this cancer.

  20. ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

    Directory of Open Access Journals (Sweden)

    Amit Kumar Tiwari

    2016-11-01

    Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

  1. Distribution of human papilloma virus type 16 E6/E7 gene mutation in cervical precancer or cancer: A case control study in Guizhou Province, China.

    Science.gov (United States)

    Yang, Yingjie; Ren, Jie; Zhang, Qizhu

    2016-02-01

    HPV-16 varies geographically and is correlated with cervical cancer genesis and progression. This study aimed to determine the distribution of HPV-16 E6/E7 genetic variation in patients with invasive cervical cancer or precancer in Guizhou Province, China. A case-control study was designed, and the distribution of HPV-16 E6/E7 genetic variation was compared among women with cervical cancer, precancer, and sexually active without cervical lesion. HPV infection was detected through flow-through hybridization and gene chip techniques to determine the prevalence of HPV 16 E6/E7 genetic variation. Among 90 specimens (30 cervical cancer, 30 precancer, 30 controls), 81 were subjected to HPV-16 E6/E7 gene sequencing. The rates of DNA sequence mutation and amino acid mutation were 76.5% (62/81) and 66.7% (54/81), respectively. Both E6 and E7 genes showed higher mutation rate than their prototypes. The prevalence of E6/E7 mutation significantly differed between the cervical cancer and the controls (P prevalent in cervical cancer or precancer than those in the controls. The possible correlation between genetic variation and cancerigenesis may be used to design an HPV vaccine for cervical carcinoma. © 2015 Wiley Periodicals, Inc.

  2. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper

    1999-01-01

    for folate biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP. METHODS: We studied bronchoalveolar samples collected in 1989-99 from a prospective cohort of HIV-1-infected patients who had PCP. In 144...... patients with 152 episodes of PCP, we analysed portions of DHPS using PCR and direct sequencing. The relation between survival, P. carinii DHPS mutations, and other predictors of treatment failure was assessed by Kaplan-Meier and multivariate Cox regression analysis. FINDINGS: P. carinii DHPS mutations...

  3. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  4. Somatic INK4a-ARF locus mutations: a significant mechanism of gene inactivation in squamous cell carcinomas of the head and neck.

    Science.gov (United States)

    Poi, M J; Yen, T; Li, J; Song, H; Lang, J C; Schuller, D E; Pearl, D K; Casto, B C; Tsai, M D; Weghorst, C M

    2001-01-01

    The INK4a-ARF locus is located on human chromosome 9p21 and is known to encode two functionally distinct tumor-suppressor genes. The p16(INK4a) (p16) tumor-suppressor gene product is a negative regulator of cyclin-dependent kinases 4 and 6, which in turn positively regulate progression of mammalian cells through the cell cycle. The p14(ARF) tumor-suppressor gene product specifically interacts with human double minute 2, leading to the subsequent stabilization of p53 and G(1) arrest. Previous investigations analyzing the p16 gene in squamous cell carcinomas of the head and neck (SCCHNs) have suggested the predominate inactivating events to be homozygous gene deletions and hypermethylation of the p16 promoter. Somatic mutational inactivation of p16 has been reported to be low (0-10%, with a combined incidence of 25 of 279, or 9%) and to play only a minor role in the development of SCCHN. The present study examined whether this particular mechanism of INK4a/ARF inactivation, specifically somatic mutation, has been underestimated in SCCHN by determining the mutational status of the p16 and p14(ARF) genes in 100 primary SCCHNs with the use of polymerase chain reaction technology and a highly sensitive, nonradioactive modification of single-stranded conformational polymorphism (SSCP) analysis termed "cold" SSCP. Exons 1alpha, 1beta, and 2 of INK4a/ARF were amplified using intron-based primers or a combination of intron- and exon-based primers. A total of 27 SCCHNs (27%) exhibited sequence alterations in this locus, 22 (22%) of which were somatic sequence alterations and five (5%) of which were a single polymorphism in codon 148. Of the 22 somatic alterations, 20 (91%) directly or indirectly involved exon 2, and two (9%) were located within exon 1alpha. No mutations were found in exon 1beta. All 22 somatic mutations would be expected to yield altered p16 proteins, but only 15 of them should affect p14(ARF) proteins. Specific somatic alterations included microdeletions or

  5. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    Science.gov (United States)

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  6. The p. N103K mutation of leptin (LEP gene and severe early onset obesity in Pakistan

    Directory of Open Access Journals (Sweden)

    Shabana

    Full Text Available BACKGROUND: Obesity is a complex disorder and has been increasing globally at alarming rates including Pakistan. However, there is scarce research on understanding obesity genetics in Pakistan. Leptin is a hormone secreted by adipocytes in response to satiety and correlates with body weight. Any mutations in the LEP gene have an adverse effect on energy regulation pathway and lead to severe, early onset obesity. To date, only eight mutations have been described in the LEP gene of which p. N103K is one. METHODS: We aimed to analyze the prevalence of this mutation in Pakistani subjects. A total of 475 subjects were genotyped by PCR-RFLP analysis and their serum profiling was done. RESULTS: Results showed that this mutation was present only in one male child with early onset obesity (10 year. He had very low serum leptin levels suggestive of functional impact of the mutation. The prevalence of such mutations is, however, low due to the drastic effects on the energy regulation. CONCLUSION: In conclusion, LEP gene mutations contribute significantly to the monogenic forms of obesity and are important due to the availability of treatment options. Such mutations may exert their effect by directly affecting energy regulation pathway and are more prominent in the early stages of life only.

  7. Clinical study of DMD gene point mutation causing Becker muscular dystrophy

    Directory of Open Access Journals (Sweden)

    Ji-qing CAO

    2015-07-01

    Full Text Available Background  DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD.  Methods  Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA.  Results  Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C.  Conclusions  DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005

  8. Expression of p16(INK4A) gene in human pituitary tumours.

    Science.gov (United States)

    Machiavelli, Gloria; Cotignola, Javier; Danilowicz, Karina; Carbonara, Carolina; Paes de Lima, Andrea; Basso, Armando; Bruno, Oscar Domingo; Szijan, Irene

    2008-01-01

    Pituitary adenomas comprise 10-15% of primary intracranial tumours but the mechanisms leading to tumour development are yet to be clearly established. The retinoblastoma pathway, which regulates the progression through the cell cycle, is often deregulated in different types of tumours. We studied the cyclin-dependent kinase inhibitor p16(INK4A) gene expression at mRNA level in human pituitary adenomas. Forty-six tumour specimens of different subtypes, 21 clinically non-functioning, 12 growth hormone-secreting, 6 prolactin-secreting, 6 adrenocorticotropin-secreting, and 1 thyrotropin-secreting tumours were studied. All clinically non-functioning and most of the hormone-secreting tumours were macroadenomas (38/46). The RT-PCR assay and electrophoresis of the PCR-products showed that p16(INK4A) mRNA was undetectable in: 62% of non-functioning, 8% of growth hormone-secreting, 17% of prolactin-secreting and 17% of adrenocorticotropin-secreting adenomas. Forty percent of all macroadenomas and 25% of microadenomas had negative p16(INK4A) mRNA, the latter results suggest that the absence of p16(INK4A) product might be an early event in tumours with no expression of this suppressor gene. Within the non-functioning adenomas 63% were "null cell" and 37% were positive for some hormone, both subgroups showed similar percentage of cases with absence of p16(INK4A) mRNA. Our results show that clinically non-functioning macroadenomas have impaired p16(INK4A) expression in a clearly higher proportion than any other pituitary tumour subtype investigated. Other regulatory pathways may be implicated in the development of tumours with positive p16(INK4A) expression.

  9. The origin of the p.E180 growth hormone receptor gene mutation.

    Science.gov (United States)

    Ostrer, Harry

    2016-06-01

    Laron syndrome, an autosomal recessive condition of extreme short stature, is caused by the absence or dysfunction of the growth hormone receptor. A recurrent mutation in the GHR gene, p.E180, did not alter the encoded amino acid, but activated a cryptic splice acceptor resulting in a receptor protein with an 8-amino acid deletion in the extracellular domain. This mutation has been observed among Sephardic Jews and among individuals in Ecuador, Brazil and Chile, most notably in a large genetic isolate in Loja, Ecuador. A common origin has been postulated based on a shared genetic background of markers flanking this mutation, suggesting that the Lojanos (and others) may have Sephardic (Converso) Jewish ancestry. Analysis of the population structure of Lojanos based on genome-wide analysis demonstrated European, Sephardic Jewish and Native American ancestry in this group. X-autosomal comparison and monoallelic Y chromosomal and mitochondrial genetic analysis demonstrated gender-biased admixture between Native American women and European and Sephardic Jewish men. These findings are compatible with the co-occurrence of the Inquisition and the colonization of the Americas, including Converso Jews escaping the Inquisition in the Iberian Peninsula. Although not found among Lojanos, Converso Jews also brought founder mutations to contemporary Hispanic and Latino populations in the BRCA1 (c.68_69delAG) and BLM (c.2207_2212delATCTGAinsTAGATTC) genes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  11. Aging and chronic alcohol consumption are determinants of p16 gene expression, genomic DNA methylation and p16 promoter methylation in the mouse colon

    Science.gov (United States)

    Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...

  12. The p.A382T TARDBP gene mutation in Sardinian patients affected by Parkinson’s disease and other degenerative parkinsonisms

    Science.gov (United States)

    Cannas, Antonino; Borghero, Giuseppe; Floris, Gian Luca; Solla, Paolo; Chiò, Adriano; Traynor, Bryan J.; Calvo, Andrea; Restagno, Gabriella; Majounie, Elisa; Costantino, Emanuela; Piras, Valeria; Lavra, Loredana; Pani, Carla; Orofino, Gianni; Di Stefano, Francesca; Tacconi, Paolo; Mascia, Marcello Mario; Muroni, Antonella; Murru, Maria Rita; Tranquilli, Stefania; Corongiu, Daniela; Rolesu, Marcella; Cuccu, Stefania; Marrosu, Francesco; Marrosu, Maria Giovanna

    2013-01-01

    Background Based on our previous finding of the p.A382T founder mutation in ALS patients with concomitant parkinsonism in the Sardinian population, we hypothesized that the same variant may underlie PD and/or other forms of degenerative parkinsonism on this Mediterranean island. Design We screened a cohort of 611 patients with PD (544 cases) and other forms of degenerative parkinsonism (67 cases), and 604 unrelated controls for the c.1144G>A (p.A382T) missense mutation of the TARDBP gene. Results The p.A382T mutation was identified in 9 patients with parkinsonism. Of these, 5 (0.9% of PD patients) presented a typical PD (2 with familiar forms), while 4 patients (6.0% of all other forms of parkinsonism) presented a peculiar clinical presentation quite different from classical atypical parkinsonism with an overlap of extrapyramidal-pyramidal-cognitive clinical signs. The mutation was found in 8 Sardinian controls (1.3%) consistent with a founder mutation in the island population. Conclusions Our findings suggest that the clinical presentation of the p.A382T TARDBP gene mutation may include forms of parkinsonism in which the extrapyramidal signs are the crucial core of the disease at onset. These forms can present PSP or CBD-like clinical signs, with bulbar and/or extrabulbar pyramidal signs and cognitive impairment. No evidence of association has been found between TARDBP gene mutation and typical PD. PMID:23546887

  13. PRDM16 Gene Polymorphism Is Associated with Obesity and Blood Lipids Profiles in Saudi Population

    Directory of Open Access Journals (Sweden)

    Aishah AlAmrani

    2018-06-01

    Full Text Available Aims: The PR domain containing 16 (PRDM16 gene and the Phosphodiesterase 4D (PDE4 gene are both an essential regulators in the thermogenesis process in the brown adipose tissues (BAT. The influence of polymorphisms in those genes on obesity and blood lipids profile is unknown particularly in the Saudi population, so the current study is aiming to explore that. Methods: A case control format was used that involved 89 obese individual and 84 non-obese (control. The PRDM16 (rs2651899 and PDE4D (rs295978 polymorphisms were genotyped using KASP™ (Competitive Allele-Specific PCR method. Results: The distributions of the AA, GG, and AG genotypes of PRDM16 (rs2651899 polymorphism were 0.19, 0.26 and 0.54, respectively. While the distribution of the mutated allele A was 0.7 in the obese group comparing to 0.34 in the non-obese group. Participants with the mutated genotypes, AA and AG, of PRDM16 (rs2651899 polymorphism were significantly more likely to be obese as compared to participants with wild type genotype (OR = 21, 95% CI = 5.4190 to 84.4231, p value < 0.0001 and OR = 44.6, 95% CI = 11.5984 to 172.0157, p value < 0.0001, respectively. The wild type GG genotype of this polymorphism was associated with higher blood cholesterol, HDL and LDL but lower blood triglyceride compared with the mutated genotypes (p = 0.003, p = 0.008, p = 0.02 and p = 0.003, respectively. In contrast, PDE4D (rs295978 polymorphism was not associated with risk of obesity and had no effects on blood lipids profile. Conclusions: We found that the PRDM16 polymorphism (rs2651899 is a risk factor for obesity and influence blood lipids profiles significantly in Saudi population. While the PDE4D (rs295978 polymorphism didn’t show significant effect on risk of obesity or blood lipids profiles.

  14. Glucokinase gene mutations: structural and genotype-phenotype analyses in MODY children from South Italy.

    Directory of Open Access Journals (Sweden)

    Nadia Tinto

    Full Text Available BACKGROUND: Maturity onset diabetes of the young type 2 (or GCK MODY is a genetic form of diabetes mellitus provoked by mutations in the glucokinase gene (GCK. METHODOLOGY/PRINCIPAL FINDINGS: We screened the GCK gene by direct sequencing in 30 patients from South Italy with suspected MODY. The mutation-induced structural alterations in the protein were analyzed by molecular modeling. The patients' biochemical, clinical and anamnestic data were obtained. Mutations were detected in 16/30 patients (53%; 9 of the 12 mutations identified were novel (p.Glu70Asp, p.Phe123Leu, p.Asp132Asn, p.His137Asp, p.Gly162Asp, p.Thr168Ala, p.Arg392Ser, p.Glu290X, p.Gln106_Met107delinsLeu and are in regions involved in structural rearrangements required for catalysis. The prevalence of mutation sites was higher in the small domain (7/12: approximately 59% than in the large (4/12: 33% domain or in the connection (1/12: 8% region of the protein. Mild diabetic phenotypes were detected in almost all patients [mean (SD OGTT = 7.8 mMol/L (1.8] and mean triglyceride levels were lower in mutated than in unmutated GCK patients (p = 0.04. CONCLUSIONS: The prevalence of GCK MODY is high in southern Italy, and the GCK small domain is a hot spot for MODY mutations. Both the severity of the GCK mutation and the genetic background seem to play a relevant role in the GCK MODY phenotype. Indeed, a partial genotype-phenotype correlation was identified in related patients (3 pairs of siblings but not in two unrelated children bearing the same mutation. Thus, the molecular approach allows the physician to confirm the diagnosis and to predict severity of the mutation.

  15. Comprehensive analysis of gene mutation and phenotype of tuberous sclerosis complex in China

    Directory of Open Access Journals (Sweden)

    Guo-qiang HUANG

    2015-04-01

    Full Text Available Objective To summarize the clinical features of tuberous sclerosis complex (TSC, the distribution and description of TSC gene, and to probe into the correlation of genotype with phenotype.  Methods According to the 1998 International Tuberous Sclerosis Complex Diagnostic Criteria, a total of 163 TSC patients with pathogenic mutation in TSC gene (3 cases were detected in our hospital, and the other 160 cases were collected from other institutions in China were enrolled, and their gene detection results and clinical data were analyzed.  Results Among 163 cases, TSC1 mutation (31 cases accounted for 19.02% [32.26% (10/31 in exon 15, 16.13% (5/31 in exon 21, 12.90% (4/31 in exon 18], and TSC2 mutation (132 cases accounted for 80.98% [9.85% (13/132 in exon 37, 7.58% (10/132 in exon 40, 6.82%(9/132 in exon 33]. The proportion of base replacement in TSC1 was 41.94% (13/31, and 52.27% (69/132 in TSC2. Male patients exhibited significantly more subependymal nodules or calcifications than thefemale patients (χ2 = 8.016, P = 0.005. Sporadic patients exhibited significantly more cortical tubers than familial patients (χ2 = 6.273, P = 0.012. Patients with TSC2 mutations had significantly higher frequencies of hypomelanotic macules than patients with TSC1 mutations (χ2 = 6.756, P = 0.009. Patients with missense mutations were more likely to have facial angiofibromas compared with patients with other mutations (χ2 = 4.438, P = 0.035.  Conclusions Exon 15, 21 and 18 of TSC1 and exon 37, 40 and 33 of TSC2 accounted for higher percentage of mutations. Correlating genotypes with phenotypes should facilitate the individualized treatment and prognostic assessment of tuberous sclerosis complex. DOI: 10.3969/j.issn.1672-6731.2015.04.013

  16. A low-pungency S3212 genotype of Capsicum frutescens caused by a mutation in the putative aminotransferase (p-AMT) gene.

    Science.gov (United States)

    Park, Young-Jun; Nishikawa, Tomotaro; Minami, Mineo; Nemoto, Kazuhiro; Iwasaki, Tomohiro; Matsushima, Kenichi

    2015-12-01

    The purpose of this study was to identify the genetic mechanism underlying capsinoid biosynthesis in S3212, a low-pungency genotype of Capsicum frutescens. Screening of C. frutescens accessions for capsaicinoid and capsiate contents by high-performance liquid chromatography revealed that low-pungency S3212 contained high levels of capsiate but no capsaicin. Comparison of DNA coding sequences of pungent (T1 and Bird Eye) and low-pungency (S3212) genotypes uncovered a significant 12-bp deletion mutation in exon 7 of the p-AMT gene of S3212. In addition, p-AMT gene transcript levels in placental tissue were positively correlated with the degree of pungency. S3212, the low-pungency genotype, exhibited no significant p-AMT transcript levels, whereas T1, one of the pungent genotypes, displayed high transcript levels of this gene. We therefore conclude that the deletion mutation in the p-AMT gene is related to the loss of pungency in placental tissue and has given rise to the low-pungency S3212 C. frutescens genotype. C. frutescens S3212 represents a good natural source of capsinoids. Finally, our basic characterization of the uncovered p-AMT gene mutation should contribute to future studies of capsinoid biosynthesis in Capsicum.

  17. The prognostic value of p53 mutation in pediatric marrow hypoplasia

    Directory of Open Access Journals (Sweden)

    Sharaf Alzahraa EA

    2011-06-01

    Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.

  18. Partial uniparental isodisomy of chromosome 16 unmasks a deleterious biallelic mutation in IFT140 that causes Mainzer-Saldino syndrome.

    Science.gov (United States)

    Helm, Benjamin M; Willer, Jason R; Sadeghpour, Azita; Golzio, Christelle; Crouch, Eric; Vergano, Samantha Schrier; Katsanis, Nicholas; Davis, Erica E

    2017-07-19

    The ciliopathies represent an umbrella group of >50 clinical entities that share both clinical features and molecular etiology underscored by structural and functional defects of the primary cilium. Despite the advances in gene discovery, this group of entities continues to pose a diagnostic challenge, in part due to significant genetic and phenotypic heterogeneity and variability. We consulted a pediatric case from asymptomatic, non-consanguineous parents who presented as a suspected ciliopathy due to a constellation of retinal, renal, and skeletal findings. Although clinical panel sequencing of genes implicated in nephrotic syndromes yielded no likely causal mutation, an oligo-SNP microarray identified a ~20-Mb region of homozygosity, with no altered gene dosage, on chromosome 16p13. Intersection of the proband's phenotypes with known disease genes within the homozygous region yielded a single candidate, IFT140, encoding a retrograde intraflagellar transport protein implicated previously in several ciliopathies, including the phenotypically overlapping Mainzer-Saldino syndrome (MZSDS). Sanger sequencing yielded a maternally inherited homozygous c.634G>A; p.Gly212Arg mutation altering the exon 6 splice donor site. Functional studies in cells from the proband showed that the locus produced two transcripts: a majority message containing a mis-splicing event that caused a premature termination codon and a minority message homozygous for the p.Gly212Arg allele. Zebrafish in vivo complementation studies of the latter transcript demonstrated a loss of function effect. Finally, we conducted post-hoc trio-based whole exome sequencing studies to (a) test the possibility of other causal loci in the proband and (b) explain the Mendelian error of segregation for the IFT140 mutation. We show that the proband harbors a chromosome 16 maternal heterodisomy, with segmental isodisomy at 16p13, likely due to a meiosis I error in the maternal gamete. Using clinical phenotyping

  19. Identification of missense mutations in the Norrie disease gene associated with advanced retinopathy of prematurity.

    Science.gov (United States)

    Shastry, B S; Pendergast, S D; Hartzer, M K; Liu, X; Trese, M T

    1997-05-01

    Retinopathy of prematurity (ROP) is a retinal vascular disease occurring in infants with short gestational age and low birth weight and can lead to retinal detachment (ROP stages 4 and 5). X-linked familial exudative vitreoretinopathy is phenotypically similar to ROP and has been associated with mutations in the Norrie disease (ND) gene in some cases. To determine if similar mutations in the ND gene may play a role in the development of advanced ROP. Clinical examination and molecular genetic analysis were performed on 16 children, including 2 dizygotic and 1 monozygotic twin pairs, and their parents from 13 families. Sequencing of the amplified products revealed missense mutations (R121W and L108P) in the third exon of the ND gene in 4 patients. These mutations were not present in an unaffected premature twin, 2 children with regressed stage 3 ROP, the parents, or in 50 unrelated healthy control subjects. These findings suggest that mutations in the ND gene may play a role in the development of severe ROP in premature infants.

  20. The relationship among human papilloma virus infection, survivin, and p53 gene in lung squamous carcinoma tissue

    International Nuclear Information System (INIS)

    Yue-Hua Wang; De-jie Chen; Tie-Nan Yi

    2010-01-01

    To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).

  1. Comparative analysis of Homo sapiens and Mus musculus cyclin-dependent kinase (CDK) inhibitor genes p16 (MTS1) and p15 (MTS2).

    Science.gov (United States)

    Jiang, P; Stone, S; Wagner, R; Wang, S; Dayananth, P; Kozak, C A; Wold, B; Kamb, A

    1995-12-01

    Cyclin-dependent kinase inhibitors are a growing family of molecules that regulate important transitions in the cell cycle. At least one of these molecules, p16, has been implicated in human tumorigenesis while its close homolog, p15, is induced by cell contact and transforming growth factor-beta (TGF-beta). To investigate the evolutionary and functional features of p15 and p16, we have isolated mouse (Mus musculus) homologs of each gene. Comparative analysis of these sequences provides evidence that the genes have similar functions in mouse and human. In addition, the comparison suggests that a gene conversion event is part of the evolution of the human p15 and p16 genes.

  2. Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

    DEFF Research Database (Denmark)

    Riess, O; Weber, B; Nørremølle, Anne

    1992-01-01

    as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

  3. P53, K-RAS, β-CATENIN, C-KIT and BAK mutations in the lung cancer of Chinese and Japanese patients

    International Nuclear Information System (INIS)

    Shuo Xing; Nobotoshi Nawa; Kazuhiro Tanabe; Tadashi Hongyo; Li- Ya Li; Jing-Tian Tang; Mitsunori Ohta

    2005-01-01

    Seventeen Chinese (Beijing) and 24 Japanese (Osaka) lung cancer cases were analyzed for mutations of p53, K-ras, β-catenin, c-kit and bak genes by PCR-SSCP analysis followed by direct sequencing. Significantly higher mutation frequency of p53 gene, one of key genes for radiation sensitivity, was found in Chinese cases (11/17; 64.7 %) than Japanese cases (8/24; 33.3 %) (p< O.O5). Fourteen of the 16 mutations found in the Chinese cases were transitions at exon 4,5 and intron 4. In the Japanese cases, of the total of 11 mutations, 5 were transitions and 5 were transversions and one was deletion. Six β-catenin mutations were found in 6 Chinese cases (35.3 % ) at codon 53 and 58, and 4 were found in 3 Japanese cases (12.5 %). C-kit mutations were detected in 5 Chinese cases (29.4 %), while no mutations were found in Japanese cases (p< O.O5). No K-ras mutation was found in both Chinese and Japanese cases. For the first time, we report on bak mutation in human lung cancer in Chinese (2/17; 11.8% ) and Japanese cases (2/24; 8.3% ). C-kit and bak genes are also definitive factors to radiosensitivity. These data thus suggest that there were apparent differences in frequency and/or mutational types of p53, β-catenin and c-kit? genes between Chinese and Japanese cases. The differences can be attributed to factors such as lifestyles including smoking and racial and/or environmental factors, and also to the prediction of the response to radiotherapy. (author)

  4. Identification of two novel mutations in the PHEX gene in Chinese patients with hypophosphatemic rickets/osteomalacia.

    Science.gov (United States)

    Yue, Hua; Yu, Jin-bo; He, Jin-wei; Zhang, Zeng; Fu, Wen-zhen; Zhang, Hao; Wang, Chun; Hu, Wei-wei; Gu, Jie-mei; Hu, Yun-qiu; Li, Miao; Liu, Yu-juan; Zhang, Zhen-Lin

    2014-01-01

    X-linked dominant hypophosphatemia (XLH) is the most prevalent form of inherited rickets/osteomalacia in humans. The aim of this study was to identify PHEX gene mutations and describe the clinical features observed in 6 unrelated Chinese families and 3 sporadic patients with hypophosphatemic rickets/osteomalacia. For this study, 45 individuals from 9 unrelated families of Chinese Han ethnicity (including 16 patients and 29 normal phenotype subjects), and 250 healthy donors were recruited. All 22 exons and exon-intron boundaries of the PHEX gene were amplified by polymerase chain reaction (PCR) and directly sequenced. The PHEX mutations were detected in 6 familial and 3 sporadic hypophosphatemic rickets/osteomalacia. Altogether, 2 novel mutations were detected: 1 missense mutation c.1183G>C in exon 11, resulting in p.Gly395Arg and 1 missense mutation c.1751A>C in exon 17, resulting in p.His584Pro. No mutations were found in the 250 healthy controls. Our study increases knowledge of the PHEX gene mutation types and clinical phenotypes found in Chinese patients with XLH, which is important for understanding the genetic basis of XLH. The molecular diagnosis of a PHEX genetic mutation is of great importance for confirming the clinical diagnosis of XLH, conducting genetic counseling, and facilitating prenatal intervention, especially in the case of sporadic patients.

  5. Mutations in Splicing Factor Genes Are a Major Cause of Autosomal Dominant Retinitis Pigmentosa in Belgian Families

    Science.gov (United States)

    Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy

    2017-01-01

    Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular

  6. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  7. Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

    NARCIS (Netherlands)

    Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.

    1996-01-01

    Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

  8. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

    1999-01-01

    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

  9. Novel C16orf57 mutations in patients with Poikiloderma with Neutropenia: bioinformatic analysis of the protein and predicted effects of all reported mutations

    Directory of Open Access Journals (Sweden)

    Colombo Elisa A

    2012-01-01

    Full Text Available Abstract Background Poikiloderma with Neutropenia (PN is a rare autosomal recessive genodermatosis caused by C16orf57 mutations. To date 17 mutations have been identified in 31 PN patients. Results We characterize six PN patients expanding the clinical phenotype of the syndrome and the mutational repertoire of the gene. We detect the two novel C16orf57 mutations, c.232C>T and c.265+2T>G, as well as the already reported c.179delC, c.531delA and c.693+1G>T mutations. cDNA analysis evidences the presence of aberrant transcripts, and bioinformatic prediction of C16orf57 protein structure gauges the mutations effects on the folded protein chain. Computational analysis of the C16orf57 protein shows two conserved H-X-S/T-X tetrapeptide motifs marking the active site of a two-fold pseudosymmetric structure recalling the 2H phosphoesterase superfamily. Based on this model C16orf57 is likely a 2H-active site enzyme functioning in RNA processing, as a presumptive RNA ligase. According to bioinformatic prediction, all known C16orf57 mutations, including the novel mutations herein described, impair the protein structure by either removing one or both tetrapeptide motifs or by destroying the symmetry of the native folding. Finally, we analyse the geographical distribution of the recurrent mutations that depicts clusters featuring a founder effect. Conclusions In cohorts of patients clinically affected by genodermatoses with overlapping symptoms, the molecular screening of C16orf57 gene seems the proper way to address the correct diagnosis of PN, enabling the syndrome-specific oncosurveillance. The bioinformatic prediction of the C16orf57 protein structure denotes a very basic enzymatic function consistent with a housekeeping function. Detection of aberrant transcripts, also in cells from PN patients carrying early truncated mutations, suggests they might be translatable. Tissue-specific sensitivity to the lack of functionally correct protein accounts for the

  10. Expression of cancer stem markers could be influenced by silencing of p16 gene in HeLa cervical carcinoma cells.

    Science.gov (United States)

    Wu, H; Zhang, J; Shi, H

    2016-01-01

    Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.

  11. Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings

    Energy Technology Data Exchange (ETDEWEB)

    Poussaint, T.Y. [Dept. of Radiology, Children' s Hospital, Boston, MA (United States); Fox, J.W.; Walsh, C.A. [Program in Biological and Biomedical Sciences, Harvard Medical School, Boston, MA (United States); Dept. of Neurology, Beth Israel Deaconess Medical Center, Harvard Institutes of Medicine, Boston, MA (United States); Dobyns, W.B. [Department of Human Genetics, The University of Chicago, Chicago, IL (United States); Radtke, R. [Division of Neurology, Duke University Medical Center, Durham, NC (United States); Scheffer, I.E.; Berkovic, S.F. [Department of Neurology, University of Melbourne, Austin and Repatriation Medical Centre, Heidelberg (Australia); Barnes, P.D. [Department of Radiology, Children' s Hospital and Harvard Medical School, Boston, MA (United States); Huttenlocher, P.R. [Department of Pediatrics, University of Chicago, Chicago, Illinois (United States)

    2000-11-01

    Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)

  12. Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings

    International Nuclear Information System (INIS)

    Poussaint, T.Y.; Fox, J.W.; Walsh, C.A.; Dobyns, W.B.; Radtke, R.; Scheffer, I.E.; Berkovic, S.F.; Barnes, P.D.; Huttenlocher, P.R.

    2000-01-01

    Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)

  13. Absence of p53 gene mutations in mice colon pre-cancerous stage induced by o-nitrotoluene

    Directory of Open Access Journals (Sweden)

    Nahed A Hussien

    2014-01-01

    Conclusion: The results from the present study indicate that point mutations in the p53 gene, in the coding region (exons 5-8 and outside it (exons 10, 11, are not involved in the development of the colon precancerous stage induced by o-nt in mice.

  14. Mutation Spectrum of the ABCA4 Gene in a Greek Cohort with Stargardt Disease: Identification of Novel Mutations and Evidence of Three Prevalent Mutated Alleles

    Directory of Open Access Journals (Sweden)

    Kamakari Smaragda

    2018-01-01

    Full Text Available Aim. To evaluate the frequency and pattern of disease-associated mutations of ABCA4 gene among Greek patients with presumed Stargardt disease (STGD1. Materials and Methods. A total of 59 patients were analyzed for ABCA4 mutations using the ABCR400 microarray and PCR-based sequencing of all coding exons and flanking intronic regions. MLPA analysis as well as sequencing of two regions in introns 30 and 36 reported earlier to harbor deep intronic disease-associated variants was used in 4 selected cases. Results. An overall detection rate of at least one mutant allele was achieved in 52 of the 59 patients (88.1%. Direct sequencing improved significantly the complete characterization rate, that is, identification of two mutations compared to the microarray analysis (93.1% versus 50%. In total, 40 distinct potentially disease-causing variants of the ABCA4 gene were detected, including six previously unreported potentially pathogenic variants. Among the disease-causing variants, in this cohort, the most frequent was c.5714+5G>A representing 16.1%, while p.Gly1961Glu and p.Leu541Pro represented 15.2% and 8.5%, respectively. Conclusions. By using a combination of methods, we completely molecularly diagnosed 48 of the 59 patients studied. In addition, we identified six previously unreported, potentially pathogenic ABCA4 mutations.

  15. Epigenetic alteration of p16 and retinoic acid receptor beta genes in the development of epithelial ovarian carcinoma.

    Science.gov (United States)

    Bhagat, Rahul; Kumar, Sandeep Sriram; Vaderhobli, Shilpa; Premalata, Chennagiri S; Pallavi, Venkateshaiah Reddihalli; Ramesh, Gawari; Krishnamoorthy, Lakshmi

    2014-09-01

    Silencing of tumor suppressor and tumor-related genes by promoter hypermethylation is one of the major events in ovarian carcinogenesis. In this study, we analyzed aberrant promoter methylation of p16 and RAR-β genes in 134 epithelial ovarian carcinomas (EOCs), 23 low malignant potential (LMP) tumors, 26 benign cystadenomas, and 15 normal ovarian tissues. Methylation was investigated by methylation-specific PCR (MSP), and the results were confirmed by bisulfite DNA sequencing. Relative gene expression of p16 and RAR-β was done using quantitative reverse transcriptase PCR (qRT-PCR) on 51 EOC cases, 9 LMP tumors, and 7 benign cystadenomas with 5 normal ovarian tissues. Aberrant methylation for p16 and RAR-β was present in 43 % (58/134) and 31 % (41/134) in carcinoma cases, 22 % (05/23) and 52 % (12/23) in LMP tumors, and 42 % (11/26) and 69 % (18/26) in benign cystadenomas. No methylation was observed in any of the normal ovarian tissues. The mRNA expression level of p16 and RAR-β was significantly downregulated in EOC and LMP tumors than the corresponding normal tissues whereas the expression level was normal in benign cystadenomas for p16 and slightly reduced for RAR-β. A significant correlation of p16 promoter methylation was observed with reduced gene expression in EOC. For RAR-β, no significant correlation was observed between promoter methylation and gene expression. Our results suggest that epigenetic alterations of p16 and RAR-β have an important role in ovarian carcinogenesis and that mechanism along with methylation plays a significant role in downregulation of RAR-β gene in ovarian cancer.

  16. High CpG island methylation of p16 gene and loss of p16 protein ...

    Indian Academy of Sciences (India)

    The study subjects consisted of 75 healthy ... that p16 protein expression was significantly lower in ToF group compared to ... in p16 promoters in ToF patients was negatively correlated with p16 protein ... studies, human foetal ventricular cardiomyocytes (HFCs) are ..... oral epithelial dysplasia: a prospective cohort study.

  17. High CpG island methylation of p16 gene and loss of p16 protein

    Indian Academy of Sciences (India)

    Methylation-specific polymerase chain reaction (MSP) was employed to detect CpG island methylation in p16 promoter region andWestern blotting was used to detect p16 expression of all subjects. Real-time fluorescence quantitative polymerase chain reaction (FQ-PCR) was performed to test p16 mRNA expression.

  18. Confirmation of the pathogenicity of a mutation p.G337C in the COL1A2 gene associated with osteogenesis imperfecta

    Science.gov (United States)

    Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang

    2017-01-01

    Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610

  19. p16 gene methylation in colorectal cancer patients with long-term follow-up Metilación de p16 en pacientes intervenidos de cáncer colorrectal tras un largo periodo de seguimiento

    Directory of Open Access Journals (Sweden)

    Silvia Veganzones-de-Castro

    2012-03-01

    Full Text Available Introduction: p16 gene plays an important role in the cell cycle regulation and is considered an important tumor suppressor gene. Several mechanisms of gene inactivation have been described; in this study we have focused on p16 gene promoter methylation. In colorectal cancer p16 gene methylation is a frequent event. Methods: 326 patients with sporadic colorectal cancer were included. DNA was extracted from tumor tissue samples obtained during the surgical procedure. Promoter methylation was analyzed using bisulfite modification and was detected by quantitative methylation-specific PCR. Frequency of p16 methylation was analyzed and compared with other clinicopathological variables. Results: p16 gene methylation was detected in 24,8% of patients. Methylation was associated with differentiation grade and with tumor location: methylation was frequent in poorly differentiated tumors and had low frequency in distal colon. The p16 promoter methylation discriminated a subgroup of patients with better prognosis in poorly differentiated tumors. Conclusions: p16 methylation was a frequent event in our population and was able to induce differences in the overall survival of patients with poorly differentiated tumors.Introducción: el gen p16 está implicado en la regulación del ciclo celular y se considera un importante gen supresor de tumores. Objetivos: se han descrito diferentes mecanismos de inactivación génica, en este estudio nos hemos centrado en la metilación del promotor del gen p16. En el cáncer colorrectal la metilación de p16 es una alteración frecuente. Material y métodos: se incluyeron 326 pacientes con cáncer colorrectal esporádico. El ADN se extrajo de muestras tumorales obtenidas durante la cirugía. La metilación del promotor se analizó mediante un proceso de modificación con bisulfito y posterior PCR cuantitativa especifica para metilación. Se analizó la frecuencia de la metilación de p16 y se comparó con las variables

  20. Analysis of GPR101 and AIP genes mutations in acromegaly: a multicentric study.

    Science.gov (United States)

    Ferraù, Francesco; Romeo, P D; Puglisi, S; Ragonese, M; Torre, M L; Scaroni, C; Occhi, G; De Menis, E; Arnaldi, G; Trimarchi, F; Cannavò, S

    2016-12-01

    This multicentric study aimed to investigate the prevalence of the G protein-coupled receptor 101 (GPR101) p.E308D variant and aryl hydrocarbon receptor interacting protein (AIP) gene mutations in a representative cohort of Italian patients with acromegaly. 215 patients with GH-secreting pituitary adenomas, referred to 4 Italian referral centres for pituitary diseases, have been included. Three cases of gigantism were present. Five cases were classified as FIPA. All the patients have been screened for germline AIP gene mutations and GPR101 gene p.E308D variant. Heterozygous AIP gene variants have been found in 7 patients (3.2 %). Five patients carried an AIP mutation (2.3 %; 4 females): 3 patients harboured the p.R3O4Q mutation, one had the p.R304* mutation and the last one the IVS3+1G>A mutation. The prevalence of AIP mutations was 3.3 % and 2.8 % when considering only the patients diagnosed when they were <30 or <40-year old, respectively. Furthermore, 2.0 % of the patients with a pituitary macroadenoma and 4.2 % of patients resistant to somatostatin analogues treatment were found to harbour an AIP gene mutation. None of the patients was found to carry the GPR101 p.E308D variant. The prevalence of AIP gene mutations among our sporadic and familial acromegaly cases was similar to that one reported in previous studies, but lower when considering only the cases diagnosed before 40 years of age. The GPR101 p.E308D change is unlikely to have a role in somatotroph adenomas tumorigenesis, since none of our sporadic or familial patients tested positive for this variant.

  1. [Characteristics of phenylalanine hydroxylase gene mutations among patients with phenylketonuria from Linyi region of Shandong Province].

    Science.gov (United States)

    Li, Huafeng; Li, Yongli; Zhang, Li

    2017-06-10

    To explore the characteristics of (PAH) gene mutations among patients with phenylketonuria (PKU) from Linyi area of Shandong Province. For 51 children affected with PKU and their parents, the 13 exons and their flanking intronic sequences of the PAH gene were directly sequenced with Sanger method. PAH gene mutations were detected in all of the 102 alleles of the patients, which included 31 types of mutations. Common mutations included R243Q (17/102, 16.67%), IVS4-1G to A (9/102, 8.82%), R241C (8/102, 7.84%), R111X (8/102, 7.84%), and V399V (8/102, 7.84%). In addition, two novel mutations, D101N, 345-347del, have been detected. The 31 types of mutations included missense, nonsense, deletion, and splicing mutations, which were mainly located in exons 7 (29, 28.43%), 11 (18, 17.65%), 3 (16, 15.69%) and 12 (13, 12.75%). Mutations of the PAH gene in Linyi region mainly distributed in exons 7, 11, and 3, and the most common mutation were R243Q. Two novel mutations, D101N and 345-347del, have been detected.

  2. P63 gene mutations and human developmental syndromes.

    NARCIS (Netherlands)

    Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van

    2002-01-01

    The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the

  3. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  4. Specific UV-induced mutation spectrum in the p53 gene of skin tumors from DNA-repair-deficient xeroderma pigmentosum patients

    International Nuclear Information System (INIS)

    Dumaz, N.; Drougard, C.; Sarasin, A.; Daya-Grosjean, L.

    1993-01-01

    The UV component of sunlight is the major carcinogen involved in the etiology of skin cancers. The authors have studied the rare, hereditary syndrome xeroderma pigmentosum (XP), which is characterized by a very high incidence of cutaneous tumors on exposed skin at an early age, probably due to a deficiency in excision repair of UV-induced lesions. It is interesting to determine the UV mutation spectrum in XP skin tumors in order to correlate the absence of repair of specific DNA lesions and the initiation of skin tumors. The p53 gene is frequently mutated in human cancers and represents a good target for studying mutation spectra since there are >100 potential sites for phenotypic mutations. Using reverse transcription-PCR and single-strand conformation polymorphism to analyze >40 XP skin tumors (mainly basal and squamous cell carcinomas), the authors have found that 40% (17 out of 43) contained at least one point mutation on the p53 gene. All the mutations were located at dipyrimidine sites, essentially at CC sequences, which are hot spots for UV-induced DNA lesions. Sixty-one percent of these mutations were tandem CC → TT mutations considered to be unique to UV-induced lesions; these mutations are not observed in internal human tumors. All the mutations, except two, must be due to translesion synthesis of unrepaired dipyrimidine lesions left on the nontranscribed strand. These results show the existence of preferential repair of UV lesions [either pyrimidine dimers or pyrimidine-pyrimidone (6-4) photoproducts] on the transcribed strand in human tissues

  5. The change of p16 gene expression in glioma cell line C6 after radiation with gamma knife

    International Nuclear Information System (INIS)

    Zhao Xingli; Zhao Conghai; Tian Yu

    2002-01-01

    Objective: T observe the change of expression of p16 gene product, P16 protein, after treated by gamma knife on glioma cell line C6. Methods: Glioma C6 cells proliferated in vitro, treated by γ-knife in dose of 5.00 and 6.22 Gy, respectively. P16 protein was detected by immunohistochemical technique and image analysis. Results: The P16 protein in glioma C6 cells was notably increased after treatment with γ knife (P < 0.01). The grey number in C6 group (control group) was 167.1 +- 6.2 and was 155.4 +- 2.0 and 124.9 +- 7.1, respectively, in 5.00 Gy and 6.22 Gy gamma knife treated group. Conclusion: It is suggests that one of the mechanisms of glioma cell C6 apoptosis induced by γ-knife radiation may be associated with activation of p16 gene and increase of P16 protein expression

  6. Generation of a gene-corrected isogenic control hiPSC line derived from a familial Alzheimer's disease patient carrying a L150P mutation in presenilin 1

    DEFF Research Database (Denmark)

    Poon, Anna Fong-Yee; Schmid, Benjamin; Pires, Carlota

    2016-01-01

    a familial AD patient carrying a L150P point mutation in PSEN1. Here we used CRISPR/Cas9 gene editing to correct for the single base pair mutation. This gene-corrected line, L150P-GC-hiPSC, serves as an isogenic control to the mutant line for future investigation of mechanisms and cellular phenotypes altered...

  7. Novel mutations in the USH1C gene in Usher syndrome patients.

    Science.gov (United States)

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

    2010-12-31

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  8. Splice Site Mutations in the ATP7A Gene

    DEFF Research Database (Denmark)

    Skjørringe, Tina; Tümer, Zeynep; Møller, Lisbeth Birk

    2011-01-01

    Menkes disease (MD) is caused by mutations in the ATP7A gene. We describe 33 novel splice site mutations detected in patients with MD or the milder phenotypic form, Occipital Horn Syndrome. We review these 33 mutations together with 28 previously published splice site mutations. We investigate 12...... mutations for their effect on the mRNA transcript in vivo. Transcriptional data from another 16 mutations were collected from the literature. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool Human Splice Finder, were investigated and evaluated in relation...... to in vivo results. Ninety-six percent of the mutations identified in 45 patients with classical MD were predicted to have a significant effect on splicing, which concurs with the absence of any detectable wild-type transcript in all 19 patients investigated in vivo. Sixty-seven percent of the mutations...

  9. A novel mutation of WFS1 gene in a Chinese patient with Wolfram syndrome: a case report.

    Science.gov (United States)

    Li, Min; Liu, Jia; Yi, Huan; Xu, Li; Zhong, Xiufeng; Peng, Fuhua

    2018-03-17

    Wolfram syndrome (WS), caused by mutations of the Wolfram syndrome 1 (WFS1) gene on chromosome 4p16.1, is an autosomal recessive disorder characterized by diabetes insipidus (DI), neuro-psychiatric disorders, hearing deficit, and urinary tract anomalies. Here we report a 11-year-old Chinese boy who presented with visual loss, was suspected with optic neuritis (ON) or neuromyelitis optica (NMO) and referred to our department for further diagnosis. Finally he was diagnosed with WS because of diabetes mellitus (DM) and optic atrophy (OA). Eight exons and flanking introns of WFS1 gene were analyzed by sequencing. A novel mutation c.1760G > A in WFS1 gene of exon 8 was identified. This report reviews a case of WS associated with a novel mutation, c.1760G > A in WFS1 gene of exon 8, and emphasizes that WS should be taken into account for juveniles with visual loss and diabetes mellitus.

  10. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  11. Human Papillomavirus 16 Infection and TP53 Mutation: Two Distinct Pathogeneses for Oropharyngeal Squamous Cell Carcinoma in an Eastern Chinese Population.

    Directory of Open Access Journals (Sweden)

    Zhen Wang

    Full Text Available To investigate the clinicopathological characteristics, human papillomavirus (HPV infection, p53 expression, and TP53 mutations in oropharyngeal squamous cell carcinoma (OPSCC and determine their utility as prognostic predictors in a primarily eastern Chinese population.The HPV infection status was tested via p16INK4A immunohistochemistry and validated using PCR, reverse blot hybridization and in situ hybridization (ISH in 188 OPSCC samples. p53 expression levels and TP53 gene mutations were assessed through immunohistochemistry and sequencing, respectively. Clinicopathological characteristics and follow-up information were collected. Overall survival was estimated using the Log-rank test.Overall, 22 of the 188 OPSCC samples were associated with HPV infection. HPV16 was identified in all 22 samples, whereas no samples were positive for HPV18. All 22 HPV-associated OPSCC samples were p53 negative and lacked TP53 mutations. HPV16 positivity, female patients, non-smokers, and patients with histological grade I and stage N0 diseases showed better overall survival (p = 0.009, 0.003, 0.048, 0.009, and 0.004, respectively. No significant differences in overall survival between smoking and non-smoking patients were observed in the HPV-associated OPSCC group. Patients without mutations in TP53 exons 5-8 had better prognoses (p = 0.031 among the 43 sequenced specimens. Multivariate analysis indicated that HPV16 infection status (p = 0.011, histological grade (p = 0.017, and N stage (p = 0.019 were independent prognostic factors for patients with OPSCC.Distinct from the situation in Europe and America, for the patients with OPSCC in this study, HPV16 infection was relatively low, although it was still the most important independent prognostic predictor for the disease. In addition to the high smoking and drinking rate in this population, HPV16 infection and TP53 dysfunction appear to be two distinct pathogens for OPSCC patients in the eastern Chinese

  12. Human Papillomavirus 16 Infection and TP53 Mutation: Two Distinct Pathogeneses for Oropharyngeal Squamous Cell Carcinoma in an Eastern Chinese Population.

    Science.gov (United States)

    Wang, Zhen; Xia, Rong-Hui; Ye, Dong-Xia; Li, Jiang

    2016-01-01

    To investigate the clinicopathological characteristics, human papillomavirus (HPV) infection, p53 expression, and TP53 mutations in oropharyngeal squamous cell carcinoma (OPSCC) and determine their utility as prognostic predictors in a primarily eastern Chinese population. The HPV infection status was tested via p16INK4A immunohistochemistry and validated using PCR, reverse blot hybridization and in situ hybridization (ISH) in 188 OPSCC samples. p53 expression levels and TP53 gene mutations were assessed through immunohistochemistry and sequencing, respectively. Clinicopathological characteristics and follow-up information were collected. Overall survival was estimated using the Log-rank test. Overall, 22 of the 188 OPSCC samples were associated with HPV infection. HPV16 was identified in all 22 samples, whereas no samples were positive for HPV18. All 22 HPV-associated OPSCC samples were p53 negative and lacked TP53 mutations. HPV16 positivity, female patients, non-smokers, and patients with histological grade I and stage N0 diseases showed better overall survival (p = 0.009, 0.003, 0.048, 0.009, and 0.004, respectively). No significant differences in overall survival between smoking and non-smoking patients were observed in the HPV-associated OPSCC group. Patients without mutations in TP53 exons 5-8 had better prognoses (p = 0.031) among the 43 sequenced specimens. Multivariate analysis indicated that HPV16 infection status (p = 0.011), histological grade (p = 0.017), and N stage (p = 0.019) were independent prognostic factors for patients with OPSCC. Distinct from the situation in Europe and America, for the patients with OPSCC in this study, HPV16 infection was relatively low, although it was still the most important independent prognostic predictor for the disease. In addition to the high smoking and drinking rate in this population, HPV16 infection and TP53 dysfunction appear to be two distinct pathogens for OPSCC patients in the eastern Chinese population.

  13. Aberrant Methylation of Preproenkephalin and p16 Genes in Pancreatic Intraepithelial Neoplasia and Pancreatic Ductal Adenocarcinoma

    OpenAIRE

    Fukushima, Noriyoshi; Sato, Norihiro; Ueki, Takashi; Rosty, Christophe; Walter, Kimberly M.; Wilentz, Robb E.; Yeo, Charles J.; Hruban, Ralph H.; Goggins, Michael

    2002-01-01

    Pancreatic intraductal neoplasia (PanIN) is thought to be the precursor to infiltrating pancreatic ductal adenocarcinoma. We have previously shown that the preproenkephalin (ppENK) and p16 genes are aberrantly methylated in pancreatic adenocarcinoma. In this study we define the methylation status of the ppENK and p16 genes in various grades of PanINs. One hundred seventy-four samples (28 nonneoplastic pancreatic epithelia, 7 reactive epithelia, 29 PanIN-1A, 48 PanIN-1B, 27 PanIN-2, 14 PanIN-3...

  14. Advances in sarcoma gene mutations and therapeutic targets.

    Science.gov (United States)

    Gao, Peng; Seebacher, Nicole A; Hornicek, Francis; Guo, Zheng; Duan, Zhenfeng

    2018-01-01

    Sarcomas are rare and complex malignancies that have been associated with a poor prognostic outcome. Over the last few decades, traditional treatment with surgery and/or chemotherapy has not significantly improved outcomes for most types of sarcomas. In recent years, there have been significant advances in the understanding of specific gene mutations that are important in driving the pathogenesis and progression of sarcomas. Identification of these new gene mutations, using next-generation sequencing and advanced molecular techniques, has revealed a range of potential therapeutic targets. This, in turn, may lead to the development of novel agents targeted to different sarcoma subtypes. In this review, we highlight the advances made in identifying sarcoma gene mutations, including those of p53, RB, PI3K and IDH genes, as well as novel therapeutic strategies aimed at utilizing these mutant genes. In addition, we discuss a number of preclinical studies and ongoing early clinical trials in sarcoma targeting therapies, as well as gene editing technology, which may provide a better choice for sarcoma patient management. Published by Elsevier Ltd.

  15. Hotspots of missense mutation identify novel neurodevelopmental disorder genes and functional domains

    Science.gov (United States)

    Geisheker, Madeleine R.; Heymann, Gabriel; Wang, Tianyun; Coe, Bradley P.; Turner, Tychele N.; Stessman, Holly A.F.; Hoekzema, Kendra; Kvarnung, Malin; Shaw, Marie; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Thompson, Elizabeth M.; Haan, Eric; Guo, Hui; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Vandeweyer, Geert; Alberti, Antonino; Avola, Emanuela; Vinci, Mirella; Giusto, Stefania; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Michaelson, Jacob J.; Sedlacek, Zdenek; Santen, Gijs W.E.; Peeters, Hilde; Hakonarson, Hakon; Courchesne, Eric; Romano, Corrado; Kooy, R. Frank; Bernier, Raphael A.; Nordenskjöld, Magnus; Gecz, Jozef; Xia, Kun; Zweifel, Larry S.; Eichler, Evan E.

    2017-01-01

    Although de novo missense mutations have been predicted to account for more cases of autism than gene-truncating mutations, most research has focused on the latter. We identified the properties of de novo missense mutations in patients with neurodevelopmental disorders (NDDs) and highlight 35 genes with excess missense mutations. Additionally, 40 amino acid sites were recurrently mutated in 36 genes, and targeted sequencing of 20 sites in 17,689 NDD patients identified 21 new patients with identical missense mutations. One recurrent site (p.Ala636Thr) occurs in a glutamate receptor subunit, GRIA1. This same amino acid substitution in the homologous but distinct mouse glutamate receptor subunit Grid2 is associated with Lurcher ataxia. Phenotypic follow-up in five individuals with GRIA1 mutations shows evidence of specific learning disabilities and autism. Overall, we find significant clustering of de novo mutations in 200 genes, highlighting specific functional domains and synaptic candidate genes important in NDD pathology. PMID:28628100

  16. A p.(Glu809Lys) Mutation in the WFS1 Gene Associated with Wolfram-like Syndrome: A Case Report.

    Science.gov (United States)

    Prochazkova, Dagmar; Hruba, Zuzana; Konecna, Petra; Skotakova, Jarmila; Fajkusova, Lenka

    2016-12-01

    Wolfram-like syndrome (WFSL) is a rare autosomal dominant disease characterised by congenital progressive hearing loss, diabetes mellitus, and optic atrophy. The patient was a boy with the juvenile form of diabetes mellitus and findings which clinically matched the symptoms of Wolfram syndrome. At the age of 3 1/4 years, diabetes mellitus was diagnosed in this boy who also had severe psychomotor retardation, failure to thrive, a dysmorphic face with Peters anomaly type 3 (i.e. posterior central defect with stromal opacity of the cornea, adhering stripes of the iris, and cataract with corneolenticular adhesion), congenital glaucoma, megalocornea, severe hearing impairment, a one-sided deformity of the auricle with atresia of the bony and soft external auditory canal, non-differentiable eardrum, missing os incus, hypothyreosis, and nephrocalcinosis. Molecular-genetic examinations revealed a de novo mutation p.(Glu809Lys) in the WFS1 gene. No mutations were detected in the biological parents. The mutation p.(Glu809Lys) in the WFS1 gene is associated with WFSL.

  17. BRCA1 and BRCA2 Gene Mutations Screening In Sporadic Breast Cancer Patients In Kazakhstan.

    Directory of Open Access Journals (Sweden)

    Ainur R. Akilzhanova

    2013-05-01

    Full Text Available Background: A large number of distinct mutations in the BRCA1 and BRCA2 genes have been reported worldwide, but little is known regarding the role of these inherited susceptibility genes in breast cancer risk among Kazakhstan women. Aim: To evaluate the role of BRCA1/2 mutations in Kazakhstan women presenting with sporadic breast cancer. Methods: We investigated the distribution and nature of polymorphisms in BRCA1 and BRCA2 entire coding regions in 156 Kazakhstan sporadic breast cancer cases and 112 age-matched controls using automatic direct sequencing. Results: We identified 22 distinct variants, including 16 missense mutations and 6 polymorphisms in BRCA1/2 genes. In BRCA1, 9 missense mutations and 3 synonymous polymorphisms were observed. In BRCA2, 7 missense mutations and 3 polymorphisms were detected. There was a higher prevalence of observed mutations in Caucasian breast cancer cases compared to Asian cases (p<0.05; higher frequencies of sequence variants were observed in Asian controls. No recurrent or founder mutations were observed in BRCA1/2 genes. There were no statistically significant differences in age at diagnosis, tumor histology, size of tumor, and lymph node involvement between women with breast cancer with or without the BRCA sequence alterations. Conclusions: Considering the majority of breast cancer cases are sporadic, the present study will be helpful in the evaluation of the need for the genetic screening of BRCA1/2 mutations and reliable genetic counseling for Kazakhstan sporadic breast cancer patients. Evaluation of common polymorphisms and mutations and breast cancer risk in families with genetic predisposition to breast cancer is ongoing in another current investigation. 

  18. Molecular screening of pituitary adenomas for gene mutations and rearrangements

    Energy Technology Data Exchange (ETDEWEB)

    Herman, V.; Drazin, N.Z.; Gonskey, R.; Melmed, S. (Cedars-Sinai Medical Center, Los Angeles, CA (United States))

    1993-07-01

    Although pituitary tumors arise as benign monoclonal neoplasms, genetic alterations have not readily been identified in these adenomas. The authors studied restriction fragment abnormalities involving the GH gene locus, and mutations in the p53 and H-, K-, and N-ras genes in 22 human GH cell adenomas. Twenty two nonsecretory adenomas were also examined for p53 and ras gene mutations. Seven prolactinoma DNA samples were tested for deletions in the multiple endocrine neoplasia-1 (MEN-1) locus, as well as for rearrangements in the hst gene, a member of the fibroblast growth factor family. In DNA from GH-cell adenomas, identical GH restriction patterns were detected in both pituitary and lymphocyte DNA in all patients and in one patient with a mixed GH-TSH cell adenoma. Using polymerase chain reaction (PCR)-single stranded conformation polymorphism analysis, no mutations were detected in exons 5, 6, 7 and 8 of the p53 gene in GH cell adenomas nor in 22 nonsecretory adenomas. Codons 12/13 and 61 of H-ras, K-ras, and N-ras genes were also intact on GH cell adenomas and in nonsecretory adenomas. Site-specific probes for chromosome 11q13 including, PYGM, D11S146, and INT2 were used in 7 sporadic PRL-secreting adenomas to detect deletions of the MEN-1 locus on chromosome 11. One patient was identified with a loss of 11p, and the remaining 6 patients did not demonstrate loss of heterozygosity in the pituitary 11q13 locus, compared to lymphocyte DNA. None of these patients demonstrated hst gene rearrangements which also maps to this locus. These results show that p53 and ras gene mutations are not common events in the pathogenesis of acromegaly and nonsecretory tumors. Although hst gene rearrangements and deletions of 11q13 are not associated with sporadic PRl-cell adenoma formation, a single patient was detected with a partial loss of chromosome 11, including the putative MEN-1 site. 31 refs., 5 figs., 2 tabs.

  19. Mutation analysis of GJB2 gene and prenatal diagnosis in a non-syndromic deafness family

    Directory of Open Access Journals (Sweden)

    Xiao-hua CHEN

    2014-08-01

    Full Text Available Objective To identify the pathogenic gene in a non-syndromic deafness family, provide an accurate genetic consultation and early intervention for deaf family to reduce the incidence of congenital deafness. Methods Mutation analysis was carried out by polymerase chain reaction followed by DNA sequencing of coding region of GJB2 gene. The fetal DNA was extracted from the amniotic fluid cells by amniocentesis at 20 weeks during pregnancy. The genotype of the fetus was characterized for predicting the status of hearing. Results Complex heterozygous mutations 235delC and 176-191del16bp were detected in the proband of the family, heterozygous mutation 176-191del16bp was detected in the father, and 235delC was detected in the mother. Fetus carried 235delC heterozygous mutation inherited from his mother. Conclusions The proband's hearing loss is resulted from the complex heterozygous mutations 235delC and 176-191del16bp in GJB2 gene. Fetus is a heterozygous mutation 235delC carrier. Prenatal diagnosis for deafness assisted by genetic test can provide efficient guidance about offspring's hearing condition, and prevent another deaf-mute member from birth. DOI: 10.11855/j.issn.0577-7402.2014.07.09

  20. LOH at 16p13 is a novel chromosomal alteration detected in benign and malignant microdissected papillary neoplasms of the breast.

    Science.gov (United States)

    Lininger, R A; Park, W S; Man, Y G; Pham, T; MacGrogan, G; Zhuang, Z; Tavassoli, F A

    1998-10-01

    Papillary carcinoma of the breast is a variant of predominantly intraductal carcinoma characterized by a papillary growth pattern with fibrovascular support. Loss of heterozygosity (LOH) was evaluated at multiple chromosomal loci (including loci reported to show frequent genetic alterations in breast cancer) to determine the frequency of genetic mutations in these tumors and their precursors. Thirty-three papillary lesions of the breast (6 papillary carcinomas, 12 carcinomas arising in a papilloma, and 15 intraductal papillomas with florid epithelial hyperplasia) were retrieved from the files of the Armed Forces Institute of Pathology (AFIP). Tumor cells and normal tissue were microdissected in each case and screened for LOH at INT-2 and p53 as well as several loci on chromosome 16p13 in the TSC2/PKD1 gene region (D16S423, D16S663, D16S665). LOH on chromosome 16p13 was present in 10 of 16 (63%) informative cases of either papillary carcinoma or carcinoma arising in a papilloma as well as in 6 of 10 (60%) informative cases of intraductal papilloma with florid epithelial hyperplasia (IDH). One case showed simultaneous LOH in both the florid IDH and carcinoma components of a papilloma. LOH was not observed at either INT-2 or p53 in any of the papillary carcinomas or papillomas with florid IDH. In conclusion, a high frequency of LOH at chromosome 16p13 (the TSC2/PKD1 gene region) is in both papillary carcinomas of the breast as well as in papillomas with florid IDH, including a case with LOH present simultaneously in both components. These findings suggest that chromosome 16p contains a tumor suppressor gene that frequently is mutated early in papillary neoplasia.

  1. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

    Directory of Open Access Journals (Sweden)

    Maryam Taghdiri

    2017-08-01

    Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  2. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

    Science.gov (United States)

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  3. Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

    Directory of Open Access Journals (Sweden)

    Jakub Piotr Fichna

    Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

  4. Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

    Science.gov (United States)

    Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

    2014-01-01

    Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

  5. Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

    Science.gov (United States)

    Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

    2014-05-01

    Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

  6. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

    Science.gov (United States)

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-12-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

  7. Alterations of tumor suppressor genes (Rb, p16, p27 and p53) and an increased FDG uptake in lung cancer

    International Nuclear Information System (INIS)

    Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo

    2003-01-01

    The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)

  8. Application of DNA chips in the analysis of gene mutation in HBV

    International Nuclear Information System (INIS)

    Wang Yongzhong; Ruan Lihua; Zhou Guoping; Wu Guoxiang; Chen Min

    2005-01-01

    Objective: To investigate the clinical applicability of DNA chips for analysis of gene mutation in HBV. Methods: Serum HBV DNA from 47 patients with viral hepatitis type B was amplified with PCR. Possible gene mutations were searched for in site 1896 of pre-C section, sites 1762,1764 of BCP section and sites 528, 552 of P section with DNA chip method based upon membrane coloration. Results: In the 32 patients without lamivudine treatment, the results were as follows: (1) 6 specimens with HBsAg + , HBeAg + , HBeAb - , no mutations observed. (2) 13 specimens with HBsAg + , HBeAg - , HBeAb + , mutations at site 1896, pre- C 4 cases, mutations at sites 1762,1764, BCP 11 cases. (3) 13 specimens with HBsAg + , HBeAg + , HBeAb + , mutations at site 1896 pre -C 4 cases, mutations at sites 1762,1764 BCP 13 cases. In the 15 patients after 48 weeks treatment with lamivudine but remained HBV DNA positive, mutations were observed at: site 1896 pre-C, 5 cases, sites 1762,1764 BCP, 6 cases, site 528 P section, 2 cases, site 552 P section, YVDD 4 cases, YIDD 7 cases. Conclusion: Mutations at sites 1896, 1762,1764 were more frequent in patients with HBeAb + and were related to the negative expression of HBeAg, Mutations at 1762,1764 BCP were closely related to the changes of HBeAg/HBeAb. P section mutations were only observed after lamivadine treatment and were related to resistance against the drug. DNA chip method based upon membrane coloration for detection of gene mutation was expedient and specific and worth popularization. (authors)

  9. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  10. [Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

    Science.gov (United States)

    He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

    2015-11-01

    To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

  11. New Mutation Identified in the SRY Gene High Mobility Group (HMG

    Directory of Open Access Journals (Sweden)

    Feride İffet Şahin

    2013-06-01

    Full Text Available Mutations in the SRY gene prevent the differentiation of the fetal gonads to testes and cause developing female phenotype, and as a result sex reversal and pure gonadal dysgenesis (Swyer syndrome can be developed. Different types of mutations identified in the SRY gene are responsible for 15% of the gonadal dysgenesis. In this study, we report a new mutation (R132P in the High Mobility Group (HMG region of SRY gene was detected in a patient with primary amenorrhea who has 46,XY karyotype. This mutation leads to replacement of the polar and basic arginine with a nonpolar hydrophobic proline residue at aminoacid 132 in the nuclear localization signal region of the protein. With this case report we want to emphasize the genetic approach to the patients with gonadal dysgenesis. If Y chromosome is detected during cytogenetic analysis, revealing the presence of the SRY gene and identification of mutations in this gene by sequencing analysis is become important in.

  12. Recurrent and founder mutations in the Netherlands Plakophilin-2 p.Arg79X mutation causing arrhythmogenic right ventricular cardiomyopathy/dysplasia

    NARCIS (Netherlands)

    van der Zwaag, P. A.; Cox, M. G. P. J.; van der Werf, C.; Wiesfeld, A. C. P.; Jongbloed, J. D. H.; Dooijes, D.; Bikker, H.; Jongbloed, R.; Suurmeijer, A. J. H.; van den Berg, M. P.; Hofstra, R. M. W.; Hauer, R. N. W.; Wilde, A. A. M.; van Tintelen, J. P.

    Background. Arrhythmogenic right ventricular cardiomyopathy/dysplasia (ARVC/D) is an inherited cardiac disease with reduced penetrance and a highly variable expression. Mutations in the gene encoding the plakophilin-2 gene (PKP2) are detected in about 50% of ARVC/D patients. The p. Arg79X mutation

  13. Recurrent and founder mutations in the Netherlands Plakophilin-2 p.Arg79X mutation causing arrhythmogenic right ventricular cardiomyopathy/dysplasia

    NARCIS (Netherlands)

    van der Zwaag, P. A.; Cox, M. G. P. J.; van der Werf, C.; Wiesfeld, A. C. P.; Jongbloed, J. D. H.; Dooijes, D.; Bikker, H.; Jongbloed, R.; Suurmeijer, A. J. H.; van den Berg, M. P.; Hofstra, R. M. W.; Hauer, R. N. W.; Wilde, A. A. M.; van Tintelen, J. P.

    2010-01-01

    Background. Arrhythmogenic right ventricular cardiomyopathy/dysplasia (ARVC/D) is an inherited cardiac disease with reduced penetrance and a highly variable expression. Mutations in the gene encoding the plakophilin-2 gene (PKP2) are detected in about 50% of ARVC/D patients. The p. Arg79X mutation

  14. Clinical Variability in a Family with an Ectodermal Dysplasia Syndrome and a Nonsense Mutation in the TP63 Gene.

    Science.gov (United States)

    Eisenkraft, Arik; Pode-Shakked, Ben; Goldstein, Nurit; Shpirer, Zvi; van Bokhoven, Hans; Anikster, Yair

    2015-01-01

    Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish descent, in which the index patient presented with a persistent scalp skin lesion, dystrophic nails and light thin hair. Further evaluation revealed over 10 affected individuals in the kindred, over four generations, exhibiting varying degrees of ectodermal involvement. Analysis of the TP63 gene from four of the patients and from two healthy individuals of the same family was performed. Gene sequencing of the patients revealed a nonsense mutation leading to a premature termination codon (PTC) (p.Gln16X). The same mutation was found in all tested affected individuals in the family, but gave rise to marked phenotypic variability with minor clinical manifestations in some individuals, underscoring the clinical heterogeneity associated with the recently described PTC-causing mutations.

  15. A comprehensive evaluation of the sl1p pipeline for 16S rRNA gene sequencing analysis.

    Science.gov (United States)

    Whelan, Fiona J; Surette, Michael G

    2017-08-14

    Advances in next-generation sequencing technologies have allowed for detailed, molecular-based studies of microbial communities such as the human gut, soil, and ocean waters. Sequencing of the 16S rRNA gene, specific to prokaryotes, using universal PCR primers has become a common approach to studying the composition of these microbiota. However, the bioinformatic processing of the resulting millions of DNA sequences can be challenging, and a standardized protocol would aid in reproducible analyses. The short-read library 16S rRNA gene sequencing pipeline (sl1p, pronounced "slip") was designed with the purpose of mitigating this lack of reproducibility by combining pre-existing tools into a computational pipeline. This pipeline automates the processing of raw 16S rRNA gene sequencing data to create human-readable tables, graphs, and figures to make the collected data more readily accessible. Data generated from mock communities were compared using eight OTU clustering algorithms, two taxon assignment approaches, and three 16S rRNA gene reference databases. While all of these algorithms and options are available to sl1p users, through testing with human-associated mock communities, AbundantOTU+, the RDP Classifier, and the Greengenes 2011 reference database were chosen as sl1p's defaults based on their ability to best represent the known input communities. sl1p promotes reproducible research by providing a comprehensive log file, and reduces the computational knowledge needed by the user to process next-generation sequencing data. sl1p is freely available at https://bitbucket.org/fwhelan/sl1p .

  16. Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.

    Science.gov (United States)

    Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E

    2015-01-01

    To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.

  17. Evidence that expression of a mutated p53 gene attenuates apoptotic cell death in human gastric intestinal-type carcinomas in vivo.

    Science.gov (United States)

    Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H

    1997-05-01

    To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.

  18. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  19. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  20. High CpG island methylation of p16 gene and loss of p16 protein ...

    Indian Academy of Sciences (India)

    SI-JU GAO

    The study subjects consisted of 75 healthy controls and 63 ToF ... Additionally, our analysis suggested that CpG island methylation in p16 promoters in ToF ..... reduced p16 protein expression in lung cancer (Kondo et al. 2006). In this context ..... promoter methylation in gastric carcinogenesis: a meta-analysis. Mol. Biol. Rep.

  1. Mutational analysis of GALT gene in Greek patients with galactosaemia: identification of two novel mutations and clinical evaluation.

    Science.gov (United States)

    Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L

    2017-10-01

    Classical galactosaemia is an inborn error of metabolism due to the deficiency of the enzyme galactose-1-phosphate uridylyltransferase (GALT). The aim of the study was to identify the underlying mutations in Greek patients with GALT deficiency and evaluate their psychomotor and speech development. Patients with GALT deficiency (n = 17) were picked up through neonatal screening. Mutational analysis was conducted via Sanger sequencing, while in silico analysis was used in the cases of novel missense mutations. Psychomotor speech development tests were utilized for the clinical evaluation of the patients. Eleven different mutations in the GALT gene were detected in the patient cohort, including two novel ones. The most frequent mutation was p.Q188R (c.563 A > G). As for the novel mutations, p.M298I (c.894 G > A) was identified in four out of 32 independent alleles, while p.P115S (c.343 C > T) was identified once. Psychomotor evaluation revealed that most of the patients were found in the borderline area (Peabody test), while only two had speech delay problems. The WISK test revealed three patients at borderline limits and two were at lower than normal limits. The mutational spectrum of the GALT gene in Greek patients is presented for the first time. The mutation p.Q188R is the most frequent among Greek patients. Two novel mutations were identified and their potential pathogenicity was estimated. Regarding the phenotypic characteristics, psychomotor disturbances and speech delay were mainly observed among GALT-deficient patients.

  2. p16INK4A, p53, EGFR expression and KRAS mutation status in squamous cell cancers of the anus: Correlation with outcomes following chemo-radiotherapy

    International Nuclear Information System (INIS)

    Gilbert, Duncan C; Williams, Anthony; Allan, Kimberley; Stokoe, Joanna; Jackson, Tim; Linsdall, Suzanne; Bailey, Charles MH; Summers, Jeff

    2013-01-01

    Background and Purpose: Squamous cell carcinomas of the anal canal are associated with infection with Human Papilloma Viruses (HPVs). Chemo-radiotherapy (CRT) gives 70% 3-year relapse-free survival. Improved predictive markers and therapeutic options are required. Methods: Tumours from 153 patients treated with radical chemo-radiotherapy (50.4 Gy in 28 with concurrent Mitomycin and 5-Fluorouracil between 2004 and 2009) were retrieved and immunohistochemistry performed for p16 INK4A , p53 and EGFR and correlated with outcome. Primary and relapsed samples were analysed for mutations in KRAS. Results: 137/153 (89.5%) stained moderately or strongly for p16 INK4A . p16 INK4A correlated strongly with outcome. 37/137 patients demonstrating moderate/strong p16 INK4A expression relapsed (27.0%), as opposed to 10/16 (62.5%) with absent/weak staining (log rank test p INK4A negative tumours were more frequent in men. p16 INK4A negative patients had significantly worse overall survival (p INK4A is strongly associated with relapse in SCC of the anus and identifies patients with very poor rates of relapse-free and overall survival. Primary and recurrent anal cancer expresses wild type KRAS, unaffected by treatment, supporting trials targeting EGFR in poor risk/recurrent anal cancer

  3. Mutations of alpha-galactosidase A gene in two unusual cases of Fabry disease

    NARCIS (Netherlands)

    Beyer, EM; Kopishinskaya, SV; Van Amstel, JKP; Tsvetkova, [No Value

    1999-01-01

    The mutation analysis of alpha-galactosidase A gene was carried out in two families with Fabry disease described by us earlier. In the family P. a new point mutation E341K (a G to A transition at position 10999 of the gene) was identified. The mutation causes a Glu341Lys substitution in

  4. Novel mutations in the TBX5 gene in patients with Holt-Oram Syndrome

    Directory of Open Access Journals (Sweden)

    Marianna P.R. Porto

    2010-01-01

    Full Text Available The Holt-Oram syndrome (HOS is an autosomal dominant condition characterized by upper limb and cardiac malformations. Mutations in the TBX5 gene cause HOS and have also been associated with isolated heart and arm defects. Interactions between the TBX5, GATA4 and NKX2.5 proteins have been reported in humans. We screened the TBX5, GATA4, and NKX2.5 genes for mutations, by direct sequencing, in 32 unrelated patients presenting classical (8 or atypical HOS (1, isolated congenital heart defects (16 or isolated upper-limb malformations (7. Pathogenic mutations in the TBX5 gene were found in four HOS patients, including two new mutations (c.374delG; c.678G > T in typical patients, and the hotspot mutation c.835C > T in two patients, one of them with an atypical HOS phenotype involving lower-limb malformations. Two new mutations in the GATA4 gene were found in association with isolated upper-limb malformations, but their clinical significance remains to be established. A previously described possibly pathogenic mutation in the NKX2.5 gene (c.73C > 7 was detected in a patient with isolated heart malformations and also in his clinically normal father.

  5. Cardiac abnormalities in diabetic patients with mutation in the mitochondrial tRNA Leu(UUR)Gene

    International Nuclear Information System (INIS)

    Ueno, Hiroshi; Shiotani, Hideyuki

    1999-01-01

    An A-to-G transition at position 3243 of the mitochondrial DNA is known to be a pathogenic factor for mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS), diabetes and cardiomyopathy. This mutation causes dysfunction of the central nervous system in MELAS. Because the heart, as well as the brain and nervous system, is highly dependent on the energy produced by mitochondrial oxidation, these tissues are more vulnerable to mitochondrial defects. Cardiac abnormalities were assessed in 10 diabetic patients associated with this mutation using echocardiography and 123 I-metaiodobenzylguanidine (MIBG) scintigraphy, and compared with 19 diabetic patients without the mutation. Duration of diabetes, therapy, control of blood glucose and diabetic complications, such as diabetic retinopathy and nephropathy, were not different between the 2 groups. Diabetic patients with the mutation had a significantly thicker interventricular septum (16.8±3.7 vs 11.0±1.6 mm, p 0.05). In conclusion, left ventricular hypertrophy with or without abnormal wall motion and severely reduced MIBG uptake may be characteristic in diabetic patients with a mutation in the mitochondrial tRNA Leu(UUR) gene. (author)

  6. Common Mediterranean Fever (MEFV Gene Mutations Associated with Ankylosing Spondylitis in Turkish Population

    Directory of Open Access Journals (Sweden)

    Serbulent Yigit

    2012-01-01

    Full Text Available Ankylosing spondylitis (AS is a common inflammatory rheumatic disease. Mediterranean fever (MEFV gene, which has already been identified as being responsible for familial Mediterranean fever (FMF, is also a suspicious gene for AS because of the clinical association of these two diseases. The aim of this study was to explore the frequency and clinical significance of MEFV gene mutations (M694V, M680I, V726A, E148Q and P369S in a cohort of Turkish patients with AS. Genomic DNAs of 103 AS patients and 120 controls were isolated and genotyped using polymerase chain reaction (PCR and restriction fragment length polymorphism (RFLP methods. There was a statistically significant difference of the MEFV gene mutation carrier rates between AS patients and healthy controls (p = 0.004, OR: 2.5, 95% CI: 1.32–4.76. This association was also observed in allele frequencies (p = 0.005, OR: 2.3, 95% CI: 1.27–4.2. A relatively higher frequency was observed for M694V mutation in AS patients than controls (10.7% versus 4.2% , p = 0.060. There were no significant differences between MEFV mutation carriers and non-carriers with respect to the clinical and demographic characteristics. The results of this study suggest that MEFV gene mutations are positively associated with a predisposition to develop AS.

  7. Gene Mutation Profiles in Primary Diffuse Large B Cell Lymphoma of Central Nervous System: Next Generation Sequencing Analyses

    Science.gov (United States)

    Todorovic Balint, Milena; Jelicic, Jelena; Mihaljevic, Biljana; Kostic, Jelena; Stanic, Bojana; Balint, Bela; Pejanovic, Nadja; Lucic, Bojana; Tosic, Natasa; Marjanovic, Irena; Stojiljkovic, Maja; Karan-Djurasevic, Teodora; Perisic, Ognjen; Rakocevic, Goran; Popovic, Milos; Raicevic, Sava; Bila, Jelena; Antic, Darko; Andjelic, Bosko; Pavlovic, Sonja

    2016-01-01

    The existence of a potential primary central nervous system lymphoma-specific genomic signature that differs from the systemic form of diffuse large B cell lymphoma (DLBCL) has been suggested, but is still controversial. We investigated 19 patients with primary DLBCL of central nervous system (DLBCL CNS) using the TruSeq Amplicon Cancer Panel (TSACP) for 48 cancer-related genes. Next generation sequencing (NGS) analyses have revealed that over 80% of potentially protein-changing mutations were located in eight genes (CTNNB1, PIK3CA, PTEN, ATM, KRAS, PTPN11, TP53 and JAK3), pointing to the potential role of these genes in lymphomagenesis. TP53 was the only gene harboring mutations in all 19 patients. In addition, the presence of mutated TP53 and ATM genes correlated with a higher total number of mutations in other analyzed genes. Furthermore, the presence of mutated ATM correlated with poorer event-free survival (EFS) (p = 0.036). The presence of the mutated SMO gene correlated with earlier disease relapse (p = 0.023), inferior event-free survival (p = 0.011) and overall survival (OS) (p = 0.017), while mutations in the PTEN gene were associated with inferior OS (p = 0.048). Our findings suggest that the TP53 and ATM genes could be involved in the molecular pathophysiology of primary DLBCL CNS, whereas mutations in the PTEN and SMO genes could affect survival regardless of the initial treatment approach. PMID:27164089

  8. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    Science.gov (United States)

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  9. Identification of HNF4A Mutation p.T130I and HNF1A Mutations p.I27L and p.S487N in a Han Chinese Family with Early-Onset Maternally Inherited Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Ying Yang

    2016-01-01

    Full Text Available Maturity-onset diabetes of the young (MODY is characterized by the onset of diabetes before the age of 25 years, positive family history, high genetic predisposition, monogenic mutations, and an autosomal dominant mode of inheritance. Here, we aimed to investigate the mutations and to characterize the phenotypes of a Han Chinese family with early-onset maternally inherited type 2 diabetes. Detailed clinical assessments and genetic screening for mutations in the HNF4α, GCK, HNF-1α, IPF-1, HNF1β, and NEUROD1 genes were carried out in this family. One HNF4A mutation (p.T130I and two HNF1A polymorphisms (p.I27L and p.S487N were identified. Mutation p.T130I was associated with both early-onset and late-onset diabetes and caused downregulated HNF4A expression, whereas HNF1A polymorphisms p.I27L and p.S487N were associated with the age of diagnosis of diabetes. We demonstrated that mutation p.T130I in HNF4A was pathogenic as were the predicted polymorphisms p.I27L and p.S487N in HNF1A by genetic and functional analysis. Our results show that mutations in HNF4A and HNF1A genes might account for this early-onset inherited type 2 diabetes.

  10. Germline CDKN1B/p27Kip1 mutation in multiple endocrine neoplasia

    NARCIS (Netherlands)

    Georgitsi, Marianthi; Raitila, Anniina; Karhu, Auli; van der Luijt, Rob B.; Aalfs, Cora M.; Sane, Timo; Vierimaa, Outi; Mäkinen, Markus J.; Tuppurainen, Karoliina; Paschke, Ralph; Gimm, Oliver; Koch, Christian A.; Gündogdu, Sadi; Lucassen, Anneke; Tischkowitz, Marc; Izatt, Louise; Aylwin, Simon; Bano, Gul; Hodgson, Shirley; de Menis, Ernesto; Launonen, Virpi; Vahteristo, Pia; Aaltonen, Lauri A.

    2007-01-01

    Germline mutations in the MEN1 gene predispose to multiple endocrine neoplasia type 1 (MEN1) syndrome, but in up to 20-25% of clinical MEN1 cases, no MEN1 mutations can be found. Recently, a germline mutation in the CDKN1B gene, encoding p27(Kip1), was reported in one suspected MEN1 family with two

  11. Frequency of common CFTR gene mutations in Venezuelan patients with cystic fibrosis

    OpenAIRE

    Sánchez, Karen; Arcia, Orlando; Matute, Xiorama; Mindiola, Luz; Chaustre, Ismenia; Takiff, Howard

    2014-01-01

    Mutations in the CFTR gene in Cystic Fibrosis (CF) patients have geographic differences and there is scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in these patients. We amplified and sequenced exons 7, 10, 11, 19, 20 and 21, which contain the most common CFTR mutations, from 105 Venezuelan patients in the National CF Program. Eleven different mutations were identified, four with frequencies greater than 1%: p.Phe508del...

  12. Mutations of the phenylalanine hydroxylase gene in patients with phenylketonuria in Shanxi, China

    Directory of Open Access Journals (Sweden)

    Yong-An Zhou

    2012-01-01

    Full Text Available The variation in mutations in exons 3, 6, 7, 11 and 12 of the phenylalanine hydroxylase (PAH gene was investigated in 59 children with phenylketonuria (PKU and 100 normal children. Three single nucleotide polymorphisms were detected by sequence analysis. The mutational frequencies of cDNA 696, cDNA 735 and cDNA 1155 in patients were 96.2%, 76.1% and 7.6%, respectively, whereas in healthy children the corresponding frequencies were 97.0%, 77.3% and 8.3%. In addition, 81 mutations accounted for 61.0% of the mutant alleles. R111X, H64 > TfsX9 and S70 del accounted for 5.1%, 0.8% and 0.8% mutation of alleles in exon 3, whereas EX6-96A > G accounted for 10.2% mutation of alleles in exon 6. R243Q had the highest incidence in exon 7 (12.7%, followed by Ivs7 +2T>A (5.1% and T278I (2.5%. G247V, R252Q, L255S, R261Q and E280K accounted for 0.8% while Y356X and V399V accounted for 5.9% and 5.1%, respectively, in exon 11. R413P and A434D accounted for 5.9% and 2.5%, respectively, in exon 12. Seventy-two variant alleles accounted for the 16 mutations observed here. The mutation characteristics and distributions demonstrated that EX6-96A > G and R243Q were the hot regions for mutations in the PAH gene in Shanxi patients with PKU.

  13. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    Science.gov (United States)

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  14. Eight Mutations of Three Genes (EDA, EDAR, and WNT10A) Identified in Seven Hypohidrotic Ectodermal Dysplasia Patients.

    Science.gov (United States)

    Zeng, Binghui; Xiao, Xue; Li, Sijie; Lu, Hui; Lu, Jiaxuan; Zhu, Ling; Yu, Dongsheng; Zhao, Wei

    2016-09-19

    Hypohidrotic ectodermal dysplasia (HED) is characterized by abnormal development of the teeth, hair, and sweat glands. Ectodysplasin A (EDA), Ectodysplasin A receptor (EDAR), and EDAR-associated death domain (EDARADD) are candidate genes for HED, but the relationship between WNT10A and HED has not yet been validated. In this study, we included patients who presented at least two of the three ectodermal dysplasia features. The four genes were analyzed in seven HED patients by PCR and Sanger sequencing. Five EDA and one EDAR heterozygous mutations were identified in families 1-6. Two WNT10A heterozygous mutations were identified in family 7 as a compound heterozygote. c.662G>A (p.Gly221Asp) in EDA and c.354T>G (p.Tyr118*) in WNT10A are novel mutations. Bioinformatics analyses results confirmed the pathogenicity of the two novel mutations. In family 7, we also identified two single-nucleotide polymorphisms (SNPs) that were predicted to affect the splicing of EDAR. Analysis of the patient's total RNA revealed normal splicing of EDAR. This ascertained that the compound heterozygous WNT10A mutations are the genetic defects that led to the onset of HED. Our data revealed the genetic basis of seven HED patients and expended the mutational spectrum. Interestingly, we confirmed WNT10A as a candidate gene of HED and we propose WNT10A to be tested in EDA-negative HED patients.

  15. p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

    Science.gov (United States)

    Cox, Darren P

    2012-01-01

    Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. THE EXON 5, 6, 7, 8 OF P53 MUTATIONS IN ORAL SQUAMOUS CELLS CARCINOMA

    Directory of Open Access Journals (Sweden)

    Retno P Rahayu

    2012-04-01

    Full Text Available Genetic instability may underlie the etiology of multistep carcinogenesis. The altered p53 gene observed in tumors may represent the expression of such instability and may allow the accumulation of other gene alterations caused by multiple mechanism. p53 gene is the guardian of the genome, that is why we pay more attention to this gene. In this study, we evaluated the significance of p53 mutation in 55 patient with oral squamous carcinoma. Thirty among them underwent well-differentiated carcinoma, while the remaining 25 patients underwent poorly differentiated carcinoma. The mutations were detected by PCR-SSCP (Single strand Conformational Polymorphism analysis in the region between exon 5 and exon 8. The results indicated that the p53 mutation in exon 5 (40%, exon 6 (28%, exon 7 (24% and exon 8 (8% were associated with poorly differentiated carcinoma, whereas mutation in exon 5 (10%, exon 6 (30%, exon 7 (40% and exon 8 (20% were associated with well-differentiated carcinoma. These observations suggest that p53 mutation in exon 5, 6, and 7 have strong correlation with poorly differentiated in oral squamous carcinoma while well-differentiated level was related with mutation in exon 6,7 and 8.

  17. Rare deletions at 16p13.11 predispose to a diverse spectrum of sporadic epilepsy syndromes.

    Science.gov (United States)

    Heinzen, Erin L; Radtke, Rodney A; Urban, Thomas J; Cavalleri, Gianpiero L; Depondt, Chantal; Need, Anna C; Walley, Nicole M; Nicoletti, Paola; Ge, Dongliang; Catarino, Claudia B; Duncan, John S; Kasperaviciūte, Dalia; Tate, Sarah K; Caboclo, Luis O; Sander, Josemir W; Clayton, Lisa; Linney, Kristen N; Shianna, Kevin V; Gumbs, Curtis E; Smith, Jason; Cronin, Kenneth D; Maia, Jessica M; Doherty, Colin P; Pandolfo, Massimo; Leppert, David; Middleton, Lefkos T; Gibson, Rachel A; Johnson, Michael R; Matthews, Paul M; Hosford, David; Kälviäinen, Reetta; Eriksson, Kai; Kantanen, Anne-Mari; Dorn, Thomas; Hansen, Jörg; Krämer, Günter; Steinhoff, Bernhard J; Wieser, Heinz-Gregor; Zumsteg, Dominik; Ortega, Marcos; Wood, Nicholas W; Huxley-Jones, Julie; Mikati, Mohamad; Gallentine, William B; Husain, Aatif M; Buckley, Patrick G; Stallings, Ray L; Podgoreanu, Mihai V; Delanty, Norman; Sisodiya, Sanjay M; Goldstein, David B

    2010-05-14

    Deletions at 16p13.11 are associated with schizophrenia, mental retardation, and most recently idiopathic generalized epilepsy. To evaluate the role of 16p13.11 deletions, as well as other structural variation, in epilepsy disorders, we used genome-wide screens to identify copy number variation in 3812 patients with a diverse spectrum of epilepsy syndromes and in 1299 neurologically-normal controls. Large deletions (> 100 kb) at 16p13.11 were observed in 23 patients, whereas no control had a deletion greater than 16 kb. Patients, even those with identically sized 16p13.11 deletions, presented with highly variable epilepsy phenotypes. For a subset of patients with a 16p13.11 deletion, we show a consistent reduction of expression for included genes, suggesting that haploinsufficiency might contribute to pathogenicity. We also investigated another possible mechanism of pathogenicity by using hybridization-based capture and next-generation sequencing of the homologous chromosome for ten 16p13.11-deletion patients to look for unmasked recessive mutations. Follow-up genotyping of suggestive polymorphisms failed to identify any convincing recessive-acting mutations in the homologous interval corresponding to the deletion. The observation that two of the 16p13.11 deletions were larger than 2 Mb in size led us to screen for other large deletions. We found 12 additional genomic regions harboring deletions > 2 Mb in epilepsy patients, and none in controls. Additional evaluation is needed to characterize the role of these exceedingly large, non-locus-specific deletions in epilepsy. Collectively, these data implicate 16p13.11 and possibly other large deletions as risk factors for a wide range of epilepsy disorders, and they appear to point toward haploinsufficiency as a contributor to the pathogenicity of deletions. Copyright (c) 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  18. Occult HBV among Anti-HBc Alone: Mutation Analysis of an HBV Surface Gene and Pre-S Gene.

    Science.gov (United States)

    Kim, Myeong Hee; Kang, So Young; Lee, Woo In

    2017-05-01

    The aim of this study is to investigate the molecular characteristics of occult hepatitis B virus (HBV) infection in 'anti-HBc alone' subjects. Twenty-four patients with 'anti-HBc alone' and 20 control patients diagnosed with HBV were analyzed regarding S and pre-S gene mutations. All specimens were analyzed for HBs Ag, anti-HBc, and anti-HBs. For specimens with an anti-HBc alone, quantitative analysis of HBV DNA, as well as sequencing and mutation analysis of S and pre-S genes, were performed. A total 24 were analyzed for the S gene, and 14 were analyzed for the pre-S gene through sequencing. A total of 20 control patients were analyzed for S and pre-S gene simultaneously. Nineteen point mutations of the major hydrophilic region were found in six of 24 patients. Among them, three mutations, S114T, P127S/T, M133T, were detected in common. Only one mutation was found in five subjects of the control group; this mutation was not found in the occult HBV infection group, however. Pre-S mutations were detected in 10 patients, and mutations of site aa58-aa100 were detected in 9 patients. A mutation on D114E was simultaneously detected. Although five mutations from the control group were found at the same location (aa58-aa100), no mutations of occult HBV infection were detected. The prevalence of occult HBV infection is not low among 'anti-HBc alone' subjects. Variable mutations in the S gene and pre-S gene were associated with the occurrence of occult HBV infection. Further larger scale studies are required to determine the significance of newly detected mutations. © Copyright: Yonsei University College of Medicine 2017

  19. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

    OpenAIRE

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-01-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and sev...

  20. Effect of low dose radiation on expression of p16 gene in chronic myelogenous leukemia cells

    International Nuclear Information System (INIS)

    Zhang Longzhen; Ding Xin; Li Xiangyang; Cen Jiannong; Shen Hongjie; Chen Zixing

    2010-01-01

    Objective: To investigate the effect of low dose radiation on the expression on p16 gene in chronic myelogenous leukemia. Methods: Leukemic stem cells (LSCs) which expressed CD34 +, CD38 - and CD123 + were isolated from bone marrow cells obtained from twenty patients newly-diagnosedas chronic myeloid leukemia with EasySep TM magnet beads. Hematopoietic stem cells (HSCs) which expressed CD34 + and CD38 - were isolated from human cord blood cells obtained from twenty full-term deliveries with EasySep TM magnet beads as control. HSCs vs LSCs samples were further divided into three dose groups, including 0, 12.5 and 50 cGy, respectively. RT-PCR and real-time quantitative reverse transcription-polymerase chain reaction methods were used to detect mRNA expression of p16 gene in HSCs and LSCs after irradiation. Cells were harvested at different time for detection of cell cycle and apoptosis by flow cytometer. Results: p16 mRNA level in CML-LSCs was increased slightly at 12.5 cGy, and significantly increased at 50 cGy (Z=-3.39, P 0 /G 1 stagewas increased 48 h after 12.5 cGy irradiation, and 72 h post-irradiation with 50 cGy. The apoptosis rate of CML-LSCs was gradually raised after LDR, especially at 72 h post-irradiation of 50 cGy [(17.75±11.760% vs (6.13±4.71)%, Z=-2.37, P<0.01]. Conclusions: p16 gene transcription could be up-regulated by low dose radiation, which might provide a theoretical evidence for CML therapy and LDR in leukemic clinical application. (authors)

  1. Recurrently Mutated Genes Differ between Leptomeningeal and Solid Lung Cancer Brain Metastases.

    Science.gov (United States)

    Li, Yingmei; Liu, Boxiang; Connolly, Ian David; Kakusa, Bina Wasunga; Pan, Wenying; Nagpal, Seema; Montgomery, Stephen B; Hayden Gephart, Melanie

    2018-03-29

    When compared with solid brain metastases from NSCLC, leptomeningeal disease (LMD) has unique growth patterns and is rapidly fatal. Patients with LMD do not undergo surgical resection, limiting the tissue available for scientific research. In this study we performed whole exome sequencing on eight samples of LMD to identify somatic mutations and compared the results with those for 26 solid brain metastases. We found that taste 2 receptor member 31 gene (TAS2R31) and phosphodiesterase 4D interacting protein gene (PDE4DIP) were recurrently mutated among LMD samples, suggesting involvement in LMD progression. Together with a retrospective review of the charts of an additional 44 patients with NSCLC LMD, we discovered a surprisingly low number of KRAS mutations (n = 4 [7.7%]) but a high number of EGFR mutations (n = 33 [63.5%]). The median interval for development of LMD from NSCLC was shorter in patients with mutant EGFR (16.3 months) than in patients with wild-type EGFR (23.9 months) (p = 0.017). Targeted analysis of recurrent mutations thus presents a useful complement to the existing diagnostic tool kit, and correlations of EGFR in LMD and KRAS in solid metastases suggest that molecular distinctions or systemic treatment pressure underpin the differences in growth patterns within the brain. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  2. Utilization of gene mapping and candidate gene mutation screening for diagnosing clinically equivocal conditions: a Norrie disease case study.

    Science.gov (United States)

    Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem

    2014-06-01

    Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.

  3. The p.T191M mutation of the CBS gene is highly prevalent among homocystinuric patients from Spain, Portugal and South America.

    Science.gov (United States)

    Urreizti, Roser; Asteggiano, Carla; Bermudez, Marta; Córdoba, Alfonso; Szlago, Marina; Szlago, Mariana; Grosso, Carola; de Kremer, Raquel Dodelson; Vilarinho, Laura; D'Almeida, Vania; Martínez-Pardo, Mercedes; Peña-Quintana, Luís; Dalmau, Jaime; Bernal, Jaime; Briceño, Ignacio; Couce, María Luz; Rodés, Marga; Vilaseca, Maria Antonia; Balcells, Susana; Grinberg, Daniel

    2006-01-01

    Classical homocystinuria is due to cystathionine beta-synthase (CBS) deficiency. More than 130 mutations, which differ in prevalence and severity, have been described at the CBS gene. Mutation p.I278T is very prevalent, has been found in all European countries where it has been looked for with the exception of the Iberian peninsula, and is known to respond to vitamin B6. On the other hand, mutation p.T191M is prevalent in Spain and Portugal and does not respond to B6. We analysed 30 pedigrees from Spain, Portugal, Colombia and Argentina, segregating for homocystinuria. The p.T191M mutation was detected in patients from all four countries and was particularly prevalent in Colombia. The number of p.T191M alleles described in this study, together with those previously published, is 71. The prevalence of p.T191M among CBS mutant alleles in the different countries was: 0.75 in Colombia, 0.52 in Spain, 0.33 in Portugal, 0.25 in Venezuela, 0.20 in Argentina and 0.14 in Brazil. Haplotype analyses suggested a double origin for this mutation. No genotype-phenotype correlation other than the B6-nonresponsiveness could be established for the p.T191M mutation. Additionally, three new mutations, p.M173V, p.I429del and c.69_70+8del10, were found. The p.M173V was associated with a mild, B6-responsive, phenotype.

  4. [Alternating hemiplegia of childhood: ATP1A3 gene analysis in 16 patients].

    Science.gov (United States)

    Ulate-Campos, Adriana; Fons, Carmen; Campistol, Jaume; Martorell, Loreto; Cancho-Candela, Ramón; Eiris, Jesús; López-Laso, Eduardo; Pineda, Mercedes; Sans, Anna; Velázquez, Ramón

    2014-07-07

    Alternating hemiplegia in childhood (AHC) is a disease characterized by recurrent episodes of hemiplegia, tonic or dystonic crisis and abnormal ocular movements. Recently, mutations in the ATP1A3 gene have been identified as the causal mechanism of AHC. The objective is to describe a series of 16 patients with clinical and genetic diagnosis of AHC. It is a descriptive, retrospective, multicenter study of 16 patients with clinical diagnosis of AHC in whom mutations in ATP1A3 were identified. Six heterozygous, de novo mutations were found in the ATP1A3 gene. The most frequent mutation was G2401A in 8 patients (50%) followed by G2443A in 3 patients (18.75%), G2893A in 2 patients (12.50%) and C2781G, G2893C and C2411T in one patient, respectively (6.25% each). In the studied population with AHC, de novo mutations were detected in 100% of patients. The most frequent mutations were D801N y la E815K, as reported in other series. Copyright © 2013 Elsevier España, S.L. All rights reserved.

  5. Simultaneous pyrosequencing of the 16S rRNA, IncP-1 trfA, and merA genes

    DEFF Research Database (Denmark)

    Holmsgaard, Peter Nikolai; Sørensen, Søren Johannes; Hansen, Lars H.

    2013-01-01

    The use of amplicon pyrosequencing makes it possible to produce thousands of sequences of the same gene at relatively low costs. Here we show that it is possible to simultaneously sequence the 16S rRNA gene, IncP-1 trfA gene and mercury reductase gene (merA) as a way for screening the diversity...

  6. Mutated genes as research tool

    International Nuclear Information System (INIS)

    1981-01-01

    Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of

  7. Intellectual Ability in the Duchenne Muscular Dystrophy and Dystrophin Gene Mutation Location

    Directory of Open Access Journals (Sweden)

    Rasic Milic V.

    2014-12-01

    Full Text Available Duchenne muscular dystrophy (DMD is the most common form of muscular dystrophy during childhood. Mutations in dystrophin (DMD gene are also recognized as a cause of cognitive impairment. We aimed to determine the association between intelligence level and mutation location in DMD genes in Serbian patients with DMD. Forty-one male patients with DMD, aged 3 to 16 years, were recruited at the Clinic for Neurology and Psychiatry for Children and Youth in Belgrade, Serbia. All patients had defined DMD gene deletions or duplications [multiplex ligation- dependent probe amplification (MLPA, polymerase chain reaction (PCR] and cognitive status assessment (Wechsler Intelligence Scale for Children, Brunet-Lezine scale, Vineland-Doll scale. In 37 patients with an estimated full scale intelligence quotient (FSIQ, six (16.22% had borderline intelligence (70mutations when boundaries were set at exons 30 and 45. However, FSIQ was statistically significantly associated with mutation location when we assumed their functional consequence on dystrophin isoforms and when mutations in the 5’-untranslated region (5’UTR of Dp140 (exons 45-50 were assigned to affect only Dp427 and Dp260. Mutations affecting Dp140 and Dp71/Dp40 have been associated with more frequent and more severe cognitive impairment. Finally, the same classification of mutations explained the greater proportion of FSIQ variability associated with cumulative loss of dystrophin isoforms. In conclusion, cumulative loss of dystrophin isoforms increases the risk of intellectual impairment in DMD and characterizing the genotype can define necessity of early cognitive interventions in DMD patients.

  8. ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome

    Science.gov (United States)

    Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun

    2011-01-01

    We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199

  9. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  10. Amelogenesis imperfecta in familial hypomagnesaemia and hypercalciuria with nephrocalcinosis caused by CLDN19 gene mutations.

    Science.gov (United States)

    Yamaguti, Paulo Marcio; Neves, Francisco de Assis Rocha; Hotton, Dominique; Bardet, Claire; de La Dure-Molla, Muriel; Castro, Luiz Claudio; Scher, Maria do Carmo; Barbosa, Maristela Estevão; Ditsch, Christophe; Fricain, Jean-Christophe; de La Faille, Renaud; Figueres, Marie-Lucile; Vargas-Poussou, Rosa; Houillier, Pascal; Chaussain, Catherine; Babajko, Sylvie; Berdal, Ariane; Acevedo, Ana Carolina

    2017-01-01

    Amelogenesis imperfecta (AI) is a group of genetic diseases characterised by tooth enamel defects. AI was recently described in patients with familial hypercalciuria and hypomagnesaemia with nephrocalcinosis (FHHNC) caused by CLDN16 mutations. In the kidney, claudin-16 interacts with claudin-19 to control the paracellular passage of calcium and magnesium. FHHNC can be linked to mutations in both genes. Claudin-16 was shown to be expressed during amelogenesis; however, no data are available on claudin-19. Moreover, the enamel phenotype of patients with CLDN19 mutations has never been described. In this study, we describe the clinical and genetic features of nine patients with FHHNC carrying CLDN19 mutations and the claudin-19 expression profile in rat ameloblasts. Six FHHNC Brazilian patients were subjected to mutational analysis. Three additional French patients were recruited for orodental characterisation. The expression profile of claudin-19 was evaluated by RT-qPCR and immunofluorescence using enamel epithelium from rat incisors. All patients presented AI at different degrees of severity. Two new likely pathogenic variations in CLDN19 were found: p.Arg200Gln and p.Leu90Arg. RT-qPCR revealed low Cldn19 expression in ameloblasts. Confocal analysis indicated that claudin-19 was immunolocalised at the distal poles of secretory and maturing ameloblasts. For the first time, it was demonstrated that AI is associated with FHHNC in patients carrying CLDN19 mutations. The data suggest claudin-19 as an additional determinant in enamel formation. Indeed, the coexistence of hypoplastic and hypomineralised AI in the patients was consistent with claudin-19 expression in both secretory and maturation stages. Additional indirect systemic effects cannot be excluded. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  11. Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

    Directory of Open Access Journals (Sweden)

    Srivastava Satish

    2003-07-01

    Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

  12. The insulin-like growth factor 2 (IGF2) gene intron3-g.3072G>A polymorphism is not the only Sus scrofa chromosome 2p mutation affecting meat production and carcass traits in pigs: evidence from the effects of a cathepsin D (CTSD) gene polymorphism.

    Science.gov (United States)

    Fontanesi, L; Speroni, C; Buttazzoni, L; Scotti, E; Dall'Olio, S; Nanni Costa, L; Davoli, R; Russo, V

    2010-07-01

    The objective of this study was to evaluate the effects of mutations in 2 genes [IGF2 and cathepsin D (CTSD)] that map on the telomeric end of the p arm of SSC2. In this region, an imprinted QTL affecting muscle mass and fat deposition was reported, and the IGF2 intron3-g.3072G>A substitution was identified as the causative mutation. In the same chromosome region, we assigned, by linkage mapping, the CTSD gene, a lysosomal proteinase, for which we previously identified an SNP in the 3'-untranslated region (AM933484, g.70G>A). We have already shown strong effects of this CTSD mutation on several production traits in Italian Large White pigs, suggesting a possible independent role of this marker in fatness and meat deposition in pigs. To evaluate this hypothesis, after having refined the map position of the CTSD gene by radiation hybrid mapping, we analyzed the IGF2 and the CTSD polymorphisms in 270 Italian Large White and 311 Italian Duroc pigs, for which EBV and random residuals from fixed models were calculated for several traits. Different association analyses were carried out to distinguish the effects of the 2 close markers. In the Italian Large White pigs, the results for IGF2 were highly significant for all traits when using either EBV or random residuals (e.g., using EBV: lean cuts, P = 2.2 x 10(-18); ADG, P = 2.6 x 10(-16); backfat thickness, P = 2.2 x 10(-9); feed:gain ratio, P = 2.3 x 10(-9); ham weight, P = 1.5 x 10(-6)). No effect was observed for meat quality traits. The IGF2 intron3-g.3072G>A mutation did not show any association in the Italian Duroc pigs, probably because of the small variability at this polymorphic site for this breed. However, a significant association was evident for the CTSD marker (P production traits in Italian Duroc pigs (lean content, ADG, backfat thickness, feed:gain ratio) after excluding possible confounding effects of the IGF2 mutation. The effects of the CTSD g.70G>A mutation were also confirmed in a subset of Italian

  13. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  14. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  15. Spectrum of MECP2 gene mutations in a cohort of Indian patients with Rett syndrome: report of two novel mutations.

    Science.gov (United States)

    Das, Dhanjit Kumar; Raha, Sarbani; Sanghavi, Daksha; Maitra, Anurupa; Udani, Vrajesh

    2013-02-15

    Rett syndrome (RTT) is an X-linked neurodevelopmental disorder, primarily affecting females and characterized by developmental regression, epilepsy, stereotypical hand movements, and motor abnormalities. Its prevalence is about 1 in 10,000 female births. Rett syndrome is caused by mutations within methyl CpG-binding protein 2 (MECP2) gene. Over 270 individual nucleotide changes which cause pathogenic mutations have been reported. However, eight most commonly occurring missense and nonsense mutations account for almost 70% of all patients. We screened 90 individuals with Rett syndrome phenotype. A total of 19 different MECP2 mutations and polymorphisms were identified in 27 patients. Of the 19 mutations, we identified 7 (37%) frameshift, 6 (31%) nonsense, 14 (74%) missense mutations and one duplication (5%). The most frequent pathogenic changes were: missense p.T158M (11%), p.R133C (7.4%), and p.R306C (7.4%) and nonsense p.R168X (11%), p.R255X (7.4%) mutations. We have identified two novel mutations namely p.385-388delPLPP present in atypical patients and p.Glu290AlafsX38 present in a classical patient of Rett syndrome. Sequence homology for p.385-388delPLPP mutation revealed that these 4 amino acids were conserved across mammalian species. This indicated the importance of these 4 amino acids in structure and function of the protein. A novel variant p.T479T has also been identified in a patient with atypical Rett syndrome. A total of 62 (69%) patients remained without molecular genetics diagnosis that necessitates further search for mutations in other genes like CDKL5 and FOXG1 that are known to cause Rett phenotype. The majority of mutations are detected in exon 4 and only one mutation was present in exon 3. Therefore, our study suggests the need for screening exon 4 of MECP2 as first line of diagnosis in these patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Population carrier rates of pathogenic ARSA gene mutations: is metachromatic leukodystrophy underdiagnosed?

    Directory of Open Access Journals (Sweden)

    Agnieszka Ługowska

    Full Text Available BACKGROUND: Metachromatic leukodystrophy (MLD is a severe neurometabolic disease caused mainly by deficiency of arylsulfatase A encoded by the ARSA gene. Based on epidemiological surveys the incidence of MLD per 100,000 live births varied from 0.6 to 2.5. Our purpose was to estimate the birth prevalence of MLD in Poland by determining population frequency of the common pathogenic ARSA gene mutations and to compare this estimate with epidemiological data. METHODOLOGY: We studied two independently ascertained cohorts from the Polish background population (N∼3000 each and determined carrier rates of common ARSA gene mutations: c.459+1G>A, p.P426L, p.I179S (cohort 1 and c.459+1G>A, p.I179S (cohort 2. PRINCIPAL FINDINGS: Taking into account ARSA gene mutation distribution among 60 Polish patients, the expected MLD birth prevalence in the general population (assuming no selection against homozygous fetuses was estimated as 4.0/100,000 and 4.1/100,000, respectively for the 1(st and the 2(nd cohort with a pooled estimate of 4.1/100,000 (CI: 1.8-9.4 which was higher than the estimate of 0.38 per 100,000 live births based on diagnosed cases. The p.I179S mutation was relatively more prevalent among controls than patients (OR = 3.6, P = 0.0082, for a comparison of p.I179S frequency relative to c.459+1G>A between controls vs. patients. CONCLUSIONS/SIGNIFICANCE: The observed discrepancy between the measured incidence of metachromatic leukodystrophy and the predicted carriage rates suggests that MLD is substantially underdiagnosed in the Polish population. The underdiagnosis rate may be particularly high among patients with p.I179S mutation whose disease is characterized mainly by psychotic symptoms.

  17. Genetic variability in L1 and L2 genes of HPV-16 and HPV-58 in Southwest China.

    Directory of Open Access Journals (Sweden)

    Yaofei Yue

    Full Text Available HPV account for most of the incidence of cervical cancer. Approximately 90% of anal cancers and a smaller subset (<50% of other cancers (oropharyngeal, penile, vaginal, vulvar are also attributed to HPV. The L1 protein comprising HPV vaccine formulations elicits high-titre neutralizing antibodies and confers type restricted protection. The L2 protein is a promising candidate for a broadly protective HPV vaccine. In our previous study, we found the most prevalent high-risk HPV infectious serotypes were HPV-16 and HPV-58 among women of Southwest China. To explore gene polymorphisms and intratypic variations of HPV-16 and HPV-58 L1/L2 genes originating in Southwest China, HPV-16 (L1: n = 31, L2: n = 28 and HPV-58 (L1: n = 21, L2: n = 21 L1/L2 genes were sequenced and compared to others described and submitted to GenBank. Phylogenetic trees were then constructed by Neighbor-Joining and the Kimura 2-parameters methods (MEGA software, followed by an analysis of the diversity of secondary structure. Then selection pressures acting on the L1/L2 genes were estimated by PAML software. Twenty-nine single nucleotide changes were observed in HPV-16 L1 sequences with 16/29 non-synonymous mutations and 13/29 synonymous mutations (six in alpha helix and two in beta turns. Seventeen single nucleotide changes were observed in HPV-16 L2 sequences with 8/17 non-synonymous mutations (one in beta turn and 9/17 synonymous mutations. Twenty-four single nucleotide changes were observed in HPV-58 L1 sequences with 10/24 non-synonymous mutations and 14/24 synonymous mutations (eight in alpha helix and four in beta turn. Seven single nucleotide changes were observed in HPV-58 L2 sequences with 4/7 non-synonymous mutations and 3/7 synonymous mutations. The result of selective pressure analysis showed that most of these mutations were of positive selection. This study may help understand the intrinsic geographical relatedness and biological differences of HPV-16/HPV-58 and

  18. Mapping of the human cone transducin {alpha} subunit (GNAT2) gene to 1p13 and mutation analysis in patients with Stargardt`s disease

    Energy Technology Data Exchange (ETDEWEB)

    Magovcevic, I.; Weremowicz, S.; Morton, C.C. [Harvard Medical School, Boston, MA (United States)] [and others

    1994-09-01

    Transducin {alpha} subunits are members of a large family of G-proteins and play an important role in phototransduction in rod and cone photoreceptors. We report the localization of the human cone {alpha} transducin (GNAT2) gene using fluorescence in situ hybridization (FISH) on chromosome 1 in band p13. The recent assignment of a gene for Stargardt`s disease to the same chromosomal region by linkage analysis prompted us to investigate the possible role of GNAT2 in the pathogenesis of this disease. Stargardt`s disease is characterized by degeneration in late childhood or early adulthood of the macula of the retina, a region rich in cones. We screened patients with Stargardt`s disease, with or without peripheral cone involvement as monitored by the full-field ERG, for mutations in this gene. We investigated 66 unrelated patients including 22 with peripheral cone dysfunction for mutations in the coding region of the GNAT2 gene using polymerase chain reaction-single strand conformation polymorphism analysis (SSCP) and direct sequencing. One patient (034-16) was heterozygous for a silent change in exon VI, Asp238Asp (GAT to GAC). Two patients, one (035-005) with peripheral cone involvement and one (071-001) without peripheral cone involvement, were heterozygous for the missense change Val124Met (GTG to ATG) in exon IV. A subsequent screen of 96 unrelated, unaffected controls revealed one individual (N10) who was also heterozygous for the Val124Met alteration. We concluded that Asp238Asp and Val124Met are rare variants not causing Stargardt`s disease. Hence, no disease-specific mutations were found indicating that GNAT2 is probably not involved in the pathogenesis of most cases of Stargardt`s disease.

  19. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

    Science.gov (United States)

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

    2016-01-01

    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  20. Mutational analysis of EGFR and related signaling pathway genes in lung adenocarcinomas identifies a novel somatic kinase domain mutation in FGFR4.

    Directory of Open Access Journals (Sweden)

    Jenifer L Marks

    2007-05-01

    Full Text Available Fifty percent of lung adenocarcinomas harbor somatic mutations in six genes that encode proteins in the EGFR signaling pathway, i.e., EGFR, HER2/ERBB2, HER4/ERBB4, PIK3CA, BRAF, and KRAS. We performed mutational profiling of a large cohort of lung adenocarcinomas to uncover other potential somatic mutations in genes of this signaling pathway that could contribute to lung tumorigenesis.We analyzed genomic DNA from a total of 261 resected, clinically annotated non-small cell lung cancer (NSCLC specimens. The coding sequences of 39 genes were screened for somatic mutations via high-throughput dideoxynucleotide sequencing of PCR-amplified gene products. Mutations were considered to be somatic only if they were found in an independent tumor-derived PCR product but not in matched normal tissue. Sequencing of 9MB of tumor sequence identified 239 putative genetic variants. We further examined 22 variants found in RAS family genes and 135 variants localized to exons encoding the kinase domain of respective proteins. We identified a total of 37 non-synonymous somatic mutations; 36 were found collectively in EGFR, KRAS, BRAF, and PIK3CA. One somatic mutation was a previously unreported mutation in the kinase domain (exon 16 of FGFR4 (Glu681Lys, identified in 1 of 158 tumors. The FGFR4 mutation is analogous to a reported tumor-specific somatic mutation in ERBB2 and is located in the same exon as a previously reported kinase domain mutation in FGFR4 (Pro712Thr in a lung adenocarcinoma cell line.This study is one of the first comprehensive mutational analyses of major genes in a specific signaling pathway in a sizeable cohort of lung adenocarcinomas. Our results suggest the majority of gain-of-function mutations within kinase genes in the EGFR signaling pathway have already been identified. Our findings also implicate FGFR4 in the pathogenesis of a subset of lung adenocarcinomas.

  1. Novel mutations in cyclin-dependent kinase-like 5 (CDKL5) gene in Indian cases of Rett syndrome.

    Science.gov (United States)

    Das, Dhanjit Kumar; Mehta, Bhakti; Menon, Shyla R; Raha, Sarbani; Udani, Vrajesh

    2013-03-01

    Rett syndrome is a severe neurodevelopmental disorder, almost exclusively affecting females and characterized by a wide spectrum of clinical manifestations. Both the classic and atypical forms of Rett syndrome are primarily due to mutations in the methyl-CpG-binding protein 2 (MECP2) gene. Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been identified in patients with atypical Rett syndrome, X-linked infantile spasms sharing common features of generally early-onset seizures and mental retardation. CDKL5 is known as serine/threonine protein kinase 9 (STK9) and is mapped to the Xp22 region. It has a conserved serine/threonine kinase domain within its amino terminus and a large C-terminal region. Disease-causing mutations are distributed in both the amino terminal domain and in the large C-terminal domain. We have screened the CDKL5 gene in 44 patients with atypical Rett syndrome who had tested negative for MECP2 gene mutations and have identified 6 sequence variants, out of which three were novel and three known mutations. Two of these novel mutations p.V966I and p.A1011V were missense and p.H589H a silent mutation. Other known mutations identified were p.V999M, p.Q791P and p.T734A. Sequence homology for all the mutations revealed that the two mutations (p.Q791P and p.T734A) were conserved across species. This indicated the importance of these residues in structure and function of the protein. The damaging effects of these mutations were analysed in silico using PolyPhen-2 online software. The PolyPhen-2 scores of p.Q791P and p.T734A were 0.998 and 0.48, revealing that these mutations could be deleterious and might have potential functional effect. All other mutations had a low score suggesting that they might not alter the activity of CDKL5. We have also analysed the position of the mutations in the CDKL5 protein and found that all the mutations were present in the C-terminal domain of the protein. The C-terminal domain is required for

  2. Multi-gene epigenetic silencing of tumor suppressor genes in T-cell lymphoma cells; delayed expression of the p16 protein upon reversal of the silencing

    DEFF Research Database (Denmark)

    Nagasawa, T; Zhang, Q; Raghunath, P N

    2006-01-01

    To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...

  3. A case of a Tunisian Rett patient with a novel double-mutation of the MECP2 gene

    Energy Technology Data Exchange (ETDEWEB)

    Fendri-Kriaa, Nourhene, E-mail: nourhene.fendri@gmail.com [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Hsairi, Ines [Service de Neurologie Infantile, C.H.U. Hedi Chaker de Sfax (Tunisia); Kifagi, Chamseddine [Laboratoire internationale associe LIA135, Centre de Biotechnologie de Sfax (Tunisia); Ellouze, Emna [Service de Neurologie Infantile, C.H.U. Hedi Chaker de Sfax (Tunisia); Mkaouar-Rebai, Emna [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Triki, Chahnez [Service de Neurologie Infantile, C.H.U. Hedi Chaker de Sfax (Tunisia); Fakhfakh, Faiza [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia)

    2011-06-03

    Highlights: {yields} Sequencing of the MECP2 gene, modeling and comparison of the two variants were performed in a Tunisian classical Rett patient. {yields} A double-mutation: a new and de novo mutation c.535C > T and the common one c.763C > T of the MECP2 gene was identified. {yields} The P179S transition may change local electrostatic properties which may affect the function and stability of the protein MeCP2. -- Abstract: Rett syndrome is an X-linked dominant disorder caused frequently by mutations in the methyl-CpG-binding protein 2 gene (MECP2). Rett patients present an apparently normal psychomotor development during the first 6-18 months of life. Thereafter, they show a short period of developmental stagnation followed by a rapid regression in language and motor development. The aim of this study was to perform a mutational analysis of the MECP2 gene in a classical Rett patient by sequencing the corresponding gene and modeling the found variants. The results showed the presence of a double-mutation: a new and de novo mutation c.535C > T (p.P179S) and the common c.763C > T (p.R255X) transition of the MECP2 gene. The p.P179S mutation was located in a conserved amino acid in CRIR domain (corepressor interacting region). Modeling results showed that the P179S transition could change local electrostatic properties by adding a negative charge due to serine hydroxyl group of this region of MeCP2 which may affect the function and stability of the protein. The p.R255X mutation is located in TRD-NLS domain (transcription repression domain-nuclear localization signal) of MeCP2 protein.

  4. A case of a Tunisian Rett patient with a novel double-mutation of the MECP2 gene

    International Nuclear Information System (INIS)

    Fendri-Kriaa, Nourhene; Hsairi, Ines; Kifagi, Chamseddine; Ellouze, Emna; Mkaouar-Rebai, Emna; Triki, Chahnez; Fakhfakh, Faiza

    2011-01-01

    Highlights: → Sequencing of the MECP2 gene, modeling and comparison of the two variants were performed in a Tunisian classical Rett patient. → A double-mutation: a new and de novo mutation c.535C > T and the common one c.763C > T of the MECP2 gene was identified. → The P179S transition may change local electrostatic properties which may affect the function and stability of the protein MeCP2. -- Abstract: Rett syndrome is an X-linked dominant disorder caused frequently by mutations in the methyl-CpG-binding protein 2 gene (MECP2). Rett patients present an apparently normal psychomotor development during the first 6-18 months of life. Thereafter, they show a short period of developmental stagnation followed by a rapid regression in language and motor development. The aim of this study was to perform a mutational analysis of the MECP2 gene in a classical Rett patient by sequencing the corresponding gene and modeling the found variants. The results showed the presence of a double-mutation: a new and de novo mutation c.535C > T (p.P179S) and the common c.763C > T (p.R255X) transition of the MECP2 gene. The p.P179S mutation was located in a conserved amino acid in CRIR domain (corepressor interacting region). Modeling results showed that the P179S transition could change local electrostatic properties by adding a negative charge due to serine hydroxyl group of this region of MeCP2 which may affect the function and stability of the protein. The p.R255X mutation is located in TRD-NLS domain (transcription repression domain-nuclear localization signal) of MeCP2 protein.

  5. GPR143 gene mutation analysis in pediatric patients with albinism.

    Science.gov (United States)

    Trebušak Podkrajšek, Katarina; Stirn Kranjc, Branka; Hovnik, Tinka; Kovač, Jernej; Battelino, Tadej

    2012-09-01

    X-linked ocular albinism type 1 is difficult to differentiate clinically from other forms of albinism in young patients. X-linked ocular albinism type 1 is caused by mutations in the GPR143 gene, encoding melanosome specific G-protein coupled receptor. Patients typically present with moderately to severely reduced visual acuity, nystagmus, strabismus, photophobia, iris translucency, hypopigmentation of the retina, foveal hypoplasia and misrouting of optic nerve fibers at the chiasm. Following clinical ophthalmological evaluation, GPR143 gene mutational analyses were performed in a cohort of 15 pediatric male patients with clinical signs of albinism. Three different mutations in the GPR143 gene were identified in four patients, including a novel c.886G>A (p.Gly296Arg) mutation occurring "de novo" and a novel intronic c.360 + 5G>A mutation, identified in two related boys. Four patients with X-linked ocular albinism type 1 were identified from a cohort of 15 boys with clinical signs of albinism using mutation detection methods. Genetic analysis offers the possibility of early definitive diagnosis of ocular albinism type 1 in a significant portion of boys with clinical signs of albinism.

  6. Alterations in the K-ras and p53 genes in rat lung tumors

    Energy Technology Data Exchange (ETDEWEB)

    Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others

    1997-06-01

    Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.

  7. Cone structure in patients with usher syndrome type III and mutations in the Clarin 1 gene.

    Science.gov (United States)

    Ratnam, Kavitha; Västinsalo, Hanna; Roorda, Austin; Sankila, Eeva-Marja K; Duncan, Jacque L

    2013-01-01

    To study macular structure and function in patients with Usher syndrome type III (USH3) caused by mutations in the Clarin 1 gene (CLRN1). High-resolution macular images were obtained by adaptive optics scanning laser ophthalmoscopy and spectral domain optical coherence tomography in 3 patients with USH3 and were compared with those of age-similar control subjects. Vision function measures included best-corrected visual acuity, kinetic and static perimetry, and full-field electroretinography. Coding regions of the CLRN1 gene were sequenced. CLRN1 mutations were present in all the patients; a 20-year-old man showed compound heterozygous mutations (p.N48K and p.S188X), and 2 unrelated women aged 25 and 32 years had homozygous mutations (p.N48K). Best-corrected visual acuity ranged from 20/16 to 20/40, with scotomas beginning at 3° eccentricity. The inner segment-outer segment junction or the inner segment ellipsoid band was disrupted within 1° to 4° of the fovea, and the foveal inner and outer segment layers were significantly thinner than normal. Cones near the fovea in patients 1 and 2 showed normal spacing, and the preserved region ended abruptly. Retinal pigment epithelial cells were visible in patient 3 where cones were lost. Cones were observed centrally but not in regions with scotomas, and retinal pigment epithelial cells were visible in regions without cones in patients with CLRN1 mutations. High-resolution measures of retinal structure demonstrate patterns of cone loss associated with CLRN1 mutations. These findings provide insight into the effect of CLRN1 mutations on macular cone structure, which has implications for the development of treatments for USH3. clinicaltrials.gov Identifier: NCT00254605.

  8. Cone Structure in Patients With Usher Syndrome Type III and Mutations in the Clarin 1 Gene

    Science.gov (United States)

    Ratnam, Kavitha; Västinsalo, Hanna; Roorda, Austin; Sankila, Eeva-Marja K.; Duncan, Jacque L.

    2015-01-01

    Objective To study macular structure and function in patients with Usher syndrome type III (USH3) caused by mutations in the Clarin 1 gene (CLRN1). Methods High-resolution macular images were obtained by adaptive optics scanning laser ophthalmoscopy and spectral domain optical coherence tomography in 3 patients with USH3 and were compared with those of age-similar control subjects. Vision function measures included best-corrected visual acuity, kinetic and static perimetry, and full-field electroretinography. Coding regions of the CLRN1 gene were sequenced. Results CLRN1 mutations were present in all the patients; a 20-year-old man showed compound heterozygous mutations (p.N48K and p.S188X), and 2 unrelated women aged 25 and 32 years had homozygous mutations (p.N48K). Best-corrected visual acuity ranged from 20/16 to 20/40, with scotomas beginning at 3° eccentricity. The inner segment-outer segment junction or the inner segment ellipsoid band was disrupted within 1° to 4° of the fovea, and the foveal inner and outer segment layers were significantly thinner than normal. Cones near the fovea in patients 1 and 2 showed normal spacing, and the preserved region ended abruptly. Retinal pigment epithelial cells were visible in patient 3 where cones were lost. Conclusions Cones were observed centrally but not in regions with scotomas, and retinal pigment epithelial cells were visible in regions without cones in patients with CLRN1 mutations. High-resolution measures of retinal structure demonstrate patterns of cone loss associated with CLRN1 mutations. Clinical Relevance These findings provide insight into the effect of CLRN1 mutations on macular cone structure, which has implications for the development of treatments for USH3. Trial Registration clinicaltrials.gov Identifier: NCT00254605 PMID:22964989

  9. A novel mutation in the MYO7A gene is associated with Usher syndrome type 1 in a Chinese family.

    Science.gov (United States)

    He, Xiaoguang; Peng, Qi; Li, Siping; Zhu, Pengyuan; Wu, Chunqiu; Rao, Chunbao; Lin, Jingqi; Lu, Xiaomei

    2017-08-01

    We aimed to investigate the genetic causes of hearing loss in a Chinese proband with autosomal recessive congenital deafness. The targeted capture of 159 known deafness genes and next-generation sequencing were performed to study the genetic causes of hearing loss in the Chinese family. Sanger sequencing was employed to verify the variant mutations in members of this family. The proband harbored two mutations in the MYO7A gene in the form of compound heterozygosity. She was found to be heterozygous for a novel insertion mutation c.3847_3848 ins TCTG (p.N1285LfsX24) in exon 30 and for the known mutation c.2239_2240delAG (p.R747S fsX16)in exon 19. The novel mutation was absent in the 1000 Genomes Project. These variants were carried in the heterozygous state by the parents and were therefore co-segregated with the genetic disease. Clinical re-assessment, including detailed audiologic and ocular examinations, revealed congenital deafness and retinitis pigmentosa in the proband. Collectively, the combination of audiometric, ophthalmologic and genetic examinations successfully confirmed the phenotype of Usher syndrome type 1 (USH1). This study demonstrates that the novel mutation c.3847_3848insTCTG (p. N1285LfsX24) in compound heterozygosity with c.2239_2240delAG in the MYO7A gene is the main cause of USH1 in the proband. Our study expands the mutational spectrum of MYO7A and provides a foundation for further investigations elucidating the MYO7A-related mechanisms of USH1. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients

    Directory of Open Access Journals (Sweden)

    F.V. Perícole

    2005-09-01

    Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

  11. Molecular cytogenetics of radiation-induced gene mutations in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Aleksandrov, I.D.; Aleksandrova, M.V.; Lapidus, I.L.; Karpovskij, A.L.

    1996-01-01

    The classical paradigm of spatially unrelated lesions for gene mutations and chromosomal exchange breakpoints induced by ionizing radiations in eukaryotic cells was re-examined in the experiments on the mapping of gamma-ray- or neutron-induced breakpoints in and outside of white (w) and vestigial (vg) genes of Drosophila melanogaster using the in situ hybridization of the large fragments of the genes under study with the polythene chromosomes of the relevant mutants. The results for the random sample of 60 inversion and translocation breakpoints analysed to date have shown that (i) 50% of them are mapped as the hot spots within big introns of both the genes, and (ii) 21 of 60 breaks (35%) are located outside of genes. It is important to note that 26% (16/60) of the breakpoints analysed are flanked by the deletions, the sizes of which vary from the quarter to a whole of the gene. It was found that the deletions flank both the inversion and translocation breakpoints and arise more often after action of neutrons than photons. An unexpectedly high frequency of the multiple-damaged w and vg mutants that have the gene/point mutation and additional, but separate, chromosome exchange (the so-called double- or triple-site mutants) has shown that the genetic danger of ionizing radiation is higher than usually accepted on the base of single gene/point mutation assessments. 11 refs., 3 figs

  12. Determination of D816V mutation in the c-kIt gene in the Slovenian patients with acute myeloid leukemia and systemic mastocytosis

    Directory of Open Access Journals (Sweden)

    Martina Fink

    2012-12-01

    Full Text Available Background: D816V mutation in the C-KIT gene is present in more than 90 % of patients with systemic mastocytosis (SM and 2–7 % of patients with acute myeloid leukemia (AML. D816V mutation is caused by the substitution of adenine with thymine at 2447 nucleotide sequence in the C-KIT gene. This nucleotide substitution causes the replacment of aspartate acid by valine at codon 816 of the KIT protein. KIT protein with D816V mutation acts as constitutively active tyrosine kinase that promotes cell proliferation and inhibits apoptosis. The purpose of our study was to determine the incidence of D816V mutation in the C-KIT gene in Slovenian patients with AML and in patients with suspected systemic mastocytosis. Patients and methods: In the retrospective study, 71 patients with AML and 25 patients with suspected systemic mastocytosis were included. D816V mutation in the C-KIT gene was determined by polymerase chain reaction (PCR and the resulting PCR products were analyzed by agarose gel electrophoresis. Results: D816V mutation in KIT protein was determined in 7 % of patients with AML and in 32 % patients with suspected systemic mastocytosis. Conclusions: Identification of D816V mutation in the C-KIT gene must always be performed in patients with suspected systemic mastocytosis. The determination of this mutation contributes to the diagnosis and treatment selection. The finding of D816V mutation in the C-KIT gene in patients with AML and concomitant genetic modifications RUNX-RUNX1T1 (typical translocation t(8; 21 (q22, q22 or CBFB-MYH11, which is the result of inversion on chromosome 16–(inv (16 (p13, q22, however, indicates a faster, more aggressive course of the disease and predicts a worse outcome. The finding of the mutation in other patients with AML may indicate the presence of concomitant AML and SM, which was not found in our patients.

  13. Left ventricular systolic dysfunction in asymptomatic Marfan syndrome patients is related to the severity of gene mutation: insights from the novel three dimensional speckle tracking echocardiography.

    Directory of Open Access Journals (Sweden)

    Mohamed Abd El Rahman

    Full Text Available In asymptomatic Marfan syndrome (MFS patients we evaluated the relationship between the types of fibrillin-1 (FBN1 gene mutation and possible altered left ventricular (LV function as assessed by three-dimensional speckle tracking echocardiography (3D-STE.Forty-five MFS patients (mean age 24 ± 15 years and 40 age-matched healthy controls were studied. Genetic evaluation for the FBN1 gene was carried on 32 MFS patients. Gene mutation (n = 15, 47% was classified as mild when the mutation resulted in nearly normally functioning protein, while mutations resulting in abnormally function protein were considered to be severe (n = 17, 53%. All patients and controls underwent 3D-STE for evaluation of LV function by an echocardiographer blinded to the results of the genetic testing. Compared to controls, MFS patients had significantly lower 3D-STE derived LV ejection fraction (EF, 57.43 ± 7.51 vs. 62.69 ± 4.76%, p = 0.0001, global LV longitudinal strain (LS, 14.85 ± 2.89 vs. 17.90 ± 2.01%, p = 0.0001, global LV circumferential strain (CS, 13.93 ± 2.81 vs. 16.82 ± 2.17%, p = 0.0001 and global LV area strain (AS, 25.76 ± 4.43 vs. 30.51 ± 2.61%, p = 0.0001. Apart from the global LV LS all these parameters were significantly lower in patients with severe gene mutation than in those with mild mutation (p < 0.05. In the multivariate linear regression analysis only the type of mutation had a significant influence on the 3D-STE derived LVEF (p = 0.017, global CS (p = 0.005 and global AS (p = 0.03.In asymptomatic MFS patients latent LV dysfunction can be detected using 3D STE. The LV dysfunction is mainly related to the severity of gene mutation, suggesting possible primary cardiomyopathy in MFS patients.

  14. A three-step programmed method for the identification of causative gene mutations of maturity onset diabetes of the young (MODY).

    Science.gov (United States)

    Li, Qian; Cao, Xi; Qiu, Hai-Yan; Lu, Jing; Gao, Rui; Liu, Chao; Yuan, Ming-Xia; Yang, Guang-Ran; Yang, Jin-Kui

    2016-08-22

    To establish a three-step programmed method to find gene mutations related to maturity onset diabetes of the young (MODY). Target region capture and next-generation sequencing (NGS) were performed using customized oligonucleotide probes designed to capture suspected genes for MODY in 11 probands with clinically diagnosed MODY. The suspected associations of certain genes with MODY were then confirmed by Sanger sequencing in the probands and their family members. Finally, to validate variants of one of the genes of interest (glucokinase, GCK) as pathogenic mutations, protein function editing by the variant genes was assessed. In the target region capture and NGS phase, a total of nine variants of seven genes (GCK, WFS1, SLC19A2, SH2B1, SERPINB4, RFX6, and GATA6) were identified in eight probands. Two heterozygous GCK mutations located on the same allele (p.Leu77Arg and p.Val101Met) were identified in a MODY family. Sanger sequencing was used to confirm the variants identified by NGS to be present in probands and their diabetic family members, but not in non-diabetic family members. Finally, enzyme kinetic and thermal stability analyses revealed that the p.Leu77Arg mutation or the p.Leu77Arg mutation in combination with the p.Val101Met mutation inactivates GCK function and stability, while mutation of p.Val101Met alone does not. The p.Leu77Arg but not p.Val101Met GCK mutation is therefore considered a pathogenic mutation associated with MODY. Genetic screening coupled with gene-editing protein function testing is an effective and reliable method by which causative gene mutations of MODY can be identified. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.

    Science.gov (United States)

    Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A

    1990-11-30

    Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.

  16. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  17. Gene expression patterns associated with p53 status in breast cancer

    International Nuclear Information System (INIS)

    Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

    2006-01-01

    Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

  18. Unambiguous detection of multiple TP53 gene mutations in AAN-associated urothelial cancer in Belgium using laser capture microdissection.

    Directory of Open Access Journals (Sweden)

    Selda Aydin

    Full Text Available In the Balkan and Taiwan, the relationship between exposure to aristolochic acid and risk of urothelial neoplasms was inferred from the A>T genetic hallmark in TP53 gene from malignant cells. This study aimed to characterize the TP53 mutational spectrum in urothelial cancers consecutive to Aristolochic Acid Nephropathy in Belgium. Serial frozen tumor sections from female patients (n=5 exposed to aristolochic acid during weight-loss regimen were alternatively used either for p53 immunostaining or laser microdissection. Tissue areas with at least 60% p53-positive nuclei were selected for microdissecting sections according to p53-positive matching areas. All areas appeared to be carcinoma in situ. After DNA extraction, mutations in the TP53 hot spot region (exons 5-8 were identified using nested-PCR and sequencing. False-negative controls consisted in microdissecting fresh-frozen tumor tissues both from a patient with a Li-Fraumeni syndrome who carried a p53 constitutional mutation, and from KRas mutated adenocarcinomas. To rule out false-positive results potentially generated by microdissection and nested-PCR, a phenacetin-associated urothelial carcinoma and normal fresh ureteral tissues (n=4 were processed with high laser power. No unexpected results being identified, molecular analysis was pursued on malignant tissues, showing at least one mutation in all (six different mutations in two patients, with 13/16 exonic (nonsense, 2; missense, 11 and 3/16 intronic (one splice site mutations. They were distributed as transitions (n=7 or transversions (n=9, with an equal prevalence of A>T and G>T (3/16 each. While current results are in line with A>T prevalence previously reported in Balkan and Taiwan studies, they also demonstrate that multiple mutations in the TP53 hot spot region and a high frequency of G>T transversion appear as a complementary signature reflecting the toxicity of a cumulative dose of aristolochic acid ingested over a short period

  19. Effect of KCNJ5 Mutations on Gene Expression in Aldosterone-Producing Adenomas and Adrenocortical Cells

    Science.gov (United States)

    Monticone, Silvia; Hattangady, Namita G.; Nishimoto, Koshiro; Mantero, Franco; Rubin, Beatrice; Cicala, Maria Verena; Pezzani, Raffaele; Auchus, Richard J.; Ghayee, Hans K.; Shibata, Hirotaka; Kurihara, Isao; Williams, Tracy A.; Giri, Judith G.; Bollag, Roni J.; Edwards, Michael A.; Isales, Carlos M.

    2012-01-01

    Context: Primary aldosteronism is a heterogeneous disease that includes both sporadic and familial forms. A point mutation in the KCNJ5 gene is responsible for familial hyperaldosteronism type III. Somatic mutations in KCNJ5 also occur in sporadic aldosterone producing adenomas (APA). Objective: The objective of the study was to define the effect of the KCNJ5 mutations on gene expression and aldosterone production using APA tissue and human adrenocortical cells. Methods: A microarray analysis was used to compare the transcriptome profiles of female-derived APA samples with and without KCNJ5 mutations and HAC15 adrenal cells overexpressing either mutated or wild-type KCNJ5. Real-time PCR validated a set of differentially expressed genes. Immunohistochemical staining localized the KCNJ5 expression in normal adrenals and APA. Results: We report a 38% (18 of 47) prevalence of KCNJ5 mutations in APA. KCNJ5 immunostaining was highest in the zona glomerulosa of NA and heterogeneous in APA tissue, and KCNJ5 mRNA was 4-fold higher in APA compared with normal adrenals (P APA with and without KCNJ5 mutations displayed slightly different gene expression patterns, notably the aldosterone synthase gene (CYP11B2) was more highly expressed in APA with KCNJ5 mutations. Overexpression of KCNJ5 mutations in HAC15 increased aldosterone production and altered expression of 36 genes by greater than 2.5-fold (P APA, and our data suggest that these mutations increase expression of CYP11B2 and NR4A2, thus increasing aldosterone production. PMID:22628608

  20. [Study of gene mutation in 62 hemophilia A children].

    Science.gov (United States)

    Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

    2017-11-02

    Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense

  1. A novel missense mutation of the DDHD1 gene associated with juvenile amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    Chujun Wu

    2016-12-01

    Full Text Available Background: Juvenile amyotrophic lateral sclerosis (jALS is a rare form of ALS with an onset age of less than 25 years and is frequently thought to be genetic in origin. DDHD1 gene mutations have been reported to be associated with the SPG28 subtype of autosomal recessive HSP but have never been reported in jALS patients.Methods: Gene screens for the causative genes of ALS, HSP and CMT using next-generation sequencing (NGS technologies were performed on a jALS patient. Sanger sequencing was used to validate identified variants and perform segregation analysis.Results: We identified a novel c.1483A>G (p.Met495Val homozygous missense mutation of the DDHD1 gene in the jALS patient. All of his parents and young bother were heterozygous for this mutation. The mutation was not found in 800 Chinese control subjects or the data of dbSNP, ExAC and 1000G.Conclusion: The novel c.1483A>G (p.Met495Val missense mutation of the DDHD1 gene could be a causative mutation of autosomal recessive jALS.

  2. Zebrafish homologs of genes within 16p11.2, a genomic region associated with brain disorders, are active during brain development, and include two deletion dosage sensor genes

    Directory of Open Access Journals (Sweden)

    Alicia Blaker-Lee

    2012-11-01

    Deletion or duplication of one copy of the human 16p11.2 interval is tightly associated with impaired brain function, including autism spectrum disorders (ASDs, intellectual disability disorder (IDD and other phenotypes, indicating the importance of gene dosage in this copy number variant region (CNV. The core of this CNV includes 25 genes; however, the number of genes that contribute to these phenotypes is not known. Furthermore, genes whose functional levels change with deletion or duplication (termed ‘dosage sensors’, which can associate the CNV with pathologies, have not been identified in this region. Using the zebrafish as a tool, a set of 16p11.2 homologs was identified, primarily on chromosomes 3 and 12. Use of 11 phenotypic assays, spanning the first 5 days of development, demonstrated that this set of genes is highly active, such that 21 out of the 22 homologs tested showed loss-of-function phenotypes. Most genes in this region were required for nervous system development – impacting brain morphology, eye development, axonal density or organization, and motor response. In general, human genes were able to substitute for the fish homolog, demonstrating orthology and suggesting conserved molecular pathways. In a screen for 16p11.2 genes whose function is sensitive to hemizygosity, the aldolase a (aldoaa and kinesin family member 22 (kif22 genes were identified as giving clear phenotypes when RNA levels were reduced by ∼50%, suggesting that these genes are deletion dosage sensors. This study leads to two major findings. The first is that the 16p11.2 region comprises a highly active set of genes, which could present a large genetic target and might explain why multiple brain function, and other, phenotypes are associated with this interval. The second major finding is that there are (at least two genes with deletion dosage sensor properties among the 16p11.2 set, and these could link this CNV to brain disorders such as ASD and IDD.

  3. Homozygous mutation in the NPHP3 gene causing foetal nephronophthisis

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Fatima, Ambrin

    2017-01-01

    We present a case of a foetal sonographic finding of hyper-echogenic kidneys, which led to a strategic series of genetic tests and identified a homozygous mutation (c.424C > T, p. R142*) in the NPHP3 gene. Our study provides a rare presentation of NPHP3-related ciliopathy and adds to the mutation...

  4. Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

    Directory of Open Access Journals (Sweden)

    LYU Tingxia

    2016-08-01

    Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.

  5. Ferredoxin Gene Mutation in Iranian Trichomonas Vaginalis Isolates

    Directory of Open Access Journals (Sweden)

    Soudabeh Heidari

    2013-09-01

    Full Text Available Background: Trichomonas vaginalis causes trichomoniasis and metronidazole is its chosen drug for treatment. Ferredoxin has role in electron transport and carbohydrate metabolism and the conversion of an inactive form of metronidazole (CO to its active form (CPR. Ferredoxin gene mutations reduce gene expression and increase its resistance to metronidazole. In this study, the frequency of ferredoxin gene mutations in clinical isolates of T.vaginalis in Tehran has been studied.Methods: Forty six clinical T. vaginalis isolates of vaginal secretions and urine sediment were collected from Tehran Province since 2011 till 2012. DNA was extracted and ferredoxin gene was amplified by PCR technique. The ferredoxin gene PCR products were sequenced to determine gene mutations.Results: In four isolates (8.69% point mutation at nucleotide position -239 (the translation start codon of the ferredoxin gene were detected in which adenosine were converted to thymine.Conclusion: Mutation at nucleotide -239 ferredoxin gene reduces translational regulatory protein’s binding affinity which concludes reduction of ferredoxin expression. For this reduction, decrease in activity and decrease in metronidazole drug delivery into the cells occur. Mutations in these four isolates may lead to resistance of them to metronidazole.

  6. Usefulness of BCOR gene mutation as a prognostic factor in acute myeloid leukemia with intermediate cytogenetic prognosis.

    Science.gov (United States)

    Terada, Kazuki; Yamaguchi, Hiroki; Ueki, Toshimitsu; Usuki, Kensuke; Kobayashi, Yutaka; Tajika, Kenji; Gomi, Seiji; Kurosawa, Saiko; Saito, Riho; Furuta, Yutaka; Miyadera, Keiki; Tokura, Taichiro; Marumo, Atushi; Omori, Ikuko; Sakaguchi, Masahiro; Fujiwara, Yusuke; Yui, Shunsuke; Ryotokuji, Takeshi; Arai, Kunihito; Kitano, Tomoaki; Wakita, Satoshi; Fukuda, Takahiro; Inokuchi, Koiti

    2018-04-16

    BCOR gene is a transcription regulatory factor that plays an essential role in normal hematopoiesis. The wider introduction of next-generation sequencing technology has led to reports in recent years of mutations in the BCOR gene in acute myeloid leukemia (AML), but the related clinical characteristics and prognosis are not sufficiently understood. We investigated the clinical characteristics and prognosis of 377 de novo AML cases with BCOR or BCORL1 mutation. BCOR or BCORL1 gene mutations were found in 28 cases (7.4%). Among cases aged 65 years or below that were also FLT3-ITD-negative and in the intermediate cytogenetic prognosis group, BCOR or BCORL1 gene mutations were observed in 11% of cases (12 of 111 cases), and this group had significantly lower 5-year overall survival (OS) (13.6% vs. 55.0%, P=0.0021) and relapse-free survival (RFS) (14.3% vs. 44.5%, P=0.0168) compared to cases without BCOR or BCORL1 gene mutations. Multivariate analysis demonstrated that BCOR mutations were an independent unfavorable prognostic factor (P=0.0038, P=0.0463) for both OS and RFS. In cases of AML that are FLT3-ITD-negative, aged 65 years or below, and in the intermediate cytogenetic prognosis group, which are considered to have relatively favorable prognosis, BCOR gene mutations appear to be an important prognostic factor. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

  7. Two Mutations in Surfactant Protein C Gene Associated with Neonatal Respiratory Distress

    Directory of Open Access Journals (Sweden)

    Anna Tarocco

    2015-01-01

    Full Text Available Multiple mutations of surfactant genes causing surfactant dysfunction have been described. Surfactant protein C (SP-C deficiency is associated with variable clinical manifestations ranging from neonatal respiratory distress syndrome to lethal lung disease. We present an extremely low birth weight male infant with an unusual course of respiratory distress syndrome associated with two mutations in the SFTPC gene: C43-7G>A and 12T>A. He required mechanical ventilation for 26 days and was treated with 5 subsequent doses of surfactant with temporary and short-term efficacy. He was discharged at 37 weeks of postconceptional age without any respiratory support. During the first 16 months of life he developed five respiratory infections that did not require hospitalization. Conclusion. This mild course in our patient with two mutations is peculiar because the outcome in patients with a single SFTPC mutation is usually poor.

  8. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  9. Tumor-specific mutations in low-frequency genes affect their functional properties

    NARCIS (Netherlands)

    L. Erdem-Eraslan (Lale); D. Heijsman (Daphne); M. De Wit (Maurice); A.E. Kremer (Andreas); A. Sacchetti (Andrea); P.J. van der Spek (Peter); P.A.E. Sillevis Smitt (Peter); P.J. French (Pim)

    2015-01-01

    textabstractCausal genetic changes in oligodendrogliomas (OD) with 1p/19q co-deletion include mutations in IDH1, IDH2, CIC, FUBP1, TERT promoter and NOTCH1. However, it is generally assumed that more somatic mutations are required for tumorigenesis. This study aimed to establish whether genes

  10. Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp

  11. Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease.

    Science.gov (United States)

    Faucz, Fabio R; Tirosh, Amit; Tatsi, Christina; Berthon, Annabel; Hernández-Ramírez, Laura C; Settas, Nikolaos; Angelousi, Anna; Correa, Ricardo; Papadakis, Georgios Z; Chittiboina, Prashant; Quezado, Martha; Pankratz, Nathan; Lane, John; Dimopoulos, Aggeliki; Mills, James L; Lodish, Maya; Stratakis, Constantine A

    2017-08-01

    Somatic mutations in the ubiquitin-specific protease 8 (USP8) gene have been recently identified as the most common genetic alteration in patients with Cushing disease (CD). However, the frequency of these mutations in the pediatric population has not been extensively assessed. We investigated the status of the USP8 gene at the somatic level in a cohort of pediatric patients with corticotroph adenomas. The USP8 gene was fully sequenced in both germline and tumor DNA samples from 42 pediatric patients with CD. Clinical, biochemical, and imaging data were compared between patients with and without somatic USP8 mutations. Five different USP8 mutations (three missense, one frameshift, and one in-frame deletion) were identified in 13 patients (31%), all of them located in exon 14 at the previously described mutational hotspot, affecting the 14-3-3 binding motif of the protein. Patients with somatic mutations were older at disease presentation [mean 5.1 ± 2.1 standard deviation (SD) vs 13.1 ± 3.6 years, P = 0.03]. Levels of urinary free cortisol, midnight serum cortisol, and adrenocorticotropic hormone, as well as tumor size and frequency of invasion of the cavernous sinus, were not significantly different between the two groups. However, patients harboring somatic USP8 mutations had a higher likelihood of recurrence compared with patients without mutations (46.2% vs 10.3%, P = 0.009). Somatic USP8 gene mutations are a common cause of pediatric CD. Patients harboring a somatic mutation had a higher likelihood of tumor recurrence, highlighting the potential importance of this molecular defect for the disease prognosis and the development of targeted therapeutic options. Copyright © 2017 Endocrine Society

  12. Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

    Directory of Open Access Journals (Sweden)

    Mehul Mistri

    Full Text Available Tay Sachs disease (TSD is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients. Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K, c.964 G>A (p.D322N, c.964 G>T (p.D322Y, c.1178C>G (p.R393P and c.1385A>T (p.E462V, c.1432 G>A (p.G478R and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W. The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

  13. Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

    Science.gov (United States)

    Mistri, Mehul; Tamhankar, Parag M; Sheth, Frenny; Sanghavi, Daksha; Kondurkar, Pratima; Patil, Swapnil; Idicula-Thomas, Susan; Gupta, Sarita; Sheth, Jayesh

    2012-01-01

    Tay Sachs disease (TSD) is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients). Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K), c.964 G>A (p.D322N), c.964 G>T (p.D322Y), c.1178C>G (p.R393P) and c.1385A>T (p.E462V), c.1432 G>A (p.G478R) and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W). The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

  14. Role of key-regulator genes in melanoma susceptibility and pathogenesis among patients from South Italy

    International Nuclear Information System (INIS)

    Casula, Milena; Sini, MariaCristina; Palomba, Grazia; The Italian Melanoma Intergroup; Palmieri, Giuseppe; Muggiano, Antonio; Cossu, Antonio; Budroni, Mario; Caracò, Corrado; Ascierto, Paolo A; Pagani, Elena; Stanganelli, Ignazio; Canzanella, Sergio

    2009-01-01

    Several genetic alterations have been demonstrated to contribute to the development and progression of melanoma. In this study, we further investigated the impact of key-regulator genes in susceptibility and pathogenesis of such a disease. A large series (N = 846) of sporadic and familial cases originating from South Italy was screened for germline mutations in p16 CDKN2A , BRCA2, and MC1R genes by DHPLC analysis and automated DNA sequencing. Paired primary melanomas and lymph node metastases from same patients (N = 35) as well as melanoma cell lines (N = 18) were analyzed for somatic mutations in NRAS, BRAF, and p16 CDKN2A genes. For melanoma susceptibility, investigations at germline level indicated that p16 CDKN2A was exclusively mutated in 16/545 (2.9%) non-Sardinian patients, whereas BRCA2 germline mutations were observed in 4/91 (4.4%) patients from North Sardinia only. Two MC1R germline variants, Arg151Cys and Asp294His, were significantly associated with melanoma in Sardinia. Regarding genetic events involved in melanoma pathogenesis at somatic level, mutually-exclusive mutations of NRAS and BRAF genes were observed at quite same rate (about two thirds) in cultured and in vivo melanomas (either primary or metastatic lesions). Conversely, p16 CDKN2A gene alterations were observed at increased rates moving from primary to metastatic melanomas and melanoma cell lines. Activation of the ERK gene product was demonstrated to be consistently induced by a combination of molecular alterations (NRAS/BRAF mutations and p16 CDKN2A silencing). Our findings further clarified that: a) mutation prevalence in melanoma susceptibility genes may vary within each specific geographical area; b) multiple molecular events are accumulating during melanomagenesis

  15. Cardiac abnormalities in diabetic patients with mutation in the mitochondrial tRNA {sup Leu(UUR)}Gene

    Energy Technology Data Exchange (ETDEWEB)

    Ueno, Hiroshi [Hyogo Medical Center for Adults, Akashi (Japan); Shiotani, Hideyuki

    1999-11-01

    An A-to-G transition at position 3243 of the mitochondrial DNA is known to be a pathogenic factor for mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS), diabetes and cardiomyopathy. This mutation causes dysfunction of the central nervous system in MELAS. Because the heart, as well as the brain and nervous system, is highly dependent on the energy produced by mitochondrial oxidation, these tissues are more vulnerable to mitochondrial defects. Cardiac abnormalities were assessed in 10 diabetic patients associated with this mutation using echocardiography and {sup 123}I-metaiodobenzylguanidine (MIBG) scintigraphy, and compared with 19 diabetic patients without the mutation. Duration of diabetes, therapy, control of blood glucose and diabetic complications, such as diabetic retinopathy and nephropathy, were not different between the 2 groups. Diabetic patients with the mutation had a significantly thicker interventricular septum (16.8{+-}3.7 vs 11.0{+-}1.6 mm, p<0.001) than those without the mutation. Fractional shortening was lower in diabetic patients with the mutation than those without it (30.7{+-}7.0 vs 42.5{+-}6.6, p<0.001). MIBG uptake on the delayed MIBG image was significantly lower in diabetic patients with the mutation than in those without the mutation (mean value of the heart to mediastinum ratio: 1.6{+-}0.2 vs 2.0{+-}0.4, p>0.05). In conclusion, left ventricular hypertrophy with or without abnormal wall motion and severely reduced MIBG uptake may be characteristic in diabetic patients with a mutation in the mitochondrial tRNA {sup Leu(UUR)} gene. (author)

  16. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    Science.gov (United States)

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

    2014-10-18

    To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

  17. Relationship of JAK2V617F gene mutation with cell proliferation and coagulation function in myeloproliferative neoplasms

    Directory of Open Access Journals (Sweden)

    Xiao-Nan Zhang

    2017-05-01

    Full Text Available Objective: To study the relationship of JAK2V617F gene mutation with cell proliferation and coagulation function in myeloproliferative neoplasms. Methods: Patients who were diagnosed with BCR-ABL-negative myeloproliferative neoplasms in Anyang District Hospital between June 2014 and August 2016 were selected, JAK2V617F gene mutation was detected, and according to the test results, the patients were divided into mutation-positive group and mutation-negative group. The expression of JAK2/STATs signaling pathway molecules and cell proliferation genes in bone marrow fluid as well as the coagulation function indexes in peripheral blood were detected. Results: p-JAK2, p-STAT3, p-STAT5, Survivin, C-myc, CyclinD1 and ASXL1 protein expression in myeloproliferative neoplasms of mutation-positive group were significantly higher than those of mutation-negative group, and peripheral blood PT and APTT levels were significantly lower than those of mutation-negative group while TT and FIB levels were not significantly different from those of mutation-negative group. Conclusion: JAK2V617F gene mutation in myeloproliferative neoplasms can promote the cell proliferation and cause the hypercoagulable state.

  18. New insights into thyroglobulin gene: molecular analysis of seven novel mutations associated with goiter and hypothyroidism.

    Science.gov (United States)

    Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2013-01-30

    The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  19. A molecular nature of mutation in ADE2 gene of the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Korolev, V.G.

    1983-01-01

    A study was made on the lethal and mutagenous effects and the spectrum of mutations, induced by the decomposition of 32 P, introduced into DNA of yeast cells in the form of 32 P-desoxyguanosinemonophosphate ( 32 PdGMP) and 32 P-thymidinemonophosphate ( 32 P-TMP). Inactivation probability for one 32 P decomposition was independent on labelled nucleotide, included in DNA. At the same time the probability of mutation occUrrence in ADE1 and ADE2 genes per one 32 P decomposition is 3 times higher for the case of 32 PdGMP inclusion than 32 P-TMP. The data showGC that amount of base pairs in ADE1 and ADE2 genes is a of induced mutations differ with respect to the ratio of GC→AT at and at AT→GC transitions, depending on labelled nucleotide

  20. Four Novel p.N385K, p.V36A, c.1033–1034insT and c.1417–1418delCT Mutations in the Sphingomyelin Phosphodiesterase 1 (SMPD1 Gene in Patients with Types A and B Niemann-Pick Disease (NPD

    Directory of Open Access Journals (Sweden)

    Masoumeh Dehghan Manshadi

    2015-03-01

    Full Text Available Background: Types A and B Niemann-Pick disease (NPD are autosomal-recessive lysosomal storage disorders caused by the deficient activity of acid sphingomyelinase due to mutations in the sphingomyelin phosphodiesterase 1 (SMPD1 gene. Methods: In order to determine the prevalence and distribution of SMPD1 gene mutations, the genomic DNA of 15 unrelated Iranian patients with types A and B NPD was examined using PCR, DNA sequencing and bioinformatics analysis. Results: Of 8 patients with the p.G508R mutation, 5 patients were homozygous, while the other 3 were heterozygous. One patient was heterozygous for both the p.N385K and p.G508R mutations. Another patient was heterozygous for both the p.A487V and p.G508R mutations. Two patients (one homozygous and one heterozygous showed the p.V36A mutation. One patient was homozygous for the c.1033–1034insT mutation. One patient was homozygous for the c.573delT mutation, and 1 patient was homozygous for the c.1417–1418delCT mutation. Additionally, bioinformatics analysis indicated that two new p.V36A and p.N385K mutations decreased the acid sphingomyelinase (ASM protein stability, which might be evidence to suggest the pathogenicity of these mutations. Conclusion: with detection of these new mutations, the genotypic spectrum of types A and B NPD is extended, facilitating the definition of disease-related mutations. However, more research is essential to confirm the pathogenic effect of these mutations.

  1. Prognostic value of p53 mutations in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Tomohiro; Kaneko, Kazuhiro; Makino, Reiko; Ito, Hiroaki; Konishi, Kazuo; Kurahashi, Toshinori; Kitahara, Tadashi; Mitamura, Keiji [Showa Univ., Tokyo (Japan). School of Medicine

    2001-05-01

    A significant correlation has been found between p53 mutation and response to chemotherapy or radiotherapy. To determine the prognostic value of p53 mutation in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy, p53 mutation was analyzed using the biopsied specimens taken for diagnosis. Concurrent chemoradiotherapy was performed for 40 patients with severe dysphagia caused by esophageal squamous cell carcinoma associated with T3 or T4 disease. Chemotherapy consisted of protracted infusion of 5-fluorouracil, combined with an infusion of cisplatinum. Radiation treatment of the mediastinum was administered concomitantly with chemotherapy. The p53 gene mutation was detected by fluorescence-based polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) methods. DNA sequences were determined for DNA fragments with shifted peaks by SSCP methods. Of the 40 patients, 15 had T3 disease and 25 had T4 disease; 11 patients had M1 lymph node (LYM) disease. Of the 40 patients, 13 (33%) achieved a complete response. The median survival time was 14 months, and the 2-year survival rate was 20%. Among the 40 tumor samples, p53 mutation was detected in 24 tumors (60%). The survival rate in the 24 patients with p53 mutation did not differ significantly from that in the 16 patients without p53 mutation. In contrast, the 15 patients with T3 disease survived longer than the 25 patients with T4 disease (P=0.016); however, the survival rate in the 11 patients with M1 LYM disease did not differ significantly from that in the 29 patients without M1 LYM disease. Concurrent chemoradiotherapy is potentially curative for locally advanced esophageal carcinoma, but p53 genetic abnormality has no impact on prognosis. (author)

  2. Prognostic value of p53 mutations in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy

    International Nuclear Information System (INIS)

    Ito, Tomohiro; Kaneko, Kazuhiro; Makino, Reiko; Ito, Hiroaki; Konishi, Kazuo; Kurahashi, Toshinori; Kitahara, Tadashi; Mitamura, Keiji

    2001-01-01

    A significant correlation has been found between p53 mutation and response to chemotherapy or radiotherapy. To determine the prognostic value of p53 mutation in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy, p53 mutation was analyzed using the biopsied specimens taken for diagnosis. Concurrent chemoradiotherapy was performed for 40 patients with severe dysphagia caused by esophageal squamous cell carcinoma associated with T3 or T4 disease. Chemotherapy consisted of protracted infusion of 5-fluorouracil, combined with an infusion of cisplatinum. Radiation treatment of the mediastinum was administered concomitantly with chemotherapy. The p53 gene mutation was detected by fluorescence-based polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) methods. DNA sequences were determined for DNA fragments with shifted peaks by SSCP methods. Of the 40 patients, 15 had T3 disease and 25 had T4 disease; 11 patients had M1 lymph node (LYM) disease. Of the 40 patients, 13 (33%) achieved a complete response. The median survival time was 14 months, and the 2-year survival rate was 20%. Among the 40 tumor samples, p53 mutation was detected in 24 tumors (60%). The survival rate in the 24 patients with p53 mutation did not differ significantly from that in the 16 patients without p53 mutation. In contrast, the 15 patients with T3 disease survived longer than the 25 patients with T4 disease (P=0.016); however, the survival rate in the 11 patients with M1 LYM disease did not differ significantly from that in the 29 patients without M1 LYM disease. Concurrent chemoradiotherapy is potentially curative for locally advanced esophageal carcinoma, but p53 genetic abnormality has no impact on prognosis. (author)

  3. Four Novel Mutations in the ALPL Gene in Chinese patients with Odonto, Childhood and Adult Hypophosphatasia.

    Science.gov (United States)

    Xu, Lijun; Pang, Qianqian; Jiang, Yan; Wang, Ou; Li, Mei; Xing, Xiaoping; Xia, Weibo

    2018-05-03

    Background and purpose: Hypophosphatasiais (HPP) is a rare inherited disorder characterized by defective bone and/or dental mineralization, and decreased serum alkaline phosphatase activity. ALPL , the only gene related with HPP, encodes tissue non-specific alkaline phosphatase (TNSALP). Few studies were carried out in ALPL gene mutations in the Chinese population with HPP. The purpose of this study is to elucidate the clinical and genetic characteristics of HPP in 5 unrelated Chinese families and 2 sporadic patients. Methods : 10 clinically diagnosed HPP patients from 5 unrelated Chinese families and 2 sporadic patients and 50 healthy controls were genetic investigated. All 12 exons and exon-intron boundaries of the ALPL gene were amplified by polymerase chain reaction and directly sequenced. The laboratory and radiological investigations were conducted simultaneously in these 10 HPP patients. A three-dimensional model of the TNSALP was used to predict the dominant negative effect of identified missense mutations. Results : 3 odonto, 3 childhood and 4 adult types of HPP were clinically diagnosed. 10 mutations were identified in 5 unrelated Chinese families and 2 sporadic patients, including 8 missense mutations and 2 frameshift mutations. Of which, 4 were novel: 1 frameshift mutation (p.R138Pfsx45); 3 missense mutations (p.C201R, p.V459A, p.C497S). No identical mutations and any other new ALPL mutations were found in unrelated 50 healthy controls. Conclusions : Our study demonstrated that the ALPL  gene mutations are responsible for HPP in these Chinese families. These findings will be useful for clinicians to improve understanding of this heritable bone disorder. ©2018 The Author(s).

  4. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  5. The spectrum of HNF1A gene mutations in Greek patients with MODY3: relative frequency and identification of seven novel germline mutations.

    Science.gov (United States)

    Tatsi, Christina; Kanaka-Gantenbein, Christina; Vazeou-Gerassimidi, Adriani; Chrysis, Dionysios; Delis, Dimitrios; Tentolouris, Nikolaos; Dacou-Voutetakis, Catherine; Chrousos, George P; Sertedaki, Amalia

    2013-11-01

    Maturity-Onset Diabetes of the Young (MODY) is the most common type of monogenic diabetes accounting for 1-2% of the population with diabetes. The relative incidence of HNF1A-MODY (MODY3) is high in European countries; however, data are not available for the Greek population. The aims of this study were to determine the relative frequency of MODY3 in Greece, the type of the mutations observed, and their relation to the phenotype of the patients. Three hundred ninety-five patients were referred to our center because of suspected MODY during a period of 15 yr. The use of Denaturing Gradient Gel Electrophoresis of polymerase chain reaction amplified DNA revealed 72 patients carrying Glucokinase gene mutations (MODY2) and 8 patients carrying HNF1A gene mutations (MODY3). After using strict criteria, 54 patients were selected to be further evaluated by direct sequencing or by multiplex ligation probe amplification (MLPA) for the presence of HNF1A gene mutations. In 16 unrelated patients and 13 of their relatives, 15 mutations were identified in the HNF1A gene. Eight of these mutations were previously reported, whereas seven were novel. Clinical features, such as age of diabetes at diagnosis or severity of hyperglycemia, were not related to the mutation type or location. In our cohort of patients fulfilling strict clinical criteria for MODY, 12% carried an HNF1A gene mutation, suggesting that defects of this gene are responsible for a significant proportion of monogenic diabetes in the Greek population. No clear phenotype-genotype correlations were identified. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Hereditary cancer genes are highly susceptible to splicing mutations

    Science.gov (United States)

    Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.

    2018-01-01

    Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604

  7. Hereditary cancer genes are highly susceptible to splicing mutations.

    Directory of Open Access Journals (Sweden)

    Christy L Rhine

    2018-03-01

    Full Text Available Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5' and 3' splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77% of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36% of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing.

  8. FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients.

    Directory of Open Access Journals (Sweden)

    Avani Solanki

    Full Text Available Fanconi anemia (FA, a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C. Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions.

  9. FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients.

    Science.gov (United States)

    Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

    2016-01-01

    Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions.

  10. Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

    Directory of Open Access Journals (Sweden)

    Udhaya H Kotecha

    2014-01-01

    Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

  11. Further evidence for P59L mutation in GJA3 associated with autosomal dominant congenital cataract

    Directory of Open Access Journals (Sweden)

    Li Wang

    2016-01-01

    Full Text Available Context: Congenital cataracts are one of the common eye disorders leading to visual impairment or blindness in children worldwide. We found a Chinese family with autosomal dominant pulverulent cataract. Aims: To identify the pathogenic gene mutation in a Chinese family with autosomal dominant inherited pulverulent cataract. Subjects and Methods: After obtained informed consent, detailed ophthalmic examinations were carried out; genomic DNAs were obtained from seven family members in a three-generation Chinese family with three affected. All exons of candidate genes were amplified by polymerase chain reaction and were sequenced performed by bidirectional sequencing. Results: By sequencing the encoding regions of the candidate genes, a missense mutation (c. 176C>T was detected in gap junction protein alpha 3 genes (GJA3, which resulted in the substitution of highly conserved proline by leucine at codon 59 (p.P59L. The mutation co-segregated with all patients and was absent in 100 normal Chinese controls. Conclusions: The study identified a missense mutation (c. 176C>T in GJA3 gene associated with autosomal dominant congenital pulverulent cataract in a Chinese family. It gave further evidence of phenotype heterogeneity for P59L mutation in GJA3 associated with congenital cataract.

  12. Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation: indicators of tumor staging and metastasis in adenocarcinomatous sporadic colorectal cancer in Indian population.

    Directory of Open Access Journals (Sweden)

    Rupal Sinha

    Full Text Available Colorectal cancer (CRC development involves underlying modifications at genetic/epigenetic level. This study evaluated the role of Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation together/independently in sporadic CRC in Indian population and correlation with clinicopathological variables of the disease.One hundred and twenty four consecutive surgically resected tissues (62 tumor and equal number of normal adjacent controls of primary sporadic CRC were included and patient details including demographic characteristics, lifestyle/food or drinking habits, clinical and histopathological profiles were recorded. Polymerase chain reaction - Restriction fragment length polymorphism and direct sequencing for Kras gene mutation and Methylation Specific-PCR for RASSF1A, FHIT and MGMT genes was performed.Kras gene mutation at codon 12 & 13 and methylated RASSF1A, FHIT and MGMT gene was observed in 47%, 19%, 47%, 37% and 47% cases, respectively. Alcohol intake and smoking were significantly associated with presence of Kras mutation (codon 12 and MGMT methylation (p-value <0.049. Tumor stage and metastasis correlated with presence of mutant Kras codon 12 (p-values 0.018, 0.044 and methylated RASSF1A (p-values 0.034, 0.044, FHIT (p-values 0.001, 0.047 and MGMT (p-values 0.018, 0.044 genes. Combinatorial effect of gene mutation/methylation was also observed (p-value <0.025. Overall, tumor stage 3, moderately differentiated tumors, presence of lymphatic invasion and absence of metastasis was more frequently observed in tumors with mutated Kras and/or methylated RASSF1A, FHIT and MGMT genes.Synergistic interrelationship between these genes in sporadic CRC may be used as diagnostic/prognostic markers in assessing the overall pathological status of CRC.

  13. Study of Deafness Associated with DFNB59 Gene (pejvakin Mutation in Fars Province

    Directory of Open Access Journals (Sweden)

    S Raeisi

    2012-05-01

    Full Text Available <p>Background and Objectives: Hearing loss is the most frequent sensory disorder affecting 1 in 500 neonates with more than 50% of inherited cases. This trait is a very heterogeneous disorder and happens due to genetic or environmental causes or both. More than 46 genes may be involved in non-syndromic hearing loss. Recently, DFNB59 gene has been shown to cause deafness in some Iranian populations. The aim of this study was to determine the role of DFNB59 gene mutations causing deafness in a group of 130 deaf pupils in Fars province. Methods: This descriptive-laboratory based study investigated the frequency of DFNB59 gene mutations using PCR-SSCP/HA strategy. Results: Two different DFNB59 polymorphism including 874G>A and 793C>G were found in 1 and 9 of 130 patients studied respectively. However, no DFNB59 mutation was identified. Conclusion: The results of this study shows that the association of DFNB59 mutations with deafness in Fars province is very low.p>

  14. p110α Hot Spot Mutations E545K and H1047R Exert Metabolic Reprogramming Independently of p110α Kinase Activity.

    Science.gov (United States)

    Chaudhari, Aditi; Krumlinde, Daniel; Lundqvist, Annika; Akyürek, Levent M; Bandaru, Sashidhar; Skålén, Kristina; Ståhlman, Marcus; Borén, Jan; Wettergren, Yvonne; Ejeskär, Katarina; Rotter Sopasakis, Victoria

    2015-10-01

    The phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) catalytic subunit p110α is the most frequently mutated kinase in human cancer, and the hot spot mutations E542K, E545K, and H1047R are the most common mutations in p110α. Very little is known about the metabolic consequences of the hot spot mutations of p110α in vivo. In this study, we used adenoviral gene transfer in mice to investigate the effects of the E545K and H1047R mutations on hepatic and whole-body glucose metabolism. We show that hepatic expression of these hot spot mutations results in rapid hepatic steatosis, paradoxically accompanied by increased glucose tolerance, and marked glycogen accumulation. In contrast, wild-type p110α expression does not lead to hepatic accumulation of lipids or glycogen despite similar degrees of upregulated glycolysis and expression of lipogenic genes. The reprogrammed metabolism of the E545K and H1047R p110α mutants was surprisingly not dependent on altered p110α lipid kinase activity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Novel heterozygous nonsense mutation of the OPTN gene segregating in a Danish family with ALS

    DEFF Research Database (Denmark)

    Tümer, Zeynep; Bertelsen, Birgitte; Gredal, Ole

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disorder. About 10% of ALS cases are familial (FALS) and the genetic defect is known only in approximately 20%-30% of these cases. The most common genetic cause of ALS is SOD1 (superoxide dismutase 1) mutation. Very recently......, mutations of the optineurin gene (OPTN), which is involved in open-angle glaucoma, were identified in 3 Japanese patients/families with ALS, and subsequently in a few FALS patients of European descent. We found a heterozygous nonsense mutation (c.493C>T, p.Gln165X, exon 6) in the OPTN gene in a Danish...... patient with ALS, and the mutation segregated from his affected father. The p.Gln165X mutation could not be detected in 1070 healthy Danish controls, in 1000 Danish individuals with metabolic phenotypes or in 64 sporadic ALS (SALS) cases. The p.Gln165X mutation described in this study is the first...

  16. The Frequency of MEFV Gene Mutations and Genotypes in Sanliurfa Province, South-Eastern Region of Turkey, after the Syrian Civil War by Using Next Generation Sequencing and Report of a Novel Exon 4 Mutation (I423T).

    Science.gov (United States)

    Gumus, Evren

    2018-05-07

    Familial Mediterranean Fever (FMF) is a genetic disorder characterized by recurrent episodes of fever and abdominal pain. Mutations in the Mediterranean fever (MEFV) gene are localized on the p arm of chromosome 16. Over 333 MEFV sequence variants have been identified so far in FMF patients, which occur mostly in the 2nd and 10th exons of the gene. In this study, 296 unrelated patients with clinical suspicion of FMF, which were admitted during January⁻December 2017, were retrospectively reviewed to identify the frequency of MEFV gene mutations by using next generation sequencing. Eighteen different mutations, 45 different genotypes and a novel exon 4 (I423T) mutation were identified in this study. This mutation is the fourth mutation identified in exon 4.The most frequent mutation was R202Q, followed by M694V, E148Q, M680I, R761H, V726A and R354W. One of the most important aims of this study is to investigate the MEFV mutation type and genotype of migrants coming to Sanliurfa after the civil war of Syria. This study also examines the effect of the condition on the region’s gene pool and the distribution of different types of mutations. Our results indicated that MEFV mutations are highly heterogeneous in our patient population, which is consistent with the findings of other studies in our region. Previously used methods, such as Restriction Fragment Length Polymorphism (RFLP), do not define uncommon or especially novel mutations. Therefore, Next Generation Sequencing (NGS) analysis of the MEFV gene could be useful for finding novel mutations, except for those located on exon 2 and 10.

  17. HFE gene mutations and Wilson's disease in Sardinia.

    Science.gov (United States)

    Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

    2010-03-01

    Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (PHFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

  18. Unmasking of a hemizygous WFS1 gene mutation by a chromosome 4p deletion of 8.3 Mb in a patient with Wolf-Hirschhorn syndrome.

    Science.gov (United States)

    Flipsen-ten Berg, Klara; van Hasselt, Peter M; Eleveld, Marc J; van der Wijst, Suzanne E; Hol, Frans A; de Vroede, Monique A M; Beemer, Frits A; Hochstenbach, P F Ron; Poot, Martin

    2007-11-01

    The Wolf-Hirschhorn syndrome (WHS (MIM 194190)), which is characterized by growth delay, mental retardation, epilepsy, facial dysmorphisms, and midline fusion defects, shows extensive phenotypic variability. Several of the proposed mutational and epigenetic mechanisms in this and other chromosomal deletion syndromes fail to explain the observed phenotypic variability. To explain the complex phenotype of a patient with WHS and features reminiscent of Wolfram syndrome (WFS (MIM 222300)), we performed extensive clinical evaluation and classical and molecular cytogenetic (GTG banding, FISH and array-CGH) and WFS1 gene mutation analyses. We detected an 8.3 Mb terminal deletion and an adjacent 2.6 Mb inverted duplication in the short arm of chromosome 4, which encompasses a gene associated with WFS (WFS1). In addition, a nonsense mutation in exon 8 of the WFS1 gene was found on the structurally normal chromosome 4. The combination of the 4p deletion with the WFS1 point mutation explains the complex phenotype presented by our patient. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletions represents an additional explanation for the phenotypic variability observed in chromosomal deletion disorders.

  19. Mutational robustness of gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

  20. CDKL5 mutations in boys with severe encephalopathy and early-onset intractable epilepsy.

    Science.gov (United States)

    Elia, M; Falco, M; Ferri, R; Spalletta, A; Bottitta, M; Calabrese, G; Carotenuto, M; Musumeci, S A; Lo Giudice, M; Fichera, M

    2008-09-23

    To search for CDKL5 gene mutations in boys presenting with severe early-onset encephalopathy and intractable epilepsy, a clinical picture very similar to that already described in girls with CDKL5 mutations. Eight boys (age range 3-16 years, mean age 8.5 years, SD 4.38) with severe or profound mental retardation and early-onset intractable seizures were selected for CDKL5 gene mutation screening by denaturing high-performance liquid chromatography analysis. We found three unrelated boys carrying three different missense mutations of the CDKL5 gene: c.872G>A (p.C291Y), c.863C>T (p.T288I), and c.533G>C (p.R178P). They presented early-onset, polymorphous, and drug-resistant seizures, mostly myoclonic and tonic or spasms. EEG showed epileptiform abnormalities which were multifocal during wakefulness, and pseudoperiodic bisynchronous during sleep. This study describes three boys carrying CDKL5 missense mutations and their detailed clinical and EEG data, and indicates that CDKL5 gene mutations may represent a cause of severe or profound mental retardation and early-onset intractable seizures, also in boys. Screening for CDKL5 mutations is strongly recommended in individuals with these clinical features.

  1. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  2. Cystic fibrosis transmembrane conductance regulator gene mutations: do they play a role in the aetiology of allergic bronchopulmonary aspergillosis?

    Science.gov (United States)

    Eaton, T E; Weiner Miller, P; Garrett, J E; Cutting, G R

    2002-05-01

    Previous work suggests that cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations may be implicated in the aetiology of allergic bronchopulmonary aspergilosis (ABPA). To compare the frequency of CF gene mutations in asthmatics with ABPA of varying severity with asthmatics who were skin prick test (SPT)-positive to Aspergillus fumigatus (Af) without evidence of ABPA and asthmatics SPT-negative to Af. Thirty-one Caucasian patients with ABPA were identified, together with asthmatics SPT positive to Af without evidence of ABPA (n = 23) and SPT negative to Af (n = 28). Genomic DNA was tested for 16 CF mutations accounting for approximately 85% of CF alleles in Caucasian New Zealanders. Four (12.9%) ABPA patients were found to be carriers of a CF mutation (DeltaF508 n = 3, R117H n = 1), one (4.3%) asthmatic SPT positive to Af without ABPA (DeltaF508), and one (3.6%) asthmatic SPT negative to Af (R117H). All patients with a CF mutation had normal sweat chloride (< 40 mM). There was no significant difference between the frequency of CF mutations in the ABPA patients and asthmatics without ABPA. However, the frequency of CF mutations in the ABPA patients was significantly different (P = 0.0125) to the expected carrier rate in the general population. These results lend further support to a possible link between CF mutations and ABPA.

  3. The combination of heteroduplex analysis and protein truncation test for exact detection of the APC gene mutations

    International Nuclear Information System (INIS)

    Tomka, M.; Kirchhoff, T.; Stefurkova, V.; Zajac, V.; Kulcsar, L.

    1998-01-01

    Familial adenomatous polyposis (FAP) is usually associated with mutation in the adenomatous polyposis coli (APC) gene. To examine the occurrence of these mutations in the number of FAP suspected families from the whole Slovakia effectively, we have applied heteroduplex analysis (HDA) and protein truncation test (PTT) for the analyses of 2-5 base pair deletions and point mutations of the APC gene. In the analyzed exon 15 of the APC gene determined by the primers 15Efor-15Grev for HDA and 15ET7-15J3 for PTT more than 70% of mutations should be deletions [3, 12], which are detectable by HDA. In our collection of 5 FAP families mutations in the APC gene were found in families 10, 27 and 41 using HDA. By PTT test the formation of truncated APC protein in FAP families 2, 10, 16 and 27 were revealed. The necessity of combination of at least HDA and PTT techniques for exact detection of APC mutations in analyzed APC region is discussed. (authors)

  4. Recurrent mutations in the CDKL5 gene: genotype-phenotype relationships.

    Science.gov (United States)

    Bahi-Buisson, Nadia; Villeneuve, Nathalie; Caietta, Emilie; Jacquette, Aurélia; Maurey, Helene; Matthijs, Gert; Van Esch, Hilde; Delahaye, Andrée; Moncla, Anne; Milh, Mathieu; Zufferey, Flore; Diebold, Bertrand; Bienvenu, Thierry

    2012-07-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been described in epileptic encephalopathies in females with infantile spasms with features that overlap with Rett syndrome. With more than 80 reported patients, the phenotype of CDKL5-related encephalopathy is well-defined. The main features consist of seizures starting before 6 months of age, severe intellectual disability with absent speech and hand stereotypies and deceleration of head growth, which resembles Rett syndrome. However, some clinical discrepancies suggested the influence of genetics and/or environmental factors. No genotype-phenotype correlation has been defined and thus there is a need to examine individual mutations. In this study, we analyzed eight recurrent CDKL5 mutations to test whether the clinical phenotype of patients with the same mutation is similar and whether patients with specific CDKL5 mutations have a milder phenotype than those with other CDKL5 mutations. Patients bearing missense mutations in the ATP binding site such as the p.Ala40Val mutation typically walked unaided, had normocephaly, better hand use ability, and less frequent refractory epilepsy when compared to girls with other CDKL5 mutations. In contrast, patients with mutations in the kinase domain (such as p.Arg59X, p.Arg134X, p.Arg178Trp/Pro/Gln, or c.145 + 2T > C) and frameshift mutations in the C-terminal region (such as c.2635_2636delCT) had a more severe phenotype with infantile spasms, refractory epileptic encephalopathy, absolute microcephaly, and inability to walk. It is important for clinicians to have this information when such patients are diagnosed. Copyright © 2012 Wiley Periodicals, Inc.

  5. Aarskog-Scott syndrome: clinical update and report of nine novel mutations of the FGD1 gene.

    Science.gov (United States)

    Orrico, A; Galli, L; Faivre, L; Clayton-Smith, J; Azzarello-Burri, S M; Hertz, J M; Jacquemont, S; Taurisano, R; Arroyo Carrera, I; Tarantino, E; Devriendt, K; Melis, D; Thelle, T; Meinhardt, U; Sorrentino, V

    2010-02-01

    Mutations in the FGD1 gene have been shown to cause Aarskog-Scott syndrome (AAS), or facio-digito-genital dysplasia (OMIM#305400), an X-linked disorder characterized by distinctive genital and skeletal developmental abnormalities with a broad spectrum of clinical phenotypes. To date, 20 distinct mutations have been reported, but little phenotypic data are available on patients with molecularly confirmed AAS. In the present study, we report on our experience of screening for mutations in the FGD1 gene in a cohort of 60 European patients with a clinically suspected diagnosis of AAS. We identified nine novel mutations in 11 patients (detection rate of 18.33%), including three missense mutations (p.R402Q; p.S558W; p.K748E), four truncating mutations (p.Y530X; p.R656X; c.806delC; c.1620delC), one in-frame deletion (c.2020_2022delGAG) and the first reported splice site mutation (c.1935+3A>C). A recurrent mutation (p.R656X) was detected in three independent families. We did not find any evidence for phenotype-genotype correlations between type and position of mutations and clinical features. In addition to the well-established phenotypic features of AAS, other clinical features are also reported and discussed. Copyright 2010 Wiley-Liss, Inc.

  6. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

    Science.gov (United States)

    Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

    2014-11-18

    Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

  7. Mutation update for the PORCN gene

    DEFF Research Database (Denmark)

    Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo

    2011-01-01

    Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum......, the pentalogy of Cantrell and Limb-Body Wall Complex. Here we present a review of the published mutations in the PORCN gene to date and report on seven new mutations together with the corresponding clinical data. Based on the review we have created a Web-based locus-specific database that lists all identified...... variants and allows the inclusion of future reports. The database is based on the Leiden Open (source) Variation Database (LOVD) software, and is accessible online at http://www.lovd.nl/porcn. At present, the database contains 106 variants, representing 68 different mutations, scattered along the whole...

  8. Spectrum of ABCA4 (ABCR) gene mutations in Spanish patients with autosomal recessive macular dystrophies.

    Science.gov (United States)

    Paloma, E; Martínez-Mir, A; Vilageliu, L; Gonzàlez-Duarte, R; Balcells, S

    2001-06-01

    The ABCA4 gene has been involved in several forms of inherited macular dystrophy. In order to further characterize the complex genotype-phenotype relationships involving this gene, we have performed a mutation analysis of ABCA4 in 14 Spanish patients comprising eight STGD (Stargardt), four FFM (fundus flavimaculatus), and two CRD (Cone-rod dystrophy) patients. SSCP (single-strand conformation polymorphism) analysis and DNA sequencing of the coding and 5' upstream regions of this gene allowed the identification of 16 putatively pathogenic alterations, nine of which are novel. Most of these were missense changes, and no patient was found to carry two null alleles. Overall, the new data agree with a working model relating the different pathogenic phenotypes to the severity of the mutations. When considering the information presented here together with that of previous reports, a picture of the geographic distribution of three particular mutations emerges. The R212C change has been found in French, Italian, Dutch, German, and Spanish but not in British patients. In the Spanish collection, R212C was found in a CRD patient, indicating that it may be a rather severe change. In contrast, c.2588G>C, a very common mild allele in the Dutch population, is rarely found in Southern Europe. Interestingly, the c.2588G>C mutation has been found in a double mutant allele together with the missense R1055W. Finally, the newly described L1940P was found in two unrelated Spanish patients, and may be a moderate to severe allele. Copyright 2001 Wiley-Liss, Inc.

  9. Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

    Science.gov (United States)

    Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

    2006-01-01

    To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

  10. MUTATIONS IN THE ARX GENE: CLINICAL, ELECTROENCEPHALOGRAPHIC AND NEUROIMAGING FEATURES IN 3 PATIENTS

    Directory of Open Access Journals (Sweden)

    I. V. Ivanova

    2017-01-01

    Full Text Available The Aristaless-related homeobox (ARX gene is a member of the paired-type homeodomain transcription factor family with critical roles in embryonic development, particularly in the developing brain. Mutations in ARX gene demonstrate striking intra- and interfamilial pleiotropy together with genetic heterogeneity and lead to a broad spectrum of diseases. They give rise to 4 key phenotypic features: a different types of brain malformation, abnormal genitalia, epilepsy and intellectual disability. Authors present 3 clinical cases: a girl with duplication on the short arm of X-chromosome (Xp11.22-p22.33, which include genes ARX and CDKL5; a girl and a boy with a missense mutation in ARX gene that have not been previously described (chrX:25031522C>A, causes the substitution of an amino acid in the 197 protein position (p.Gly197Val, NM_139058.2. All patients suffer from severe epilepsy, that is refractory to antiepileptic drugs, and all of them have different degrees of psychomotor delay. The patients with missense mutation also have movement disorders: stereotypic movements in the girl and choreo athetosis and dystonia in the boy. Electroencephalographic abnormalities have been identified in all patients, and there were not significant abnormalities on magnetic resonance imaging in all cases. The described cases broaden the clinical spectrum of mutations in ARX gene.

  11. Mutation and Methylation Analysis of the Chromodomain-Helicase-DNA Binding 5 Gene in Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Kylie L. Gorringe

    2008-11-01

    Full Text Available Chromodomain, helicase, DNA binding 5 (CHD5 is a member of a subclass of the chromatin remodeling Swi/Snf proteins and has recently been proposed as a tumor suppressor in a diverse range of human cancers. We analyzed all 41 coding exons of CHD5 for somatic mutations in 123 primary ovarian cancers as well as 60 primary breast cancers using high-resolution melt analysis. We also examined methylation of the CHD5 promoter in 48 ovarian cancer samples by methylation-specific single-stranded conformation polymorphism and bisulfite sequencing. In contrast to previous studies, no mutations were identified in the breast cancers, but somatic heterozygous missense mutations were identified in 3 of 123 ovarian cancers. We identified promoter methylation in 3 of 45 samples with normal CHD5 and in 2 of 3 samples with CHD5 mutation, suggesting these tumors may have biallelic inactivation of CHD5. Hemizygous copy number loss at CHD5 occurred in 6 of 85 samples as assessed by single nucleotide polymorphism array. Tumors with CHD5 mutation or methylation were more likely to have mutation of KRAS or BRAF (P = .04. The aggregate frequency of CHD5 haploinsufficiency or inactivation is 16.2% in ovarian cancer. Thus, CHD5 may play a role as a tumor suppressor gene in ovarian cancer; however, it is likely that there is another target of the frequent copy number neutral loss of heterozygosity observed at 1p36.

  12. Glucokinase gene mutations (MODY 2) in Asian Indians.

    Science.gov (United States)

    Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

    2014-03-01

    Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

  13. The prognostic impact of mutations in spliceosomal genes for myelodysplastic syndrome patients without ring sideroblasts

    International Nuclear Information System (INIS)

    Kang, Min-Gu; Kim, Hye-Ran; Seo, Bo-Young; Lee, Jun Hyung; Choi, Seok-Yong; Kim, Soo-Hyun; Shin, Jong-Hee; Suh, Soon-Pal; Ahn, Jae-Sook; Shin, Myung-Geun

    2015-01-01

    Mutations in genes that are part of the splicing machinery for myelodysplastic syndromes (MDS), including MDS without ring sideroblasts (RS), have been widely investigated. The effects of these mutations on clinical outcomes have been diverse and contrasting. We examined a cohort of 129 de novo MDS patients, who did not harbor RS, for mutations affecting three spliceosomal genes (SF3B1, U2AF1, and SRSF2). The mutation rates of SF3B1, U2AF1, and SRSF2 were 7.0 %, 7.8 %, and 10.1 %, respectively. Compared with previously reported results, these rates were relatively infrequent. The SRSF2 mutation strongly correlated with old age (P < 0.001), while the mutation status of SF3B1 did not affect overall survival (OS), progression-free survival (PFS), or acute myeloid leukemia (AML) transformation. In contrast, MDS patients with mutations in U2AF1 or SRSF2 exhibited inferior PFS. The U2AF1 mutation was associated with inferior OS in low-risk MDS patients (P = 0.035). The SRSF2 mutation was somewhat associated with AML transformation (P = 0.083). Our findings suggest that the frequencies of the SF3B1, U2AF1, and SRSF2 splicing gene mutations in MDS without RS were relatively low. We also demonstrated that the U2AF1 and SRSF2 mutations were associated with an unfavorable prognostic impact in MDS patients without RS. The online version of this article (doi:10.1186/s12885-015-1493-5) contains supplementary material, which is available to authorized users

  14. The Frequency of MEFV Gene Mutations and Genotypes in Sanliurfa Province, South-Eastern Region of Turkey, after the Syrian Civil War by Using Next Generation Sequencing and Report of a Novel Exon 4 Mutation (I423T

    Directory of Open Access Journals (Sweden)

    Evren Gumus

    2018-05-01

    Full Text Available Background: Familial Mediterranean Fever (FMF is a genetic disorder characterized by recurrent episodes of fever and abdominal pain. Mutations in the Mediterranean fever (MEFV gene are localized on the p arm of chromosome 16. Over 333 MEFV sequence variants have been identified so far in FMF patients, which occur mostly in the 2nd and 10th exons of the gene. Methods: In this study, 296 unrelated patients with clinical suspicion of FMF, which were admitted during January–December 2017, were retrospectively reviewed to identify the frequency of MEFV gene mutations by using next generation sequencing. Results: Eighteen different mutations, 45 different genotypes and a novel exon 4 (I423T mutation were identified in this study. This mutation is the fourth mutation identified in exon 4.The most frequent mutation was R202Q, followed by M694V, E148Q, M680I, R761H, V726A and R354W. Conclusions: One of the most important aims of this study is to investigate the MEFV mutation type and genotype of migrants coming to Sanliurfa after the civil war of Syria. This study also examines the effect of the condition on the region’s gene pool and the distribution of different types of mutations. Our results indicated that MEFV mutations are highly heterogeneous in our patient population, which is consistent with the findings of other studies in our region. Previously used methods, such as Restriction Fragment Length Polymorphism (RFLP, do not define uncommon or especially novel mutations. Therefore, Next Generation Sequencing (NGS analysis of the MEFV gene could be useful for finding novel mutations, except for those located on exon 2 and 10.

  15. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  16. [FANCA gene mutation analysis in Fanconi anemia patients].

    Science.gov (United States)

    Chen, Fei; Peng, Guang-Jie; Zhang, Kejian; Hu, Qun; Zhang, Liu-Qing; Liu, Ai-Guo

    2005-10-01

    To screen the FANCA gene mutation and explore the FANCA protein function in Fanconi anemia (FA) patients. FANCA protein expression and its interaction with FANCF were analyzed using Western blot and immunoprecipitation in 3 cases of FA-A. Genomic DNA was used for MLPA analysis followed by sequencing. FANCA protein was undetectable and FANCA and FANCF protein interaction was impaired in these 3 cases of FA-A. Each case of FA-A contained biallelic pathogenic mutations in FANCA gene. No functional FANCA protein was found in these 3 cases of FA-A, and intragenic deletion, frame shift and splice site mutation were the major pathogenic mutations found in FANCA gene.

  17. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  18. Mutational characterization of the P3H1/CRTAP/CypB complex in recessive osteogenesis imperfecta.

    Science.gov (United States)

    Barbirato, C; Trancozo, M; Almeida, M G; Almeida, L S; Santos, T O; Duarte, J C G; Rebouças, M R G O; Sipolatti, V; Nunes, V R R; Paula, F

    2015-12-03

    Osteogenesis imperfecta (OI) is a genetic disease characterized by bone deformities and fractures. Most cases are caused by autosomal dominant mutations in the type I collagen genes COL1A1 and COL1A2; however, an increasing number of recessive mutations in other genes have been reported. The LEPRE1, CRTAP, and PPIB genes encode proteins that form the P3H1/CRTAP/CypB complex, which is responsible for posttranslational modifications of type I collagen. In general, mutations in these genes lead to severe and lethal phenotypes of recessive OI. Here, we describe sixteen genetic variations detected in LEPRE1, CRTAP, and PPIB from 25 Brazilian patients with OI. Samples were screened for mutations on single-strand conformation polymorphism gels and variants were determined by automated sequencing. Seven variants were detected in patients but were absent in control samples. LEPRE1 contained the highest number of variants, including the previously described West African allele (c.1080+1G>T) found in one patient with severe OI as well as a previously undescribed p.Trp675Leu change that is predicted to be disease causing. In CRTAP, one patient carried the c.558A>G homozygous mutation, predicted as disease causing through alteration of a splice site. Genetic variations detected in the PPIB gene are probably not pathogenic due to their localization or because of their synonymous effect. This study enhances our knowledge about the mutational pattern of the LEPRE1, CRTAP, and PPIB genes. In addition, the results strengthen the proposition that LEPRE1 should be the first gene analyzed in mutation detection studies in patients with recessive OI.

  19. Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.

    Directory of Open Access Journals (Sweden)

    Quan Li

    Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.

  20. Mutated Genes in Schizophrenia Map to Brain Networks

    Science.gov (United States)

    ... Matters NIH Research Matters August 12, 2013 Mutated Genes in Schizophrenia Map to Brain Networks Schizophrenia networks ... have a high number of spontaneous mutations in genes that form a network in the front region ...

  1. Two novel mutations in the EYS gene are possible major causes of autosomal recessive retinitis pigmentosa in the Japanese population.

    Directory of Open Access Journals (Sweden)

    Katsuhiro Hosono

    Full Text Available Retinitis pigmentosa (RP is a highly heterogeneous genetic disease including autosomal recessive (ar, autosomal dominant (ad, and X-linked inheritance. Recently, arRP has been associated with mutations in EYS (Eyes shut homolog, which is a major causative gene for this disease. This study was conducted to determine the spectrum and frequency of EYS mutations in 100 Japanese arRP patients. To determine the prevalence of EYS mutations, all EYS exons were screened for mutations by polymerase chain reaction amplification, and sequence analysis was performed. We detected 67 sequence alterations in EYS, of which 21 were novel. Of these, 7 were very likely pathogenic mutations, 6 were possible pathogenic mutations, and 54 were predicted non-pathogenic sequence alterations. The minimum observed prevalence of distinct EYS mutations in our study was 18% (18/100, comprising 9 patients with 2 very likely pathogenic mutations and the remaining 9 with only one such mutation. Among these mutations, 2 novel truncating mutations, c.4957_4958insA (p.S1653KfsX2 and c.8868C>A (p.Y2956X, were identified in 16 patients and accounted for 57.1% (20/35 alleles of the mutated alleles. Although these 2 truncating mutations were not detected in Japanese patients with adRP or Leber's congenital amaurosis, we detected them in Korean arRP patients. Similar to Japanese arRP results, the c.4957_4958insA mutation was more frequently detected than the c.8868C>A mutation. The 18% estimated prevalence of very likely pathogenic mutations in our study suggests a major involvement of EYS in the pathogenesis of arRP in the Japanese population. Mutation spectrum of EYS in 100 Japanese patients, including 13 distinct very likely and possible pathogenic mutations, was largely different from the previously reported spectrum in patients from non-Asian populations. Screening for c.4957_4958insA and c.8868C>A mutations in the EYS gene may therefore be very effective for the genetic testing

  2. 657del5 mutation of the NBS1 gene in myelodysplastic syndrome

    Directory of Open Access Journals (Sweden)

    Bunjevacki Vera

    2014-01-01

    Full Text Available Myelodysplastic syndromes (MDS are clonal hematologic stem cell disorders with an as yet unknown molecular pathology. Genetic instability has been proposed as a cause of MDS. Mutations in the NBS1 gene, whose product nibrin (p95 is involved in DNA damage repair and cell-cycle control, might be associated with an elevated predisposition to the development of MDS. The aim of the study was to examine truncating 5 bp deletion (657del5, the most frequent NBS1 gene mutation in Slavic populations, in MDS patients. Among 71 MDS patients, we found one case that was heterozygous for the NBS1 657del5 mutation. To the best of our knowledge, this is the first report of a NBS1 mutation in MDS. [Projekat Ministarstva nauke Republike Srbije, br. 175091

  3. A novel missense mutation in the CLCN7 gene linked to benign autosomal dominant osteopetrosis: a case series

    Directory of Open Access Journals (Sweden)

    Rashid Ban Mousa

    2013-01-01

    Full Text Available Abstract Introduction Osteopetrosis is a rare inherited genetic disease characterized by sclerosis of the skeleton. The absence or malfunction of osteoclasts is found to be strongly associated with the disease evolution. Currently, four clinically distinct forms of the disease have been recognized: the infantile autosomal recessive osteopetrosis, the malignant and the intermediate forms, and autosomal dominant osteopetrosis, type I and type II forms. The autosomal recessive types are the most severe forms with symptoms in very early childhood, whereas the autosomal dominant classes exhibit a heterogeneous trait with milder symptoms, often at later childhood or adulthood. Case presentation Case 1 is the 12-year-old daughter (index patient of an Iraqi-Kurdish family who, at the age of eight years, was diagnosed clinically to have mild autosomal dominant osteopetrosis. Presently, at 12-years old, she has severe complications due to the disease progression. In addition, the same family previously experienced the death of a female child in her late childhood. The deceased child had been misdiagnosed, at that time, with thalassemia major. In this report, we extended our investigation to identify the type of the inheritance patterns of osteopetrosis using molecular techniques, because consanguineous marriages exist within the family history. We have detected one heterozygous mutation in exon 15 of the Chloride Channel 7 gene in the index patient (Case 1, whereas other mutations were not detected in the associated genes TCIRG1, OSTM1, RANK, and RANKL. The missense mutation (CGG>TGG located in exon 15 (c.1225C>T of the Chloride Channel 7 gene changed the amino acid position 409 from arginine to tryptophan (p.R409W, c.1225C>T. Case 2 is the 16-year-old son (brother of the index patient of the same family who was diagnosed clinically with mild autosomal dominant osteopetrosis. We have identified the same heterozygous mutation in exon 15 of the Chloride

  4. A novel missense mutation in the CLCN7 gene linked to benign autosomal dominant osteopetrosis: a case series.

    Science.gov (United States)

    Rashid, Ban Mousa; Rashid, Nawshirwan Gafoor; Schulz, Ansgar; Lahr, Georgia; Nore, Beston Faiek

    2013-01-09

    Osteopetrosis is a rare inherited genetic disease characterized by sclerosis of the skeleton. The absence or malfunction of osteoclasts is found to be strongly associated with the disease evolution. Currently, four clinically distinct forms of the disease have been recognized: the infantile autosomal recessive osteopetrosis, the malignant and the intermediate forms, and autosomal dominant osteopetrosis, type I and type II forms. The autosomal recessive types are the most severe forms with symptoms in very early childhood, whereas the autosomal dominant classes exhibit a heterogeneous trait with milder symptoms, often at later childhood or adulthood. Case 1 is the 12-year-old daughter (index patient) of an Iraqi-Kurdish family who, at the age of eight years, was diagnosed clinically to have mild autosomal dominant osteopetrosis. Presently, at 12-years old, she has severe complications due to the disease progression. In addition, the same family previously experienced the death of a female child in her late childhood. The deceased child had been misdiagnosed, at that time, with thalassemia major. In this report, we extended our investigation to identify the type of the inheritance patterns of osteopetrosis using molecular techniques, because consanguineous marriages exist within the family history. We have detected one heterozygous mutation in exon 15 of the Chloride Channel 7 gene in the index patient (Case 1), whereas other mutations were not detected in the associated genes TCIRG1, OSTM1, RANK, and RANKL. The missense mutation (CGG>TGG) located in exon 15 (c.1225C>T) of the Chloride Channel 7 gene changed the amino acid position 409 from arginine to tryptophan (p.R409W, c.1225C>T).Case 2 is the 16-year-old son (brother of the index patient) of the same family who was diagnosed clinically with mild autosomal dominant osteopetrosis. We have identified the same heterozygous mutation in exon 15 of the Chloride channel 7 gene in this patient (Case 2). The missense

  5. Longevity Genes Revealed by Integrative Analysis of Isoform-Specific daf-16/FoxO Mutants of Caenorhabditis elegans.

    Science.gov (United States)

    Chen, Albert Tzong-Yang; Guo, Chunfang; Itani, Omar A; Budaitis, Breane G; Williams, Travis W; Hopkins, Christopher E; McEachin, Richard C; Pande, Manjusha; Grant, Ana R; Yoshina, Sawako; Mitani, Shohei; Hu, Patrick J

    2015-10-01

    FoxO transcription factors promote longevity across taxa. How they do so is poorly understood. In the nematode Caenorhabditis elegans, the A- and F-isoforms of the FoxO transcription factor DAF-16 extend life span in the context of reduced DAF-2 insulin-like growth factor receptor (IGFR) signaling. To elucidate the mechanistic basis for DAF-16/FoxO-dependent life span extension, we performed an integrative analysis of isoform-specific daf-16/FoxO mutants. In contrast to previous studies suggesting that DAF-16F plays a more prominent role in life span control than DAF-16A, isoform-specific daf-16/FoxO mutant phenotypes and whole transcriptome profiling revealed a predominant role for DAF-16A over DAF-16F in life span control, stress resistance, and target gene regulation. Integration of these datasets enabled the prioritization of a subset of 92 DAF-16/FoxO target genes for functional interrogation. Among 29 genes tested, two DAF-16A-specific target genes significantly influenced longevity. A loss-of-function mutation in the conserved gene gst-20, which is induced by DAF-16A, reduced life span extension in the context of daf-2/IGFR RNAi without influencing longevity in animals subjected to control RNAi. Therefore, gst-20 promotes DAF-16/FoxO-dependent longevity. Conversely, a loss-of-function mutation in srr-4, a gene encoding a seven-transmembrane-domain receptor family member that is repressed by DAF-16A, extended life span in control animals, indicating that DAF-16/FoxO may extend life span at least in part by reducing srr-4 expression. Our discovery of new longevity genes underscores the efficacy of our integrative strategy while providing a general framework for identifying specific downstream gene regulatory events that contribute substantially to transcription factor functions. As FoxO transcription factors have conserved functions in promoting longevity and may be dysregulated in aging-related diseases, these findings promise to illuminate fundamental

  6. Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines

    DEFF Research Database (Denmark)

    Liu, Ying; Bodmer, Walter F

    2006-01-01

    A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...

  7. Digenic mutations involving both the BSND and GJB2 genes detected in Bartter syndrome type IV.

    Science.gov (United States)

    Wang, Hong-Han; Feng, Yong; Li, Hai-Bo; Wu, Hong; Mei, Ling-Yun; Wang, Xing-Wei; Jiang, Lu; He, Chu-Feng

    2017-01-01

    Bartter syndrome type IV, characterized by salt-losing nephropathies and sensorineural deafness, is caused by mutations of BSND or simultaneous mutations of both CLCNKA and CLCNKB. GJB2 is the primary causative gene for non-syndromic sensorineural deafness and associated with several syndromic sensorineural deafness. Owing to the rarity of Bartter syndrome, only a few mutations have been reported in the abovementioned causative genes. To investigate the underlying mutations in a Chinese patient with Bartter syndrome type IV, genetic analysis of BSND, CLCNKA, CLCNKB and GJB2 were performed by polymerase chain reaction and direct sequencing. Finally, double homozygous mutations c.22C > T (p.Arg8Trp) and c.127G > A (Val43Ile) were detected in exon 1 of BSND. Intriguingly, compound heterozygous mutations c.235delC (p.Leu79CysfsX3) and c.109G > A (p.Val37Ile) were also revealed in exon 2 of GJB2 in the same patient. No pathogenic mutations were found in CLCNKA and CLCNKB. Our results indicated that the homozygous mutation c.22C > T was the key genetic reason for the proband, and a digenic effect of BSND and GJB2 might contributed to sensorineural deafness. To our knowledge, it was the first report showing that the GJB2 gene mutations were detected in Bartter syndrome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Correlation of RET somatic mutations with clinicopathological features in sporadic medullary thyroid carcinomas

    Science.gov (United States)

    Moura, M M; Cavaco, B M; Pinto, A E; Domingues, R; Santos, J R; Cid, M O; Bugalho, M J; Leite, V

    2009-01-01

    Screening of REarranged during Transfection (RET) gene mutations has been carried out in different series of sporadic medullary thyroid carcinomas (MTC). RET-positive tumours seem to be associated to a worse clinical outcome. However, the correlation between the type of RET mutation and the patients' clinicopathological data has not been evaluated yet. We analysed RET exons 5, 8, 10–16 in fifty-one sporadic MTC, and found somatic mutations in thirty-three (64.7%) tumours. Among the RET-positive cases, exon 16 was the most frequently affected (60.6%). Two novel somatic mutations (Cys630Gly, c.1881del18) were identified. MTC patients were divided into three groups: group 1, with mutations in RET exons 15 and 16; group 2, with other RET mutations; group 3, having no RET mutations. Group 1 had higher prevalence (P=0.0051) and number of lymph node metastases (P=0.0017), and presented more often multifocal tumours (P=0.037) and persistent disease at last control (P=0.0242) than group 2. Detectable serum calcitonin levels at last screening (P=0.0119) and stage IV disease (P=0.0145) were more frequent in group 1, than in the other groups. Our results suggest that, among the sporadic MTC, cases with RET mutations in exons 15 and 16 are associated with the worst prognosis. Cases with other RET mutations have the most indolent course, and those with no RET mutations have an intermediate risk. PMID:19401695

  9. Identification of a breast cancer family double heterozygote for RAD51C and BRCA2 gene mutations

    DEFF Research Database (Denmark)

    Ahlborn, Lise B; Steffensen, Ane Y; Jønson, Lars

    2015-01-01

    for mutations in the RAD51C and BRCA2 genes. The RAD51C missense mutation p.Arg258His has previously been identified in a homozygous state in a patient with Fanconi anemia. This mutation is known to affect the DNA repair function of the RAD51C protein. The BRCA2 p.Leu3216Leu synonymous mutation has not been...

  10. Generation of an isogenic, gene-corrected iPSC line from a symptomatic 57-year-old female patient with frontotemporal dementia caused by a P301L mutation in the microtubule associated protein tau (MAPT) gene

    DEFF Research Database (Denmark)

    Nimsanor, Natakarn; Kitiyanant, Narisorn; Poulsen, Ulla

    2016-01-01

    pluripotent stem cells (iPSCs) hold great promise to model FTDP-17 as such cells can be differentiated in vitro to the required cell type. Furthermore, gene-editing approaches allow generating isogenic gene-corrected controls that can be used as a very specific control. Here, we report the generation......Frontotemporal dementia with parkinsonism linked to chromosome 17q21.2 (FTDP-17) is an autosomal-dominant neurodegenerative disorder. Mutations in the MAPT (microtubule-associated protein tau)-gene can cause FTDP-17, but the underlying pathomechanisms of the disease are still unknown. Induced...... of genetically corrected iPSCs from a 57-year-old female FTD-17 patient carrying an P301L mutation in the MAPT-gene....

  11. High CpG island methylation of p16 gene and loss of p16 protein ...

    Indian Academy of Sciences (India)

    SI-JU GAO

    abnormality or family history of congenital heart disease, as well as the exclusion of ... Germany) according to the manufacture's protocol. A total of. 45 μL of DNA was ... islands and the primer sites are illustrated in figure 1. Detection of p16 ...

  12. Diverse growth hormone receptor gene mutations in Laron syndrome.

    Science.gov (United States)

    Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

    1993-01-01

    To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

  13. Promoter hypermethylation of the DNA repair gene O(6)-methylguanine-DNA methyltransferase is associated with the presence of G:C to A:T transition mutations in p53 in human colorectal tumorigenesis.

    Science.gov (United States)

    Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G

    2001-06-15

    Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.

  14. Novel compound heterozygous mutations in MYO7A gene associated with autosomal recessive sensorineural hearing loss in a Chinese family.

    Science.gov (United States)

    Ma, Yalin; Xiao, Yun; Zhang, Fengguo; Han, Yuechen; Li, Jianfeng; Xu, Lei; Bai, Xiaohui; Wang, Haibo

    2016-04-01

    Mutations in MYO7A gene have been reported to be associated with Usher Syndrome type 1B (USH1B) and nonsyndromic hearing loss (DFNB2, DFNA11). Most mutations in MYO7A gene caused USH1B, whereas only a few reported mutations led to DFNB2 and DFNA11. The current study was designed to investigate the mutations among a Chinese family with autosomal recessive hearing loss. In this study, we present the clinical, genetic and molecular characteristics of a Chinese family. Targeted capture of 127 known deafness genes and next-generation sequencing were employed to study the genetic causes of two siblings in the Chinese family. Sanger sequencing was employed to examine those variant mutations in the members of this family and other ethnicity-matched controls. We identified the novel compound heterozygous mutant alleles of MYO7A gene: a novel missense mutation c.3671C>A (p.A1224D) and a reported insert mutation c.390_391insC (p.P131PfsX9). Variants were further confirmed by Sanger sequencing. These two compound heterozygous variants were co-segregated with autosomal recessive hearing loss phenotype. The gene mutation analysis and protein sequence alignment further supported that the novel compound heterozygous mutations were pathogenic. The novel compound heterozygous mutations (c.3671C>A and c.390_391insC) in MYO7A gene identified in this study were responsible for the autosomal recessive sensorineural hearing loss of this Chinese family. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation in chronic lymphocytic leukemia.

    Science.gov (United States)

    Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R

    2002-08-15

    Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.

  16. Unexpected identification of a recurrent mutation in the DLX3 gene causing amelogenesis imperfecta.

    Science.gov (United States)

    Kim, Y-J; Seymen, F; Koruyucu, M; Kasimoglu, Y; Gencay, K; Shin, T J; Hyun, H-K; Lee, Z H; Kim, J-W

    2016-05-01

    To identify the molecular genetic aetiology of a family with autosomal dominant amelogenesis imperfecta (AI). DNA samples were collected from a six-generation family, and the candidate gene approach was used to screen for the enamelin (ENAM) gene. Whole-exome sequencing and linkage analysis with SNP array data identified linked regions, and candidate gene screening was performed. Mutational analysis revealed a mutation (c.561_562delCT and p.Tyr188Glnfs*13) in the DLX3 gene. After finding a recurrent DLX3 mutation, the clinical phenotype of the family members was re-examined. The proband's mother had pulp elongation in the third molars. The proband had not hair phenotype, but her cousin had curly hair at birth. In this study, we identified a recurrent 2-bp deletional DLX3 mutation in a new family. The clinical phenotype was the mildest one associated with the DLX3 mutations. These results will advance the understanding of the functional role of DLX3 in developmental processes. © 2016 The Authors. Oral Diseases Published by John Wiley & Sons Ltd.

  17. Identification of a Gypsy SHOX mutation (p.A170P) in Léri-Weill dyschondrosteosis and Langer mesomelic dysplasia.

    Science.gov (United States)

    Barca-Tierno, Verónica; Aza-Carmona, Miriam; Barroso, Eva; Heine-Suner, Damia; Azmanov, Dimitar; Rosell, Jordi; Ezquieta, Begoña; Montané, Lucia Sentchordi; Vendrell, Teresa; Cruz, Jaime; Santos, Fernando; Rodríguez, José Ignacio; Pozo, Jesús; Argente, Jesús; Kalaydjieva, Luba; Gracía, Ricardo; Campos-Barros, Angel; Benito-Sanz, Sara; Heath, Karen E

    2011-12-01

    We report the clinical and molecular characteristics of 12 Spanish families with multiple members affected with Léri-Weill dyschondrosteosis (LWD) or Langer mesomelic dysplasia (LMD), who present the SHOX (short stature homeobox gene) mutation p.A170P (c.508G>C) in heterozygosity or homozygosity, respectively. In all studied families, the A170P mutation co-segregated with the fully penetrant phenotype of mesomelic limb shortening and Madelung deformity. A shared haplotype around SHOX was observed by microsatellite analysis, confirming the presence of a common ancestor, probably of Gypsy origin, as 11 of the families were of this ethnic group. Mutation screening in 359 Eastern-European Gypsies failed to identify any carriers. For the first time, we have shown SHOX expression in the human growth plate of a 22-week LMD fetus, homozygous for the A170P mutation. Although the mutant SHOX protein was expressed in all zones of the growth plate, the chondrocyte columns in the proliferative zone were disorganized with the chondrocytes occurring in smaller columnal clusters. We have also identified a novel mutation at the same residue, c. 509C>A (p.A170D), in two unrelated Spanish LWD families, which similar to A170P mutation impedes nuclear localization of SHOX. In conclusion, we have identified A170P as the first frequent SHOX mutation in Gypsy LWD and LMD individuals.

  18. A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

    Science.gov (United States)

    Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

    2012-12-01

    Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

  19. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    Science.gov (United States)

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  20. A study on tumor suppressor genes mutations associated with different pathological colorectal lesions

    International Nuclear Information System (INIS)

    Matar, S.N.A.

    2011-01-01

    Colorectal cancer (CRC) is the second leading cause of cancer-related death in the Western world. In Egypt; there is an increasing incidence of the disease, especially among patients ≤40 years age. While CRC have been reported in low incidence rate in developing countries, it is the third most common tumor in male and the fifth common tumor in females in Egypt. Early diagnosis and surgical interference guarantee long survival of most CRC patients. Early diagnosis is impeded by the disease onset at young age and imprecise symptoms at the initial stages of the disease. As in most solid tumors, the malignant transformation of colonic epithelial cells is to arise through a multistep process during which they acquire genetic changes involving the activation of proto-oncogenes and the loss of tumor suppressor genes. Recently, a candidate tumor suppressor gene, KLF6, which is mapped to chromosome 10p, was found to be frequently mutated in a number of cancers. There are some evidences suggesting that the disruption of the functional activity of KLF6 gene products may be one of the early events in tumor genesis of the colon. The main objective of the present study was to detect mutational changes of KLF6 tumor suppressor gene and to study the loss of heterozygosity (LOH) markers at chromosome 10p15 (KLF6 locus) in colorectal lesions and colorectal cancer in Egyptian patients. The patients included in this study were 83 presented with different indications for colonoscopic examination. Selecting patients with colorectal pre-cancerous lesions or colorectal cancer was done according to the results of tissue biopsy from lesion and adjacent normal. The patients were classified into three main groups; (G I) Cancerous group, (G II) polyps group including patients with adenomatous polyps (AP), familial adenomatous polyps (FAP) and hyperplastic polyps (HP) and (G III) Inflammatory Bowel Diseases (IBD) including patients with ulcerative colitis (UC) and Crohn's disease (CD

  1. Nonsense and missense mutation of mitochondrial ND6 gene promotes cell migration and invasion in human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Yuan, Yang; Wang, Weixing; Li, Huizhong; Yu, Yongwei; Tao, Jin; Huang, Shengdong; Zeng, Zhiyong

    2015-01-01

    Previous study showed that mitochondrial ND6 (mitND6) gene missense mutation resulted in NADH dehydrogenase deficiency and was associated with tumor metastasis in several mouse tumor cell lines. In the present study, we investigated the possible role of mitND6 gene nonsense and missense mutations in the metastasis of human lung adenocarcinoma. The presence of mitND6 gene mutations was screened by DNA sequencing of tumor tissues from 87 primary lung adenocarcinoma patients and the correlation of the mutations with the clinical features was analyzed. In addition, we constructed cytoplasmic hybrid cells with denucleared primary lung adenocarcinoma cell as the mitochondria donor and mitochondria depleted lung adenocarcinoma A549 cell as the nuclear donor. Using these cells, we studied the effects of mitND6 gene nonsense and missense mutations on cell migration and invasion through wounding healing and matrigel-coated transwell assay. The effects of mitND6 gene mutations on NADH dehydrogenase activity and ROS production were analyzed by spectrophotometry and flow cytometry. mitND6 gene nonsense and missense mutations were detected in 11 of 87 lung adenocarcinoma specimens and was correlated with the clinical features including age, pathological grade, tumor stage, lymph node metastasis and survival rate. Moreover, A549 cell containing mitND6 gene nonsense and missense mutation exhibited significantly lower activity of NADH dehydrogenase, higher level of ROS, higher capacity of cell migration and invasion, and higher pAKT and pERK1/ERK2 expression level than cells with the wild type mitND6 gene. In addition, NADH dehydrogenase inhibitor rotenone was found to significantly promote the migration and invasion of A549 cells. Our data suggest that mitND6 gene nonsense and missense mutation might promote cell migration and invasion in lung adenocarcinoma, probably by NADH dehydrogenase deficiency induced over-production of ROS

  2. Novel Missense Mitochondrial ND4L Gene Mutations in Friedreich's Ataxia

    Directory of Open Access Journals (Sweden)

    Mohammad Mehdi Heidari

    2011-05-01

    Full Text Available AbstractObjective(sThe mitochondrial defects in Friedreich's ataxia have been reported in many researches. Mitochondrial DNA is one of the candidates for defects in mitochondrion, and complex I is the first and one of the largest catalytic complexes of oxidative phosphorylation (OXPHOS system. Materials and MethodsWe searched the mitochondrial ND4L gene for mutations by TTGE and sequencing on 30 FRDA patients and 35 healthy controls.ResultsWe found 3 missense mutations [m.10506A>G (T13A, m.10530G>A (V21M, and m.10653G>A (A62T] in four patients whose m.10530G>A and m.10653G>A were not reported previously. In two patients, heteroplasmic m.10530G>A mutation was detected. They showed a very early ataxia syndrome. Our results showed that the number of mutations in FRDA patients was higher than that in the control cases (P= 0.0287.ConclusionAlthough this disease is due to nuclear gene mutation, the presence of these mutations might be responsible for further mitochondrial defects and the increase of the gravity of the disease. Thus, it should be considered in patients with this disorder.

  3. Mutation Analysis of 16 Mucolipidosis II and III Alpha/Beta Chinese Children Revealed Genotype-Phenotype Correlations.

    Directory of Open Access Journals (Sweden)

    Shuang Liu

    Full Text Available Mucolipidosis II and III alpha/beta are autosomal recessive diseases caused by mutations in the GNPTAB gene which encodes the α and β subunits of the N-acetylglucosamine-1-phosphotransferase. Clinically, mucolipidosis II (MLII is characterized by severe developmental delay, coarse facial features, skeletal deformities, and other systemic involvement. In contrast, MLIII alpha/beta is a much milder disorder, the symptoms of which include progressive joint stiffness, short stature, and scoliosis. To study the relationship between the genotypes and phenotypes of the MLII and MLIII alpha/beta patients, we analyzed the GNPTAB gene in 16 Chinese MLII and MLIII alpha/beta patients. We collected and analyzed the patients' available clinical data and all showed clinical features typical of MLII or MLIII alpha/beta. Moreover, the activity of several lysosomal enzymes was measured in the plasma and finally the GNPTAB gene was sequenced. We detected 30 mutant alleles out of 32 alleles in our patients. These include 10 new mutations (c.99delC, c.118-1G>A, c.523_524delAAinsG, c.1212C>G, c.2213C>A, c.2345C>T, c.2356C>T, c.2455G>T, c.2821dupA, and c.3136-2A>G and 5 previously reported mutations (c.1071G>A, c.1090C>T, c.2715+1G>A, c.2550_2554delGAAA, and c.3613C>T. The most frequent mutation was the splicing mutation c.2715+1G>A, which accounted for 28% of the mutations. The majority of the mutations reported in the Chinese patients (57% were located on exon 13 or in its intronic flanking regions.

  4. Inactivation of the P16INK4/MTS1 gene by a chromosome translocation t(9;14)(p21-22;q11) in an acute lymphoblastic leukemia of B-cell type.

    Science.gov (United States)

    Duro, D; Bernard, O; Della Valle, V; Leblanc, T; Berger, R; Larsen, C J

    1996-02-15

    We have reported previously a preliminary study of a t(9;14)(p21-22; q11) in B-cell acute lymphoblastic leukemia. This translocation had rearranged the TCRA/D locus on chromosome band 14q11 and the locus encoding the tumor suppressor gene P16INK4/MTS1 (P16) on band 9p21 (D. Duro et al., Oncogene, 11: 21-29, 1995). In the present report, the breakpoints were precisely localized on each chromosome partner. On the 14q- derivative, the sequence derived from chromosome 9 was interrupted at 1.0 kb upstream of the first exon of P16, close to a consensus recombination heptamer, CACTGTG. In addition, the chromosome 14 breakpoint was localized at the end of the TCRD2 (delta 2) segment, and 22 residues with unknown origin were present at the translocation junction. On the 9p+ derivative, chromosome 9 sequences were in continuity with those displaced onto chromosome 14, and the 14q11 breakpoint was located within TCRJA29 segment. These features are consistent with aberrant activity of the TCR gene recombinase complex. Although all three coding exons of P16 were displaced onto the chromosome 14q-derivative, no P16 transcript was detected in the leukemic cells. Because the region spanning the P16 exon 1 was not inactivated by methylation and because the other P16 allele was deleted, the implication is that the chromosome breakpoint was likely to disrupt regulatory elements involved in the normal expression of the gene. As a whole, then, our results show that translocations affecting band 9p21 can participate to the inactivation of P16, thus justifying a systematic survey of translocations of the 9p21 band in acute lymphoblastic leukemia.

  5.  Mutations of noncollagen genes in osteogenesis imperfecta – implications of the gene products in collagen biosynthesis and pathogenesis of disease

    Directory of Open Access Journals (Sweden)

    Anna Galicka

    2012-06-01

    Full Text Available  Recent investigations revealed that the “brittle bone” phenotype in osteogenesis imperfecta (OI is caused not only by dominant mutations in collagen type I genes, but also by recessively inherited mutations in genes responsible for the post-translational processing of type I procollagen as well as for bone formation. The phenotype of patients with mutations in noncollagen genes overlaps with very severe type III and lethal type II OI caused by mutations in collagen genes. Mutations in genes that encode proteins involved in collagen prolyl 3-hydroxylation (P3H1/CRTAP/CyPB eliminated Pro986 hydroxylation and caused an increase in modification of collagen helix by prolyl 4-hydroxylase and lysyl hydroxylase. However, the importance of these disturbances in the disease pathomechanism is not known. Loss of complex proteins’ function as collagen chaperones may dominate the disease mechanism. The latest findings added to the spectrum of OI-causing and collagen-influencing factors other chaperones (HSP47 and FKBP65 and protein BMP-1, which emphasizes the complexity of collagen folding and secretion as well as their importance in bone formation. Furthermore, mutations in genes encoding transcription factor SP7/Osterix and pigment epithelium-derived factor (PEDF constitute a novel mechanism for OI, which is independent of changes in biosynthesis and processing of collagen.

  6. Rapidly progressive renal disease as part of Wolfram syndrome in a large inbred Turkish family due to a novel WFS1 mutation (p.Leu511Pro)

    DEFF Research Database (Denmark)

    Yuca, Sevil Ari; Rendtorff, Nanna Dahl; Boulahbel, Houda

    2012-01-01

    Wolfram syndrome, also named "DIDMOAD" (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness), is an inherited association of juvenile-onset diabetes mellitus and optic atrophy as key diagnostic criteria. Renal tract abnormalities and neurodegenerative disorder may occur in the third...... and fourth decade. The wolframin gene, WFS1, associated with this syndrome, is located on chromosome 4p16.1. Many mutations have been described since the identification of WFS1 as the cause of Wolfram syndrome. We identified a new homozygous WFS1 mutation (c.1532T>C; p.Leu511Pro) causing Wolfram syndrome...

  7. P18 tumor suppressor gene and progression of oligodendrogliomas to anaplasia.

    Science.gov (United States)

    He, J; Hoang-Xuan, K; Marie, Y; Leuraud, P; Mokhtari, K; Kujas, M; Delattre, J Y; Sanson, M

    2000-09-26

    P18INK4C is a good candidate to be the tumor suppressor gene involved in oligodendrogliomas on 1p32. Loss of heterozygosity on 1p, mutation(s), homozygous deletion(s), and expression of p18 in 30 oligodendroglial tumors were investigated. Loss of heterozygosity on 1p was found in 15 tumors. A p18 mutation was found at an recurrence of an anaplastic oligodendroglioma, but not in the primary, low-grade tumor. No homozygous deletions were found and p18 was expressed in all cases. These results show that p18 alteration is involved in tumor progression in a subset of oligodendrogliomas.

  8. Overexpression of the p53 tumor suppressor gene product in primary lung adenocarcinomas is associated with cigarette smoking

    NARCIS (Netherlands)

    Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.

    1993-01-01

    Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the

  9. A Novel FOXE1 Mutation (R73S) in Bamforth–Lazarus Syndrome Causing Increased Thyroidal Gene Expression

    Science.gov (United States)

    Carré, Aurore; Hamza, Rasha T.; Kariyawasam, Dulanjalee; Guillot, Loïc; Teissier, Raphaël; Tron, Elodie; Castanet, Mireille; Dupuy, Corinne; El Kholy, Mohamed; Polak, Michel

    2014-01-01

    Background: Homozygous loss-of-function mutations in the FOXE1 gene have been reported in several patients with partial or complete Bamforth–Lazarus syndrome: congenital hypothyroidism (CH) with thyroid dysgenesis (usually athyreosis), cleft palate, spiky hair, with or without choanal atresia, and bifid epiglottis. Here, our objective was to evaluate potential functional consequences of a FOXE1 mutation in a patient with a similar clinical phenotype. Methods: FOXE1 was sequenced in eight patients with thyroid dysgenesis and cleft palate. Transient transfection was performed in HEK293 cells using the thyroglobulin (TG) and thyroid peroxidase (TPO) promoters in luciferase reporter plasmids to assess the functional impact of the FOXE1 mutations. Primary human thyrocytes transfected with wild type and mutant FOXE1 served to assess the impact of the mutation on endogenous TG and TPO expression. Results: We identified and characterized the function of a new homozygous FOXE1 missense mutation (p.R73S) in a boy with a typical phenotype (athyreosis, cleft palate, and partial choanal atresia). This new mutation located within the forkhead domain was inherited from the heterozygous healthy consanguineous parents. In vitro functional studies in HEK293 cells showed that this mutant gene enhanced the activity of the TG and TPO gene promoters (1.5-fold and 1.7-fold respectively vs. wild type FOXE1; p<0.05), unlike the five mutations previously reported in Bamforth–Lazarus syndrome. The gain-of-function effect of the FOXE1-p.R73S mutant gene was confirmed by an increase in endogenous TG production in primary human thyrocytes. Conclusion: We identified a new homozygous FOXE1 mutation responsible for enhanced expression of the TG and TPO genes in a boy whose phenotype is similar to that reported previously in patients with loss-of-function FOXE1 mutations. This finding further delineates the role for FOXE1 in both thyroid and palate development, and shows that enhanced gene

  10. Sarcomeric gene mutations in sudden infant death syndrome (SIDS).

    Science.gov (United States)

    Brion, Maria; Allegue, Catarina; Santori, Montserrat; Gil, Rocio; Blanco-Verea, Alejandro; Haas, Cordula; Bartsch, Christine; Poster, Simone; Madea, Burkhard; Campuzano, Oscar; Brugada, Ramon; Carracedo, Angel

    2012-06-10

    In developed countries, sudden infant death syndrome (SIDS) represents the most prevalent cause of death in children between 1 month and 1 year of age. SIDS is a diagnosis of exclusion, a negative autopsy which requires the absence of structural organ disease. Although investigators have confirmed that a significant percentage of SIDS cases are actually channelopathies, no data have been made available as to whether other sudden cardiac death-associated diseases, such as hypertrophic cardiomyopathy (HCM), could be responsible for some cases of SIDS. The presence of a genetic mutation in the sarcomeric protein usually affects the force of contraction of the myocyte, whose weakness is compensated with progressive hypertrophy and disarray. However, it is unclear whether in the most incipient forms, that is, first years of life, the lack of these phenotypes still confers a risk of arrhythmogenesis. The main goal of the present study is to wonder whether genetic defects in the sarcomeric proteins, previously associated with HCM, could be responsible for SIDS. We have analysed 286 SIDS cases for the most common genes implicated in HCM in adults. A total of 680 mutations localised in 16 genes were analysed by semi-automated matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDITOF-MS) using the Sequenom MassARRAY(®) System. Ten subjects with completely normal hearts showed mutated alleles at nine of the genetic variants analysed, and one additional novel mutation was detected by conventional sequencing. Therefore, a genetic mutation associated with HCM may cause sudden cardiac death in the absence of an identifiable phenotype. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  11. Mutation scanning of peach floral genes

    Directory of Open Access Journals (Sweden)

    Wilde H Dayton

    2011-05-01

    Full Text Available Abstract Background Mutation scanning technology has been used to develop crop species with improved traits. Modifications that improve screening throughput and sensitivity would facilitate the targeted mutation breeding of crops. Technical innovations for high-resolution melting (HRM analysis are enabling the clinic-based screening for human disease gene polymorphism. We examined the application of two HRM modifications, COLD-PCR and QMC-PCR, to the mutation scanning of genes in peach, Prunus persica. The targeted genes were the putative floral regulators PpAGAMOUS and PpTERMINAL FLOWER I. Results HRM analysis of PpAG and PpTFL1 coding regions in 36 peach cultivars found one polymorphic site in each gene. PpTFL1 and PpAG SNPs were used to examine approaches to increase HRM throughput. Cultivars with SNPs could be reliably detected in pools of twelve genotypes. COLD-PCR was found to increase the sensitivity of HRM analysis of pooled samples, but worked best with small amplicons. Examination of QMC-PCR demonstrated that primary PCR products for further analysis could be produced from variable levels of genomic DNA. Conclusions Natural SNPs in exons of target peach genes were discovered by HRM analysis of cultivars from a southeastern US breeding program. For detecting natural or induced SNPs in larger populations, HRM efficiency can be improved by increasing sample pooling and template production through approaches such as COLD-PCR and QMC-PCR. Technical advances developed to improve clinical diagnostics can play a role in the targeted mutation breeding of crops.

  12. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

    Science.gov (United States)

    Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

    2009-01-01

    Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  13. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis

    Directory of Open Access Journals (Sweden)

    Paulo Lisboa Bittencourt

    2009-01-01

    Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  14. Spectrum of EGFR gene mutations in Vietnamese patients with non-small cell lung cancer.

    Science.gov (United States)

    Vu, Hoang Anh; Xinh, Phan Thi; Ha, Hua Thi Ngoc; Hanh, Ngo Thi Tuyet; Bach, Nguyen Duc; Thao, Doan Thi Phuong; Dat, Ngo Quoc; Trung, Nguyen Sao

    2016-03-01

    Epidermal growth factor receptor (EGFR) mutational status is a crucial biomarker for prediction of response to tyrosine kinase inhibitors in patients with non-small cell lung cancer (NSCLC). Although these mutations have been well characterized in other countries, little is known about the frequency or spectrum of EGFR mutations in Vietnamese NSCLC patients. Using Sanger DNA sequencing, we investigated mutations in EGFR exons 18-21 from 332 patients diagnosed with NSCLC at University of Medicine and Pharmacy, Ho Chi Minh City, Vietnam. DNA was extracted from formalin-fixed, paraffin-embedded tissues, followed by PCR amplification and sequencing. EGFR mutations were detected in 135 samples (40.7%), of which eight samples carried double mutations. In total, 46 different types of EGFR mutations were found, including six novel mutations (p.K713E, p.K714R, p.P794S, p.R803W, p.P848S, and p.K867E). Among the four exons investigated, exon 19 was most frequently mutated (63 out of 332 patients, 19%), with the p.E746_A750del appearing in 43 samples. Exon 21 was mutated in 56 samples (16.9%), of which 47 were p.L858R. Each of exons 18 and 20 was mutated in 12 samples (3.6%). The frequency of EGFR mutations was higher in females than in males (48.9% vs 35%, P = 0.012), but not statistically different between adenocarcinomas and other histological types of NSCLC (41.3% vs 34.5%, P = 0.478). DNA sequencing detected EGFR mutations with high frequency and revealed a broad spectrum of mutation type in Vietnamese patients with NSCLC. © 2015 Wiley Publishing Asia Pty Ltd.

  15. Mutation update for the PORCN gene

    NARCIS (Netherlands)

    Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo; Lampe, Anne; Gabbett, Michael T.; Ousager, Lillian Bomme; van der Smagt, Jasper J.; Soller, Maria; Stattin, Eva-Lena; Mannens, Marcel A. M. M.; Smigiel, Robert; Hennekam, Raoul C.

    2011-01-01

    Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum,

  16. Low prevalence of CHEK2 gene mutations in multiethnic cohorts of breast cancer patients in Malaysia.

    Science.gov (United States)

    Mohamad, Suriati; Isa, Nurismah Md; Muhammad, Rohaizak; Emran, Nor Aina; Kitan, Nor Mayah; Kang, Peter; Kang, In Nee; Taib, Nur Aishah Mohd; Teo, Soo Hwang; Akmal, Sharifah Noor

    2015-01-01

    CHEK2 is a protein kinase that is involved in cell-cycle checkpoint control after DNA damage. Germline mutations in CHEK2 gene have been associated with increase in breast cancer risk. The aim of this study is to identify the CHEK2 gene germline mutations among high-risk breast cancer patients and its contribution to the multiethnic population in Malaysia. We screened the entire coding region of CHEK2 gene on 59 high-risk breast cancer patients who tested negative for BRCA1/2 germline mutations from UKM Medical Centre (UKMMC), Hospital Kuala Lumpur (HKL) and Hospital Putrajaya (HPJ). Sequence variants identified were screened further in case-control cohorts consisting of 878 unselected invasive breast cancer patients (180 Malays, 526 Chinese and 172 Indian) and 270 healthy individuals (90 Malays, 90 Chinese and 90 Indian). By screening the entire coding region of the CHEK2 gene, two missense mutations, c.480A>G (p.I160M) and c.538C>T (p.R180C) were identified in two unrelated patients (3.4%). Further screening of these missense mutations on the case-control cohorts unveiled the variant p.I160M in 2/172 (1.1%) Indian cases and 1/90 (1.1%) Indian control, variant p.R180C in 2/526 (0.38%) Chinese cases and 0/90 Chinese control, and in 2/180 (1.1%) of Malay cases and 1/90 (1.1%) of Malay control. The results of this study suggest that CHEK2 mutations are rare among high-risk breast cancer patients and may play a minor contributing role in breast carcinogenesis among Malaysian population.

  17. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  18. Mutations of the Norrie gene in Korean ROP infants.

    Science.gov (United States)

    Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup

    2002-12-01

    The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.

  19. Mutation spectrum of the Norrie disease pseudoglioma (NDP) gene in Indian patients with FEVR.

    Science.gov (United States)

    Musada, Ganeswara Rao; Jalali, Subhadra; Hussain, Anjli; Chururu, Anupama Reddy; Gaddam, Pramod Reddy; Chakrabarti, Subhabrata; Kaur, Inderjeet

    2016-01-01

    Mutations in the Norrie disease pseudoglioma (NDP; Xp11.3) gene have been involved in retinal blood vessel formation and neural differentiation and are implicated in familial exudative vitreoretinopathy (FEVR) cases. However, the role of the gene has not been explored in the Indian context. Thus, this study was designed to understand the involvement of NDP among Indian patients with FEVR. The study cohort comprised 225 subjects, including unrelated patients with FEVR (n = 110) and ethnically matched healthy subjects (n = 115) recruited from a tertiary eye care center in India. The entire coding regions, intron-exon boundaries, along with the 5' and 3' untranslated regions of NDP were screened with resequencing following standard protocols. The spectrum of the observed variants was analyzed in conjunction with data available from other populations. Eight potentially pathogenic mutations (p.His4ArgfsX21, p.Asp23GlufsX9, p.Ile48ValfsX55, p.His50Asp, p.Ser57*, p.Gly113Asp, p.Arg121Gln, and p.Cys126Arg, including five novel ones), were observed in the coding region of the NDP gene in ten unrelated FEVR probands (9%). The novel changes were not observed in the control subjects and were unavailable in the dbSNP, ESP5400, NIEHS95, and ExAC databases. All probands with NDP mutations exhibited classical features of the disease as observed among patients with FEVR worldwide. This is perhaps the first study to demonstrate the involvement of NDP among patients with Indian FEVR that further expands its mutation spectrum. The data generated could have broad implications in genetic counseling, disease management, and early intervention for a better prognosis in FEVR.

  20. Inhibition of HBV replication by delivering the dual-gene expression vector pHsa-miR16-siRNA in HepG2.2.15 cells.

    Science.gov (United States)

    Wei, Wei; Wang, Su-Fei; Yu, Bing; Ni, Ming

    2017-12-01

    This study aimed to construct the dual-gene expression vector pHsa-miR16-siRNA which can express human miR-16 and HBV X siRNA, and examine its regulatory effect on HBV gene expression in the HepG2.2.15 cell line. The expression vectors siR-1583 and pHsa-miR16-siRNA were designed and constructed. HepG2.2.15 cells were transfected with the empty vector, siR-1583, pmiR-16 and pHsa-miR16-siRNA, respectively. ELISA was performed to measure the expression of HBsAg and HBeAg in the culture supernatant 48 and72 h post transfection. Fluorescence quantitative PCR was used to measure the HBV mRNA degradation efficiency and HBV DNA copy number. The results showed that the expression of HBV genes was significantly inhibited in HepG2.2.15 cells transfected with siR-1583, pmiR-16 and pHsa-miR16-siRNA, respectively, when compared with that in cells transfected with the empty vectors, with the inhibitory effect of pHsa-miR16-siRNA being the most significant. ELISA showed that the inhibitory rates of HBsAg and HBeAg in pHsa-miR16-siRNA transfected cells were correspondingly 87.3% and 85.0% at 48 h, and 88.6% and 86.5% at 72 h post transfection (PHBV mRNA decreased by 80.2% (t=-99.22, PHBV DNA by 92.8% (t=-73.06, PHBV DNA copy number by 89.8% (t=-47.13, PHBV more efficiently than a single-gene expression vector.

  1. Mutations in MC1R Gene Determine Black Coat Color Phenotype in Chinese Sheep

    Directory of Open Access Journals (Sweden)

    Guang-Li Yang

    2013-01-01

    Full Text Available The melanocortin receptor 1 (MC1R plays a central role in regulation of animal coat color formation. In this study, we sequenced the complete coding region and parts of the 5′- and 3′-untranslated regions of the MC1R gene in Chinese sheep with completely white (Large-tailed Han sheep, black (Minxian Black-fur sheep, and brown coat colors (Kazakh Fat-Rumped sheep. The results showed five single nucleotide polymorphisms (SNPs: two non-synonymous mutations previously associated with coat color (c.218 T>A, p.73 Met>Lys. c.361 G>A, p.121 Asp>Asn and three synonymous mutations (c.429 C>T, p.143 Tyr>Tyr; c.600 T>G, p.200 Leu>Leu. c.735 C>T, p.245 Ile>Ile. Meanwhile, all mutations were detected in Minxian Black-fur sheep. However, the two nonsynonymous mutation sites were not in all studied breeds (Large-tailed Han, Small-tailed Han, Gansu Alpine Merino, and China Merino breeds, all of which are in white coat. A single haplotype AATGT (haplotype3 was uniquely associated with black coat color in Minxian Black-fur breed (P=9.72E-72, chi-square test. The first and second A alleles in this haplotype 3 represent location at 218 and 361 positions, respectively. Our results suggest that the mutations of MC1R gene are associated with black coat color phenotype in Chinese sheep.

  2. Congenital Hypopituitarism due to POU1F1 Gene Mutation

    Directory of Open Access Journals (Sweden)

    Ni-Chung Lee

    2011-01-01

    Full Text Available POU1F1 (Pit-1; Gene ID 5449 is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome, elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S mutation. The rarity of the disease can result in delayed diagnosis and treatment.

  3. Gene repair of an Usher syndrome causing mutation by zinc-finger nuclease mediated homologous recombination.

    Science.gov (United States)

    Overlack, Nora; Goldmann, Tobias; Wolfrum, Uwe; Nagel-Wolfrum, Kerstin

    2012-06-26

    Human Usher syndrome (USH) is the most frequent cause of inherited deaf-blindness. It is clinically and genetically heterogeneous, assigned to three clinical types of which the most severe type is USH1. No effective treatment for the ophthalmic component of USH exists. Gene augmentation is an attractive strategy for hereditary retinal diseases. However, several USH genes, like USH1C, are expressed in various isoforms, hampering gene augmentation. As an alternative treatment strategy, we applied the zinc-finger nuclease (ZFN) technology for targeted gene repair of an USH1C, causing mutation by homologous recombination. We designed ZFNs customized for the p.R31X nonsense mutation in Ush1c. We evaluated ZFNs for DNA cleavage capability and analyzed ZFNs biocompatibilities by XTT assays. We demonstrated ZFNs mediated gene repair on genomic level by digestion assays and DNA sequencing, and on protein level by indirect immunofluorescence and Western blot analyses. The specifically designed ZFNs did not show cytotoxic effects in a p.R31X cell line. We demonstrated that ZFN induced cleavage of their target sequence. We showed that simultaneous application of ZFN and rescue DNA induced gene repair of the disease-causing mutation on the genomic level, resulting in recovery of protein expression. In our present study, we analyzed for the first time ZFN-activated gene repair of an USH gene. The data highlight the ability of ZFNs to induce targeted homologous recombination and mediate gene repair in USH. We provide further evidence that the ZFN technology holds great potential to recover disease-causing mutations in inherited retinal disorders.

  4. Sequence analysis of tyrosinase gene in ocular and oculocutaneous albinism patients: introducing three novel mutations.

    Science.gov (United States)

    Khordadpoor-Deilamani, Faravareh; Akbari, Mohammad Taghi; Karimipoor, Morteza; Javadi, Gholamreza

    2015-01-01

    Albinism is a heterogeneous genetic disorder of melanin synthesis that results in hypopigmented eyes (in patients with ocular albinism) or hair, skin, and eyes (in individuals with oculocutaneous albinism). It is associated with decreased visual acuity, nystagmus, strabismus, and photophobia. The tyrosinase gene is known to be involved in both oculocutaneous albinism and autosomal recessive ocular albinism. In this study, we aimed to screen the mutations in the TYR gene in the nonsyndromic OCA and autosomal recessive ocular albinism patients from Iran. The tyrosinase gene was examined in 23 unrelated patients with autosomal recessive ocular albinism or nonsyndromic OCA using DNA sequencing and bioinformatics analysis. TYR gene mutations were identified in 14 (app. 60%) albinism patients. We found 10 mutations, 3 of which were novel. No mutation was found in our ocular albinism patients, but one of them was heterozygous for the p.R402Q polymorphism.

  5. c.376G>A mutation in WFS1 gene causes Wolfram syndrome without deafness.

    Science.gov (United States)

    Safarpour Lima, Behnam; Ghaedi, Hamid; Daftarian, Narsis; Ahmadieh, Hamid; Jamshidi, Javad; Khorrami, Mehdi; Noroozi, Rezvan; Sohrabifar, Nasim; Assarzadegan, Farhad; Hesami, Omid; Taghavi, Shaghayegh; Ahmadifard, Azadeh; Atakhorrami, Minoo; Rahimi-Aliabadi, Simin; Shahmohammadibeni, Neda; Alehabib, Elham; Andarva, Monavvar; Darvish, Hossein; Emamalizadeh, Babak

    2016-02-01

    Wolfram syndrome is one of the rare autosomal recessive, progressive, neurodegenerative disorders, characterized by diabetes mellitus and optic atrophy. Several other features are observed in patients including deafness, ataxia, and peripheral neuropathy. A gene called WFS1 is identified on chromosome 4p, responsible for Wolfram syndrome. We investigated a family consisted of parents and 8 children, which 5 of them have been diagnosed for Wolfram syndrome. WFS1 gene in all family members was sequenced for causative mutations. A mutation (c.376G>A, p.A126T) was found in all affected members in homozygous state and in both parents in heterozygous state. The bioinformatics analysis showed the deleterious effects of this nucleotide change on the structure and function of the protein product. As all of the patients in the family showed the homozygote mutation, and parents were both heterozygote, this mutation is probably the cause of the disease. We identified this mutation in homozygous state for the first time as Wolfram syndrome causation. We also showed that this mutation probably doesn't cause deafness in affected individuals. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  6. Suppression of severe achondroplasia with developmental delay and acanthosis nigricans by the p.Thr651Pro mutation.

    Science.gov (United States)

    Manickam, Kandamurugu; Donoghue, Daniel J; Meyer, April N; Snyder, Pamela J; Prior, Thomas W

    2014-01-01

    Severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN) is an extremely rare severe skeletal dysplasia characterized by significant developmental delay, brain structural abnormalities, hearing loss, and acanthosis nigricans. The disorder is the result of a single missense mutation at codon 650 (p.Lys650Met) in the fibroblast growth factor receptor 3 gene (FGFR3). We describe a child who initially presented with a mild achondroplasia or hypochondroplasia like phenotype. Molecular analysis of the FGFR3 gene showed the common SADDAN mutation and a second novel mutation at codon 651 (p.Thr651Pro). Both mutations were shown to occur on the same allele (cis) and de novo. Transient transfection studies with FGFR3 double mutant constructs show that the p.Thr651Pro mutation causes a dramatic decrease in constitutive receptor kinase activity than that observed by the p.Lys650Met mutation. Our data suggest that the molecular effect by the p.Thr651Pro is to elicit a conformational change that decreases the FGFR3 tyrosine kinase activity, which is constitutively activated by the SADDAN mutation. Due to the inheritance of both a gain-of-function and a loss-of-function mutation, we conclude that a reduction of constitutive activation caused the milder skeletal phenotype. Although the occurrence of double mutations are expected to be rare, the presence of other FGFR3 modifiers may be responsible for some of the clinically discrepant skeletal dysplasia cases. © 2013 Wiley Periodicals, Inc.

  7. Relationship between ELA2 gene mutations, clinical and laboratory parameters in severe congenital and cyclic neutropenia

    Directory of Open Access Journals (Sweden)

    Farhoodi A

    2007-09-01

    Full Text Available   Background: Mutations of ELA2, the gene encoding neutrophil elastase (NE are known to be associated with cyclic neutropenia (CN and severe congenital neutropenia (SCN. However, high variability of these mutations has been reported. This study was designed to describe the analysis of the ELA2 gene, clinical manifestations and demographic characteristics in patients with CN and SCN.Methods: A series of 21 patients with CN or SCN were selected, based on SCINR criteria, from the immunology ward of the Pediatric Medicine Center, Tehran, Iran, from March 2004 to August 2005. The ELA2 gene, isolated from blood samples, was analyzed using RT-PCR and automated capillary sequencing. Informed consent was obtained under the tenets of the Helsinki Declaration and the Ethical Committee of the Tehran University of Medical Sciences.Results: Kostmann's syndrome and CN was diagnosed in three and 18 patients respectively. Of all the patients, one or two mutations were found in 18 cases (85.7%, including all three patients with SCN and 15 of the patients with CN. Exons two and four had the most mutations (eight and seven cases, respectively. Seven patients had double mutations in two distinct exons. Overall, 16 different mutations were found. At the time of presentation, the mean age of patients was 13.4 ±17.6 months, ranging from one month to seven years. Overall, 61.9% of patients had consanguineous parents. The mean absolute neutrophil count was 830.5 ±419.4 (150-2000/mm3. On average, each patient had been admitted to the hospital 2.2 ±1.6 times. The neutrophil counts of the SCN patients were significantly higher than those of the CN patients. However, there was no significant difference in the neutrophil counts between patients with mutations and those without mutations. All patients with SCN had two or more infectious complications, although the prevalence of infectious or non-infectious complications did not correlate with ELA2 mutations or the

  8. Staphylococcus aureus colonization in atopic eczema and its association with filaggrin gene mutations

    DEFF Research Database (Denmark)

    Clausen, M. L.; Edslev, S. M.; Andersen, P. S.

    2017-01-01

    was to assess differences in S. aureus colonization in patients with AD with and without filaggrin gene mutations. The secondary aim was to assess disease severity in relation to S. aureus colonization. Exploratory analyses were performed to investigate S. aureus genetic lineages in relation to filaggrin gene...... were characterized with respect to disease severity (Scoring Atopic Dermatitis) and FLG mutations (n = 88). Fisher's exact test was used to analyse differences in S. aureus colonization in relation to FLG mutations. Results: Of the 101 patients included, 74 (73%) were colonized with S. aureus....... Of the colonized patients, 70 (95%) carried only one CC type in all three different sampling sites. In lesional skin, S. aureus was found in 24 of 31 patients with FLG mutations vs. 24 of 54 wild-type patients (P = 0·0004). Staphylococcus aureusCC1 clonal lineage was more prevalent in patients with FLG mutations...

  9. Impact of mutations in Toll-like receptor pathway genes on esophageal carcinogenesis.

    Directory of Open Access Journals (Sweden)

    Daffolyn Rachael Fels Elliott

    2017-05-01

    Full Text Available Esophageal adenocarcinoma (EAC develops in an inflammatory microenvironment with reduced microbial diversity, but mechanisms for these influences remain poorly characterized. We hypothesized that mutations targeting the Toll-like receptor (TLR pathway could disrupt innate immune signaling and promote a microenvironment that favors tumorigenesis. Through interrogating whole genome sequencing data from 171 EAC patients, we showed that non-synonymous mutations collectively affect the TLR pathway in 25/171 (14.6%, PathScan p = 8.7x10-5 tumors. TLR mutant cases were associated with more proximal tumors and metastatic disease, indicating possible clinical significance of these mutations. Only rare mutations were identified in adjacent Barrett's esophagus samples. We validated our findings in an external EAC dataset with non-synonymous TLR pathway mutations in 33/149 (22.1%, PathScan p = 0.05 tumors, and in other solid tumor types exposed to microbiomes in the COSMIC database (10,318 samples, including uterine endometrioid carcinoma (188/320, 58.8%, cutaneous melanoma (377/988, 38.2%, colorectal adenocarcinoma (402/1519, 26.5%, and stomach adenocarcinoma (151/579, 26.1%. TLR4 was the most frequently mutated gene with eleven mutations in 10/171 (5.8% of EAC tumors. The TLR4 mutants E439G, S570I, F703C and R787H were confirmed to have impaired reactivity to bacterial lipopolysaccharide with marked reductions in signaling by luciferase reporter assays. Overall, our findings show that TLR pathway genes are recurrently mutated in EAC, and TLR4 mutations have decreased responsiveness to bacterial lipopolysaccharide and may play a role in disease pathogenesis in a subset of patients.

  10. A novel natural killer cell line (KHYG-1) from a patient with aggressive natural killer cell leukemia carrying a p53 point mutation.

    Science.gov (United States)

    Yagita, M; Huang, C L; Umehara, H; Matsuo, Y; Tabata, R; Miyake, M; Konaka, Y; Takatsuki, K

    2000-05-01

    We present the establishment of a natural killer (NK) leukemia cell line, designated KHYG-1, from the blood of a patient with aggressive NK leukemia, which both possessed the same p53 point mutation. The immunophenotype of the primary leukemia cells was CD2+, surface CD3-, cytoplasmic CD3epsilon+, CD7+, CD8alphaalpha+, CD16+, CD56+, CD57+ and HLA-DR+. A new cell line (KHYG-1) was established by culturing peripheral leukemia cells with 100 units of recombinant interleukin (IL)-2. The KHYG-1 cells showed LGL morphology with a large nucleus, coarse chromatin, conspicuous nucleoli, and abundant basophilic cytoplasm with many azurophilic granules. The immunophenotype of KHYG-1 cells was CD1-, CD2+, surface CD3-, cytoplasmic CD3epsilon+, CD7+, CD8alphaalpha+, CD16-, CD25-, CD33+, CD34-, CD56+, CD57-, CD122+, CD132+, and TdT-. Southern blot analysis of these cells revealed a normal germline configuration for the beta, delta, and gamma chains of the T cell receptor and the immunoglobulin heavy-chain genes. Moreover, the KHYG-1 cells displayed NK cell activity and IL-2-dependent proliferation in vitro, suggesting that they are of NK cell origin. Epstein-Barr virus (EBV) DNA was not detected in KHYG-1 cells by Southern blot analysis with a terminal repeat probe from an EBV genome. A point mutation in exon 7 of the p53 gene was detected in the KHYG-1 cells by PCR/SSCP analysis, and direct sequencing revealed the conversion of C to T at nucleotide 877 in codon 248. The primary leukemia cells also carried the same point mutation. Although the precise role of the p53 point mutation in leukemogenesis remains to be clarified, the establishment of an NK leukemia cell line with a p53 point mutation could be valuable in the study of leukemogenesis.

  11. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    Directory of Open Access Journals (Sweden)

    Zanatta Daniela B

    2010-06-01

    Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet

  12. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    International Nuclear Information System (INIS)

    Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E

    2010-01-01

    Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19

  13. p.Ser252Trp and p.Pro253Arg mutations in FGFR2 gene causing Apert syndrome: the first clinical and molecular report of Indonesian patients.

    Science.gov (United States)

    Mundhofir, Farmaditya E P; Sistermans, Erik A; Faradz, Sultana M H; Hamel, Ben C J

    2013-03-01

    Apert syndrome (AS) is a rare autosomal dominant disorder characterised by craniosynostosis and limb malformations, and is associated with congenital heart disease and other systemic malformations, including intellectual disability. We report two Indonesian patients with AS, in whom molecular analysis detected p.Ser252Trp (c.755C>G) and p.Pro253Arg (c.758C>G) mutations in the fibroblast growth factor receptor 2 (FGFR2) gene, respectively. Although the syndrome has been frequently described, this is the first clinical report of AS confirmed by molecular analysis in Indonesia. The difference in severity of clinical features in the two patients may be consistent with a genotype-phenotype correlation of the FGFR2mutation. The management of individuals with AS is best achieved within a multidisciplinary setting. However, in most developing countries, early intervention may be delayed due to late diagnosis, a lack of facilities and financial constraints. This report underpins the benefits of early diagnosis for AS management.

  14. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients.

    Science.gov (United States)

    Zhao, Ying; Zhang, Xiaoying; Bao, Xinhua; Zhang, Qingping; Zhang, Jingjing; Cao, Guangna; Zhang, Jie; Li, Jiarui; Wei, Liping; Pan, Hong; Wu, Xiru

    2014-02-25

    Mutations in the cyclin-dependent kinase-like 5 (CDKL5) (NM_003159.2) gene have been associated with early-onset epileptic encephalopathies or Hanefeld variants of RTT(Rett syndrome). In order to clarify the CDKL5 genotype-phenotype correlations in Chinese patients, CDKL5 mutational screening in cases with early-onset epileptic encephalopathies and RTT without MECP2 mutation were performed. The detailed clinical information including clinical manifestation, electroencephalogram (EEG), magnetic resonance imaging (MRI), blood, urine amino acid and organic acid screening of 102 Chinese patients with early-onset epileptic encephalopathies and RTT were collected. CDKL5 gene mutations were analyzed by PCR, direct sequencing and multiplex ligation-dependent probe amplification (MLPA). The patterns of X-chromosome inactivation (XCI) were studied in the female patients with CDKL5 gene mutation. De novo CDKL5 gene mutations were found in ten patients including one missense mutation (c.533G > A, p.R178Q) which had been reported, two splicing mutations (ISV6 + 1A > G, ISV13 + 1A > G), three micro-deletions (c.1111delC, c.2360delA, c.234delA), two insertions (c.1791 ins G, c.891_892 ins TT in a pair of twins) and one nonsense mutation (c.1375C > T, p.Q459X). Out of ten patients, 7 of 9 females with Hanefeld variants of RTT and the remaining 2 females with early onset epileptic encephalopathy, were detected while only one male with infantile spasms was detected. The common features of all female patients with CDKL5 gene mutations included refractory seizures starting before 4 months of age, severe psychomotor retardation, Rett-like features such as hand stereotypies, deceleration of head growth after birth and poor prognosis. In contrast, the only one male patient with CDKL5 mutation showed no obvious Rett-like features as females in our cohort. The X-chromosome inactivation patterns of all the female patients were random. Mutations in CDKL5 gene are responsible for 7 with

  15. Gene mutations in hepatocellular adenomas

    DEFF Research Database (Denmark)

    Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben

    2015-01-01

    is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due...... to alterations in the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. In the diagnostic setting, sub classification of HCA is based primarily on immunohistochemical analyzes, and has had an increasing impact on choice of treatment and individual prognostic assessment....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....

  16. [Clinical significance of JAK2、CALR and MPL gene mutations in 1 648 Philadelphia chromosome negative myeloproliferative neoplasms patients from a single center].

    Science.gov (United States)

    Li, M Y; Chao, H Y; Sun, A N; Qiu, H Y; Jin, Z M; Tang, X W; Han, Y; Fu, C C; Chen, S N; Wu, D P

    2017-04-14

    Objective: To explore the prevalences of JAK2, CALR and MPL gene mutations and the mutation types in patients with Philadelphia chromosome negative myeloproliferative neoplasms (MPNs) , and to compare their clinical characteristics of different mutation types with each other and mutation negative group. Methods: The mutations of JAK2 V617F, JAK2 gene at exon 12, CALR gene at exon 9 and MPL gene at exon 10 in 1 648 Ph negative MPNs patients were detected by direct sequencing. Results: ① The JAK2V617F mutation was found in 471 (92.7%) of 508 PV patients, 819 (78.1%) of 1 049 ET patients and 74 (81.3%) of 91 PMF patients respectively, with the total mutation rate as 82.8% (1 364/1 648) . The JAK2 exon12 mutation was found in 9 (1.7%) of 508 PV patients, none was found in ET or PMF patients, with the total mutation rate as 0.5% (9/1 648) . The CALR mutation was found in 132 (12.6%) of 1 049 ET patients and 11 (12.1%) of 91 PMF patients respectively, with the total mutation rate as 8.7% (143/1 648) ; the MPL mutation was found in 9 (0.9%) of 1 049 ET patients and 1 (1.1%) of 91 PMF patients respectively, with the total mutation rate as 0.6% (10/1 648) . The co-occurrence of any two types of driver gene mutations was not detected by direct sequencing. ②The median onset age of patients with JAK2V617F[61 (15-95) y] was significant higher than of with JAK2 exon12 mutation[49 (33-62) y] or without mutations[42 (3-78) y] ( P MPL mutation[59 (22-71) y] ( P >0.05) . Patients with JAK2V617F had higher white blood cell count and hemoglobin level ( P MPL mutation ( P =0.013) . The platelet count of patients with CALR mutation was significantly higher than of with JAK2V617F[966 (400-2 069) ×10(9)/L vs 800 (198-3 730) ×10(9)/L, P MPL gene mutation revealed normal karyotype. Conclusions: Driver gene mutations detection could ensure the diagnosis and prognosis judgment of MPN more reliable, different subtypes of MPNs had different profiles of driver gene mutations, the latter

  17. DRUMS: a human disease related unique gene mutation search engine.

    Science.gov (United States)

    Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

    2011-10-01

    With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.

  18. Meiotic and pedigree segregation analyses in carriers of t(4;8)(p16;p23.1) differing in localization of breakpoint positions at 4p subband 4p16.3 and 4p16.1.

    Science.gov (United States)

    Midro, Alina T; Zollino, Marcella; Wiland, Ewa; Panasiuk, Barbara; Iwanowski, Piotr S; Murdolo, Marina; Śmigiel, Robert; Sąsiadek, Maria; Pilch, Jacek; Kurpisz, Maciej

    2016-02-01

    The purpose of this study was to compare meiotic segregation in sperm cells from two carriers with t(4;8)(p16;p23.1) reciprocal chromosome translocations (RCTs), differing in localization of the breakpoint positions at the 4p subband-namely, 4p16.3 (carrier 1) and 4p16.1 (carrier 2)-and to compare data of the pedigree analyses performed by direct method. Three-color fluorescent in situ hybridization (FISH) on sperm cells and FISH mapping for the evaluation of the breakpoint positions, data from pedigrees, and direct segregation analysis of the pedigrees were performed. Similar proportions of normal/balanced and unbalanced sperm cells were found in both carriers. The most common was an alternate type of segregation (about 52 % and about 48 %, respectively). Unbalanced adjacent I and adjacent II karyotypes were found in similar proportions about 15 %. The direct segregation analysis (following Stengel-Rutkowski) of the pedigree of carriers of t(4;8)(p16.1;p23.1) was performed and results were compared with the data of the pedigree segregation analysis obtained earlier through the indirect method. The probability of live-born progeny with unbalanced karyotype for carriers of t(4;8)(p16.1;p23.1) was moderately high at 18.8 %-comparable to the value obtained using the indirect method for the same carriership, which was 12 %. This was, however, markedly lower than the value of 41.2 % obtained through the pedigree segregation indirect analysis estimated for carriers of t(4;8)(p16.3;p23.1), perhaps due to the unique composition of genes present within the 4p16.1-4p 16.3 region. Revealed differences in pedigree segregation analysis did not correspond to the very similar profile of meiotic segregation patterns presented by carrier 1 and carrier 2. Most probably, such discordances may be due to differences in embryo survival rates arising from different genetic backgrounds.

  19. Ancient genes establish stress-induced mutation as a hallmark of cancer.

    Science.gov (United States)

    Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to

  20. Screening for mutations in two exons of FANCG gene in Pakistani population.

    Science.gov (United States)

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  1. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis.

    Science.gov (United States)

    Esteller, M; Toyota, M; Sanchez-Cespedes, M; Capella, G; Peinado, M A; Watkins, D N; Issa, J P; Sidransky, D; Baylin, S B; Herman, J G

    2000-05-01

    O6-methylguanine DNA methyltransferase (MGMT) is a DNA repair protein that removes mutagenic and cytotoxic adducts from the O6 position of guanine. O6-methylguanine mispairs with thymine during replication, and if the adduct is not removed, this results in conversion from a guanine-cytosine pair to an adenine-thymine pair. In vitro assays show that MGMT expression avoids G to A mutations and MGMT transgenic mice are protected against G to A transitions at ras genes. We have recently demonstrated that the MGMT gene is silenced by promoter methylation in many human tumors, including colorectal carcinomas. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of K-ras mutations, we studied 244 colorectal tumor samples for MGMT promoter hypermethylation and K-ras mutational status. Our results show a clear association between the inactivation of MGMT by promoter hypermethylation and the appearance of G to A mutations at K-ras: 71% (36 of 51) of the tumors displaying this particular type of mutation had abnormal MGMT methylation, whereas only 32% (12 of 37) of those with other K-ras mutations not involving G to A transitions and 35% (55 of 156) of the tumors without K-ras mutations demonstrated MGMT methylation (P = 0.002). In addition, MGMT loss associated with hypermethylation was observed in the small adenomas, including those that do not yet contain K-ras mutations. Hypermethylation of other genes such as p16INK4a and p14ARF was not associated with either MGMT hypermethylation or K-ras mutation. Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to a particular genetic change in human cancer, specifically G to A transitions in the K-ras oncogene.

  2. Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2012-10-15

    Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

  3. A novel truncating AIP mutation, p.W279*, in a familial isolated pituitary adenoma (FIPA) kindred.

    Science.gov (United States)

    Cansu, Güven Barış; Taşkıran, Bengür; Trivellin, Giampaolo; Faucz, Fabio R; Stratakis, Constantine A

    2016-07-01

    Familial isolated pituitary adenomas (FIPA) constitute 2-3% of pituitary tumours. AIP is the most commonly mutated gene in FIPA. We herein report a novel germline mutation of the AIP gene in a family with FIPA. We present two patients, a father and his 12-year-old daughter, diagnosed clinically and using laboratory measures with acromegaly-gigantism. Both underwent transsphenoidal hypophyseal surgery for macroadenomas. We initially detected a novel heterozygous germline AIP mutation, c.836G>A (p.W279*), in the father's DNA. We then found the same mutation in his affected daughter. Pituitary adenomas associated with AIP mutations mostly present as FIPA (68%) at an early age (78% occur at treatment success, and genetic counseling.

  4. Arrestin gene mutations in autosomal recessive retinitis pigmentosa.

    Science.gov (United States)

    Nakazawa, M; Wada, Y; Tamai, M

    1998-04-01

    To assess the clinical and molecular genetic studies of patients with autosomal recessive retinitis pigmentosa associated with a mutation in the arrestin gene. Results of molecular genetic screening and case reports with DNA analysis and clinical features. University medical center. One hundred twenty anamnestically unrelated patients with autosomal recessive retinitis pigmentosa. DNA analysis was performed by single strand conformation polymorphism followed by nucleotide sequencing to search for a mutation in exon 11 of the arrestin gene. Clinical features were characterized by visual acuity slitlamp biomicroscopy, fundus examinations, fluorescein angiography, kinetic visual field testing, and electroretinography. We identified 3 unrelated patients with retinitis pigmentosa associated with a homozygous 1-base-pair deletion mutation in codon 309 of the arrestin gene designated as 1147delA. All 3 patients showed pigmentary retinal degeneration in the midperipheral area with or without macular involvement. Patient 1 had a sibling with Oguchi disease associated with the same mutation. Patient 2 demonstrated pigmentary retinal degeneration associated with a golden-yellow reflex in the peripheral fundus. Patients 1 and 3 showed features of retinitis pigmentosa without the golden-yellow fundus reflex. Although the arrestin 1147delA has been known as a frequent cause of Oguchi disease, this mutation also may be related to the pathogenesis of autosomal recessive retinitis pigmentosa. This phenomenon may provide evidence of variable expressivity of the mutation in the arrestin gene.

  5. THE EFFECT OF HAEMOCHROMATOSIS MUTATION ON IRON OVERLOAD IN THALASSAEMIA MAJOR PATIENTS

    Directory of Open Access Journals (Sweden)

    Tapas Ranjan Behera

    2016-11-01

    Full Text Available BACKGROUND Haemochromatosis is a genetic form of iron overload due to a defective HFE gene. Secondary iron overload is the main complication in transfusion-dependent thalassaemia major patients. This study aims at evaluating the degree of iron overload in β-thalassaemia major patients with and without HFE mutations (C282Y, H63D and S65C. MATERIALS AND METHODS A descriptive observational study was conducted including fifty diagnosed -thalassaemia major cases. Detailed clinical history and iron profile was estimated. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS After DNA analysis of all the thalassaemia major cases, two groups were identified, one with HFE gene mutation and other without HFE gene mutation. Iron profile of both the groups (with and without HFE gene mutation was estimated and compared. Only H63D mutation (out of three HFE gene mutations was detected in 16% cases (8 out of 50 cases, which comprised the group with mutation. Comparison of iron parameters between two groups (with and without HFE gene mutation showed significant difference in percent transferrin saturation (p=0.02, while other iron parameters (serum iron and serum ferritin did not show significant difference. CONCLUSION No significant difference between serum ferritin values (a marker of iron overload of groups with and without mutation (mean ferritin level 4641±2166 ng/mL and 4170±2461 ng/mL, respectively was found (p=0.61, in a patient population in whom transfusion protocol and proper chelation regimen was followed.

  6. Germline and somatic mutations in the MTOR gene in focal cortical dysplasia and epilepsy

    DEFF Research Database (Denmark)

    Møller, Rikke S; Weckhuysen, Sarah; Chipaux, Mathilde

    2016-01-01

    OBJECTIVE: To assess the prevalence of somatic MTOR mutations in focal cortical dysplasia (FCD) and of germline MTOR mutations in a broad range of epilepsies. METHODS: We collected 20 blood-brain paired samples from patients with FCD and searched for somatic variants using deep-targeted gene panel...... sequencing. Germline mutations in MTOR were assessed in a French research cohort of 93 probands with focal epilepsies and in a diagnostic Danish cohort of 245 patients with a broad range of epilepsies. Data sharing among collaborators allowed us to ascertain additional germline variants in MTOR. RESULTS: We...... detected recurrent somatic variants (p.Ser2215Phe, p.Ser2215Tyr, and p.Leu1460Pro) in the MTOR gene in 37% of participants with FCD II and showed histologic evidence for activation of the mTORC1 signaling cascade in brain tissue. We further identified 5 novel de novo germline missense MTOR variants in 6...

  7. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

    Science.gov (United States)

    Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

    2015-04-23

    With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

  8. PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

    Science.gov (United States)

    Wimmer, Katharina; Wernstedt, Annekatrin

    2014-01-01

    The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

  9. Mutational analysis in patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD): Identification of five mutations in the PKD1 gene.

    Science.gov (United States)

    Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla

    2018-05-31

    Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.

  10. A novel -192c/g mutation in the proximal P2 promoter of the hepatocyte nuclear factor-4 alpha gene (HNF4A) associates with late-onset diabetes

    DEFF Research Database (Denmark)

    Ek, Jakob; Hansen, Sara P; Lajer, Maria

    2006-01-01

    Recently, it has been shown that mutations in the P2 promoter of the hepatocyte nuclear factor (HNF)-4 alpha gene (HNF4A) cause maturity-onset diabetes of the young (MODY), while single nucleotide polymorphisms in this locus are associated with type 2 diabetes. In this study, we examined 1,189 bp...... of the P2 promoter and the associated exon 1D of HNF4A for variations associated with diabetes in 114 patients with type 2 diabetes, 72 MODYX probands, and 85 women with previous gestational diabetes mellitus. A -192c/g mutation was found in five patients. We screened 1,587 diabetic subjects and 4......,812 glucose-tolerant subjects for the -192c/g mutation and identified 5 diabetic and 1 glucose-tolerant mutation carriers (P=0.004). Examination of the families showed that carriers of the -192c/g mutation had a significantly impaired glucose-stimulated insulin release and lower levels of serum total...

  11. Vacuolar Protein Sorting Genes in Parkinson's Disease: A Re-appraisal of Mutations Detection Rate and Neurobiology of Disease.

    Science.gov (United States)

    Gambardella, Stefano; Biagioni, Francesca; Ferese, Rosangela; Busceti, Carla L; Frati, Alessandro; Novelli, Giuseppe; Ruggieri, Stefano; Fornai, Francesco

    2016-01-01

    Mammalian retromers play a critical role in protein trans-membrane sorting from endosome to the trans-Golgi network (TGN). Recently, retromer alterations have been related to the onset of Parkinson's Disease (PD) since the variant p.Asp620Asn in VPS35 (Vacuolar Protein Sorting 35) was identified as a cause of late onset PD. This variant causes a primary defect in endosomal trafficking and retromers formation. Other mutations in VPS genes have been reported in both sporadic and familial PD. These mutations are less defined. Understanding the specific prevalence of all VPS gene mutations is key to understand the relevance of retromers impairment in the onset of PD. A number of PD-related mutations despite affecting different biochemical systems (autophagy, mitophagy, proteasome, endosomes, protein folding), all converge in producing an impairment in cell clearance. This may explain how genetic predispositions to PD may derive from slightly deleterious VPS mutations when combined with environmental agents overwhelming the clearance of the cell. This manuscript reviews genetic data produced in the last 5 years to re-define the actual prevalence of VPS gene mutations in the onset of PD. The prevalence of p.Asp620Asn mutation in VPS35 is 0.286 of familial PD. This increases up to 0.548 when considering mutations affecting all VPS genes. This configures mutations in VPS genes as the second most frequent autosomal dominant PD genotype. This high prevalence, joined with increased awareness of the role played by retromers in the neurobiology of PD, suggests environmentally-induced VPS alterations as crucial in the genesis of PD.

  12. A de-novo interstitial microduplication involving 2p16.1-p15 and mirroring 2p16.1-p15 microdeletion syndrome: Clinical and molecular analysis.

    Science.gov (United States)

    Mimouni-Bloch, Aviva; Yeshaya, Josepha; Kahana, Sarit; Maya, Idit; Basel-Vanagaite, Lina

    2015-11-01

    Microdeletions of various sizes in the 2p16.1-p15 chromosomal region have been grouped together under the 2p16.1-p15 microdeletion syndrome. Children with this syndrome generally share certain features including microcephaly, developmental delay, facial dysmorphism, urogenital and skeletal abnormalities. We present a child with a de-novo interstitial 1665 kb duplication of 2p16.1-p15. Clinical features of this child are distinct from those of children with the 2p16.1-p15 microdeletion syndrome, specifically the head circumference which is within the normal range and mild intellectual disability with absence of autistic behaviors. Microduplications many times bear milder clinical phenotypes in comparison with corresponding microdeletion syndromes. Indeed, as compared to the microdeletion syndrome patients, the 2p16.1-p15 microduplication seems to have a milder cognitive effect and no effect on other body systems. Limited information available in genetic databases about cases with overlapping duplications indicates that they all have abnormal developmental phenotypes. The involvement of genes in this location including BCL11A, USP34 and PEX13, affecting fundamental developmental processes both within and outside the nervous system may explain the clinical features of the individual described in this report. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  13. Dysplastic spondylolysis is caused by mutations in the diastrophic dysplasia sulfate transporter gene.

    Science.gov (United States)

    Cai, Tao; Yang, Liu; Cai, Wanshi; Guo, Sen; Yu, Ping; Li, Jinchen; Hu, Xueyu; Yan, Ming; Shao, Qianzhi; Jin, Yan; Sun, Zhong Sheng; Luo, Zhuo-Jing

    2015-06-30

    Spondylolysis is a fracture in part of the vertebra with a reported prevalence of about 3-6% in the general population. Genetic etiology of this disorder remains unknown. The present study was aimed at identifying genomic mutations in patients with dysplastic spondylolysis as well as the potential pathogenesis of the abnormalities. Whole-exome sequencing and functional analysis were performed for patients with spondylolysis. We identified a novel heterozygous mutation (c.2286A > T; p.D673V) in the sulfate transporter gene SLC26A2 in five affected subjects of a Chinese family. Two additional mutations (e.g., c.1922A > G; p.H641R and g.18654T > C in the intron 1) in the gene were identified by screening a cohort of 30 unrelated patients with the disease. In situ hybridization analysis showed that SLC26A2 is abundantly expressed in the lumbosacral spine of the mouse embryo at day 14.5. Sulfate uptake activities in CHO cells transfected with mutant SLC26A2 were dramatically reduced compared with the wild type, confirming the pathogenicity of the two missense mutations. Further analysis of the gene-disease network revealed a convergent pathogenic network for the development of lumbosacral spine. To our knowledge, our findings provide the first identification of autosomal dominant SLC26A2 mutations in patients with dysplastic spondylolysis, suggesting a new clinical entity in the pathogenesis of chondrodysplasia involving lumbosacral spine. The analysis of the gene-disease network may shed new light on the study of patients with dysplastic spondylolysis and spondylolisthesis as well as high-risk individuals who are asymptomatic.

  14. Mutations in the glucocerebrosidase gene are common in patients with Parkinson's disease from Eastern Canada.

    Science.gov (United States)

    Han, Fabin; Grimes, David A; Li, Fang; Wang, Ting; Yu, Zhe; Song, Na; Wu, Shichao; Racacho, Lemuel; Bulman, Dennis E

    2016-01-01

    Mutations in the β-glucocerebrosidase gene (GBA) have been implicated as a risk factor for Parkinson's disease (PD). However, GBA mutations in PD patients of different ethnic origins were reported to be inconsistent. We sequenced all exons of the GBA gene in 225 PD patients and 110 control individuals from Eastern Canada. Two novel GBA variants of c.-119 A/G and S(-35)N, five known GBA mutations of R120W, N370S, L444P, RecNciI and RecTL mutation (del55/D409H/RecNciI) as well as two non-pathological variants of E326K and T369M were identified from PD patients while only one mutation of S13L and two non-pathological variants of E326K and T369M were found in the control individuals. The frequency of GBA mutations within PD patients (4.4%) is 4.8 times higher than the 0.91% observed in control individuals (X(2) = 2.91, p = 0.088; odds ratio = 4.835; 95% confidence interval = 2.524-9.123). The most common mutations of N370S and L444P accounted for 36.0% (9/25) of all the GBA mutations in this Eastern Canadian PD cohort. The frequency (6.67%) of E326K and T369M in PD patients is comparable to 7.27% in control individuals (X(2) = 0.042, p = 0.8376), further supporting that these two variants have no pathological effects on PD. Phenotype analysis showed that no significant difference in family history, age at onset and cognitive impairment was identified between the GBA mutation carriers and non-GBA mutation carriers. GBA mutations were found to be a common genetic risk factor for PD in Eastern Canadian patients.

  15. Sodium channel SCN8A (Nav1.6: properties and de novo mutations in epileptic encephalopathy and intellectual disability

    Directory of Open Access Journals (Sweden)

    Janelle Elizabeth O'Brien

    2013-10-01

    Full Text Available The sodium channel Nav1.6, encoded by the gene SCN8A, is one of the major voltage-gated channels in human brain. The sequences of sodium channels have been highly conserved during evolution, and minor changes in biophysical properties can have a major impact in vivo. Insight into the role of Nav1.6 has come from analysis of spontaneous and induced mutations of mouse Scn8a during the past 18 years. Only within the past year has the role of SCN8A in human disease become apparent from whole exome and genome sequences of patients with sporadic disease. Unique features of Nav1.6 include its contribution to persistent current, resurgent current, repetitive neuronal firing, and subcellular localization at the axon initial segment and nodes of Ranvier. Loss of Nav1.6 activity results in reduced neuronal excitability, while gain-of-function mutations can increase neuronal excitability. Mouse Scn8a (med mutants exhibit movement disorders including ataxia, tremor and dystonia. Thus far, more than ten human de novo mutations have been identified in patients with two types of disorders, epileptic encephalopathy and intellectual disability. We review these human mutations as well as the unique features of Nav1.6 that contribute to its role in determining neuronal excitability in vivo. A supplemental figure illustrating the positions of amino acid residues within the 4 domains and 24 transmembrane segments of Nav1.6 is provided to facilitate the location of novel mutations within the channel protein.

  16. Mutations in the Norrie disease gene.

    Science.gov (United States)

    Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

    1995-01-01

    We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Tyrosine kinase domain mutations of EGFR gene in head and neck squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Vatte C

    2017-03-01

    Full Text Available Chittibabu Vatte,1 Ali M Al Amri,2 Cyril Cyrus,1 Shahanas Chathoth,1 Sadananda Acharya,3 Tariq Mohammad Hashim,4 Zhara Al Ali,2 Saleh Tawfeeq Alshreadah,2 Ahmed Alsayyah,4 Amein K Al-Ali5 1Department of Genetic Research, Institute for Research and Medical Consultation, University of Dammam, Dammam, 2Department of Internal Medicine, King Fahd Hospital of the University, University of Dammam, Al-Khobar, 3Department of Stemcell Research, Institute for Research and Medical Consultation, 4Department of Pathology, King Fahd Hospital of the University, University of Dammam, Al-Khobar, 5Department of Biochemistry, College of Medicine, University of Dammam, Dammam, Kingdom of Saudi Arabia Background: Epidermal growth factor receptor (EGFR is a commonly altered gene that is identified in various cancers, including head and neck squamous cell carcinoma (HNSCC. Therefore, EGFR is a promising molecular marker targeted by monoclonal antibodies and small molecule inhibitors targeting the tyrosine kinase (TK domain. Objective: The objective of this study was to investigate the spectrum of mutations in exons 18, 19, 20, and 21 of the EGFR gene in HNSCC patients. Materials and methods: This retrospective study included 47 confirmed HNSCC cases. Mutations in the TK domain, exons 18, 19, 20, and 21 of the EGFR gene, were detected by Scorpion® chemistry and ARMS® technologies on Rotor-Gene Q real-time polymerase chain reaction.Results: The tumors exhibited EGFR-TK domain mutations in 57% of cases. Four cases of T790M mutations were reported for the first time among HNSCC patients. Out of the total mutations, L861Q (exon 21, exon 20 insertions and deletions of exon 19 accounted for the majority of mutations (21%, 19%, and 17%, respectively. EGFR mutation status was correlated with the higher grade (P=0.026 and advanced stage (P=0.034 of HNSCC tumors.Conclusion: Higher frequency of EGFR-TK domain mutations together with the presence of the T790M mutation suggests

  18. Mutation spectrum of the Norrie disease pseudoglioma (NDP) gene in Indian patients with FEVR

    Science.gov (United States)

    Musada, Ganeswara Rao; Jalali, Subhadra; Hussain, Anjli; Chururu, Anupama Reddy; Gaddam, Pramod Reddy; Chakrabarti, Subhabrata

    2016-01-01

    Purpose Mutations in the Norrie disease pseudoglioma (NDP; Xp11.3) gene have been involved in retinal blood vessel formation and neural differentiation and are implicated in familial exudative vitreoretinopathy (FEVR) cases. However, the role of the gene has not been explored in the Indian context. Thus, this study was designed to understand the involvement of NDP among Indian patients with FEVR. Methods The study cohort comprised 225 subjects, including unrelated patients with FEVR (n = 110) and ethnically matched healthy subjects (n = 115) recruited from a tertiary eye care center in India. The entire coding regions, intron–exon boundaries, along with the 5′ and 3′ untranslated regions of NDP were screened with resequencing following standard protocols. The spectrum of the observed variants was analyzed in conjunction with data available from other populations. Results Eight potentially pathogenic mutations (p.His4ArgfsX21, p.Asp23GlufsX9, p.Ile48ValfsX55, p.His50Asp, p.Ser57*, p.Gly113Asp, p.Arg121Gln, and p.Cys126Arg, including five novel ones), were observed in the coding region of the NDP gene in ten unrelated FEVR probands (9%). The novel changes were not observed in the control subjects and were unavailable in the dbSNP, ESP5400, NIEHS95, and ExAC databases. All probands with NDP mutations exhibited classical features of the disease as observed among patients with FEVR worldwide. Conclusions This is perhaps the first study to demonstrate the involvement of NDP among patients with Indian FEVR that further expands its mutation spectrum. The data generated could have broad implications in genetic counseling, disease management, and early intervention for a better prognosis in FEVR. PMID:27217716

  19. Simple mathematical method to quantify p53 mutations in occupational lung cancer

    International Nuclear Information System (INIS)

    Helal, N.L.

    2005-01-01

    Radon-222, a decay product of uranium-238 and a source of high linear energy transfer (LET) alpha -particles, has been implicated in the increase risk of lung cancer in uranium miners as well as non-miners. The p53 gene mutational spectrum reveals evidence for a direct causal effect of radon inhalation in lung cancer. This mutation has been proposed as a marker of radon exposure. The development of such markers may ultimately be of benefit in the reduction of occupational morbidity and mortality from occupational cancer. One of the tasks in risk assessment of genotoxic occupational radiation exposure is to devise a simple numerical method. This method may be used to quantify the relationship between radiation dose and the effect on the genetic sequences. The tumor suppressor gene (TSG) p53 is an ideal bio marker addressing questions of exposure and risk. These proteins may be suitable for the design of more effective or less invasive cancer therapies. The clinical outcome of lung cancer patients may correlate with the normal regulation of these patients and, therefore, their identification may be used as a guideline for future therapy modalities. To investigate the association between radon exposure and p53 mutations in lung tumors, we have implied a mathematical method. This method has been developed from a 2-D graphical representational technique that enables easy visualization of base distributions. This is of special relevance to libraries of single nucleotide polymorphic (SNP) genes

  20. Predictive models for mutations in mismatch repair genes: implication for genetic counseling in developing countries

    Energy Technology Data Exchange (ETDEWEB)

    Monteiro Santos, Erika Maria [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); International Center of Research and Training (CIPE), AC Camargo Hospital, Sao Paulo (Brazil); Silva Junior, Wilson Araujo da [Sao Paulo University, Department of Genetics, Medical School of Ribeirao Preto, Ribeirao Preto (Brazil); Carraro, Dirce Maria [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); International Center of Research and Training (CIPE), AC Camargo Hospital, Sao Paulo (Brazil); Rossi, Benedito Mauro; Valentin, Mev Dominguez [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Carneiro, Felipe [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); International Center of Research and Training (CIPE), AC Camargo Hospital, Sao Paulo (Brazil); Oliveira, Ligia Petrolini de [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Oliveira Ferreira, Fabio de; Junior, Samuel Aguiar [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Hereditary Colorectal Cancer Registry, AC Camargo Hospital, Sao Paulo (Brazil); Nakagawa, Wilson Toshihiko [Hereditary Colorectal Cancer Registry, AC Camargo Hospital, Sao Paulo (Brazil); Gomy, Israel [Graduation Program, AC Camargo Hospital, Sao Paulo (Brazil); Sao Paulo University, Department of Genetics, Medical School of Ribeirao Preto, Ribeirao Preto (Brazil); Faria Ferraz, Victor Evangelista de [Sao Paulo University, Department of Genetics, Medical School of Ribeirao Preto, Ribeirao Preto (Brazil)

    2012-02-09

    Lynch syndrome (LS) is the most common form of inherited predisposition to colorectal cancer (CRC), accounting for 2-5% of all CRC. LS is an autosomal dominant disease characterized by mutations in the mismatch repair genes mutL homolog 1 (MLH1), mutS homolog 2 (MSH2), postmeiotic segregation increased 1 (PMS1), post-meiotic segregation increased 2 (PMS2) and mutS homolog 6 (MSH6). Mutation risk prediction models can be incorporated into clinical practice, facilitating the decision-making process and identifying individuals for molecular investigation. This is extremely important in countries with limited economic resources. This study aims to evaluate sensitivity and specificity of five predictive models for germline mutations in repair genes in a sample of individuals with suspected Lynch syndrome. Blood samples from 88 patients were analyzed through sequencing MLH1, MSH2 and MSH6 genes. The probability of detecting a mutation was calculated using the PREMM, Barnetson, MMRpro, Wijnen and Myriad models. To evaluate the sensitivity and specificity of the models, receiver operating characteristic curves were constructed. Of the 88 patients included in this analysis, 31 mutations were identified: 16 were found in the MSH2 gene, 15 in the MLH1 gene and no pathogenic mutations were identified in the MSH6 gene. It was observed that the AUC for the PREMM (0.846), Barnetson (0.850), MMRpro (0.821) and Wijnen (0.807) models did not present significant statistical difference. The Myriad model presented lower AUC (0.704) than the four other models evaluated. Considering thresholds of ≥ 5%, the models sensitivity varied between 1 (Myriad) and 0.87 (Wijnen) and specificity ranged from 0 (Myriad) to 0.38 (Barnetson). The Barnetson, PREMM, MMRpro and Wijnen models present similar AUC. The AUC of the Myriad model is statistically inferior to the four other models.

  1. Predictive models for mutations in mismatch repair genes: implication for genetic counseling in developing countries

    International Nuclear Information System (INIS)

    Monteiro Santos, Erika Maria; Silva Junior, Wilson Araujo da; Carraro, Dirce Maria; Rossi, Benedito Mauro; Valentin, Mev Dominguez; Carneiro, Felipe; Oliveira, Ligia Petrolini de; Oliveira Ferreira, Fabio de; Junior, Samuel Aguiar; Nakagawa, Wilson Toshihiko; Gomy, Israel; Faria Ferraz, Victor Evangelista de

    2012-01-01

    Lynch syndrome (LS) is the most common form of inherited predisposition to colorectal cancer (CRC), accounting for 2-5% of all CRC. LS is an autosomal dominant disease characterized by mutations in the mismatch repair genes mutL homolog 1 (MLH1), mutS homolog 2 (MSH2), postmeiotic segregation increased 1 (PMS1), post-meiotic segregation increased 2 (PMS2) and mutS homolog 6 (MSH6). Mutation risk prediction models can be incorporated into clinical practice, facilitating the decision-making process and identifying individuals for molecular investigation. This is extremely important in countries with limited economic resources. This study aims to evaluate sensitivity and specificity of five predictive models for germline mutations in repair genes in a sample of individuals with suspected Lynch syndrome. Blood samples from 88 patients were analyzed through sequencing MLH1, MSH2 and MSH6 genes. The probability of detecting a mutation was calculated using the PREMM, Barnetson, MMRpro, Wijnen and Myriad models. To evaluate the sensitivity and specificity of the models, receiver operating characteristic curves were constructed. Of the 88 patients included in this analysis, 31 mutations were identified: 16 were found in the MSH2 gene, 15 in the MLH1 gene and no pathogenic mutations were identified in the MSH6 gene. It was observed that the AUC for the PREMM (0.846), Barnetson (0.850), MMRpro (0.821) and Wijnen (0.807) models did not present significant statistical difference. The Myriad model presented lower AUC (0.704) than the four other models evaluated. Considering thresholds of ≥ 5%, the models sensitivity varied between 1 (Myriad) and 0.87 (Wijnen) and specificity ranged from 0 (Myriad) to 0.38 (Barnetson). The Barnetson, PREMM, MMRpro and Wijnen models present similar AUC. The AUC of the Myriad model is statistically inferior to the four other models

  2. Thyroglobulin Gene Mutation with Cold Nodule on Thyroid Scintigraphy

    Directory of Open Access Journals (Sweden)

    Toshio Kahara

    2012-01-01

    Full Text Available Thyroglobulin gene mutation is a rare cause of congenital hypothyroidism, but thyroglobulin gene mutations are thought to be associated with thyroid cancer development. A 21-year-old Japanese man treated with levothyroxine for congenital hypothyroidism had an enlarged thyroid gland with undetectable serum thyroglobulin despite elevated serum TSH level. The patient was diagnosed with thyroglobulin gene mutation, with compound heterozygosity for Gly304Cys missense mutation and Arg432X nonsense mutation. Ultrasonography showed a hypovascular large tumor in the left lobe that appeared as a cold nodule on thyroid scintigraphy. He underwent total thyroidectomy, but pathological study did not reveal findings of thyroid carcinoma, but rather a hyperplastic nodule with hemorrhage. Strong cytoplasmic thyroglobulin immunostaining was observed, but sodium iodide symporter immunostaining was hardly detected in the hyperplastic nodule. The clinical characteristics of patients with thyroglobulin gene mutations are diverse, and some patients are diagnosed by chance on examination of goiter in adults. The presence of thyroid tumors that appear as cold nodules on thyroid scintigraphy should consider the potential for thyroid carcinoma, if the patient has relatively low serum thyroglobulin concentration in relation to the degree of TSH without thyroglobulin autoantibody.

  3. Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

    Science.gov (United States)

    Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

    2017-03-15

    Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

  4. Coevolution of Siglec-11 and Siglec-16 via gene conversion in primates.

    Science.gov (United States)

    Hayakawa, Toshiyuki; Khedri, Zahra; Schwarz, Flavio; Landig, Corinna; Liang, Suh-Yuen; Yu, Hai; Chen, Xi; Fujito, Naoko T; Satta, Yoko; Varki, Ajit; Angata, Takashi

    2017-11-23

    Siglecs-11 and -16 are members of the sialic acid recognizing Ig-like lectin family, and expressed in same cells. Siglec-11 functions as an inhibitory receptor, whereas Siglec-16 exhibits activating properties. In humans, SIGLEC11 and SIGLEC16 gene sequences are extremely similar in the region encoding the extracellular domain due to gene conversions. Human SIGLEC11 was converted by the nonfunctional SIGLEC16P allele, and the converted SIGLEC11 allele became fixed in humans, possibly because it provides novel neuroprotective functions in brain microglia. However, the detailed evolutionary history of SIGLEC11 and SIGLEC16 in other primates remains unclear. We analyzed SIGLEC11 and SIGLEC16 gene sequences of multiple primate species, and examined glycan binding profiles of these Siglecs. The phylogenetic tree demonstrated that gene conversions between SIGLEC11 and SIGLEC16 occurred in the region including the exon encoding the sialic acid binding domain in every primate examined. Functional assays showed that glycan binding preference is similar between Siglec-11 and Siglec-16 in all analyzed hominid species. Taken together with the fact that Siglec-11 and Siglec-16 are expressed in the same cells, Siglec-11 and Siglec-16 are regarded as paired receptors that have maintained similar ligand binding preferences via gene conversions. Relaxed functional constraints were detected on the SIGLEC11 and SIGLEC16 exons that underwent gene conversions, possibly contributing to the evolutionary acceptance of repeated gene conversions. The frequency of nonfunctional SIGLEC16P alleles is much higher than that of SIGLEC16 alleles in every human population. Our findings indicate that Siglec-11 and Siglec-16 have been maintained as paired receptors by repeated gene conversions under relaxed functional constraints in the primate lineage. The high prevalence of the nonfunctional SIGLEC16P allele and the fixation of the converted SIGLEC11 imply that the loss of Siglec-16 and the gain of

  5. Atypical Clinical Presentation of Xeroderma Pigmentosum in a Patient Harboring a Novel Missense Mutation in the XPC Gene: The Importance of Clinical Suspicion.

    Science.gov (United States)

    Meneses, Marina; Chavez-Bourgeois, Marion; Badenas, Celia; Villablanca, Salvador; Aguilera, Paula; Bennàssar, Antoni; Alos, Llucia; Puig, Susana; Malvehy, Josep; Carrera, Cristina

    2015-01-01

    Xeroderma pigmentosum (XP) is a genodermatosis caused by abnormal DNA repair. XP complementation group C (XPC) is the most frequent type in Mediterranean countries. We describe a case with a novel mutation in the XPC gene. A healthy Caucasian male patient was diagnosed with multiple primary melanomas. Digital follow-up and molecular studies were carried out. During digital follow-up 8 more additional melanomas were diagnosed. Molecular studies did not identify mutations in CDKN2A, CDK4 or MITF genes. Two heterozygous mutations in the XPC gene were detected: c.2287delC (p.Leu763Cysfs*4) frameshift and c.2212A>G (p.Thr738Ala) missense mutations. The p.Thr738Ala missense mutation has not been previously described. Missense mutations in the XPC gene may allow partial functionality that could explain this unusual late onset XP. Atypical clinical presentation of XPC could be misdiagnosed when genetic aberrations allow partial DNA repair capacity. © 2015 S. Karger AG, Basel.

  6. Mutational screening of CHX10, GDF6, OTX2, RAX and SOX2 genes in 50 unrelated microphthalmia-anophthalmia-coloboma (MAC) spectrum cases.

    Science.gov (United States)

    Gonzalez-Rodriguez, J; Pelcastre, E L; Tovilla-Canales, J L; Garcia-Ortiz, J E; Amato-Almanza, M; Villanueva-Mendoza, C; Espinosa-Mattar, Z; Zenteno, J C

    2010-08-01

    Microphthalmia-anophthalmia-coloboma (MAC) are congenital eye malformations causing a significant percentage of visually impairments in children. Although these anomalies can arise from prenatal exposure to teratogens, mutations in well-defined genes originate potentially heritable forms of MAC. Mutations in genes such as CHX10, GDF6, RAX, SOX2 and OTX2, among others, have been recognised in dominant or recessive MAC. SOX2 and OTX2 are the two most commonly mutated genes in monogenic MAC. However, as more numerous samples of MAC subjects would be analysed, a better estimation of the actual involvement of specific MAC-genes could be made. Here, a comprehensive mutational analysis of the CHX10, GDF6, RAX, SOX2 and OTX2 genes was performed in 50 MAC subjects. PCR amplification and direct automated DNA sequencing of all five genes in 50 unrelated subjects. Eight mutations (16% prevalence) were recognised, including four GDF6 mutations (one novel), two novel RAX mutations, one novel OTX2 mutation and one SOX2 mutation. Anophthalmia and nanophthalmia, not previously associated with GDF6 mutations, were observed in two subjects carrying defects in this gene, expanding the spectrum of GDF6-linked ocular anomalies. Our study underscores the importance of genotyping large groups of patients from distinct ethnic origins for improving the estimation of the global involvement of particular MAC-causing genes.

  7. Almost 2% of Spanish breast cancer families are associated to germline pathogenic mutations in the ATM gene.

    Science.gov (United States)

    Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A

    2017-02-01

    There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.

  8. Effect of radon and its progeny on the expression and mutation of p53 in lung tissues of mice

    International Nuclear Information System (INIS)

    Piao Chunnan; Tian Mei; Liu Jianxiang; Ruan Jianlei; Su Xu

    2010-01-01

    Objective: To explore the effect of radon and its progeny on the expression and mutations of p53 in lung tissue of mouse model. Methods: Apoptosis was detected by terminal deoxynucleotidy transferase-mediated dUTP-biotin nick end labeling. The expression of p53 gene was analyzed by immunohistochemistry, Western blot and realtime-PCR. PCR-SSCP was used to detect the mutation of p53 in lung tissues. Results: Compared with those in the control group, the apoptotic index were increased significantly in 30 WLM and 60 WLM groups (t=18.11, -10.30, P<0.05). The p53 protein was increased significantly (t=-11.08, P<0.05; t=-7.00, P<0.05) in 30 WLM and 60 WLM groups. The mutation of p53 gene was not detected in lungs of radon-exposure mice. Conclusions: Lung and bronchus might be the targets of radon and its progeny, and p53 gene plays an important role in the progression of radon-induced lung injury. (authors)

  9. Three cases with L1 syndrome and two novel mutations in the L1CAM gene.

    Science.gov (United States)

    Marín, Rosario; Ley-Martos, Miriam; Gutiérrez, Gema; Rodríguez-Sánchez, Felicidad; Arroyo, Diego; Mora-López, Francisco

    2015-11-01

    Mutations in the L1CAM gene have been identified in the following various X-linked neurological disorders: congenital hydrocephalus; mental retardation, aphasia, shuffling gait, and adducted thumbs (MASA) syndrome; spastic paraplegia; and agenesis of the corpus callosum. These conditions are currently considered different phenotypes of a single entity known as L1 syndrome. We present three families with L1 syndrome. Sequencing of the L1CAM gene allowed the identification of the following mutations involved: a known splicing mutation (c.3531-12G>A) and two novel ones: a missense mutation (c.1754A>C; p.Asp585Ala) and a nonsense mutation (c.3478C>T; p.Gln1160Stop). The number of affected males and carrier females identified in a relatively small population suggests that L1 syndrome may be under-diagnosed. L1 syndrome should be considered in the differential diagnosis of intellectual disability or mental retardation in children, especially when other signs such as hydrocephalus or adducted thumbs are present.

  10. A novel AMELX mutation causes hypoplastic amelogenesis imperfecta.

    Science.gov (United States)

    Kim, Young-Jae; Kim, Youn Jung; Kang, Jenny; Shin, Teo Jeon; Hyun, Hong-Keun; Lee, Sang-Hoon; Lee, Zang Hee; Kim, Jung-Wook

    2017-04-01

    Amelogenesis imperfecta (AI) is a hereditary genetic defect affecting tooth enamel. AI is heterogeneous in clinical phenotype as well as in genetic etiology. To date, more than 10 genes have been associated with the etiology of AI. Amelogenin is the most abundant enamel matrix protein, most of which is encoded by the amelogenin gene in the X-chromosome (AMELX). More than 16 alternative splicing transcripts have been identified in the murine Amelx gene. The purpose of this study was to identify the genetic cause of an AI family. We recruited a family with hypoplastic AI and performed mutational analysis on the candidate gene based on the clinical phenotype. Mutational analysis revealed a missense mutation in exon 6 (NM_182680.1; c.242C > T), which changes a sequence in a highly conserved amino acid (NP_872621.1; p.Pro81Leu). Furthermore, a splicing assay using a minigene displayed that the mutation changed the mRNA splicing repertory. In this study, we identified a novel AMELX missense mutation causing hypoplastic AI, and this mutation also resulted in altered mRNA splicing. These results will not only expand the mutation spectrum causing AI but also broaden our understanding of the biological mechanism of enamel formation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  12. p53 immunostaining is correlated with reduced survival and is not correlated with gene mutations in resected pulmonary large cell carcinomas

    Directory of Open Access Journals (Sweden)

    L.M. Massoni Neto

    2007-08-01

    Full Text Available Malignancy of pulmonary large cell carcinomas (LCC increases from classic LCC through LCC with neuroendocrine morphology (LCCNM to large cell neuroendocrine carcinomas (LCNEC. However, the histological classification has sometimes proved to be difficult. Because the malignancy of LCC is highly dependent on proteins with functions in the cell cycle, DNA repair, and apoptosis, p53 has been targeted as a potentially useful biological marker. p53 mutations in lung cancers have been shown to result in expression and protein expression also occurs in the absence of mutations. To validate the importance of both p53 protein expression (by immunostaining and p53 gene mutations in lung LCC (by PCR-single strand conformational polymorphism analysis of exons 5, 6, 7, and 8 and to study their relationships with clinical factors and sub-classification we investigated the correlation of p53 abnormalities in 15 patients with LCC (5 classic LCC, 5 LCNEC, and 5 LCCNM who had undergone resection with curative intent. Of these patients, 5/15 expressed p53 and none had mutant p53 sequences. There was a negative survival correlation with positive p53 immunostaining (P = 0.05. After adjustment for stage, age, gender, chemotherapy, radiotherapy, and histological subtypes by multivariate analysis, p53 expression had an independent impact on survival. The present study indicates that p53 assessment may provide an objective marker for the prognosis of LCC irrespective of morphological variants and suggests that p53 expression is important for outcome prediction in patients with the early stages of LCC. The results reported here should be considered to be initial results because tumors from only 15 patients were studied: 5 each from LCC, LCNEC and LCCNM. This was due to the rarity of these specific diseases.

  13. The genetic alteration of p53 in esophageal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1996-01-01

    Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

  14. Multiple Origins of Mutations in the mdr1 Gene--A Putative Marker of Chloroquine Resistance in P. vivax.

    Directory of Open Access Journals (Sweden)

    Mette L Schousboe

    2015-11-01

    Full Text Available Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR. Single nucleotide polymorphisms (SNPs in the multidrug resistance gene, Pvmdr1 are putative determinants of CQR but the extent of their emergence at population level remains to be explored.In this study we describe the prevalence of SNPs in the Pvmdr1 among samples collected in seven P. vivax endemic countries and we looked for molecular evidence of drug selection by characterising polymorphism at microsatellite (MS loci flanking the Pvmdr1 gene.We examined the prevalence of SNPs in the Pvmdr1 gene among 267 samples collected from Pakistan, Afghanistan, Sri Lanka, Nepal, Sudan, São Tomé and Ecuador. We measured and diversity in four microsatellite (MS markers flanking the Pvmdr1 gene to look evidence of selection on mutant alleles.SNP polymorphism in the Pvmdr1 gene was largely confined to codons T958M, Y976F and F1076L. Only 2.4% of samples were wildtype at all three codons (TYF, n = 5, 13.3% (n = 28 of the samples were single mutant MYF, 63.0% of samples (n = 133 were double mutant MYL, and 21.3% (n = 45 were triple mutant MFL. Clear geographic differences in the prevalence of these Pvmdr mutation combinations were observed. Significant linkage disequilibrium (LD between Pvmdr1 and MS alleles was found in populations sampled in Ecuador, Nepal and Sri Lanka, while significant LD between Pvmdr1 and the combined 4 MS locus haplotype was only seen in Ecuador and Sri Lanka. When combining the 5 loci, high level diversity, measured as expected heterozygosity (He, was seen in the complete sample set (He = 0.99, while He estimates for individual loci ranged from 0.00-0.93. Although Pvmdr1 haplotypes were not consistently associated with specific flanking MS alleles, there was significant differentiation between geographic

  15. Novel mutations in the genes TGM1 and ALOXE3 underlying autosomal recessive congenital ichthyosis

    Science.gov (United States)

    Ullah, Rahim; Ansar, Muhammad; Durrani, Zaka Ullah; Lee, Kwanghyuk; Santos-Cortez, Regie Lyn P.; Muhammad, Dost; Ali, Mahboob; Zia, Muhammad; Ayub, Muhammad; Khan, Suliman; Smith, Josh D.; Nickerson, Deborah A.; Shendure, Jay; Bamshad, Michael; Leal, Suzanne M.; Ahmad, Wasim

    2016-01-01

    Background Ichthyoses are clinically characterized by scaling or hyperkeratosis of the skin or both. It can be an isolated condition limited to the skin or appear secondarily with involvement of other cutaneous or systemic abnormalities. Methods The present study investigated clinical and molecular characterization of three consanguineous families (A, B, C) segregating two different forms of autosomal recessive congenital ichthyosis (ARCI). Linkage in three consanguineous families (A, B, C) segregating two different forms of ARCI was searched by typing microsatellite and single nucleotide polymorphism marker analysis. Sequencing of the two genes TGM1 and ALOXE3 was performed by the dideoxy chain termination method. Results Genome-wide linkage analysis established linkage in family A to TGM1 gene on chromosome 14q11 and in families B and C to ALOXE3 gene on chromosome 17p13. Subsequently, sequencing of these genes using samples from affected family members led to the identification of three novel mutations: a missense variant p.Trp455Arg in TGM1 (family A); a nonsense variant p.Arg140* in ALOXE3 (family B); and a complex rearrangement in ALOXE3 (family C). Conclusion The present study further extends the spectrum of mutations in the two genes involved in causing ARCI. Characterizing the clinical spectrum resulting from mutations in the TGM1 and ALOXE3 genes will improve diagnosis and may direct clinical care of the family members. PMID:26578203

  16. Vacuolar Protein Sorting Genes in Parkinson's Disease: A Re-appraisal of Mutations Detection Rate and Neurobiology of Disease

    Science.gov (United States)

    Gambardella, Stefano; Biagioni, Francesca; Ferese, Rosangela; Busceti, Carla L.; Frati, Alessandro; Novelli, Giuseppe; Ruggieri, Stefano; Fornai, Francesco

    2016-01-01

    Mammalian retromers play a critical role in protein trans-membrane sorting from endosome to the trans-Golgi network (TGN). Recently, retromer alterations have been related to the onset of Parkinson's Disease (PD) since the variant p.Asp620Asn in VPS35 (Vacuolar Protein Sorting 35) was identified as a cause of late onset PD. This variant causes a primary defect in endosomal trafficking and retromers formation. Other mutations in VPS genes have been reported in both sporadic and familial PD. These mutations are less defined. Understanding the specific prevalence of all VPS gene mutations is key to understand the relevance of retromers impairment in the onset of PD. A number of PD-related mutations despite affecting different biochemical systems (autophagy, mitophagy, proteasome, endosomes, protein folding), all converge in producing an impairment in cell clearance. This may explain how genetic predispositions to PD may derive from slightly deleterious VPS mutations when combined with environmental agents overwhelming the clearance of the cell. This manuscript reviews genetic data produced in the last 5 years to re-define the actual prevalence of VPS gene mutations in the onset of PD. The prevalence of p.Asp620Asn mutation in VPS35 is 0.286 of familial PD. This increases up to 0.548 when considering mutations affecting all VPS genes. This configures mutations in VPS genes as the second most frequent autosomal dominant PD genotype. This high prevalence, joined with increased awareness of the role played by retromers in the neurobiology of PD, suggests environmentally-induced VPS alterations as crucial in the genesis of PD. PMID:27932943

  17. HFE gene mutations and iron status of Brazilian blood donors.

    Science.gov (United States)

    Santos, P C J L; Cançado, R D; Terada, C T; Rostelato, S; Gonzales, I; Hirata, R D C; Hirata, M H; Chiattone, C S; Guerra-Shinohara, E M

    2010-01-01

    Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542) were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC) than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018) and a 83.65% decrease (P = 0.007) in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001) and the HFE 63HD plus DD genotype (55.84%, P = 0.021). In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

  18. HFE gene mutations and iron status of Brazilian blood donors

    Directory of Open Access Journals (Sweden)

    P.C.J.L. Santos

    2010-01-01

    Full Text Available Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542 were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018 and a 83.65% decrease (P = 0.007 in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001 and the HFE 63HD plus DD genotype (55.84%, P = 0.021. In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

  19. Genetic study of the PAH locus in the Iranian population: familial gene mutations and minihaplotypes.

    Science.gov (United States)

    Razipour, Masoumeh; Alavinejad, Elaheh; Sajedi, Seyede Zahra; Talebi, Saeed; Entezam, Mona; Mohajer, Neda; Kazemi-Sefat, Golnaz-Ensieh; Gharesouran, Jalal; Setoodeh, Aria; Mohaddes Ardebili, Seyyed Mojtaba; Keramatipour, Mohammad

    2017-10-01

    Phenylketonuria (PKU), one of the most common inborn errors of amino acid metabolism, is caused by mutations in the phenylalanine hydroxylase (PAH) gene (PAH). PKU has wide allelic heterogeneity, and over 600 different disease-causing mutations in PAH have been detected to date. Up to now, there have been no reports on the minihaplotype (VNTR/STR) analysis of PAH locus in the Iranian population. The aims of the present study were to determine PAH mutations and minihaplotypes in Iranian families with PAH deficiency and to investigate the correlation between them. A total of 81 Iranian families with PAH deficiency were examined using PCR-sequencing of all 13 PAH exons and their flanking intron regions to identify sequence variations. Fragment analysis of the PAH minihaplotypes was performed by capillary electrophoresis for 59 families. In our study, 33 different mutations were found accounting for 95% of the total mutant alleles. The majority of these mutations (72%) were distributed across exons 7, 11, 2 and their flanking intronic regions. Mutation c.1066-11G > A was the most common with a frequency of 20.37%. The less frequent mutations, p.Arg261Gln (8%), p.Arg243Ter (7.4%), p.Leu48Ser (7.4%), p.Lys363Asnfs*37 (6.79%), c.969 + 5G > A (6.17%), p.Pro281Leu (5.56), c.168 + 5G > C (5.56), and p.Arg261Ter (4.94) together comprised about 52% of all mutant alleles. In this study, a total of seventeen PAH gene minihaplotypes were detected, six of which associated exclusively with particular mutations. Our findings indicate a broad PAH mutation spectrum in the Iranian population, which is consistent with previous studies reporting a wide range of PAH mutations, most likely due to ethnic heterogeneity. High prevalence of c.1066-11G > A mutation linked to minihaplotype 7/250 among both Iranian and Mediterranean populations is indicative of historical and geographical links between them. Also, strong association between particular mutations and minihaplotypes

  20. Parkinson disease: α-synuclein mutational screening and new clinical insight into the p.E46K mutation.

    Science.gov (United States)

    Pimentel, Márcia M G; Rodrigues, Fabíola C; Leite, Marco Antônio A; Campos Júnior, Mário; Rosso, Ana Lucia; Nicaretta, Denise H; Pereira, João S; Silva, Delson José; Della Coletta, Marcus V; Vasconcellos, Luiz Felipe R; Abreu, Gabriella M; Dos Santos, Jussara M; Santos-Rebouças, Cíntia B

    2015-06-01

    Amongst Parkinson's disease-causing genetic factors, missense mutations and genomic multiplications in the gene encoding α-synuclein are well established causes of the disease, although genetic data in populations with a high degree of admixture, such as the Brazilian one, are still scarce. In this study, we conducted a molecular screening of α-synuclein point mutations and copy number variation in the largest cohort of Brazilian patients with Parkinson's disease (n = 549) and also in twelve Portuguese and one Bolivian immigrants. Genomic DNA was isolated from peripheral blood leukocytes or saliva, and the mutational screening was performed by quantitative and qualitative real-time PCR. The only alteration identified was the p.E46K mutation in a 60-year-old man, born in Bolivia, with a familial history of autosomal dominant Parkinson's disease. This is the second family ever reported, in which this rare pathogenic mutation is segregating. The same mutation was firstly described ten years ago in a Spanish family with a neurodegenerative syndrome combining parkinsonism, dementia and visual hallucinations. The clinical condition of our proband reveals a less aggressive phenotype than previously described and reinforces that marked phenotypic heterogeneity is common among patients with Parkinson's disease, even among those carriers sharing the same mutation. Our findings add new insight into the preexisting information about α-synuclein p.E46K, improving our understanding about the endophenotypes associated to this mutation and corroborate that missense alterations and multiplications in α-synuclein are uncommon among Brazilian patients with Parkinson's disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Mutations in the LHX2 gene are not a frequent cause of micro/anophthalmia.

    Science.gov (United States)

    Desmaison, Annaïck; Vigouroux, Adeline; Rieubland, Claudine; Peres, Christine; Calvas, Patrick; Chassaing, Nicolas

    2010-12-18

    Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (orthodenticle homeobox 2 [OTX2], retina and anterior neural fold homeobox [RAX], SRY-box 2 [SOX2], CEH10 homeodomain-containing homolog [CHX10], and growth differentiation factor 6 [GDF6]) have been implicated mainly in isolated micro/anophthalmia but causative mutations of these genes explain less than a quarter of these developmental defects. The essential role of the LIM homeobox 2 (LHX2) transcription factor in early eye development has recently been documented. We postulated that mutations in this gene could lead to micro/anophthalmia, and thus performed molecular screening of its sequence in patients having micro/anophthalmia. Seventy patients having non-syndromic forms of colobomatous microphthalmia (n=25), isolated microphthalmia (n=18), or anophthalmia (n=17), and syndromic forms of micro/anophthalmia (n=10) were included in this study after negative molecular screening for OTX2, RAX, SOX2, and CHX10 mutations. Mutation screening of LHX2 was performed by direct sequencing of the coding sequences and intron/exon boundaries. Two heterozygous variants of unknown significance (c.128C>G [p.Pro43Arg]; c.776C>A [p.Pro259Gln]) were identified in LHX2 among the 70 patients. These variations were not identified in a panel of 100 control patients of mixed origins. The variation c.776C>A (p.Pro259Gln) was considered as non pathogenic by in silico analysis, while the variation c.128C>G (p.Pro43Arg) considered as deleterious by in silico analysis and was inherited from the asymptomatic father. Mutations in LHX2 do not represent a frequent cause of micro/anophthalmia.

  2. Absence of mutations in the coding sequence of the potential tumor suppressor 3pK in metastatic melanoma

    Directory of Open Access Journals (Sweden)

    Houben Roland

    2005-12-01

    Full Text Available Abstract Background Activation of Ras or Raf contributes to tumorigenesis of melanoma. However, constitutive Raf activation is also a characteristic of the majority of benign melanocytic nevi and high intensity signaling of either Ras or Raf was found to induce growth inhibition and senescence rather than transformation. Since the chromosome 3p kinase (3pK is a target of the Ras/Raf/Mek/Erk signaling pathway which antagonizes the function of the oncogene and anti-differentiation factor Bmi-1, 3pK may function as a tumor suppressor in tumors with constitutive Ras/Raf activation. Consequently, we tested whether inactivating 3pK mutations are present in melanoma. Methods 30 metastatic melanoma samples, which were positive for activating mutations of either BRaf or NRas, were analyzed for possible mutations in the 3pk gene. The 10 coding exons and their flanking intron sequences were amplified by PCR and direct sequencing of the PCR products was performed. Results This analysis revealed that besides the presence of some single nucleotide polymorphisms in the 3pk gene, we could not detect any possible loss of function mutation in any of these 30 metastatic melanoma samples selected for the presence of activating mutations within the Ras/Raf/Mek/Erk signaling pathway. Conclusion Hence, in melanoma with constitutively active Ras/Raf inactivating mutations within the 3pk gene do not contribute to the oncogenic phenotype of this highly malignant tumor.

  3. Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Fernanda Veronese Oliveira

    2014-01-01

    Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.

  4. Prothrombin G20210A gene mutation in pregnant females with thrombotic obstetric complications

    International Nuclear Information System (INIS)

    Alam, M.A.; Ali, N.; Ayyub, M.

    2018-01-01

    To determine the frequency of prothrombin G20210A gene mutation in pregnant females with adverse thrombotic obstetric complication and to compare it with prothrombin G20210A gene's frequency in control population. Study Design: Case control study. Place and Duration of Study: Department of Haematology, Army Medical College Rawalpindi and Military Hospital Rawalpindi, from Nov 2013 to Oct 2014. Material and Methods: Sixty pregnant females were included in the study; 30 were cases with adverse thrombotic obstetric complication, while 30 were controls. Detailed history was obtained and 3 ml blood in EDTA tube was collected. DNA was extracted from whole blood and through RT-PCR, presence of prothrombin G20210A gene mutation was looked for in patients and controls. Data was analyzed using SPSS 21. Results: A total of 60 women-30 cases with thrombotic obstetric complications as 'cases' and 30 as 'controls'- were included in the study. Mean age of 'cases' was 28.70 +- 4.23 years while that of 'controls' was 27.33 +- 4.49 years. There was no statistically significant difference among the two groups (p=0.54). In case group only one of 30 (3.3%) patients had heterozygous F2 G20210A mutation while 29 (96.7%) patients had wild type allele. In control group, all the 30 (100%) subjects had wild type allele. The odds of finding the mutation in cases was 1:29 i.e. 0.03 as compared to zero in the control group. The difference was statistically insignificant (p=0.5). Conclusion: Our study shows that the frequency of F2 G20210A gene mutation in pregnant females having adverse thrombotic obstetric complications was not significantly different from its frequency in control population. (author)

  5. Mutation analysis of the NRXN1 gene in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Onay H

    2016-12-01

    Full Text Available The aim of this study was to identify the sequence mutations in the Neurexin 1 (NRXN1 gene that has been considered as one of the strong candidate genes. A total of 30 children and adolescents (aged 3-18 with non syndromic autism were enrolled this study. Sequencing of the coding exons and the exon-intron boundaries of the NRXN1 gene was performed. Two known mutations were described in two different cases. Heterozygous S14L was determined in one patient and heterozygous L748I was determined in another patient. The S14L and L748I mutations have been described in the patients with autism before. Both of these mutations were inherited from their father. In this study, two of 30 (6.7% autism spectrum disorder (ASD patients carrying NRXN1 gene mutations were detected. It indicates that variants in the NRXN1 gene might confer a risk of developing nonsyndromic ASD. However, due to the reduced penetrance in the gene, the causal role of the NRXN1 gene mutations must be evaluated carefully in all cases.

  6. Hemochromatosis (HFE) gene mutations and response to chloroquine in porphyria cutanea tarda.

    Science.gov (United States)

    Stölzel, Ulrich; Köstler, Erich; Schuppan, Detlef; Richter, Matthias; Wollina, Uwe; Doss, Manfred O; Wittekind, Christian; Tannapfel, Andrea

    2003-03-01

    To examine the role of hemochromatosis (HFE) gene mutations, which are associated with porphyria cutanea tarda (PCT), in the therapeutic response to chloroquine. We retrospectively analyzed a database (Excel version 2001 [Microsoft Excel, Redmond, Wash]; date range of search, 1985-1999) of chloroquine-treated patients with PCT on whether HFE mutations (C282Y and H63D) might have influenced the clinical response, urinary porphyrin excretion, liver enzyme activities, and serum iron markers. Serum samples and corresponding complete sets of data before and after therapy were available in 62 of 207 patients with PCT who were treated exclusively with chloroquine. Academic teaching hospital. For treatment, low-dose chloroquine diphosphate, 125 to 250 mg twice weekly, was used during a median time of 16 months (range, 12-26 months). Of the 62 German patients with PCT, 37 (60%) carries HFE mutations. Chloroquine therapy was accompanied by clinical remission and reduced urinary porphyrin excretion (P<.001) in the 24 patients (39%) with HFE wild type as well as in 35 HFE heterozygous patients with PCT (56%). Decreases of serum iron markers following chloroquine therapy were limited to patients with PCT and HFE wild type. All patients homozygous for the C282Y mutation (3 [5%] of 62) had high serum iron, ferritin, and transferrin saturation and failed to respond to chloroquine treatment. The therapeutic response to chloroquine was not compromised by C282Y heterozygosity and compound heterozygosity of HFE mutations. Because HFE C282Y homozygotes (+/+) did not respond to chloroquine and a decrease in serum iron concentration was limited to patients with PCT and HFE wild type, phlebotomy should be first-line therapy in patients with PCT and HFE mutations.

  7. Update of the androgen receptor gene mutations database.

    Science.gov (United States)

    Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1999-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). Copyright 1999 Wiley-Liss, Inc.

  8. p53, erbB-2 and K-ras gene alterations are rare in spontaneous and plutonium-239-induced canine lung neoplasia

    International Nuclear Information System (INIS)

    Tierney, L.A.; Hahn, F.F.; Lechner, J.F.

    1996-01-01

    Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs

  9. Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

    Science.gov (United States)

    Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco

    2017-01-01

    Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.

  10. Chromosome 16 microdeletion in a patient with juvenile neuronal ceroid lipofuscinosis (Batten disease)

    NARCIS (Netherlands)

    Taschner, P. E.; de Vos, N.; Thompson, A. D.; Callen, D. F.; Doggett, N.; Mole, S. E.; Dooley, T. P.; Barth, P. G.; Breuning, M. H.

    1995-01-01

    The gene that is involved in juvenile neuronal ceroid lipofuscinosis (JNCL), or Batten disease--CLN3--has been localized to 16p12, and the mutation shows a strong association with alleles of microsatellite markers D16S298, D16S299, and D16S288. Recently, haplotype analysis of a Batten patient from a

  11. Companied P16 genetic and protein status together providing useful information on the clinical outcome of urinary bladder cancer.

    Science.gov (United States)

    Pu, Xiaohong; Zhu, Liya; Fu, Yao; Fan, Zhiwen; Zheng, Jinyu; Zhang, Biao; Yang, Jun; Guan, Wenyan; Wu, Hongyan; Ye, Qing; Huang, Qing

    2018-04-01

    SPEC P16/CEN3/7/17 Probe fluorescence-in-situ-hybridization (FISH) has become the most sensitive method in indentifying the urothelial tumors and loss of P16 has often been identified in low-grade urothelial lesions; however, little is known about the significations of other P16 genetic status (normal and amplification) in bladder cancer.We detected P16 gene status by FISH in 259 urine samples and divided these samples into 3 groups: 1, normal P16; 2, loss of P16; and 3, amplified P16. Meanwhile, p16 protein expression was measured by immunocytochemistry and we characterized the clinicopathologic features of cases with P16 gene status.Loss of P16 occurred in 26.2%, P16 amplification occurred in 41.3% and P16 gene normal occurred in 32.4% of all cases. P16 genetic status was significantly associated with tumor grade and primary tumor status (P = .008 and .017), but not with pathological tumor stage, overall survival, and p16 protein expression. However, P16 gene amplification accompanied protein high-expression has shorter overall survival compared with the overall patients (P = .023), and P16 gene loss accompanied loss of protein also had the tendency to predict bad prognosis (P = .067).Studies show that the genetic status of P16 has a close relation with the stages of bladder cancer. Loss of P16 is associated with low-grade urothelial malignancy while amplified P16 donotes high-grade. Neither P16 gene status nor p16 protein expression alone is an independent predictor of urothelial bladder carcinoma, but combine gene and protein status together providing useful information on the clinical outcome of these patients.

  12. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  13. Frequency of mutations in the genes associated with hereditary sensory and autonomic neuropathy in a UK cohort.

    LENUS (Irish Health Repository)

    Davidson, G L

    2012-08-01

    The hereditary sensory and autonomic neuropathies (HSAN, also known as the hereditary sensory neuropathies) are a clinically and genetically heterogeneous group of disorders, characterised by a progressive sensory neuropathy often complicated by ulcers and amputations, with variable motor and autonomic involvement. To date, mutations in twelve genes have been identified as causing HSAN. To study the frequency of mutations in these genes and the associated phenotypes, we screened 140 index patients in our inherited neuropathy cohort with a clinical diagnosis of HSAN for mutations in the coding regions of SPTLC1, RAB7, WNK1\\/HSN2, FAM134B, NTRK1 (TRKA) and NGFB. We identified 25 index patients with mutations in six genes associated with HSAN (SPTLC1, RAB7, WNK1\\/HSN2, FAM134B, NTRK1 and NGFB); 20 of which appear to be pathogenic giving an overall mutation frequency of 14.3%. Mutations in the known genes for HSAN are rare suggesting that further HSAN genes are yet to be identified. The p.Cys133Trp mutation in SPTLC1 is the most common cause of HSAN in the UK population and should be screened first in all patients with sporadic or autosomal dominant HSAN.

  14. Frequency of mutations in the genes associated with hereditary sensory and autonomic neuropathy in a UK cohort.

    Science.gov (United States)

    Davidson, G L; Murphy, S M; Polke, J M; Laura, M; Salih, M A M; Muntoni, F; Blake, J; Brandner, S; Davies, N; Horvath, R; Price, S; Donaghy, M; Roberts, M; Foulds, N; Ramdharry, G; Soler, D; Lunn, M P; Manji, H; Davis, M B; Houlden, H; Reilly, M M

    2012-08-01

    The hereditary sensory and autonomic neuropathies (HSAN, also known as the hereditary sensory neuropathies) are a clinically and genetically heterogeneous group of disorders, characterised by a progressive sensory neuropathy often complicated by ulcers and amputations, with variable motor and autonomic involvement. To date, mutations in twelve genes have been identified as causing HSAN. To study the frequency of mutations in these genes and the associated phenotypes, we screened 140 index patients in our inherited neuropathy cohort with a clinical diagnosis of HSAN for mutations in the coding regions of SPTLC1, RAB7, WNK1/HSN2, FAM134B, NTRK1 (TRKA) and NGFB. We identified 25 index patients with mutations in six genes associated with HSAN (SPTLC1, RAB7, WNK1/HSN2, FAM134B, NTRK1 and NGFB); 20 of which appear to be pathogenic giving an overall mutation frequency of 14.3%. Mutations in the known genes for HSAN are rare suggesting that further HSAN genes are yet to be identified. The p.Cys133Trp mutation in SPTLC1 is the most common cause of HSAN in the UK population and should be screened first in all patients with sporadic or autosomal dominant HSAN.

  15. Mitochondrial DNA depletion syndrome due to mutations in the RRM2B gene.

    Science.gov (United States)

    Bornstein, Belén; Area, Estela; Flanigan, Kevin M; Ganesh, Jaya; Jayakar, Parul; Swoboda, Kathryn J; Coku, Jorida; Naini, Ali; Shanske, Sara; Tanji, Kurenai; Hirano, Michio; DiMauro, Salvatore

    2008-06-01

    Mitochondrial DNA depletion syndrome (MDS) is characterized by a reduction in mtDNA copy number and has been associated with mutations in eight nuclear genes, including enzymes involved in mitochondrial nucleotide metabolism (POLG, TK2, DGUOK, SUCLA2, SUCLG1, PEO1) and MPV17. Recently, mutations in the RRM2B gene, encoding the p53-controlled ribonucleotide reductase subunit, have been described in seven infants from four families, who presented with various combinations of hypotonia, tubulopathy, seizures, respiratory distress, diarrhea, and lactic acidosis. All children died before 4 months of age. We sequenced the RRM2B gene in three unrelated cases with unexplained severe mtDNA depletion. The first patient developed intractable diarrhea, profound weakness, respiratory distress, and died at 3 months. The other two unrelated patients had a much milder phenotype and are still alive at ages 27 and 36 months. All three patients had lactic acidosis and severe depletion of mtDNA in muscle. Muscle histochemistry showed RRF and COX deficiency. Sequencing the RRM2B gene revealed three missense mutations and two single nucleotide deletions in exons 6, 8, and 9, confirming that RRM2B mutations are important causes of MDS and that the clinical phenotype is heterogeneous and not invariably fatal in infancy.

  16. Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

    Science.gov (United States)

    Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

    2009-10-01

    Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

  17. MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS

    Directory of Open Access Journals (Sweden)

    D. S. Mikhaylenko

    2016-01-01

    Full Text Available In the recent years, the full exome sequencing helped to reveal a  set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the

  18. Congenital hypopituitarism due to POU1F1 gene mutation.

    Science.gov (United States)

    Lee, Ni-Chung; Tsai, Wen-Yu; Peng, Shinn-Forng; Tung, Yi-Ching; Chien, Yin-Hsiu; Hwu, Wuh-Liang

    2011-01-01

    POU1F1 (Pit-1; Gene ID 5449) is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome), elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S) mutation. The rarity of the disease can result in delayed diagnosis and treatment. Copyright © 2011 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All rights reserved.

  19. Mutations in the ABCA4 (ABCR) gene are the major cause of autosomal recessive cone-rod dystrophy.

    Science.gov (United States)

    Maugeri, A; Klevering, B J; Rohrschneider, K; Blankenagel, A; Brunner, H G; Deutman, A F; Hoyng, C B; Cremers, F P

    2000-10-01

    The photoreceptor cell-specific ATP-binding cassette transporter gene (ABCA4; previously denoted "ABCR") is mutated, in most patients, with autosomal recessive (AR) Stargardt disease (STGD1) or fundus flavimaculatus (FFM). In addition, a few cases with AR retinitis pigmentosa (RP) and AR cone-rod dystrophy (CRD) have been found to have ABCA4 mutations. To evaluate the importance of the ABCA4 gene as a cause of AR CRD, we selected 5 patients with AR CRD and 15 patients from Germany and The Netherlands with isolated CRD. Single-strand conformation-polymorphism analysis and sequencing revealed 19 ABCA4 mutations in 13 (65%) of 20 patients. In six patients, mutations were identified in both ABCA4 alleles; in seven patients, mutations were detected in one allele. One complex ABCA4 allele (L541P;A1038V) was found exclusively in German patients with CRD; one patient carried this complex allele homozygously, and five others were compound heterozygous. These findings suggest that mutations in the ABCA4 gene are the major cause of AR CRD. A primary role of the ABCA4 gene in STGD1/FFM and AR CRD, together with the gene's involvement in an as-yet-unknown proportion of cases with AR RP, strengthens the idea that mutations in the ABCA4 gene could be the most frequent cause of inherited retinal dystrophy in humans.

  20. Shell model description of 16O(p,γ)17F and 16O(p,p)16O reactions

    International Nuclear Information System (INIS)

    Bennaceur, K.; Michel, N.; Okolowicz, J.; Ploszajczak, M.; Bennaceur, K.; Nowacki, F.; Okolowicz, J.

    2000-01-01

    We present shell model calculations of both the structure of 17 F and the reactions 16 O(p,γ) 17 F, 16 O(p,p) 16 O. We use the ZBM interaction which provides a fair description of the properties of 16 O and neighbouring nuclei and, in particular it takes account for the complicated correlations in coexisting low-lying states of 16 O. (authors)

  1. [Clone, construct, expression and verification of lactoferricin B gene and several sequence mutations in yeast].

    Science.gov (United States)

    Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang

    2007-07-01

    To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.

  2. Lack of robustness of life extension associated with several single-gene P element mutations in Drosophila melanogaster.

    Science.gov (United States)

    Mockett, Robin J; Nobles, Amber C

    2013-10-01

    The hypothesis tested in this study was that single-gene mutations found previously to extend the life span of Drosophila melanogaster could do so consistently in both long-lived y w and standard w (1118) genetic backgrounds. GAL4 drivers were used to express upstream activation sequence (UAS)-responder transgenes globally or in the nervous system. Transgenes associated with oxidative damage prevention (UAS-hSOD1 and UAS-GCLc) or removal (EP-UAS-Atg8a and UAS-dTOR (FRB) ) failed to increase mean life spans in any expression pattern in either genetic background. Flies containing a UAS-EGFP-bMSRA (C) transgene associated with protein repair were found not to exhibit life extension or detectable enhanced green fluorescent protein (EGFP) activity. The presence of UAS-responder transgenes was confirmed by PCR amplification and sequencing at the 5' and 3' end of each insertion. These results cast doubt on the robustness of life extension in flies carrying single-gene mutations and suggest that the effects of all such mutations should be tested independently in multiple genetic backgrounds and laboratory environments.

  3. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    Science.gov (United States)

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  4. Analysis of Hungarian patients with Rett syndrome phenotype for MECP2, CDKL5 and FOXG1 gene mutations.

    Science.gov (United States)

    Hadzsiev, Kinga; Polgar, Noemi; Bene, Judit; Komlosi, Katalin; Karteszi, Judit; Hollody, Katalin; Kosztolanyi, Gyorgy; Renieri, Alessandra; Melegh, Bela

    2011-03-01

    Rett syndrome (RTT) is characterized by a relatively specific clinical phenotype. We screened 152 individuals with RTT phenotype. A total of 22 different known MECP2 mutations were identified in 42 subjects (27.6%). Of the 22 mutations, we identified 7 (31.8%) frameshift-causing deletions, 4 (18.2%) nonsense, 10 (45.5%) missense mutations and one insertion (4.5%). The most frequent pathologic changes were: p.Thr158Met (14.2%) and p.Arg133Cys (11.9%) missense, and p.Arg255Stop (9.5%) and p.Arg294Stop (9.5%) nonsense mutations. We also detected the c.925C >T (p.Arg309Trp) mutation in an affected patient, whose role in RTT pathogenesis is still unknown. Patients without detectable MECP2 defects were screened for mutations of cyclin-dependent kinase-like 5 (CDKL5) gene, responsible for the early-onset variant of RTT. We discovered two novel mutations: c.607G >T resulting in a termination codon at aa203, disrupting the catalytic domain, and c.1708G >T leading to a stop at aa570 of the C terminus. Both patients with CDKL5 mutation presented therapy-resistant epilepsy and a phenotype fitting with the diagnosis of early-onset variant of RTT. No FOXG1 mutation was detected in any of the remaining patients. A total of 110 (72.5%) patients remained without molecular genetic diagnosis that necessitates further search for novel gene mutations in this phenotype. Our results also suggest the need of screening for CDKL5 mutations in patients with Rett phenotype tested negative for MECP2 mutations.

  5. Novel homozygous nonsense mutations in the luteinizing hormone receptor (LHCGR) gene associated with 46,XY primary amenorrhea.

    Science.gov (United States)

    Ben Hadj Hmida, Imen; Mougou-Zerelli, Soumaya; Hadded, Anis; Dimassi, Sarra; Kammoun, Molka; Bignon-Topalovic, Joelle; Bibi, Mohamed; Saad, Ali; Bashamboo, Anu; McElreavey, Ken

    2016-07-01

    To determine the genetic cause of 46,XY primary amenorrhea in three 46,XY girls. Whole exome sequencing. University cytogenetics center. Three patients with unexplained 46,XY primary amenorrhea were included in the study. Potentially pathogenic variants were confirmed by Sanger sequencing, and familial segregation was determined where parents' DNA was available. Exome sequencing was performed in the three patients, and the data were analyzed for potentially pathogenic mutations. The functional consequences of mutations were predicted. Three novel homozygous nonsense mutations in the luteinizing hormone receptor (LHCGR) gene were identified:c.1573 C→T, p.Gln525Ter, c.1435 C→T p.Arg479Ter, and c.508 C→T, p.Gln170Ter. Inactivating mutations of the LHCGR gene may be a more common cause of 46,XY primary amenorrhea than previously considered. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  6. Quantum dots immunofluorescence histochemical detection of EGFR gene mutations in the non-small cell lung cancers using mutation-specific antibodies

    Directory of Open Access Journals (Sweden)

    Qu YG

    2014-12-01

    Full Text Available Yan-Gang Qu,1 Qian Zhang,2 Qi Pan,3 Xian-Da Zhao,4 Yan-Hua Huang,2 Fu-Chun Chen,3 Hong-Lei Chen41Department of Pathology, The Central Hospital of Enshi Autonomous Prefecture, Enshi, 2Department of Molecular Pathology, Wuhan Nano Tumor Diagnosis Engineering Research Center, Wuhan, Hubei, People’s Republic of China; 3Department of Thoracosurgery, Traditional Chinese Medical Hospital of Wenling, Wenling, Zhejiang, People’s Republic of China; 4Department of Pathology, School of Basic Medical Science, Wuhan University, Wuhan, Hubei, People’s Republic of ChinaBackground: Epidermal growth factor receptor (EGFR mutation status plays an important role in therapeutic decision making for non-small cell lung cancer (NSCLC patients. Since EGFR mutation-specific antibodies (E746-A750del and L858R have been developed, EGFR mutation detection by immunohistochemistry (IHC is a suitable screening test. On this basis, we want to establish a new screening test, quantum dots immunofluorescence histochemistry (QDs-IHC, to assess EGFR gene mutation in NSCLC tissues, and we compared it to traditional IHC and amplification refractory mutation system (ARMS.Materials and methods: EGFR gene mutations were detected by QDs-IHC, IHC, and ADx-ARMS in 65 cases of NSCLC composed of 55 formalin-fixed, paraffin-embedded specimens and ten pleural effusion cell blocks, including 13 squamous cell carcinomas, two adenosquamous carcinomas, and 50 adenocarcinomas.Results: Positive rates of EGFR gene mutations detected by QDs-IHC, IHC, and ADx-ARMS were 40.0%, 36.9%, and 46.2%, respectively, in 65 cases of NSCLC patients. The sensitivity of QDs-IHC when detecting EGFR mutations, as compared to ADx-ARMS, was 86.7% (26/30; the specificity for both antibodies was 100.0% (26/26. IHC sensitivity was 80.0% (24/30 and the specificity was 92.31% (24/26. When detecting EGFR mutations, QDs-IHC and ADx-ARMS had perfect consistency (κ=0.882; P<0.01. Excellent agreement was observed

  7. Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

    Science.gov (United States)

    Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

    2016-10-31

    To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

  8. High frequency of p 16 promoter methylation in non-small cell lung carcinomas from Chile

    Directory of Open Access Journals (Sweden)

    LEDA M GUZMAN

    2007-01-01

    Full Text Available The inactivation of tumour suppressor genes by aberrant methylation of promoter regions has been described as a frequent event in neoplasia development, including lung cancer. The p16 gene is a tumour suppressor gene involved in the regulation of cell cycle progression that has been reported to be inactivated by promoter methylation in lung carcinomas at variable frequencies around the world in a smoking habit dependent manner. The purpose of this study was to investigate the methylation status of the promoter region of the p16 gene in 74 non-small cell lung carcinomas from Chile. The frequency of p16 gene inactivation by promoter methylation was determined as 79.7% (59/74. When we considered histological type, we observed that p16 promoter methylation was significantly higher in squamous cell carcinomas (30/33, 91% compared with adenocarcinomas (21/30, 70% (p=0.029. In addition, no association between p16 promoter methylation and gender, age or smoking habit was found (p=0.202, 0.202 and 0.147 respectively. Our results suggest that p16 promoter hypermethylation is a very frequent event in non-small cell lung carcinomas from Chile and could be smoking habit-independent

  9. Neonatal High Bone Mass With First Mutation of the NF-κB Complex: Heterozygous De Novo Missense (p.Asp512Ser) RELA (Rela/p65).

    Science.gov (United States)

    Frederiksen, Anja L; Larsen, Martin J; Brusgaard, Klaus; Novack, Deborah V; Knudsen, Peter Juel Thiis; Schrøder, Henrik Daa; Qiu, Weimin; Eckhardt, Christina; McAlister, William H; Kassem, Moustapha; Mumm, Steven; Frost, Morten; Whyte, Michael P

    2016-01-01

    Heritable disorders that feature high bone mass (HBM) are rare. The etiology is typically a mutation(s) within a gene that regulates the differentiation and function of osteoblasts (OBs) or osteoclasts (OCs). Nevertheless, the molecular basis is unknown for approximately one-fifth of such entities. NF-κB signaling is a key regulator of bone remodeling and acts by enhancing OC survival while impairing OB maturation and function. The NF-κB transcription complex comprises five subunits. In mice, deletion of the p50 and p52 subunits together causes osteopetrosis (OPT). In humans, however, mutations within the genes that encode the NF-κB complex, including the Rela/p65 subunit, have not been reported. We describe a neonate who died suddenly and unexpectedly and was found at postmortem to have HBM documented radiographically and by skeletal histopathology. Serum was not available for study. Radiographic changes resembled malignant OPT, but histopathological investigation showed morphologically normal OCs and evidence of intact bone resorption excluding OPT. Furthermore, mutation analysis was negative for eight genes associated with OPT or HBM. Instead, accelerated bone formation appeared to account for the HBM. Subsequently, trio-based whole exome sequencing revealed a heterozygous de novo missense mutation (c.1534_1535delinsAG, p.Asp512Ser) in exon 11 of RELA encoding Rela/p65. The mutation was then verified using bidirectional Sanger sequencing. Lipopolysaccharide stimulation of patient fibroblasts elicited impaired NF-κB responses compared with healthy control fibroblasts. Five unrelated patients with unexplained HBM did not show a RELA defect. Ours is apparently the first report of a mutation within the NF-κB complex in humans. The missense change is associated with neonatal osteosclerosis from in utero increased OB function rather than failed OC action. These findings demonstrate the importance of the Rela/p65 subunit within the NF-κB pathway for human

  10. Frequent POLE1 p.S297F mutation in Chinese patients with ovarian endometrioid carcinoma

    International Nuclear Information System (INIS)

    Zou, Yang; Liu, Fa-Ying; Liu, Huai; Wang, Feng; Li, Wei; Huang, Mei-Zhen; Huang, Yan; Yuan, Xiao-Qun; Xu, Xiao-Yun; Huang, Ou-Ping; He, Ming

    2014-01-01

    The catalytic subunit of DNA polymerase epsilon (POLE1) functions primarily in nuclear DNA replication and repair. Recently, POLE1 mutations were detected frequently in colorectal and endometrial carcinomas while with lower frequency in several other types of cancer, and the p.P286R and p.V411L mutations were the potential mutation hotspots in human cancers. Nevertheless, the mutation frequency of POLE1 in ovarian cancer still remains largely unknown. Here, we screened a total of 251 Chinese samples with distinct subtypes of ovarian carcinoma for the presence of POLE1 hotspot mutations by direct sequencing. A heterozygous somatic POLE1 mutation, p.S297F (c.890C>T), but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was identified in 3 out of 37 (8.1%) patients with ovarian endometrioid carcinoma; this mutation was evolutionarily highly conserved from Homo sapiens to Schizosaccharomyces. Of note, the POLE1 mutation coexisted with mutation in the ovarian cancer-associated PPP2R1A (protein phosphatase 2, regulatory subunit A, α) gene in a 46-year-old patient, who was also diagnosed with ectopic endometriosis in the benign ovary. In addition, a 45-year-old POLE1-mutated ovarian endometrioid carcinoma patient was also diagnosed with uterine leiomyoma while the remaining 52-year-old POLE1-mutated patient showed no additional distinctive clinical manifestation. In contrast to high frequency of POLE1 mutations in ovarian endometrioid carcinoma, no POLE1 mutations were identified in patients with other subtypes of ovarian carcinoma. Our results showed for the first time that the POLE1 p.S297F mutation, but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was frequent in Chinese ovarian endometrioid carcinoma, but absent in other subtypes of ovarian carcinoma. These results implicated that POLE1 p.S297F mutation might be actively involved in the pathogenesis of ovarian endometrioid carcinoma, but might not be actively

  11. Frequent POLE1 p.S297F mutation in Chinese patients with ovarian endometrioid carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Zou, Yang; Liu, Fa-Ying; Liu, Huai; Wang, Feng [Key Laboratory of Women' s Reproductive Health of Jiangxi Province, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Central Laboratory, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Li, Wei [Key Laboratory of Women' s Reproductive Health of Jiangxi Province, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Central Laboratory, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Graduate School of Nanchang University, Nanchang, Jiangxi 330031 (China); Huang, Mei-Zhen [Graduate School of Nanchang University, Nanchang, Jiangxi 330031 (China); Jiangxi Provincial Cancer Institute, Jiangxi Provincial Cancer Hospital, Nanchang, Jiangxi 330029 (China); Huang, Yan; Yuan, Xiao-Qun [Key Laboratory of Women' s Reproductive Health of Jiangxi Province, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Central Laboratory, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006 (China); Graduate School of Nanchang University, Nanchang, Jiangxi 330031 (China); Xu, Xiao-Yun [Graduate School of Nanchang University, Nanchang, Jiangxi 330031 (China); Jiangxi Provincial Cancer Institute, Jiangxi Provincial Cancer Hospital, Nanchang, Jiangxi 330029 (China); Huang, Ou-Ping, E-mail: huangouping@gmail.com [Jiangxi Provincial Cancer Institute, Jiangxi Provincial Cancer Hospital, Nanchang, Jiangxi 330029 (China); He, Ming, E-mail: jxhm56@hotmail.com [Department of Pharmacology and Molecular Therapeutics, Nanchang University School of Pharmaceutical Science, Nanchang 330006 (China)

    2014-03-15

    The catalytic subunit of DNA polymerase epsilon (POLE1) functions primarily in nuclear DNA replication and repair. Recently, POLE1 mutations were detected frequently in colorectal and endometrial carcinomas while with lower frequency in several other types of cancer, and the p.P286R and p.V411L mutations were the potential mutation hotspots in human cancers. Nevertheless, the mutation frequency of POLE1 in ovarian cancer still remains largely unknown. Here, we screened a total of 251 Chinese samples with distinct subtypes of ovarian carcinoma for the presence of POLE1 hotspot mutations by direct sequencing. A heterozygous somatic POLE1 mutation, p.S297F (c.890C>T), but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was identified in 3 out of 37 (8.1%) patients with ovarian endometrioid carcinoma; this mutation was evolutionarily highly conserved from Homo sapiens to Schizosaccharomyces. Of note, the POLE1 mutation coexisted with mutation in the ovarian cancer-associated PPP2R1A (protein phosphatase 2, regulatory subunit A, α) gene in a 46-year-old patient, who was also diagnosed with ectopic endometriosis in the benign ovary. In addition, a 45-year-old POLE1-mutated ovarian endometrioid carcinoma patient was also diagnosed with uterine leiomyoma while the remaining 52-year-old POLE1-mutated patient showed no additional distinctive clinical manifestation. In contrast to high frequency of POLE1 mutations in ovarian endometrioid carcinoma, no POLE1 mutations were identified in patients with other subtypes of ovarian carcinoma. Our results showed for the first time that the POLE1 p.S297F mutation, but not p.P286R and p.V411L hotspot mutations observed in other cancer types, was frequent in Chinese ovarian endometrioid carcinoma, but absent in other subtypes of ovarian carcinoma. These results implicated that POLE1 p.S297F mutation might be actively involved in the pathogenesis of ovarian endometrioid carcinoma, but might not be actively

  12. P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

    International Nuclear Information System (INIS)

    Tierney, L.A.; Johnson, N.F.; Lechner, J.F.

    1994-01-01

    Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

  13. Identification of SCN1A and PCDH19 mutations in Chinese children with Dravet syndrome.

    Directory of Open Access Journals (Sweden)

    Anna Ka-Yee Kwong

    Full Text Available BACKGROUND: Dravet syndrome is a severe form of epilepsy. Majority of patients have a mutation in SCN1A gene, which encodes a voltage-gated sodium channel. A recent study has demonstrated that 16% of SCN1A-negative patients have a mutation in PCDH19, the gene encoding protocadherin-19. Mutations in other genes account for only a very small proportion of families. TSPYL4 is a novel candidate gene within the locus 6q16.3-q22.31 identified by linkage study. OBJECTIVE: The present study examined the mutations in epileptic Chinese children with emphasis on Dravet syndrome. METHODS: A hundred children with severe epilepsy were divided into Dravet syndrome and non-Dravet syndrome groups and screened for SCN1A mutations by direct sequencing. SCN1A-negative Dravet syndrome patients and patients with phenotypes resembling Dravet syndrome were checked for PCDH19 and TSPYL4 mutations. RESULTS: Eighteen patients (9 males, 9 females were diagnosed to have Dravet syndrome. Among them, 83% (15/18 had SCN1A mutations including truncating (7, splice site (2 and missense mutations (6. The truncating/splice site mutations were associated with moderate to severe degree of intellectual disability (p<0.05. During the progression of disease, 73% (11/15 had features fitting into the diagnostic criteria of autism spectrum disorder and 53% (8/15 had history of vaccination-induced seizures. A novel PCDH19 p.D377N mutation was identified in one SCN1A-negative female patient with Dravet syndrome and a known PCDH19 p.N340S mutation in a female non-Dravet syndrome patient. The former also inherited a TSPYL4 p.G60R variant. CONCLUSION: A high percentage of SCN1A mutations was identified in our Chinese cohort of Dravet syndrome patients but none in the rest of patients. We demonstrated that truncating/splice site mutations were linked to moderate to severe intellectual disability in these patients. A de novo PCDH19 missense mutation together with an inherited TSPYL4 missense

  14. Effect of genes controlling radiation sensitivity on chemically induced mutations in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Prakash, L.

    1976-01-01

    The effect of 16 different genes (rad) conferring radiation sensitivity on chemically induced reversion in the yeast Saccharomyces cerevisiae was determined. The site of reversion used was a well-defined chain initiation mutant mapping in the structural gene coding for iso-1-cytochrome c. High doses of EMS and HNO 2 resulted in decreased reversion of cyc1-131 in rad6, rad9 and rad15 strains compared to the normal RAD + strains. In addition, rad52 greatly decreased EMS reversion of cyc1-131 but had no effect on HNO 2 -induced reversion; rad18, on the other hand, increased HNO 2 -induced reversion but did not alter EMS-induced reversion. When NQO was used as the mutagen, every rad gene tested, except for rad18, had an effect on reversion; rad6, rad9, rad15, rad17, rad18, rad22, rev1, rev2, and rev3 lowered NQO reversion while rad1, rad2, rad3, rad4, rad10, rad12, and rad16 increased it compared to the RAD + strain. The effect of rad genes on chemical mutagenesis is discussed in terms of their effect on uv mutagenesis. It is concluded that although the nature of the repair pathways may differ for uv- and chemically-induced mutations in yeast, a functional repair system is required for the induction of mutation by the chemical agents NQO, EMS, and HNO 2

  15. THYROID HORMONE RECEPTOR BETA GENE MUTATION (P453A) IN A TURKISH FAMILY PRODUCING RESISTANCE TO THYROID HORMONE

    Science.gov (United States)

    Bayraktaroglu, Taner; Noel, Janet; Mukaddes, Nahit Motavalli; Refetoff, Samuel

    2018-01-01

    Two members of a Turkish family, a mother and son, had thyroid function tests suggestive of resistance to thyroid hormone (RTH). The clinical presentation was, however, different. The mother (proposita) had palpitation, weakness, tiredness, nervousness, dry mouth and was misdiagnosed as having multinodular toxic goiter which was treated with antithyroid drugs and partial thyroidectomy. Her younger son had attention deficit hyperactivity disorder and primary encopresis, but normal intellectual quotient. Both had elevated serum iodothyronine levels with nonsuppressed thyrotropin. A mutation in one allele of the thyroid hormone receptor beta gene (P453A) was identified, providing a genetic confirmation for the diagnosis of RTH. PMID:18561095

  16. Molecular analysis of the most prevalent mutations of the FANCA and FANCC genes in Brazilian patients with Fanconi anaemia

    Directory of Open Access Journals (Sweden)

    David Enrique Aguilar Rodriguez

    2005-01-01

    Full Text Available Fanconi anaemia (FA is a recessive autosomal disease determined by mutations in genes of at least eleven complementation groups, with distinct distributions in different populations. As far as we know, there are no reports regarding the molecular characterisation of the disease in unselected FA patients in Brazil. OBECTIVE: This study aimed to investigate the most prevalent mutations of FANCA and FANCC genes in Brazilian patients with FA. METHODS: Genomic DNA obtained from 22 racially and ethnically diverse unrelated FA patients (mean age ± SD: 14.0 ± 7.8 years; 10 male, 12 female; 14 white, 8 black was analysed by polymerase chain reaction and restriction site assays for identification of FANCA (delta3788-3790 and FANCC (delta322G, IVS4+4A -> T, W22X, L496R, R548X, Q13X, R185X, and L554P gene mutations. RESULTS: Mutations in FANCA and FANCC genes were identified in 6 (27.3% and 14 (63.6% out of 22 patients, respectively. The disease could not be attributed to the tested mutations in the two remaining patients enrolled in the study (9.1%. The registry of the two most prevalent gene abnormalities (delta3788-3790 and IVS4 + 4 -> T revealed that they were present in 18.2% and 15.9% of the FA alleles, respectively. Additional FANCC gene mutations were found in the study, with the following prevalence: delta322G (11.4%, W22X (9.1%, Q13X (2.3%, L554P (2.3%, and R548X (2.3% of total FA alleles. CONCLUSION: These results suggest that mutations of FANCA and FANCC genes are the most prevalent mutations among FA patients in Brazil.

  17. Identification of a Novel HADHB Gene Mutation in an Iranian Patient with Mitochondrial Trifunctional Protein Deficiency.

    Science.gov (United States)

    Shahrokhi, Mahdiyeh; Shafiei, Mohammad; Galehdari, Hamid; Shariati, Gholamreza

    2017-01-01

    Mitochondrial trifunctional protein (MTP) is a hetero-octamer composed of eight parts (subunits): four α-subunits containing LCEH (long-chain 2,3-enoyl-CoA  hydratase) and LCHAD (long-chain 3-hydroxyacyl CoA dehydrogenase) activity, and four β-subunits that possess LCKT (long-chain  3-ketoacyl-CoA thiolase) activity which catalyzes three out of four steps in β-oxidation spiral of long-chain fatty acid. Its deficiency is an autosomal recessive disorder that causes a clinical spectrum of diseases. A blood spot was collected from the patient's original newborn screening card with parental informed consent. A newborn screening test and quantity plasma acylcarnitine profile analysis by MS/MS were performed. After isolation of DNA and Amplification of all exons of the HADHA and HADHB, directly Sequence analyses of all exons and the flanking introns both of genes were performed. Here, we report a novel mutation in a patient with MTP deficiency diagnosed with newborn screening test and quantity plasma acylcarnitine profile analysis by MS/MS and then confirmed by enzyme analysis in cultured fibroblasts and direct sequencing of the HADHA and HADHB genes. Molecular analysis of causative genes showed a missense mutation (p.Q385P) c.1154A > C in exon 14 of HADHB gene. Since this mutation was not found in 50 normal control cases; so it was concluded that c.1154A > C mutation was a causative mutation. Phenotype analysis of this mutation predicted pathogenesis which reduces the stability of the MTP protein complex.

  18. [Clinical features and COMP gene mutation in a family with a pseudoachondroplasia child].

    Science.gov (United States)

    Lu, Chun-Ting; Guo, Li; Zahng, Zhan-Hui; Lin, Wei-Xia; Song, Yuan-Zong; Feng, Lie

    2013-11-01

    This study aimed to report the clinical characteristics and COMP gene mutation of a family with pseudoachondroplasia (PSACH), a relatively rare spinal and epiphyseal dysplasia that is inherited as an autosomal dominant trait. Clinical information on a 5-year-2-month-old PSACH child and his parents was collected and analyzed. Diagnosis was confirmed by PCR amplification and direct sequencing of all the 19 exons and their flanking sequences of COMP gene, and the mutation was further ascertained by cloning analysis of exon 10. The child presented with short and stubby fingers, bow leg, short limb dwarfism and metaphysic broadening in long bone as well as lumbar lordosis. A mutation c.1048_1116del (p.Asn350_Asp372del) in exon 10, inherited from his father who did not demonstrate any phenotypic feature of PSACH, was detected in the child. PSACH was diagnosed definitively by means of COMP mutation analysis, on the basis of the child's clinical and imaging features. The non-penetrance phenomenon of COMP mutation was described for the first time in PSACH.

  19. Mutation inactivation of Nijmegen breakage syndrome gene (NBS1 in hepatocellular carcinoma and intrahepatic cholangiocarcinoma.

    Directory of Open Access Journals (Sweden)

    Yan Wang

    Full Text Available Nijmegen breakage syndrome (NBS with NBS1 germ-line mutation is a human autosomal recessive disease characterized by genomic instability and enhanced cancer predisposition. The NBS1 gene codes for a protein, Nbs1(p95/Nibrin, involved in the processing/repair of DNA double-strand breaks. Hepatocellular carcinoma (HCC is a complex and heterogeneous tumor with several genomic alterations. Recent studies have shown that heterozygous NBS1 mice exhibited a higher incidence of HCC than did wild-type mice. The objective of the present study is to assess whether NBS1 mutations play a role in the pathogenesis of human primary liver cancer, including HBV-associated HCC and intrahepatic cholangiocarcinoma (ICC. Eight missense NBS1 mutations were identified in six of 64 (9.4% HCCs and two of 18 (11.1% ICCs, whereas only one synonymous mutation was found in 89 control cases of cirrhosis and chronic hepatitis B. Analysis of the functional consequences of the identified NBS1 mutations in Mre11-binding domain showed loss of nuclear localization of Nbs1 partner Mre11, one of the hallmarks for Nbs1 deficiency, in one HCC and two ICCs with NBS1 mutations. Moreover, seven of the eight tumors with NBS1 mutations had at least one genetic alteration in the TP53 pathway, including TP53 mutation, MDM2 amplification, p14ARF homozygous deletion and promoter methylation, implying a synergistic effect of Nbs1 disruption and p53 inactivation. Our findings provide novel insight on the molecular pathogenesis of primary liver cancer characterized by mutation inactivation of NBS1, a DNA repair associated gene.

  20. Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients

    Directory of Open Access Journals (Sweden)

    Yunus Kasım Terzi

    2016-12-01

    Full Text Available Objective: Hemochromatosis is an autosomal recessive disease that is one of the most important reasons for iron overload. Sickle cell disease is a hemoglobinopathy that occurs as a result of a homozygous mutation in the hemoglobin gene. Erythrocyte transfusion is frequently used in the treatment of this disease. Iron overload as a result of transfusion is important in the mortality and morbidity of sickle cell anemia patients as well as in other hemoglobinopathies. In this study, the effect of hemochromatosis gene (HFE p.H63D and p.C282Y mutations on transfusion-related cardiac and liver iron overload in sickle cell disease patients who carry homozygous hemoglobin S mutation has been investigated. Materials and Methods: This is a prospective single-center crosssectional study in patients with homozygous hemoglobin S mutation between the years 2008 and 2013. The patients were divided into two groups. The first group (group A, n=31 was receiving chelation therapy and the second group (group B, n=13 was not. Direct and indirect iron loads were analyzed by magnetic resonance imaging and biochemically, respectively. HFE gene mutations were analyzed by polymerase chain reaction-restriction fragment length polymorphism method. Statistical analyses were performed by independent samples t-test. Results: p.H63D mutation was detected in 10 (32.3% patients in group A and in only 1 patient (7.7% in group B. When the 2 groups were compared for iron overload, iron deposition in the liver was significantly higher in group B (p=0.046. In addition, in group A, iron deposition was significantly higher in HFE mutation carriers compared to patients without the mutation (p=0.05. Conclusion: Results of this study showed that HFE gene mutations are important in iron deposition in the liver in patients with sickle cell disease.

  1. Mutational analysis of the HGO gene in Finnish alkaptonuria patients

    Science.gov (United States)

    de Bernabe, D. B.-V.; Peterson, P.; Luopajarvi, K.; Matintalo, P.; Alho, A.; Konttinen, Y.; Krohn, K.; de Cordoba, S. R.; Ranki, A.

    1999-01-01

    Alkaptonuria (AKU), the prototypic inborn error of metabolism, has recently been shown to be caused by loss of function mutations in the homogentisate-1,2-dioxygenase gene (HGO). So far 17 mutations have been characterised in AKU patients of different ethnic origin. We describe three novel mutations (R58fs, R330S, and H371R) and one common AKU mutation (M368V), detected by mutational and polymorphism analysis of the HGO gene in five Finnish AKU pedigrees. The three novel AKU mutations are most likely specific for the Finnish population and have originated recently.


Keywords: alkaptonuria; homogentisate-1,2-dioxygenase; Finland PMID:10594001

  2. Evidence for a modifier of onset age in Huntington disease linked to the HD gene in 4p16

    Science.gov (United States)

    Djoussé, Luc; Knowlton, Beth; Hayden, Michael R.; Almqvist, Elisabeth W.; Brinkman, Ryan R.; Ross, Christopher A.; Margolis, Russel L.; Rosenblatt, Adam; Durr, Alexandra; Dode, Catherine; Morrison, Patrick J.; Novelletto, Andrea; Frontali, Marina; Trent, Ronald J. A.; McCusker, Elizabeth; Gómez-Tortosa, Estrella; Mayo Cabrero, David; Jones, Randi; Zanko, Andrea; Nance, Martha; Abramson, Ruth K.; Suchowersky, Oksana; Paulsen, Jane S.; Harrison, Madaline B.; Yang, Qiong; Cupples, L. Adrienne; Mysore, Jayalakshmi; Gusella, James F.; MacDonald, Marcy E.

    2007-01-01

    Huntington disease (HD) is a neurodegenerative disorder caused by the abnormal expansion of CAG repeats in the HD gene on chromosome 4p16.3. A recent genome scan for genetic modifiers of age at onset of motor symptoms (AO) in HD suggests that one modifier may reside in the region close to the HD gene itself. We used data from 535 HD participants of the New England Huntington cohort and the HD MAPS cohort to assess whether AO was influenced by any of the three markers in the 4p16 region: MSX1 (Drosophila homeo box homologue 1, formerly known as homeo box 7, HOX7), Δ2642 (within the HD coding sequence), and BJ56 (D4S127). Suggestive evidence for an association was seen between MSX1 alleles and AO, after adjustment for normal CAG repeat, expanded repeat, and their product term (model P value 0.079). Of the variance of AO that was not accounted for by HD and normal CAG repeats, 0.8% could be attributed to the MSX1 genotype. Individuals with MSX1 genotype 3/3 tended to have younger AO. No association was found between Δ2642 (P=0.44) and BJ56 (P=0.73) and AO. This study supports previous studies suggesting that there may be a significant genetic modifier for AO in HD in the 4p16 region. Furthermore, the modifier may be present on both HD and normal chromosomes bearing the 3 allele of the MSX1 marker. PMID:15029481

  3. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  4. Gene mutation-based and specific therapies in precision medicine.

    Science.gov (United States)

    Wang, Xiangdong

    2016-04-01

    Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  5. Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

    Science.gov (United States)

    Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

    2013-01-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Multiple BiP genes of Arabidopsis thaliana are required for male gametogenesis and pollen competitiveness.

    Science.gov (United States)

    Maruyama, Daisuke; Sugiyama, Tomoyuki; Endo, Toshiya; Nishikawa, Shuh-Ichi

    2014-04-01

    Immunoglobulin-binding protein (BiP) is a molecular chaperone of the heat shock protein 70 (Hsp70) family. BiP is localized in the endoplasmic reticulum (ER) and plays key roles in protein translocation, protein folding and quality control in the ER. The genomes of flowering plants contain multiple BiP genes. Arabidopsis thaliana has three BiP genes. BIP1 and BIP2 are ubiquitously expressed. BIP3 encodes a less well conserved BiP paralog, and it is expressed only under ER stress conditions in the majority of organs. Here, we report that all BiP genes are expressed and functional in pollen and pollen tubes. Although the bip1 bip2 double mutation does not affect pollen viability, the bip1 bip2 bip3 triple mutation is lethal in pollen. This result indicates that lethality of the bip1 bip2 double mutation is rescued by BiP3 expression. A decrease in the copy number of the ubiquitously expressed BiP genes correlates well with a decrease in pollen tube growth, which leads to reduced fitness of mutant pollen during fertilization. Because an increased protein secretion activity is expected to increase the protein folding demand in the ER, the multiple BiP genes probably cooperate with each other to ensure ER homeostasis in cells with active secretion such as rapidly growing pollen tubes.

  7. p53 mutations promote proteasomal activity.

    Science.gov (United States)

    Oren, Moshe; Kotler, Eran

    2016-07-27

    p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

  8. SLC25A13 gene analysis in citrin deficiency: sixteen novel mutations in East Asian patients, and the mutation distribution in a large pediatric cohort in China.

    Directory of Open Access Journals (Sweden)

    Yuan-Zong Song

    Full Text Available BACKGROUND: The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2, and SLC25A13 mutations cause citrin deficiency (CD, a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2 and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD. The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. METHODS AND RESULTS: By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758, were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ(2 = 14.93, P<0.01, with the latitude of 30°N as the geographic dividing line in mainland China. CONCLUSIONS: This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients.

  9. A functional alternative splicing mutation in AIRE gene causes autoimmune polyendocrine syndrome type 1.

    Directory of Open Access Journals (Sweden)

    Junyu Zhang

    Full Text Available Autoimmune polyendocrine syndrome type 1 (APS-1 is a rare autosomal recessive disease defined by the presence of two of the three conditions: mucocutaneous candidiasis, hypoparathyroidism, and Addison's disease. Loss-of-function mutations of the autoimmune regulator (AIRE gene have been linked to APS-1. Here we report mutational analysis and functional characterization of an AIRE mutation in a consanguineous Chinese family with APS-1. All exons of the AIRE gene and adjacent exon-intron sequences were amplified by PCR and subsequently sequenced. We identified a homozygous missense AIRE mutation c.463G>A (p.Gly155Ser in two siblings with different clinical features of APS-1. In silico splice-site prediction and minigene analysis were carried out to study the potential pathological consequence. Minigene splicing analysis and subsequent cDNA sequencing revealed that the AIRE mutation potentially compromised the recognition of the splice donor of intron 3, causing alternative pre-mRNA splicing by intron 3 retention. Furthermore, the aberrant AIRE transcript was identified in a heterozygous carrier of the c.463G>A mutation. The aberrant intron 3-retaining transcript generated a truncated protein (p.G155fsX203 containing the first 154 AIRE amino acids and followed by 48 aberrant amino acids. Therefore, our study represents the first functional characterization of the alternatively spliced AIRE mutation that may explain the pathogenetic role in APS-1.

  10. Long QT interval in Turner syndrome--a high prevalence of LQTS gene mutations.

    Science.gov (United States)

    Trolle, Christian; Mortensen, Kristian H; Pedersen, Lisbeth N; Berglund, Agnethe; Jensen, Henrik K; Andersen, Niels H; Gravholt, Claus H

    2013-01-01

    QT-interval prolongation of unknown aetiology is common in Turner syndrome. This study set out to explore the presence of known long QT mutations in Turner syndrome and to examine the corrected QT-interval (QTc) over time and relate the findings to the Turner syndrome phenotype. Adult women with Turner syndrome (n = 88) were examined thrice and 68 age-matched healthy controls were examined once. QTc was measured by one blinded reader (intra-reader variability: 0.7%), and adjusted for influence of heart rate by Bazett's (bQTc) and Hodges's formula (hQTc). The prevalence of mutations in genes related to Long QT syndrome was determined in women with Turner syndrome and a QTc >432.0 milliseconds (ms). Echocardiographic assessment of aortic valve morphology, 24-hour blood pressures and blood samples were done. The mean hQTc in women with Turner syndrome (414.0 ± 25.5 ms) compared to controls (390.4 ± 17.8 ms) was prolonged (pTurner syndrome karyotypes (418.2 ± 24.8 vs. 407.6 ± 25.5 ms; p = 0.055). In women with Turner syndrome and a bQTc >432 ms, 7 had mutations in major Long QT syndrome genes (SCN5A and KCNH2) and one in a minor Long QT syndrome gene (KCNE2). There is a high prevalence of mutations in the major LQTS genes in women with TS and prolonged QTc. It remains to be settled, whether these findings are related to the unexplained excess mortality in Turner women. NCT00624949. https://register.clinicaltrials.gov/prs/app/action/SelectProtocol/sid/S0001FLI/selectaction/View/ts/3/uid/U000099E.

  11. Identification and functional analysis of a novel mutation in the SOX10 gene associated with Waardenburg syndrome type IV.

    Science.gov (United States)

    Wang, Hong-Han; Chen, Hong-Sheng; Li, Hai-Bo; Zhang, Hua; Mei, Ling-Yun; He, Chu-Feng; Wang, Xing-Wei; Men, Mei-Chao; Jiang, Lu; Liao, Xin-Bin; Wu, Hong; Feng, Yong

    2014-03-15

    Waardenburg syndrome type IV (WS4) is a rare genetic disorder, characterized by auditory-pigmentary abnormalities and Hirschsprung disease. Mutations of the EDNRB gene, EDN3 gene, or SOX10 gene are responsible for WS4. In the present study, we reported a case of a Chinese patient with clinical features of WS4. In addition, the three genes mentioned above were sequenced in order to identify whether mutations are responsible for the case. We revealed a novel nonsense mutation, c.1063C>T (p.Q355*), in the last coding exon of SOX10. The same mutation was not found in three unaffected family members or 100 unrelated controls. Then, the function and mechanism of the mutation were investigated in vitro. We found both wild-type (WT) and mutant SOX10 p.Q355* were detected at the expected size and their expression levels are equivalent. The mutant protein also localized in the nucleus and retained the DNA-binding activity as WT counterpart; however, it lost its transactivation capability on the MITF promoter and acted as a dominant-negative repressor impairing function of the WT SOX10. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

    Science.gov (United States)

    Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

    2007-11-01

    Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

  13. Mutation analysis of the ERCC4/FANCQ gene in hereditary breast cancer.

    Directory of Open Access Journals (Sweden)

    Sandra Kohlhase

    Full Text Available The ERCC4 protein forms a structure-specific endonuclease involved in the DNA damage response. Different cancer syndromes such as a subtype of Xeroderma pigmentosum, XPF, and recently a subtype of Fanconi Anemia, FA-Q, have been attributed to biallelic ERCC4 gene mutations. To investigate whether monoallelic ERCC4 gene defects play some role in the inherited component of breast cancer susceptibility, we sequenced the whole ERCC4 coding region and flanking untranslated portions in a series of 101 Byelorussian and German breast cancer patients selected for familial disease (set 1, n = 63 or for the presence of the rs1800067 risk haplotype (set 2, n = 38. This study confirmed six known and one novel exonic variants, including four missense substitutions but no truncating mutation. Missense substitution p.R415Q (rs1800067, a previously postulated breast cancer susceptibility allele, was subsequently screened for in a total of 3,698 breast cancer cases and 2,868 controls from Germany, Belarus or Russia. The Gln415 allele appeared protective against breast cancer in the German series, with the strongest effect for ductal histology (OR 0.67; 95%CI 0.49; 0.92; p = 0.003, but this association was not confirmed in the other two series, with the combined analysis yielding an overall Mantel-Haenszel OR of 0.94 (95% CI 0.81; 1.08. There was no significant effect of p.R415Q on breast cancer survival in the German patient series. The other three detected ERCC4 missense mutations included two known rare variants as well as a novel substitution, p.E17V, that we identified on a p.R415Q haplotype background. The p.E17V mutation is predicted to be probably damaging but was present in just one heterozygous patient. We conclude that the contribution of ERCC4/FANCQ coding mutations to hereditary breast cancer in Central and Eastern Europe is likely to be small.

  14. RAI1 gene mutations: mechanisms of Smith–Magenis Syndrome

    Directory of Open Access Journals (Sweden)

    Falco M

    2017-11-01

    Full Text Available Mariateresa Falco,1,* Sonia Amabile,1,* Fabio Acquaviva2 1Department of Molecular Medicine and Medical Biotechnology, University of Naples “Federico II”, Naples, Italy; 2Department of Translational Medical Sciences (DISMET, Section of Pediatric Clinical Genetics, University of Naples “Federico II”, Naples, Italy *These authors contributed equally to this work Abstract: Smith–Magenis syndrome (SMS; OMIM #182290 is a complex genetic disorder characterized by distinctive physical features, developmental delay, cognitive impairment, and a typical behavioral phenotype. SMS is caused by interstitial 17p11.2 deletions, encompassing multiple genes and including the retinoic acid-induced 1 gene (RAI1, or by mutations in RAI1 itself. About 10% of all the SMS patients, in fact, carry an RAI1 mutation responsible for the phenotype. RAI1 (OMIM *607642 is a dosage-sensitive gene expressed in many tissues and highly conserved among species. Over the years, several studies have demonstrated that RAI1 (or its homologs in animal models acts as a transcriptional factor implicated in embryonic neurodevelopment, neuronal differentiation, cell growth and cell cycle regulation, bone and skeletal development, lipid and glucose metabolisms, behavioral functions, and circadian activity. Patients with RAI1 pathogenic variants show some phenotypic differences when compared to those carrying the typical deletion. They usually have lower incidence of hypotonia and less cognitive impairment than those with 17p11.2 deletions but more frequently show the behavioral characteristics of the syndrome and overeating issues. These differences reflect the primary pathogenetic role of RAI1 without the pathogenetic contribution of the other genes included in the typical 17p11.2 deletion. The better comprehension of physiological roles of RAI1, its molecular co-workers and interactors, and its contribution in determining the typical SMS phenotype will certainly open a new path

  15. Genetic mutations in non-syndromic deafness patients of uyghur and han chinese ethnicities in xinjiang, China: a comparative study

    Directory of Open Access Journals (Sweden)

    Kuyaxi Pilidong

    2011-09-01

    Full Text Available Abstract Background The deafness-associated gene mutation profile varies greatly among regions and races. Due to the multi-ethnic coalition of over one thousand years, non-syndromic deafness (NSD patients of Uyghur ethnicity may exhibit a unique deafness-associated gene mutation spectrum as compared to Han Chinese deaf population. Methods In order to characterize nine loci of four deafness-associated genes of Uyghur NSD patients in comparison with Chinese Han deaf population, NSD patients (n = 350 were enrolled, including Uyghur (n = 199 and Han Chinese (n = 151. Following the history taking, blood samples were collected for DNA extraction. DNA microarray was performed on nine loci of four deafness-associated genes, including 35delG, 176-191del16, 235delC, 299-300delAT, 538C > T, 1555A > G, 1494C > T, 2168A > G, and IVS7-2A > G. The samples that showed the absence of both wild and mutant probe signals were tested for further DNA sequencing analysis. Results The mutations in the nine loci of prevalent deafness-associated genes were detected in 13.06% of Uyghur NSD patients and 32.45% of Han Chinese patients (P GJB2 mutation was detected in 9.05% of Uyghur patients and 16.56% of Han Chinese patients (P > 0.05, respectively. 235delC was the hotspot mutation region in NSD patients of the two ethnicities, whereas 35delG was the mutation hotspot in Uyghur patients. 187delG mutation was detected for the first time in Uyghur NSD patients and considered as an unreported pathological variant of GJB2. SLC26A4 mutation was found in 2.01% of Uyghur patients and 14.57% of Han Chinese patients (P P > 0.05, respectively. The NSD patients exhibited a low frequency of GJB3 mutation regardless of ethnicity. Conclusion Prevalent deafness-associated gene mutations in the nine loci studied were less frequently detected in Uyghur NSD patients than in Han Chinese patients. GJB2 was the most common mutant gene in the two ethnicities, whilst the two ethnicities differed

  16. A novel mutation of the fibrillin gene causing Ectopia lentis

    Energy Technology Data Exchange (ETDEWEB)

    Loennqvist, L.; Kainulainen, K.; Puhakka, L.; Peltonen, L. (National Public Health Institute, Helsinki (Finland)); Child, A. (St. George' s Hospital Medical School, London (United Kingdom)); Peltonen, L. (Duncan Guthrie Institute, Glasgow, Scotland (United Kingdom))

    1994-02-01

    Ectopia lentis (EL), a dominantly inherited connective tissue disorder, has been genetically linked to the fibrillin gene on chromosome 15 (FBN1) in earlier studies. Here, the authors report the first EL mutation in the FBN1 gene confirming that EL is caused by mutations of this gene. So far, several mutations in the FBN1 gene have been reported in patients with Marfan syndrome (MFS). EL and MFS are clinically related but distinct conditions with typical manifestations in the ocular and skeletal systems, the fundamental difference between them being the absence of cardiovascular involvement in EL. They report a point mutation, cosegregating with the disease in the described family, that displays EL over four generations. The mutation changes a conserved glutamic acid residue in an EGF-like motif, which is the major structural component of the fibrillin and is repeated throughout the polypeptide. In vitro mutagenetic studies have demonstrated the necessity of an analogous glutamic acid residue for calcium binding in an EGF-like repeat of human factor IX. This provides a possible explanation for the role of this mutation in the disease pathogenesis. 32 refs., 2 figs., 1 tab.

  17. Neurocognitive Profiles in Duchenne Muscular Dystrophy and Gene Mutation Site

    Science.gov (United States)

    D’Angelo, Maria Grazia; Lorusso, Maria Luisa; Civati, Federica; Comi, Giacomo Pietro; Magri, Francesca; Del Bo, Roberto; Guglieri, Michela; Molteni, Massimo; Turconi, Anna Carla; Bresolin, Nereo

    2011-01-01

    The presence of nonprogressive cognitive impairment is recognized as a common feature in a substantial proportion of patients with Duchenne muscular dystrophy. To investigate the possible role of mutations along the dystrophin gene affecting different brain dystrophin isoforms and specific cognitive profiles, 42 school-age children affected with Duchenne muscular dystrophy, subdivided according to sites of mutations along the dystrophin gene, underwent a battery of tests tapping a wide range of intellectual, linguistic, and neuropsychologic functions. Full-scale intelligence quotient was approximately 1 S.D. below the population average in the whole group of dystrophic children. Patients with Duchenne muscular dystrophy and mutations located in the distal portion of the dystrophin gene (involving the 140-kDa brain protein isoform, called Dp140) were generally more severely affected and expressed different patterns of strengths and impairments, compared with patients with Duchenne muscular dystrophy and mutations located in the proximal portion of the dystrophin gene (not involving Dp140). Patients with Duchenne muscular dystrophy and distal mutations demonstrated specific impairments in visuospatial functions and visual memory (which seemed intact in proximally mutated patients) and greater impairment in syntactic processing. PMID:22000308

  18. Predictive models for mutations in mismatch repair genes: implication for genetic counseling in developing countries

    Directory of Open Access Journals (Sweden)

    Monteiro Santos Erika

    2012-02-01

    Full Text Available Abstract Background Lynch syndrome (LS is the most common form of inherited predisposition to colorectal cancer (CRC, accounting for 2-5% of all CRC. LS is an autosomal dominant disease characterized by mutations in the mismatch repair genes mutL homolog 1 (MLH1, mutS homolog 2 (MSH2, postmeiotic segregation increased 1 (PMS1, post-meiotic segregation increased 2 (PMS2 and mutS homolog 6 (MSH6. Mutation risk prediction models can be incorporated into clinical practice, facilitating the decision-making process and identifying individuals for molecular investigation. This is extremely important in countries with limited economic resources. This study aims to evaluate sensitivity and specificity of five predictive models for germline mutations in repair genes in a sample of individuals with suspected Lynch syndrome. Methods Blood samples from 88 patients were analyzed through sequencing MLH1, MSH2 and MSH6 genes. The probability of detecting a mutation was calculated using the PREMM, Barnetson, MMRpro, Wijnen and Myriad models. To evaluate the sensitivity and specificity of the models, receiver operating characteristic curves were constructed. Results Of the 88 patients included in this analysis, 31 mutations were identified: 16 were found in the MSH2 gene, 15 in the MLH1 gene and no pathogenic mutations were identified in the MSH6 gene. It was observed that the AUC for the PREMM (0.846, Barnetson (0.850, MMRpro (0.821 and Wijnen (0.807 models did not present significant statistical difference. The Myriad model presented lower AUC (0.704 than the four other models evaluated. Considering thresholds of ≥ 5%, the models sensitivity varied between 1 (Myriad and 0.87 (Wijnen and specificity ranged from 0 (Myriad to 0.38 (Barnetson. Conclusions The Barnetson, PREMM, MMRpro and Wijnen models present similar AUC. The AUC of the Myriad model is statistically inferior to the four other models.

  19. Major Vault Protein, a Candidate Gene in 16p11.2 Microdeletion Syndrome, Is Required for the Homeostatic Regulation of Visual Cortical Plasticity.

    Science.gov (United States)

    Ip, Jacque P K; Nagakura, Ikue; Petravicz, Jeremy; Li, Keji; Wiemer, Erik A C; Sur, Mriganka

    2018-04-18

    Microdeletion of a region in chromosome 16p11.2 increases susceptibility to autism. Although this region contains exons of 29 genes, disrupting only a small segment of the region, which spans five genes, is sufficient to cause autistic traits. One candidate gene in this critical segment is MVP , which encodes for the major vault protein (MVP) that has been implicated in regulation of cellular transport mechanisms. MVP expression levels in MVP +/- mice closely phenocopy those of 16p11.2 mutant mice, suggesting that MVP +/- mice may serve as a model of MVP function in 16p11.2 microdeletion. Here we show that MVP regulates the homeostatic component of ocular dominance (OD) plasticity in primary visual cortex. MVP +/- mice of both sexes show impairment in strengthening of open-eye responses after several days of monocular deprivation (MD), whereas closed-eye responses are weakened as normal, resulting in reduced overall OD plasticity. The frequency of miniature EPSCs (mEPSCs) in pyramidal neurons is decreased in MVP +/- mice after extended MD, suggesting a reduction of functional synapses. Correspondingly, upregulation of surface GluA1 AMPA receptors is reduced in MVP +/- mice after extended MD, and is accompanied by altered expression of STAT1 and phosphorylated ERK, which have been previously implicated in OD plasticity. Normalization of STAT1 levels by introducing STAT1 shRNA rescues surface GluA1 and open-eye responses, implicating STAT1 as a downstream effector of MVP. These findings demonstrate a specific role for MVP as a key molecule influencing the homeostatic component of activity-dependent synaptic plasticity, and potentially the corresponding phenotypes of 16p11.2 microdeletion syndrome. SIGNIFICANCE STATEMENT Major vault protein (MVP), a candidate gene in 16p11.2 microdeletion syndrome, has been implicated in the regulation of several cellular processes including transport mechanisms and scaffold signaling. However, its role in brain function and

  20. Two co-existing germline mutations P53 V157D and PMS2 R20Q promote tumorigenesis in a familial cancer syndrome.

    Science.gov (United States)

    Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin

    2014-01-01

    Germline mutations are responsible for familial cancer syndromes which account for approximately 5-10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  1. Mutations in TP53 tumor suppressor gene in wood dust-related sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Bornholdt, Jette; Heikkilä, Pirjo

    2010-01-01

    The causal role of work-related exposure to wood dust in the development of sinonasal cancer has long been established by numerous epidemiologic studies. To study molecular changes in these tumors, we analyzed TP53 gene mutations in 358 sinonasal cancer cases with or without occupational exposure...... affected the ORs only slightly. Smoking did not influence the occurrence of TP53 mutation; however, it was associated with multiple mutations (p = 0.03). As far as we are aware, this is the first study to demonstrate a high prevalence of TP53 mutation-positive cases in a large collection of sinonasal...... cancers with data on occupational exposure. Our results indicate that mutational mechanisms, in particular TP53 mutations, are associated with work-related exposure to wood dust in sinonasal cancer....

  2. Ageing, chronic alcohol consumption and folate are determinants of genomic DNA methylation, p16 promoter methylation and the expression of p16 in the mouse colon

    Science.gov (United States)

    Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...

  3. Chronic pancreatitis associated with the p.G208A variant of PRSS1 gene in a European patient.

    Science.gov (United States)

    Hegyi, Eszter; Cierna, Iveta; Vavrova, Ludmila; Ilencikova, Denisa; Konecny, Michal; Kovacs, Laszlo

    2014-01-10

    The major etiologic factor of chronic pancreatitis in adults is excessive alcohol consumption, whereas among children structural anomalies, systemic and metabolic disorders, and genetic factors are prevalent. Mutations in the cationic trypsinogen gene (PRSS1) cause hereditary pancreatitis, while mutations in serine protease inhibitor Kazal type 1 (SPINK1), cystic fibrosis transmembrane conductance regulator (CFTR) and chymotrypsin C (CTRC) genes have been shown to associate with chronic pancreatitis as independent risk factors. We present a case of 13-year-old boy with idiopathic chronic pancreatitis. Given the unexplained attacks of pancreatitis since early childhood and despite the negative family history, molecular-genetic analysis of four pancreatitis susceptibility genes (PRSS1, SPINK1, CTRC and CFTR) was performed. The boy was found to carry the c.623G>C (p.G208A) mutation of the PRSS1 gene and the c.180C>T (p.G60G) mutation of the CTRC gene, both in heterozygous state. These mutations are considered as contributing risk factors for chronic pancreatitis. In children with idiopathic chronic pancreatitis genetic causes should be considered, even in absence of positive family history. To the best of our knowledge, this is the first description of a European patient with chronic pancreatitis associated with the p.G208A mutation of PRSS1 gene. This mutation was previously reported only in Asian subjects and is thought to be a unique genetic cause of pancreatitis in Asia.

  4. LPL gene expression is associated with poor prognosis in CLL and closely related to NOTCH1 mutations

    DEFF Research Database (Denmark)

    Kristensen, Louise; Kielsgaard Kristensen, Thomas; Abildgaard, Niels

    2016-01-01

    these markers. AIM: To evaluate LPL gene expression together with the well-established prognostic markers of CLL and investigate correlations with more recently identified prognostic markers, NOTCH1 and TP53 mutations. METHODS: On 149 patients LPL gene expression was analyzed by real-time RT-PCR. Exon 34...... of NOTCH1 was PCR amplified and directly sequenced. RESULTS: LPL gene expression could be measured as a categorical variable (LPL+/LPL-) and was associated with time to treatment (p... and new prognostic markers, 3 out of 4 patients, who received treatment within 24 months after diagnosis, were LPL+ (p=0.03). There was a strong correlation between NOTCH1 mutation and LPL+ (p=0.005). The unfavorable prognosis of LPL+ was maintained in CLL with wild-type NOTCH1. CONCLUSIONS: NOTCH1...

  5. Mutation and Expression of the DCC Gene in Human Lung Cancer

    Directory of Open Access Journals (Sweden)

    Takashi Kohno

    2000-07-01

    Full Text Available Chromosome 18q is frequently deleted in lung cancers, a common region of 18q deletions was mapped to chromosome 18g21. Since the DCC candidate tumor suppressor gene has been mapped in this region, mutation and expression of the DCC gene were examined in 46 lung cancer cell lines, consisting of 14 small cell lung carcinomas (SCLCs and 32 non-small cell lung carcinomas (NSCLCs, to elucidate the pathogenetic significance of DCC alterations in human lung carcinogenesis. A heterozygous missense mutation was detected in a NSCLC cell line, Ma26, while homozygous deletion was not detected in any of the cell lines. The DCC gene was expressed in 11 (24% of the 46 cell lines, the incidence of DCC expression was significantly higher in SCLCs (7/14, 50% than in NSCLCs (4/32, 13% (P = .01, Fisher's exact test. Therefore, genetic alterations of DCC are infrequent; however, the levels of DCC expression vary among lung cancer cells, in particular, between SCLCs and NSCLCs. The present result does not implicate DCC as a specific mutational target of 18q deletions in human lung cancer; however, it suggests that DCC is a potential target of inactivation by genetic defects including intron or promoter mutations and/or epigenetic alterations. The present result also suggests that DCC expression is associated with some properties of SCLCs, such as a neuroendocrine (NE feature.

  6. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

    Science.gov (United States)

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2016-11-01

    Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Skin pH, Atopic Dermatitis, and Filaggrin Mutations

    DEFF Research Database (Denmark)

    Bandier, Josefine; Johansen, Jeanne Duus; Petersen, Lars Jelstrup

    2014-01-01

    mutations may influence skin pH. OBJECTIVE: We aimed to determine the epidermal pH in different groups stratified by filaggrin mutations and atopic dermatitis. Further, we investigated the changes in pH according to severity of mutational status among patients with dermatitis, irrespective of skin condition....... METHODS: pH was measured with a multiprobe system pH probe (PH 905), and the study population was composed of 67 individuals, who had all been genotyped for 3 filaggrin mutations (R501X, 2282del4, R2447X). RESULTS: We found no clear pattern in relation to filaggrin mutation carrier status. Individuals...... with wild-type filaggrin displayed both the most acidic and most alkaline values independent of concomitant skin disease; however, no statistical differences between the groups were found. CONCLUSIONS: The lack of significant diversity in skin pH in relation to filaggrin mutation carrier status suggests...

  8. DNA mutation motifs in the genes associated with inherited diseases.

    Directory of Open Access Journals (Sweden)

    Michal Růžička

    Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

  9. [Frequency of the most common mutations of the CFTR gene in peruvian patients with cystic fibrosis using the ARMS-PCR technique].

    Science.gov (United States)

    Aquino, Ruth; Protzel, Ana; Rivera, Juan; Abarca, Hugo; Dueñas, Milagros; Nestarez, Cecilia; Purizaga, Nestor; Diringer, Benoit

    2017-01-01

    To determine the frequency of the ten most common mutations of the CFTR gene reported in Latin Americausing amplification-refractory mutation system-polymerase chain reaction (ARMS-PCR) in patients with cystic fibrosis (CF) in two referral hospitals in Peru during the year 2014. The frequency of the ten most common mutations of the CFTR gene was assessed in patients of the Hospital Nacional Edgardo Rebagliati Martins and the Instituto Nacional de Salud del Niño, both located in Lima, Peru. Blood samples were collected from 36 patients with CF, and the ARMS-PCR technique was used to determine the presence of these mutations. The study group included 73.5% of patients with a known diagnosis of CF in the country when the study was carried out. ARMS-PCR allowed three of the mutations to be identified in a combined 30.6% of the alleles from patients with CF, and 64.9% of the mutated alleles were not identified. The mutations found were p.Phe508del (22,2%), p.Gly542* (6,9%), and p.Arg1162* (1,4%). There is significant variability in both the frequency and type of mutations present in our study population and in what has been reported in other Latin American countries. It is necessary to perform studies that use complete sequencing technology for the CFTR gene to identify other mutations present in our population.

  10. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    Science.gov (United States)

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Ethnic disparity in 21-hydroxylase gene mutations identified in Pakistani congenital adrenal hyperplasia patients

    Directory of Open Access Journals (Sweden)

    Jabbar Abdul

    2011-02-01

    Full Text Available Abstract Background Congenital adrenal hyperplasia (CAH is a group of autosomal recessive disorders caused by defects in the steroid 21 hydroxylase gene (CYP21A2. We studied the spectrum of mutations in CYP21A2 gene in a multi-ethnic population in Pakistan to explore the genetics of CAH. Methods A cross sectional study was conducted for the identification of mutations CYP21A2 and their phenotypic associations in CAH using ARMS-PCR assay. Results Overall, 29 patients were analyzed for nine different mutations. The group consisted of two major forms of CAH including 17 salt wasters and 12 simple virilizers. There were 14 phenotypic males and 15 females representing all the major ethnic groups of Pakistan. Parental consanguinity was reported in 65% cases and was equally distributed in the major ethnic groups. Among 58 chromosomes analyzed, mutations were identified in 45 (78.6% chromosomes. The most frequent mutation was I2 splice (27% followed by Ile173Asn (26%, Arg 357 Trp (19%, Gln319stop, 16% and Leu308InsT (12%, whereas Val282Leu was not observed in this study. Homozygosity was seen in 44% and heterozygosity in 34% cases. I2 splice mutation was found to be associated with SW in the homozygous. The Ile173Asn mutation was identified in both SW and SV forms. Moreover, Arg357Trp manifested SW in compound heterozygous state. Conclusion Our study showed that CAH exists in our population with ethnic difference in the prevalence of mutations examined.

  12. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Science.gov (United States)

    2010-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...

  13. Four novel mutations in the lactase gene (LCT) underlying congenital lactase deficiency (CLD).

    Science.gov (United States)

    Torniainen, Suvi; Freddara, Roberta; Routi, Taina; Gijsbers, Carolien; Catassi, Carlo; Höglund, Pia; Savilahti, Erkki; Järvelä, Irma

    2009-01-22

    Congenital lactase deficiency (CLD) is a severe gastrointestinal disorder of newborns. The diagnosis is challenging and based on clinical symptoms and low lactase activity in intestinal biopsy specimens. The disease is enriched in Finland but is also present in other parts of the world. Mutations encoding the lactase (LCT) gene have recently been shown to underlie CLD. The purpose of this study was to identify new mutations underlying CLD in patients with different ethnic origins, and to increase awareness of this disease so that the patients could be sought out and treated correctly. Disaccharidase activities in intestinal biopsy specimens were assayed and the coding region of LCT was sequenced from five patients from Europe with clinical features compatible with CLD. In the analysis and prediction of mutations the following programs: ClustalW, Blosum62, PolyPhen, SIFT and Panther PSEC were used. Four novel mutations in the LCT gene were identified. A single nucleotide substitution leading to an amino acid change S688P in exon 7 and E1612X in exon 12 were present in a patient of Italian origin. Five base deletion V565fsX567 leading to a stop codon in exon 6 was found in one and a substitution R1587H in exon 12 from another Finnish patient. Both Finnish patients were heterozygous for the Finnish founder mutation Y1390X. The previously reported mutation G1363S was found in a homozygous state in two siblings of Turkish origin. This is the first report of CLD mutations in patients living outside Finland. It seems that disease is more common than previously thought. All mutations in the LCT gene lead to a similar phenotype despite the location and/or type of mutation.

  14. Four novel mutations in the lactase gene (LCT underlying congenital lactase deficiency (CLD

    Directory of Open Access Journals (Sweden)

    Höglund Pia

    2009-01-01

    Full Text Available Abstract Background Congenital lactase deficiency (CLD is a severe gastrointestinal disorder of newborns. The diagnosis is challenging and based on clinical symptoms and low lactase activity in intestinal biopsy specimens. The disease is enriched in Finland but is also present in other parts of the world. Mutations encoding the lactase (LCT gene have recently been shown to underlie CLD. The purpose of this study was to identify new mutations underlying CLD in patients with different ethnic origins, and to increase awareness of this disease so that the patients could be sought out and treated correctly. Methods Disaccharidase activities in intestinal biopsy specimens were assayed and the coding region of LCT was sequenced from five patients from Europe with clinical features compatible with CLD. In the analysis and prediction of mutations the following programs: ClustalW, Blosum62, PolyPhen, SIFT and Panther PSEC were used. Results Four novel mutations in the LCT gene were identified. A single nucleotide substitution leading to an amino acid change S688P in exon 7 and E1612X in exon 12 were present in a patient of Italian origin. Five base deletion V565fsX567 leading to a stop codon in exon 6 was found in one and a substitution R1587H in exon 12 from another Finnish patient. Both Finnish patients were heterozygous for the Finnish founder mutation Y1390X. The previously reported mutation G1363S was found in a homozygous state in two siblings of Turkish origin. Conclusion This is the first report of CLD mutations in patients living outside Finland. It seems that disease is more common than previously thought. All mutations in the LCT gene lead to a similar phenotype despite the location and/or type of mutation.

  15. Efficacy of Gefitinib for Young Patients with Unknown EGFR Gene Mutation 
in Advanced Lung Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Yutao LIU

    2014-05-01

    Full Text Available Background and objective Lung cancer in young patients (less or equal to 45 years is relatively rare. We explored the efficacy and survival of Gefitinib for young patients with unknown epidermal growth factor receptor (EGFR gene mutation of advanced lung adenocarcinoma. Methods The clinical data of 55 young patients with unknown EGFR gene mutation in advanced lung adenocarcinoma referred to the Cancer Hospital & Institute, Chinese Academy of Medical Sciences from Jan 2006 through Dec 2010 were analyzed retrospectively. Results Of 55 young patients enrolled, the median age was 41 years. The objective response rate and disease control rate were 43.6% and 90.9%, respectively.. The median progression-free survival (PFS was 9.0 months. Among the factors analyzed, brain metastasis had significant effect on PFS (P=0.017. The median overall survival (OS was 24.0 months. The independent prognostic factors to significantly improve OS included non-smoking history (P=0.028 and receiving other anti-cancer treatment after Gefitinib therapy (P<0.001. Conclusion The median PFS and OS of the young patients with Unknown EGFR gene mutation in advanced lung adenocarcinoma were similar with general population.

  16. [Identification of novel compound heterozygous mutations of USH2A gene in a family with Usher syndrome type II].

    Science.gov (United States)

    Jiang, Haiou; Ge, Chuanqin; Wang, Yiwang; Tang, Genyun; Quan, Qingli

    2015-06-01

    To identify potential mutations in a Chinese family with Usher syndrome type II. Genomic DNA was obtained from two affected and four unaffected members of the family and subjected to amplification of the entire coding sequence and splicing sites of USH2A gene. Mutation detection was conducted by direct sequencing of the PCR products. A total of 100 normal unrelated individuals were used as controls. The patients were identified to be a compound heterozygote for two mutations: c.8272G>T (p.E2758X) in exon 42 from his mother and c.12376-12378ACT>TAA(p.T4126X) in exon 63 of the USH2A gene from his father. Both mutations were not found in either of the two unaffected family members or 100 unrelated controls, and had completely co-segregated with the disease phenotype in the family. Neither mutation has been reported in the HGMD database. The novel compound heterozygous mutations c.8272G>T and c.12376-12378ACT>TAA within the USH2A gene may be responsible for the disease. This result may provide new clues for molecular diagnosis of this disease.

  17. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  18. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  19. Mutations and Rearrangements in the Genome of Sulfolobus solfataricus P2

    DEFF Research Database (Denmark)

    Redder, P.; Garrett, R. A.

    2006-01-01

    The genome of Sulfolobus solfataricus P2 carries a larger number of transposable elements than any other sequenced genome from an archaeon or bacterium and, as a consequence, may be particularly susceptible to rearrangement and change. In order to gain more insight into the natures and frequencies...... of different types of mutation and possible rearrangements that can occur in the genome, the pyrEF locus was examined for mutations that were isolated after selection with 5-fluoroorotic acid. About two-thirds of the 130 mutations resulted from insertions of mobile elements, including insertion sequence (IS...... deletions, insertions, and a duplication, were observed, and about one-fifth of the mutations occurred elsewhere in the genome, possibly in an orotate transporter gene. One mutant exhibited a 5-kb genomic rearrangement at the pyrEF locus involving a two-step IS element-dependent reaction, and its boundaries...

  20. Analysis of the Effects of a gerP Mutation on the Germination of Spores of Bacillus subtilis

    Science.gov (United States)

    2012-11-01

    REPORT Analysis of the effects of a gerP mutation on the germination of spores of Bacillus subtilis 14. ABSTRACT 16. SECURITY CLASSIFICATION OF... Bacillus subtilis spores with a gerP mutation triggered spore germination via nutrient germinant receptors (GRs) slowly, although this defect was...gerP, Bacillus subtilis , dipicolinic acid Xuan Y. Butzin, Anthony J. Troiano, William H. Coleman, Keren K. Griffiths, Christopher J. Doona, Florence E

  1. Use of human tissue to assess the oncogenic activity of melanoma-associated mutations.

    Science.gov (United States)

    Chudnovsky, Yakov; Adams, Amy E; Robbins, Paul B; Lin, Qun; Khavari, Paul A

    2005-07-01

    Multiple genetic alterations occur in melanoma, a lethal skin malignancy of increasing incidence. These include mutations that activate Ras and two of its effector cascades, Raf and phosphoinositide 3-kinase (PI3K). Induction of Ras and Raf can be caused by active N-Ras and B-Raf mutants as well as by gene amplification. Activation of PI3K pathway components occurs by PTEN loss and by AKT3 amplification. Melanomas also commonly show impairment of the p16(INK4A)-CDK4-Rb and ARF-HDM2-p53 tumor suppressor pathways. CDKN2A mutations can produce p16(INK4A) and ARF protein loss. Rb bypass can also occur through activating CDK4 mutations as well as by CDK4 amplification. In addition to ARF deletion, p53 pathway disruption can result from dominant negative TP53 mutations. TERT amplification also occurs in melanoma. The extent to which these mutations can induce human melanocytic neoplasia is unknown. Here we characterize pathways sufficient to generate human melanocytic neoplasia and show that genetically altered human tissue facilitates functional analysis of mutations observed in human tumors.

  2. Three novel and two known androgen receptor gene mutations ...

    Indian Academy of Sciences (India)

    gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients. J. Genet. ... signal and a C-terminal. Keywords. androgen insensitivity syndrome; androgen receptor; truncation mutation; N-terminal domain; XY sex reversal. .... and an increased risk of gonadal tumour. Mutations in SRY.

  3. A novel nonsense mutation of the GPR143 gene identified in a Chinese pedigree with ocular albinism.

    Directory of Open Access Journals (Sweden)

    Naihong Yan

    Full Text Available BACKGROUND: The purpose of this study was to elucidate the molecular basis of ocular albinism type I in a Chinese pedigree. METHODOLOGY/PRINCIPAL FINDINGS: Complete ophthalmologic examinations were performed on 4 patients, 7 carriers and 17 unaffected individuals in this five-generation family. All coding exons of four-point-one (4.1, ezrin, radixin, moesin (FERM domain-containing 7 (FRMD7 and G protein-coupled receptor 143 (GPR143 genes were amplified by polymerase chain reaction (PCR, sequenced and compared with a reference database. Ocular albinism and nystagmus were found in all patients of this family. Macular hypoplasia was present in the patients including the proband. A novel nonsense hemizygous mutation c.807T>A in the GPR143 gene was identified in four patients and the heterozygous mutation was found in seven asymptomatic individuals. This mutation is a substitution of tyrosine for adenine which leads to a premature stop codon at position 269 (p.Y269X of GPR143. CONCLUSIONS/SIGNIFICANCE: This is the first report that p.Y269X mutation of GPR143 gene is responsible for the pathogenesis of familial ocular albinism. These results expand the mutation spectrum of GPR143, and demonstrate the clinical characteristics of ocular albinism type I in Chinese population.

  4. Mutational analysis of the cell cycle inhibitor Kip1/p27 in childhood leukemia.

    Science.gov (United States)

    Markaki, E-A; Stiakaki, E; Zafiropoulos, A; Arvanitis, D A; Katzilakis, N; Dimitriou, H; Spandidos, D A; Kalmanti, M

    2006-07-01

    Cyclin-dependent kinases (CDKs) and cyclins, their regulatory subunits, govern cell-cycle progression in eukaryotic cells. Kip1/p27 is the main cyclin-dependent kinase inhibitor, which arrests cell division inhibiting G1-S transition. Kip1/p27 seems to play a critical role in the pathogenesis of several human malignancies and its lower expression has been shown to correlate with a poor prognosis in adult solid tumors. Bone marrow blasts from 49 children with leukemia, 37 acute lymphoblastic leukemia (ALL), and 12 acute myeloid leukemia (AML) were studied. Exon 3 of Kip1/p27 was amplified using the polymerase chain reaction technique (PCR). Single strand conformational polymorphism and heterodouplex analysis were performed to detect DNA sequence with altered conformations and were subsequently sequenced to document mutations. Mutations in Kip1/p27 gene were detected in 2 out of 3 T-ALL, 6 out of 12 AML patients, and only 1 out of 34 B lineage ALL cases. Although the patient groups are small, a highly significant relation of the mutation status with the type of leukemia (P = 0.0037) and the risk group according to treatment protocols (P = 0.00021) was estimated. A statistically significant difference in the white blood count was observed (P = 0.019) between the mutated and non-mutated patient groups although no statistically significant association of the mutation status with the hemoglobin and platelets values, karyotype, age, sex, disease progression, and outcome was determined. Based upon these results, the Kip1/p27 mutations should be considered for further prospective testing as an additional parameter for risk stratification and treatment of childhood leukemia. Copyright 2006 Wiley-Liss, Inc.

  5. Law-medicine interfacing: patenting of human genes and mutations.

    Science.gov (United States)

    Fialho, Arsenio M; Chakrabarty, Ananda M

    2011-08-01

    Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.

  6. HFE gene: Structure, function, mutations, and associated iron abnormalities.

    Science.gov (United States)

    Barton, James C; Edwards, Corwin Q; Acton, Ronald T

    2015-12-15

    The hemochromatosis gene HFE was discovered in 1996, more than a century after clinical and pathologic manifestations of hemochromatosis were reported. Linked to the major histocompatibility complex (MHC) on chromosome 6p, HFE encodes the MHC class I-like protein HFE that binds beta-2 microglobulin. HFE influences iron absorption by modulating the expression of hepcidin, the main controller of iron metabolism. Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent. We review HFE mapping and cloning, structure, promoters and controllers, and coding region mutations, HFE protein structure, cell and tissue expression and function, mouse Hfe knockouts and knockins, and HFE mutations in other mammals with iron overload. We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. VarWalker: personalized mutation network analysis of putative cancer genes from next-generation sequencing data.

    Science.gov (United States)

    Jia, Peilin; Zhao, Zhongming

    2014-02-01

    A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.

  8. Novel germline mutation (Leu512Met) in the thyrotropin receptor gene (TSHR) leading to sporadic non-autoimmune hyperthyroidism.

    Science.gov (United States)

    Roberts, Stephanie A; Moon, Jennifer E; Dauber, Andrew; Smith, Jessica R

    2017-03-01

    Primary nonautoimmune hyperthyroidism is a rare cause of neonatal hyperthyroidism. This results from an activating mutation in the thyrotropin-receptor (TSHR). It can be inherited in an autosomal dominant manner or occur sporadically as a de novo mutation. Affected individuals display a wide phenotype from severe neonatal to mild subclinical hyperthyroidism. We describe a 6-month-old boy with a de novo mutation in the TSHR gene who presented with accelerated growth, enlarging head circumference, tremor and thyrotoxicosis. Genomic DNA from the patient's and parents' peripheral blood leukocytes was extracted. Exons 9 and 10 of the TSHR gene were amplified by PCR and sequenced. Sequencing exon 10 of the TSHR gene revealed a novel heterozygous missense mutation substituting cytosine to adenine at nucleotide position 1534 in the patient's peripheral blood leukocytes. This leads to a substitution of leucine to methionine at amino acid position 512. The mutation was absent in the parents. In silico modeling by PolyPhen-2 and SIFT predicted the mutation to be deleterious. The p.Leu512Met mutation (c.1534C>A) of the TSHR gene has not been previously described in germline or somatic mutations. This case presentation highlights the possibility of mild thyrotoxicosis in affected individuals and contributes to the understanding of sporadic non-autoimmune primary hyperthyroidism.

  9. Characterization of mutations and loss of heterozygosity of p53 and K-ras2 in pancreatic cancer cell lines by immobilized polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Edwards Jeremy

    2003-07-01

    Full Text Available Abstract Background The identification of known mutations in a cell population is important for clinical applications and basic cancer research. In this work an immobilized form of the polymerase chain reaction, referred to as polony technology, was used to detect mutations as well as gene deletions, resulting in loss of heterozygosity (LOH, in cancer cell lines. Specifically, the mutational hotspots in p53, namely codons 175, 245, 248, 249, 273, and 282, and K-ras2, codons 12, 13 and 61, were genotyped in the pancreatic cell line, Panc-1. In addition LOH analysis was also performed for these same two genes in Panc-1 by quantifying the relative gene copy number of p53 and K-ras2. Results Using polony technology, Panc-1 was determined to possess only one copy of p53, which possessed a mutation in codon 273, and two copies of K-ras2, one wildtype and one with a mutation in codon 12. To further demonstrate the general approach of this method, polonies were also used to detect K-ras2 mutations in the pancreatic cell lines, AsPc-1 and CAPAN-1. Conclusions In conclusion, we have developed an assay that can detect mutations in hotspots of p53 and K-ras2 as well as diagnose LOH in these same genes.

  10. Analysis of SOX10 mutations identified in Waardenburg-Hirschsprung patients: Differential effects on target gene regulation.

    Science.gov (United States)

    Chan, Kwok Keung; Wong, Corinne Kung Yen; Lui, Vincent Chi Hang; Tam, Paul Kwong Hang; Sham, Mai Har

    2003-10-15

    SOX10 is a member of the SOX gene family related by homology to the high-mobility group (HMG) box region of the testis-determining gene SRY. Mutations of the transcription factor gene SOX10 lead to Waardenburg-Hirschsprung syndrome (Waardenburg-Shah syndrome, WS4) in humans. A number of SOX10 mutations have been identified in WS4 patients who suffer from different extents of intestinal aganglionosis, pigmentation, and hearing abnormalities. Some patients also exhibit signs of myelination deficiency in the central and peripheral nervous systems. Although the molecular bases for the wide range of symptoms displayed by the patients are still not clearly understood, a few target genes for SOX10 have been identified. We have analyzed the impact of six different SOX10 mutations on the activation of SOX10 target genes by yeast one-hybrid and mammalian cell transfection assays. To investigate the transactivation activities of the mutant proteins, three different SOX target binding sites were introduced into luciferase reporter gene constructs and examined in our series of transfection assays: consensus HMG domain protein binding sites; SOX10 binding sites identified in the RET promoter; and Sox10 binding sites identified in the P0 promoter. We found that the same mutation could have different transactivation activities when tested with different target binding sites and in different cell lines. The differential transactivation activities of the SOX10 mutants appeared to correlate with the intestinal and/or neurological symptoms presented in the patients. Among the six mutant SOX10 proteins tested, much reduced transactivation activities were observed when tested on the SOX10 binding sites from the RET promoter. Of the two similar mutations X467K and 1400del12, only the 1400del12 mutant protein exhibited an increase of transactivation through the P0 promoter. While the lack of normal SOX10 mediated activation of RET transcription may lead to intestinal aganglionosis

  11. Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.

    Science.gov (United States)

    Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P

    2000-08-01

    We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

  12. Genomic characterization of the porcine CRTC3 and the effects of a non-synonymous mutation p.V515F on lean meat production and belly fat.

    Science.gov (United States)

    Lee, S H; Hur, M H; Lee, E A; Hong, K C; Kim, J M

    2018-03-01

    cAMP-responsive element-binding protein (CREB)-regulated transcriptional coactivator 3 (CRTC3) is well known to be related to obesity in humans and mice. However, the effects of CRTC3 have not been studied in pigs. Here, we characterized the structure of the porcine CRTC3 gene and identified single nucleotide polymorphisms (SNPs) in its coding region. Moreover, mRNA expression profiles of CRTC3 in muscle and fat tissues were examined. Of the 40 identified SNPs, the p.V515F mutation, located on exon 16, was genotyped in 368 Yorkshire pigs. The p.V515F mutation was significantly associated with lean meat production ability, including reduced back fat thickness (P=0.0317) and loin eye area (P=0.0174). Moreover, the SNP was significantly associated with differences in intermuscular fat (P=0.0092), total muscle area in the belly (P=0.0108), and total fat percentage in the belly (P=0.0298). Taken together, our results suggest that the p.V515F mutation affects to lean meat production ability and amount of belly fat. Copyright © 2017. Published by Elsevier Ltd.

  13. Functional implications of the p.Cys680Arg mutation in the MLH1 mismatch repair protein

    DEFF Research Database (Denmark)

    Dominguez-Valentin, Mev; Drost, Mark; Therkildsen, Christina

    2014-01-01

    >C missense mutation in exon 18 of the human MLH1 gene and biochemically characterization of the p.Cys680Arg mutant MLH1 protein to implicate it in the pathogenicity of the Lynch syndrome (LS). We show that the mutation is deficient in DNA mismatch repair and, therefore, contributing to LS in the carriers....

  14. p16(INK4A) inhibits the pro-metastatic potentials of osteosarcoma cells through targeting the ERK pathway and TGF-β1.

    Science.gov (United States)

    Silva, Gabriela; Aboussekhra, Abdelilah

    2016-05-01

    Extracellular signal-regulated kinase (ERK) is a downstream component of the evolutionarily conserved mitogen-activated protein kinase-signaling pathway, which controls the expression of a plethora of genes implicated in various physiological processes. This pathway is often hyper-activated by mutations or abnormal extracellular signaling in different types of human cancer, including the most common primary malignant bone tumor osteosarcomas. p16(INK4A) is an important tumor suppressor gene frequently lost in osteosarcomas, and is associated with the progression of these malignancies. We have shown, here, that the ERK1/2 protein kinase is also activated by p16(INK4A) down-regulation in osteosarcoma cells and normal human as well as mouse cells. This inhibitory effect is associated with the suppression of the upstream kinase MEK1/2, and is mediated via the repression of miR-21-5p and the consequent up-regulation of the MEK/ERK antagonist SPRY2 in osteosarcoma cells. Furthermore, we have shown that p16(INK4) inhibits the migration/invasion abilities of these cells through miR-21-5p-dependent inhibition of ERK1/2. In addition, we present clear evidence that p16(INK4) represses the paracrine pro-migratory effect of osteosarcoma cells on stromal fibroblasts through the inhibition of the TGF-β1 expression/secretion. This effect is also ERK1/2-dependent, indicating that in addition to their cell-autonomous actions, p16(INK4) and ERK1/2 have also non-cell-autonomous cancer-related functions. Together, these results indicate that the tumor suppressor p16(INK4) protein represses the carcinogenic process of osteosarcoma cells not only as a cell cycle regulator, but also as a negative regulator of pro-carcinogenic/-metastatic pathways. This indicates that targeting the ERK pathway is of utmost therapeutic value. © 2015 Wiley Periodicals, Inc.

  15. Significant difference in p53 and p21 protein immunoreactivity in HPV 16 positive and HPV negative breast carcinomas

    International Nuclear Information System (INIS)

    Hennig, E.M.; Norwegian Radium Hospital, Oslo; Kvinnsland, S.; Holm, R.; Nesland, J.M.

    1999-01-01

    Human papillomavirus (HPV) 16 has previously been found in 19/41 breast carcinomas (46%) in women with a history of HPV 16 positive CIN III lesions. There was no significant difference in distribution of histological subtypes, mean or median tumour diameter or number of regional lymph node metastases in the HPV positive and HPV negative breast carcinoma groups. P53, p21 and c-erbB-2 proteins were analyzed by immunohistochemistry in the HPV 16 positive and HPV negative breast carcinomas. There was a significant difference in p53 and p21 protein immunoreactivity between HPV 16 positive and HPV negative breast carcinomas (p=0.0091 and p=0.0040), with a significant less detectable p53 and p21 protein immunoreactivity in the HPV 16 positive cases. There was also a significant difference in the coexpression of p53/p21 between the HPV 16 positive and HPV 16 negative breast carcinomas (p=0.002). No significant difference in immunostaining for c-erbB-2 protein in the two groups was found (p=0.15), or for the coexpression of p53/c-erbB-2 (p=0.19). The significantly lower expression of p53 and p21 proteins in HPV 16 positive than in HPV 16 negative breast carcinomas supports the hypothesis of inactivation and degradation of wild-type p53 proteins by HPV 16 E6 and that p53 mutation is not necessary for transformation in the HPV 16 positive cases. (orig.)

  16. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    Science.gov (United States)

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  17. Proximal dominant hereditary motor and sensory neuropathy with proximal dominance association with mutation in the TRK-fused gene.

    Science.gov (United States)

    Lee, Sang-Soo; Lee, Hye Jin; Park, Jin-Mo; Hong, Young Bin; Park, Kee-Duk; Yoo, Jeong Hyun; Koo, Heasoo; Jung, Sung-Chul; Park, Hyung Soon; Lee, Ji Hyun; Lee, Min Goo; Hyun, Young Se; Nakhro, Khriezhanou; Chung, Ki Wha; Choi, Byung-Ok

    2013-05-01

    Hereditary motor and sensory neuropathy with proximal dominance (HMSN-P) has been reported as a rare type of autosomal dominant adult-onset Charcot-Marie-Tooth disease. HMSN-P has been described only in Japanese descendants since 1997, and the causative gene has not been found. To identify the genetic cause of HMSN-P in a Korean family and determine the pathogenic mechanism. Genetic and observational analysis. Translational research center for rare neurologic disease. Twenty-eight individuals (12 men and 16 women) from a Korean family with HMSN-P. Whole-exome sequencing, linkage analysis, and magnetic resonance imaging. Through whole-exome sequencing, we revealed that HMSN-P is caused by a mutation in the TRK-fused gene (TFG). Clinical heterogeneities were revealed in HMSN-P between Korean and Japanese patients. The patients in the present report showed faster progression of the disease compared with the Japanese patients, and sensory nerve action potentials of the sural nerve were lost in the early stages of the disease. Moreover, tremor and hyperlipidemia were frequently found. Magnetic resonance imaging of the lower extremity revealed a distinct proximal dominant and sequential pattern of muscular involvement with a clearly different pattern than patients with Charcot-Marie-Tooth disease type 1A. Particularly, endoneural blood vessels revealed marked narrowing of the lumen with swollen vesicular endothelial cells. The underlying cause of HMSN-P proves to be a mutation in TFG that lies on chromosome 3q13.2. This disease is not limited to Japanese descendants, and marked narrowing of endoneural blood vessels was noted in the present study. We believe that TFG can affect the peripheral nerve tissue.

  18. XPC gene mutations in families with xeroderma pigmentosum from Pakistan; prevalent founder effect.

    Science.gov (United States)

    Ijaz, Ambreen; Basit, Sulman; Gul, Ajab; Batool, Lilas; Hussain, Abrar; Afzal, Sibtain; Ramzan, Khushnooda; Ahmad, Jamil; Wali, Abdul

    2018-03-23

    Xeroderma pigmentosum (XP) is a rare autosomal recessive skin disorder characterized by hyperpigmentation, premature skin aging, ocular and cutaneous photosensitivity, and increased risk of skin carcinoma. We investigated seven consanguineous XP families with nine patients from Pakistan. All the Patients exhibited typical clinical symptoms of XP since first year of life. Whole genome SNP genotyping identified a 14 Mb autozygous region segregating with the disease phenotype on chromosome 3p25.1. DNA sequencing of XPC gene revealed a founder homozygous splice site mutation (c.2251-1G>C) in patients from six families (A-F) and a homozygous nonsense mutation (c.1399C>T; p.Gln467*) in patients of family G. This is the first report of XPC mutations, underlying XP phenotype, in Pakistani population. © 2018 Japanese Teratology Society.

  19. Male-biased autosomal effect of 16p13.11 copy number variation in neurodevelopmental disorders.

    Directory of Open Access Journals (Sweden)

    Maria Tropeano

    Full Text Available Copy number variants (CNVs at chromosome 16p13.11 have been associated with a range of neurodevelopmental disorders including autism, ADHD, intellectual disability and schizophrenia. Significant sex differences in prevalence, course and severity have been described for a number of these conditions but the biological and environmental factors underlying such sex-specific features remain unclear. We tested the burden and the possible sex-biased effect of CNVs at 16p13.11 in a sample of 10,397 individuals with a range of neurodevelopmental conditions, clinically referred for array comparative genomic hybridisation (aCGH; cases were compared with 11,277 controls. In order to identify candidate phenotype-associated genes, we performed an interval-based analysis and investigated the presence of ohnologs at 16p13.11; finally, we searched the DECIPHER database for previously identified 16p13.11 copy number variants. In the clinical referral series, we identified 46 cases with CNVs of variable size at 16p13.11, including 28 duplications and 18 deletions. Patients were referred for various phenotypes, including developmental delay, autism, speech delay, learning difficulties, behavioural problems, epilepsy, microcephaly and physical dysmorphisms. CNVs at 16p13.11 were also present in 17 controls. Association analysis revealed an excess of CNVs in cases compared with controls (OR = 2.59; p = 0.0005, and a sex-biased effect, with a significant enrichment of CNVs only in the male subgroup of cases (OR = 5.62; p = 0.0002, but not in females (OR = 1.19, p = 0.673. The same pattern of results was also observed in the DECIPHER sample. Interval-based analysis showed a significant enrichment of case CNVs containing interval II (OR = 2.59; p = 0.0005, located in the 0.83 Mb genomic region between 15.49-16.32 Mb, and encompassing the four ohnologs NDE1, MYH11, ABCC1 and ABCC6. Our data confirm that duplications and deletions at 16p13

  20. TINF2 Gene Mutation in a Patient with Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    T. W. Hoffman

    2016-01-01

    Full Text Available Pulmonary fibrosis is a frequent manifestation of telomere syndromes. Telomere gene mutations are found in up to 25% and 3% of patients with familial disease and sporadic disease, respectively. The telomere gene TINF2 encodes an eponymous protein that is part of the shelterin complex, a complex involved in telomere protection and maintenance. A TINF2 gene mutation was recently reported in a family with pulmonary fibrosis. We identified a heterozygous Ser245Tyr mutation in the TINF2 gene of previously healthy female patient that presented with progressive cough due to pulmonary fibrosis as well as panhypogammaglobulinemia at age 52. Retrospective multidisciplinary evaluation classified her as a case of possible idiopathic pulmonary fibrosis. Telomere length-measurement indicated normal telomere length in the peripheral blood compartment. This is the first report of a TINF2 mutation in a patient with sporadic pulmonary fibrosis, which represents another association between TINF2 mutations and this disease. Furthermore, this case underlines the importance of telomere dysfunction and not telomere length alone in telomere syndromes and draws attention to hypogammaglobulinemia as a manifestation of telomere syndromes.

  1. Deep learning of mutation-gene-drug relations from the literature.

    Science.gov (United States)

    Lee, Kyubum; Kim, Byounggun; Choi, Yonghwa; Kim, Sunkyu; Shin, Wonho; Lee, Sunwon; Park, Sungjoon; Kim, Seongsoon; Tan, Aik Choon; Kang, Jaewoo

    2018-01-25

    Molecular biomarkers that can predict drug efficacy in cancer patients are crucial components for the advancement of precision medicine. However, identifying these molecular biomarkers remains a laborious and challenging task. Next-generation sequencing of patients and preclinical models have increasingly led to the identification of novel gene-mutation-drug relations, and these results have been reported and published in the scientific literature. Here, we present two new computational methods that utilize all the PubMed articles as domain specific background knowledge to assist in the extraction and curation of gene-mutation-drug relations from the literature. The first method uses the Biomedical Entity Search Tool (BEST) scoring results as some of the features to train the machine learning classifiers. The second method uses not only the BEST scoring results, but also word vectors in a deep convolutional neural network model that are constructed from and trained on numerous documents such as PubMed abstracts and Google News articles. Using the features obtained from both the BEST search engine scores and word vectors, we extract mutation-gene and mutation-drug relations from the literature using machine learning classifiers such as random forest and deep convolutional neural networks. Our methods achieved better results compared with the state-of-the-art methods. We used our proposed features in a simple machine learning model, and obtained F1-scores of 0.96 and 0.82 for mutation-gene and mutation-drug relation classification, respectively. We also developed a deep learning classification model using convolutional neural networks, BEST scores, and the word embeddings that are pre-trained on PubMed or Google News data. Using deep learning, the classification accuracy improved, and F1-scores of 0.96 and 0.86 were obtained for the mutation-gene and mutation-drug relations, respectively. We believe that our computational methods described in this research could be

  2. Metabolic alterations, HFE gene mutations and atherogenic lipoprotein modifications in patients with primary iron overload.

    Science.gov (United States)

    Meroño, Tomás; Brites, Fernando; Dauteuille, Carolane; Lhomme, Marie; Menafra, Martín; Arteaga, Alejandra; Castro, Marcelo; Saez, María Soledad; Ballerga, Esteban González; Sorroche, Patricia; Rey, Jorge; Lesnik, Philippe; Sordá, Juan Andrés; Chapman, M John; Kontush, Anatol; Daruich, Jorge

    2015-05-01

    Iron overload (IO) has been associated with glucose metabolism alterations and increased risk of cardiovascular disease (CVD). Primary IO is associated with mutations in the HFE gene. To which extent HFE gene mutations and metabolic alterations contribute to the presence of atherogenic lipoprotein modifications in primary IO remains undetermined. The present study aimed to assess small, dense low-density lipoprotein (LDL) levels, chemical composition of LDL and high-density lipoprotein (HDL) particles, and HDL functionality in IO patients. Eighteen male patients with primary IO and 16 sex- and age-matched controls were recruited. HFE mutations (C282Y, H63D and S65C), measures of insulin sensitivity and secretion (calculated from the oral glucose tolerance test), chemical composition and distribution profile of LDL and HDL subfractions (isolated by gradient density ultracentrifugation) and HDL functionality (as cholesterol efflux and antioxidative activity) were studied. IO patients compared with controls exhibited insulin resistance (HOMA-IR (homoeostasis model assessment-estimated insulin resistance): +93%, PHFE genotypes. C282Y homozygotes (n=7) presented a reduced β-cell function and insulin secretion compared with non-C282Y patients (n=11) (-58% and -73%, respectively, PHFE gene mutations are involved in the presence of atherogenic lipoprotein modifications in primary IO. To what extent such alterations could account for an increase in CVD risk remains to be determined.

  3. A novel homozygous mutation in the FSHR gene is causative for primary ovarian insufficiency.

    Science.gov (United States)

    Liu, Hongli; Xu, Xiaofei; Han, Ting; Yan, Lei; Cheng, Lei; Qin, Yingying; Liu, Wen; Zhao, Shidou; Chen, Zi-Jiang

    2017-12-01

    To identify the potential FSHR mutation in a Chinese woman with primary ovarian insufficiency (POI). Genetic and functional studies. University-based reproductive medicine center. A POI patient, her family members, and another 192 control women with regular menstruation. Ovarian biopsy was performed in the patient. Sanger sequencing was carried out for the patient, her sister, and parents. The novel variant identified was further confirmed with the use of control subjects. Sanger sequencing and genotype analysis to identify the potential variant of the FSHR gene; hematoxylin and eosin staining of the ovarian section to observe the follicular development; Western blotting and immunofluorescence to detect FSH receptor (FSHR) expression; and cyclic adenosine monophosphate (cAMP) assay to monitor FSH-induced signaling. Histologic examination of the ovaries in the patient revealed follicular development up to the early antral stage. Mutational screening and genotype analysis of the FSHR gene identified a novel homozygous mutation c.175C>T (p.R59X) in exon 2, which was inherited in the autosomal recessive mode from her heterozygous parents but was absent in her sister and the 192 control women. Functional studies demonstrated that in vitro the nonsense mutation caused the loss of full-length FSHR expression and that p.R59X mutant showed no response to FSH stimulation in the cAMP level. The mutation p.R59X in FSHR is causative for POI by means of arresting folliculogenesis. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  4. [Hereditary motor and sensory neuropathy with proximal dominant involvement (HMSN-P) is caused by a mutation in TFG].

    Science.gov (United States)

    Ishiura, Hiroyuki; Tsuji, Shoji

    2013-01-01

    Hereditary motor and sensory neuropathy with proximal dominant involvement (HMSN-P) is an autosomal dominant neurodegenerative disease characterized by proximal predominant weakness and muscle atrophy accompanied by distal sensory disturbance. Linkage analysis using 4 families identified a region on chromosome 3 showing a LOD score exceeding 4. Further refinement of candidate region was performed by haplotype analysis using high-density SNP data, resulting in a minimum candidate region spanning 3.3 Mb. Exome analysis of an HMSN-P patient revealed a mutation (c.854C>T, p.Pro285Leu) in TRK-fused gene (TFG). The identical mutation was found in the four families, which cosegregated with the disease. The mutation was neither found in Japanese control subjects nor public databases. Detailed haplotype analysis suggested two independent origins of the mutation. These findings indicate that the mutation in TFG causes HMSN-P.

  5. Cytogenetic Profile and Gene Mutations of Childhood Acute Lymphoblastic Leukemia

    Directory of Open Access Journals (Sweden)

    Nawaf Alkhayat

    2017-07-01

    Full Text Available Background: Childhood acute lymphoblastic leukemia (ALL is characterized by recurrent genetic aberrations. The identification of those abnormalities is clinically important because they are considered significant risk-stratifying markers. Aims: There are insufficient data of cytogenetic profiles in Saudi Arabian patients with childhood ALL leukemia. We have examined a cohort of 110 cases of ALL to determine the cytogenetic profiles and prevalence of FLT3 mutations and analysis of the more frequently observed abnormalities and its correlations to other biologic factors and patient outcomes and to compare our results with previously published results. Materials and methods: Patients —We reviewed all cases from 2007 to 2016 with an established diagnosis of childhood ALL. Of the 110 patients, 98 were B-lineage ALL and 12 T-cell ALL. All the patients were treated by UKALL 2003 protocol and risk stratified according previously published criteria. Cytogenetic analysis —Chromosome banding analysis and fluorescence in situ hybridization were used to detect genetic aberrations. Analysis of FLT3 mutations —Bone marrow or blood samples were screened for FLT3 mutations (internal tandem duplications, and point mutations, D835 using polymerase chain reaction methods. Result: Cytogenetic analysis showed chromosomal anomalies in 68 out of 102 cases with an overall incidence 66.7%. The most frequent chromosomal anomalies in ALL were hyperdiploidy, t(9;22, t(12;21, and MLL gene rearrangements. Our data are in accordance with those published previously and showed that FLT3 mutations are not common in patients with ALL (4.7% and have no prognostic relevance in pediatric patients with ALL. On the contrary, t(9;22, MLL gene rearrangements and hypodiploidy were signs of a bad prognosis in childhood ALL with high rate of relapse and shorter overall survival compared with the standard-risk group ( P  = .031.The event-free survival was also found to be worse ( P

  6. the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia

    International Nuclear Information System (INIS)

    Abass, M.M.E.

    2004-01-01

    β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group

  7. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  8. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    Science.gov (United States)

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-03-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  9. Determination of HER2 and p53 Mutations by Sequence Analysis Method and EGFR/Chromosome 7 Gene Status by Fluorescence in Situ Hybridization for the Predilection of Targeted Therapy Modalities in Immunohistochemically Triple Negative Breast Carcinomas in Turkish Population.

    Science.gov (United States)

    Pala, Emel Ebru; Bayol, Umit; Keskin, Elif Usturali; Ozguzer, Alp; Kucuk, Ulku; Ozer, Ozge; Koc, Altug

    2015-09-01

    Triple negative breast cancer (TNBC), an agressive subtype accounts nearly 15 % of all breast carcinomas. Conventional chemotherapy is the only treatment modality thus new, effective targeted therapy methods have been investigated. Epidermal growth factor receptor (EGFR) inhibitors give hope according to the recent studies results. Also therapeutic agents have been tried against aberrant p53 signal activity as TNBC show high p53 mutation rates. Our aim was to detect the incidence of mutations/amplifications identified in TNBC in our population. Here we used sequence analysis to detect HER2 (exon 18-23), p53 (exon 5-8) mutations; fluorescence in situ hybridization (FISH) method to analyse EGFR/chromosome 7 centromere gene status in 82 immunohistochemically TNBC. Basaloid phenotype was identified in 49 (59.8 %) patients. EGFR amplification was noted in 5 cases (6.1 %). All EGFR amplified cases showed EGFR overexpression by immunohistochemistry (IHC). p53 mutations were identified in 33 (40.2 %) cases. Almost 60 % of the basal like breast cancer cases showed p53 mutation. Only one case showed HER2 mutation (exon 20:g.36830_3). Our results showed that gene amplification is not the unique mechanism in EGFR overexpression. IHC might be used in the decision of anti-EGFR therapy in routine practice. p53 mutation rate was lower than the rates reported in the literature probably due to ethnic differences and low sensitivity of sanger sequences in general mutation screening. We also established the rarity of HER2 mutation in TNBC. In conclusion EGFR and p53 are the major targets in TNBC also for our population.

  10. Treament Response in the neck: p16+ versus p16- oropharyngeal cancer

    International Nuclear Information System (INIS)

    Mak, Daisy; Hicks, Rodney J.; Rischin, Danny; Solomon, Ben; Peters, Lester; Corry, June; Bressel, Mathias; Young, Richard J.

    2013-01-01

    To compare nodal response rates following chemoradiotherapy in patients with p16+ and p16− oropharyngeal squamous cell carcinoma (OPSCC). Patients with node-positive OPSCC treated at Peter MacCallum Cancer Centre on the published phase I–III tirapazamine trials were identified. All patients had conventional assessment (clinical examination (CA), CT and/or MRI) and positron emission tomography (PET) at both baseline and 2–4 months post-treatment. There were 30 p16+ and 18 p16− patients, the former group having significantly higher stage nodal disease (P=0.016). The mean overall reduction in nodal size at post-treatment assessment was similar in p16+ and p16− patients (78% vs. 75%), and no statistically significant difference in nodal complete response (CR) rates was detected by either CA (50% vs. 39%, P=0.35) or PET/PET-CT (93% vs. 83%, P=0.19). PET was significantly more accurate in determining the true nodal CR rate in both groups, with a negative predictive value of 96%. Nodal response rates following chemoradiotherapy appear to be similar in p16+ and p16− patients when assessed by either CA or PET/PET-CT. However, higher nodal CR was seen in PET/PET-CT compared with CA in both groups. Metabolic imaging is more accurate than CA in assessing nodal response post-treatment.

  11. The Analysis Mutation Of The CARD 15 Gene Variants In Chronic Periodontis

    OpenAIRE

    Bahruddin Thalib, Dr.drg. M.Kes,Sp.Pros.

    2014-01-01

    As Conclusion, CARD 15 gene mutation with chronic periodontitis was found to have heterozygote mutation and homozygote mutation variants, and also found genetics variation that changed the composition of C??? T nucleotide at codon 802 in exon 4 amino acid changed from alanine to valine. Purpose of This study was to determine the variant of card 15 gene mutation with periodontitis chronic.

  12. Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2011-03-01

    The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

  13. rpoB gene mutations among Mycobacterium tuberculosis isolates from extrapulmonary sites.

    Science.gov (United States)

    Khosravi, Azar Dokht; Meghdadi, Hossein; Ghadiri, Ata A; Alami, Ameneh; Sina, Amir Hossein; Mirsaeidi, Mehdi

    2018-03-01

    The aim of this study was to analyze mutations occurring in the rpoB gene of Mycobacterium tuberculosis (MTB) isolates from clinical samples of extrapulmonary tuberculosis (EPTB). Seventy formalin-fixed, paraffin-embedded samples and fresh tissue samples from confirmed EPTB cases were analyzed. Nested PCR based on the rpoB gene was performed on the extracted DNAs, combined with cloning and subsequent sequencing. Sixty-seven (95.7%) samples were positive for nester PCR. Sequence analysis of the 81 bp region of the rpoB gene demonstrated mutations in 41 (61.2%) of 67 sequenced samples. Several point mutations including deletion mutations at codons 510, 512, 513 and 515, with 45% and 51% of the mutations in codons 512 and 513 respectively were seen, along with 26% replacement mutations at codons 509, 513, 514, 518, 520, 524 and 531. The most common alteration was Gln → His, at codon 513, presented in 30 (75.6%) isolates. This study demonstrated sequence alterations in codon 513 of the 81 bp region of the rpoB gene as the most common mutation occurred in 75.6% of molecularly confirmed rifampin-resistant strains. In addition, simultaneous mutation at codons 512 and 513 was demonstrated in 34.3% of the isolates. © 2018 APMIS. Published by John Wiley & Sons Ltd.

  14. Novel ENAM and LAMB3 mutations in Chinese families with hypoplastic amelogenesis imperfecta.

    Science.gov (United States)

    Wang, Xin; Zhao, Yuming; Yang, Yuan; Qin, Man

    2015-01-01

    Amelogenesis imperfecta is a group of inherited diseases affecting the quality and quantity of dental enamel. To date, mutations in more than ten genes have been associated with non-syndromic amelogenesis imperfecta (AI). Among these, ENAM and LAMB3 mutations are known to be parts of the etiology of hypoplastic AI in human cases. When both alleles of LAMB3 are defective, it could cause junctional epidermolysis bullosa (JEB), while with only one mutant allele in the C-terminus of LAMB3, it could result in severe hypoplastic AI without skin fragility. We enrolled three Chinese families with hypoplastic autosomal-dominant AI. Despite the diagnosis falling into the same type, the characteristics of their enamel hypoplasia were different. Screening of ENAM and LAMB3 genes was performed by direct sequencing of genomic DNA from blood samples. Disease-causing mutations were identified and perfectly segregated with the enamel defects in three families: a 19-bp insertion mutation in the exon 7 of ENAM (c.406_407insTCAAAAAAGCCGACCACAA, p.K136Ifs*16) in Family 1, a single-base deletion mutation in the exon 5 of ENAM (c. 139delA, p. M47Cfs*11) in Family 2, and a LAMB3 nonsense mutation in the last exon (c.3466C>T, p.Q1156X) in Family 3. Our results suggest that heterozygous mutations in ENAM and LAMB3 genes can cause hypoplastic AI with markedly different phenotypes in Chinese patients. And these findings extend the mutation spectrum of both genes and can be used for mutation screening of AI in the Chinese population.

  15. Novel ENAM and LAMB3 mutations in Chinese families with hypoplastic amelogenesis imperfecta.

    Directory of Open Access Journals (Sweden)

    Xin Wang

    Full Text Available Amelogenesis imperfecta is a group of inherited diseases affecting the quality and quantity of dental enamel. To date, mutations in more than ten genes have been associated with non-syndromic amelogenesis imperfecta (AI. Among these, ENAM and LAMB3 mutations are known to be parts of the etiology of hypoplastic AI in human cases. When both alleles of LAMB3 are defective, it could cause junctional epidermolysis bullosa (JEB, while with only one mutant allele in the C-terminus of LAMB3, it could result in severe hypoplastic AI without skin fragility. We enrolled three Chinese families with hypoplastic autosomal-dominant AI. Despite the diagnosis falling into the same type, the characteristics of their enamel hypoplasia were different. Screening of ENAM and LAMB3 genes was performed by direct sequencing of genomic DNA from blood samples. Disease-causing mutations were identified and perfectly segregated with the enamel defects in three families: a 19-bp insertion mutation in the exon 7 of ENAM (c.406_407insTCAAAAAAGCCGACCACAA, p.K136Ifs*16 in Family 1, a single-base deletion mutation in the exon 5 of ENAM (c. 139delA, p. M47Cfs*11 in Family 2, and a LAMB3 nonsense mutation in the last exon (c.3466C>T, p.Q1156X in Family 3. Our results suggest that heterozygous mutations in ENAM and LAMB3 genes can cause hypoplastic AI with markedly different phenotypes in Chinese patients. And these findings extend the mutation spectrum of both genes and can be used for mutation screening of AI in the Chinese population.

  16. Detection of KatG Gen Mutation on Mycobacterium Tuberculosis by Means of PCR-Dot Blot Hybridization with 32P Labeled Oligonucleotide Probe Methods

    International Nuclear Information System (INIS)

    Maria Lina R; Budiman Bela; Andi Yasmon

    2009-01-01

    Handling and controlling of tuberculosis, a disease caused by Mycobacterium tuberculosis (MTB), is now complicated since there are many MTBs that are resistant against anti-tuberculosis drugs such as isoniazid. The drug resistance could occurred due to the inadequate and un-regular drug utilization that cause gene mutation of the drug target such as katG gene for isoniazid. The molecular biology techniques such as the PCR- dot blot hybridization with radioisotope ( 32 P) labeled oligonucleotide probe, has been reported as a technique that is more sensitive and rapid for detection of gene mutations related with drug resistances. Hence, the aim of this study was to apply the PCR- dot blot hybridization technique using 32 P labeled oligonucleotide probe for detection of single mutation at codon 315 of katG gene of MTBs that rise the isoniazid resistance. In this study, we used 89 sputum specimens and a standard MTB (MTB H 37 RV) as a control. DNA extractions were performed by the BOOM method and the phenol chloroform for sputum samples and standard MTB, respectively. Primers used for PCR technique were Pt8 and Pt9 and RTB59 and RTB36 for detecting tuberculosis causing Mycobacterium and the existence of katG gene, respectively. Both of the primers are specific for IS6110 region and katG gene, respectively. PCR products were detected by an agarose gel electrophoresis technique. Dot blot hybridization with 32 P-oligonucleotide probe 315mu was performed to detect mutation at codon 315 of tested samples. Results of the PCR using primer Pt8 and Pt9 showed that all sputum specimens had positive results. Mutation detection by PCR- dot blot hybridization with 32 P-oligonucleotide probe 315mu, revealed that 11 of 89 tested samples had a mutation at their codon 315 of katG gene. Based upon these results, it is concluded that PCR-dot blot hybridization with 32 P-oligonucleotide probe is a technique that is rapid and highly specific and sensitive for detection of mutation at codon

  17. A Multi-tracer Dopaminergic PET Study of Young-Onset Parkinsonian Patients With and Without Parkin Gene Mutations

    International Nuclear Information System (INIS)

    Ribeiro, M.J.; Thobois, St.; Broussolle, E.; Lohmann, E.; Lesage, S.; Dubois, B.; Agid, Y.; Brice, A.; Lohmann, E.; Agid, Y.; Brice, A.; Lohmann, E.; Lesage, S.; Dubois, B.; Agid, Y.; Brice, A.; Tezenas du Montcel, S.; Tezenas du Montcel, S.; Pelissolo, A.; Dubois, B.; Mallet, L.; Pollak, P.; Agid, Y.; Brice, A.; Remy, Ph.; Remy, Ph.

    2009-01-01

    The impact of parkin gene mutations on nigrostriatal dopaminergic degeneration is not well established. The purpose of this study was to characterize by PET using 18 F-fluoro-L-3, 4- dihydroxyphenylalanine ( 18 F-fluoro-L-DOPA), 11 C-PE2I, and 11 C-raclopride the pattern of dopaminergic lesions in young-onset Parkinson disease (YOPD) patients with or without mutations of the parkin gene and to correlate the clinical and neuro-psychologic characteristics of these patients with PET results. Methods: A total of 35 YOPD patients were enrolled (16 with parkin mutation, 19 without). The uptake constant (K i ) of 18 F-fluoro- L-DOPA and the binding potential (BP) of 11 C-PE2I (BPDAT) and of 11 C-raclopride (BPD2) were calculated in the striatum. Comparisons were made between the 2 groups of YOPD and between controls and patients. For each radiotracer, parametric images were obtained, and statistical parametric mapping (SPM) analysis using a voxel-by-voxel statistical t test was performed. Correlations between the cognitive and motor status and PET results were analyzed. Results: In YOPD patients, 18 F-fluoro-L-DOPA K i values were reduced to 68% (caudate) and 40% (putamen) of normal values (P ≤ 0.0001). This decrease was symmetric and comparable for non-parkin and parkin patients. No correlation was found between the K i values and cognitive or motor status. 11 C-PE2I BPDAT values in YOPD patients were decreased to 56% (caudate) and 41% (putamen) of normal values (P ≤ 0.0001) and did not differ between the 2 YOPD populations. The mean 11 C-raclopride BPD2 values were reduced to 72% (caudate) and 84% (putamen) of the normal values (P ≤ 0.02) and did not differ between non-parkin and parkin patients. SPM analyses showed in patients an additional decrease of 11 C-raclopride in the frontal cortex and a decrease of 18 F-fluoro-L-DOPA and 11 C-PE2I uptake in the substantia nigra bilaterally (P ≤ 0.05, false-discovery rate-corrected). Conclusion: Carriers of parkin

  18. Mutation Analysis of Consanguineous Moroccan Patients with Parkinson’s Disease Combining Microarray and Gene Panel

    Directory of Open Access Journals (Sweden)

    Ahmed Bouhouche

    2017-10-01

    Full Text Available During the last two decades, 15 different genes have been reported to be responsible for the monogenic form of Parkinson’s disease (PD, representing a worldwide frequency of 5–10%. Among them, 10 genes have been associated with autosomal recessive PD, with PRKN and PINK1 being the most frequent. In a cohort of 145 unrelated Moroccan PD patients enrolled since 2013, 19 patients were born from a consanguineous marriage, of which 15 were isolated cases and 4 familial. One patient was homozygous for the common LRRK2 G2019S mutation and the 18 others who did not carry this mutation were screened for exon rearrangements in the PRKN gene using Affymetrix Cytoscan HD microarray. Two patients were determined homozygous for PRKN exon-deletions, while another patient presented with compound heterozygous inheritance (3/18, 17%. Two other patients showed a region of homozygosity covering the 1p36.12 locus and were sequenced for the candidate PINK1 gene, which revealed two homozygous point mutations: the known Q456X mutation in exon 7 and a novel L539F variation in exon 8. The 13 remaining patients were subjected to next-generation sequencing (NGS that targeted a panel of 22 PD-causing genes and overlapping phenotypes. NGS data showed that two unrelated consanguineous patients with juvenile-onset PD (12 and 13 years carried the same homozygous stop mutation W258X in the ATP13A2 gene, possibly resulting from a founder effect; and one patient with late onset (76 years carried a novel heterozygous frameshift mutation in SYNJ1. Clinical analysis showed that patients with the ATP13A2 mutation developed juvenile-onset PD with a severe phenotype, whereas patients having either PRKN or PINK1 mutations displayed early-onset PD with a relatively mild phenotype. By identifying pathogenic mutations in 45% (8/18 of our consanguineous Moroccan PD series, we demonstrate that the combination of chromosomal microarray analysis and NGS is a powerful approach to

  19. K-RAS and N-RAS mutations in testicular germ cell tumors

    Directory of Open Access Journals (Sweden)

    Bekir Muhammet Hacioglu

    2017-05-01

    Full Text Available Testicular cancer is a relatively rare tumor type, accounting for approximately 1% of all cancers in men. However, among men aged between 15 and 40 years, testicular cancer is the most commonly diagnosed malignancy. Testicular germ cell tumors (TGCTs are classified as seminoma and non-seminoma. The RAS oncogene controls several cellular functions, including cell proliferation, apoptosis, migration, and differentiation. Thus, RAS signaling is important for normal germ cell development. Mutations of the Kirsten RAS (K-RAS gene are present in over 20% of all cancers. RAS gene mutations have also been reported in TGCTs. We investigated K-RAS and N-RAS mutations in seminoma and non-seminoma TGCT patients. A total of 24 (55% pure seminoma cases and 19 (45% non-seminoma cases were included in the study. K-RAS and N-RAS analyses were performed in our molecular pathology laboratory, using K-RAS and N-RAS Pyro Kit 24 V1 (Qiagen. In total, a RAS mutation was present in 12 patients (27%: 7 seminoma (29% and 5 non-seminoma cases (26% [p = 0.55]. A K-RAS mutation was present in 4 pure seminoma tumors (16% and 3 non-seminoma tumors (15% [p = 0.63], and an N-RAS mutation was observed in 4 seminoma tumors (16% and 3 non-seminoma tumors (15% [p = 0.63]. Both, K-RAS and N-RAS mutations were present in two patients: one with seminoma tumor and the other with non-seminoma tumor. To date, no approved targeted therapy is available for the treatment of TGCTs. The analysis of K-RAS and N-RAS mutations in these tumors may provide more treatment options, especially in platinum-resistant tumors.

  20. Heterogeneous Pulmonary Phenotypes Associated With Mutations in the Thyroid Transcription Factor Gene NKX2-1

    Science.gov (United States)

    Deterding, Robin R.; Wert, Susan E.; White, Frances V.; Dishop, Megan K.; Alfano, Danielle N.; Halbower, Ann C.; Planer, Benjamin; Stephan, Mark J.; Uchida, Derek A.; Williames, Lee D.; Rosenfeld, Jill A.; Lebel, Robert Roger; Young, Lisa R.; Cole, F. Sessions; Nogee, Lawrence M.

    2013-01-01

    Background: Mutations in the gene encoding thyroid transcription factor, NKX2-1, result in neurologic abnormalities, hypothyroidism, and neonatal respiratory distress syndrome (RDS) that together are known as the brain-thyroid-lung syndrome. To characterize the spectrum of associated pulmonary phenotypes, we identified individuals with mutations in NKX2-1 whose primary manifestation was respiratory disease. Methods: Retrospective and prospective approaches identified infants and children with unexplained diffuse lung disease for NKX2-1 sequencing. Histopathologic results and electron micrographs were assessed, and immunohistochemical analysis for surfactant-associated proteins was performed in a subset of 10 children for whom lung tissue was available. Results: We identified 16 individuals with heterozygous missense, nonsense, and frameshift mutations and five individuals with heterozygous, whole-gene deletions of NKX2-1. Neonatal RDS was the presenting pulmonary phenotype in 16 individuals (76%), interstitial lung disease in four (19%), and pulmonary fibrosis in one adult family member. Altogether, 12 individuals (57%) had the full triad of neurologic, thyroid, and respiratory manifestations, but five (24%) had only pulmonary symptoms at the time of presentation. Recurrent respiratory infections were a prominent feature in nine subjects. Lung histopathology demonstrated evidence of disrupted surfactant homeostasis in the majority of cases, and at least five cases had evidence of disrupted lung growth. Conclusions: Patients with mutations in NKX2-1 may present with pulmonary manifestations in the newborn period or during childhood when thyroid or neurologic abnormalities are not apparent. Surfactant dysfunction and, in more severe cases, disrupted lung development are likely mechanisms for the respiratory disease. PMID:23430038

  1. Novel mutations in CRB1 gene identified in a chinese pedigree with retinitis pigmentosa by targeted capture and next generation sequencing

    Science.gov (United States)

    Lo, David; Weng, Jingning; Liu, xiaohong; Yang, Juhua; He, Fen; Wang, Yun; Liu, Xuyang

    2016-01-01

    PURPOSE To detect the disease-causing gene in a Chinese pedigree with autosomal-recessive retinitis pigmentosa (ARRP). METHODS All subjects in this family underwent a complete ophthalmic examination. Targeted-capture next generation sequencing (NGS) was performed on the proband to detect variants. All variants were verified in the remaining family members by PCR amplification and Sanger sequencing. RESULTS All the affected subjects in this pedigree were diagnosed with retinitis pigmentosa (RP). The compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations in the Crumbs homolog 1 (CRB1) gene were identified in all the affected patients but not in the unaffected individuals in this family. These mutations were inherited from their parents, respectively. CONCLUSION The novel compound heterozygous mutations in CRB1 were identified in a Chinese pedigree with ARRP using targeted-capture next generation sequencing. After evaluating the significant heredity and impaired protein function, the compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations are the causal genes of early onset ARRP in this pedigree. To the best of our knowledge, there is no previous report regarding the compound mutations. PMID:27806333

  2. Mutation Spectrum and Phenotypic Features in Noonan Syndrome with PTPN11 Mutations: Definition of Two Novel Mutations.

    Science.gov (United States)

    Atik, Tahir; Aykut, Ayca; Hazan, Filiz; Onay, Huseyin; Goksen, Damla; Darcan, Sukran; Tukun, Ajlan; Ozkinay, Ferda

    2016-06-01

    To evaluate the spectrum of PTPN11 gene mutations in Noonan syndrome patients and to study the genotype-phenotype associations. In this study, twenty Noonan syndrome patients with PTPN11 mutations were included. The patients underwent a detailed clinical and physical evaluation. To identify inherited cases, parents of all mutation positive patients were analyzed. Thirteen different PTPN11 mutations, two of them being novel, were detected in the study group. These mutations included eleven missense mutations: p.G60A, p.D61N, p.Y62D, p.Y63C, p.E69Q, p.Q79R, p.Y279C,p.N308D, p.N308S, p.M504V, p.Q510R and two novel missense mutations: p.I56V and p.I282M. The frequency of cardiac abnormalities and short stature were found to be 80 % and 80 %, respectively. Mental retardation was not observed in patients having exon 8 mutations. No significant correlations were detected between other phenotypic features and genotypes. By identifying genotype-phenotype correlations, this study provides information on phenotypes observed in NS patients with different PTPN11 mutations.

  3. De novo mutations in synaptic transmission genes including DNM1 cause epileptic encephalopathies

    DEFF Research Database (Denmark)

    2014-01-01

    in five individuals and de novo mutations in GABBR2, FASN, and RYR3 in two individuals each. Unlike previous studies, this cohort is sufficiently large to show a significant excess of de novo mutations in epileptic encephalopathy probands compared to the general population using a likelihood analysis (p...... = 8.2 × 10(-4)), supporting a prominent role for de novo mutations in epileptic encephalopathies. We bring statistical evidence that mutations in DNM1 cause epileptic encephalopathy, find suggestive evidence for a role of three additional genes, and show that at least 12% of analyzed individuals have...... analyzed exome-sequencing data of 356 trios with the "classical" epileptic encephalopathies, infantile spasms and Lennox Gastaut syndrome, including 264 trios previously analyzed by the Epi4K/EPGP consortium. In this expanded cohort, we find 429 de novo mutations, including de novo mutations in DNM1...

  4. Mutational and Evolutionary Analyses of Bovine Reprimo Gene ...

    African Journals Online (AJOL)

    It can therefore be concluded that bovine RPRM gene contained 4 transition mutations and 5 indels that can be used in marker assisted selection. Evolutionary findings also demonstrated the existence of a divergent evolution between bovine RPRM gene and RPRM gene of fishes and frog. Keywords: Identity, phylogeny ...

  5. A novel missense mutation in the gene EDARADD associated with an unusual phenotype of hypohidrotic ectodermal dysplasia.

    Science.gov (United States)

    Wohlfart, Sigrun; Söder, Stephan; Smahi, Asma; Schneider, Holm

    2016-01-01

    Hypohidrotic ectodermal dysplasia (HED) is a rare disorder characterized by deficient development of structures derived from the ectoderm including hair, nails, eccrine glands, and teeth. HED forms that are caused by mutations in the genes EDA, EDAR, or EDARADD may show almost identical phenotypes, explained by a common signaling pathway. Proper interaction of the proteins encoded by these three genes is important for the activation of the NF-κB signaling pathway and subsequent transcription of the target genes. Mutations in the gene EDARADD are most rarely implicated in HED. Here we describe a novel missense mutation, c.367G>A (p.Asp123Asn), in this gene which did not appear to influence the interaction between EDAR and EDARADD proteins, but led to an impaired ability to activate NF-κB signaling. Female members of the affected family showed either unilateral or bilateral amazia. In addition, an affected girl developed bilateral ovarian teratomas, possibly associated with her genetic condition. © 2015 Wiley Periodicals, Inc.

  6. GCK gene mutations are a common cause of childhood-onset MODY (maturity-onset diabetes of the young) in Turkey.

    Science.gov (United States)

    Haliloglu, Belma; Hysenaj, Gerald; Atay, Zeynep; Guran, Tulay; Abalı, Saygın; Turan, Serap; Bereket, Abdullah; Ellard, Sian

    2016-09-01

    Inactivating heterozygous mutations in the GCK gene are a common cause of MODY and result in mild fasting hyperglycaemia, which does not require treatment. We aimed to identify the frequency, clinical and molecular features of GCK mutations in a Turkish paediatric cohort. Fifty-four unrelated probands were selected based on the following criteria: age of diagnosis ≤17 years, family history of diabetes in at least two generations, anti-GAD/ICA negative, BMIMODY probability score (www.diabetesgenes.org) was calculated and 21 patients with a score ≥75%, HbA1c levels ≤7·5% (58·5 mmol/mol) and fasting blood glucose (FBG) levels 99-145 mg/dl (5·5-8·0 mmol/l) were selected for Sanger sequencing of the GCK gene. Targeted next-generation sequencing for all known monogenic diabetes genes was undertaken for any patient without a GCK gene mutation. GCK gene mutations (pathogenic or likely pathogenic variants) and a novel intronic variant of uncertain significance (c.208 + 3A>T) were identified in 13/54 probands (24%). Twelve of these patients had a MODY probability score ≥75%. FBG level and 2-h glucose level in OGTT were 123 ± 14 mg/dl (6·8 ± 0·7 mmol/l) (107-157 mg/dl) and 181 ± 30 mg/dl (10·1 ± 1·6 mmol/l) (136-247 mg/dl), respectively. Average of glucose increment in OGTT was 58 ± 27 mg/dl (3·2 ± 1·5 mmol/l) (19-120 mg/dl), and mean HbA1c level was 6·5 ± 0·5% (47·5 ± 5·5 mmol/mol) (5·9-7·6%). Five novel missense mutations were identified (p.F123S, p.L58P, p.G246A, p.F419C, and p.S151C). Two patients treated with low-dose insulin before the molecular analysis were able to stop treatment. Approximately 1 in 4 MODY cases in this Turkish paediatric cohort have a GCK mutation. Selection of patients for GCK gene analysis using the MODY probability score was an effective way of identifying most (11/12) patients with a GCK mutation. © 2016 The Authors. Clinical Endocrinology Published by John Wiley & Sons Ltd.

  7. Challenging a dogma: co-mutations exist in MAPK pathway genes in colorectal cancer.

    Science.gov (United States)

    Grellety, Thomas; Gros, Audrey; Pedeutour, Florence; Merlio, Jean-Philippe; Duranton-Tanneur, Valerie; Italiano, Antoine; Soubeyran, Isabelle

    2016-10-01

    Sequencing of genes encoding mitogen-activated protein kinase (MAPK) pathway proteins in colorectal cancer (CRC) has established as dogma that of the genes in a pathway only a single one is ever mutated. We searched for cases with a mutation in more than one MAPK pathway gene (co-mutations). Tumor tissue samples of all patients presenting with CRC, and referred between 01/01/2008 and 01/06/2015 to three French cancer centers for determination of mutation status of RAS/RAF+/-PIK3CA, were retrospectively screened for co-mutations using Sanger sequencing or next-generation sequencing. We found that of 1791 colorectal patients with mutations in the MAPK pathway, 20 had a co-mutation, 8 of KRAS/NRAS, and some even with a third mutation. More than half of the mutations were in codons 12 and 13. We also found 3 cases with a co-mutation of NRAS/BRAF and 9 with a co-mutation of KRAS/BRAF. In 2 patients with a co-mutation of KRAS/NRAS, the co-mutation existed in the primary as well as in a metastasis, which suggests that co-mutations occur early during carcinogenesis and are maintained when a tumor disseminates. We conclude that co-mutations exist in the MAPK genes but with low frequency and as yet with unknown outcome implications.

  8. Novel germline mutation (Leu512Met) in the thyrotropin receptor gene (TSHR) leading to sporadic non-autoimmune hyperthyroidism

    Science.gov (United States)

    Roberts, Stephanie A.; Moon, Jennifer E.; Dauber, Andrew; Smith, Jessica R.

    2018-01-01

    Background Primary nonautoimmune hyperthyroidism is a rare cause of neonatal hyperthyroidism. This results from an activating mutation in the thyrotropin-receptor (TSHR). It can be inherited in an autosomal dominant manner or occur sporadically as a de novo mutation. Affected individuals display a wide phenotype from severe neonatal to mild subclinical hyperthyroidism. We describe a 6-month-old boy with a de novo mutation in the TSHR gene who presented with accelerated growth, enlarging head circumference, tremor and thyrotoxicosis. Methods Genomic DNA from the patient’s and parents’ peripheral blood leukocytes was extracted. Exons 9 and 10 of the TSHR gene were amplified by PCR and sequenced. Results Sequencing exon 10 of the TSHR gene revealed a novel heterozygous missense mutation substituting cytosine to adenine at nucleotide position 1534 in the patient’s peripheral blood leukocytes. This leads to a substitution of leucine to methionine at amino acid position 512. The mutation was absent in the parents. In silico modeling by PolyPhen-2 and SIFT predicted the mutation to be deleterious. Conclusions The p.Leu512Met mutation (c.l534C>A) of the TSHR gene has not been previously described in germline or somatic mutations. This case presentation highlights the possibility of mild thyrotoxicosis in affected individuals and contributes to the understanding of sporadic non-autoimmune primary hyperthyroidism. PMID:28195550

  9. KMeyeDB: a graphical database of mutations in genes that cause eye diseases.

    Science.gov (United States)

    Kawamura, Takashi; Ohtsubo, Masafumi; Mitsuyama, Susumu; Ohno-Nakamura, Saho; Shimizu, Nobuyoshi; Minoshima, Shinsei

    2010-06-01

    KMeyeDB (http://mutview.dmb.med.keio.ac.jp/) is a database of human gene mutations that cause eye diseases. We have substantially enriched the amount of data in the database, which now contains information about the mutations of 167 human genes causing eye-related diseases including retinitis pigmentosa, cone-rod dystrophy, night blindness, Oguchi disease, Stargardt disease, macular degeneration, Leber congenital amaurosis, corneal dystrophy, cataract, glaucoma, retinoblastoma, Bardet-Biedl syndrome, and Usher syndrome. KMeyeDB is operated using the database software MutationView, which deals with various characters of mutations, gene structure, protein functional domains, and polymerase chain reaction (PCR) primers, as well as clinical data for each case. Users can access the database using an ordinary Internet browser with smooth user-interface, without user registration. The results are displayed on the graphical windows together with statistical calculations. All mutations and associated data have been collected from published articles. Careful data analysis with KMeyeDB revealed many interesting features regarding the mutations in 167 genes that cause 326 different types of eye diseases. Some genes are involved in multiple types of eye diseases, whereas several eye diseases are caused by different mutations in one gene.

  10. A novel AVPR2 gene mutation of X-linked congenital nephrogenic diabetes insipidus in an Asian pedigree.

    Science.gov (United States)

    Guo, Wei-Hong; Li, Qiang; Wei, Hong-Yan; Lu, Hong-Yan; Qu, Hui-Qi; Zhu, Mei

    2016-10-01

    Polyuria and polydipsia are the characteristics of congenital nephrogenic diabetes insipidus (CNDI). Approximately 90% of all patients with CNDI have X-linked hereditary disease, which is due to a mutation of the arginine vasopressin receptor 2 ( AVPR2) gene. This case report describes a 54-year-old male with polyuria and polydipsia and several male members of his pedigree who had the same symptoms. The proband was diagnosed with diabetes insipidus using a water-deprivation and arginine vasopressin stimulation test. Genomic DNA from the patient and his family members was extracted and the AVPR2 gene was sequenced. A novel missense mutation of a cytosine to guanine transition at position 972 (c.972C > G) was found, which resulted in the substitution of isoleucine for methionine at amino acid position 324 (p.I324M) in the seventh transmembrane domain of the protein. The proband's mother and daughter were heterozygous for this mutation. The novel mutation of the AVPR2 gene further broadens the phenotypic spectrum of the AVPR2 gene.

  11. Functional characterisation of the type 1 von Willebrand disease candidate VWF gene variants: p.M771I, p.L881R and p.P1413L.

    Science.gov (United States)

    Berber, Ergul; Ozbil, Mehmet; Brown, Christine; Baslar, Zafer; Caglayan, S Hande; Lillicrap, David

    2017-10-01

    Abnormalities in the biosynthetic pathway or increased clearance of plasma von Willebrand factor (VWF) are likely to contribute to decreased plasma VWF levels in inherited type 1 von Willebrand disease (VWD). Recent studies demonstrated that 65% of type 1 VWD patients have candidate VWF mutations, the majority of which are missense variants. The purpose of this study was to explore the effects of three VWF missense mutations (p.M771I, p.L881R and p.P1413L) located in different functional domains of VWF, reported as candidate mutations in type 1 VWD patients in the course of the MCMDM-1VWD study. The focus of these studies was on the intracellular biosynthetic processing and localisation of VWF in a heterologous cell system. Molecular dynamic simulation for p.M771I and p.P1413L was also performed to analyse the conformational effects of the changes. As determined by immunofluorescence antibody staining and confocal microscopy of HEK293 cells, the intracellular localisation of recombinant VWF with the p.M771I variation was impaired. Transient transfection studies and phorbol myristate acetate stimulation in COS-7 cells revealed significant intracellular retention. In addition, major loss of VWF multimers was observed for only the p.M771I mutation. Molecular dynamic simulations on p.M771I mutant VWF revealed distinct structural rearrangements including a large deviation in the E' domain, and significant loss of β-sheet secondary structure. The pathogenic effects of candidate VWF gene mutations were explored in this study. In vitro expression studies in heterologous cell systems revealed impaired secretion of VWF and a dominant negative effect on the processing of the wild-type protein for only the p.M771I mutation and none of the mutations affected the regulated secretion.

  12. Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.

    Science.gov (United States)

    Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok

    GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.

  13. Mutations du gene de la filamine et syndromes malformatifs | Koffi ...

    African Journals Online (AJOL)

    Filamin is a cytoskeletal protein that occurs in the control of cytoskeleton structure and activity, the modulation of cell shape and migration as well as in the maintaining of cell shape. Mutations in the genes FLNA and FLNB provoke diverse malformative diseases in human. Mutations in the gene FLNA cause four X-Linked ...

  14. Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

    Science.gov (United States)

    Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

    1999-01-01

    We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

  15. Functional characterization of carboxylesterase gene mutations involved in Aphis gossypii resistance to organophosphate insecticides.

    Science.gov (United States)

    Gong, Y-H; Ai, G-M; Li, M; Shi, X-Y; Diao, Q-Y; Gao, X-W

    2017-12-01

    Carboxylesterases (CarEs) play an important role in detoxifying insecticides in insects. Over-expression and structural modification of CarEs have been implicated in the development of organophosphate (OP) insecticide resistance in insects. A previous study identified four nonsynonymous mutations (resulting in four amino acid residue substitutions) in the open reading frame of the carboxylesterase gene of resistant cotton aphids compared to the omethoate susceptible strain, which has possibly influenced the development of resistance to omethoate (a systemic OP insecticide). The current study further characterized the function of these mutations, both alone and in combination, in the hydrolysis of OP insecticides. The metabolism results suggest that the combination of four mutations, mainly existing in the laboratory-selected OP-resistant cotton aphid population, increased the OP hydrolase activity (approximately twofold) at the cost of detectable carboxylesterase activity. The functional studies of single or multiple mutations suggest the positive effect of H104R, A128V and T333P on the acquisition of OP hydrolase activity, especially the combination of H104R with A128V or T333P. K484R substitution decreased both the OP hydrolase activity and the CarE activity, indicating that this mutation primarily drives the negative effect on the acquisition of OP hydrolase activity amongst these four mutations in the resistant strain. The modelling and docking results are basically consistent with the metabolic results, which strongly suggest that the structural gene modification is the molecular basis for the OP resistance in this laboratory-selected cotton aphid strain. © 2017 The Royal Entomological Society.

  16. A novel nonsense mutation in the NDP gene in a Chinese family with Norrie disease.

    Science.gov (United States)

    Liu, Deyuan; Hu, Zhengmao; Peng, Yu; Yu, Changhong; Liu, Yalan; Mo, Xiaoyun; Li, Xiaoping; Lu, Lina; Xu, Xiaojuan; Su, Wei; Pan, Qian; Xia, Kun

    2010-12-08

    Norrie disease (ND), a rare X-linked recessive disorder, is characterized by congenital blindness and, occasionally, mental retardation and hearing loss. ND is caused by the Norrie Disease Protein gene (NDP), which codes for norrin, a cysteine-rich protein involved in ocular vascular development. Here, we report a novel mutation of NDP that was identified in a Chinese family in which three members displayed typical ND symptoms and other complex phenotypes, such as cerebellar atrophy, motor disorders, and mental disorders. We conducted an extensive clinical examination of the proband and performed a computed tomography (CT) scan of his brain. Additionally, we performed ophthalmic examinations, haplotype analyses, and NDP DNA sequencing for 26 individuals from the proband's extended family. The proband's computed tomography scan, in which the fifth ventricle could be observed, indicated cerebellar atrophy. Genome scans and haplotype analyses traced the disease to chromosome Xp21.1-p11.22. Mutation screening of the NDP gene identified a novel nonsense mutation, c.343C>T, in this region. Although recent research has shown that multiple different mutations can be responsible for the ND phenotype, additional research is needed to understand the mechanism responsible for the diverse phenotypes caused by mutations in the NDP gene.

  17. Towards linked open gene mutations data

    Science.gov (United States)

    2012-01-01

    Background With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. Methods A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. Results We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. Conclusions This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development. The publication of variation information as Linked Data opens new perspectives

  18. Towards linked open gene mutations data.

    Science.gov (United States)

    Zappa, Achille; Splendiani, Andrea; Romano, Paolo

    2012-03-28

    With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development.The publication of variation information as Linked Data opens new perspectives: the exploitation of SPARQL searches on

  19. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

    Science.gov (United States)

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

    2011-11-24

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

  20. NMD Microarray Analysis for Rapid Genome-Wide Screen of Mutated Genes in Cancer

    Directory of Open Access Journals (Sweden)

    Maija Wolf

    2005-01-01

    Full Text Available Gene mutations play a critical role in cancer development and progression, and their identification offers possibilities for accurate diagnostics and therapeutic targeting. Finding genes undergoing mutations is challenging and slow, even in the post-genomic era. A new approach was recently developed by Noensie and Dietz to prioritize and focus the search, making use of nonsense-mediated mRNA decay (NMD inhibition and microarray analysis (NMD microarrays in the identification of transcripts containing nonsense mutations. We combined NMD microarrays with array-based CGH (comparative genomic hybridization in order to identify inactivation of tumor suppressor genes in cancer. Such a “mutatomics” screening of prostate cancer cell lines led to the identification of inactivating mutations in the EPHB2 gene. Up to 8% of metastatic uncultured prostate cancers also showed mutations of this gene whose loss of function may confer loss of tissue architecture. NMD microarray analysis could turn out to be a powerful research method to identify novel mutated genes in cancer cell lines, providing targets that could then be further investigated for their clinical relevance and therapeutic potential.

  1. Mutation of the S and 3c genes in genomes of feline coronaviruses.

    Science.gov (United States)

    Oguma, Keisuke; Ohno, Megumi; Yoshida, Mayuko; Sentsui, Hiroshi

    2018-05-17

    Feline coronavirus (FCoV) is classified into two biotypes based on its pathogenicity in cats: a feline enteric coronavirus of low pathogenicity and a highly virulent feline infectious peritonitis virus. It has been suspected that FCoV alters its biotype via mutations in the viral genome. The S and 3c genes of FCoV have been considered the candidates for viral pathogenicity conversion. In the present study, FCoVs were analyzed for the frequency and location of mutations in the S and 3c genes from faecal samples of cats in an animal shelter and the faeces, effusions, and tissues of cats that were referred to veterinary hospitals. Our results indicated that approximately 95% FCoVs in faeces did not carry mutations in the two genes. However, 80% FCoVs in effusion samples exhibited mutations in the S and 3c genes with remainder displaying a mutation in the S or 3c gene. It was also suggested that mutational analysis of the 3c gene could be useful for studying the horizontal transmission of FCoVs in multi-cat environments.

  2. An experimental study of BIGH3 gene mutations in the patients with corneal dystrophies

    International Nuclear Information System (INIS)

    Jin Tao; Zou Liuhe; Yang Ling

    2004-01-01

    Objective: To evaluate BIGH3 gene mutations in Chinese patents with corneal dystrophies. Methods: 2ml peripheral venous blood was collected from 15 patients with granular corneal dystrophies and 5 normal subjects. Leucocytes DNA was extracted with standard method. With two pairs of oligonucleotide primers, exon 4 and exon 12 of the BIGH3 gene were amplified using the polymerase chain reaction. Amplified DNA fragments were purified and sequenced directly. Results: Mutations in BIGH3 gene were detected in all the patients with corneal dystrophies. BIGH3 gene mutations were not found in normal subjects. 12 patients with Avellino corneal dystrophy had the missense mutation R124H in the BIGH3 gene. 3 patients with granular corneal dystrophy had the missense mutation R555W in the BIGH3 gene. Conclusion: R124H and R555W mutations in BIGH3 gene were also found in the Chinese patients with Avellino and granular corneal dystrophies. In China, Avellino corneal dystrophy associated with the R124H mutation is the most common form in the corneal dystrophies resulted by BIGH3 gene mutions. Condon 124 and 555 are also the hot spots for the mutations in the BIGH3 gene in the Chinese patients with corneal dystrophies. Molecular genetic analysis may be repuired for proper diagnosis and subclassification of corneal dystrophies. (authors)

  3. Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1 vaccine candidates containing stabilized mutations in the P/C and L genes

    Directory of Open Access Journals (Sweden)

    Skiadopoulos Mario H

    2007-07-01

    Full Text Available Abstract Background Two recombinant, live attenuated human parainfluenza virus type 1 (rHPIV1 mutant viruses have been developed, using a reverse genetics system, for evaluation as potential intranasal vaccine candidates. These rHPIV1 vaccine candidates have two non-temperature sensitive (non-ts attenuating (att mutations primarily in the P/C gene, namely CR84GHNT553A (two point mutations used together as a set and CΔ170 (a short deletion mutation, and two ts att mutations in the L gene, namely LY942A (a point mutation, and LΔ1710–11 (a short deletion, the last of which has not been previously described. The latter three mutations were specifically designed for increased genetic and phenotypic stability. These mutations were evaluated on the HPIV1 backbone, both individually and in combination, for attenuation, immunogenicity, and protective efficacy in African green monkeys (AGMs. Results The rHPIV1 mutant bearing the novel LΔ1710–11 mutation was highly ts and attenuated in AGMs and was immunogenic and efficacious against HPIV1 wt challenge. The rHPIV1-CR84G/Δ170HNT553ALY942A and rHPIV1-CR84G/Δ170HNT553ALΔ1710–11 vaccine candidates were highly ts, with shut-off temperatures of 38°C and 35°C, respectively, and were highly attenuated in AGMs. Immunization with rHPIV1-CR84G/Δ170HNT553ALY942A protected against HPIV1 wt challenge in both the upper and lower respiratory tracts. In contrast, rHPIV1-CR84G/Δ170HNT553ALΔ1710–11 was not protective in AGMs due to over-attenuation, but it is expected to replicate more efficiently and be more immunogenic in the natural human host. Conclusion The rHPIV1-CR84G/Δ170HNT553ALY942A and rHPIV1-CR84G/Δ170HNT553ALΔ1710–11 vaccine candidates are clearly highly attenuated in AGMs and clinical trials are planned to address safety and immunogenicity in humans.

  4. Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

    Science.gov (United States)

    Riahi, Zied; Bonnet, Crystel; Zainine, Rim; Lahbib, Saida; Bouyacoub, Yosra; Bechraoui, Rym; Marrakchi, Jihène; Hardelin, Jean-Pierre; Louha, Malek; Largueche, Leila; Ben Yahia, Salim; Kheirallah, Moncef; Elmatri, Leila; Besbes, Ghazi; Abdelhak, Sonia; Petit, Christine

    2015-01-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3) are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys), in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24), and a nonsense mutation, c.52A>T (p.Lys18*). Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

  5. Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

    Directory of Open Access Journals (Sweden)

    Zied Riahi

    Full Text Available Usher syndrome (USH is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3 are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys, in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24, and a nonsense mutation, c.52A>T (p.Lys18*. Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

  6. Two novel mutations of CLCN7 gene in Chinese families with autosomal dominant osteopetrosis (type II).

    Science.gov (United States)

    Zheng, Hui; Shao, Chong; Zheng, Yan; He, Jin-Wei; Fu, Wen-Zhen; Wang, Chun; Zhang, Zhen-Lin

    2016-07-01

    Autosomal dominant osteopetrosis type II (ADO-II) is a heritable bone disorder characterized by osteosclerosis, predominantly involving the spine (vertebral end-plate thickening, or rugger-jersey spine), the pelvis ("bone-within-bone" structures) and the skull base. Chloride channel 7 (CLCN7) has been reported to be the causative gene. In this study, we aimed to identify the pathogenic mutation in four Chinese families with ADO-II. All 25 exons of the CLCN7 gene, including the exon-intron boundaries, were amplified and sequenced directly in four probands from the Chinese families with ADO-II. The mutation site was then identified in other family members and 250 healthy controls. In family 1, a known missense mutation c.296A>G in exon 4 of CLCN7 was identified in the proband, resulting in a tyrosine (UAU) to cysteine (UGU) substitution at p.99 (Y99C); the mutation was also identified in his affected father. In family 2, a novel missense mutation c.865G>C in exon 10 was identified in the proband, resulting in a valine (GUC) to leucine (CUC) substitution at p.289 (V289L); the mutation was also identified in her healthy mother and sister. In family 3, a novel missense mutation c.1625C>T in exon 17 of CLCN7 was identified in the proband, resulting in an alanine (GCG) to valine (GUG) substitution at p.542 (A542V); the mutation was also identified in her father. In family 4, a hot spot, R767W (c.2299C>T, CGG>TGG), in exon 24 was found in the proband which once again proved the susceptibility of the site or the similar genetic background in different races. Moreover, two novel mutations, V289L and A542V, occurred at a highly conserved position, found by a comparison of the protein sequences from eight vertebrates, and were predicted to have a pathogenic effect by PolyPhen-2 software, which showed "probably damaging" with a score of approximately 1. These mutation sites were not identified in 250 healthy controls. Our present findings suggest that the novel missense

  7. Haplotype analysis of TP53 polymorphisms, Arg72Pro and Ins16, in BRCA1 and BRCA2 mutation carriers of French Canadian descent

    International Nuclear Information System (INIS)

    Cavallone, Luca; Arcand, Suzanna L; Maugard, Christine; Ghadirian, Parviz; Mes-Masson, Anne-Marie; Provencher, Diane; Tonin, Patricia N

    2008-01-01

    The TP53 polymorphisms Arg72Pro (Ex4+199 G>C) and Ins16 (IVS3+24 ins16) have been proposed to modify risk of breast cancer associated with germline BRCA1 and BRCA2 mutations. Allele frequencies of these polymorphisms were investigated to determine if they modify risk in BRCA mutation carriers in breast cancer cases drawn from French Canadian cancer families, a population shown to exhibit strong founder effects. The frequencies of the TP53 alleles, genotypes and haplotypes of 157 index breast cancer cases comprised of 42 BRCA1 mutation carriers, 57 BRCA2 mutation carriers, and 58 BRCA mutation-negative cases, where each case was drawn from independently ascertained families were compared. The effect of TP53 variants on the age of diagnosis was also investigated for these groups. The TP53 polymorphisms were also investigated in 112 women of French Canadian descent with no personal history of cancer. The BRCA mutation-positive groups had the highest frequency of homozygous carriers of the 72Pro allele compared with mutation-negative group. The TP53 polymorphisms exhibited linkage disequilibrium (p < 0.001), where the 72Arg and Ins16minus alleles occurred in strong disequilibrium. The highest frequency of carriers of Ins16minus-72Arg haplotype occurred in the BRCA mutation-negative groups. The BRCA1 mutation carriers homozygous for the 72Pro allele had the youngest ages of diagnosis of breast cancer. However none of these observations were statistically significant. In contrast, the BRCA2 mutation carriers homozygous for the 72Pro allele had a significantly older age of diagnosis of breast cancer (p = 0.018). Moreover, in this group, the mean age of diagnosis of breast cancer in carriers of the Ins16minus-72Arg haplotype was significantly younger than that of the individuals who did not this carry this haplotype (p = 0.009). We observed no significant association of breast cancer risk with TP53 genetic variants based on BRCA1/2 mutation carrier status. Although the

  8. p53 tumor suppressor gene: significance in neoplasia - a review

    International Nuclear Information System (INIS)

    Alam, J.M.

    2000-01-01

    p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

  9. Inactivating Mutation screening of Exon 6 and Exon 10E of FSHR gene in women with Polycystic Ovarian Syndrome in Vellore population

    Science.gov (United States)

    Sekar, Nishu; Sapre, Madhura; Kale, Vaikhari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

    2017-11-01

    Polycystic Ovarian syndrome (PCOS) is a major cause of infertility in females of reproducing age and is typified by oligo-anovulation, hyperandrogenism, hirsutism and polycystic ovaries. FSHR gene located on chromosome 2 p21 is responsible for the normal follicular development and any deletion or mutation in the gene affects the interaction of FSH with its receptor. Thus, it becomes the candidate gene for PCOS study. Inactivating mutation in FSHR gene limits the receptor’s function by creating a complete block, changing the receptor-ligand complex or the basic hormone signal transduction.To screen the inactivating mutations in Exon 6 and Exon 10E of FSHR gene in women diagnosed with PCOS.PCR-RFLP analysis indicated that there were no inactivating mutations found in Exon 6 and Exon 10E. Variations in hormone levels were seen amongst the PCOS patients. There were no inactivating mutations found in FSHR gene of the women diagnosed with PCOS according to the Rotterdam criteria in Vellore population.

  10. Functioning Mediastinal Paraganglioma Associated with a Germline Mutation of von Hippel-Lindau Gene

    Directory of Open Access Journals (Sweden)

    Thibault Bahougne

    2018-05-01

    Full Text Available We report the case of a 21-year old woman presenting with high blood pressure and raised normetanephrine levels. Indium-111-pentetreotide single photon-emission computed tomography with computed tomography (SPECT/CT and 2-deoxy-2-[fluorine-18]fluoro-d-glucose (FDG positron emission tomography/computed tomography (PET/CT imaging showing isolated tracer-uptake by a 2 cm tumor close to the costovertebral angle of the third thoracic vertebra. Thoracic surgery led to normalization of normetanephrine levels. Histological findings were consistent with the presence of a paraganglioma. Mutations in SDHA, SDHB, SDHC, SDHD, RET, SDHAF2, TMEM127, MAX, NF1, FH, MDH2, and EPAS1 were absent, but a heterozygous missense mutation, c.311G > T, was found in exon 1 of the von Hippel-Lindau gene, VHL, resulting in a glycine to valine substitution in the VHL protein at position 104, p.Gly104Val. This same mutation was found in both the mother and the 17-year old sister in whom a small retinal hemangioblastoma was also found. We diagnose an unusual functional mediastinal paraganglioma in this young patient with a germline VHL gene mutation, a mutation previously described as inducing polycythemia and/or pheochromocytoma but not paraganglioma or retinal hemangioblastoma.

  11. Identification of a Variety of Mutations in Cancer Predisposition Genes in Patients With Suspected Lynch Syndrome.

    Science.gov (United States)

    Yurgelun, Matthew B; Allen, Brian; Kaldate, Rajesh R; Bowles, Karla R; Judkins, Thaddeus; Kaushik, Praveen; Roa, Benjamin B; Wenstrup, Richard J; Hartman, Anne-Renee; Syngal, Sapna

    2015-09-01

    Multigene panels are commercially available tools for hereditary cancer risk assessment that allow for next-generation sequencing of numerous genes in parallel. However, it is not clear if these panels offer advantages over traditional genetic testing. We investigated the number of cancer predisposition gene mutations identified by parallel sequencing in individuals with suspected Lynch syndrome. We performed germline analysis with a 25-gene, next-generation sequencing panel using DNA from 1260 individuals who underwent clinical genetic testing for Lynch syndrome from 2012 through 2013. All patients had a history of Lynch syndrome-associated cancer and/or polyps. We classified all identified germline alterations for pathogenicity and calculated the frequencies of pathogenic mutations and variants of uncertain clinical significance (VUS). We also analyzed data on patients' personal and family history of cancer, including fulfillment of clinical guidelines for genetic testing. Of the 1260 patients, 1112 met National Comprehensive Cancer Network (NCCN) criteria for Lynch syndrome testing (88%; 95% confidence interval [CI], 86%-90%). Multigene panel testing identified 114 probands with Lynch syndrome mutations (9.0%; 95% CI, 7.6%-10.8%) and 71 with mutations in other cancer predisposition genes (5.6%; 95% CI, 4.4%-7.1%). Fifteen individuals had mutations in BRCA1 or BRCA2; 93% of these met the NCCN criteria for Lynch syndrome testing and 33% met NCCN criteria for BRCA1 and BRCA2 analysis (P = .0017). An additional 9 individuals carried mutations in other genes linked to high lifetime risks of cancer (5 had mutations in APC, 3 had bi-allelic mutations in MUTYH, and 1 had a mutation in STK11); all of these patients met NCCN criteria for Lynch syndrome testing. A total of 479 individuals had 1 or more VUS (38%; 95% CI, 35%-41%). In individuals with suspected Lynch syndrome, multigene panel testing identified high-penetrance mutations in cancer predisposition genes, many

  12. Mutation analysis of the CHK2 gene in breast carcinoma and other cancers

    International Nuclear Information System (INIS)

    Ingvarsson, Sigurdur; Sigbjornsdottir, Bjarnveig I; Huiping, Chen; Hafsteinsdottir, Sigridur H; Ragnarsson, Gisli; Barkardottir, Rosa B; Arason, Adalgeir; Egilsson, Valgardur; Bergthorsson, Jon TH

    2002-01-01

    Mutations in the CHK2 gene at chromosome 22q12.1 have been reported in families with Li-Fraumeni syndrome. Chk2 is an effector kinase that is activated in response to DNA damage and is involved in cell-cycle pathways and p53 pathways. We screened 139 breast tumors for loss of heterozygosity at chromosome 22q, using seven microsatellite markers, and screened 119 breast tumors with single-strand conformation polymorphism and DNA sequencing for mutations in the CHK2 gene. Seventy-four of 139 sporadic breast tumors (53%) show loss of heterozygosity with at least one marker. These samples and 45 tumors from individuals carrying the BRCA2 999del5 mutation were screened for mutations in the CHK2 gene. In addition to putative polymorphic regions in short mononucleotide repeats in a non-coding exon and intron 2, a germ line variant (T59K) in the first coding exon was detected. On screening 1172 cancer patients for the T59K sequence variant, it was detected in a total of four breast-cancer patients, two colon-cancer patients, one stomach-cancer patient and one ovary-cancer patient, but not in 452 healthy individuals. A tumor-specific 5' splice site mutation at site +3 in intron 8 (TTgt [a → c]atg) was also detected. We conclude that somatic CHK2 mutations are rare in breast cancer, but our results suggest a tumor suppressor function for CHK2 in a small proportion of breast tumors. Furthermore, our results suggest that the T59K CHK2 sequence variant is a low-penetrance allele with respect to tumor growth

  13. Bladder-like graphical representation of p53 gene alterations in some human cancers

    International Nuclear Information System (INIS)

    Helal, N.L.; Dorrah, M.; LI, C.

    2005-01-01

    the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer

  14. Identification of Novel Mutations in FAH Gene and Prenatal Diagnosis of Tyrosinemia in Indian Family

    Directory of Open Access Journals (Sweden)

    Jayesh J. Sheth

    2012-01-01

    Full Text Available Carrier of tyrosinemia type I was diagnosed by sequencing FAH (fumarylacetoacetate hydrolase gene. It leads to the identification of heterozygous status for both c.648C>G (p.Ile216Met and c.1159G>A (p.Gly387Arg mutations in exons 8 and 13, respectively, in the parents. The experimental program PolyPhen, SIFT, and MT predicts former missense point mutation as “benign” that creates a potential donor splice site and later one as “probably damaging” which disrupts secondary structure of protein.

  15. Analysis of gene mutations in children with cholestasis of undefined etiology.

    Science.gov (United States)

    Matte, Ursula; Mourya, Reena; Miethke, Alexander; Liu, Cong; Kauffmann, Gregory; Moyer, Katie; Zhang, Kejian; Bezerra, Jorge A

    2010-10-01

    The discovery of genetic mutations in children with inherited syndromes of intrahepatic cholestasis allows for diagnostic specificity despite similar clinical phenotypes. Here, we aimed to determine whether mutation screening of target genes could assign a molecular diagnosis in children with idiopathic cholestasis. DNA samples were obtained from 51 subjects with cholestasis of undefined etiology and surveyed for mutations in the genes SERPINA1, JAG1, ATP8B1, ABCB11, and ABCB4 by a high-throughput gene chip. Then, the sequence readouts for all 5 genes were analyzed for mutations and correlated with clinical phenotypes. Healthy subjects served as controls. Sequence analysis of the genes identified 14 (or 27%) subjects with missense, nonsense, deletion, and splice site variants associated with disease phenotypes based on the type of mutation and/or biallelic involvement in the JAG1, ATP8B1, ABCB11, or ABCB4 genes. These patients had no syndromic features and could not be differentiated by biochemical markers or histopathology. Among the remaining subjects, 10 (or ∼20%) had sequence variants in ATP8B1 or ABCB11 that involved only 1 allele, 8 had variants not likely to be associated with disease phenotypes, and 19 had no variants that changed amino acid composition. Gene sequence analysis assigned a molecular diagnosis in 27% of subjects with idiopathic cholestasis based on the presence of variants likely to cause disease phenotypes.

  16. MSH6 Mutations are Frequent in Hereditary Nonpolyposis Colorectal Cancer Families With Normal pMSH6 Expression as Detected by Immunohistochemistry

    DEFF Research Database (Denmark)

    Okkels, Henrik; Larsen, K.L.; Thorlacius-Ussing, O.

    2012-01-01

    INTRODUCTION:: Hereditary nonpolyposis colorectal cancer (HNPCC) is an autosomal dominant condition accounting for 2% to 4% of all colorectal cancer cases worldwide. Families with germ line mutations in 1 of 6 mismatch repair genes are known as Lynch syndrome families. The largest number...... this approach in Lynch families carrying mutations in MSH6. MATERIALS AND METHODS:: Results of the screening of the MSH6 gene in HNPCC families were compared with those obtained on immunohistochemical protein analysis. RESULTS:: In 56 (7%) of 815 families, at least 1 MSH6 mutation, 23 definitively pathogenic...... be detected, whereas in 34.5% pMSH6 was present and pMLH1/pPMS2 was absent. CONCLUSIONS:: If genetic screening of HNPCC families depended on immunohistochemical results, a substantial number of families harboring a pathogenic mutation in MSH6 and the vast majority of families harboring an MSH6 unclassified...

  17. Potential late-onset Alzheimer's disease-associated mutations in the ADAM10 gene attenuate {alpha}-secretase activity.

    Science.gov (United States)

    Kim, Minji; Suh, Jaehong; Romano, Donna; Truong, Mimy H; Mullin, Kristina; Hooli, Basavaraj; Norton, David; Tesco, Giuseppina; Elliott, Kathy; Wagner, Steven L; Moir, Robert D; Becker, K David; Tanzi, Rudolph E

    2009-10-15

    ADAM10, a member of a disintegrin and metalloprotease family, is an alpha-secretase capable of anti-amyloidogenic proteolysis of the amyloid precursor protein. Here, we present evidence for genetic association of ADAM10 with Alzheimer's disease (AD) as well as two rare potentially disease-associated non-synonymous mutations, Q170H and R181G, in the ADAM10 prodomain. These mutations were found in 11 of 16 affected individuals (average onset age 69.5 years) from seven late-onset AD families. Each mutation was also found in one unaffected subject implying incomplete penetrance. Functionally, both mutations significantly attenuated alpha-secretase activity of ADAM10 (>70% decrease), and elevated Abeta levels (1.5-3.5-fold) in cell-based studies. In summary, we provide the first evidence of ADAM10 as a candidate AD susceptibility gene, and report two potentially pathogenic mutations with incomplete penetrance for late-onset familial AD.

  18. Geographical distribution of β-globin gene mutations in Syria.

    Science.gov (United States)

    Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A

    2018-04-11

    Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.

  19. BAP1 missense mutation c.2054 A>T (p.E685V completely disrupts normal splicing through creation of a novel 5' splice site in a human mesothelioma cell line.

    Directory of Open Access Journals (Sweden)

    Arianne Morrison

    Full Text Available BAP1 is a tumor suppressor gene that is lost or deleted in diverse cancers, including uveal mela¬noma, malignant pleural mesothelioma (MPM, clear cell renal carcinoma, and cholangiocarcinoma. Recently, BAP1 germline mutations have been reported in families with combinations of these same cancers. A particular challenge for mutation screening is the classification of non-truncating BAP1 sequence variants because it is not known whether these subtle changes can affect the protein function sufficiently to predispose to cancer development. Here we report mRNA splicing analysis on a homozygous substitution mutation, BAP1 c. 2054 A&T (p.Glu685Val, identified in an MPM cell line derived from a mesothelioma patient. The mutation occurred at the 3rd nucleotide from the 3' end of exon 16. RT-PCR, cloning and subsequent sequencing revealed several aberrant splicing products not observed in the controls: 1 a 4 bp deletion at the end of exon 16 in all clones derived from the major splicing product. The BAP1 c. 2054 A&T mutation introduced a new 5' splice site (GU, which resulted in the deletion of 4 base pairs and presumably protein truncation; 2 a variety of alternative splicing products that led to retention of different introns: introns 14-16; introns 15-16; intron 14 and intron 16; 3 partial intron 14 and 15 retentions caused by activation of alternative 3' splice acceptor sites (AG in the introns. Taken together, we were unable to detect any correctly spliced mRNA transcripts in this cell line. These results suggest that aberrant splicing caused by this mutation is quite efficient as it completely abolishes normal splicing through creation of a novel 5' splice site and activation of cryptic splice sites. These data support the conclusion that BAP1 c.2054 A&T (p.E685V variant is a pathogenic mutation and contributes to MPM through disruption of normal splicing.

  20. Blau syndrome-associated mutations in exon 4 of the caspase activating recruitment domain 15 (CARD 15) gene are not found in ethnic Danes with sarcoidosis

    DEFF Research Database (Denmark)

    Milman, Nils; Nielsen, Finn Cilius; Hviid, Thomas Vauvert F

    2007-01-01

    BACKGROUND: Distinct mutations of the caspase activating recruitment domain 15 (CARD15) gene (also known as nucleotide-binding oligomerisation domain protein 2) on chromosome 16q are associated with the chronic granulomatous disease called Blau syndrome. Sarcoidosis is a systemic granulomatous...... disease, which has features in common with Blau syndrome. AIM: The aim of this study was to evaluate whether ethnic Danes with sarcoidosis have CARD15 mutations associated with Blau syndrome. METHODS: Analysis of exon 4 of the CARD15 gene containing mutations associated with Blau syndrome was performed...