Effect of Urea on G-Quadruplex Stability.
Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V
2017-07-13
G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the
Multimerization rules for G-quadruplexes
Czech Academy of Sciences Publication Activity Database
Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.
2017-01-01
Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes
Guanine base stacking in G-quadruplex nucleic acids
Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân
2013-01-01
G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444
Seven essential questions on G-quadruplexes.
König, Sebastian L B; Evans, Amanda C; Huppert, Julian L
2010-08-01
The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.
Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications
2018-01-01
Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699
Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.
Directory of Open Access Journals (Sweden)
Li-Ping Bai
Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.
Buczek, Pawel; Horvath, Martin P
2006-06-23
The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.
Efficient Long-Range Hole Transport Through G-Quadruplexes.
Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei
2017-10-09
DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands
Directory of Open Access Journals (Sweden)
Alessandro Altieri
2013-10-01
Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.
A multi-functional guanine derivative for studying the DNA G-quadruplex structure.
Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan
2017-10-23
In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.
Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân
2014-01-01
G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274
Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate
Ranjan, Nihar; Davis, Erik; Xue, Liang
2013-01-01
The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792
G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.
Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela
2015-09-22
Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.
Experimental approaches to identify cellular G-quadruplex structures and functions.
Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar
2012-05-01
Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Batista, Enrique R [Los Alamos National Laboratory; Newcomer, Micharel B [YALE UNIV; Raggin, Christina M [YALE UNIV; Gascon, Jose A [YALE UNIV; Loria, J Patrick [YALE UNIV; Batista, Victor S [YALE UNIV
2008-01-01
This paper generalizes the MoD-QM/MM hybrid method, developed for ab initio computations of protein electrostatic potentials [Gasc6n, l.A.; Leung, S.S.F.; Batista, E.R.; Batista, V.S. J. Chem. Theory Comput. 2006,2, 175-186], as a practical algorithm for structural refinement of extended systems. The computational protocol involves a space-domain decomposition scheme for the formal fragmentation of extended systems into smaller, partially overlapping, molecular domains and the iterative self-consistent energy minimization of the constituent domains by relaxation of their geometry and electronic structure. The method accounts for mutual polarization of the molecular domains, modeled as Quantum-Mechanical (QM) layers embedded in the otherwise classical Molecular-Mechanics (MM) environment according to QM/MM hybrid methods. The method is applied to the description of benchmark models systems that allow for direct comparisons with full QM calculations, and subsequently applied to the structural characterization of the DNA Oxytricha nova Guanine quadruplex (G4). The resulting MoD-QM/MM structural model of the DNA G4 is compared to recently reported highresolution X-ray diffraction and NMR models, and partially validated by direct comparisons between {sup 1}H NMR chemical shifts that are highly sensitive to hydrogen-bonding and stacking interactions and the corresponding theoretical values obtained at the density functional theory DFT QM/MM (BH&H/6-31 G*:Amber) level in conjunction with the gauge independent atomic orbital (GIAO) method for the ab initio self consistent-field (SCF) calculation of NMR chemical shifts.
Selectivity in ligand recognition of G-quadruplex loops.
Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen
2009-03-03
A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences
König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.
2013-01-01
G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141
Studies of G-quadruplexes formed within self-assembled DNA mini-circles.
Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon
2016-10-13
We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.
Altered biochemical specificity of G-quadruplexes with mutated tetrads
Czech Academy of Sciences Publication Activity Database
Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.
2016-01-01
Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes
Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.
Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân
2016-01-04
G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Macrocyclic G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, M C; Ulven, Trond
2010-01-01
are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...
Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.
Directory of Open Access Journals (Sweden)
Dmitry Kaluzhny
Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.
Studies of G-quadruplex DNA structures at the single molecule level
DEFF Research Database (Denmark)
Kragh, Sofie Louise
2015-01-01
Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...
G-quadruplexes as novel cis-elements controlling transcription during embryonic development.
David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B
2016-05-19
G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Simultaneous G-Quadruplex DNA Logic.
Bader, Antoine; Cockroft, Scott L
2018-04-03
A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.
Armas, Pablo; David, Aldana; Calcaterra, Nora B
2017-01-01
G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.
Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents
Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David
2013-01-01
Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518
Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A
2018-06-01
Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.
Directory of Open Access Journals (Sweden)
Giovanna Sattin
Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.
Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.
Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân
2015-12-02
G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu
2013-10-01
G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.
Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix
Phan, Anh Tuân; Mergny, Jean-Louis
2002-01-01
Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451
Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee
2016-03-02
The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte
2011-01-01
G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...
GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.
Directory of Open Access Journals (Sweden)
Kohal Das
Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.
Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S
2017-09-12
The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.
Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng
2017-10-20
Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.
Directory of Open Access Journals (Sweden)
Gajjela Raju
Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.
Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana
2012-01-01
Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271
Takahashi, Shuntaro; Sugimoto, Naoki
2017-12-01
DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Li-Na Zhu
Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming
2012-01-01
The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes
Directory of Open Access Journals (Sweden)
Rowe J
2009-08-01
Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.
UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA
International Nuclear Information System (INIS)
Das, Anubrata; Misra, H.S.
2015-01-01
Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)
Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond
2009-01-01
the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....
Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey
2016-10-01
Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different
Energy Technology Data Exchange (ETDEWEB)
Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)
2017-02-15
In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.
Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu
2018-03-01
A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Juan Hu
2013-01-01
Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.
A mRNA-Responsive G-Quadruplex-Based Drug Release System
Directory of Open Access Journals (Sweden)
Hidenobu Yaku
2015-04-01
Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.
Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis
2017-07-15
Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the
Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes
Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij
2015-01-01
Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...
Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.
Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi
2016-05-17
ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes
Czech Academy of Sciences Publication Activity Database
Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis
2017-01-01
Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016
Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.
Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo
2014-03-21
In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.
2014-01-01
O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506
Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki
2011-01-01
Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901
Directory of Open Access Journals (Sweden)
Emmanuel O Ariyo
Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.
Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi
2013-01-01
Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846
Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes
Czech Academy of Sciences Publication Activity Database
Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří
2017-01-01
Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016
Directory of Open Access Journals (Sweden)
Andrzej S Kudlicki
Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.
Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao
2018-06-01
G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.
Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan
2015-05-01
Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.
Local epigenetic reprogramming induced by G-quadruplex ligands
Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar
2017-11-01
DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.
Directory of Open Access Journals (Sweden)
Rosalba Perrone
Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.
DEFF Research Database (Denmark)
Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard
2017-01-01
Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....
Sun, Daekyu; Hurley, Laurence H
2010-01-01
The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.
Intermolecular G-quadruplex structure-based fluorescent DNA detection system.
Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin
2013-03-15
Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.
A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative
Directory of Open Access Journals (Sweden)
Md. Monirul Islam
2015-06-01
Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.
Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar
2012-06-05
The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.
Directory of Open Access Journals (Sweden)
Aishwarya Prakash
2011-01-01
Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.
Directory of Open Access Journals (Sweden)
Deanna N Edwards
Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.
Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân
2009-11-25
Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.
Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng
2013-05-01
G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.
RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.
Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola
2018-05-25
DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.
Directory of Open Access Journals (Sweden)
Natalia Rizeq
2017-12-01
Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.
Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.
2018-05-01
Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.
De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân
2016-07-27
The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression
Directory of Open Access Journals (Sweden)
Charikleia Papadopoulou
2015-12-01
Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.
McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L
2017-07-25
G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.
Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu
2014-10-01
Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.
Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro
2009-09-16
We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.
Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun
2017-07-19
RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.
Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David
2014-09-03
Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.
Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui
2018-10-05
G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.
G-Quadruplexes influence pri-microRNA processing.
Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre
2018-02-01
RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.
G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.
Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja
2017-01-01
G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.
G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance
Directory of Open Access Journals (Sweden)
Vikas Yadav
2017-07-01
Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.
A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore
Energy Technology Data Exchange (ETDEWEB)
Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC
2014-08-21
Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.
Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke
2016-01-01
We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.
Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.
Directory of Open Access Journals (Sweden)
Yunqiang Bian
2014-04-01
Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.
Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.
Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij
2015-12-02
Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano
2013-10-01
Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
G-Quadruplexes in DNA Replication: A Problem or a Necessity?
Valton, Anne-Laure; Prioleau, Marie-Noëlle
2016-11-01
DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.
Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar
2014-07-23
L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.
Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia
2015-01-01
A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.
Directory of Open Access Journals (Sweden)
David Monchaud
2010-01-01
Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.
Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo
2009-01-01
Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.
Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik
2013-03-05
Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.
Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein
2014-01-01
G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...
Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-03-20
A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO
Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo
2018-02-01
As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.
Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole
2018-03-01
Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong
2017-12-21
An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.
Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping
2014-07-15
For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.
Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae
2018-06-01
The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.
Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.
Directory of Open Access Journals (Sweden)
Khondaker M Rahman
Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.
Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch
Czech Academy of Sciences Publication Activity Database
Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.
2017-01-01
Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016
Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.
Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek
2015-06-22
A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin
2015-02-15
Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.
Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina
2018-03-01
Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung
2013-01-01
We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.
A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.
Directory of Open Access Journals (Sweden)
Ka-Ho Leung
Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.
Lech, Christopher Jacques; Phan, Anh Tuân
2017-06-20
Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Thermal stability of DNA quadruplex-duplex hybrids.
Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân
2014-01-14
DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.
DNA and RNA Quadruplex-Binding Proteins
Czech Academy of Sciences Publication Activity Database
Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav
2014-01-01
Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014
Directory of Open Access Journals (Sweden)
Aaron J. Stevens
2017-03-01
Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.
DEFF Research Database (Denmark)
Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus
2011-01-01
Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...
Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu
2017-03-15
This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.
Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V
2012-09-19
Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.
Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch
Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.
2017-10-01
We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.
Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A
2017-03-10
Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.
Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin
2017-07-21
G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable
Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.
Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P
2010-01-15
A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.
RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP
Czech Academy of Sciences Publication Activity Database
Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.
2014-01-01
Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014
DEFF Research Database (Denmark)
Porru, Manuela; Artuso, Simona; Salvati, Erica
2015-01-01
We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...
Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N
2018-06-01
G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.
Directory of Open Access Journals (Sweden)
Ezekiel Crenshaw
Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.
Czech Academy of Sciences Publication Activity Database
Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk
2015-01-01
Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015
Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C
2018-02-15
Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.
Mms1 is an assistant for regulating G-quadruplex DNA structures.
Schwindt, Eike; Paeschke, Katrin
2017-11-02
The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.
Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands
DEFF Research Database (Denmark)
Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond
2012-01-01
Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....
Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun
2014-09-01
A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels
2017-01-01
The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...
Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal
2018-06-01
Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.
Directory of Open Access Journals (Sweden)
Stefano Alcaro
2013-09-01
Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.
DNA secondary structures: stability and function of G-quadruplex structures
Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.
2013-01-01
In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257
Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel
2018-05-01
An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.
Extended molecular dynamics of a c-kit promoter quadruplex
Czech Academy of Sciences Publication Activity Database
Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří
2015-01-01
Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015
Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu
2018-04-21
An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.
Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo
2015-08-04
Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.
Directory of Open Access Journals (Sweden)
John A Capra
2010-07-01
Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.
Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao
2017-12-01
A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
DEFF Research Database (Denmark)
Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong
2016-01-01
DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...
Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G
2018-06-01
APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.
2014-01-01
Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669
Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N
2016-02-03
We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
G-quadruplex recognition activities of E. Coli MutS
Directory of Open Access Journals (Sweden)
Ehrat Edward A
2012-07-01
Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.
Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela
2016-03-18
The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*
Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang
2015-01-01
The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683
Directory of Open Access Journals (Sweden)
Alan M Zahler
Full Text Available Ciliated protozoans possess two types of nuclei; a transcriptionally silent micronucleus, which serves as the germ line nucleus, and a transcriptionally active macronucleus, which serves as the somatic nucleus. The macronucleus is derived from a new diploid micronucleus after mating, with epigenetic information contributed by the parental macronucleus serving to guide the formation of the new macronucleus. In the stichotrichous ciliate Oxytricha trifallax, the macronuclear DNA is highly processed to yield gene-sized nanochromosomes with telomeres at each end. Here we report that soon after mating of Oxytricha trifallax, abundant 27 nt small RNAs are produced that are not present prior to mating. We performed next generation sequencing of Oxytricha small RNAs from vegetative and mating cells. Using sequence comparisons between macronuclear and micronuclear versions of genes, we found that the 27 nt RNA class derives from the parental macronucleus, not the developing macronucleus. These small RNAs are produced equally from both strands of macronuclear nanochromosomes, but in a highly non-uniform distribution along the length of the nanochromosome, and with a particular depletion in the 30 nt telomere-proximal positions. This production of small RNAs from the parental macronucleus during macronuclear development stands in contrast to the mechanism of epigenetic control in the distantly related ciliate Tetrahymena. In that species, 28-29 nt scanRNAs are produced from the micronucleus and these micronuclear-derived RNAs serve as epigenetic controllers of macronuclear development. Unlike the Tetrahymena scanRNAs, the Oxytricha macronuclear-derived 27 mers are not modified by 2'O-methylation at their 3' ends. We propose models for the role of these "27macRNAs" in macronuclear development.
Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can
2015-03-02
Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
RPA-mediated unfolding of systematically varying G-quadruplex structures.
Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza
2013-05-21
G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.
Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole
2014-08-01
Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng
2018-02-07
Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.
Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei
2016-01-15
Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua
2017-08-01
Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.
Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization
Directory of Open Access Journals (Sweden)
Victor Constantin Diculescu
2010-01-01
Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.
Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.
Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang
2017-12-01
Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.
Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.
Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng
2014-01-29
We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.
Czech Academy of Sciences Publication Activity Database
Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.
2017-01-01
Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016
Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen
2010-08-21
A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.
DEFF Research Database (Denmark)
Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav
2009-01-01
A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....
Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena
2018-02-01
Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.
De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela
2013-11-20
A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.
Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin
2017-09-05
The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.
Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun
2016-06-15
The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.
Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua
2018-05-01
Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.
Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.
Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio
2017-03-14
G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.
G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding
Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza
2014-01-01
Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170
Directory of Open Access Journals (Sweden)
Julia H Chariker
Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.
DEFF Research Database (Denmark)
Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.
2007-01-01
Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...
Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos
2018-02-08
G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.
The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.
Directory of Open Access Journals (Sweden)
Jinzhi Tan
2009-05-01
Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins
Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E
2014-02-21
Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.
Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer
Directory of Open Access Journals (Sweden)
Felipe Opazo
2015-01-01
Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.
Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage
Czech Academy of Sciences Publication Activity Database
Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel
2017-01-01
Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016
G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression
Czech Academy of Sciences Publication Activity Database
Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela
2017-01-01
Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016
Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo
2015-01-28
In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).
Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang
2016-01-01
Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032
Directory of Open Access Journals (Sweden)
Yanhua Chen
2016-05-01
Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.
Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.
Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V
2015-03-28
Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.
DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes
Czech Academy of Sciences Publication Activity Database
Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor
2009-01-01
Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process
Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.
2011-01-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589
Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.
Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo
2017-06-01
To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.
Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun
2017-06-02
G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang
2015-01-01
This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.
Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân
2017-09-20
Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.
Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro
Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.
2015-01-01
The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241
Czech Academy of Sciences Publication Activity Database
Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.
2017-01-01
Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016
Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka
2018-03-01
The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.
Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V
2011-12-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.
Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate
2016-09-21
Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.
Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.
Directory of Open Access Journals (Sweden)
Bidisha Sengupta
Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.
Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach
Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.
2013-01-01
Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423
Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia
2011-05-17
Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao
2015-08-05
Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.
Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen
2015-11-23
A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J
2015-08-26
Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.
Directory of Open Access Journals (Sweden)
Alexandro Membrino
Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.
Czech Academy of Sciences Publication Activity Database
Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří
105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014
DEFF Research Database (Denmark)
Foulk, M. S.; Urban, J. M.; Casella, Cinzia
2015-01-01
Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...
Czech Academy of Sciences Publication Activity Database
Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří
2016-01-01
Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016
Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates
International Nuclear Information System (INIS)
Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.
1991-01-01
Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures
Serendipitous discovery of a dwarf Nova in the Kepler field near the G dwarf KIC 5438845
International Nuclear Information System (INIS)
Brown, Alexander; Ayres, Thomas R.; Neff, James E.; Wells, Mark A.; Kowalski, Adam; Hawley, Suzanne; Berdyugina, Svetlana; Harper, Graham M.; Korhonen, Heidi; Piskunov, Nikolai; Saar, Steven; Walkowicz, Lucianne
2015-01-01
The Kepler satellite provides a unique window into stellar temporal variability by observing a wide variety of stars with multi-year, near-continuous, high precision, optical photometric time series. While most Kepler targets are faint stars with poorly known physical properties, many unexpected discoveries should result from a long photometric survey of such a large area of sky. During our Kepler Guest Observer programs that monitored late-type stars for starspot and flaring variability, we discovered a previously unknown dwarf nova that lies within a few arcseconds of the mid-G dwarf star KIC 5438845. This dwarf nova underwent nine outbursts over a 4 year time span. The two largest outbursts lasted ∼17–18 days and show strong modulations with a 110.8 minute period and a declining amplitude during the outburst decay phase. These properties are characteristic of an SU UMa-type cataclysmic variable. By analogy with other dwarf nova light curves, we associate the 110.8 minute (1.847 hr) period with the superhump period, close to but slightly longer than the orbital period of the binary. No precursor outbursts are seen before the super-outbursts and the overall super-outburst morphology corresponds to Osaki and Meyer “Case B” outbursts, which are initiated when the outer edge of the disk reaches the tidal truncation radius. “Case B” outbursts are rare within the Kepler light curves of dwarf novae. The dwarf nova is undergoing relatively slow mass transfer, as evidenced by the long intervals between outbursts, but the mass transfer rate appears to be steady, because the smaller “normal” outbursts show a strong correlation between the integrated outburst energy and the elapsed time since the previous outburst. At super-outburst maximum the system was at V ∼ 18, but in quiescence it is fainter than V ∼ 22, which will make any detailed quiescent follow-up of this system difficult.
2015-01-01
Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692
Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong
2017-11-29
G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.
Hirashima, Kyotaro; Seimiya, Hiroyuki
2015-02-27
Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Mostafavi, Najmeh; Ebrahimi, Ali
2018-06-01
In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.
Relationship of classical novae to other eruptive variables
International Nuclear Information System (INIS)
Vogt, N.
1989-01-01
Classical novae are characterized by their well known large-amplitude outbursts, accompanied by the ejection of a shell. The same stars, however, apparently pass through much longer quiescent phases whose duration exceeds that of the outburst phase by a factor ∼ 10 5 and that of historical nova records by a factor 10 2 -10 3 . Therefore a large number of variable stars should exist which actually are classical nova systems but whose last outbursts occurred in prehistoric times. We assume that some of these stars are hidden among the so-called 'nova-lies' in the literature. However some eruptive variables and symbiotic stars, i.e. stars which certainly are not nova remnants, are mentioned. Variables related to classical novae can be divided into three main classes: (i) Potential novae which are possibly classical novae in their quiescent state. Potential novae must share the basic configuration and parameters (orbital period, masses) with classical novae; they must be semi-detached cataclysmic binaries with a white dwarf as primary and a Roche-lobe-filling red dwarf on, or near, the mainsequence as secondary. (ii) Stars which share some outburst characteristics with classical novae without having the same binary configuration. For example recurrent novae with giant secondaries, very slow novae (and symbiotic binary stars). (iii) Stars which are evolutionarily related to classical novae, i.e. which possibly are progenitors or successors of novae in their secular evolution, such as binary nuclei of planetary nebulae and close, but detached, white dwarf-red dwarf pairs (e.g. V 471 Tau), both resulting from common-envelope evolution. These three main groups of nova-related stars are discussed. (author)
On Presolar Stardust Grains from CO Classical Novae
Iliadis, Christian; Downen, Lori N.; José, Jordi; Nittler, Larry R.; Starrfield, Sumner
2018-03-01
About 30%–40% of classical novae produce dust 20–100 days after the outburst, but no presolar stardust grains from classical novae have been unambiguously identified yet. Although several studies claimed a nova paternity for certain grains, the measured and simulated isotopic ratios could only be reconciled, assuming that the grains condensed after the nova ejecta mixed with a much larger amount of close-to-solar matter. However, the source and mechanism of this potential post-explosion dilution of the ejecta remains a mystery. A major problem with previous studies is the small number of simulations performed and the implied poor exploration of the large nova parameter space. We report the results of a different strategy, based on a Monte Carlo technique, that involves the random sampling over the most important nova model parameters: the white dwarf composition; the mixing of the outer white dwarf layers with the accreted material before the explosion; the peak temperature and density; the explosion timescales; and the possible dilution of the ejecta after the outburst. We discuss and take into account the systematic uncertainties for both the presolar grain measurements and the simulation results. Only those simulations that are consistent with all measured isotopic ratios of a given grain are accepted for further analysis. We also present the numerical results of the model parameters. We identify 18 presolar grains with measured isotopic signatures consistent with a CO nova origin, without assuming any dilution of the ejecta. Among these, the grains G270_2, M11-334-2, G278, M11-347-4, M11-151-4, and Ag26 have the highest probability of a CO nova paternity.
Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao
2018-03-09
Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
AT Cnc: A SECOND DWARF NOVA WITH A CLASSICAL NOVA SHELL
International Nuclear Information System (INIS)
Shara, Michael M.; Mizusawa, Trisha; Zurek, David; Wehinger, Peter; Martin, Christopher D.; Neill, James D.; Forster, Karl; Seibert, Mark
2012-01-01
We are systematically surveying all known and suspected Z Cam-type dwarf novae for classical nova shells. This survey is motivated by the discovery of the largest known classical nova shell, which surrounds the archetypal dwarf nova Z Camelopardalis. The Z Cam shell demonstrates that at least some dwarf novae must have undergone classical nova eruptions in the past, and that at least some classical novae become dwarf novae long after their nova thermonuclear outbursts, in accord with the hibernation scenario of cataclysmic binaries. Here we report the detection of a fragmented 'shell', 3 arcmin in diameter, surrounding the dwarf nova AT Cancri. This second discovery demonstrates that nova shells surrounding Z Cam-type dwarf novae cannot be very rare. The shell geometry is suggestive of bipolar, conical ejection seen nearly pole-on. A spectrum of the brightest AT Cnc shell knot is similar to that of the ejecta of the classical nova GK Per, and of Z Cam, dominated by [N II] emission. Galaxy Evolution Explorer FUV imagery reveals a similar-sized, FUV-emitting shell. We determine a distance of 460 pc to AT Cnc, and an upper limit to its ejecta mass of ∼5 × 10 –5 M ☉ , typical of classical novae.
AT Cnc: A SECOND DWARF NOVA WITH A CLASSICAL NOVA SHELL
Energy Technology Data Exchange (ETDEWEB)
Shara, Michael M.; Mizusawa, Trisha; Zurek, David [Department of Astrophysics, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024-5192 (United States); Wehinger, Peter [Steward Observatory, the University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721 (United States); Martin, Christopher D.; Neill, James D.; Forster, Karl [Department of Physics, Math and Astronomy, California Institute of Technology, 1200 East California Boulevard, Mail Code 405-47, Pasadena, CA 91125 (United States); Seibert, Mark [Observatories of the Carnegie Institution of Washington, 813 Santa Barbara Street, Pasadena, CA 91101 (United States)
2012-10-20
We are systematically surveying all known and suspected Z Cam-type dwarf novae for classical nova shells. This survey is motivated by the discovery of the largest known classical nova shell, which surrounds the archetypal dwarf nova Z Camelopardalis. The Z Cam shell demonstrates that at least some dwarf novae must have undergone classical nova eruptions in the past, and that at least some classical novae become dwarf novae long after their nova thermonuclear outbursts, in accord with the hibernation scenario of cataclysmic binaries. Here we report the detection of a fragmented 'shell', 3 arcmin in diameter, surrounding the dwarf nova AT Cancri. This second discovery demonstrates that nova shells surrounding Z Cam-type dwarf novae cannot be very rare. The shell geometry is suggestive of bipolar, conical ejection seen nearly pole-on. A spectrum of the brightest AT Cnc shell knot is similar to that of the ejecta of the classical nova GK Per, and of Z Cam, dominated by [N II] emission. Galaxy Evolution Explorer FUV imagery reveals a similar-sized, FUV-emitting shell. We determine a distance of 460 pc to AT Cnc, and an upper limit to its ejecta mass of {approx}5 Multiplication-Sign 10{sup -5} M {sub Sun }, typical of classical novae.
Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta
2016-09-01
Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.
Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S
2016-01-15
The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Directory of Open Access Journals (Sweden)
Charlotte Rehm
Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S
2015-01-01
In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Charge splitters and charge transport junctions based on guanine quadruplexes
Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.
2018-04-01
Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.
The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.
Zaccaria, F; Paragi, G; Fonseca Guerra, C
2016-08-21
The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.
Radio Observations of Gamma-ray Novae
Linford, Justin D.; Chomiuk, L.; Ribeiro, V.; project, E.-Nova
2014-01-01
Recent detection of gamma-ray emission from classical novae by the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope surprised many in the astronomical community. We present results from radio observations, obtained using the Karl G. Jansky Very Large Array (VLA), of three gamma-ray novae: Mon2012, Sco2012, and Del2013. Radio observations allow for the calculation of ejecta masses, place limits on the distances, and provide information about the gamma-ray emission mechanism for these sources.
International Nuclear Information System (INIS)
Slivinsky, V.W.; Drake, R.P.
1985-01-01
The authors intend that Nova be the best diagnosed ICF research facility in operation today. The authors experience in providing advanced diagnostics for previous laser systems will be extended at Nova, and will be challenged by the development of new instrumentation to diagnose the more advanced targets made possible by this powerful laser. Previous experience has shown that to understand target performance, the authors must have as complete a set of diagnostics as possible. The Nova diagnostics are divided into two sets: the basic set required for the initial Nova experiments and the more advanced set for later, generally more complex, experiments. The basic set will be operational for the first Nova shots; it was a Nova line item funded with Nova construction money. This basic set is presented in a table
Audry, Julien; Maestroni, Laetitia; Delagoutte, Emmanuelle; Gauthier, Tiphaine; Nakamura, Toru M; Gachet, Yannick; Saintomé, Carole; Géli, Vincent; Coulon, Stéphane
2015-07-14
Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in DNA replication, recombination, and repair. In fission yeast, the Rpa1-D223Y mutation provokes telomere shortening. Here, we show that this mutation impairs lagging-strand telomere replication and leads to the accumulation of secondary structures and recruitment of the homologous recombination factor Rad52. The presence of these secondary DNA structures correlates with reduced association of shelterin subunits Pot1 and Ccq1 at telomeres. Strikingly, heterologous expression of the budding yeast Pif1 known to efficiently unwind G-quadruplex rescues all the telomeric defects of the D223Y cells. Furthermore, in vitro data show that the identical D to Y mutation in human RPA specifically affects its ability to bind G-quadruplex. We propose that RPA prevents the formation of G-quadruplex structures at lagging-strand telomeres to promote shelterin association and facilitate telomerase action at telomeres. © 2015 The Authors.
Structure of a Stable G-Hairpin
Czech Academy of Sciences Publication Activity Database
Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.
2017-01-01
Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016
Stability of Human Telomere Quadruplexes at High DNA Concentrations
Czech Academy of Sciences Publication Activity Database
Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.
2014-01-01
Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014
Typical examples of classical novae
Hack, Margherita; Selvelli, Pierluigi; Bianchini, Antonio; Duerbeck, Hilmar W.
1993-09-01
Because of the very complicated individualistic behavior of each nova, we think it necessary to review the observations of a few well-observed individuals. We have selected a few objects of different speed classes, which have been extensively observed. They are: V1500 Cygni 1975, a very fast nova; V603 Aql 1918, fast nova; CP Pup 1942, fast nova; GK Per 1901, fast nova; V 1668 Cyg 1979, moderately fast nova; FH Ser 1970, slow nova; DQ Her 1934, slow nova; T Aur 1891, slow nova; RR Pic 1925, slow nova; and HR Del 1967, very slow nova.
Isolation of deletion alleles by G4 DNA-induced mutagenesis
Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel
Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature
Nova outburst modeling and its application to the recurrent nova phenomenon
International Nuclear Information System (INIS)
Sparks, W.M.; Starrfield, S.; Truran, J.
1985-12-01
The thermonuclear runaway (TNR) theory for the cause of the common novae is reviewed. Numerical simulations of this theory were performed using an implicit hydrodynamic Lagrangian computer code. Relevant physical phenomena are explained with the simpler envelope-in-place calculations. Next the models that include accretion are discussed. The calculations agree very well with observations of common novae. The observational differences between common novae and recurrent novae are examined. We propose input parameters to the TNR model which can give the outburst characteristics of RS Ophiuchi and discuss the implications. This review is concluded with a brief discussion of two current topics in novae research: shear mixing on the white dwarf and Neon novae. 36 refs., 4 figs
Czech Academy of Sciences Publication Activity Database
Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří
2014-01-01
Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014
Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A
2015-05-01
Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.
International Nuclear Information System (INIS)
Starrfield, S.G.
1988-01-01
The classical nova outburst occurs on the white dwarf component in a close binary system. Nova systems are members of the general class of cataclysmic variables and other members of the class are the Dwarf Novae, AM Her variables, Intermediate Polars, Recurrent Novae, and some of the Symbiotic variables. Although multiwavelength observations have already provided important information about all of these systems, in this review I will concentrate on the outbursts of the classical and recurrent novae and refer to other members of the class only when necessary. 140 refs., 1 tab
Neon novae, recurrent novae, and type I supernovae
International Nuclear Information System (INIS)
Starrfield, S.; Sparks, W.M.; Truran, J.W.; Shaviv, G.; Illinois Univ., Urbana, IL; Technion-Israel Inst. of Tech., Haifa
1989-01-01
Over the past few years, we have been investigating the effects of accretion onto massive white dwarfs and its implications for their growth in mass toward the Chandrasekhar limit, in attempts to identify a possible relationship between SN I and novae. In our studies we have considered accretion at various mass accretion rates onto a variety of different white dwarf masses. We have found that there is a critical white dwarf mass above which a significant fraction of the accreted mass can remain on the white dwarf after the outburst. Below this value of the white dwarf mass, all of the accreted mass, plus core material dredged up into the envelope, is ejected as a result of the explosion. Our latest results include accretion and boundary layer heating produced by the infalling material. From these studies, we have identified some members of the class of recurrent novae, those involving a thermonuclear runaway, as the novae that are occurring on very massive white dwarfs and evolving toward an SN I explosion. One of the outgrowths of our uv studies of novae in outburst has been the identification of a class of novae which eject material that is very rich in the elements from oxygen to aluminum. We have shown that these outbursts occur on ONeMg white dwarfs, which are necessarily very massive white dwarfs. 11 refs
Mikolajewska, Joanna
2010-01-01
The symbiotic novae are thermonuclear novae in symbiotic binary systems -- interacting binaries with evolved red giant donors, and the longest orbital periods. This paper aims at presenting physical characteristics of these objects and discussing their place among the whole family of symbiotic stars.
A statistical analysis of IUE spectra of dwarf novae and nova-like stars
Ladous, Constanze
1990-01-01
First results of a statistical analysis of the IUE International Ultraviolet Explorer archive on dwarf novae and nova like stars are presented. The archive contains approximately 2000 low resolution spectra of somewhat over 100 dwarf novae and nova like stars. Many of these were looked at individually, but so far the collective information content of this set of data has not been explored. The first results of work are reported.
International Nuclear Information System (INIS)
Drake, R.P.
1985-11-01
The Nova laser, at the Lawrence Livermore National Laboratory, provides unique opportunities for target experiments. It has unprecedented energy on target and significant flexibility. The paper presented by John Hunt described the capabilities and the status of Nova. This paper discusses plans for future experiments using Nova, and the present status of target experiments. We plan to perform high-quality physics experiments that exploit the unique capabilities of Nova. Because this is our goal, we are fielding an extensive array of well-characterized target diagnostics to measure the emissions from the target. The first section of this paper discusses the basic target diagnostics. We are also taking care to quantify the performance of the laser
Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar
2015-01-01
Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.
International Nuclear Information System (INIS)
Bruch, A.
1987-01-01
The nature of dwarf novae with their components white dwarf star, cool star, accretion disk, boundary layer and hot spot is investigated. It is shown that very different physical states and processes occur in the components of dwarf novae. Spectroscopical and photometrical observations are carried out. For better understanding the radiation portions of the single dwarf novae components are separated from the total electromagnetic spectrum recieved from the dwarf novae. The model assumptions are compared with the observations and verified
Paiva, T S; Silva-Neto, I D
2004-08-01
We found 34 species of ciliate protists in the samples collected by the margins of Cabiúnas Lagoon during 2001. The ciliates were cultivated in the laboratory, where they were examined in vivo and identified through silver impregnation techniques. A new species, Oxytricha marcili (Ciliophora, Oxytrichidae), was found and characterized as follows: in vivo length about 60-80 microm x 30-40 microm wide; on average 22 adoral membranelles; 18 left marginal cirri; 18 right marginal cirri; and 3 small caudal cirri. All specimens analyzed presented 7 frontal cirri (3 anterior + 4 posterior), 1 buccal cirrus, 4 ventral cirri (3 postoral + 1 pre-transverse), and 5 transverse cirri. Among the species found, some are considered as water quality indicators ranging from alpha-mesosaprobity to polysaprobity and isosaprobity.
Spectral evolution of Nova V400 Per (1974) and Nova V373 Sct (1975)
International Nuclear Information System (INIS)
Rosino, L.
1978-01-01
Photographic and spectroscopic observations of the two galactic novae, V400 Per and V373 Sct, which appeared in 1974 and 1975, have been carried out at Asiago. The light curves of the two novae were characterized by the presence of brightness oscillations during the early decline. The spectral evolution was quite normal: the spectra showed at first, over a relatively strong continuum, wide emission bands of moderate excitation, accompanied by blueshifted absorptions, with radial velocities of - 1760 kms -1 (Nova Per) and - 1260 kms -1 (Nova Sct). Later, after the novae entered the nebular stage, the continuum weakened, the absorption disappeared and the novae displayed the usual emission spectrum, with permitted and forbidden lines of high excitation ([O III], N III, He I, He II). Forbidden lines of Fe VI and Fe VII - and in Nova Sct, also Fe X and A X - were present for a time, but they soon disappeared, so that at the end the spectrum was dominated by the [O III] nebular lines, even stronger than Hα. (Auth.)
2012-01-01
As announced in the previous Bulletin, Novae has opened a new snack bar on the Flagstaff car park, just a few metres from CERN's reception area (Building 33). Just a few metres from the CERN Reception, the new Novae snack point welcomes visitors and CERNois. Opening hours Currently: Monday to Friday, 8 a.m. to 4 p.m. From September: Monday to Friday, 7:45 a.m. to 5 p.m.; Saturdays from 8 a.m. to 2 p.m. The snack bar selection includes breakfast, starting at 2.70 CHF, cold dishes from 5 CHF, and hot dishes from 6 CHF. Novae has also installed a 24-hour-a-day food vending machine in the CERN hostel (Building 39) and in Building 13. You can buy pasta and cooked dishes for 6.50 CHF to 8 CHF. In addition, a groceries vending machine has been installed in the main building, just across from the news kiosk. Nearly 60 different items are available around the clock. Finally, Novae has introduced a new payment system in several buildings on the Meyrin site. It accepts credit ca...
International Nuclear Information System (INIS)
Shara, M.M.; Potter, M.; Shara, D.J.
1989-01-01
Three of the oldest recovered novae were monitored with a CCD camera almost nightly for six weeks. The cyclic variability reported by Della Valle and Rosino (1987) for Nova Oph 1848 is confirmed. A similar variability is also suggested for Nova Cyg 1876, though this system exhibits more random flickering than Nova Oph. No secular variability is seen in Nova Sge 1783. 12 refs
Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei
2017-01-01
To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564
Nova frequency conversion and focusing system
International Nuclear Information System (INIS)
Summers, M.A.; Seppala, L.G.; Williams, J.D.
1985-01-01
New developments in crystal array technology provided significant improvements in the mechanical design and optical performance of the Nova 2 omega/3 omega array hardware. The final Nova array configuration was tested on the Novette laser and on the first arm of Nova. Ten Nova 2 omega/3 omega crystal arrays were assembled and tested for crystal alignment and wave front distortion before installation on the Nova target chamber. Ten Nova focus lens positioners were assembled and tested last year. The positioning accuracy and repeatability of each assembly were evaluated before installation on the target chamber. A cylindrical focusing system was also developed for installation in the Nova lens positioner assembly. Finally, 10 completed frequency conversion and focusing systems were activated
Directory of Open Access Journals (Sweden)
T. S. Paiva
Full Text Available We found 34 species of ciliate protists in the samples collected by the margins of Cabiúnas Lagoon during 2001. The ciliates were cultivated in the laboratory, where they were examined in vivo and identified through silver impregnation techniques. A new species, Oxytricha marcili (Ciliophora, Oxytrichidae, was found and characterized as follows: in vivo length about 60-80 mum x 30-40 mum wide; on average 22 adoral membranelles; 18 left marginal cirri; 18 right marginal cirri; and 3 small caudal cirri. All specimens analyzed presented 7 frontal cirri (3 anterior + 4 posterior, 1 buccal cirrus, 4 ventral cirri (3 postoral + 1 pre-transverse, and 5 transverse cirri. Among the species found, some are considered as water quality indicators ranging from alpha-mesosaprobity to polysaprobity and isosaprobity.
The Distance to Nova V959 Mon from VLA Imaging
Linford, J. D.; Ribeiro, V. A. R. M.; Chomiuk, L.; Nelson, T.; Sokoloski, J. L.; Rupen, M. P.; Mukai, K.; O'Brien, T. J.; Mioduszewski, A. J.; Weston, J.
2015-06-01
Determining reliable distances to classical novae is a challenging but crucial step in deriving their ejected masses and explosion energetics. Here we combine radio expansion measurements from the Karl G. Jansky Very Large Array with velocities derived from optical spectra to estimate an expansion parallax for nova V959 Mon, the first nova discovered through its γ-ray emission. We spatially resolve the nova at frequencies of 4.5-36.5 GHz in nine different imaging epochs. The first five epochs cover the expansion of the ejecta from 2012 October to 2013 January, while the final four epochs span 2014 February-May. These observations correspond to days 126 through 199 and days 615 through 703 after the first detection of the nova. The images clearly show a non-spherical ejecta geometry. Utilizing ejecta velocities derived from three-dimensional modeling of optical spectroscopy, the radio expansion implies a distance between 0.9 ± 0.2 and 2.2 ± 0.4 kpc, with a most probable distance of 1.4 ± 0.4 kpc. This distance implies a γ-ray luminosity of 0.6× {{10}35} erg s-1, which is much less than the prototype γ-ray-detected nova, V407 Cyg, possibly due to the lack of a red giant companion in the V959 Mon system. V959 Mon also has a much lower γ-ray luminosity than other classical novae detected in γ-rays to date, indicating a range of at least a factor of 10 in the γ-ray luminosities for these explosions.
Uranium in Nova Scotia: a background summary for the uranium inquiry, Nova Scotia
International Nuclear Information System (INIS)
1982-01-01
Since the mid 1970's Nova Scotia has experienced increased exploration for a number of commodities including uranium. The exploration activity for uranium has resulted in discovery of significant occurrences of the element. It became obvious to the Government of Nova Scotia that a segment of the population of the Province is concerned about the potential hazards associated with the exploration, mining and milling stages of the uranium industry. Public concern has resulted in the appointment of a Commissioner under the Public Inquiries Act of Nova Scotia to inquire and make recommendations to the Governor-in-Council on all aspects of exploration, development, mining, processing, storage, waste management and transportation of uranium in any form. The regulation of mineral exploration and mining activities is carried out by the Nova Scotia Department of Mines and Energy through the Mineral Resources Act of the Province of Nova Scotia. The regulation of the special radioactive aspects involved in the mining and processing of uranium ore is the responsibility of the federal Atomic Energy Control Board. The purposes of this report is to: outline the history of uranium exploration in Nova Scotia; summarize the results of geological surveys by provincial and federal government agencies, universities and exploration companies which document the natural levels of radioactivity in the Province; briefly outline the physical and chemical characteristics of uranium and thorium which make these elements unique and a potential environmental and health concern; outline chronologically the steps taken by the Nova Scotia Department of Mines and Energy to monitor and regulate uranium exploration activities; classify the types of uranium deposits known to occur in Nova Scotia and describe their main geological features; outline the role of the Nova Scotia Department of Mines and Energy in the regulation of mining activities in the Province. The report is written for the interested
The NOvA Technical Design Report
International Nuclear Information System (INIS)
Ayres, D.S.; Drake, G.R.; Goodman, M.C.; Grudzinski, J.J.; Guarino, V.J.; Talaga, R.L.; Zhao, A.; Stamoulis, P.; Stiliaris, E.; Tzanakos, G.; Zois, M.
2007-01-01
Technical Design Report (TDR) describes the preliminary design of the NOvA accelerator upgrades, NOvA detectors, detector halls and detector sites. Compared to the March 2006 and November 2006 NOvA Conceptual Design Reports (CDR), critical value engineering studies have been completed and the alternatives still active in the CDR have been narrowed to achieve a preliminary technical design ready for a Critical Decision 2 review. Many aspects of NOvA described this TDR are complete to a level far beyond a preliminary design. In particular, the access road to the NOvA Far Detector site in Minnesota has an advanced technical design at a level appropriate for a Critical Decision 3a review. Several components of the accelerator upgrade and new neutrino detectors also have advanced technical designs appropriate for a Critical Decision 3a review. Chapter 1 is an Executive Summary with a short description of the NOvA project. Chapter 2 describes how the Fermilab NuMI beam will provide a narrow band beam of neutrinos for NOvA. Chapter 3 gives an updated overview of the scientific basis for the NOvA experiment, focusing on the primary goal to extend the search for ν μ → ν e oscillations and measure the sin 2 (2θ 13 ) parameter. This parameter has not been measured in any previous experiment and NOvA would extend the search by about an order of magnitude beyond the current limit. A secondary goal is to measure the dominant mode oscillation parameters, sin 2 (2θ 23 ) and Δm 32 2 to a more precise level than previous experiments. Additional physics goals for NOvA are also discussed. Chapter 4 describes the Scientific Design Criteria which the Fermilab accelerator complex, NOvA detectors and NOvA detector sites must satisfy to meet the physics goals discussed in Chapter 3. Chapter 5 is an overview of the NOvA project. The changes in the design relative to the NOvA CDR are discussed. Chapter 6 summarizes the NOvA design performance relative to the Design Criteria set out
Climate change in Nova Scotia : a background paper to guide Nova Scotia's climate change action plan
International Nuclear Information System (INIS)
2007-10-01
Climate change causes changes in the temperature of the earth, the level of the sea, and the frequency of extreme weather conditions. The province of Nova Scotia recently released an act related to environmental goals and sustainable prosperity. Addressing climate change is a key element in achieving Nova Scotia's sustainable prosperity goals outlined in the act. The Nova Scotia Department of Energy is working towards developing both policy and action, to help meet its target of a 10 per cent reduction in greenhouse gases from 1990 levels by the year 2020. Two major plans are underway, notably a climate change action plan and a renewed energy strategy. This report provided background information on Nova Scotia's climate change action plan. It discussed climate change issues affecting Nova Scotia, air pollutants, energy sources in Nova Scotia, energy consumers in the province, and Nova Scotia's approach to climate change. The report also discussed actions underway and funding sources. It was concluded that in order for the climate change action plan to be successful, Nova Scotians must use energy more efficiently; use renewable energy; use cleaner energy; and plan for change. 13 refs., 2 tabs., 6 figs., 4 appendices
International Nuclear Information System (INIS)
Helton, L. Andrew; Woodward, Charles E.; Gehrz, Robert D.; Walter, Frederick M.; Vanlandingham, Karen; Schwarz, Greg J.; Evans, Aneurin; Ness, Jan-Uwe; Geballe, Thomas R.; Greenhouse, Matthew; Krautter, Joachim; Liller, William; Lynch, David K.; Rudy, Richard J.; Shore, Steven N.; Starrfield, Sumner; Truran, Jim
2010-01-01
We examine the ejecta evolution of the classical nova V1065 Centauri, constructing a detailed picture of the system based on spectrophotometric observations obtained from 9 to approximately 900 days post-outburst with extensive coverage from optical to mid-infrared wavelengths. We estimate a reddening toward the system of E(B-V) = 0.5 ± 0.1, based upon the B - V color and analysis of the Balmer decrement, and derive a distance estimate of 8.7 +2.8 -2.1 kpc. The optical spectral evolution is classified as P o fe N ne A o according to the CTIO Nova Classification system of Williams et al. Photoionization modeling yields absolute abundance values by number, relative to solar of He/H = 1.6 ± 0.3, N/H = 144 ± 34, O/H = 58 ± 18, and Ne/H = 316 ± 58 for the ejecta. We derive an ejected gas mass of M g = (1.6 ± 0.2) x 10 -4 M sun . The infrared excess at late epochs in the evolution of the nova arises from dust condensed in the ejecta composed primarily of silicate grains. We estimate a total dust mass, M d , of order (0.2-3.7) x 10 -7 M sun , inferred from modeling the spectral energy distribution observed with the Spitzer IRS and Gemini-South GNIRS spectrometers. Based on the speed class, neon abundance, and the predominance of silicate dust, we classify V1065 Cen as an ONe-type classical nova.
The NOvA Technical Design Report
Energy Technology Data Exchange (ETDEWEB)
Ayres, D.S.; Drake, G.R.; Goodman, M.C.; Grudzinski, J.J.; Guarino, V.J.; Talaga, R.L.; Zhao, A.; /Argonne; Stamoulis, P.; Stiliaris, E.; Tzanakos, G.; Zois, M.; /Athens U. /Caltech /UCLA /Fermilab /College de France /Harvard U. /Indiana U. /Lebedev Inst. /Michigan State U. /Minnesota U., Duluth /Minnesota U.
2007-10-08
Technical Design Report (TDR) describes the preliminary design of the NOvA accelerator upgrades, NOvA detectors, detector halls and detector sites. Compared to the March 2006 and November 2006 NOvA Conceptual Design Reports (CDR), critical value engineering studies have been completed and the alternatives still active in the CDR have been narrowed to achieve a preliminary technical design ready for a Critical Decision 2 review. Many aspects of NOvA described this TDR are complete to a level far beyond a preliminary design. In particular, the access road to the NOvA Far Detector site in Minnesota has an advanced technical design at a level appropriate for a Critical Decision 3a review. Several components of the accelerator upgrade and new neutrino detectors also have advanced technical designs appropriate for a Critical Decision 3a review. Chapter 1 is an Executive Summary with a short description of the NOvA project. Chapter 2 describes how the Fermilab NuMI beam will provide a narrow band beam of neutrinos for NOvA. Chapter 3 gives an updated overview of the scientific basis for the NOvA experiment, focusing on the primary goal to extend the search for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations and measure the sin{sup 2}(2{theta}{sub 13}) parameter. This parameter has not been measured in any previous experiment and NOvA would extend the search by about an order of magnitude beyond the current limit. A secondary goal is to measure the dominant mode oscillation parameters, sin{sup 2}(2{theta}{sub 23}) and {Delta}m{sub 32}{sup 2} to a more precise level than previous experiments. Additional physics goals for NOvA are also discussed. Chapter 4 describes the Scientific Design Criteria which the Fermilab accelerator complex, NOvA detectors and NOvA detector sites must satisfy to meet the physics goals discussed in Chapter 3. Chapter 5 is an overview of the NOvA project. The changes in the design relative to the NOvA CDR are discussed. Chapter 6 summarizes the NOvA
Nova laser assurance-management system
International Nuclear Information System (INIS)
Levy, A.J.
1983-01-01
In a well managed project, Quality Assurance is an integral part of the management activities performed on a daily basis. Management assures successful performance within budget and on schedule by using all the good business, scientific, engineering, quality assurance, and safety practices available. Quality assurance and safety practices employed on Nova are put in perspective by integrating them into the overall function of good project management. The Nova assurance management system was developed using the quality assurance (QA) approach first implemented at LLNL in early 1978. The LLNL QA program is described as an introduction to the Nova assurance management system. The Nova system is described pictorially through the Nova configuration, subsystems and major components, interjecting the QA techniques which are being pragmatically used to assure the successful completion of the project
School Psychology in Nova Scotia
King, Sara; McGonnell, Melissa; Noyes, Amira
2016-01-01
Registration as a psychologist in Nova Scotia can be at the master's or doctoral level; however, the Nova Scotia Board of Examiners in Psychology has announced a move to the doctoral degree as the entry-level to practice. Many school psychologists in Nova Scotia practice at the master's level; therefore, this change could affect school psychology…
Explosive hydrogen burning in novae
International Nuclear Information System (INIS)
Wiescher, M.; Goerres, J.; Thielemann, F.K.; Ritter, H.
1986-01-01
Recent observations (nova CrA 81 and Aql 82) reported large enhancements of element abundances beyond CNO nuclei in nova ejecta, which still wait for a clear theoretical explanation. Attempts to interprete these findings include scenarios like nova events on a O-Ne-Mg white dwarf or nuclear processing which enables the transfer of CNO material to heavier nuclei. In the present study we included all available nuclear information on proton-rich unstable nuclei, to update thermo-nuclear reaction rates in explosive hydrogen burning. They are applied in a systematic analysis of explosive hydrogen burning for a variety of temperature conditions, appropriate to nova explosions. We find that (a) for temperatures T>2 10 8 K, pre-existing material in Ne, Al, or Mg can be transferred to heavier nuclei following the flow pattern of a r(apid) p(roton-capture) process (b) for T> or approx.3.5 10 8 K CNO matter can be processed to heavier nuclei (in accordance with previous findings). On the basis of these results it seems unlikely that nova Aql 82 (which shows strong carbon and oxygen enrichment together with heavier elements) can be explained by a nova event on a bare O-Ne-Mg white dwarf but is rather a result of burning with T> or approx.3.5 10 8 K. An application to existing nova models shows a reduced 26 Al production, when compared to earlier predictions. Both conclusions, however, have to be verified by complete nova calculations which include the improved nuclear physics input, presented here. (orig.)
Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets
Czech Academy of Sciences Publication Activity Database
Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela
2009-01-01
Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009
Chomiuk, Laura; Krauss, Miriam I.; Rupen, Michael P.; Nelson, Thomas; Roy, Nirupam; Sokoloski, Jennifer L.; Mukai, Koji; Munari, Ulisse; Mioduszewski, Amy; Weston, Jeninfer;
2012-01-01
We present multi-frequency radio observations of the 2010 nova event in the symbiotic binary V407 Cygni, obtained with the Karl G. Jansky Very Large Array (VLA) and spanning 1.45 GHz and 17.770 days following discovery. This nova.the first ever detected in gamma rays.shows a radio light curve dominated by the wind of the Mira giant companion, rather than the nova ejecta themselves. The radio luminosity grewas the wind became increasingly ionized by the nova outburst, and faded as the wind was violently heated from within by the nova shock. This study marks the first time that this physical mechanism has been shown to dominate the radio light curve of an astrophysical transient. We do not observe a thermal signature from the nova ejecta or synchrotron emission from the shock, due to the fact that these components were hidden behind the absorbing screen of the Mira wind. We estimate a mass-loss rate for the Mira wind of .Mw approximately equals 10(exp -6) Solar mass yr(exp -1). We also present the only radio detection of V407 Cyg before the 2010 nova, gleaned from unpublished 1993 archival VLA data, which shows that the radio luminosity of the Mira wind varies by a factor of 20 even in quiescence. Although V407 Cyg likely hosts a massive accreting white dwarf, making it a candidate progenitor system for a Type Ia supernova, the dense and radially continuous circumbinary material surrounding V407 Cyg is inconsistent with observational constraints on the environments of most Type Ia supernovae.
Searching for nova shells around cataclysmic variables
Sahman, D. I.; Dhillon, V. S.; Knigge, C.; Marsh, T. R.
2015-08-01
We present the results of a search for nova shells around 101 cataclysmic variables (CVs), using H α images taken with the 4.2-m William Herschel Telescope (WHT) and the 2.5-m Isaac Newton Telescope Photometric H α Survey of the Northern Galactic Plane (IPHAS). Both telescopes are located on La Palma. We concentrated our WHT search on nova-like variables, whilst our IPHAS search covered all CVs in the IPHAS footprint. We found one shell out of the 24 nova-like variables we examined. The newly discovered shell is around V1315 Aql and has a radius of ˜2.5 arcmin, indicative of a nova eruption approximately 120 yr ago. This result is consistent with the idea that the high mass-transfer rate exhibited by nova-like variables is due to enhanced irradiation of the secondary by the hot white dwarf following a recent nova eruption. The implications of our observations for the lifetime of the nova-like variable phase are discussed. We also examined four asynchronous polars, but found no new shells around any of them, so we are unable to confirm that a recent nova eruption is the cause of the asynchronicity in the white dwarf spin. We find tentative evidence of a faint shell around the dwarf nova V1363 Cyg. In addition, we find evidence for a light echo around the nova V2275 Cyg, which erupted in 2001, indicative of an earlier nova eruption ˜300 yr ago, making V2275 Cyg a possible recurrent nova.
Uma nova espécie do gênero Temnomastax (Temnomastacinae, Eumastacidae, Orthoptera da Amazônia
Directory of Open Access Journals (Sweden)
Renan S. Olivier
2014-12-01
Full Text Available O gênero Temnomastax apresenta atualmente sete espécies, sendo amplamente distribuídas pelo domínio Cerrado, na América do Sul. Neste trabalho, uma oitava espécie, Temnomastax spielmanni sp. nov., é descrita para a região Amazônica brasileira. A diagnose da nova espécie baseia-se em caracteres do complexo fálico e em características morfológicas externas. Temnomastax spielmanni sp. nov. apresenta semelhança com Temnomastax beni Rehn & Rehn, 1942, que ocorre em território boliviano, mas pode ser diferenciada por alguns caracteres externos. O complexo fálico de T. spielmanni sp. nov. apresenta caracteres ainda não descritos em Temnomastacinae; tal fato reforça a necessidade da revisão taxonômica dessa subfamília, o que poderá esclarecer as relações filogenéticas existentes.
Observations of classical novae in outburst
Starrfield, S.; Stryker, L. L.; Sonneborn, G.; Sparks, Warren M.; Ferland, Gary; Wagner, R. M.; Williams, R. E.; Gehrz, Robert D.; Ney, Edward P.; Kenyon, Scott
1988-01-01
The IUE obtained ultraviolet data on novae in outburst. The characteristics of every one of the outbursts are different. Optical and infrared data on many of the same novae were also obtained. Three members of the carbon-oxygen class of novae are presented.
Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations
Czech Academy of Sciences Publication Activity Database
Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří
2004-01-01
Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004
O rap radical e a "nova classe média"
Directory of Open Access Journals (Sweden)
Ricardo Indig Teperman
2015-04-01
Full Text Available Este artigo discute a recente alteração na posição relativa do rap e dos rappers no campo da produção cultural no Brasil. O grupo Racionais MCs, tão central no campo do rap nacional que acaba por determinar a tendência hegemônica do gênero, vem se afastando do posicionamento revolucionário que marcou seus primeiros anos. Proponho que o aumento do poder de consumo e a democratização do acesso à tecnologia e à educação são aspectos que marcam a experiência da nova geração do rap (a chamada "nova escola", personificada em Emicida, e que provocaram o reposicionamento do Racionais. Recupero uma formulação de Antonio Candido para propor que essa nova posição pode ser considerada "radical".
Energy Technology Data Exchange (ETDEWEB)
Chomiuk, Laura; Krauss, Miriam I.; Rupen, Michael P.; Roy, Nirupam; Mioduszewski, Amy [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); Nelson, Thomas [School of Physics and Astronomy, University of Minnesota, 116 Church Street SE, Minneapolis, MN 55455 (United States); Sokoloski, Jennifer L.; Weston, Jennifer [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Mukai, Koji [CRESST and X-ray Astrophysics Laboratory, NASA/GSFC, Greenbelt, MD 20771 (United States); Munari, Ulisse [INAF Astronomical Observatory of Padova, I-36012 Asiago (VI) (Italy); O' Brien, Tim J. [Jodrell Bank Centre for Astrophysics, University of Manchester, Manchester M13 9PL (United Kingdom); Eyres, Stewart P. S. [Jeremiah Horrocks Institute, University of Central Lancashire, Preston PR1 2HE (United Kingdom); Bode, Michael F., E-mail: chomiuk@pa.msu.edu [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)
2012-12-20
We present multi-frequency radio observations of the 2010 nova event in the symbiotic binary V407 Cygni, obtained with the Karl G. Jansky Very Large Array (VLA) and spanning 1-45 GHz and 17-770 days following discovery. This nova-the first ever detected in gamma rays-shows a radio light curve dominated by the wind of the Mira giant companion, rather than the nova ejecta themselves. The radio luminosity grew as the wind became increasingly ionized by the nova outburst, and faded as the wind was violently heated from within by the nova shock. This study marks the first time that this physical mechanism has been shown to dominate the radio light curve of an astrophysical transient. We do not observe a thermal signature from the nova ejecta or synchrotron emission from the shock, due to the fact that these components were hidden behind the absorbing screen of the Mira wind. We estimate a mass-loss rate for the Mira wind of M-dot{sub w} approx. 10{sup -6} M{sub Sun} yr{sup -1}. We also present the only radio detection of V407 Cyg before the 2010 nova, gleaned from unpublished 1993 archival VLA data, which shows that the radio luminosity of the Mira wind varies by a factor of {approx}>20 even in quiescence. Although V407 Cyg likely hosts a massive accreting white dwarf, making it a candidate progenitor system for a Type Ia supernova, the dense and radially continuous circumbinary material surrounding V407 Cyg is inconsistent with observational constraints on the environments of most Type Ia supernovae.
Directory of Open Access Journals (Sweden)
Enide Luciana Lima Belmont
2012-09-01
Full Text Available Leptohyphidae (Insecta, Ephemeroptera do Estado do Amazonas, Brasil: novos registros, nova combinação, nova espécie e chave de identificação para estágios ninfais. Os seguintes gêneros de Leptohyphidae ocorrem no estado do Amazonas: Amanahyphes Salles & Molineri, Leptohyphes Eaton, Tricorythodes Ulmer e Tricorythopsis Traver. A distribuição das espécies de Leptohyphidae no Estado do Amazonas é apresentada. Uma espécie nova, Tricorythodes yapekuna sp. nov., é descrita e pode ser diferenciada de outros Tricorythodes pelas (1 garras tarsais com um par de dentículos submarginais e sem dentículos marginais; (2 palpo maxilar biarticulado; (3 brânquia opercular uniformemente preta com exceção da margem apical; (4 fórmula branquial 2/3/3/3/2; e (5 margem lateral do abdome expandida nos segmentos III_VI. Uma combinação nova, Tricorythopsis rondoniensis (Dias, Cruz & Ferreira, 2009 comb. nov., é proposta e constitui o primeiro registro dessa espécie para o Estado do Amazonas. Uma chave dicotômica ilustrada para identificar ninfas de gêneros e espécies ocorrentes no Amazonas também é apresentada.
Energy Technology Data Exchange (ETDEWEB)
Shafter, A. W. [Department of Astronomy, San Diego State University, San Diego, CA 92182 (United States); Henze, M. [European Space Astronomy Centre, P.O. Box 78, E-28692 Villanueva de la Cañada, Madrid (Spain); Rector, T. A. [Department of Physics and Astronomy, University of Alaska Anchorage, 3211 Providence Dr., Anchorage, AK 99508 (United States); Schweizer, F. [Carnegie Observatories, 813 Santa Barbara St., Pasadena, CA 91101 (United States); Hornoch, K. [Astronomical Institute, Academy of Sciences, CZ-251 65 Ondřejov (Czech Republic); Orio, M. [Astronomical Observatory of Padova (INAF), I-35122 Padova (Italy); Pietsch, W. [Max Planck Institute for Extraterrestrial Physics, P.O. Box 1312, Giessenbachstr., D-85741, Garching (Germany); Darnley, M. J.; Williams, S. C.; Bode, M. F. [Astrophysics Research Institute, Liverpool John Moores University, Liverpool L3 5RF (United Kingdom); Bryan, J., E-mail: aws@nova.sdsu.edu [McDonald Observatory, Austin, TX 78712 (United States)
2015-02-01
The reported positions of 964 suspected nova eruptions in M31 recorded through the end of calendar year 2013 have been compared in order to identify recurrent nova (RN) candidates. To pass the initial screen and qualify as a RN candidate, two or more eruptions were required to be coincident within 0.′1, although this criterion was relaxed to 0.′15 for novae discovered on early photographic patrols. A total of 118 eruptions from 51 potential RN systems satisfied the screening criterion. To determine what fraction of these novae are indeed recurrent, the original plates and published images of the relevant eruptions have been carefully compared. This procedure has resulted in the elimination of 27 of the 51 progenitor candidates (61 eruptions) from further consideration as RNe, with another 8 systems (17 eruptions) deemed unlikely to be recurrent. Of the remaining 16 systems, 12 candidates (32 eruptions) were judged to be RNe, with an additional 4 systems (8 eruptions) being possibly recurrent. It is estimated that ∼4% of the nova eruptions seen in M31 over the past century are associated with RNe. A Monte Carlo analysis shows that the discovery efficiency for RNe may be as low as 10% that for novae in general, suggesting that as many as one in three nova eruptions observed in M31 arise from progenitor systems having recurrence times ≲100 yr. For plausible system parameters, it appears unlikely that RNe can provide a significant channel for the production of Type Ia supernovae.
Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons
Czech Academy of Sciences Publication Activity Database
Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris
2014-01-01
Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014
Nova-driven winds in globular clusters
International Nuclear Information System (INIS)
Scott, E.H.; Durisen, R.H.
1978-01-01
Recent sensitive searches for Hα emission from ionized intracluster gas in globular clusters have set upper limits that conflict with theoretical predictions. We suggest that nova outbursts heat the gas, producing winds that resolve this discrepancy. The incidence of novae in globular clusters, the conversion of kinetic energy of the nova shell to thermal energy of the intracluster gas, and the characteristics of the resultant winds are discussed. Calculated emission from the nova-driven models does not conflict with any observations to date. Some suggestions are made concerning the most promising approaches for future detection of intracluster gas on the basis of these models. The possible relationship of nova-driven winds of globular cluster X-ray sources is also considered
Synoptic GNIRS XD Spectra ToO Novae
Woodward, Chick; Helton, Andrew; Spitzer/Chandra Team
2007-02-01
Novae are important contributors to galactic chemical enrichment on local scales. NIR spectroscopy of novae provides information about the elemental abundances of the gas and dust in the ejecta dispersing into the ISM as well as kinematic information related to the outburst. We propose to obtain synoptic GNIRS spectra of select Target of Opportunity (ToO) novae in the Magellanic Clouds (MC) and the galaxy to study the dynamics of the ejecta, to determine the temporal evolution of coronal lines and recombination lines (measuring their strength and velocity profiles), and to determine abundances. Being all equidistant, MC nova permit a more robust analysis of distant-dependent physical parameters of outburst than is generally possible for Galactic novae. The GNIRS data will provide critical spectral coverage and synoptic data to complement extant Spitzer and Chandra nova programs. Triggering of the GNIRS program will occur when a nova becomes brighter than V=12 mag, (assuming that adequate PWFS guide stars exist) as reported in the IAUC or CBET.
QuadBase2: web server for multiplexed guanine quadruplex mining and visualization
Dhapola, Parashar; Chowdhury, Shantanu
2016-01-01
DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890
Discovery of a New Classical Nova Shell Around a Nova-like Cataclysmic Variable
Guerrero, Martín A.; Sabin, Laurence; Tovmassian, Gagik; Santamaría, Edgar; Michel, Raul; Ramos-Larios, Gerardo; Alarie, Alexandre; Morisset, Christophe; Bermúdez Bustamante, Luis C.; González, Chantal P.; Wright, Nick J.
2018-04-01
The morphology and optical spectrum of IPHASX J210204.7+471015, a nebula classified as a possible planetary nebula are, however, strikingly similar to those of AT Cnc, a classical nova shell around a dwarf nova. To investigate its true nature, we have obtained high-resolution narrowband [O III] and [N II] images and deep optical spectra. The nebula shows an arc of [N II]-bright knots notably enriched in nitrogen, while an [O III]-bright bow shock is progressing throughout the ISM. Diagnostic line ratios indicate that shocks are associated with the arc and bow shock. The central star of this nebula has been identified by its photometric variability. Time-resolved photometric and spectroscopic data of this source reveal a period of 4.26 hr, which is attributed to a binary system. The optical spectrum is notably similar to that of RW Sex, a cataclysmic variable star (CV) of the UX UMa nova-like (NL) type. Based on these results, we propose that IPHASX J210204.7 + 471015 is a classical nova shell observed around a CV-NL system in quiescence.
Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding
Czech Academy of Sciences Publication Activity Database
Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela
2014-01-01
Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014
WGBH-TV, Boston, MA.
News clippings, reviews, and feature articles about the Public Broadcasting System science-adventure series "Nova" are collected here. Included are comments from the New York Times, Washington Post, Christian Science Monitor, and TV Guide. Commentaries are primarily favorable and include synopses of various episodes. (DGC)
Directory of Open Access Journals (Sweden)
K. Mukai
2015-02-01
Full Text Available In recent years, recurrent nova eruptions are often observed very intensely in wide range of wavelengths from radio to optical to X-rays. Here I present selected highlights from recent multi-wavelength observations. The enigma of T Pyx is at the heart of this paper. While our current understanding of CV and symbiotic star evolution can explain why certain subset of recurrent novae have high accretion rate, that of T Pyx must be greatly elevated compared to the evolutionary mean. At the same time, we have extensive data to be able to estimate how the nova envelope was ejected in T Pyx, and it turns to be a rather complex tale. One suspects that envelope ejection in recurrent and classical novae in general is more complicated than the textbook descriptions. At the end of the review, I will speculate that these two may be connected.
Identifying and quantifying recurrent novae masquerading as classical novae
International Nuclear Information System (INIS)
Pagnotta, Ashley; Schaefer, Bradley E.
2014-01-01
Recurrent novae (RNe) are cataclysmic variables with two or more nova eruptions within a century. Classical novae (CNe) are similar systems with only one such eruption. Many of the so-called CNe are actually RNe for which only one eruption has been discovered. Since RNe are candidate Type Ia supernova progenitors, it is important to know whether there are enough in our Galaxy to provide the supernova rate, and therefore to know how many RNe are masquerading as CNe. To quantify this, we collected all available information on the light curves and spectra of a Galactic, time-limited sample of 237 CNe and the 10 known RNe, as well as exhaustive discovery efficiency records. We recognize RNe as having (1) outburst amplitude smaller than 14.5 – 4.5 × log (t 3 ), (2) orbital period >0.6 days, (3) infrared colors of J – H > 0.7 mag and H – K > 0.1 mag, (4) FWHM of Hα > 2000 km s –1 , (5) high excitation lines, such as Fe X or He II near peak, (6) eruption light curves with a plateau, and (7) white dwarf mass greater than 1.2 M ☉ . Using these criteria, we identify V1721 Aql, DE Cir, CP Cru, KT Eri, V838 Her, V2672 Oph, V4160 Sgr, V4643 Sgr, V4739 Sgr, and V477 Sct as strong RN candidates. We evaluate the RN fraction among the known CNe using three methods to get 24% ± 4%, 12% ± 3%, and 35% ± 3%. With roughly a quarter of the 394 known Galactic novae actually being RNe, there should be approximately a hundred such systems masquerading as CNe.
Theory of Nova Outbursts and Type Ia Supernovae
Directory of Open Access Journals (Sweden)
M. Kato
2015-02-01
Full Text Available We briefly review the current theoretical understanding of the light curves of novae. These curves exhibit a homologous nature, dubbed the universal decline law, and when time-normalized, they almost follow a single curve independently of the white dwarf (WD mass or chemical composition of the envelope. The optical and near-infrared light curves of novae are reproduced mainly by free-free emission from their optically thick winds. We can estimate the WD mass from multiwavelength observations because the optical, UV, and soft X-ray light curves evolve differently and we can easily resolve the degeneracy of the optical light curves. Recurrent novae and classical novae are a testbed of type Ia supernova scenarios. In the orbital period versus secondary mass diagram, recurrent novae are located in different regions from classical novae and the positions of recurrent novae are consistent with the single degenerate scenario.
Pulsed power supply for Nova Upgrade
International Nuclear Information System (INIS)
Bacon, J.L.; Kajs, J.P.; Walls, A.; Weldon, W.F.; Zowarka, R.C.
1992-01-01
This report describes work carried out at the Center for Electromechanics at The University of Texas at Austin (CEM-UT). A baseline design of the Nova Upgrade has been completed by Lawrence Livermore National Laboratory. The Nova Upgrade is an 18 beamline Nd: glass laser design utilizing fully relayed 4x4 30 cm aperture segmented optical components. The laser thus consists of 288 independent beamlets nominally producing 1.5 to 2.0 MJ of 0.35 μm light in a 3 to 5 ns pulse. The laser design is extremely flexible and will allow a wide range of pulses to irradiate ICF targets. This facility will demonstrate ignition/gain and the scientific feasibility of ICF for energy and defense applications. The pulsed power requirements for the Nova Upgrade are given. CEM-UT was contracted to study and develop a design for a homopolar generator/inductor (HPG/inductor) opening switch system which would satisfy the pulsed power supply requirements of the Nova Upgrade. The Nd:glass laser amplifiers used in the Nova Upgrade will be powered by light from xenon flashlamps. The pulsed power supply for the Nova Upgrade powers the xenon flashlamps. This design and study was for a power supply to drive flashlamps
DEFF Research Database (Denmark)
Petersen, Nicoline Jacoby; Bræstrup, Lise
"Bossa Nova" giver dig de bedste bud på, hvordan du takler den menneskelige dimension i ledelse. Når du bevæger dig ud på gulvet, opstår der konflikter, kærlighed, jalousi og vrede. Pludselig opdager du, at medarbejdere tænker meget anderledes end dig selv, har forskellige behov og af og til......, kriser og meget andet. Her er værdifulde iagttagelser og tips, som enhver leder ? uanset branche ? kan bruge i sin dagligdag. "Bossa Nova" er uundværlig for den, der vil lære mere om, hvordan man får mennesker til at præstere det sublime, så ledelse bliver en dans, hvor alle kan følge takten....
Absolute spectrophotometry of Nova Cygni 1975
International Nuclear Information System (INIS)
Kontizas, E.; Kontizas, M.; Smyth, M.J.
1976-01-01
Radiometric photoelectric spectrophotometry of Nova Cygni 1975 was carried out on 1975 August 31, September 2, 3. α Lyr was used as reference star and its absolute spectral energy distribution was used to reduce the spectrophotometry of the nova to absolute units. Emission strengths of Hα, Hβ, Hγ (in W cm -2 ) were derived. The Balmer decrement Hα:Hβ:Hγ was compared with theory, and found to deviate less than had been reported for an earlier nova. (author)
NOVA Corporation of Alberta annual report, 1992
International Nuclear Information System (INIS)
1993-01-01
Nova Corporation and its related businesses are involved in natural gas production, gas pipelines, consulting services, and upgrading of natural gas into chemicals and plastics. Nova owns Alberta Gas Transmission Division, the primary gas transportation system in Alberta, with 11,400 miles of pipeline and total deliveries in 1992 of 3.4 trillion ft 3 . Nova also owns 50% of Foothills Pipe Lines Ltd., one of Canada's largest carriers of exported gas, and 50% of TQM Pipeline Partnership, which transports natural gas in Quebec. Nova conducts its chemicals business through Novacor Chemicals Ltd., which has plants in Alberta, Ontario, Quebec, and the USA. Novacor's major petrochemicals are methanol, ethylene, propylene, and styrene and its major plastics are polystyrene, polypropylene, and polyethylene. Nova's gas-producing branch Novalta Resources produced 26 billion ft 3 of natural gas in 1992 and has proven reserves of 334 billion ft 3 . Nova's net income in 1992 was $164 million, compared to only $46 million in 1991. The company's operations, along with management discussion and analysis, are presented for 1992 and financial statements are included. 20 figs., 43 tabs
Shara, Michael M.; Doyle, Trisha F.; Pagnotta, Ashley; Garland, James T.; Lauer, Tod R.; Zurek, David; Baltz, Edward A.; Goerl, Ariel; Kovetz, Attay; Machac, Tamara; Madrid, Juan P.; Mikołajewska, Joanna; Neill, J. D.; Prialnik, Dina; Welch, D. L.; Yaron, Ofer
2018-02-01
Ten weeks of daily imaging of the giant elliptical galaxy M87 with the Hubble Space Telescope (HST) has yielded 41 nova light curves of unprecedented quality for extragalactic cataclysmic variables. We have recently used these light curves to demonstrate that the observational scatter in the so-called maximum-magnitude rate of decline (MMRD) relation for classical novae is so large as to render the nova-MMRD useless as a standard candle. Here, we demonstrate that a modified Buscombe-de Vaucouleurs hypothesis, namely that novae with decline times t2 > 10 d converge to nearly the same absolute magnitude about two weeks after maximum light in a giant elliptical galaxy, is supported by our M87 nova data. For 13 novae with daily sampled light curves, well determined times of maximum light in both the F606W and F814W filters, and decline times t2 > 10 d we find that M87 novae display M606W,15 = -6.37 ± 0.46 and M814W,15 = -6.11 ± 0.43. If very fast novae with decline times t2 < 10 d are excluded, the distances to novae in elliptical galaxies with stellar binary populations similar to those of M87 should be determinable with 1σ accuracies of ± 20 per cent with the above calibrations.
Photometry and polarimetry of Nova Andromedae 1986
Energy Technology Data Exchange (ETDEWEB)
Kikuchi, Sen; Mikami, Yoshitaka; Kondo, Masayuki
1988-01-01
We have carried out photometry of Nova Andromedae 1986 and find that it should be classified as a fast nova. We have also made polarimetry simultaneously at six wavelengths between 0.36-0.70 ..mu..m. The polarization increased between 2 and 22 days after the light maximum showing that dust formation was associated with the nova explosion.
OGLE ATLAS OF CLASSICAL NOVAE. II. MAGELLANIC CLOUDS
Energy Technology Data Exchange (ETDEWEB)
Mróz, P.; Udalski, A.; Poleski, R.; Soszyński, I.; Szymański, M. K.; Pietrzyński, G.; Wyrzykowski, Ł.; Ulaczyk, K.; Kozłowski, S.; Pietrukowicz, P.; Skowron, J., E-mail: pmroz@astrouw.edu.pl [Warsaw University Observatory, Al. Ujazdowskie 4, 00-478 Warszawa (Poland)
2016-01-15
The population of classical novae in the Magellanic Clouds was poorly known because of a lack of systematic studies. There were some suggestions that nova rates per unit mass in the Magellanic Clouds were higher than in any other galaxy. Here, we present an analysis of data collected over 16 years by the OGLE survey with the aim of characterizing the nova population in the Clouds. We found 20 eruptions of novae, half of which are new discoveries. We robustly measure nova rates of 2.4 ± 0.8 yr{sup −1} (LMC) and 0.9 ± 0.4 yr{sup −1} (SMC) and confirm that the K-band luminosity-specific nova rates in both Clouds are 2–3 times higher than in other galaxies. This can be explained by the star formation history in the Magellanic Clouds, specifically the re-ignition of the star formation rate a few Gyr ago. We also present the discovery of the intriguing system OGLE-MBR133.25.1160, which mimics recurrent nova eruptions.
Zemko, Polina; Orio, Marina
2016-07-01
We present the results of optical and X-ray observations of two quiescent novae, V2491 Cyg and V4743 Sgr. Our observations suggest the intriguing possibility of localization of hydrogen burning in magnetic novae, in which accretion is streamed to the polar caps. V2491 Cyg was observed with Suzaku more than 2 years after the outburst and V4743 Sgr was observed with XMM Newton 2 and 3.5 years after maximum. In the framework of a monitoring program of novae previously observed as super soft X-ray sources we also obtained optical spectra of V4743 Sgr with the SALT telescope 11.5 years after the eruption and of V2491 Cyg with the 6m Big Azimutal Telescope 4 and 7 years post-outburst. In order to confirm the possible white dwarf spin period of V2491 Cyg measured in the Suzaku observations we obtained photometric data using the 90cm WIYN telescope at Kitt Peak and the 1.2 m telescope in Crimea. We found that V4743 Sgr is an intermediate polar (IP) and V2491 Cyg is a strong IP candidate. Both novae show modulation of their X-ray light curves and have X-ray spectra typical of IPs. The Suzaku and XMM Newton exposures revealed that the spectra of both novae have a very soft blackbody-like component with a temperature close to that of the hydrogen burning white dwarfs in their SSS phases, but with flux by at least two orders of magnitude lower, implying a possible shrinking of emitting regions in the thin atmosphere that is heated by nuclear burning underneath it. In quiescent IPs, independently of the burning, an ultrasoft X-ray flux component originates at times in the polar regions irradiated by the accretion column, but the soft component of V4743 Sgr disappeared in 2006, indicating that the origin may be different from accretion. We suggest it may have been due to an atmospheric temperature gradient on the white dwarf surface, or to continuing localized thermonuclear burning at the bottom of the envelope, before complete turn-off. The optical spectra of V2491 Cyg and V
The UBV Color Evolution of Classical and Symbiotic Novae
Directory of Open Access Journals (Sweden)
I. Hachisu
2015-02-01
Full Text Available We identified a general course of classical nova outbursts in the B − V vs. U − B diagram. It has been reported that novae show spectra similar to A–F supergiants near optical light maximum. However, they do not follow the supergiant sequence in the color-color diagram, neither the blackbody nor the main-sequence sequence. Instead, we found that novae evolve along a new sequence in the pre-maximum and near-maximum phases, which we call the nova-giant sequence. This sequence is parallel to but Δ(U − B ≈ −0.2 mag bluer than the supergiant sequence. After optical maximum, its color quickly evolves back blueward along the same nova-giant sequence and reaches the point of free-free emission (B − V = −0.03, U − B = −0.97 and stays there for a while, which is coincident with the intersection of the blackbody sequence and the nova-giant sequence. Then the color evolves leftward (blueward in B − V but almost constant in U − B due mainly to development of strong emission lines. This is the general course of nova outbursts in the color-color diagram, which is deduced from eight well-observed novae including various speed classes. For a nova with unknown extinction, we can determine a reliable value of the color excess by matching the observed track of the target nova with this general course. This is a new and convenient method for obtaining color excesses of classical novae. Using this method, we redetermined the color excesses of nineteen well-observed novae.
Czech Academy of Sciences Publication Activity Database
Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří
2016-01-01
Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016
A nova outburst powered by shocks
Li, Kwan-Lok; Metzger, Brian D.; Chomiuk, Laura; Vurm, Indrek; Strader, Jay; Finzell, Thomas; Beloborodov, Andrei M.; Nelson, Thomas; Shappee, Benjamin J.; Kochanek, Christopher S.; Prieto, José L.; Kafka, Stella; Holoien, Thomas W.-S.; Thompson, Todd A.; Luckas, Paul J.; Itoh, Hiroshi
2017-10-01
Classical novae are runaway thermonuclear burning events on the surfaces of accreting white dwarfs in close binary star systems, sometimes appearing as new naked-eye sources in the night sky1. The standard model of novae predicts that their optical luminosity derives from energy released near the hot white dwarf, which is reprocessed through the ejected material2-5. Recent studies using the Fermi Large Area Telescope have shown that many classical novae are accompanied by gigaelectronvolt γ-ray emission6,7. This emission likely originates from strong shocks, providing new insights into the properties of nova outflows and allowing them to be used as laboratories for the study of the unknown efficiency of particle acceleration in shocks. Here, we report γ-ray and optical observations of the Milky Way nova ASASSN-16ma, which is among the brightest novae ever detected in γ-rays. The γ-ray and optical light curves show a remarkable correlation, implying that the majority of the optical light comes from reprocessed emission from shocks rather than the white dwarf8. The ratio of γ-ray to optical flux in ASASSN-16ma directly constrains the acceleration efficiency of non-thermal particles to be around 0.005, favouring hadronic models for the γ-ray emission9. The need to accelerate particles up to energies exceeding 100 gigaelectronvolts provides compelling evidence for magnetic field amplification in the shocks.
Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang
2015-01-01
Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.
Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju
2017-12-15
Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.
X-ray Modeling of Classical Novae
Nemeth, Peter
2010-01-01
It has been observed and theoretically supported in the last decade that the peak of the spectral energy distribution of classical novae gradually shifts to higher energies at constant bolometric luminosity after a nova event. For this reason, comprehensive evolutionary studies require spectral analysis in multiple spectral bands. After a nova explosion, the white dwarf can maintain stable surface hydrogen burning, the duration of which strongly correlates with the white dwarf mass. During this stage the peak of the luminosity is in the soft X-ray band (15 - 60 Angstroms). By extending the modeling range of TLUSTY/SYNSPEC, I analyse the luminosity and abundance evolution of classical novae. Model atoms required for this work were built using atomic data from NIST/ASD and TOPBASE. The accurate but incomplete set of energy levels and radiative transitions in NIST were completed with calculated data from TOPBASE. Synthetic spectra were then compared to observed data to derive stellar parameters. I show the capabilities and validity of this project on the example of V4743 Sgr. This nova was observed with both Chandra and XMM-Newton observatories and has already been modeled by several scientific groups (PHOENIX, TMAP).
Energy Technology Data Exchange (ETDEWEB)
Shara, Michael M.; Doyle, Trisha; Zurek, David [Department of Astrophysics, American Museum of Natural History, Central Park West and 79th Street, New York, NY 10024-5192 (United States); Lauer, Tod R. [National Optical Astronomy Observatory, P.O. Box 26732, Tucson, AZ 85726 (United States); Baltz, Edward A. [KIPAC, SLAC, 2575 Sand Hill Road, M/S 29, Menlo Park, CA 94025 (United States); Kovetz, Attay [School of Physics and Astronomy, Faculty of Exact Sciences, Tel Aviv University, Tel Aviv (Israel); Madrid, Juan P. [CSIRO, Astronomy and Space Science, P.O. Box 76, Epping, NSW 1710 (Australia); Mikołajewska, Joanna [N. Copernicus Astronomical Center, Polish Academy of Sciences, Bartycka 18, PL 00-716 Warsaw (Poland); Neill, J. D. [California Institute of Technology, 1200 East California Boulevard, MC 278-17, Pasadena CA 91125 (United States); Prialnik, Dina [Department of Geosciences, Tel Aviv University, Ramat Aviv, Tel Aviv 69978 (Israel); Welch, D. L. [Department of Physics and Astronomy, McMaster University, Hamilton, L8S 4M1, Ontario (Canada); Yaron, Ofer [Department of Particle Physics and Astrophysics, Weizmann Institute of Science, 76100 Rehovot (Israel)
2017-04-20
The extensive grid of numerical simulations of nova eruptions from the work of Yaron et al. first predicted that some classical novae might significantly deviate from the Maximum Magnitude–Rate of Decline (MMRD) relation, which purports to characterize novae as standard candles. Kasliwal et al. have announced the observational detection of a new class of faint, fast classical novae in the Andromeda galaxy. These objects deviate strongly from the MMRD relationship, as predicted by Yaron et al. Recently, Shara et al. reported the first detections of faint, fast novae in M87. These previously overlooked objects are as common in the giant elliptical galaxy M87 as they are in the giant spiral M31; they comprise about 40% of all classical nova eruptions and greatly increase the observational scatter in the MMRD relation. We use the extensive grid of the nova simulations of Yaron et al. to identify the underlying causes of the existence of faint, fast novae. These are systems that have accreted, and can thus eject, only very low-mass envelopes, of the order of 10{sup −7}–10{sup −8} M {sub ⊙}, on massive white dwarfs. Such binaries include, but are not limited to, the recurrent novae. These same models predict the existence of ultrafast novae that display decline times, t {sub 2,} to be as short as five hours. We outline a strategy for their future detection.
Aprendizagens e novas tecnologias
Directory of Open Access Journals (Sweden)
Pedro Demo
2011-06-01
Full Text Available Pretendo aqui, muito preliminarmente, reunir alguns argumentos favoráveis à multiplicidade de oportunidades de aprender que o aluno pode encontrar hoje em ambientes de aprendizagem mediados por novas tecnologias. Centro-me principalmente na desconstrução de algumas resistências pedagógicas (EVANS, 2001 ainda persistentes entre nós como “transmissão de conteúdos”; agarramento a uma única teoria; fixação na aula instrucionista; extirpação/endeusamento de processos avaliativos, etc. Procuro ver, em um vasto âmbito de ofertas teóricas, componentes atualmente ressaltados na discussão tecnológica em vigor, com o objetivo de indicar oportunidades de reconstrução muito aproveitável de autores e clássicos, uma vez que aprender bem não foi algo inventado pelas novas tecnologias; sempre existiu e os grandes pedagogos tiveram consciência disso, insinuando infinitas maneiras de aprender bem (DEMO, 2008. As novas tecnologias proporcionam oportunidades ainda mais ampliadas, em meio também a enormes riscos e desacertos. O que menos interessa aqui é incidir em panaceias tecnológicas, bem a gosto do consumismo neoliberal. Interessa, porém, explorar novas oportunidades de aprendizagem, bem mais centradas na atividade dos alunos, flexíveis, motivadoras e capazes de sustentar processos de autoria e autonomia.
Dicty_cDB: Contig-U02747-1 [Dicty_cDB
Lifescience Database Archive (English)
Full Text Available 3d05.g1 Oxytricha_pSMART_OXBB Sterkiella... 50 0.098 1 ( FK749731 ) av02085g19r1.1 Symbiotic... sea anemone (Anemonia vi... 50 0.098 1 ( FK731884 ) av02115l17r1.1 Symbiotic sea anemone (Anemon
THE UNUSUALLY LUMINOUS EXTRAGALACTIC NOVA SN 2010U
International Nuclear Information System (INIS)
Czekala, Ian; Berger, E.; Chornock, R.; Marion, G. H.; Margutti, R.; Challis, P.; Pastorello, A.; Botticella, M. T.; Ergon, M.; Sollerman, J.; Smartt, S.; Vinkó, J.; Wheeler, J. C.
2013-01-01
We present observations of the unusual optical transient SN 2010U, including spectra taken 1.03 days to 15.3 days after maximum light that identify it as a fast and luminous Fe II type nova. Our multi-band light curve traces the fast decline (t 2 = 3.5 ± 0.3 days) from maximum light (M V = –10.2 ± 0.1 mag), placing SN 2010U in the top 0.5% of the most luminous novae ever observed. We find typical ejecta velocities of ≈1100 km s –1 and that SN 2010U shares many spectral and photometric characteristics with two other fast and luminous Fe II type novae, including Nova LMC 1991 and M31N-2007-11d. For the extreme luminosity of this nova, the maximum magnitude versus rate of decline relationship indicates a massive white dwarf (WD) progenitor with a low pre-outburst accretion rate. However, this prediction is in conflict with emerging theories of nova populations, which predict that luminous novae from massive WDs should preferentially exhibit an alternate spectral type (He/N) near maximum light.
Marathias, V M; Sawicki, M J; Bolton, P H
1999-07-15
The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.
Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.
Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro
2012-04-14
The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012
Measurement of Reactions on 30P for Nova Nucleosynthesis
Ma, Z.; Guidry, M. W.; Hix, W. R.; Smith, M. S.
2003-05-01
Replace these paragraphs with your abstract. We encourage you to include a sentence acknowledging your funding agency. In a recent study the 30P(p,gamma)31S rate played a crucial role in the synthesis of heavier nuclear species, from Si to Ca, in nova outbursts on ONe White Dwarfs [1]. The adopted rate of this reaction, based on a Hauser-Feshbach calculation [2], has a large uncertainty and could be as much as a factor of 100 too high or too low [3]. In their study, Jose et al.[1] varied the 30P(p,gamma)31S reaction rate within this uncertainty and found that, when rate is reduced by a factor of 100, the synthesis of elements above Si is lowered by a factor 10 with respect to the values found with the nominal rate. This has important consequences for nova nucleosynthesis, as overproduction of isotopes in the Si to Ca mass region has been observed in the ejecta from some nova explosions (e.g.,[4,5]). While generally valid at higher temperatures, Hauser-Feshbach calculations of the rates at nova temperatures can have large uncertainties. At these temperatures, the rate is more likely dominated by a few individual nuclear resonances. At present there are about 10 31S resonances known above the 30P + p threshold that may contribute to the 30P(p,gamma)31S reaction rate at nova temperatures. The excitation energies of these levels are known but spins and parities (for all but two) are not. We plan to measure the 30P(p,p)30P and 30P(p,gamma)31S reactions at HRIBF to better determine this reaction rate. A detailed description of the experiments will be given. We are also conducting a new nova nucleosynthesis simulation over multiple spatial zones of the exploding envelope to investigate the influence of the 30P(p,gamma)31S reaction rate on nova nucleosynthesis. The results of these calculations will be discussed. 1. Jose , J., Coc, A., Hernanz, M., Astrophys. J., 560, 897(2001). 2. Thielemann, F.-K et al., 1987, Advances in Nuclear Astrophysics, ed. E. Vangioni-Flam ( Gif
Copernicus observations of Nova Cygni 1975
Jenkins, E. B.; Snow, T. P.; Upson, W. L.; Anderson, R.; Starrfield, S. G.; Gallagher, J. S.; Friedjung, M.; Linsky, J. L.; Henry, R. C.; Moos, H. W.
1977-01-01
Near-ultraviolet radiation from Nova Cygni 1975 was detected by the Copernicus satellite on five occasions from 1975 September 1 to 1975 September 9. The nova was not seen in the UV after this date. The principal result was the observation of a broad emission feature from the Mg II doublet at 2800 A. The absence of strong UV radiation at shorter wavelengths suggests that these lines are produced by collisional excitation in the outer layers of an expanding shell with electron temperature of approximately 4000 K. The absence of observed emission lines from highly ionized species indicates that the amount of material with log T between 4.4 and 5.7 is less than 0.001 times that which produces the Mg II emission. The continuum flux in the near-UV decreased as the nova evolved, showing that the total luminosity decreased as the nova faded in the visible.
Imaging the Ejecta in Classical Novae
Linford, Justin
2016-10-01
A nova outburst results when sufficient mass accretes from a companion star onto the surface of a white dwarf, triggering a thermonuclear explosion. In classical novae the bulk of the emission comes from the warm, expanding ejecta. The prevailing theories assume that the explosion occurs as a single, spherically symmetric ejection event and predict a simple relationship between the white dwarf mass, the accretion rate, and the mass loss and energetics of the explosion. However, observations with modern instruments indicate that nova eruptions are far from simple. There is now evidence for multiple ejection events, common envelopes, non-spherical geometry, and even jet-like structures in the ejecta. Our ENova collaboration combines radio, mm, optical, and X-ray observations and detailed theoretical modelling to study the most common major explosions in the universe. Among our results so far are the direct demonstration of the importance of shocks in novae, including the detection of gamma-ray producing shocks in several sources, and the realization that multiple, long-lived outflows are much more common than previously assumed. Here we propose to continue these highly successful observations with coordinated detailed VLA radio interferometry and HST optical imaging and spectroscropy of several recent novae with substantial VLA monitoring already in progress.
ORIGINS OF ABSORPTION SYSTEMS OF CLASSICAL NOVA V2659 CYG (NOVA CYG 2014)
Energy Technology Data Exchange (ETDEWEB)
Arai, A.; Kawakita, H. [Koyama Astronomical Observatory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555 (Japan); Shinnaka, Y. [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Tajitsu, A., E-mail: arai6a@cc.kyoto-su.ac.jp [Subaru Telescope, National Astronomical Observatory of Japan, 650 North A’ohoku Place, Hilo, Hawaii 96720 (United States)
2016-10-10
We report on high-dispersion spectroscopy results of a classical nova V2659 Cyg (Nova Cyg 2014) that are taken 33.05 days after the V -band maximum. The spectrum shows two distinct blueshifted absorption systems originating from H i, Fe ii, Ca ii, etc. The radial velocities of the absorption systems are −620 km s{sup −1}, and −1100 to −1500 km s{sup −1}. The higher velocity component corresponds to the P-Cygni absorption features frequently observed in low-resolution spectra. Much larger numbers of absorption lines are identified at the lower velocity. These mainly originate from neutral or singly ionized Fe-peak elements (Fe i, Ti ii, Cr ii, etc.). Based on the results of our spectroscopic observations, we discuss the structure of the ejecta of V2659 Cyg. We conclude that the low- and high-velocity components are likely to be produced by the outflow wind and the ballistic nova ejecta, respectively.
Classical and Recurrent Novae as Quintessential Panchromatic Transients
Mukai, K.; Nelson, T.; Chomiuk, L.; Finzell, T.; Linford, J.; Mioduszewski, A.; Rupen, M.; Sokoloski, J.; Weston, J.
2014-07-01
In classical and recurrent novae, thermonuclear runaway (TNR) of accreted material on the white dwarf surface results in ejection of 10^{-6} to 10^{-4} solar masses at velocities of order 1000 km s^{-1}. They are routinely detected as transients from X-rays to radio, and 6 novae (so far) have also been detected in GeV gamma-rays with Fermi/LAT. It appears that all the nearby novae are detected with Fermi, suggesting gamma-ray emission to be a universal property of novae, while a few exceptional novae further away are also detected, indicating that the gamma-ray luminosity of novae varies from system to system. Here we present selected results from our multi-wavelength observations of recent classical and recurrent novae and discuss evidence for multiple, discrete mass ejection episodes driven by a single TNR. The collision among these shells create shocks that can be observed through synchrotron radio emission and optically thin, thermal, hard X-ray emission. We do not find obvious correlation between the X-ray flux and the GeV flux, even though the latter must also result from shocks. It is clear that shocks can either be efficient particle accelerator or efficient thermal X-ray emitter, but not necessarily both at the same time.
Directory of Open Access Journals (Sweden)
Vera R. S Wolff
2010-09-01
Full Text Available O gênero Diaspidistis Hempel, 1900 foi estudado. Foram redescritas Diaspidistis multilobis Hempel, 1900 e D. squamosa Hempel, 1937. Novas combinações são propostas: D. gomescostai (Lepage & Giannotti, 1946, D. memorabilis (Ferris, 1941, D. multipunctata (Lepage & Giannotti, 1946 e D. petasata (Ferris, 1942. São descritas e ilustradas duas espécies novas: Diaspidistis fonsecai sp. nov. e Diaspidistis tucumanensis sp. nov. Uma chave para identificação das espécies é apresentada baseada em fêmeas adultas.The genus Diaspidistis Hempel, 1900 was studied. Diaspidistis multilobis Hempel, 1900 and D. squamosa Hempel, 1937 were redescribed. New combinations are proposed: D. gomescostai (Lepage & Giannotti, 1946, D. memorabilis (Ferris, 1941, D. multipunctata (Lepage & Giannotti, 1946 and D. petasata (Ferris, 1942. Two new species are described and illustrated: Diaspidistis fonsecai sp. nov. and Diaspidistis tucumanensis sp. nov. A key to the species is presented based on adult females.
Nucleosynthesis in nova outbursts
International Nuclear Information System (INIS)
Iliadis, C.; Azuma, R.E.; Buchmann, L.
1994-02-01
Astronomical observations have shown that He, CNO material and/or heavy elements are considerably enriched in certain nova ejecta relative to solar matter. The heavy element enrichments can be explained by the dredge-up of matter from an underlying ONeMg white dwarf and subsequent redistribution of the material by the rp-process. The proton capture reactions on 32 S and 36 A r important for hydrogen burning during nova outbursts have been measured experimentally. The derived stellar reaction rates have been incorporated into large-scale network calculations and the astrophysical consequences are discussed. (author)
Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions
Kocman, Vojč; Plavec, Janez
2017-05-01
Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.
Time-Dependent Dust Formation in Novae
Directory of Open Access Journals (Sweden)
Kyung-Won Suh
1991-06-01
Full Text Available The dust formation processes in novae are investigated with close attention to recent infrared observations. Using mainly the classical nucleation theory, we have calculated the time scales of dust formation and growth in the environments of novae. Those time scales roughly resemble the typical observations. We have classified the dust-forming novae into three classes according to their explosion properties and the thermodynamic properties of dust grains. Oxygen grains from much later than carbon grains because of their thermodynamic properties. The effect of grain formation to the efficiency of stellar winds to drive the material outward is tested with newly obtained Planck mean values of dust grains.
Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.
Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu
2018-08-01
In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.
New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.
Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni
2018-02-10
The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50 = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
2014-01-01
Novae lance une enquête de satisfaction auprès de ses clients. Vous pouvez accéder au questionnaire au sujet des trois restaurants d’entreprise du CERN en utilisant le lien et les codes ci-dessous. Le délai de réponse est fixé au jeudi 29 mai. https://survey.mis-trend.ch/NOVAE Voici les codes à introduire (en respectant la casse) pour entrer dans le questionnaire, selon le site : CERN Restaurant n°1 : CERN114 CERN Restaurant n°2 : CERN214 CERN Restaurant n°3 : CERN314 Nous attirons votre attention sur le fait que tout questionnaire rempli sera validé. Nous vous prions donc de ne pas utiliser ce lien pour tester le questionnaire. Merci d’avance pour votre collaboration. L'équipe Novae
Directory of Open Access Journals (Sweden)
Minglei Yang
Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.
NUCLEAR MIXING METERS FOR CLASSICAL NOVAE
Energy Technology Data Exchange (ETDEWEB)
Kelly, Keegan J.; Iliadis, Christian; Downen, Lori; Champagne, Art [Department of Physics and Astronomy, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-3255 (United States); José, Jordi [Departament de Física i Enginyeria Nuclear, EUETIB, Universitat Politècnica de Catalunya, E-08036 Barcelona (Spain)
2013-11-10
Classical novae are caused by mass transfer episodes from a main-sequence star onto a white dwarf via Roche lobe overflow. This material possesses angular momentum and forms an accretion disk around the white dwarf. Ultimately, a fraction of this material spirals in and piles up on the white dwarf surface under electron-degenerate conditions. The subsequently occurring thermonuclear runaway reaches hundreds of megakelvin and explosively ejects matter into the interstellar medium. The exact peak temperature strongly depends on the underlying white dwarf mass, the accreted mass and metallicity, and the initial white dwarf luminosity. Observations of elemental abundance enrichments in these classical nova events imply that the ejected matter consists not only of processed solar material from the main-sequence partner but also of material from the outer layers of the underlying white dwarf. This indicates that white dwarf and accreted matter mix prior to the thermonuclear runaway. The processes by which this mixing occurs require further investigation to be understood. In this work, we analyze elemental abundances ejected from hydrodynamic nova models in search of elemental abundance ratios that are useful indicators of the total amount of mixing. We identify the abundance ratios ΣCNO/H, Ne/H, Mg/H, Al/H, and Si/H as useful mixing meters in ONe novae. The impact of thermonuclear reaction rate uncertainties on the mixing meters is investigated using Monte Carlo post-processing network calculations with temperature-density evolutions of all mass zones computed by the hydrodynamic models. We find that the current uncertainties in the {sup 30}P(p, γ){sup 31}S rate influence the Si/H abundance ratio, but overall the mixing meters found here are robust against nuclear physics uncertainties. A comparison of our results with observations of ONe novae provides strong constraints for classical nova models.
Nucleosynthesis in nova outbursts
Energy Technology Data Exchange (ETDEWEB)
Iliadis, C [TRIUMF, Vancouver, BC (Canada); [Univ. of Toronto, McLennan Physical Labs., Toronto, ON (Canada); Azuma, R E [Univ. of Toronto, McLennan Physical Lab., Toronto, ON (Canada); Buchmann, L [TRIUMF, Vancouver, BC (Canada); and others
1994-02-01
Astronomical observations have shown that He, CNO material and/or heavy elements are considerably enriched in certain nova ejecta relative to solar matter. The heavy element enrichments can be explained by the dredge-up of matter from an underlying ONeMg white dwarf and subsequent redistribution of the material by the rp-process. The proton capture reactions on 32{sup S} and 36{sup A}r important for hydrogen burning during nova outbursts have been measured experimentally. The derived stellar reaction rates have been incorporated into large-scale network calculations and the astrophysical consequences are discussed. (author) 17 refs., 2 figs.
The distances of the Galactic Novae
Ozdonmez, Aykut; Guver, Tolga; Cabrera-Lavers, Antonio; Ak, Tansel
2016-07-01
Using location of the RC stars on the CMDs obtained from the UKIDSS, VISTA and 2MASS photometry, we have derived the reddening-distance relations towards each Galactic nova for which at least one independent reddening measurement exists. We were able to determine the distances of 72 Galactic novae and set lower limits on the distances of 45 systems. The reddening curves of the systems are presented. These curves can be also used to estimate reddening or the distance of any source, whose location is close to the position of the nova in our sample. The distance measurement method in our study can be easily applicable to any source, especially for ones that concentrated along the Galactic plane.
Nova: the laser fusion breakeven experiment
International Nuclear Information System (INIS)
Godwin, R.O.; Glaze, J.A.; Hagen, W.F.; Holzrichter, J.F.; Simmons, W.W.; Trenholme, J.B.
1979-01-01
A new laboratory building is being constructed adjacent to the Shiva laser to house the Phase I $137M ten-beam Nova laser and a target chamber designed for twenty beams. The first ten beams will be operational in early 1980. Following Phase I, it is planned that the Shiva laser will be shut down and upgraded into ten Nova laser beams. These beams will then be combined with Nova Phase I beams to provide the full twenty beams having a minimum output energy of 300 kJ in a 3 nc pulse, or a power capability of 300 terawatts (10 12 watts) in a 100 ps pulse. This paper will describe the Phase I engineering project
Can isolated single black holes produce X-ray novae?
Matsumoto, Tatsuya; Teraki, Yuto; Ioka, Kunihito
2018-03-01
Almost all black holes (BHs) and BH candidates in our Galaxy have been discovered as soft X-ray transients, so-called X-ray novae. X-ray novae are usually considered to arise from binary systems. Here, we propose that X-ray novae are also caused by isolated single BHs. We calculate the distribution of the accretion rate from interstellar matter to isolated BHs, and find that BHs in molecular clouds satisfy the condition of the hydrogen-ionization disc instability, which results in X-ray novae. The estimated event rate is consistent with the observed one. We also check an X-ray novae catalogue (Corral-Santana et al.) and find that 16/59 ˜ 0.27 of the observed X-ray novae are potentially powered by isolated BHs. The possible candidates include IGR J17454-2919, XTE J1908-094, and SAX J1711.6-3808. Near-infrared photometric and spectroscopic follow-ups can exclude companion stars for a BH census in our Galaxy.
Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie
2018-06-01
An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.
SN 2010U: A LUMINOUS NOVA IN NGC 4214
International Nuclear Information System (INIS)
Humphreys, Roberta M.; Helton, L. Andrew; Prieto, Jose L.; Rosenfield, Philip; Williams, Benjamin; Murphy, Jeremiah; Dalcanton, Julianne; Gilbert, Karoline; Kochanek, Christopher S.; Stanek, K. Z.; Khan, Rubab; Szczygiel, Dorota; Mogren, Karen; Fesen, Robert A.; Milisavljevic, Dan
2010-01-01
The luminosity, light curve, post-maximum spectrum, and lack of a progenitor on deep pre-outburst images suggest that SN 2010U was a luminous, fast nova. Its outburst magnitude is consistent with that for a fast nova using the maximum magnitude-rate of decline relationship for classical novae.
PHOTOMETRIC AND SPECTROSCOPIC PROPERTIES OF NOVAE IN THE LARGE MAGELLANIC CLOUD
International Nuclear Information System (INIS)
Shafter, A. W.
2013-01-01
The photometric and spectroscopic properties of the 43 known LMC nova candidates are summarized and reviewed. Of these, photometric data sufficient to establish decline rates are available for 29 novae, while spectroscopic data sufficient to establish the spectroscopic classes are available for 18 systems. Half of the 18 novae belong to the Fe II class, with the remaining nine belonging to either the He/N or the Fe IIb classes. As seen in previous nova studies of M31 and M33, the He/N and Fe IIb novae have on average faster photometric developments than do their Fe II counterparts. Overall, the available photometry confirms earlier studies, and shows conclusively that LMC novae have faster rates of decline than do novae in the Galaxy and M31. It appears that the increased fraction of faster, He/N and Fe IIb novae observed in the LMC compared with M31 is almost certainly the result of differences in the underlying stellar population between the two galaxies. We propose that the younger population seen in the LMC compared with M31's bulge (where most of the novae are found), produces progenitor binaries with higher average white dwarf masses. The higher mean white dwarf mass not only produces a larger fraction of fast, He/N novae compared with M31, but also results in a relatively large recurrent nova population.
Nova Aquilae 1982: the nature of its dust
International Nuclear Information System (INIS)
Longmore, A.J.; Williams, P.M.
1984-01-01
Infrared photometric measurements of Nova Aquilae 1982, covering a period from 37 to 261 days after its discovery, have been obtained. Thermal emission was present even from the first observation. The observations show that the conventional picture of dust forming in the nova ejecta does not apply in this case, and suggest that a re-examination of the infrared modelling of earlier novae would be worthwhile. (U.K.)
Dust formation and ionization in novae
International Nuclear Information System (INIS)
Yamamoto, Tetsuo; Sato, Shuji; Nariai, Kyoji.
1979-01-01
In order to explain the fact that some novae show the increase of infrared radiation indicating the formation of circumstellar dust grains while some others do not, the theory that the formation of dust in the circumstellar envelope of a nova depends on the intensity of ultraviolet radiation from a central star has been presented. It is known that the central star of a nova emits radiation at nearly constant rate, and its effective temperature rises. It was concluded that the novae with higher emission than a certain value are the poor candidates for dust formation because the whole envelope is ionized before dust is formed. But this conclusion is misleading. The evolution of the ultraviolet radiation emanating from a central star is summarized. The condensation of grains is possible when the partial pressure of the vapor, from which the grains are formed, becomes higher than the saturation vapor pressure. The temperature of grains can be estimated by equating the radiations absorbed and emitted. The grains evaporate if the grain temperature is higher than the condensation temperature. The formation of a Stroemgren sphere in the exploding envelope of a nova is discussed. For the formation of grains, it is necessary that temperature drops below the condensation temperature before the whole envelope is ionized. Hence dust grains do not grow if the grain temperature at a phase is higher than the condensation temperature. (Kako, I.)
ON THE SPECTROSCOPIC CLASSES OF NOVAE IN M33
International Nuclear Information System (INIS)
Shafter, A. W.; Darnley, M. J.; Bode, M. F.; Ciardullo, R.
2012-01-01
We report the initial results from an ongoing multi-year spectroscopic survey of novae in M33. The survey resulted in the spectroscopic classification of six novae (M33N 2006-09a, 2007-09a, 2009-01a, 2010-10a, 2010-11a, and 2011-12a) and a determination of rates of decline (t 2 times) for four of them (2006-09a, 2007-09a, 2009-01a, and 2010-10a). When these data are combined with existing spectroscopic data for two additional M33 novae (2003-09a and 2008-02a), we find that five of the eight novae with available spectroscopic class appear to be members of either the He/N or Fe IIb (hybrid) classes, with only two clear members of the Fe II spectroscopic class. This initial finding is very different from what would be expected based on the results for M31 and the Galaxy where Fe II novae dominate, and the He/N and Fe IIb classes together make up only ∼20% of the total. It is plausible that the increased fraction of He/N and Fe IIb novae observed in M33 thus far may be the result of the younger stellar population that dominates this galaxy, which is expected to produce novae that harbor generally more massive white dwarfs than those typically associated with novae in M31 or the Milky Way.
Assurance management program for the 30 Nova laser fusion project
International Nuclear Information System (INIS)
Levy, A.J.
1983-01-01
The Nova assurance management program was developed using the quality assurance (QA) approach first implemented at LLNL in early 1978. The LLNL QA program is described as an introduction to the Nova assurance management program. The Nova system is described pictorially through the Nova configuration, subsystems and major components, interjecting the QA techniques which are being pragmatically used to assure the successful completion of the project
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process
Czech Academy of Sciences Publication Activity Database
Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.
2011-01-01
Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011
Nova Scotia Power : in-stream tidal
International Nuclear Information System (INIS)
Meade, K.
2007-01-01
The Government of Nova Scotia, the Government of New Brunswick, Nova Scotia Power and others have funded a feasibility study of North American sites for commercial instream tidal power. In July 2007, Nova Scotia Power received partial funding for a demonstration project. This presentation provided information on a demonstration plant for tidal power run by Nova Scotia Power. It discussed the benefits of the Open Hydro technology for this plant. In this simple design, the generator is on the circumference of the turbine. The design does not involve any power transmission systems or any pitching of blades. In addition, the technology is environmentally sound as it is completely shrouded, has low rotational speed, and a large open centre allows fish to pass through, and it does not require lubricants. The last benefit that was presented was the scale up of 250 kW machine deployed in a European test facility. The presentation also discussed the advantages of developing tidal power at this time. It was concluded that tidal energy has significant potential. Although it is intermittent, it is predictable and bulk power system can be scheduled to accommodate it. figs
Characterisation and application of NovaFiber lignin
Gosselink, R.J.A.; Snijder, M.H.B.; Kranenbarg, A.; Keijsers, E.R.P.; Jong, de E.; Stigsson, L.L.
2004-01-01
Sulphur-free lignin coming from a novel alkaline-pulping process called NovaFiber, which has been developed by KIRAM AB, has been characterised and evaluated for potential applications. A Kraft lignin has been used for comparison. Considering the characterisation results of a NovaFiber softwood and
Heterothalamus rupestris, espécie nova de Asteraceae do Rio Grande do Sul.
Directory of Open Access Journals (Sweden)
Leonardo Paz Deble
2010-08-01
Full Text Available Na revisão botânica do gênero Heterothalamus Less., foi descoberta uma nova espécie, endêmica da Serra do Sudeste do Rio Grande do Sul (Brasil que, a seguir, é descrita, ilustrada e comparada com sua espécie afim.
Big and Little Feet Provincial Profiles: Nova Scotia
Directory of Open Access Journals (Sweden)
Sarah Dobson
2017-09-01
Full Text Available This communiqué provides a summary of the production- and consumption-based greenhouse gas emissions accounts for Nova Scotia, as well as their associated trade flows. It is part of a series of communiqués profiling the Canadian provinces and territories.1 In simplest terms, a production-based emissions account measures the quantity of greenhouse gas emissions produced in Nova Scotia. In contrast, a consumption-based emissions account measures the quantity of greenhouse gas emissions generated during the production process for final goods and services that are consumed in Nova Scotia through household purchases, investment by firms and government spending. Trade flows refer to the movement of emissions that are produced in Nova Scotia but which support consumption in a different province, territory or country (and vice versa. For example, emissions at the Port of Halifax that are associated with goods that are subsequently exported to Ontario for sale are recorded as a trade flow from Nova Scotia to Ontario. Moving in the opposite direction, emissions associated with the production of motor gasoline in New Brunswick that is exported to Nova Scotia for sale are recorded as a trade flow from New Brunswick to Nova Scotia. For further details on these results in a national context, the methodology for generating them and their policy implications, please see the companion papers to this communiqué series: (1 Fellows and Dobson (2017; and (2 Dobson and Fellows (2017. Additionally, the consumption emissions and trade flow data for each of the provinces and territories are available at: http://www.policyschool.ca/embodied-emissions-inputs-outputs-datatables-2004-2011/.
Continuum emission from classical nova winds
International Nuclear Information System (INIS)
Harkness, R.P.
1983-01-01
The emergent continuum of a slow classical nova during outburst is considered in the quasi-steady optically thick, transonic wind model. Models are presented for various steady mass loss rates and are related to the evolution of slow novae during decline and early post-maximum. The continuum emission is found to depart radically from a blackbody spectrum and to exhibit features common to highly extended stellar atmospheres. (author)
Nova chain design and performance
International Nuclear Information System (INIS)
Simmons, W.W.; Glaze, J.A.; Trenholme, J.B.; Hagen, W.F.
1980-01-01
During the past year design of the Nova laser has undergone significant change as a result of developments in our laser glass and optical coating evaluation programs. Two notable aspects of the glass development program deserve emphasis. First, vendor qualification for production of fluorophosphate laser glass is progressing satisfactorily. There is a reasonable expectation that vendors can meet fluorophosphate glass specifications within Nova schedule constraints. Secondly, recent gain saturation measurements have shown that the saturation fluence of the fluorophosphate glass is larger than previously supposed (approx. 5.5 J/cm 2 ) and in fact is somewhat larger than Shiva silicate glasses. Hence, performance of Nova for pulses in the 3 ns and longer range should be satisfactory. For pulses in the 1 ns regime, of course, the fluorophosphate chain will have superior performance to that of silicate because of its low nonlinear index of refraction (approx. 30% that of silicate). These and other considerations have led us to choose a chain design based upon the use of fluorophosphate glass in our amplifiers
Slow magnetic monopoles search in NOvA
Antoshkin, Alexander; Frank, Martin
2018-04-01
The NOvA far detector is well suited for finding exotic particles due to its technical features (see [1]). One type of those exotic particles is a "slow" magnetic monopole. It is assumed that the energy deposition of such monopoles should be enough to be registered (see [2]). Measurement of the expected signals was performed on the NOvA test bench at JINR (see [3]). Result of this measurement allows us to perform slow monopole's research using NOvA software and hardware with high efficiency. As a whole, the research can lead to a discovery, or it can limit the existence of monopoles in a wide range of parameters, previously unreachable in other experiments (MACRO, SLIM, RICE, IceCube). Several special software tools have been developed. Slow Monopole Trigger has been created and implemented in the NOvA Data-Driven-Trigger system. Also, an online reconstruction algorithm has been developed and tested on 5% of the data. A technical description of these tools and current results of the analysis are presented in this work.
Novae, supernovae, and the island universe hypothesis
International Nuclear Information System (INIS)
Van Den Bergh, S.
1988-01-01
Arguments in Curtis's (1917) paper related to the island universe hypothesis and the existence of novae in spiral nebulae are considered. It is noted that the maximum magnitude versus rate-of-decline relation for novae may be the best tool presently available for the calibration of the extragalactic distance scale. Light curve observations of six novae are used to determine a distance of 18.6 + or - 3.5 MPc to the Virgo cluster. Results suggest that Type Ia supernovae cannot easily be used as standard candles, and that Type II supernovae are unsuitable as distance indicators. Factors other than precursor mass are probably responsible for determining the ultimate fate of evolving stars. 83 references
Directory of Open Access Journals (Sweden)
Bhakti Bajpai
2008-12-01
Full Text Available In a new approach to microbial gallic acid production by Aspergillus fischeri MTCC 150, 40gL-1 of tannic acid was added in two installments during the bioconversion phase of the process (25gL-1 and 15gL-1 at 32 and 44h respectively. The optimum parameters for the bioconversion phase were found to be temperature: 35ºC, pH: slightly acidic (3.3-3.5, aeration: nil and agitation: 250 rpm. A maximum of 71.4% conversion was obtained after 71h fermentation with 83.3% product recovery. The yield was 7.35 g of gallic acid per g of biomass accumulated and the fermenter productivity was 0.56 g of gallic acid produced per liter of medium per hour.Em uma nova abordagem para produção de ácido gálico por Aspergillus fischeri MTCC 150, adiciona-se 40 g.L-1 de ácido tânico em dois momentos da fase de bioconversão do processo (25 g.L-1 e 15 g.L-1 a 32h e 44h, respectivamente. Os parâmetros ótimos para a fase de bioconversão foram: temperatura 35ºC, pH levemente ácido (3,3 a 3,5, nenhuma aeração e agitação 250 rpm. Um máximo de 71,4% de conversão foi obtido após 71h de fermentação, com 83,3% de recuperação do produto. O rendimento foi 7,35g de ácido gálico por g de biomassa acumulada e a produtividade do fermentador foi 0,56g de ácido gálico por litro de meio por hora.
NOVA: a software to analyze complexome profiling data
Giese, H.; Ackermann, J.; Heide, H.; Bleier, L.; Drose, S.; Wittig, I.; Brandt, U.; Koch, I.
2015-01-01
SUMMARY: We introduce nova, a software for the analysis of complexome profiling data. nova supports the investigation of the composition of complexes, cluster analysis of the experimental data, visual inspection and comparison of experiments and many other features. AVAILABILITY AND IMPLEMENTATION:
Nucleosynthesis and the nova outburst
International Nuclear Information System (INIS)
Starrfield, S.
1995-01-01
A nova outburst is the consequence of the accretion of hydrogen rich material onto a white dwarf and it can be considered as the largest hydrogen bomb in the Universe. The fuel is supplied by a secondary star in a close binary system while the strong degeneracy of the massive white dwarf acts to contain the gas during the early stages of the explosion. The containment allows the temperature in the nuclear burning region to exceed 10 8 K under all circumstances. As a result a major fraction of CNO nuclei in the envelope are transformed into β + -unstable nuclei. We discuss the effects of these nuclei on the evolution. Recent observational studies have shown that there are two compositional classes of novae; one which occurs on carbon-oxygen white dwarfs, and a second class that occurs on oxygen-neon-magnesium white dwarfs. In this review we will concentrate on the latter explosions since they produce the most interesting nucleosynthesis. We report both on the results of new observational determinations of nova abundances and, in addition, new hydrodynamic calculations that examine the consequences of the accretion process on 1.0M circle-dot , 1.25M circle-dot , and 1.35M circle-dot white dwarfs. Our results show that novae can produce 22 Na, 26 Al, and other intermediate mass nuclei in interesting amounts. We will present the results of new calculations, done with updated nuclear reaction rates and opacities, which exhibit quantitative differences with respect to published work
A new method of determining the ejected mass of novae
Energy Technology Data Exchange (ETDEWEB)
Sparks, W.M.
1994-12-31
A new method of determining the ejected mass of novae based on simple, reasonable assumptions is presented. This method assumes that the remnant mass on the white dwarf is the same as that from the previous nova outburst. The hydrogen, helium, and metal abundances of the accreted material from the secondary must also be known or assumed. The white dwarf`s mass has a small effect because the amount of hydrogen consumed during the thermonuclear runaway only depends weakly upon this mass. If the composition of the ejecta and the time of the remnant shell burnout are determined from observations, then the ejected and remnant masses can be deduced. At present only a sharp decrease in the X-rays observed by ROSAT has been attributed to this remnant burnout and only for two novae: GQ Mus and V1974 Cyg. The ejected and remnant masses for these two novae are calculated. If other indicators of nova remnant burnout, such as a rapid decrease in high-ionization lines, can be identified, then this method could be applied to additional novae.
The NOvA software testing framework
International Nuclear Information System (INIS)
Tamsett, M; Group, C
2015-01-01
The NOvA experiment at Fermilab is a long-baseline neutrino experiment designed to study vε appearance in a vμ beam. NOvA has already produced more than one million Monte Carlo and detector generated files amounting to more than 1 PB in size. This data is divided between a number of parallel streams such as far and near detector beam spills, cosmic ray backgrounds, a number of data-driven triggers and over 20 different Monte Carlo configurations. Each of these data streams must be processed through the appropriate steps of the rapidly evolving, multi-tiered, interdependent NOvA software framework. In total there are greater than 12 individual software tiers, each of which performs a different function and can be configured differently depending on the input stream. In order to regularly test and validate that all of these software stages are working correctly NOvA has designed a powerful, modular testing framework that enables detailed validation and benchmarking to be performed in a fast, efficient and accessible way with minimal expert knowledge. The core of this system is a novel series of python modules which wrap, monitor and handle the underlying C++ software framework and then report the results to a slick front-end web-based interface. This interface utilises modern, cross-platform, visualisation libraries to render the test results in a meaningful way. They are fast and flexible, allowing for the easy addition of new tests and datasets. In total upwards of 14 individual streams are regularly tested amounting to over 70 individual software processes, producing over 25 GB of output files. The rigour enforced through this flexible testing framework enables NOvA to rapidly verify configurations, results and software and thus ensure that data is available for physics analysis in a timely and robust manner. (paper)
The assurance management program for the Nova laser fusion project
International Nuclear Information System (INIS)
Levy, A.J.
1983-01-01
In a well managed project, Quality Assurance is an integral part of the management activities performed on a daily basis. Management assures successful performance within budget and on schedule by using all the good business, scientific, engineering, quality assurance, and safety practices available. Quality assurance and safety practices employed on Nova are put in perspective by integrating them into the overall function of good project management. The Inertial Confinement Fusion (ICF) approach is explained in general terms. The laser ICF and magnetic fusion facilities are significantly different in that the laser system is used solely as a highly reliable energy source for performing plasma physics experiments related to fusion target development; by contrast, magnetic fusion facilities are themselves the experiments. The Nova project consists of a 10-beam, 74 cm aperture neodymium-glass laser experimental facility which is being constructed by the Lawrence Livermore National Laboratory (LLNL) for the U.S. Department of Energy. Nova has a total estimated cost of $176M and will become operational in the Fall of 1984. The Nova laser will be used as the high energy driver for studying the regime of ignition for ICF. The Nova assurance management program was developed using the quality assurance (QA) approach first implemented at LLNL in early 1978. The LLNL QA program is described as an introduction to the Nova assurance management program. The Nova system is described pictorially through the Nova configuration, subsystems and major components, interjecting the QA techniques which are being pragmatically used to assure the successful completion of the project
ToO Galactic Nova -- Michelle ``Quick Response''
Helton, L. Andrew; Woodward, Chick; Evans, Nye; Geballe, Tom; Spitzer Nova Team
2006-08-01
Stars are the engines of energy production and chemical evolution in our Universe, depositing radiative and mechanical energy into their environments and enriching the ambient ISM with elements synthesized in their interiors and dust grains condensed in their atmospheres. Classical novae (CN) contribute to this cycle of chemical enrichment through explosive nucleosynthesis and the violent ejection of material dredged from the white dwarf progenitor and mixed with the accreted surface layers. We propose to obtain mid-IR spectra of a new galactic CN in outburst to investigate aspects of the CN phenomenon including the in situ formation and mineralogy of nova dust and the elemental abundances resulting from thermonuclear runaway. Synoptic, high S/N Michelle spectra permit: 1) determination of the grain size distribution and mineral composition of nova dust; 2) estimation of chemical abundances of nova ejecta from coronal and other emission line spectroscopy; and 3) measurement of the density and masses of the ejecta. This Gemini `Target of Opportunity' initiative (trigger K=5- 8 mag, assuming adequate PWFS guide stars exist) complements our extensive Spitzer, Chandra, Swift, XMM-Newton CN DDT/ToO programs.
Synoptic Mid-IR Spectra ToO Novae
Helton, L. Andrew; Woodward, Chick; Evans, Nye; Geballe, Tom; Spitzer Nova Team
2007-02-01
Stars are the engines of energy production and chemical evolution in our Universe, depositing radiative and mechanical energy into their environments and enriching the ambient ISM with elements synthesized in their interiors and dust grains condensed in their atmospheres. Classical novae (CN) contribute to this cycle of chemical enrichment through explosive nucleosynthesis and the violent ejection of material dredged from the white dwarf progenitor and mixed with the accreted surface layers. We propose to obtain mid-IR spectra of a new galactic CN in outburst to investigate aspects of the CN phenomenon including the in situ formation and mineralogy of nova dust and the elemental abundances resulting from thermonuclear runaway. Synoptic, high S/N Michelle spectra permit: 1) determination of the grain size distribution and mineral composition of nova dust; 2) estimation of chemical abundances of nova ejecta from coronal and other emission line spectroscopy; and 3) measurement of the density and masses of the ejecta. This Gemini `Target of Opportunity' initiative (trigger K=5- 8 mag, assuming adequate PWFS guide stars exist) complements our extensive Spitzer, Chandra, Swift, XMM-Newton CN DDT/ToO programs.
Energy distributions of symbiotic novae
International Nuclear Information System (INIS)
Bryan, G.L.; Kwok, S.
1991-01-01
The IRAS low-resolution spectra of three recent symbiotic novae are fitted with a dust continuum radiative transfer model. It is found that the dust shells are detached from the photosphere and that the sizes of the inner radii are correlated with times since outburst. An analysis of the IUE spectra of HM Sge at different epochs suggests that the strength of the 2200 A feature is decreasing with times and the grains responsible for the feature are probably formed in the white dwarf ejecta. A complete accounting of the entire energy budget from radio to X-ray shows that most of the energy is emitted by the cool component in the infrared, and a significant fraction of the flux of the hot component is escaping in the far-ultraviolet. The density-bounded nature of the circumstellar gas nebulae could be the result of a bipolar geometry of the nebulae. Unlike classical novae, the optical outburst of symbiotic novae is due to the ionization of the preexisting envelope of the cool component and is not the result of a sudden ejection by the hot component. 55 refs
Nova Scotia wind integration study : final report
International Nuclear Information System (INIS)
2008-01-01
An independent study was commissioned by the Nova Scotia Department of Energy to identify and assess the impacts of integrating large scale wind power generation into Nova Scotia's electric power system. The purpose of the study was to help Nova Scotia's efforts towards building its renewable energy supply, in order to secure a local energy resource and to protect the environment. This report provided an overview of Nova Scotia's electric power sector, including organizations involved; existing generation system; existing transmission system; renewable energy standards; Nova Scotia Power integrated resource plan; and 2007 renewable energy request for proposals. The major assumptions for the study that were discussed included system parameters; system capacity reserve requirements; expansion plans to 2020; and allocation of new wind generation by zone. Wind resource data and system dispatch modeling were also presented and transmission system modeling was outlined. This included a discussion of steady state reliability requirements; inputs to the load flow model; load flow study and contingency analysis; intra-province transmission congestion; and potential impacts on system security. The report also presented an approach to impact analysis and mitigation such as the impact on greenhouse gas and other air emissions and the impact of wind energy prices on system costs. It was concluded that one of the most important factors in evaluation of the economic impact of wind power integration is the forecasted fuel prices for the thermal units. If the fuel prices had varied significantly from the forecasted values, the study economic impact results could have been quite different. 55 tabs., 64 figs., 1 appendix
Long-Term Photometry of Very Slow Novae
Directory of Open Access Journals (Sweden)
Chochol D.
2003-12-01
Full Text Available Long-term photographic, photoelectric and recent CCD photometry of the classical nova V723 Cas and symbiotic novae V1329 Cyg, PU Vul, V1016 Cyg and HM Sge were used to find their orbital periods. The arguments in favor of the presence of the third components in these systems are given. Physical processes, responsible for the brightness variations, are discussed.
The geographic accessibility of pharmacies in Nova Scotia.
Law, Michael R; Heard, Deborah; Fisher, Judith; Douillard, Jay; Muzika, Greg; Sketris, Ingrid S
2013-01-01
Geographic proximity is an important component of access to primary care and the pharmaceutical services of community pharmacies. Variations in access to primary care have been found between rural and urban areas in Canadian and international jurisdictions. We studied access to community pharmacies in the province of Nova Scotia. We used information on the locations of 297 community pharmacies operating in Nova Scotia in June 2011. Population estimates at the census block level and network analysis were used to study the number of Nova Scotia residents living within 800 m (walking) and 2 km and 5 km (driving) distances of a pharmacy. We then simulated the impact of pharmacy closures on geographic access in urban and rural areas. We found that 40.3% of Nova Scotia residents lived within walking distance of a pharmacy; 62.6% and 78.8% lived within 2 km and 5 km, respectively. Differences between urban and rural areas were pronounced: 99.2% of urban residents lived within 5 km of a pharmacy compared with 53.3% of rural residents. Simulated pharmacy closures had a greater impact on geographic access to community pharmacies in rural areas than urban areas. The majority of Nova Scotia residents lived within walking or short driving distance of at least 1 community pharmacy. While overall geographic access appears to be lower than in the province of Ontario, the difference appears to be largely driven by the higher proportion of rural dwellers in Nova Scotia. Further studies should examine how geographic proximity to pharmacies influences patients' access to traditional and specialized pharmacy services, as well as health outcomes and adherence to therapy. Can Pharm J 2013;146:39-46.
SWIFT X-RAY OBSERVATIONS OF CLASSICAL NOVAE. II. THE SUPER SOFT SOURCE SAMPLE
Energy Technology Data Exchange (ETDEWEB)
Schwarz, Greg J. [American Astronomical Society, 2000 Florida Avenue, NW, Suite 400, Washington, DC 20009-1231 (United States); Ness, Jan-Uwe [XMM-Newton Science Operations Centre, ESAC, Apartado 78, 28691 Villanueva de la Canada, Madrid (Spain); Osborne, J. P.; Page, K. L.; Evans, P. A.; Beardmore, A. P. [Department of Physics and Astronomy, University of Leicester, Leicester LE1 7RH (United Kingdom); Walter, Frederick M. [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794-3800 (United States); Andrew Helton, L. [SOFIA Science Center, USRA, NASA Ames Research Center, M.S. N211-3, Moffett Field, CA 94035 (United States); Woodward, Charles E. [Minnesota Institute of Astrophysics, 116 Church Street S.E., University of Minnesota, Minneapolis, MN 55455 (United States); Bode, Mike [Astrophysics Research Institute, Liverpool John Moores University, Birkenhead CH41 1LD (United Kingdom); Starrfield, Sumner [School of Earth and Space Exploration, Arizona State University, P.O. Box 871404, Tempe, AZ 85287-1404 (United States); Drake, Jeremy J., E-mail: Greg.Schwarz@aas.org [Smithsonian Astrophysical Observatory, 60 Garden Street, MS 3, Cambridge, MA 02138 (United States)
2011-12-01
The Swift gamma-ray burst satellite is an excellent facility for studying novae. Its rapid response time and sensitive X-ray detector provides an unparalleled opportunity to investigate the previously poorly sampled evolution of novae in the X-ray regime. This paper presents Swift observations of 52 Galactic/Magellanic Cloud novae. We included the X-Ray Telescope (0.3-10 keV) instrument count rates and the UltraViolet and Optical Telescope (1700-8000 A) filter photometry. Also included in the analysis are the publicly available pointed observations of 10 additional novae the X-ray archives. This is the largest X-ray sample of Galactic/Magellanic Cloud novae yet assembled and consists of 26 novae with Super Soft X-ray emission, 19 from Swift observations. The data set shows that the faster novae have an early hard X-ray phase that is usually missing in slower novae. The Super Soft X-ray phase occurs earlier and does not last as long in fast novae compared to slower novae. All the Swift novae with sufficient observations show that novae are highly variable with rapid variability and different periodicities. In the majority of cases, nuclear burning ceases less than three years after the outburst begins. Previous relationships, such as the nuclear burning duration versus t{sub 2} or the expansion velocity of the eject and nuclear burning duration versus the orbital period, are shown to be poorly correlated with the full sample indicating that additional factors beyond the white dwarf mass and binary separation play important roles in the evolution of a nova outburst. Finally, we confirm two optical phenomena that are correlated with strong, soft X-ray emission which can be used to further increase the efficiency of X-ray campaigns.
SWIFT X-RAY OBSERVATIONS OF CLASSICAL NOVAE. II. THE SUPER SOFT SOURCE SAMPLE
International Nuclear Information System (INIS)
Schwarz, Greg J.; Ness, Jan-Uwe; Osborne, J. P.; Page, K. L.; Evans, P. A.; Beardmore, A. P.; Walter, Frederick M.; Andrew Helton, L.; Woodward, Charles E.; Bode, Mike; Starrfield, Sumner; Drake, Jeremy J.
2011-01-01
The Swift gamma-ray burst satellite is an excellent facility for studying novae. Its rapid response time and sensitive X-ray detector provides an unparalleled opportunity to investigate the previously poorly sampled evolution of novae in the X-ray regime. This paper presents Swift observations of 52 Galactic/Magellanic Cloud novae. We included the X-Ray Telescope (0.3-10 keV) instrument count rates and the UltraViolet and Optical Telescope (1700-8000 Å) filter photometry. Also included in the analysis are the publicly available pointed observations of 10 additional novae the X-ray archives. This is the largest X-ray sample of Galactic/Magellanic Cloud novae yet assembled and consists of 26 novae with Super Soft X-ray emission, 19 from Swift observations. The data set shows that the faster novae have an early hard X-ray phase that is usually missing in slower novae. The Super Soft X-ray phase occurs earlier and does not last as long in fast novae compared to slower novae. All the Swift novae with sufficient observations show that novae are highly variable with rapid variability and different periodicities. In the majority of cases, nuclear burning ceases less than three years after the outburst begins. Previous relationships, such as the nuclear burning duration versus t 2 or the expansion velocity of the eject and nuclear burning duration versus the orbital period, are shown to be poorly correlated with the full sample indicating that additional factors beyond the white dwarf mass and binary separation play important roles in the evolution of a nova outburst. Finally, we confirm two optical phenomena that are correlated with strong, soft X-ray emission which can be used to further increase the efficiency of X-ray campaigns.
Observations and predictions of EUV emission from classical novae
International Nuclear Information System (INIS)
Starrfield, S.; Truran, J.W.; Sparks, W.M.; Krautter, J.
1989-01-01
Theoretical modeling of novae in outburst predicts that they should be active emitters of radiation both in the EUV and soft X-ray wavelengths twice during the outburst. The first time is very early in the outburst when only an all sky survey can detect them. This period lasts only a few hours. They again become bright EUV and soft X-ray emitters late in the outburst when the remnant object becomes very hot and is still luminous. The predictions imply both that a nova can remain very hot for months to years and that the peak temperature at this time strongly depends upon the mass of the white dwarf. It is important to observe novae at these late times because a measurement of both the flux and temperature can provide information about the mass of the white dwarf, the tun-off time scale, and the energy budget of the outburst. We review the existing observations of novae in late stages of their outburst and present some newly obtained data for GQ Mus 1983. We then provide results of new hydrodynamic simulations of novae in outburst and compare the predictions to the observations. 43 refs., 6 figs
Eruptions and superhumps in dwarf novae
International Nuclear Information System (INIS)
Patterson, J.
1979-01-01
The existence of two distinct eruption types in dwarf novae is considered. A small subclass of dwarf novae, the SU Ursae Majoris stars, show occasional very bright and long eruptions (''supermaxima''), and during supermaxima, large-amplitude photometric variations (''superhumps'') at a period related to the orbital period are seen. Two new stars showing these effects, AY Lyrae and YZ Cancri, are reported. A third star, WZ Sagittae, is probably also a member of the class. Models for the superhumps are reviewed and found to be unsatisfactory. Observational constraints on a successful model are discussed
Spectral evolution of dwarf nova outbursts
International Nuclear Information System (INIS)
Cannizzo, J.K.; Kenyon, S.J.
1987-01-01
The disk instability model for dwarf nova eruptions is investigated by computing the spectral development of the accretion disk through a complete limit cycle. Observed stellar spectra are used to model the radiation emitted by optically thick annuli within the disc. The general findings agree with those of Smak (1984) and Pringle et al. (1986). It is suggested that the dwarf nova oscillations might be a source of information concerning the evolution of the inner disk and that detailed observations of this phenomenon can be used to test various outburst mechanisms. 74 references
Spectroscopy of poorly known northern dwarf novae. Part. I
International Nuclear Information System (INIS)
Bruch, A.
1989-01-01
Spectroscopic observations of 12 dwarf novae are presented most of which hitherto unknown spectroscopically. The classifications as dwarf novae could be confirmed in most cases. Two objects remain doubtful: CI UMa and MR Per. The latter has the spectrum of a very late type main sequence star with hydrogen emissions and might be a flare star showing extremely slow flares, while the CI UMa spectrum does not contain any emission line above the noise level. In two dwarf novae - DX And and NS Per - absorption lines of the secondary star are newly detected
CIRCUMSTELLAR SHELL FORMATION IN SYMBIOTIC RECURRENT NOVAE
Energy Technology Data Exchange (ETDEWEB)
Moore, Kevin; Bildsten, Lars [Department of Physics, Broida Hall, University of California, Santa Barbara, CA 93106 (United States)
2012-12-20
We present models of spherically symmetric recurrent nova shells interacting with circumstellar material (CSM) in a symbiotic system composed of a red giant (RG) expelling a wind and a white dwarf accreting from this material. Recurrent nova eruptions periodically eject material at high velocities ({approx}> 10{sup 3} km s{sup -1}) into the RG wind profile, creating a decelerating shock wave as CSM is swept up. High CSM densities cause the shocked wind and ejecta to have very short cooling times of days to weeks. Thus, the late-time evolution of the shell is determined by momentum conservation instead of energy conservation. We compute and show evolutionary tracks of shell deceleration, as well as post-shock structure. After sweeping up all the RG wind, the shell coasts at a velocity {approx}100 km s{sup -1}, depending on system parameters. These velocities are similar to those measured in blueshifted CSM from the symbiotic nova RS Oph, as well as a few Type Ia supernovae that show evidence of CSM, such as 2006X, 2007le, and PTF 11kx. Supernovae occurring in such systems may not show CSM interaction until the inner nova shell gets hit by the supernova ejecta, days to months after the explosion.
Rate of nova production in the Galaxy
International Nuclear Information System (INIS)
Liller, W.; Mayer, B.; PROBLICOM Sky Survey, Los Angeles, CA)
1987-01-01
The ongoing PROBLICOM program in the Southern Hemisphere now makes it possible to derive a reliable value for the overall production rate of Galactic novae. The results, 73 + or - 24/y, indicates that the Galaxy outproduces M 31 by a factor of two or three. It is estimated that the rate of supernova ejecta is one and a half orders of magnitude greater than that of novae in the Galaxy. 15 references
Results of Statewide TerraNova Testing, Fall 1998.
La Marca, Paul M.
This summary provides key findings about state, district, and school level performance on the TerraNova examinations (CTB/McGraw Hill) in Nevada in 1998-1999. The TerraNova tests are used to assess students in grades 4, 8, and 10 as stipulated by Nevada law. Within this summary, a description of performance as measured by national percentile…
A Recurrent Nova Super-Remnant in the Andromeda Galaxy
DEFF Research Database (Denmark)
Darnley, M. J.; Hounsell, R.; O'Brien, T. J.
2017-01-01
Here we report that the most rapidly recurring nova, M31N 2008-12a, which erupts annually, is surrounded by a "nova super-remnant" which demonstrates that M31N 2008-12a has erupted with high frequency for millions of years....
Rapid Decline in Radio Flux Density of Nova Sco 2015 Followed By Rise at High Frequencies
Linford, J.; Nelson, T.; Chomiuk, L.; Sokoloski, J.; Mukai, K.; Finzell, T.; Weston, J.; Rupen, M.; Mioduszewski, A.
2015-03-01
We are monitoring Nova Sco 2015 (PNV J17032620-3504140) at radio wavelengths with the Karl G. Jansky Very Large Array (VLA). We have observations from three epochs: 2015 Feb 14.5, 2015 Feb 18.5-19.5, and 2015 Feb 24.6-Mar 01.5.
A Radio Emission Analysis of Classical Nova V351 Pup (1991)
Wendeln, Carolyn; Chomiuk, Laura; Finzell, Thomas; Linford, Justin D.; Strader, Jay
2017-05-01
Previously, Nova Puppis 1991 (V351 Pup) was measured to host one of the most massive ejections claimed in the literature. Multi-frequency radio detections from one epoch were published for this nova in the 1990's; and yet, the remaining data collected by the Karl G. Jansky Very Large Array (VLA) have remained unpublished. In this paper, we analyze the remaining unpublished data sets for V351 Pup at frequencies of 4.9, 8.4, 14.9, and 22.5 GHz. We fit the resulting light curve to a model of expanding thermal ejecta, under the assumption that the radio emission is dominated by free-free radiation and accounting for high levels of clumping in the ejecta. Images of V351 Pup in both the radio (from the VLA) and Hα+[N II] (from Hubble Space Telescope) exhibit no aspherical structure, strengthening our assumption of spherical symmetry. From expansion parallax methods, we estimate the distance to V351 Pup to be 5.0 ± 1.5 kpc. Our light-curve fit yields a value of {{log}}10({M}{ej})=-5.2+/- 0.7 {M}⊙ for the ejecta mass, implying that V351 Pup is on the low end of expectations for ejecta mass from classical novae. A comparison between our derived ejecta mass and theoretical models gives evidence for a very massive (1.25 {M}⊙ ) white dwarf, which is consistent with spectroscopic evidence for an oxygen-neon white dwarf.
Czech Academy of Sciences Publication Activity Database
Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří
2010-01-01
Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010
NOVAS TECNOLOGIAS NO ENVELHECIMENTO
Directory of Open Access Journals (Sweden)
Rosa Maria Farah
2010-02-01
Full Text Available O Programa de Estudos Pós-Graduados em Gerontologia/PUC-SP desenvolve pesquisas em diversificadas linhas algumas das quais têm em comum o acolhimento à questão das novas tecnologias no envelhecimento. São investigações de caráter interdisciplinar que envolvem docentes-pesquisadores, orientandos de mestrado e de iniciação científica. Na área da educação a distância, a PUC-SP inaugura um trabalho em que o idoso interessado em avançar em seus conhecimentos é recebido em um ambiente virtual de aprendizagem, em que pode participar de cursos avançados de aquisição de novas linguagens e de navegação na Internet, cujas consequências são o investimento em uma via mais digna para o envelhecer no sentido de esse idoso sentir-se um ser ligado aos novos tempos em que a interatividade digital traz-lhe possibilidades ilimitadas de contatos com o outro, com o mundo enfim. A pesquisa sobre a inclusão cibersocial do idoso mostra o que significa colocar o idoso em contato com a Internet, quando este recebe, por meio das redes sociais, ofertas de várias ordens, e equipamentos que contornam limitações de ordem física ou motora. Além disso, o registro digital da memória do idoso, de sua história e referências também podem constituir conteudos preciosos para pesquisas. A relação do idoso com a informática pode situá-lo como um ator, produtor e reprodutor no ciberespaço. Isso significa que as vantagens do uso do computador fazem o idoso ganhar novo sentido na vida, na medida em que pode assim preencher o vazio causado pelas perdas que lhe vão ocorrendo, possibilitando que ele redimensione seu olhar para o presente e futuro. Palavras-chave: o sujeito-idoso nas novas tecnologias; novas tecnologias e envelhecimento; o idoso na educação a distância; internet na velhice.
Gamma-ray emission from internal shocks in novae
Martin, P.; Dubus, G.; Jean, P.; Tatischeff, V.; Dosne, C.
2018-04-01
Context. Gamma-ray emission at energies ≥100 MeV has been detected from nine novae using the Fermi Large Area Telescope (LAT), and can be explained by particle acceleration at shocks in these systems. Eight out of these nine objects are classical novae in which interaction of the ejecta with a tenuous circumbinary material is not expected to generate detectable gamma-ray emission. Aim. We examine whether particle acceleration at internal shocks can account for the gamma-ray emission from these novae. The shocks result from the interaction of a fast wind radiatively-driven by nuclear burning on the white dwarf with material ejected in the initial runaway stage of the nova outburst. Methods: We present a one-dimensional model for the dynamics of a forward and reverse shock system in a nova ejecta, and for the associated time-dependent particle acceleration and high-energy gamma-ray emission. Non-thermal proton and electron spectra are calculated by solving a time-dependent transport equation for particle injection, acceleration, losses, and escape from the shock region. The predicted emission is compared to LAT observations of V407 Cyg, V1324 Sco, V959 Mon, V339 Del, V1369 Cen, and V5668 Sgr. Results: The ≥100 MeV gamma-ray emission arises predominantly from particles accelerated up to 100 GeV at the reverse shock and undergoing hadronic interactions in the dense cooling layer downstream of the shock. The emission rises within days after the onset of the wind, quickly reaches a maximum, and its subsequent decrease reflects mostly the time evolution of the wind properties. Comparison to gamma-ray data points to a typical scenario where an ejecta of mass 10-5-10-4 M⊙ expands in a homologous way with a maximum velocity of 1000-2000 km s-1, followed within a day by a wind with a velocity values of which result in the majority of best-fit models having gamma-ray spectra with a high-energy turnover below 10 GeV. Our typical model is able to account for the main
FUSE SPECTROSCOPIC ANALYSIS OF THE SLOWEST SYMBIOTIC NOVA AG PEG DURING QUIESCENCE
Sion, Edward Michael; Godon, Patrick; Katynski, Marcus; Mikolajewska, Joanna
2018-01-01
We present a far ultraviolet spectroscopic analysis of the slowest known symbiotic nova AG Peg (MIII giant + hot white dwarf; P_orb = 818.4 days) which underwent a nova explosion in 1850 followed by a very slow decline that did not end until ~ 1996, marking the beginning of queiscence. Eight years of quiescence ended in June 2015, when AG Peg exhibited a Z And-type outburst with an optical amplitude of ~ 3 magnitudes. We have carried out accretion disk and WD photosphere synthetic spectral modeling of a FUSE spectrum (Froning et al. 2014) obtained on June 5.618, 2003 during the quiescence intervai ~ 12 years before the 2015 outburst. The spectrum is heavily affected by ISM absorption as well as strong broad emission lines. We de-reddened the FUSE fluxes with E(B-V) = 0.10 which is the maximum galactic reddening in the direction of AG Peg and took the distance of 800 pc (Kenyon et al. 1993) but used a range of white dwarf masses, surface temperatures and disk inclination angles. Our analysis also incororates archival HST FOS spectra obtained in 1996 at the onset of quiescence, 147 years after the 1850 nova explosion. The results of our analysis are presented and implications are discussed.This work is supported in part by NASA ADP grant NNX17AF36G to Villanova University.
What does an erupting nova do to its red dwarf companion?
International Nuclear Information System (INIS)
Kovetz, A.; Prialnik, D.; Shara, M.M.
1988-01-01
During nova eruptions and for decades afterward, the red dwards in cataclysmic binaries are irradiated with hundreds of times more luminosity than they themselves produce. Simulations of the time-dependent irradiation of three red dwarf models (0.25, 0.50, and 0.75 solar mass) are presented. The mass transfer rates forced by irradiation after nova eruption are found to be enhanced by two orders of magnitude because of the irradiation. The time scale for irradiation to become unimportant is that of the white dwarf cooling time scale, a few centuries. These two results support the hibernation scenario of novae, which suggests that novae remain bright for a few centuries after eruption because of irradiation-induced mass transfer. After irradiation decreases mass transfer slows, and some very old novae may then become extremely faint. 26 references
Novel molecular targets for kRAS downregulation: promoter G-quadruplexes
2016-11-01
proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with
Near-infrared and optical studies of the highly obscured nova V1831 Aquilae (Nova Aquilae 2015)
Banerjee, D. P. K.; Srivastava, Mudit K.; Ashok, N. M.; Munari, U.; Hambsch, F.-J.; Righetti, G. L.; Maitan, A.
2018-01-01
Near-infrared (NIR) and optical photometry and spectroscopy are presented for the nova V1831 Aquilae, covering the early decline and dust-forming phases during the first ∼90 d after its discovery. The nova is highly reddened due to interstellar extinction. Based solely on the nature of the NIR spectrum, we are able to classify the nova to be of the Fe II class. The distance and extinction to the nova are estimated to be 6.1 ± 0.5 kpc and Av ∼ 9.02, respectively. Lower limits of the electron density, emission measure and ionized ejecta mass are made from a Case B analysis of the NIR Brackett lines, while the neutral gas mass is estimated from the optical [O I] lines. We discuss the cause of the rapid strengthening of the He I 1.0830-μm line during the early stages. V1831 Aql formed a modest amount of dust fairly early (∼19.2 d after discovery); the dust shell is not seen to be optically thick. Estimates of the dust temperature, dust mass and grain size are made. Dust formation commences around day 19.2 at a condensation temperature of 1461 ± 15 K, suggestive of a carbon composition, following which the temperature is seen to decrease gradually to 950 K. The dust mass shows a rapid initial increase, which we interpret as being due to an increase in the number of grains, followed by a period of constancy, suggesting the absence of grain destruction processes during this latter time. A discussion of the evolution of these parameters is made, including certain peculiarities seen in the grain radius evolution.
Late-type components of slow novae and symbiotic stars
Energy Technology Data Exchange (ETDEWEB)
Allen, D A [Anglo-Australian Observatory, Epping (Australia); Royal Observatory, Edinburgh (UK))
1980-08-01
It is argued that the various types of symbiotic stars and the slow novae are the same phenomena exhibiting a range of associated time-scales, the slow novae being of intermediate speed. Evidence is summarized showing that both types of object contain normal M giants or mira variables. This fact is at odds with currently fashionable single-star models for slow novae, according to which the M star is totally disrupted before the outburst. Spectral types of the late-type components are presented for nearly 80 symbiotic stars and slow novae, derived from 2 ..mu..m spectroscopy. It is found that both the intensity of the emission spectrum and the electron density of the gas are functions of the spectral type of the late-type star. Explanations for these correlations are given. On the assumption that the late-type components are normal giants, spectroscopic parallaxes are determined; credible distances are derived which indicate that the known symbiotic stars have been sampled as far afield as the Galactic Centre. Hydrogen shell flashes on a white dwarf accreting gas from the late-type components offer an attractive explanation of the phenomena of slow novae and symbiotic stars, and such models are discussed in the concluding section.
Canada-Nova Scotia Offshore Petroleum Board annual report, 1992-1993
International Nuclear Information System (INIS)
1993-06-01
The Canada-Nova Scotia Offshore Petroleum Board was established as the agency responsible for the regulation of the hydrocarbon resources in the Nova Scotia offshore. The Board evaluates resource potential, administers petroleum exploration and production rights, approves offshore activities, and approves benefits and development plans. The main activities of the Board in 1992-1993 are summarized and financial statements are presented. Highlights include production of 572,300 m 3 of oil during the first production season of LASMO Nova Scotia Ltd.'s Cohasset development, the first commercial offshore oil production for Canada; four major resource evaluation projects in the Glenelg Field, the Laurentian sub-basin, the Fundy Rift Basin, and the Panuke Field; holding of discussions between Nova Scotia, Newfoundland, and Canada on the maritime boundary lines between respective offshore petroleum board jurisdictions, in the wake of a June 1992 determination of the disputed maritime boundary around St. Pierre et Miquelon; and amendments of certain safety-related legislation applicable to offshore operations. Employment benefits of the Cohasset project during 1992 totalled ca 470 Nova Scotians and 120 other Canadians. 3 tabs
International Nuclear Information System (INIS)
Wennfors, B.
1976-01-01
Ten of the two hundred cosmic X-ray sources exhibit characteristics in their emissions analogous to novae, i.e. after a rapid increase in luminosity, lasting about three days, follows a period of about a month with a slow decrease, and thereafter a rapid decrease to invisibility. The spectra of such sources are discussed in general terms and brief descriptions are given of the five which have been identified with optical objects. Three models for the history of X-ray novae, all based on X-ray emission from a compact object in an orbit very near a larger star, are discussed. (JIW)
Observations and simulations of recurrent novae: U Sco and V394 CrA
Starrfield, S.; Sonneborn, G.; Sparks, Warren M.; Shaviv, G.; Williams, R. E.; Heathcote, S.; Ferland, Gary; Gehrz, Robert D.; Ney, Edward P.; Kenyon, Scott
1988-01-01
Observations and analysis of the Aug. 1987 outburst of the recurrent nova V394 CrA are presented. This nova is extremely fast and its outburst characteristics closely resemble those of the recurrent nova U Sco. Hydrodynamic simulations of the outbursts of recurrent novae were performed. Results as applied to the outbursts of V394 CrA and U Sco are summarized.
THE INTER-ERUPTION TIMESCALE OF CLASSICAL NOVAE FROM EXPANSION OF THE Z CAMELOPARDALIS SHELL
International Nuclear Information System (INIS)
Shara, Michael M.; Mizusawa, Trisha; Zurek, David; Martin, Christopher D.; Neill, James D.; Seibert, Mark
2012-01-01
The dwarf nova Z Camelopardalis is surrounded by the largest known classical nova shell. This shell demonstrates that at least some dwarf novae must have undergone classical nova eruptions in the past, and that at least some classical novae become dwarf novae long after their nova thermonuclear outbursts. The current size of the shell, its known distance, and the largest observed nova ejection velocity set a lower limit to the time since Z Cam's last outburst of 220 years. The radius of the brightest part of Z Cam's shell is currently ∼880 arcsec. No expansion of the radius of the brightest part of the ejecta was detected, with an upper limit of ≤0.17 arcsec yr –1 . This suggests that the last Z Cam eruption occurred ≥5000 years ago. However, including the important effect of deceleration as the ejecta sweeps up interstellar matter in its snowplow phase reduces the lower limit to 1300 years. This is the first strong test of the prediction of nova thermonuclear runaway theory that the interoutburst times of classical novae are longer than 1000 years. The intriguing suggestion that Z Cam was a bright nova, recorded by Chinese imperial astrologers in October-November 77 B.C.E., is consistent with our measurements. If Z Cam was indeed the nova of 77 B.C.E. we predict that its ejecta are currently expanding at 85 km s –1 , or 0.11 arcsec yr –1 . Detection and measurement of this rate of expansion should be possible in just a few years.
Spinello, A; Barone, G; Grunenberg, J
2016-01-28
In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.
INT WFC follow-up photometry of the M31 nova M31N 2017-10a
Hermosa-Munoz, L.; Garcia-Rivas, M.; Gonzalez-Cuesta, L.; Jimenez-Gallardo, A.; Mantero-Castaneda, E. A.; Arce-Tord, C.; Prendin, M. G.; Rodriguez-Sanchez, M.; Esteban-Gutierrez, A.; Garcia-Broock, E.; Hernandez-Sanchez, M.; Lopez-Navas, E.; Otero-Santos, J.; Perez-Fournon, I.
2017-12-01
We report follow-up photometry in the Sloan g, r, and i bands, 240s per band, of the nova M31N 2017-10a ( = PNV J00423905+4123006) from observations on the night of 29 October 2017 with the Wide Field Camera of the Isaac Newton Telescope*.
Policy statement on gas distribution in Nova Scotia
Energy Technology Data Exchange (ETDEWEB)
NONE
2002-01-30
This paper presented Nova Scotia's policy related to gas distribution. The government of Nova Scotia views natural gas as an economic enabler and is committed to ensuring that natural gas is available and accessible to Nova Scotians where it is economically feasible. Natural gas will give the province an efficient and clean burning energy supply that will make existing businesses more competitive. The province will support and facilitate the construction and operation of a gas distribution system by the private sector and will ensure that there is regulatory oversight by the Nova Scotia Utility and Review Board to protect the public interest. The government will also develop a plan for early conversion of government buildings to natural gas. This paper described the province's policy on gas distribution in relation to: (1) a province-wide franchise, (2) a supplemental franchise, (3) cost of service/performance based rates, (4) postage stamp rates, (5) a Maritimes and Northeast lateral policy, (6) direct access/bypass, (7) existing direct access user, (8) bundling of gas sales and other products and services, (9) licensing of gas marketers, (10) benefits, (11), regulatory efficiency, (12) municipal taxes, and (13) municipal operating agreements.
V2487 Oph 1998: a post nova in an intermediate polar
Directory of Open Access Journals (Sweden)
Hernanz Margarita
2014-01-01
Full Text Available V2487 Oph (Nova Oph 1998 is a classical nova that exploded in 1998. XMM-Newton observations performed between 2 and 9 years after the explosion showed emission related to restablished accretion, and indicative of a magnetic white dwarf. The spectrum looks like that of a cataclysmic variable of the intermediate polar type. Anyway, we don’t have yet a definitive confirmation of the intermediate polar character, through determination of spin and orbital periods. Although it is not the first nova exploding in a magnetic white dwarf, it is always challenging to reach explosive conditions when a standard accretion disk can’t be formed, because of the magnetic field. In addition, V2487 Oph has been the first nova where a detection of X-rays - in the host binary system – has been reported prior to its eruption, in 1990 with the ROSAT satellite. V2487 Oph has been also detected in hard X-rays with INTEGRAL/IBIS and RXTE/PCA. Last but not least, V2487 Oph has been identified as a recurrent nova in 2008, since a prior eruption in 1900 has been reported through analysis of Harvard photographic plates. Therefore, it is expected to host a massive white dwarf and be a candidate for a type Ia supernova explosion. In a recent study of the progenitors of galactic novae, it has been emphasized that V2487 Oph is an important and interesting object, "intermediate" between the "standard" classical novae and other historical and well-known recurrent novae with shorter recurrence periods. It could be that in the end there’s a continuous distribution of recurrence periods, instead of the common understanding up to now that "classical" and "recurrent" novae were quite apart (with recurrence periods of more than 104 years and less than 100years - approximately - respectively. We present the results of our campaign of several observations with XMM-Newton. The consequences for the understanding of such a puzzling object are discussed.
Figueira, Joana; José, Jordi; García-Berro, Enrique; Campbell, Simon W.; García-Senz, Domingo; Mohamed, Shazrene
2018-05-01
Context. Classical novae are thermonuclear explosions hosted by accreting white dwarfs in stellar binary systems. Material piles up on top of the white dwarf star under mildly degenerate conditions, driving a thermonuclear runaway. The energy released by the suite of nuclear processes operating at the envelope, mostly proton-capture reactions and β+-decays, heats the material up to peak temperatures ranging from 100 to 400 MK. In these events, about 10-3-10-7 M⊙, enriched in CNO and, sometimes, other intermediate-mass elements (e.g., Ne, Na, Mg, and Al) are ejected into the interstellar medium. Aims: To date, most of the efforts undertaken in the modeling of classical nova outbursts have focused on the early stages of the explosion and ejection, ignoring the interaction of the ejecta, first with the accretion disk orbiting the white dwarf and ultimately with the secondary star. Methods: A suite of 3D, smoothed-particle hydrodynamics (SPH) simulations of the interaction between the nova ejecta, accretion disk, and stellar companion were performed to fill this gap; these simulations were aimed at testing the influence of the model parameters—that is, the mass and velocity of the ejecta, mass and the geometry of the accretion disk—on the dynamical and chemical properties of the system. Results: We discuss the conditions that lead to the disruption of the accretion disk and to mass loss from the binary system. In addition, we discuss the likelihood of chemical contamination of the stellar secondary induced by the impact with the nova ejecta and its potential effect on the next nova cycle. Movies showing the full evolution of several models are available online at http://https://www.aanda.org and at http://www.fen.upc.edu/users/jjose/Downloads.html
Do policial ao noir: as novas faces da narrativa violenta
Directory of Open Access Journals (Sweden)
Paulo Sesar Pimentel
2014-01-01
Full Text Available O presente artigo se propõe a, num primeiro momento, descrever a evolução do gênero policial, do seu surgimento até sua transformação, numa nova categoria, designada por noir. Partindo deste ponto, trabalham-se as especificidades do chamado romance negro, suas motivações e suas peculiaridades, inseridas na estrutura social contemporânea, discutindo, por sua relação intrínseca, a violência e a morte. A fim de exemplificar esta construção narrativa, usa-se o conto "Tempestade sobre a Montanha", de Wander Antunes, numa análise que permite vislumbrar as manifestações temáticas e estruturais deste novo gênero adaptadas à realidade brasileira.
Constraining Calcium Production in Novae
Tiwari, Pranjal; C. Fry, C. Wrede Team; A. Chen, J. Liang Collaboration; S. Bishop, T. Faestermann, D. Seiler Collaboration; R. Hertenberger, H. Wirth Collaboration
2017-09-01
Calcium is an element that can be produced by thermonuclear reactions in the hottest classical novae. There are discrepancies between the abundance of Calcium observed in novae and expectations based on astrophysical models. Unbound states 1 MeV above the proton threshold affect the production of Calcium in nova models because they act as resonances in the 38 K(p , γ) 39 Ca reaction present. This work describes an experiment to measure the energies of the excited states of 39 Ca . We will bombard a thin target of 40 Ca with a beam of 22 MeV deuterons, resulting in tritons and 39Ca. We will use a Q3D magnetic spectrograph from the MLL in Garching, Germany to momenta analyze the tritons to observe the excitation energies of the resulting 39 Ca states. Simulations have been run to determine the optimal spectrograph settings. We decided to use a chemically stable target composed of CaF2 , doing so resulted in an extra contaminant, Fluorine, which is dealt with by measuring the background from a LiF target. These simulations have led to settings and targets that will result in the observation of the 39 Ca states of interest with minimal interference from contaminants. Preliminary results from this experiment will be presented. National Sciences and Engineering Research Council of Canada and U.S. National Science Foundation.
A deep optical imaging study of the nebular remnants of classical novae
Slavin, A. J.; O'Brien, T. J.; Dunlop, J. S.
1995-09-01
An optical imaging study of old nova remnants has revealed previously unobserved features in the shells of 13 classical novae - DQ Her, FH Ser, HR Del, GK Per, V1500 Cyg, T Aur, V533 Her, NQ Vul, V476 Cyg, DK Lac, LV Vul, RW UMi and V450 Cyg. These data indicate a possible correlation between nova speed class and the ellipticity of the resulting remnants - those of faster novae tend to comprise randomly distributed clumps of ejecta superposed on spherically symmetric diffuse material, whilst slower novae produce more structured ellipsoidal remnants with at least one and sometimes several rings of enhanced emission. By measuring the extent of the resolved shells and combining this information with previously published ejection speeds, we use expansion parallax to estimate distances for the 13 novae. Whilst we are able to deduce new information about every nova, it is notable that these observations include the first detections of shells around the old novae V450 Cyg and NQ Vul, and that velocity-resolved images of FH Ser and DQ Her have enabled us to estimate their orbital inclinations. Our observations of DQ Her also show that the main ellipsoidal shell is constricted by three rings and surrounded by a faint halo; this halo contains long tails extending outwards from bright knots, perhaps indicating that during or after outburst a fast inner wind has broken through the fractured principal shell.
Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA
DEFF Research Database (Denmark)
Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch
2016-01-01
of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...
Transposable elements and G-quadruplexes
Czech Academy of Sciences Publication Activity Database
Kejnovský, Eduard; Tokan, Viktor; Lexa, M.
2015-01-01
Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015
Nova Upgrade program: ignition and beyond
International Nuclear Information System (INIS)
Storm, E.; Campbell, E.M.; Hogan, W.J.; Lindl, J.D.
1993-01-01
The Lawrence Livermore National Laboratory (LLNL) Inertial Confinement Fusion (ICF) Program is addressing the critical physics and technology issues directed toward demonstrating and exploiting ignition and propagating burn to high gain with ICF targets for both defense and civilian applications. Nova is the primary U.S. facility employed in the study of the X-ray-driven (indirect drive) approach to ICF. Nova's principal objective is to demonstrate that laser-driven hohlraums can achieve the conditions of driver-target coupling efficiency, driver irradiation symmetry, driver pulseshaping, target preheat, and hydrodynamic stability required by hot-spot ignition and fuel compression to realize a fusion gain. (author)
Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh
2014-09-05
The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
2012-01-01
Located next to the car park by the flag poles, a few metres from the Main CERN Reception (building 33), a new snack point catered by Novae will open to the public on Wednesday 8 August. More information will be available in the next issue of the Bulletin!
Line Evolution of the Nova V5587 Sgr from Early to Nebula Phase
Directory of Open Access Journals (Sweden)
T. Kajikawa
2015-02-01
Full Text Available The spectral evolution of the nova V5587 Sgr has been monitored at Koyama Astronomical Observatory and Higashi-Hiroshima Observatory, Japan, from the early to nebula phase. The nova rebrightened several times. The spectra during the early phase showed emission lines of H α, H β, O I, He I, He II, N II, Fe II. Nova V5587 Sgr is classified into the Fe II type. The helium abundance of the nova is estimated as N(He/N(H = 0.134 ± 0.09. The light curve, the spectral evolution, and the helium abundance in V5587 Sgr are similar to those of the nova PW Vul.
Multicolour photometry and spectroscopy of the slow nova V475 Sct (Nova Scuti 2003)
Czech Academy of Sciences Publication Activity Database
Chochol, D.; Katysheva, N.A.; Pribulla, T.; Schmidtobreick, L.; Shugarov, S.Yu.; Škoda, Petr; Šlechta, Miroslav; Vittone, A.A.; Volkov, I. M.
2006-01-01
Roč. 6, č. 1 (2006), s. 137-142 ISSN 1009-9271 Institutional research plan: CEZ:AV0Z10030501 Keywords : cataclysmic variables * circumstellar matter * stars: novae Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 0.746, year: 2006
Photometric and spectroscopic variability of the slow nova V475 Sct (Nova Scuti 2003)
Czech Academy of Sciences Publication Activity Database
Chochol, D.; Katysheva, N.A.; Pribulla, T.; Schmidtobreick, L.; Shugarov, S.Yu.; Škoda, Petr; Šlechta, Miroslav; Vittone, A.A.; Volkov, I. M.
2005-01-01
Roč. 35, č. 2 (2005), s. 107-129 ISSN 1335-1842 R&D Projects: GA AV ČR KSK2043105 Institutional research plan: CEZ:AV0Z1003909 Keywords : novae * photometry * spectroscopy Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics
The progenitor of Nova Cygni 2006 (=V2362 Cyg)
Steeghs, D.; Greimel, R.; Drew, J.; Irwin, M.; Gaensicke, B.; Groot, P.J.; Knigge, C.
2006-01-01
We report on the detection of the likely progenitor to Nova Cygni 2006 = V2362 Cyg (IAUC #8697, #8698, ATel #792) using images from the INT Photometric H-Alpha Survey (IPHAS; http://www.iphas.org). The field containing the classical nova was observed as part of our galactic plane survey on Aug. 3rd
Nova Scotia's new gas distribution regime
Energy Technology Data Exchange (ETDEWEB)
MacIsaac, J.B. [Cox Hanson O' Reilly Matheson, Halifax, NS (Canada)
2002-07-01
The most recent amendments to Nova Scotia's gas distribution regime were described in detail. The amended legislation includes: (1) elimination of mandatory service targets, (2) franchise terms of 25 years, (3) a 10 year prohibition on industrial by-pass, (4) gas sales licenses are now required to market gas in Nova Scotia, (5) distributors can offer bundled services, (6) the elimination of province wide uniform tolls for low volume customers, (7) public utilities are permitted to apply for a distribution franchise and to market natural gas, (8) ex-party filing of interim rates, (9) the Pipeline Act applies to the construction of gas distribution systems, (10) socio-economic studies are required for parties seeking a single-end user franchise outside a franchise area, and (11) regulations for underground gas storage have been removed from the legislation. It was noted that these significant changes to the statutory framework of Nova Scotia's delivery of natural gas are sending encouraging signals to parties considering investing in the distribution network in the province. It was also noted, that as in any industry, success of natural gas distribution in Nova Scotia will depend on economics and not on structural changes. 66 refs.
Cross Check of NOvA Oscillation Probabilities
Energy Technology Data Exchange (ETDEWEB)
Parke, Stephen J. [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States). Dept. of Theoretical Physics; Messier, Mark D. [Indiana Univ., Bloomington, IN (United States). Dept. of Physics
2018-01-12
In this note we perform a cross check of the programs used by NOvA to calculate the 3-flavor oscillation probabilities with a independent program using a different method. The comparison is performed at 6 significant figures and the agreement, $|\\Delta P|/P$ is better than $10^{-5}$, as good as can be expected with 6 significant figures. In addition, a simple and accurate alternative method to calculate the oscillation probabilities is outlined and compared in the L/E range and matter density relevant for the NOvA experiment.
DEFF Research Database (Denmark)
Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich
2012-01-01
Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...
Exquisite Nova Light Curves from the Solar Mass Ejection Imager (SMEI)
Hounsell, R.; Bode, M. F.; Hick, P. P.; Buffington, A.; Jackson, B. V.; Clover, J. M.; Shafter, A. W.; Darnley, M. J.; Mawson, N. R.; Steele, I. A.; Evans, A.; Eyres, S. P. S.; O'Brien, T. J.
2010-01-01
We present light curves of three classical novae (KT Eridani, V598 Puppis, V1280 Scorpii) and one recurrent nova (RS Ophiuchi) derived from data obtained by the Solar Mass Ejection Imager (SMEI) on board the Coriolis satellite. SMEI provides near complete sky-map coverage with precision visible-light photometry at 102-minute cadence. The light curves derived from these sky maps offer unprecedented temporal resolution around, and especially before, maximum light, a phase of the nova eruption n...
Intriguing Misalignment Between Radio and Optical Structures in Classical Nova V5668 Sgr
Linford, Justin; Lawrence, Stephen; Chomiuk, Laura; Sokoloski, Jennifer; Nelson, Thomas; Mukai, Koji; Rupen, Michael; Mioduszewski, Amy; van der Horst, Alexander; Kawash, Adam
2018-01-01
The mass-loss and particle acceleration mechanism that drive gamma-ray production in classical novae remain largely unknown, but clues can be found in high spatial resolution images. The nova V5668 Sgr erupted in March of 2015 and was detected by the Fermi Gamma-ray Space Telescope approximately 2 days after its eruption. We obtained high-resolution radio images of the ejecta with the Karl G. Jansky Very Large Array (VLA) in December 2016 and January 2017. The VLA images reveal a bipolar morphology, very similar to that seen in V959 Mon. We obtained images of the ejecta with the Hubble Space Telescope (HST) in July 2017 using two narrow-band filters: F657N H-alpha+[N II] and F502N [O III]. The HST images also show a bipolar structure, but the HST structure is not aligned with the VLA structure. We present preliminary results of this multi-wavelength project.
Nova Aql 1918: A nude old nova
International Nuclear Information System (INIS)
Selvelli, P.L.; Cassatella, A.
1981-01-01
IUE observations at high and low resolution of Nova Aql 1918 show neither evidence of outflow nor the presence of nebular lines. This indicates that the shell ejected at the time of the outburst and surrounding the system for many years (Mustel and Boyarchuck, 1970) has by now disappeared. The high excitation spectrum presents rapid variations in the far UV and eclipse effects in the near UV that seem well correlated with the orbital phase. The observations can be interpreted in terms of phenomena occurring in or near the accretion disk surrounding the white dwarf. However, the small inclination of the orbital axis raises serious problems in trying to model the system. (Auth.)
Tourism Development Plan for Nova Lima, MG/BR: A Case Study
Directory of Open Access Journals (Sweden)
Porto Aluisio Finazzi
2014-01-01
Full Text Available The project called “Tourism Development Plan of Nova Lima, MG” was a labor required by the city of Nova Lima, through the Secretary of Municipal Tourism. The municipality of Nova Lima has numerous tourist attractions or potential for them attractive, and is developing a work of public policies aimed at structuring this activity. The objective of this project was to offer to its population, as well as the government and the private sector, the assurance of quality activity according to the international, national and state the assumptions referred to in the Municipal Tourism Plan. All work was developed by Scientific and Technical Research Data Collection, which took into consideration the participation of local stakeholders in the development of tourism through public hearings with the Section for Local Tourism, making use of Information from the Current Municipal Development Plan for Nova Lima and its Secretary of Tourism. We also note that the study was conducted in accordance with the guidelines and considerations of the Municipal Tourism Council (COMTUR of Nova Lima.
Spectroscopic observations of Nova Cygni 1975: The coronal line region revisited
International Nuclear Information System (INIS)
Ferland, G.J.; Lambert, D.L.; Woodman, J.H.
1986-01-01
A synopsis of the McDonald Observatory spectrophotometric observations of Nova Cyg 1975 (V1500 Cyg) is presented. We present these data in a form in which they can be readily accessed in the future, and also study the continous spectrum during the early nebular phase. We show that (1) the remnant probably maintained a luminosity at or above the Eddington limit for at least a year after outburst, (2) free-free emission from the coronal line region made a significant contribution to the optical continuum, and (3) the coronal line region was probably a significant source of ionizing radiation. The energetics of this nova appear to be dominated by the lift-off energy from the white dwarf and radiation from the coronal line region. Thus the light curve of Nova Cyg may tell more about the cooling of the coronal line region than about the decline of the central object. In appendices we discuss the argon abundance of Nova Cyg (less than 8 times solar) and describe how to obtain copies of the McDonald nova data
UBVJHKLM Photometry and Low-Resolution Spectroscopy of Nova Delphini 2013 (V339 Del
Directory of Open Access Journals (Sweden)
Burlak M. A.
2015-03-01
Full Text Available We present UBVJHKLM photometric observations of Nova Delphini 2013 that started several hours before maximum light and lasted for 130 nights. Using the obtained data, we derived several photometric parameters of the Nova: the time of maximum light, brightness at maximum, rate of decline, t2 = 11 d. This places Nova Del 2013 among fast novae according to the classification introduced by Payne-Gaposchkin. We estimated the interstellar reddening EB−V = 0.18 using maps of Galactic extinction and the absolute brightness in maximum light via the MMRD relation that allowed us to determine the distance D ≈ 2.7 kpc and height above the Galactic plane z ≈ 440 pc. Low-resolution spectroscopy shows that Nova Del 2013 belongs to the Fe II spectral type of novae. The broad emission feature near 6825 Å observed during 2013 August and September may be the Raman-scattered OVI 1032 Å line.
Tracking the NOvA Detectors' Performance
Psihas, Fernanda; NOvA Collaboration
2016-03-01
The NOvA experiment measures long baseline νμ -->νe oscillations in Fermilab's NuMI beam. We employ two detectors equipped with over 10 thousand sets of data-taking electronics; avalanche photo diodes and front end boards which collect and process the scintillation signal from particle interactions within the detectors. These sets of electronics -as well as the systems which power and cool them- must be monitored and maintained at precise working conditions to ensure maximal data-taking uptime, good data quality and a lasting life for our detectors. This poster describes the automated systems used on NOvA to simultaneously monitor our data quality, diagnose hardware issues, track our performance and coordinate maintenance for the detectors.
Nova Scotia Resources Limited annual report, 1992
International Nuclear Information System (INIS)
1992-01-01
Nova Scotia Resources was established in 1981 by the provincial government to invest in and manage Nova Scotia's participation in petroleum, energy, and mineral development. The company and its subsidiaries hold interests in oil and gas discovery areas and producing fields in the Nova Scotia offshore, and owns producing oil and gas interests in western Canada. In June 1992, oil production began from the Cohasset project, representing Canada's first commercial offshore oil production. Nearly 4 million bbl of crude will be sold in the first production season. Work is continuing on additional producing wells; the production life of the Cohasset project is currently estimated at 6 y. Offshore exploration activity is also continuing under four exploration licenses. For the 12 months ending March 31, 1992, net earnings from western oil and gas production were $369,000. Total gross revenues from oil and gas producing properties for the year were ca $4.8 million. Other 1992 activities include active exploration for salt and potash sites with potential for underground storage of natural gas. Financial statements are included. 14 figs., 2 tabs
Directory of Open Access Journals (Sweden)
Carlos Roberto Ferreira Brandão
2008-09-01
Full Text Available The fungus-farming ant genus Mycetagroicus Brandão & Mayhé-Nunes was proposed based on three species from the Brazilian "Cerrado": M. cerradensis, M. triangularis and M. urbanus. Here we describe a new species of Attini ant of the genus Mycetagroicus, M. inflatus n. sp., based on two workers collected in eastern Pará State, Brazil. A new key for species identification, comments on differences among species and new geographical distribution data are furnished.O gênero de formigas cultivadoras de fungos, Mycetagroicus Brandão & Mayhé-Nunes, foi proposto com base em três espécies do Cerrado: M. cerradensis, M. triangularis e M. urbanus. Neste trabalho descrevemos uma nova espécie de Attini do gênero Mycetagroicus, M. inflatus n. sp., baseada em duas operárias coletadas no leste do Pará, Brasil. Apresentamos uma nova chave para a identificação das espécies, comentários sobre as diferenças entre as espécies e novos dados sobre a distribuição geográfica.
Exquisite Nova Light Curves from the Solar Mass Ejection Imager (SMEI)
Hounsell, R.; Bode, M. F.; Hick, P. P.; Buffington, A.; Jackson, B. V.; Clover, J. M.; Shafter, A. W.; Darnley, M. J.; Mawson, N. R.; Steele, I. A.; Evans, A.; Eyres, S. P. S.; O'Brien, T. J.
2010-11-01
We present light curves of three classical novae (CNe; KT Eridani, V598 Puppis, V1280 Scorpii) and one recurrent nova (RS Ophiuchi) derived from data obtained by the Solar Mass Ejection Imager (SMEI) on board the Coriolis satellite. SMEI provides near complete skymap coverage with precision visible-light photometry at 102 minute cadence. The light curves derived from these skymaps offer unprecedented temporal resolution around, and especially before, maximum light, a phase of the eruption normally not covered by ground-based observations. They allow us to explore fundamental parameters of individual objects including the epoch of the initial explosion, the reality and duration of any pre-maximum halt (found in all three fast novae in our sample), the presence of secondary maxima, speed of decline of the initial light curve, plus precise timing of the onset of dust formation (in V1280 Sco) leading to estimation of the bolometric luminosity, white dwarf mass, and object distance. For KT Eri, Liverpool Telescope SkyCamT data confirm important features of the SMEI light curve and overall our results add weight to the proposed similarities of this object to recurrent rather than to CNe. In RS Oph, comparison with hard X-ray data from the 2006 outburst implies that the onset of the outburst coincides with extensive high-velocity mass loss. It is also noted that two of the four novae we have detected (V598 Pup and KT Eri) were only discovered by ground-based observers weeks or months after maximum light, yet these novae reached peak magnitudes of 3.46 and 5.42, respectively. This emphasizes the fact that many bright novae per year are still overlooked, particularly those of the very fast speed class. Coupled with its ability to observe novae in detail even when relatively close to the Sun in the sky, we estimate that as many as five novae per year may be detectable by SMEI.
First Neutrino Oscillation Results from the NOvA experiment
Energy Technology Data Exchange (ETDEWEB)
Sachdev, Kanika [Fermilab
2016-11-29
NOvA is a long-baseline neutrino oscillation experiment on the NuMI muon neutrino beam at Fermilab. It consists of two functionally identical, nearly fully-active liquid-scintillator tracking calorimeters. The Near Detector (ND) at Fermilab is used to study the neutrino beam spectrum and composition before oscillations occur. The Far Detector in northern Minnesota, 810 km away, observes the oscillated beam and is used to extract the oscillation parameters. NOvA is designed to observe oscillations in two channels: disappearance channel ( ν μ → ν μ ) and ν e appearance channel ( ν μ → ν e ). This paper reports the measurements of both these channels based on the first NOvA data taken from February 16, 2014 till May 15, 2015
Spectrophotometry of nova Cygni 1975
International Nuclear Information System (INIS)
Panek, R.J.
1977-01-01
Low-resolution spectrophotometry of nova Cygni 1975 is presented for eight nights in September 1975. Representative spectrum scans from 3600 A to 4500 A (10 A bandpass) and from 6350 A to 6750 A (20 A bandpass) also are shown
Energy Technology Data Exchange (ETDEWEB)
Hoffman, G. [Nova Scotia Petroleum Directorate, Halifax, NS (Canada)
1998-09-01
Opportunities for the local distribution of natural gas in Nova Scotia were reviewed, with special emphasis on franchising. Franchising in Nova Scotia began in 1980, made possible by the passage of the Gas Utilities Act and the Pipeline Act which promised western Canadian natural gas to eastern Canada. However, proposals for franchisees to distribute natural gas in the province were abandoned as the hope for natural gas transmission service to the province faded. The plummeting of world oil prices by the mid-1980s was also a contributory factor. Discovery and development of natural gas facilities around Sable Island led to the September 1997 proclamation of the Gas Distribution Act, which also led to the revival of interest in franchising. The Act provides for the competitive marketing of natural gas as a commodity and the regulation of the gas delivery system under a franchise agreement. Competitive applications are expected early in 1998, with awards of franchises in late 1998. Construction and gas delivery services should begin operations late in 1999.
International Nuclear Information System (INIS)
Hoffman, G.
1998-01-01
Opportunities for the local distribution of natural gas in Nova Scotia were reviewed, with special emphasis on franchising. Franchising in Nova Scotia began in 1980, made possible by the passage of the Gas Utilities Act and the Pipeline Act which promised western Canadian natural gas to eastern Canada. However, proposals for franchisees to distribute natural gas in the province were abandoned as the hope for natural gas transmission service to the province faded. The plummeting of world oil prices by the mid-1980s was also a contributory factor. Discovery and development of natural gas facilities around Sable Island led to the September 1997 proclamation of the Gas Distribution Act, which also led to the revival of interest in franchising. The Act provides for the competitive marketing of natural gas as a commodity and the regulation of the gas delivery system under a franchise agreement. Competitive applications are expected early in 1998, with awards of franchises in late 1998. Construction and gas delivery services should begin operations late in 1999
Optical and Near-infrared Study of Nova V2676 Oph 2012
Energy Technology Data Exchange (ETDEWEB)
Raj, A. [Korea Astronomy and Space Science Institute, Daejeon, 34055 (Korea, Republic of); Das, R. K. [Department of Astrophysics and Cosmology, S N Bose National Centre for Basic Sciences, Salt Lake, Kolkata 700106 (India); Walter, F. M., E-mail: ashish.raj@iiap.res.in [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794-3800 (United States)
2017-02-01
We present optical spectrophotometric and near-infrared (NIR) photometric observations of the nova V2676 Oph covering the period from 2012 March 29 through 2015 May 8. The optical spectra and photometry of the nova have been taken from SMARTS and Asiago; the NIR photometry was obtained from SMARTS and Mt. Abu. The spectra were dominated by strong H i lines from the Balmer series, Fe ii, N i, and [O i] lines in the initial days, typical of an Fe ii type nova. The measured FWHM for the H β and H α lines was 800–1200 km s{sup −1}. There was pronounced dust formation starting 90 days after the outburst. The J − K color was the largest among recent dust-forming novae.
Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří
2016-04-12
Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.
Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence
Tawani, Arpita; Kumar, Amit
2015-01-01
Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543
5. Neuromarketing: uma nova disciplina acadêmica?
Eric David Cohen; Gabriela Guimarães Lima; Peter Alexander Bleinroth Schulz
2017-01-01
Através da aplicação de técnicas neurocientíficas, o Neuromarketing busca entender como ocorrem os processos de decisão de compra. Verifica-se que há um grande movimento em torno do Neuromarketing no ambiente empresarial, apontando que o desenvolvimento desta nova área de conhecimento, bem como a sua possível autonomia, estão em desenvolvimento. Por meio de um estudo exploratório, mapeou-se a construção deste campo de conhecimento no tempo, levando à formação de uma possível nova disciplina c...
New studies of nuclear decay γ-rays from novae
International Nuclear Information System (INIS)
Starrfield, S.; Truran, J.W.; Wiescher, M.C.; Sparks, W.M.
1997-01-01
The cause of the nova outburst is a thermonuclear runaway (TNR) in hydrogen rich material transferred by a companion onto a white dwarf. Studies of this phenomenon have shown that the TNR produces large concentrations of the short lived positron unstable isotopes of the CNO nuclei which are transported to the surface by convection so that early in the outburst we expect significant numbers of radioactive decays to occur at the surface. The resulting γ-ray emission may be detectable from nearby novae early in their outbursts. The TNR is also expected to produce substantial amounts of 7 Be and 22 Na. Their decays also yield potentially detectable levels of γ-ray emission for relatively nearby novae. We are also interested in the role played by novae in the production of the ∼2M circle-dot of 26 Al found in the galaxy. In order to improve our predictions of this phenomenon, we have performed a new set of calculations of TNR close-quote s on ONeMg and CO white dwarfs with an updated nuclear reaction network and opacities. copyright 1997 American Institute of Physics
Hohlraum drive and implosion experiments on Nova. Revision 1
International Nuclear Information System (INIS)
Kilkenny, J.D.; Suter, L.J.; Cable, M.D.
1994-01-01
Experiments on Nova have demonstrated hohlraum radiation temperatures up to 300 eV and in lower temperature experiments reproducible time integrated symmetry to 1--2%. Detailed 2-D LASNEX simulations satisfactorily reproduce Nova's drive and symmetry scaling data bases. Hohlraums has been used for implosion experiments achieving convergence ratios (initial capsule radius/final fuel radius) up to 24 with high density glass surrounding a hot gas fill
Infrared and optical observations of Nova Mus 1983
International Nuclear Information System (INIS)
Whitelock, P.A.; Carter, B.S.; Feast, M.W.; Glass, I.S.; Laney, D.; Menzies, J.W.
1984-01-01
Extensive optical (UBVRI) and infrared (JHKL) photometry of Nova Mus 1983 obtained over a period of 300 days is tabulated. Infrared and optical spectra are described. Although by classical definition this was a fast nova its later development was slower than for typical objects of this class. Surprisingly the development of infrared thermal dust emission did not occur. Throughout the period covered, the infrared emission was characteristic of a bound-free plus free-free plasma continuum with emission lines. (author)
Preliminary performance and ICF target experiments with Nova
International Nuclear Information System (INIS)
Drake, R.P.
1985-11-01
In December 1984, the Nova facility fired all ten laser arms, converted the output 1.05 micron energy to 0.35 micron light, and focused the 0.35 micron light through a 4 mm pinhole in the ten-beam target chamber. Since that time, a two-beam target chamber has been added, the performance of the laser evaluated, and preparation has been made for target experiments. This paper summarizes the performance of Nova and describes progress and plans for target experiments
SALT high-resolution spectroscopy of nova PNV J15384000-4744500
Aydi, E.; Buckley, D. A. H.; Mohamed, S.; Whitelock, P. A.
2018-06-01
We report on high-resolution spectroscopy of PNV J15384000-4744500 which was reported as a possible nova by Rob Kaufman (Bright, Victoria, Australia; CBAT follow-up: http://www.cbat.eps.harvard.edu/unconf/followups/J15384000-4744500.html) and confirmed as a classical nova by F. Walter (ATel #11681).
2017-01-01
We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322
Statistical analysis of dwarf nova outbursts
International Nuclear Information System (INIS)
Gicger, A.
1987-01-01
Correlation between maximum brightness, outburst width, lengths of preceding and following intervals has been studied for 14 dwarf novae (mostly from southern sky). Significant correlations (ρ ≥ 0.4) occur only in 16 per cent of cases, what confirms earlier results of Szkody and Mattei (1984). Global correlations have also been studied between mean photometric parameters and binary system parameters using a sample including over 30 objects. The most interesting result is the strong correlation (ρ = +0.94) between the orbital period and the outburst duration. It implies that the quantity α(z 0 /r) 2 is approximately constant for all dwarf novae. Using typical estimates for z 0 /r we get α = 0.2. 30 refs., 1 figs., 2 tabs. (author)
Neutrino Oscillation Results from NOvA
CERN. Geneva
2016-01-01
NOvA is an accelerator long-baseline neutrino oscillation experiment optimised to measure electron neutrino appearance in a high-purity beam of muon neutrinos from Fermilab. The exciting discovery of the theta13 neutrino mixing angle in 2012 has opened a door to making multiple new measurements of neutrinos. These include leptonic CP violation, the neutrino mass ordering and the octant of theta23. NOvA with its 810km baseline and higher energy beam has about triple the matter effect of T2K which opens a new window on the neutrino mass ordering. With about 20% of our design beam exposure and significant analysis improvements we have recently released updated results. I will present both our disappearance and appearance measurements.
Experimental study of the 22Ne(p,γ)23Na reaction and its implications for novae scenarios
International Nuclear Information System (INIS)
Menzel, Marie-Luise
2013-01-01
The 22 Ne(p,γ) 23 Na reaction belongs to the catalytic neon-sodium cycle and has an important role in the explosive hydrogen burning. The neon-sodium cycle takes place at temperatures of T = 0.1 - 0.5 GK and is assumed to occur in different astrophysical systems: e.g. in novae, in super novae of type Ia and during the shell-burning of red giant branch stars. The implications of 22 Ne(p,γ) 23 Na and the neon-sodium cycle in a nova scenario have been studied by using the nuclear network code libnucnet at GSI in Darmstadt. A nova is an outburst of matter in a binary system consisting of a white dwarf and a red giant star. It is therefore a representative phenomenon for explosive hydrogen burning. For the calculation of the nucleosynthesis during the nova outburst, the code libnucnet requires the initial mass composition of the novae partners, the temperature and density profiles of the nova explosion and the thermonuclear reaction rates of the participating reactions. In the following, the code determined the flow and the final atomic abundance in the neon-sodium cycle during the entire nova process. Additionally, the influence of the temperature profile of the novae outburst as well as the thermonuclear reaction rate of the 22 Ne(p,γ) 23 Na reaction on the final atomic abundance in the outburst has been studied. A characteristic measure for the reactions in astrophysical environments is the thermonuclear reaction rate. The reaction rate of 22 Ne(p,γ) 23 Na has still strong uncertainties in the temperature range of T = 0.03 - 0.3 GK. These uncertainties are based on insufficient upper limits of the resonance strengths as well as the possible existence of tentative states that are populated in the energy range of E lab p = 30 - 300 keV. The research presented in this thesis is dedicated to the experimental study of the 22 Ne(p,γ) 23 Na reaction for an improved determination of the thermonuclear reaction rate. Furthermore, the implications of 22 Ne(p,γ) 23 Na and
Effect of Undiagnosed Deep Adenomyosis After Failed NovaSure Endometrial Ablation
Mengerink, B.B.; Wurff, A.A. van der; Haar, J.F. ter; Rooij, I.A.L.M. van; Pijnenborg, J.M.
2015-01-01
STUDY OBJECTIVE: To determine the prevalence of adenomyosis and deep adenomyosis after NovaSure (Hologic Inc., Newark, DE) endometrial ablation in hysterectomy specimens after NovaSure endometrial ablation failure. DESIGN: Prospective observational study (Canadian Task Force classification II-2).
Ten-year literature review of global endometrial ablation with the NovaSure® device
Directory of Open Access Journals (Sweden)
Gimpelson RJ
2014-03-01
Full Text Available Richard J Gimpelson Mercy Clinic, Minimally Invasive Gynecology, Department of Obstetrics and Gynecology, Mercy Hospital St Louis, St Louis, MO, USA Abstract: This review examines the peer-reviewed literature describing prospective studies that report amenorrhea rates, patient satisfaction, and surgical reintervention rates following the NovaSure® endometrial ablation procedure. A search of the English-language literature published from 2000 to 2011 was conducted using PubMed. Ten prospective studies, six single-arm NovaSure trials, and four randomized controlled trials comparing the NovaSure procedure with other global endometrial ablation modalities met the inclusion criteria and were reviewed. The follow-up periods ranged from 6 to 60 months. Amenorrhea rates for the NovaSure procedure ranged from 30.0% to 75.0%. Patients who reported being satisfied with the NovaSure procedure ranged from 85.0% to 94.0%. In randomized controlled trials with other global endometrial ablation modalities, amenorrhea rates at 12 months with the NovaSure procedure ranged from 43.0% to 56.0%, while other modalities ranged from 8% to 24%. In addition, this manuscript reviews the following: the NovaSure technology; use of the NovaSure procedure in the office setting; intraoperative and postoperative pain; effects on premenstrual syndrome (PMS; dysmenorrhea; special circumstances, including presence of uterine disease, history of cesarean delivery, coagulopathy, or use of anticoagulant medication; post-procedure uterine cavity assessment and cancer risk; contraception and pregnancy; and safety. Keywords: abnormal uterine bleeding, menorrhagia, endometrial ablation, NovaSure®
Quasi-periodic luminosity variations in dwarf novae
International Nuclear Information System (INIS)
Robinson, E.L.; Nather, R.E.
1979-01-01
We have identified quasi-periodic oscillations in the light curves of five dwarf novae--U Gem, SS Cyg, RU Peg, KT Per, and VW Hyi-- and in the light curve of the quasi-periodic X-ray source Sco X-1. The mean periods of the quasi-periodic oscillations range from 32 s in SS Cyg to 147 s in KT Per and 165 s in Sco X-l. Their amplitudes are typically 0.005--0.0l mag. The properties of the quasi-periodic oscillations are represented well by a second-order autoregressive process. Use of this representation shows that the length of time over which the quasi-periodic oscillations maintain coherence is very short, typically 3--5 cycles of the oscillations. Thus the quasi-periodic oscillations can be distinguished from the short-period coherent oscillations in dwarf novae, which are usually interpreted as white dwarf pulsations, because t the periods of the quasi-periodic oscillations are 3--4 times longer and their coherence time is much shorter. The quasi-periodic oscillations occur in dwarf novae only during their eruptions and occur in Sco X-l only when the system is bright. The presence of the oscillations does not depend on the subclass to which a dwarf nova belongs or on the morphology of the individual eruptions. We argue that their short periods, their short coherence times, and their presence in Sco X-l require that the quasi-periodic oscillations be produced by the accretion disk, and not by the stars or by the boundary between the a accretion disk and its central star
Hot spot manifestation in eclipsing dwarf nova HT Cassiopeiae
Bakowska, K.; Olech, A.
2014-01-01
We report the detection of the hot spot in light curves of the eclipsing dwarf nova HT Cassiopeiae during its superoutburst in 2010 November. Analysis of eight reconstructed light curves of the hot spot eclipses showed directly that the brightness of the hot spot was changing significantly during the superoutburst. Thereby, detected hot spot manifestation in HT Cas is the newest observational evidence for the EMT model for dwarf novae.
Multi-wavelength observations of novae in outburst
International Nuclear Information System (INIS)
Starrfield, S.; Arizona State Univ., Tempe, AZ
1989-01-01
This review serves as the introduction to the observational studies of novae and I will mention a number of results that will be emphasized by other reviewers. Therefore, I will try to provide the physical framework for multi-wavelength observations as applied to studies of novae. I divide the outburst into phases based on the physical effects that are occurring at that time. The first phase is the rise to bolometric maximum and occurs on a convective time scale. The second phase is the rise to visual maximum and occurs on the time scale for the envelope to expand to ∼10 12 cm. The third phase is the time when the nova is emitting at constant bolometric luminosity, but declining optical magnitude, and it lasts until most of the accreted material has been either exhausted or eroded from the surface of the white dwarf. The fourth and final phase is the return is the return to quiescence (turn-off phase) and it occurs at the time that nuclear burning is ending. I will discuss each of these phases in turn and end with a discussion. 36 refs
Dynamic testing of NOVA laser switchyard tower
International Nuclear Information System (INIS)
Weaver, H.J.; Pastrnak, J.W.; Fields, D.E.
1984-01-01
NOVA is the latest in a series of powerful laser systems designed to study the feasibility of initiating a controlled fusion reaction by concentrating several laser beams on a small fuel target. The laser components, turning mirrors and target chamber are all mounted on large steel frame structures. These structures were first analyzed via finite element models to access their seismic integrity as well as their overall vibrational stability. When construction was completed, a modal analysis was performed on the structures to verify and improve the finite element models. This report discusses the linking of the analytical and experimental studies for the NOVA switchyard tower structure
Terra Nova breaks new ground for alliances
International Nuclear Information System (INIS)
Ghiselin, D.
1996-01-01
This paper reviews the development of alliances to help develop the Terra Nova oil and gas field in the offshore Atlantic areas of Canada. Largely attributed to BP, the strategic alliance concept got its start in the North Sea and on the North Slope of Alaska. BP saw it as the best way to take advantage of economy-of-scale, mitigate risk, and achieve outsourcing goals while retaining their core competencies. This paper reviews the methods of developing the alliances, the developing of a development plan for the Terra Nova field, and how the alliance plans to maximize the profittability of the operation for all involved
Discovery of a Probable Nova in M81 and Photometry of Three M81 Novae
Hornoch, K.; Errmann, R.; Carlisle, Ch.; Vaduvescu, O.
2015-02-01
We report the discovery of a probable nova in M81 on a co-added 1600-s narrow-band H-alpha CCD image taken with the 2.5-m Isaac Newton Telescope (INT) + WFC at La Palma under ~1.6" seeing on 2015 Jan.
SWSex Stars, Old Novae, and the Evolution of Cataclysmic Variables
Directory of Open Access Journals (Sweden)
L. Schmidtobreick
2015-02-01
Full Text Available The population of cataclysmic variables with orbital periods right above the period gap are dominated by systems with extremely high mass transfer rates, the so-called SW Sextantis stars. On the other hand, some old novae in this period range which are expected to show high mass transfer rate instead show photometric and/or spectroscopic resemblance to low mass transfer systems like dwarf novae. We discuss them as candidates for so-called hibernating systems, CVs that changed their mass transfer behaviour due to a previously experienced nova outburst. This paper is designed to provide input for further research and discussion as the results as such are still very preliminary.
a Synoptic Study of AN X-Ray Nova in Outburst
McClintock, Jeffrey
Optical studies of X-ray novae in quiescence have yielded compelling evidence for black holes in binary systems. However, X-ray studies in quiescence are severely constrained by the near absence of high energy emission. Thus, further observational advances in black hole astrophysics require a substantial commitment to observe X-ray novae in outburst in just that spectral range accessible to XTE. We propose an agressive campaign of X-ray observations of the next non-pulsing X-ray nova that rises above 3 Crab at 2-10 keV. We further propose a coordinated and intensive campaign of optical and radio observations covering both hemispheres. The observations will provide a full temporal and spectral view of the outburst cycle.
Status for CASA NOVA konsortiet
DEFF Research Database (Denmark)
Bonke, Sten
1997-01-01
The report reviews the development projects and the results hitherto achieved by the design and build organisation CASA NOVA which is one of four consortia within the R&D programme "Process and Product Development in Building", financed by the Ministry of Industry and the Ministry of Housing....
Non-LTE model atmosphere analysis of Nova Cygni 1992
Hauschildt, P. H.; Starrfield, S.; Austin, S.; Wagner, R. M.; Shore, S. N.; Sonneborn, G.
1994-01-01
We use spherically symmetric non-local thermodynamic equilibrium (non-LTE), line-blanketed, expanding model atmospheres to analyze the International Ultraviolet Explorer (IUE) and optical spectra of Nova Cygni 1992 during the early phases of its outburst. We find that the first IUE spectrum obtained just after discovery on 1992 February 20, is best reproduced by a model atmosphere with a steep density gradient and homologous expansion, whereas the IUE and optical spectra obtained on February 24 show an extended, optically thick, wind structure. Therefore, we distinguish two phases of the early evolution of the nova photosphere: the initial, rapid, 'fireball' phase and the subsequent, much longer, optically thick 'wind' phase. The importance of line-blanketing in nova spectra is demonstrated. Our preliminary abundance analysis implies that hydrogen is depeleted in the ejecta, corresponding to abundance enhancements of Fe by a factor of approximately 2 and of CNO by more than a factor of 10 when compared to solar abundances. The synthetic spectra reproduce both the observed pseudo-continua as well as most of the observed features from the UV to the optical spectral range and demonstrate the importance of obtaining nearly simultaneous UV and optical spectra for performing accurate analyses of expanding stellar atmospheres (for both novae and supernovae).
Joshi, Vishal; Banerjee, D. P. K.; Srivastava, Mudit
2017-12-01
We present a series of near-infrared spectra of Nova Ophiuchus 2017 in the K band that record the evolution of the first overtone CO emission in unprecedented detail. Starting from 11.7 days after maximum, when CO is first detected at great strength, the spectra track the CO emission to +25.6 days by which time it is found to have rapidly declined in strength by almost a factor of ∼35. The cause for the rapid destruction of CO is examined in the framework of different mechanisms for CO destruction, namely, an increase in photoionizating flux, chemical pathways of destruction, or destruction by energetic nonthermal particles created in shocks. From LTE modeling of the CO emission, the 12C/13C ratio is determined to be 1.6 ± 0.3. This is consistent with the expected value of this parameter from nucleosynthesis theory for a nova eruption occuring on a low mass (∼ 0.6 {M}ȯ ) carbon–oxygen core white dwarf. The present 12C/13C estimate constitutes one of the most secure estimates of this ratio in a classical nova.
Soft x-ray emission from classical novae in outburst
International Nuclear Information System (INIS)
Starrfield, S.; Krautter, J.; MacDonald, J.
1989-01-01
Theoretical modeling of novae in outburst predicts that they should be active emitters of radiation at soft x-ray wavelengths twice during their outburst. The first time occurs very early in the outburst when only a very sensitive all sky survey will be able to detect them. This period lasts only a few hours for the very fastest novae. They again become bright in x-rays late in the outburst when the remnant object becomes very hot and is still luminous. Both simulations and observations show that novae can remain very hot for months to years. It is important to observe them at these late times because a measurement both of the flux and temperature can provide information about the mass of the white dwarf, the turn-off time scale, and the energy budget of the outburst. 8 refs., 2 figs
A multiwavelength study of superoutbursts in dwarf novae
International Nuclear Information System (INIS)
Woerd, H.J. van der.
1987-01-01
Dwarf novae are stellar systems consisting of two stars which orbit around each other within a few hours. In dwarf novae one of the stars, which is a bit smaller and less massive than our sun, loses matter to a very compact and degenerated star: a white dwarf. This white dwarf has nearly the same mass as our sun but its radius is about a hundred times smaller. The process of mass transport was studied on the basis of observations with the Exosat-satelite (European X-ray Observatory satelite). 397 refs.; 50 figs.; 21 tabs
On the late-type components of slow novae and symbiotic stars
International Nuclear Information System (INIS)
Allen, D.A.
1980-01-01
It is argued that the various types of symbiotic stars and the slow novae are the same phenomena exhibiting a range of associated time-scales, the slow novae being of intermediate speed. Evidence is summarized showing that both types of object contain normal M giants or mira variables. This fact is at odds with currently fashionable single-star models for slow novae, according to which the M star is totally disrupted before the outburst. Spectral types of the late-type components are presented for nearly 80 symbiotic stars and slow novae, derived from 2 μm spectroscopy. It is found that both the intensity of the emission spectrum and the electron density of the gas are functions of the spectral type of the late-type star. Explanations for these correlations are given. On the assumption that the late-type components are normal giants, spectroscopic parallaxes are determined; credible distances are derived which indicate that the known symbiotic stars have been sampled as far afield as the Galactic Centre. Hydrogen shell flashes on a white dwarf accreting gas from the late-type components offer an attractive explanation of the phenomena of slow novae and symbiotic stars, and such models are discussed in the concluding section. (author)
An Emerging Wine Region in Nova Scotia, Canada: Terroir Trials and Tribulations
Cameron, B. I.; Ketter, B. S.; Karakis, S.
2012-12-01
Nova Scotia, strategically located on Canada's east coast, is an emerging wine region, whose distinctive wines are garnering international acclaim. Nova Scotia has a long and rich tradition of growing grapes for wine dating back as far as 1611. Nova Scotia's mesoclimates, glacial soils, and proximity to the Atlantic Ocean form a complex alliance to create a unique and expressive terroir. Tidal Bay is a new appellation wine for Nova Scotia stylistically defined as a fresh, crisp and high-acid blend of white grapes. There are four main wine-growing regions in Nova Scotia, all influenced by the warming effects of the Bay of Fundy and Atlantic Ocean: Malagash Peninsula, Annapolis Valley, Bear River Valley and the South Shore. Nova Scotia currently has 14 producing wineries with many more in the development stage. Nova Scotia grape growers not only have had success developing mature and consistent hybrids, but in recent years several vinifera have flourished in this cool climate area. The white hybrids include L'Acadie Blanc, New York Muscat, Seyval Blanc, and Vidal Blanc. The white vinifera include chardonnay, riesling, pinot gris, and sauvignon blanc. Red hybrids are Baco Noir, Leon Millet, Lucie Kuhlmann, and Marechal Foch, whereas the only red vinifera is pinot noir. Nova Scotia has nearly perfect climatic conditions for making world class icewines and sparkling wines. A preliminary GIS analysis of climate, topographic, geology and soil data helps to define Nova Scotia's terroir. Annual precipiatation varies from 10 to 21.6 cm/year with a vast majority of the wineries located in regions with the lowest rainfall. Daily average temperature ranges from 5.5 to 7.5°C, degree growing days above 5°C from 1382 to 1991, and mean August temperature from 15.6 to 19.3 °C. Wineries cluster in the warmest regions based on these temperature measures to assist grape ripening. Soils in these diverse wine regions can range from silty, sandy and clay loams to more gravel-rich sandy
ASASSN-18gb: Discovery of A Probable Nova in NGC 3109
Brimacombe, J.; Vallely, P.; Stanek, K. Z.; Kochanek, C. S.; Brown, J. S.; Shields, J.; Thompson, T. A.; Shappee, B. J.; Holoien, T. W.-S.; Prieto, J. L.; Bersier, D.; Dong, Subo; Bose, S.; Chen, Ping; Stritzinger, M.; Holmbo, S.
2018-03-01
During the ongoing All Sky Automated Survey for SuperNovae (ASAS-SN, Shappee et al. 2014), using data from the quadruple 14-cm "Payne-Gaposchkin" telescope in Sutherland, South Africa, we discovered a new transient source, most likely a nova, in the Local Group galaxy NGC 3109.
Novas ocorrências de Erwinia carotovora subsp. carotovora e de E. chrysanthemi
Directory of Open Access Journals (Sweden)
Irene M. G. Almeida
1997-05-01
Full Text Available Em continuidade a trabalhos de caracterização de bactérias pectinolíticas do gênero Eruia ocorrendo no Brasil, são relacionadas novas ocorrências dessas fitobactérias em plantios comerciais, que ocasionam podridão mole em cinco espécies de plantas ornamentais. Testes bioquímicas, fisiológicos, culturais e de patogenicidade permitiram comprovar a ocorrência de Erwinia carotovora subsp. carotovora em plantas de afelandra, amarílis e copo-de-leite, e de Erwiniachr santhemiemcordilineekalanchoe.
Zeng, Xiaojun; Zhang, Liyun; Xiao, Xiuchan; Jiang, Yuanyuan; Guo, Yanzhi; Yu, Xinyan; Pu, Xuemei; Li, Menglong
2016-04-05
Thrombin-binding aptamer (TBA) with the sequence 5'GGTTGGTGTGGTTGG3' could fold into G-quadruplex, which correlates with functionally important genomic regionsis. However, unfolding mechanism involved in the structural stability of G-quadruplex has not been satisfactorily elucidated on experiments so far. Herein, we studied the unfolding pathway of TBA by a combination of molecular dynamics simulation (MD) and Markov State Model (MSM). Our results revealed that the unfolding of TBA is not a simple two-state process but proceeds along multiple pathways with multistate intermediates. One high flux confirms some observations from NMR experiment. Another high flux exhibits a different and simpler unfolding pathway with less intermediates. Two important intermediate states were identified. One is similar to the G-triplex reported in the folding of G-quadruplex, but lack of H-bonding between guanines in the upper plane. More importantly, another intermediate state acting as a connector to link the folding region and the unfolding one, was the first time identified, which exhibits higher population and stability than the G-triplex-like intermediate. These results will provide valuable information for extending our understanding the folding landscape of G-quadruplex formation.
Polarimetry and spectroscopy of the "oxygen flaring" DQ Herculis-like nova: V5668 Sagittarii (2015)
Harvey, E. J.; Redman, M. P.; Darnley, M. J.; Williams, S. C.; Berdyugin, A.; Piirola, V. E.; Fitzgerald, K. P.; O'Connor, E. G. P.
2018-03-01
Context. Classical novae are eruptions on the surface of a white dwarf in a binary system. The material ejected from the white dwarf surface generally forms an axisymmetric shell of gas and dust around the system. The three-dimensional structure of these shells is difficult to untangle when viewed on the plane of the sky. In this work a geometrical model is developed to explain new observations of the 2015 nova V5668 Sagittarii. Aim. We aim to better understand the early evolution of classical nova shells in the context of the relationship between polarisation, photometry, and spectroscopy in the optical regime. To understand the ionisation structure in terms of the nova shell morphology and estimate the emission distribution directly following the light curve's dust-dip. Methods: High-cadence optical polarimetry and spectroscopy observations of a nova are presented. The ejecta is modelled in terms of morpho-kinematics and photoionisation structure. Results: Initially observational results are presented, including broadband polarimetry and spectroscopy of V5668 Sgr nova during eruption. Variability over these observations provides clues towards the evolving structure of the nova shell. The position angle of the shell is derived from polarimetry, which is attributed to scattering from small dust grains. Shocks in the nova outflow are suggested in the photometry and the effect of these on the nova shell are illustrated with various physical diagnostics. Changes in density and temperature as the super soft source phase of the nova began are discussed. Gas densities are found to be of the order of 109 cm-3 for the nova in its auroral phase. The blackbody temperature of the central stellar system is estimated to be around 2.2 × 105 K at times coincident with the super soft source turn-on. It was found that the blend around 4640 Å commonly called "nitrogen flaring" is more naturally explained as flaring of the O II multiplet (V1) from 4638-4696 Å, i.e. "oxygen flaring
Directory of Open Access Journals (Sweden)
Camila Marques Viana Silva
2013-06-01
Full Text Available Este estudo se refere à análise da experiência de mulheres que buscam, por meio da Associação de Mulheres do Projeto de Assentamento Nova Lagoa Rica (Ampal, no município de Paracatu (MG, um protagonismo no espaço produtivo da agricultura familiar, e de como a questão de gênero se insere no processo de construção territorial desse assentamento, procurando iluminar algumas dimensões da vida comunitária. A pesquisa foi realizada em 2006 e se apoiou na perspectiva técnico-metodológica da Antropologia, que tem como linhas condutoras a exigência do trabalho de campo e o estudo de caso. Os resultados revelam que as práticas que resultam na assimetria das relações entre homens e mulheres continuam sendo reproduzidas no âmbito da agricultura familiar, o que não contribui para a diminuição das desigualdades no campo. Porém, revelam que há um movimento de recusa por parte das agricultoras que, por meio da ação coletiva, têm dado início a um processo emancipatório que as levam a tomar consciência de suas próprias necessidades. Essa análise ainda permite que sejam tecidas algumas considerações a respeito das políticas públicas de apoio à agricultura familiar com recorte de gênero.
Upgrade of the LLNL Nova laser for inertial confinement fusion
International Nuclear Information System (INIS)
Murray, J.R.; Trenholme, J.B.; Hunt, J.T.; Frank, D.N.; Lowdermilk, W.H.; Storm, E.
1991-01-01
The Lawrence Livermore National Laboratory has proposed to construct an upgrade to the Nova glass laser facility to give an output energy of 1.5-2 megajoules at 350 nanometers wavelength in a nominally 3--5 nanosecond shaped pulse. The Nova Upgrade will be suitable for driving inertial fusion targets to ignition. This paper reviews the design proposed for the laser. 14 refs., 10 figs., 1 tab
High-resolution AFM structure of DNA G-wires in aqueous solution.
Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân
2018-05-17
We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.
Optical polarimetry and distance estimate for Nova Cygni 1975
Energy Technology Data Exchange (ETDEWEB)
McLean, I S [Glasgow Univ. (UK). Observatory
1976-07-01
Polarization observations of Nova Cygni 1975 were obtained with several passbands in the wavelength interval lambda lambda 4600 to 6700 A before and after maximum light. Special attention was given to the regions of H..cap alpha.. and H..beta.. emission. On average, a precision of +- 0.04 per cent polarization was obtained in these observations. Statistically significant evidence for the presence of an intrinsically-polarized component in the light from the nova is very weak, but such a component is not completely ruled out. Any variability, however, is likely to be less than 0.18 per cent polarization. The observed polarization (1.38 per cent at lambda 5460), is therefore attributed mainly to scattering in the interstellar medium and the amount of polarization is employed to give a rough estimate of the distance of the nova and its absolute magnitude at maximum brightness, namely 1.14 kpc and -10sup(m).1.
International Nuclear Information System (INIS)
Kenyon, S.J.; Truran, J.W.
1983-01-01
We discuss possible conditions under which thermonuclear burning episodes in the hydrogen-rich envelopes of accreting white dwarfs give rise to outbursts similar in nature to those observed in the symbiotic stars AG Peg, RT Ser, RR Tel, AS 239, V1016 Cyg, V1329 Cyg, and HM Sge. In principle, thermonuclear runaways involving low-luminosity white dwarfs accreting matter at low rates produce configurations that evolve into A--F supergiants at maximum visual light and which resemble the outbursts of RR Tel, RT Ser, and AG peg. Very weak, nondegenerage hydrogen shell flashes on white dwarfs accreting matter at high rates (M> or approx. =10 -8 M/sub sun/ yr -1 ) do not produce cool supergiants at maximum, and may explain the outbursts in V1016 Cyg, V1329 Cyg, and HM Sge. The low accretion rates demanded for systems developing strong hydrogen shell flashes on low-luminsoity white dwarfs are not compatible with observations of ''normal'' quiescent symbiotic stars. The extremely slow outbursts of symbiotic novae appear to be typical of accreting white dwarfs in wide binaries, which suggests that the outbursts of classical novae may be accelerated by the interaction of the expanding white dwarf envelope with its close binary companion
NuSTAR Observations of Fermi-detected Novae, V339 Delphini and V5668 Sagitarii
Mukai, K.; Nelson, T.; Sokoloski, J.; Chomiuk, L.; Finzell, T.; Linford, J.; Weston, J.; Rupen, M.; Mioduszewski, A.
2017-10-01
Ten Galactic novae have been detected as transient GeV gamma-ray sources with Fermi/LAT to date, presumably due to shock acceleration that produces relativistic particles. This unexpected discovery highlights the complexity of the mass ejection process in novae. It has also added a new class of objects in which particle acceleration can be studied. We can in principle study the same shock in X-rays through their thermal emission and the lower energy extension of the non-thermal emission. Here we present our NuSTAR observations of two Fermi-detected novae, V339 Del and V5668 Sgr, that were carried out while they were being detected with the LAT. We did not detect thermal or non-thermal emissions from these novae. Our results place a tight limit on the properties of the putative shocks in V339 Del and V5668 Sgr. We also compare our results with previous reports of possible detection of non-thermal hard X-rays from novae, and discuss the implications in the context of our current understanding of the complicated process of mass ejection in novae.
High Energy Neutrino Physics with NOvA
Energy Technology Data Exchange (ETDEWEB)
Coan, Thomas [Southern Methodist Univ. , Dallas, TX (United States)
2016-09-09
Knowledge of the position of energy deposition in “hit” detector cells of the NOvA neutrino detector is required by algorithms for pattern reconstruction and particle identification necessary to interpret the raw data. To increase the accuracy of this process, the majority of NOvA's 350 000 far detector cell shapes, including distortions, were measured as they were constructed. Using a special laser scanning system installed at the site of the NOvA far detector in Ash River, MN, we completed algorithmic development and measured shape parameters for the far detector. The algorithm and the measurements are “published” in NOνA’s document database (doc #10389, “Cell Center Finder for the NOνA Far Detector Modules”).
NOVA[R] Spring 2002 Teacher's Guide.
Armstrong, Peter; Ransick, Kristi; Rosene, Dale; Sammons, James
The guide presents lesson plans from "NOVA" which targets middle school and junior high school students and meet the National Science Education Standards. Lessons include: (1) "Neanderthals on Trial"; (2) "Fireworks"; (3) "Secrets, Lies and Atomic Spies"; (4) "Bioterror"; (5) "The Missing…
Energy Technology Data Exchange (ETDEWEB)
Menzel, Marie-Luise
2013-08-01
The {sup 22}Ne(p,{gamma}){sup 23}Na reaction belongs to the catalytic neon-sodium cycle and has an important role in the explosive hydrogen burning. The neon-sodium cycle takes place at temperatures of T = 0.1 - 0.5 GK and is assumed to occur in different astrophysical systems: e.g. in novae, in super novae of type Ia and during the shell-burning of red giant branch stars. The implications of {sup 22}Ne(p,{gamma}){sup 23}Na and the neon-sodium cycle in a nova scenario have been studied by using the nuclear network code libnucnet at GSI in Darmstadt. A nova is an outburst of matter in a binary system consisting of a white dwarf and a red giant star. It is therefore a representative phenomenon for explosive hydrogen burning. For the calculation of the nucleosynthesis during the nova outburst, the code libnucnet requires the initial mass composition of the novae partners, the temperature and density profiles of the nova explosion and the thermonuclear reaction rates of the participating reactions. In the following, the code determined the flow and the final atomic abundance in the neon-sodium cycle during the entire nova process. Additionally, the influence of the temperature profile of the novae outburst as well as the thermonuclear reaction rate of the {sup 22}Ne(p,{gamma}){sup 23}Na reaction on the final atomic abundance in the outburst has been studied. A characteristic measure for the reactions in astrophysical environments is the thermonuclear reaction rate. The reaction rate of {sup 22}Ne(p,{gamma}){sup 23}Na has still strong uncertainties in the temperature range of T = 0.03 - 0.3 GK. These uncertainties are based on insufficient upper limits of the resonance strengths as well as the possible existence of tentative states that are populated in the energy range of E{sup lab}{sub p} = 30 - 300 keV. The research presented in this thesis is dedicated to the experimental study of the {sup 22}Ne(p,{gamma}){sup 23}Na reaction for an improved determination of the
Theoretical and observational review of results on nova explosions occurring on ONeMg white dwarfs
International Nuclear Information System (INIS)
Starrfield, S.
1986-01-01
The nova outburst is the second most violent explosion that occurs in a galaxy. This review presents the recent observational and theoretical studies that have demonstrated that there exist two classes of nova outburst. One type of nova occurs on a CO white dwarf and the other type of nova occurs on an ONeMg white dwarf. The second class of outbursts are much more violent and occur much more frequently then the first class of outbursts. Hydrodynamic simulations of both kinds of outbursts are in excellent agreement with the observations. 51 refs
Model atmospheres for novae during the early stages
International Nuclear Information System (INIS)
Wehrse, R.; Hauschildt, P.H.; Shaviv, G.; Starrfield, S.; Arizona State Univ., Tempe, AZ
1989-01-01
Continuum and line blanketing models for the photospheres of novae in the early stages of their outbursts are presented. The expanding envelopes are characterized by a very slow increase of density with decreasing radius which leads to very large geometrical extensions and large temperature differences between the inner and outer parts. The spectra show a large IR excess and a small Balmer jump which may be either in absorption or in emission. For the parameters considered (T eff = 10 4 , 1.5 x 10 4 , 2 x 10 4 K, R = 10 11 cm, solar composition), most lines are in absorption. The effects of both modifications in the temperature structure (e.g. by heating from shock fronts) and changes in the abundances of the heavy elements on the emergent spectra are briefly discussed. 13 refs., 11 figs
Discovery of an old nova shell surrounding the cataclysmic variable V1315 Aql
Sahman, D. I.; Dhillon, V. S.; Littlefair, S. P.; Hallinan, G.
2018-04-01
Following our tentative discovery of a faint shell around V1315 Aql reported in Sahman et al. (2015), we undertook deep Hα imaging and intermediate-resolution spectroscopy of the shell. We find that the shell has its geometric centre located on V1315 Aql. The mass, spectral features and density of the shell are consistent with other nova shells, rather than planetary nebulae or supernova remnants. The radial velocity of the shell is consistent with the systemic velocity of V1315 Aql. We believe this evidence strongly suggests that the shell originates from an earlier nova event. This is the first nova shell discovered around a novalike, and supports the theory of nova-induced cycles in mass transfer rates (hibernation theory) first proposed by Shara et al. (1986).
High density implosion experiments at Nova
International Nuclear Information System (INIS)
Cable, M.D.; Hatchett, S.P.; Nelson, M.B.; Lerche, R.A.; Murphy, T.J.; Ress, D.B.
1994-01-01
Deuterium filled glass microballoons are used as indirectly driven targets for implosion experiments at the Nova Laser Fusion Facility. High levels of laser precision were required to achieve fuel densities and convergences to an ignition scale hot spot. (AIP) copyright 1994 American Institute of Physics
5. Neuromarketing: uma nova disciplina acadêmica?
Directory of Open Access Journals (Sweden)
Eric David Cohen
2017-12-01
Full Text Available Através da aplicação de técnicas neurocientíficas, o Neuromarketing busca entender como ocorrem os processos de decisão de compra. Verifica-se que há um grande movimento em torno do Neuromarketing no ambiente empresarial, apontando que o desenvolvimento desta nova área de conhecimento, bem como a sua possível autonomia, estão em desenvolvimento. Por meio de um estudo exploratório, mapeou-se a construção deste campo de conhecimento no tempo, levando à formação de uma possível nova disciplina científica e acadêmica, assim como verificar a sua origem interdisciplinar. Ademais, apresenta-se a construção de um mapa a partir de dados secundários, de modo a demonstrar a percepção da história e das contribuições potenciais do Neuromarketing, a partir de uma análise da produção científica na área. A partir de um conjunto de dados levantados, conclui-se que existe uma dinâmica de construção do Neuromarketing em torno dos diferentes atores na academia e nos negócios, levando à formulação de hipóteses quanto à maturidade desta nova disciplina acadêmica.
ECONOMIA SOCIAL INCORPORATIVA (e as novas linguagens
Directory of Open Access Journals (Sweden)
Welinton dos Santos
2017-05-01
Full Text Available A inovação tecnológica aliada à interação de comunicação sem limites, chamada de “Economia Social Incorporativa”, sendo uma rede integrada e sociável as populações do mundo. Baseada em uma pesquisa bibliográfica de caráter qualitativo e documental mostrando que a comunicação, informações e tecnologias evoluem surgindo novos materiais em destaque o grafeno, composto por átomos de carbono com alta condutividade térmica e elétrica, flexível e resistente, material que pode substituir o silício e permitir a segunda revolução tecnológica e levando consigo a economia. Com esses feitos tecnológicos a humanidade tende a estar mais do que nunca com uma ligação inseparável das novas tecnologias que vem aparecendo de forma exponencial no mercado estimulando assim mais do que nunca a economia social. O futuro visa uma nova economia que está em transformação, provocando mudanças significativas na política econômica mundial, e por isso, todos os esforços nesta nova dinâmica de conscientização do comportamento social integrativo auxilia numa política estratégica global mais justa e igualitária.
Coexistência de redes de acesso de nova geração
Viana, Diogo Fernando Rebelo
2013-01-01
Nos dias que correm assiste-se a um contínuo crescimento do consumo de conteúdos que exigem uma maior largura banda disponível para cada utilizador o que leva ao investimento, por parte dos operadores de telecomunicações, na procura de novas soluções no domínio ótico. Desta procura surgiram as redes óticas passivas (PON: Passive Optical Network) que se iniciaram com as G-PON (Gigabit PON), que mais tarde evoluíram para as XG-PON (10-Gigabit PON) e que atualmente se encontram em fase de migraç...
NOVAE WITH LONG-LASTING SUPERSOFT EMISSION THAT DRIVE A HIGH ACCRETION RATE
International Nuclear Information System (INIS)
Schaefer, Bradley E.; Collazzi, Andrew C.
2010-01-01
We identify a new class of novae characterized by the post-eruption quiescent light curve being more than roughly a factor of 10 brighter than the pre-eruption light curve. Eight novae (V723 Cas, V1500 Cyg, V1974 Cyg, GQ Mus, CP Pup, T Pyx, V4633 Sgr, and RW UMi) are separated out as being significantly distinct from other novae. This group shares a suite of uncommon properties, characterized by the post-eruption magnitude being much brighter than before eruption, short orbital periods, long-lasting supersoft emission following the eruption, a highly magnetized white dwarf (WD), and secular declines during the post-eruption quiescence. We present a basic physical picture which shows why all five uncommon properties are causally connected. In general, novae show supersoft emission due to hydrogen burning on the WD in the final portion of the eruption, and this hydrogen burning will be long-lasting if new hydrogen is poured onto the surface at a sufficient rate. Most novae do not have adequate accretion for continuous hydrogen burning, but some can achieve this if the companion star is nearby (with short orbital period) and a magnetic field channels the matter onto a small area on the WD so as to produce a locally high accretion rate. The resultant supersoft flux irradiates the companion star and drives a higher accretion rate (with a brighter post-eruption phase), which serves to keep the hydrogen burning and the supersoft flux going. The feedback loop cannot be perfectly self-sustaining, so the supersoft flux will decline over time, forcing a decline in the accretion rate and the system brightness. We name this new group after the prototype, V1500 Cyg. V1500 Cyg stars are definitely not progenitors of Type Ia supernovae. The V1500 Cyg stars have similar physical mechanisms and appearances as predicted for nova by the hibernation model, but with this group accounting for only 14% of novae.
ASAS-SN Discovery of a Possible Galactic Nova ASASSN-18ix
Stanek, K. Z.; Kochanek, C. S.; Shields, J. V.; Thompson, T. A.; Chomiuk, L.; Strader, J.; Shappee, B. J.; Holoien, T. W.-S.; Prieto, J. L.; Dong, Subo; Stritzinger, M.
2018-04-01
During the ongoing All Sky Automated Survey for SuperNovae (ASAS-SN, Shappee et al. 2014), using data from multiple ASAS-SN telescopes, we detect a new bright transient source, possibly a classical nova, but it might also be a young, large amplitude outburst of a cataclysmic variable Object RA (J2000) DEC (J2000) Gal l (deg) Gal b (deg) Disc.
Restablished Accretion in Post-outburst Classical Novae Revealed by X-rays
Hernanz, Margarita; Ferri, Carlo; Sala, Glòria
2009-05-01
Classical novae are explosions on accreting white dwarfs (hereinafter WDs) in cataclysmic variables (hereinafter CVs) a hydrogen thermonuclear runaway on top of the WD is responsible for the outburst. X-rays provide a unique way to study the turn-off of H-burning, because super soft X-rays reveal the hot WD photosphere, but also to understand how accretion is established again in the binary system. Observations with XMM-Newton of some post-outburst novae have revealed such a process, but a coverage up to larger energies -as Simbol-X will provide- is fundamental to well understand the characteristics of the binary system and of the nova ejecta. We present a brief summary of our results up to now and prospects for the Simbol-X mission.
La Dous, Constanze
1991-01-01
IUE observations of dwarf novae at maximum at quiescence and novalike objects at the high brightness state are analyzed for effects of the inclination angle on the emitted continuum and line radiation. A clear pattern in the continuum flux distribution is exhibited only by dwarf novae at maximum where some 80 percent of the non-double-eclipsing systems show essentially identical distributions. This result is not in disagreement with theoretical expectations. All classes of objects exhibit a clear, but in each case different, dependence of the line radiation on the inclination angle.
Role of thermonuclear instability in recent models of nova stars
Energy Technology Data Exchange (ETDEWEB)
Secco, L [Padua Univ. (Italy). Ist. di Astronomia
1981-10-11
In this paper we review models of nova-star explosion based on the original suggestion by Kraft and developed during about ten years (from 1967). We aim at summarizing here the most salient results of those theoretical models and to point out the many aspects of the problems that are still unsettled. In particular, we analyse thermonuclear instabilities both in perfect and electron-degenerate gas, since they seem to be at the base of the nova explosion phenomena.
Detection of Highly-Absorbed X-rays from Nova Mus 2018 with Swift
Nelson, Thomas; Kuin, Paul; Mukai, Koji; Page, Kim; Chomiuk, Laura; Kawash, Adam; Sokoloski, J. L.; Linford, Justin; Rupen, Michael P.; Mioduszewski, Amy
2018-03-01
We report the detection of X-rays from Nova Mus 2018 with the Swift XRT instrument. We have been carrying out weekly monitoring of the nova with Swift since its discovery on 2018 Jan 15 (see ATel #11220), and observations up to 2018 Feb 24 yielded X-ray non-detections.
Directory of Open Access Journals (Sweden)
Alessandro Wagner Coelho Ferreira
2010-03-01
Full Text Available Triphora uniflora A. C. Ferreira, Baptista & Pansarin uma nova espécie de Orchidaceae, é descrita e ilustrada. Além disso, o gênero Triphora é referido pela primeira vez para o estado de São Paulo. As relações da nova espécie com outros táxons do gênero, bem como a necessidade de conservação do habitat natural dessa espécie de Triphora, são discutidas.Triphora uniflora A. C. Ferreira, Baptista & Pansarin, a new species of Orchidaceae, is described and illustrated. Furthermore, this is the first report of the genus Triphora for São Paulo state, Brazil. The relationship of this new species to other taxa of the genus and the need to preserve the natural habitat of this Triphora species are discussed.
Province of Nova Scotia Electricity Marketplace Governance Committee First Interim Report
International Nuclear Information System (INIS)
2002-12-01
This report summarizes the group discussions of the Electricity Marketplace Governance Committee's (EMGC) over the past 6 months regarding the implementation of new rules for power competition in Nova Scotia's electricity market. Emphasis has been placed on external influences, defining the size and form of the short-term competitive portion of the Nova Scotia market, and a detailed consideration of the current transmission system and the changes needed to achieve a sustainable, world class energy sector that would enhance the quality of life for Nova Scotians. The report provides recommendations regarding how competition can be encouraged. The main drivers for electricity restructuring have been energy efficiency, risk-allocation, reliability, environmental impact, and consumer protection. The external influences on the Nova Scotia electricity market include: (1) economics of electricity restructuring, (2) the Federal Energy Regulatory Commission, (3) New Brunswick and electricity restructuring, and (4) Nova Scotia and the energy strategy. This report described the market scope and basic market model with reference to bilateral contract market, fully competitive wholesale pool market, and a single buyer market. The transmission issues discussed in this report included the importance of transmission, transmission tariff options, transmission services offered, design issues, and congestion management policies. The EMGC was directed to examine market design issues to accommodate an Open Access Transmission Tariff (OATT). As such, this report identifies some transmission issues that must be resolved to implement tariffs, and conditions of access to the transmission system and its impact on open access market design. The final report is expected to be available in March 2003
Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.
Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar
2010-06-01
The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.
Directory of Open Access Journals (Sweden)
Graziela Maciel Barroso
1990-12-01
Full Text Available O trabalho trata de espécies novas de Myrcia DC. e Marlierea Cambes., dois gêneros de Myrtaceae da sub tribo Myrciinae, da Reserva Florestal de Linhares, Espírito Santo, Brasil. Na área são conhecidas 18 espécies de Myrcia, 5 das quais são agora descritas. O gênero Marlierea está representado por 12 espécies, uma das quais é descrita como nova. Os novos taxa são ilustrados, e feitos comentários sobre relacionamento entre espécies afins.This paper deals with new species of Myrcia DC. and Marlierea Cambes., two genera of Myrtaceae subtribus Myrciinae, from the Reserva Florestal of Linhares, Espírito Santo, Brazil. From this area, 18 species of Myrcia are known, 5 of which are new to science and described here. Marlierea is not as rich in species as Myrcia but it is represented by 12 species, one here described as new. The new species are illustrated and some remarks are made about their relationships.
Role of thermonuclear instabilities of recent models of nova-stars
Energy Technology Data Exchange (ETDEWEB)
Secco, L [Padua Univ. (Italy). Ist. di Astronomia
1981-10-11
In this paper, a review models of nova-star explosion based on the original suggestion by Kraft and developed during about ten years (from 1967) is presented. The aim is to summarize the most salient results of those theoretical models and to point out the many aspects of the problems that are still unsettled. In particular, thermonuclear instabilities both in perfect and electron-degenerate gas are analyzed, since they seem to be at the base of the nova explosion phenomena.
Por uma 'nova pragmática emancipatória'
Ferreira,Dina Maria Martins; Alencar,Claudiana Nogueira de
2013-01-01
Neste artigo propomos o modus operandi de uma pragmática contra-hegemônica no que tange às teorias do mainstream, ou seja, as internalistas (auto-suficiência da língua como sistema) e as externalistas (aspecto social aliado à língua e não constitutivo da língua). Para tal, constroem-se dois percursos argumentativos para dar conta de uma nova Pragmática emancipatória: (1) nova, que mostra a incompatibilidade conceitual entre a teoria austiniana e a interpretada por seu discípulo Searle; (2) em...
A NOVA EVANGELIZAÇÃO NA EUROPA
Directory of Open Access Journals (Sweden)
Martin Maier
2013-01-01
Full Text Available Neste estudo, o olhar dirige-se em primeiro lugar para a situação religiosa da Europa. Em seguida, resumiremos o conceito da nova evangelização de acordo com os últimos papas. O passo seguinte será perguntar o que as igrejas podem oferecer à Europa. A nova evangelização deve acontecer no horizonte do ecumenismo e da globalização. Importante ponto de conexão para a transmissão da fé é a constante sede de espiritualidade e de experiência espiritual, bem como de conhecimento da religião e da fé. Por fim, desenvolveremos algumas chances que podem relacionar-se com a nova evangelização na Europa. ABSTRACT: In this study, the focus is directed first of ali to the religious situation in Europe. Then we will sum up the concept of the new evangelization according to the recent Popes. The next step will be to ask what the churches can offer to Europe. The new evangelization must happen on the horizon of ecumenism and globalization. An important point of connection to the transmission of the faith is the constant thirst for spirituality and spiritual experience as well as the knowledge of religion and faith. Finally, we will develop some opportunities that can relate to the new evangelization in Europe
CONCURRENT FORMATION OF CARBON AND SILICATE DUST IN NOVA V1280 SCO
Energy Technology Data Exchange (ETDEWEB)
Sakon, Itsuki; Onaka, Takashi; Usui, Fumihiko [Department of Astronomy, Graduate Schools of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sako, Shigeyuki; Takahashi, Hidenori; Ohsawa, Ryou [Institute of Astronomy, University of Tokyo, 2-21-1 Ohsawa, Mitaka, Tokyo 181-0015 (Japan); Nozawa, Takaya [National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan); Kimura, Yuki [Institute of Low Temperature Science, Hokkaido University, Sapporo 060-0819 (Japan); Fujiyoshi, Takuya [Subaru Telescope, National Astronomical Observatory of Japan, 650 North A’ohoku Place, Hilo, HI 96720 (United States); Shimonishi, Takashi [Frontier Research Institute for Interdisciplinary Sciences, Tohoku University, Aramaki aza Aoba 6-3, Aoba-ku, Sendai 980-8578 (Japan); Arai, Akira [Koyama Astronomical Observatory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto, 603-8555 (Japan); Uemura, Makoto [Hiroshima Astrophysical Science Center, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima 739-8526 (Japan); Nagayama, Takahiro [Department of Physics and Astronomy, Graduate School of Science and Engineering, Kagoshima University, 1-21-35 Korimoto, Kagoshima 890-0065 (Japan); Koo, Bon-Chul [Department of Physics and Astronomy, Seoul National University , 1 Gwanak-ro, Gwanak-gu, Seoul 151-742 (Korea, Republic of); Kozasa, Takashi, E-mail: isakon@astron.s.u-tokyo.ac.jp [Department of Cosmosciences, Graduate School of Science, Hokkaido University, Sapporo 060-0810 (Japan)
2016-02-01
We present infrared multi-epoch observations of the dust-forming nova V1280 Sco over ∼2000 days from the outburst. The temporal evolution of the infrared spectral energy distributions at 1272, 1616, and 1947 days can be explained by the emissions produced by amorphous carbon dust of mass (6.6–8.7) × 10{sup −8} M{sub ⊙} with a representative grain size of 0.01 μm and astronomical silicate dust of mass (3.4–4.3) × 10{sup −7} M{sub ⊙} with a representative grain size of 0.3–0.5 μm. Both of these dust species travel farther away from the white dwarf without apparent mass evolution throughout those later epochs. The dust formation scenario around V1280 Sco suggested from our analyses is that the amorphous carbon dust is formed in the nova ejecta followed by the formation of silicate dust either in the expanding nova ejecta or as a result of the interaction between the nova wind and the circumstellar medium.
Consultation paper : Nova Scotia's renewed energy strategy and climate change action plan
International Nuclear Information System (INIS)
2007-10-01
The Nova Scotia Department of Energy is seeking to create a sustainable and prosperous Nova Scotia that is responsive to climate change. The purpose of this report was to inform public discussion around two upcoming documents, namely the renewed energy strategy focusing on broad energy policy and a climate change action plan for Nova Scotia to reduce greenhouse gas emissions. The report discussed mitigation measures, as it is closely tied with energy use. The consultation process to inform the two documents was to include public forums and direct stakeholder consultation. The report discussed Nova Scotia's strategy for dealing with climate change and the world of energy. Recent changes in energy prices, exploration, awareness, and emerging but uncertain technologies were presented. Long term planning and a review of policy changes were also addressed. The report also presented options for a renewed energy strategy and discussed air quality; energy conservation and efficiency; electricity; natural gas; energy opportunities; government action; and government intervention. Submissions were also sought as input to the discussion paper. refs., tabs., figs., appendices
Perspective : component tracking on the Nova system
International Nuclear Information System (INIS)
MacDonald, S.
1999-01-01
The issue of introducing Component Tracking as a service to natural gas producers, shippers and straddle plant operators was discussed. Approximately 39 companies in the industry were contacted by consultants at Nova Gas Transmission in an effort to assess if introducing this service would add value to individual producers. The numerous implications that may have to be dealt with if Component Tracking is introduced were also described. Component Tracking would provide an equitable approach to the allocation of molecules in the gas stream, and could provide producers with the ability to avoid capital outlay in field plants by alternatively contracting for recovery of the liquids at the straddle plants. Component Tracking is to be voluntary and each shipper would be able to decide whether to utilize the service at each of their receipt points onto the Nova system
Uma padre na aldeia global : nova evangelização e novas tecnologias de informação e comunicação
Aguiar, Américo Manuel Alves
2012-01-01
Nesta dissertação, revemos os últimos cem anos de pronunciamentos dos sucessores de Pedro, do Papa Leão XIII, ao Papa Bento XVI, atestando a atenção e interesse com que a igreja católica sempre olhou para as potencialidades oferecidas pelas novas tecnologias de informação e de comunicação. Olhamos de um ponto de vista comunicacional para a urgência da Nova Evangelização pronunciada pelo Papa João Paulo II, dando continuidade ao já expresso pelo Papa Paulo VI e pelo próprio II ...
Data Driven Trigger Design and Analysis for the NOvA Experiment
Energy Technology Data Exchange (ETDEWEB)
Kurbanov, Serdar [Univ. of Virginia, Charlottesville, VA (United States)
2016-01-01
This thesis primarily describes analysis related to studying the Moon shadow with cosmic rays, an analysis using upward-going muons trigger data, and other work done as part of MSc thesis work conducted at Fermi National Laboratory. While at Fermilab I made hardware and software contributions to two experiments - NOvA and Mu2e. NOvA is a neutrino experiment with the primary goal of measuring parameters related to neutrino oscillation. This is a running experiment, so it's possible to provide analysis of real beam and cosmic data. Most of this work was related to the Data-Driven Trigger (DDT) system of NOvA. The results of the Upward-Going muon analysis was presented at ICHEP in August 2016. The analysis demonstrates the proof of principle for a low-mass dark matter search. Mu2e is an experiment currently being built at Fermilab. Its primary goal is to detect the hypothetical neutrinoless conversion from a muon into an electron. I contributed to the production and tests of Cathode Strip Chambers (CSCs) which are required for testing the Cosmic Ray Veto (CRV) system for the experiment. This contribution is described in the last chapter along with a short description of the technical work provided for the DDT system of the NOvA experiment. All of the work described in this thesis will be extended by the next generation of UVA graduate students and postdocs as new data is collected by the experiment. I hope my eorts of have helped lay the foundation for many years of beautiful results from Mu2e and NOvA.
Expanding Pharmacists' Scope of Practice to Include Immunization in Nova Scotia
Directory of Open Access Journals (Sweden)
Beth O'Reilly
2017-07-01
Full Text Available On 10 December 2010 An Act to Amend Chapter 36 of the Acts of 2001, the Pharmacy Act (Bill 7 received Royal Assent in Nova Scotia, including an amendment that enabled an expanded scope of pharmacy practice. Expanding pharmacists' scope of practice came about from recommendations by various federal and provincial government bodies as an attempt to improve accessibility to health care and decrease costs. In 2013, pharmacists in Nova Scotia began administering the influenza vaccine as part of the publicly funded program in attempts to improve vaccine coverage rates. Preliminary evaluation in Nova Scotia has shown an increase in influenza vaccination coverage. Although pharmacist administration of influenza vaccination may improve vaccination coverage and reduce demand on physician time, there may be tension created among the professions, which needs to be addressed and managed.
Directory of Open Access Journals (Sweden)
Graziela Maciel Barroso
1996-07-01
Full Text Available É descrita uma nova espécie para o gênero Calyptranthes (Myrtaceae, ocorrente na Reserva Biológica do Tinguá, município de Nova Iguaçu, Rio de Janeiro. Trata-se de árvore ou arvoreta do estrato intermediário ou inferior da floresta atlântica que se destaca pela pilosidade densa e rufa de seus raminhos, pecíolos e dorso foliar. Pela sua forma de crescimento com copa pequena e arredondada e beleza de seus ramos esfoliantes, a nova espécie tem aptidão ornamental como arvoreta para áreas sombreadas.Occuring on the Tinguá Biological Reserve in the municipality of Nova Iguaçu, Rio de Janeiro state, is described. It is a small tree from the intermediate or inferior layer of the Atlantic forest and is conspicuous because of the dense, reddish indumentum on its branches, petioles and lower blade surface. Due to its architectural form with small rounded canopy and the beauty of its exfoliating branches, the new species may prove useful for ornamental plantings in shady areas.
Energy Technology Data Exchange (ETDEWEB)
Flumerfelt, Eric Lewis [Univ. of Tennessee, Knoxville, TN (United States)
2015-08-01
The NOvA (NuMI Off-axis ve [nu_e] Appearance) Experiment is a long-baseline accelerator neutrino experiment currently in its second year of operations. NOvA uses the Neutrinos from the Main Injector (NuMI) beam at Fermilab, and there are two main off-axis detectors: a Near Detector at Fermilab and a Far Detector 810 km away at Ash River, MN. The work reported herein is in support of the NOvA Experiment, through contributions to the development of data acquisition software, providing an accurate, absolute-scale energy calibration for electromagnetic showers in NOvA detector elements, crucial to the primary electron neutrino search, and through an initial evaluation of the cosmic background rate in the NOvA Far Detector, which is situated on the surface without significant overburden. Additional support work for the NOvA Experiment is also detailed, including DAQ Server Administration duties and a study of NOvA’s sensitivity to neutrino oscillations into a “sterile” state.
Nova Scotia Energy Strategy : progress report
Energy Technology Data Exchange (ETDEWEB)
NONE
2003-02-01
Nova Scotia's energy strategy addresses all aspects of energy production and use, from offshore oil and gas to electricity and coal, to climate change and renewable resources. It also encompasses energy conservation and efficiency. This progress report highlights the efforts that the province has made to promote exploration, improve efficiency of regulations and approval processes and promote the oil and natural gas sector. Efforts have also been made to support local businesses, address climate change issues and protect the environment. The strategy demonstrates how new energy resources can be used to build a more prosperous and self-reliant province. The progress report focuses on the following 3 themes: powering the economy; improving the environment; and, securing Nova Scotia's future. The report emphasizes that the growing oil and gas industry brings many opportunities for new jobs and a stronger economy. In the next 12 to 18 months, about 8 to 10 offshore exploration wells will be drilled, which is more than in the last decade. Funding will be provided to extend pipeline systems beyond franchise areas approved by the Nova Scotia Utility and Review Board. In May 2002, the Electricity Marketplace Governance Committee was formed to make recommendations on how competition can be introduced into the province's electricity market. The Department of Energy has been working to implement initiatives to increase the use of renewable energy sources such as solar and wind power. In October 2002, new wind turbines began producing electricity in 3 communities on Cape Breton Island. A key priority is to respond to climate change and reduce greenhouse gas emissions as well as emissions of mercury, sulphur, nitrogen, and ozone. The energy strategy also identifies the need to provide competitive taxation regimes.
Strategies of design, development and activation of the Nova control system
International Nuclear Information System (INIS)
Holloway, F.W.
1983-01-01
Nova and Novette are large complex experimental laser facilities which require extensive and sophisticated control systems for their successful operation. Often, in major controls projects, certain invisible aspects of the project, such as overall strategy, management, resources and historical constraints, have a more profound effect upon success than any specific hardware/software design. The design and performance of the Nova/Novette laser control system will be presented with special emphasis upon these often controversial aspects
Strategies of design, development and activation of the Nova control system
Energy Technology Data Exchange (ETDEWEB)
Holloway, F.W.
1983-06-30
Nova and Novette are large complex experimental laser facilities which require extensive and sophisticated control systems for their successful operation. Often, in major controls projects, certain invisible aspects of the project, such as overall strategy, management, resources and historical constraints, have a more profound effect upon success than any specific hardware/software design. The design and performance of the Nova/Novette laser control system will be presented with special emphasis upon these often controversial aspects.
Isotopic 32S/33S ratio as a diagnostic of presolar grains from novae
Directory of Open Access Journals (Sweden)
A. Parikh
2014-10-01
Full Text Available Measurements of sulphur isotopes in presolar grains can help to identify the astrophysical sites in which these grains were formed. A more precise thermonuclear rate of the 33S(p,γ34Cl reaction is required, however, to assess the diagnostic ability of sulphur isotopic ratios. We have studied the 33S(3He,d34Cl proton-transfer reaction at 25 MeV using a high-resolution quadrupole–dipole–dipole–dipole magnetic spectrograph. Deuteron spectra were measured at ten scattering angles between 10° and 55°. Twenty-four levels in 34Cl over Ex=4.6–5.9 MeV were observed, including three levels for the first time. Proton spectroscopic factors were extracted for the first time for levels above the 33S + p threshold, spanning the energy range required for calculations of the thermonuclear 33S(p,γ34Cl rate in classical nova explosions. We have determined a new 33S(p,γ34Cl rate using a Monte Carlo method and have performed new hydrodynamic nova simulations to determine the impact on nova nucleosynthesis of remaining nuclear physics uncertainties in the reaction rate. We find that these uncertainties lead to a factor of ≤5 variation in the 33S(p,γ34Cl rate over typical nova peak temperatures, and variation in the ejected nova yields of SCa isotopes by ≤20%. In particular, the predicted 32S/33S ratio is 110–130 for the nova model considered, compared to 110–440 with previous rate uncertainties. As recent type II supernova models predict ratios of 130–200, the 32S/33S ratio may be used to distinguish between grains of nova and supernova origin.
Directory of Open Access Journals (Sweden)
Massimo G. Bovini
2010-06-01
Full Text Available Duas novas espécies e uma nova combinação são apresentadas para o gênero Wissadula (Malvaceae: Wissadula delicata Bovini, W. krapovickasiana Bovini e Wissadula caribea (DC. Bovini, respectivamente, além de novos sinônimos. Para as espécies apresentadas, são fornecidas descrições, ilustrações e chaves de reconhecimento para distingui-las das espécies relacionadas.Two new species and a new combination are presented for genus Wissadula (Malvaceae: Wissadula krapovickasiana Bovini, W. delicata Bovini and Wissadula caribea (DC. Bovini, respectively, plus new synonyms. Descriptions, illustrations and keys to distinguish these species from similar species are supplied.
The Convolutional Visual Network for Identification and Reconstruction of NOvA Events
Energy Technology Data Exchange (ETDEWEB)
Psihas, Fernanda [Indiana U.
2017-11-22
In 2016 the NOvA experiment released results for the observation of oscillations in the vμ and ve channels as well as ve cross section measurements using neutrinos from Fermilab’s NuMI beam. These and other measurements in progress rely on the accurate identification and reconstruction of the neutrino flavor and energy recorded by our detectors. This presentation describes the first application of convolutional neural network technology for event identification and reconstruction in particle detectors like NOvA. The Convolutional Visual Network (CVN) Algorithm was developed for identification, categorization, and reconstruction of NOvA events. It increased the selection efficiency of the ve appearance signal by 40% and studies show potential impact to the vμ disappearance analysis.
Event Reconstruction in the NOvA Experiment
Energy Technology Data Exchange (ETDEWEB)
Behera, Biswaranjan [Indian Inst. Tech., Hyderabad; Davies, Gavin [Indiana U.; Psihas, Fernanda [Indiana U.
2017-10-10
The NOvA experiment observes oscillations in two channels (electron-neutrino appearance and muon-neutrino disappearance) using a predominantly muon-neutrino NuMI beam. The Near Detector records multiple overlapping neutrino interactions in each event and the Far Detector has a large background of cosmic rays due to being located on the surface. The oscillation analyses rely on the accurate reconstruction of neutrino interactions in order to precisely measure the neutrino energy and identify the neutrino flavor and interaction mode. Similarly, measurements of neutrino cross sections using the Near Detector require accurate identification of the particle content of each interaction. A series of pattern recognition techniques have been developed to split event records into individual spatially and temporally separated interactions, to estimate the interaction vertex, and to isolate and classify individual particles within the event. This combination of methods to achieve full event reconstruction in the NOvA detectors has discussed.
White dwarf heating and the ultraviolet flux in dwarf novae
International Nuclear Information System (INIS)
Pringle, J.E.
1988-01-01
An investigation is made of the heating of the outer layers of the white dwarf which is likely to occur during a dwarf nova outburst. It is shown that the decline in IUE flux, observed during quiescent intervals in the dwarf novae VW Hydri and WX Hydri, may be due to the outer layers cooling off once the heat source is removed. The calculations here assume uniformity of the heat source over the white dwarf surface. This is unlikely to be realized from disc accretion, and we discuss that further calculations are required. (author)
Further X-ray observations of Nova Del 2013 with Swift
Nelson, T.; Mukai, K.; Chomiuk, L.; Sokoloski, J.; Weston, J.; Zheng, Y.; Rupen, M.; Mioduszewski, A.; Linford, J.; Finzell, T.
2013-08-01
We observed Nova Del 2013 (see CBET #3628) with the Swift satellite on 2013-08-18, four days after discovery (see also ATEL #5283). The exposures were carried out between 0.0 and 15.7 UT, and are therefore coincident with the first appearance of gamma-ray emission from this nova as seen with the Fermi-LAT (ATEL #5302). The XRT instrument was operated in Window Timing (WT) in order to mitigate the impact of optical loading on the CCD, and the total exposure time was 4522s.
Nova target diagnostics control system
International Nuclear Information System (INIS)
Severyn, J.R.
1985-01-01
During the past year the Nova target diagnostics control system was finished and put in service. The diagnostics loft constructed to the north of the target room provides the environmental conditions required to collect reliable target diagnostic data. These improvements include equipment cooling and isolation of the power source with strict control of instrumentation grounds to eliminate data corruption due to electromagnetic pulses from the laser power-conditioning system or from target implosion effects
2015-01-01
Tallinna Ülikooli Balti Filmi- ja Meediakooli õppehoone "Nova" Narva maantee 27, valminud 2012. Arhitektuuri sihtkapitali arhitektuuripreemia 2012 ja Arhitektuuri sihtkapitali sisearhitektuuripreemia 2013. Arhitektid Maarja Kask, Karli Luik, Ralf Lõoke, Pelle-Sten Viiburg (Salto Arhitektid). Sisearhitektid Ville Lausmäe, Kadi Karmann (VLS). Mööbel Ville Lausmäe, Tõnis Kalve. Konstruktor Jaanus Natka (EA Reng)
Modal testing and analysis of NOVA laser structures
International Nuclear Information System (INIS)
Burdick, R.B.; Weaver, H.J.; Pastrnak, J.W.
1984-09-01
NOVA, currently the world's most powerful laser system, is an ongoing project at the Lawrence Livermore National Laboratory in California. The project seeks to develop a feasible method of achieving controlled fusion reaction, initiated by multiple laser beams targeted on a tiny fuel pellet. The NOVA system consists of several large steel framed structures, the largest of which is the Target Chamber Tower. In conjunction with design engineers, the tower was first modelled and analyzed by sophisticated finite element techniques. A modal test was then conducted on the tower structure to evaluate its vibrational characteristics and seismic integrity as well as for general comparison to the finite element results. This paper will discuss the procedure used in the experimental modal analysis and the results obtained from that test
Directory of Open Access Journals (Sweden)
Severino Gonzaga Neto
2005-12-01
Full Text Available Este trabalho foi desenvolvido para se determinar a composição corporal e as exigências nutricionais de cálcio (Ca, fósforo (P, magnésio (Mg, sódio (Na e potássio de ovinos da raça Morada Nova. Foram utilizados 30 cordeiros com peso vivo (PV médio inicial de 15 kg e 70 dias de idade. Seis cordeiros foram abatidos aos 15 kg, para determinação da composição corporal inicial (animais-referência pela metodologia do abate comparativo; seis foram abatidos aos 20 kg (abate intermediário e os demais distribuídos em seis grupos de três animais (um para cada dieta, de acordo com as relações volumoso(V:concentrado(C: 1 40V:60C; 2 55V:45C; e 3 70V:30C. Os animais, em cada grupo, foram abatidos quando o cordeiro que recebia a dieta com maior teor de concentrado atingiu 25 kg de PV. A composição corporal variou de 14,33 a 12,42 g de Ca; 8,12 a 7,15 g de P; 0,47 a 0,46 g de Mg; 1,60 a 1,40 g de Na e de 2,30 a 2,23 g de K por kg de peso de corpo vazio. As exigências líquidas de ganho variaram de 13,54 a 11,74 mg de Ca; 7,96 a 7,02 mg de P; 0,57 a 0,55 mg de Mg; 1,54 a 1,35 mg de Na e de 2,75 a 2,68 mg de K por g de ganho de PV. As exigências dietéticas diárias de macrominerais para cordeiros dos 15 aos 25 kg de PV, ganhando 100 g/dia, variaram de 2,76 a 3,12 g de Ca; 1,91 a 2,95 de g de P; 0,60 a 0,77 g de Mg; 0,60 a 0,86 g de Na e de 1,51 a 2,63 g de K.The objective of this trial was to determine the body composition and nutritional requirements of macrominerals for Morada Nova sheep. Thirty lambs averaging 15 kg of initial body weight (BW and 70 days of age were used in this study. Six lambs (reference-animals were slaughtered with 15 kg of BW to determine the initial body composition using the comparative slaughter methodology; six other lambs were slaughtered with 20 kg of BW (intermediary slaughter and the remaining 18 lambs were distributed to six groups of three animals (one lamb for each treatment and received diets with the
Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.
Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh
2017-10-18
G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
A theoretical study of problems in classical nova evolution
International Nuclear Information System (INIS)
Shankar, A.
1990-01-01
Three distinct issues in classical nova evolution are addressed with the aid of one- and two-dimensional numerical hydrodynamics. The effects of convection on nova outbursts are examined within the confines of the mixing length theory. It is found that increasing the efficiency of convection enhances the violence of the thermonuclear runaway (TNR). This also relates to the question of the feasibility of obtaining nova outbursts on magnetic white dwarfs among the AM Her systems. The effects of a strong magnetic field on the TNR are explored. The field interferes with the development of convection during the TNR, which results in lower ejection velocities. However, for field strengths typical of cataclysmic variables, the violence of strong outbursts is affected only moderately. The conditions necessary for the production of strong TNR's in the hibernation model of cataclysmic binary evolution are also examined. The feasibility of obtaining strong nova outbursts is investigated when the accretion rate during hibernation is decreased. It is found that a reduction (by a factor of 100) for periods of longer than a couple thousand years, is sufficient to ensure violent outbursts, even in the presence of large pre-outburst accretion rates. The effects of a common envelope phase (CEP) on the outburst are discussed. The motion of the secondary through an expanding common envelope is resisted by frictional drag. This dissipates both energy and angular momentum from the orbit inducing hydrodynamic motion. Significant departures are found to occur in the manner in which mass is lost when the effects of drag are taken into account. Specifically, a CEP is found to accelerate and enhance mass loss. Ejection is found to be concentrated in the orbital plane, with velocities of a few thousand km/sec
Message Correlation Analysis Tool for NOvA
International Nuclear Information System (INIS)
Lu Qiming; Biery, Kurt A; Kowalkowski, James B
2012-01-01
A complex running system, such as the NOvA online data acquisition, consists of a large number of distributed but closely interacting components. This paper describes a generic real-time correlation analysis and event identification engine, named Message Analyzer. Its purpose is to capture run time abnormalities and recognize system failures based on log messages from participating components. The initial design of analysis engine is driven by the data acquisition (DAQ) of the NOvA experiment. The Message Analyzer performs filtering and pattern recognition on the log messages and reacts to system failures identified by associated triggering rules. The tool helps the system maintain a healthy running state and to minimize data corruption. This paper also describes a domain specific language that allows the recognition patterns and correlation rules to be specified in a clear and flexible way. In addition, the engine provides a plugin mechanism for users to implement specialized patterns or rules in generic languages such as C++.
Message Correlation Analysis Tool for NOvA
CERN. Geneva
2012-01-01
A complex running system, such as the NOvA online data acquisition, consists of a large number of distributed but closely interacting components. This paper describes a generic realtime correlation analysis and event identification engine, named Message Analyzer. Its purpose is to capture run time abnormalities and recognize system failures based on log messages from participating components. The initial design of analysis engine is driven by the DAQ of the NOvA experiment. The Message Analyzer performs filtering and pattern recognition on the log messages and reacts to system failures identified by associated triggering rules. The tool helps the system maintain a healthy running state and to minimize data corruption. This paper also describes a domain specific language that allows the recognition patterns and correlation rules to be specified in a clear and flexible way. In addition, the engine provides a plugin mechanism for users to implement specialized patterns or rules in generic languages such as C++.
Message correlation analysis tool for NOvA
Energy Technology Data Exchange (ETDEWEB)
Lu, Qiming [Fermilab; Biery, Kurt A. [Fermilab; Kowalkowski, James B. [Fermilab
2012-01-01
A complex running system, such as the NOvA online data acquisition, consists of a large number of distributed but closely interacting components. This paper describes a generic real-time correlation analysis and event identification engine, named Message Analyzer. Its purpose is to capture run time abnormalities and recognize system failures based on log messages from participating components. The initial design of analysis engine is driven by the data acquisition (DAQ) of the NOvA experiment. The Message Analyzer performs filtering and pattern recognition on the log messages and reacts to system failures identified by associated triggering rules. The tool helps the system maintain a healthy running state and to minimize data corruption. This paper also describes a domain specific language that allows the recognition patterns and correlation rules to be specified in a clear and flexible way. In addition, the engine provides a plugin mechanism for users to implement specialized patterns or rules in generic languages such as C++.
Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki
2014-01-01
The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.
Superoutburst of a New Sub-Period-Minimum Dwarf Nova CSS130418 in Hercules
Directory of Open Access Journals (Sweden)
D. Chochol
2015-02-01
Full Text Available Multicolour photometry of a new dwarf nova CSS130418 in Hercules, which underwent superoutburst on April 18, 2013, allow to classified it as a WZ Sge-type dwarf nova. The phase light curves for different stages of superoutburst are presented. The early superhumps were used to determine the orbital period Porb = 64.84(1 minutes, which is shorter than the period minimum ~78 minutes for normal hydrogen-rich cataclysmic variables. We found the mean period of ordinary superhumps Psh = 65.559(1 minutes. The quiescent spectrum is rich in helium, showing double peaked emissionlines of H I and He I from accretion disk, so the dwarf nova is in a late stage of stellar evolution.
RELAÇÕES DE GÊNERO, INFERTILIDADE E NOVAS TECNOLOGIAS REPRODUTIVAS
Directory of Open Access Journals (Sweden)
Rosana Machin Barbosa
2000-01-01
Full Text Available O texto aborda as novas tecnologias reprodutivas (NTRs e a infertilidade através da experiência de mulheres e homens que buscaram uma gestação por meio dessas técnicas. Os relatos apresentados estão baseados em pesquisa realizada, durante o ano de 1998, em dois serviços voltados ao tratamento de situações de infertilidade: um público — Hospital Pérola Byington, em São Paulo, e outro privado — Cenafert (Centro de Endoscopia e Assistência à Fertilidade, em Brasília/DF. As NTRs são enfocadas no âmbito da tecnologia, da saúde reprodutiva e das relações entre os gêneros.
Quark-Nova Explosion inside a Collapsar: Application to Gamma Ray Bursts
Directory of Open Access Journals (Sweden)
Rachid Ouyed
2009-01-01
Full Text Available If a quark-nova occurs inside a collapsar, the interaction between the quark-nova ejecta (relativistic iron-rich chunks and the collapsar envelope leads to features indicative of those observed in Gamma Ray Bursts. The quark-nova ejecta collides with the stellar envelope creating an outward moving cap (Γ∼ 1–10 above the polar funnel. Prompt gamma-ray burst emission from internal shocks in relativistic jets (following accretion onto the quark star becomes visible after the cap becomes optically thin. Model features include (i precursor activity (optical, X-ray, γ-ray, (ii prompt γ-ray emission, and (iii afterglow emission. We discuss SN-less long duration GRBs, short hard GRBs (including association and nonassociation with star forming regions, dark GRBs, the energetic X-ray flares detected in Swift GRBs, and the near-simultaneous optical and γ-ray prompt emission observed in GRBs in the context of our model.
V2676 Oph: Estimating Physical Parameters of a Moderately Fast Nova
Raj, A.; Pavana, M.; Kamath, U. S.; Anupama, G. C.; Walter, F. M.
2018-03-01
Using our previously reported observations, we derive some physical parameters of the moderately fast nova V2676 Oph 2012 #1. The best-fit Cloudy model of the nebular spectrum obtained on 2015 May 8 shows a hot white dwarf source with TBB≍1.0×105 K having a luminosity of 1.0×1038 erg/s. Our abundance analysis shows that the ejecta are significantly enhanced relative to solar, He/H=2.14, O/H=2.37, S/H=6.62 and Ar/H=3.25. The ejecta mass is estimated to be 1.42×10-5 M⊙. The nova showed a pronounced dust formation phase after 90 d from discovery. The J-H and H-K colors were very large as compared to other molecule- and dust-forming novae in recent years. The dust temperature and mass at two epochs have been estimated from spectral energy distribution fits to infrared photometry.
THE EXPANDING BIPOLAR SHELL OF THE HELIUM NOVA V445 PUPPIS
International Nuclear Information System (INIS)
Woudt, P. A.; Warner, B.; Steeghs, D.; Marsh, T. R.; Karovska, M.; Roelofs, G. H. A.; Groot, P. J.; Nelemans, G.; Nagayama, T.; Smits, D. P.; O'Brien, T.
2009-01-01
From multi-epoch adaptive optics imaging and integral field unit spectroscopy, we report the discovery of an expanding and narrowly confined bipolar shell surrounding the helium nova V445 Puppis (Nova Puppis 2000). An equatorial dust disc obscures the nova remnant, and the outflow is characterized by a large polar outflow velocity of 6720 ± 650 km s -1 and knots moving at even larger velocities of 8450 ± 570 km s -1 . We derive an expansion parallax distance of 8.2 ± 0.5 kpc and deduce a pre-outburst luminosity of the underlying binary of log L/L sun = 4.34 ± 0.36. The derived luminosity suggests that V445 Puppis probably contains a massive white dwarf accreting at high rate from a helium star companion making it part of a population of binary stars that potentially lead to supernova Ia explosions due to accumulation of helium-rich material on the surface of a massive white dwarf.
The Expanding Bipolar Shell of the Helium Nova V445 Puppis
Woudt, P. A.; Steeghs, D.; Karovska, M.; Warner, B.; Groot, P. J.; Nelemans, G.; Roelofs, G. H. A.; Marsh, T. R.; Nagayama, T.; Smits, D. P.; O'Brien, T.
2009-11-01
From multi-epoch adaptive optics imaging and integral field unit spectroscopy, we report the discovery of an expanding and narrowly confined bipolar shell surrounding the helium nova V445 Puppis (Nova Puppis 2000). An equatorial dust disc obscures the nova remnant, and the outflow is characterized by a large polar outflow velocity of 6720 ± 650 km s-1 and knots moving at even larger velocities of 8450 ± 570 km s-1. We derive an expansion parallax distance of 8.2 ± 0.5 kpc and deduce a pre-outburst luminosity of the underlying binary of log L/L sun = 4.34 ± 0.36. The derived luminosity suggests that V445 Puppis probably contains a massive white dwarf accreting at high rate from a helium star companion making it part of a population of binary stars that potentially lead to supernova Ia explosions due to accumulation of helium-rich material on the surface of a massive white dwarf.
Deep Convolutional Networks for Event Reconstruction and Particle Tagging on NOvA and DUNE
CERN. Geneva
2017-01-01
Deep Convolutional Neural Networks (CNNs) have been widely applied in computer vision to solve complex problems in image recognition and analysis. In recent years many efforts have emerged to extend the use of this technology to HEP applications, including the Convolutional Visual Network (CVN), our implementation for identification of neutrino events. In this presentation I will describe the core concepts of CNNs, the details of our particular implementation in the Caffe framework and our application to identify NOvA events. NOvA is a long baseline neutrino experiment whose main goal is the measurement of neutrino oscillations. This relies on the accurate identification and reconstruction of the neutrino flavor in the interactions we observe. In 2016 the NOvA experiment released results for the observation of oscillations in the ν μ → ν e channel, the first HEP result employing CNNs. I will also discuss our approach at event identification on NOvA as well as recent developments in the application of CNN...
Munari, U.; Banerjee, D. P. K.
2018-03-01
Pre-outburst 2MASS and WISE photometry of Nova Sco 2014 (V1534 Sco) has suggested the presence of a cool giant at the location of the nova in the sky. The spectral evolution recorded for the nova did not, however, support a direct partnership because no flash-ionized wind and no deceleration of the ejecta were observed, contrary to the behaviour displayed by other novae which erupted within symbiotic binaries like V407 Cyg or RS Oph. We have therefore obtained 0.8-2.5 μm spectra of the remnant of Nova Sco 2014 in order to ascertain if a cool giant is indeed present and if it is physically associated with the nova. The spectrum shows the presence of a M6III giant, reddened by E(B - V) = 1.20, displaying the typical and narrow emission-line spectrum of a symbiotic star, including He I 1.0830 μm with a deep P-Cyg profile. This makes Nova Sco 2014 a new member of the exclusive club of novae that erupt within a symbiotic binary. Nova Sco 2014 shows that a nova erupting within a symbiotic binary does not always come with a deceleration of the ejecta, contrary to the common belief. Many other similar systems may lay hidden in past novae, especially in those that erupted prior to the release of the 2MASS all-sky infrared survey, which could be profitably cross-matched now against them.
RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.
Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J
2012-05-11
T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.
Optical components for the Nova laser
International Nuclear Information System (INIS)
Wallerstein, E.P.; Baker, P.C.; Brown, N.J.
1982-01-01
In addition to its other characteristics, the Nova Laser Fusion facility may well be the largest precision optical project ever undertaken. Moreover, during the course of construction, concurrent research and development has been successfully conducted, and has resulted in significant advances in various technical areas, including manufacturing efficiency. Although assembly of the first two beams of Nova is just commencing, the optical production, including construction of the special facilities required for many of the components, has been underway for over three years, and many phases of the optical manufacturing program for the first 10 beams will be completed within the next two years. On the other hand, new requirements for second and third harmonic generation have created the need to initiate new research and development. This work has been accomplished through the enormous cooperation DOE/LLNL has received from commercial industry on this project. In many cases, industry, where much of the optical component research and development and virtually all of the manufacturing is being done, has made substantial investment of its own funds in facilities, equipment, and research and development, in addition to those supplied by DOE/LLNL