WorldWideScience

Sample records for oxr1 silencing decreases

  1. Neuron-specific antioxidant OXR1 extends survival of a mouse model of amyotrophic lateral sclerosis.

    Science.gov (United States)

    Liu, Kevin X; Edwards, Benjamin; Lee, Sheena; Finelli, Mattéa J; Davies, Ben; Davies, Kay E; Oliver, Peter L

    2015-05-01

    Amyotrophic lateral sclerosis is a devastating neurodegenerative disorder characterized by the progressive loss of spinal motor neurons. While the aetiological mechanisms underlying the disease remain poorly understood, oxidative stress is a central component of amyotrophic lateral sclerosis and contributes to motor neuron injury. Recently, oxidation resistance 1 (OXR1) has emerged as a critical regulator of neuronal survival in response to oxidative stress, and is upregulated in the spinal cord of patients with amyotrophic lateral sclerosis. Here, we tested the hypothesis that OXR1 is a key neuroprotective factor during amyotrophic lateral sclerosis pathogenesis by crossing a new transgenic mouse line that overexpresses OXR1 in neurons with the SOD1(G93A) mouse model of amyotrophic lateral sclerosis. Interestingly, we report that overexpression of OXR1 significantly extends survival, improves motor deficits, and delays pathology in the spinal cord and in muscles of SOD1(G93A) mice. Furthermore, we find that overexpression of OXR1 in neurons significantly delays non-cell-autonomous neuroinflammatory response, classic complement system activation, and STAT3 activation through transcriptomic analysis of spinal cords of SOD1(G93A) mice. Taken together, these data identify OXR1 as the first neuron-specific antioxidant modulator of pathogenesis and disease progression in SOD1-mediated amyotrophic lateral sclerosis, and suggest that OXR1 may serve as a novel target for future therapeutic strategies. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain.

  2. Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

    Directory of Open Access Journals (Sweden)

    Jiexiong Feng

    Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

  3. Decreasing erucic acid level by RNAi-mediated silencing of fatty ...

    African Journals Online (AJOL)

    To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...

  4. SREBP-1c Gene Silencing can Decrease Lipid Deposits in Bovine Hepatocytes Cultured in Vitro

    Directory of Open Access Journals (Sweden)

    Qinghua Deng

    2014-05-01

    Full Text Available Background: Fatty liver is a major metabolic disorder that occurs during early lactation in high-producing dairy cows. Sterol regulatory element-binding protein-1c (SREBP-1c is an important transcription factor that regulates lipid synthesis by regulating the expression of lipid metabolism genes. Methods: In this study, we reduced the expression of SREBP-1c by adenovirus-mediated SREBP-1c with a low expression vector (AD-GFP-SREBP-1c to study the effects of SREBP-1c on lipid deposits in bovine hepatocytes. The expression levels and enzyme activities of SERBP-1c and its target genes were determined by real-time PCR, western blot, and ELISA. Results: These results showed that Ad-GFP-SREBP-1c could inhibit SREBP-1c expression. The expression of the lipid synthesis enzyme acetyl-CoA carboxylase (ACC was down-regulated. The expression levels of the lipid oxidation enzymes long-chain fatty acyl-COA synthetase (ACSL-1, carnitine palmitoyltransferase І (CPT-І, carnitine palmitoyltransferase II (CPT- II, and β-hydroxyacyl-CoA-DH (HADH were significantly elevated. Furthermore, the expression levels of factors involved in the assembly and transport of very low-density lipoproteins (VLDLs, such as apolipoprotein B100 (ApoB, apolipoprotein E (ApoE, and microsomal triglyceride transfer protein (MTTP were decreased comparison with the negative control and the blank control groups, but the low-density lipoprotein receptor (LDLR was elevated. The concentrations of TG (triglyceride and VLDL were also reduced. Conclusion: These data suggest that low SREBP-1c expression can decrease lipid synthesis, increase lipid oxidation, and decrease the TG and VLDL content in bovine hepatocytes.

  5. Silencing the expression of connexin 43 decreases inflammation and joint destruction in experimental arthritis.

    Science.gov (United States)

    Tsuchida, Shinji; Arai, Yuji; Kishida, Tsunao; Takahashi, Kenji A; Honjo, Kuniaki; Terauchi, Ryu; Inoue, Hiroaki; Oda, Ryo; Mazda, Osam; Kubo, Toshikazu

    2013-04-01

    The objective of the present study was to determine whether the expression of connexin 43 (Cx43) effected on inflammatory conditions in rat fibroblast-like synoviocytes (FLS) and on rat model of rheumatoid arthritis (RA). The expression of Cx43 in rat FLS stimulated with lipopolysaccharide (LPS) was confirmed by real-time reverse transcriptase polymerase chain reaction (RT-PCR). The effects of small-interfering RNA targeting Cx43 (siCx43) on pro-inflammatory cytokines and chemokine were assessed by real-time RT-PCR and enzyme-linked immunosorbent assay (ELISA). The therapeutic and side effects of siCx43 in a rat model of collagen-induced arthritis (CIA) were examined by in vivo electroporation method. LPS markedly enhanced Cx43 gene expression in rat FLS, with transfection of siCx43 suppressing the over-expression of pro-inflammatory cytokines and the chemokine. Treatment of CIA rats with siCx43 significantly ameliorated paw swelling, and significantly reduced histological arthritis scores and radiographic scores. In histological appearance of rat ankle joints, siCx43 treatment significantly decreased the number of tartrate-resistant acid phosphatase (TRAP)-positive (osteoclast-like) cells. These findings indicated that siCx43 had anti-inflammatory effects in rat FLS and efficiently inhibited the development of CIA. Cx43 may play an important role in the pathophysiology of RA, and may be a potential target molecule for novel RA therapies. Copyright © 2012 Orthopaedic Research Society.

  6. STAT6 silencing induces hepatocellular carcinoma-derived cell apoptosis and growth inhibition by decreasing the RANKL expression.

    Science.gov (United States)

    Qing, Tian; Yamin, Zhang; Guijie, Wang; Yan, Jin; Zhongyang, Shen

    2017-08-01

    Signal transducer and activator of transcription-6 (STAT6) is highly expressed in various human cancers and considered a regulator of multiple biological processes in cancers, including cell apoptosis. Evidence has indicated that STAT6 predicts a worse prognosis in hepatocellular carcinoma (HCC) patients. The objective of this study was to investigate the effects and mechanism of STAT6 in human HCC cells. We found that STAT6 silencing significantly inhibited HepG2 and Hep3B cell survival and proliferation. We observed that depletion of STAT6 increased HepG2 and Hep3B cell apoptosis by using a histone DNA ELISA detection kit. STAT6 silencing induced expression of apoptosis-associated genes Bax and caspase-3/7 and inhibited anti-apoptosis gene Bcl-2 levels. We also observed that STAT6 silencing downregulated the expression of receptor activator of NF-κB ligand (RANKL). Our results demonstrated that treatment with pcDNA3.1-RANKL abolished STAT6 depletion-induced HepG2 and Hep3B cell apoptosis and growth inhibition. Based on these findings, we believe that RANKL plays a major role in STAT6-induced HCC cell apoptosis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  7. Silencing of ACO decreases reproduction and energy metabolism in triazophos-treated female brown plant hoppers, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

    Science.gov (United States)

    Liu, Zong-Yu; Jiang, Yi-Ping; Li, Lei; You, Lin-Lin; Wu, You; Xu, Bin; Ge, Lin-Quan; Wu, Jin-Cai

    2016-03-01

    The brown plant hopper (BPH), Nilaparvata lugens Stål (Hemiptera: Delphacidae), is a major pest affecting rice in Asia, and outbreaks of this pest are closely linked to pesticide-induced stimulation of reproduction. Therefore, the BPH is a classic example of a resurgent pest. However, the effects of different genes on the regulation of pesticide-induced reproductive stimulation in the BPH are unclear. In this study, the regulatory effects of acyl-coenzyme A oxidase (ACO) on the reproduction and biochemistry of the BPH were investigated with gene silencing. The number of eggs laid per female by triazophos (TZP)+dsACO BPH females was significantly lower than those of TZP-treated (without ACO silencing) or TZP+GFP females (negative control), with the number of eggs decreasing by 30.8% (from 529.5 to 366.3) and 32.0% (from 540.5 to 366.3), respectively. The preoviposition period, oviposition period, and longevity of the TZP-treated females were also influenced by dsACO treatment. Additionally, the amounts of crude fat, protein, and some fatty acids (oleic acid, palmitic acid, linoleic acid, stearic acid, and myristoleic acid) in TZP+dsACO females were significantly lower than in TZP-treated females. Thus, ACO is one of the key genes regulating the TZP-induced stimulation of reproduction in BPH females. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

  9. Vacuolar invertase gene silencing in potato (Solanum tuberosum L. improves processing quality by decreasing the frequency of sugar-end defects.

    Directory of Open Access Journals (Sweden)

    Xiaobiao Zhu

    Full Text Available Sugar-end defect is a tuber quality disorder and persistent problem for the French fry processing industry that causes unacceptable darkening of one end of French fries. This defect appears when environmental stress during tuber growth increases post-harvest vacuolar acid invertase activity at one end of the tuber. Reducing sugars produced by invertase form dark-colored Maillard reaction products during frying. Acrylamide is another Maillard reaction product formed from reducing sugars and acrylamide consumption has raised health concerns worldwide. Vacuolar invertase gene (VInv expression was suppressed in cultivars Russet Burbank and Ranger Russet using RNA interference to determine if this approach could control sugar-end defect formation. Acid invertase activity and reducing sugar content decreased at both ends of tubers. Sugar-end defects and acrylamide in fried potato strips were strongly reduced in multiple transgenic potato lines. Thus vacuolar invertase silencing can minimize a long-standing French fry quality problem while providing consumers with attractive products that reduce health concerns related to dietary acrylamide.

  10. Performative Silences

    DEFF Research Database (Denmark)

    Dupret, Katia

    2018-01-01

    static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

  11. The silence.

    Science.gov (United States)

    Millenson, Michael L

    2003-01-01

    Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

  12. Amyloid-β and α-Synuclein Decrease the Level of Metal-Catalyzed Reactive Oxygen Species by Radical Scavenging and Redox Silencing

    DEFF Research Database (Denmark)

    Pedersen, Jeppe T; Chen, Serene W; Borg, Christian B

    2016-01-01

    formation of ROS in vitro in the presence of a biological reductant. We find that the levels of ROS, and the rate by which ROS is generated, are significantly reduced when Cu(2+) is bound to Aβ or αS, particularly when they are in their oligomeric or fibrillar forms. This effect is attributed...... to a combination of radical scavenging and redox silencing mechanisms. Our findings suggest that the increase in ROS associated with the accumulation of aggregated Aβ or αS does not result from a particularly ROS-active form of these peptides, but rather from either a local increase of Cu(2+) and other ROS...

  13. Interference RNA (RNAi)-based silencing of endogenous thrombopoietin receptor (Mpl) in Dami cells resulted in decreased hNUDC-mediated megakaryocyte proliferation and differentiation

    International Nuclear Information System (INIS)

    Pang, Shi-Feng; Li, Xiao-Kun; Zhang, Qiang; Yang, Fang; Xu, Peilin

    2009-01-01

    Recently our laboratory reported evidence showing that hNUDC acts as an additional cytokine for thrombopoietin receptor (Mpl). Previously known as the human homolog of a fungal nuclear migration protein, hNUDC plays a critical role in megakaryocyte differentiation and maturation. Here we sought to further clarify the hNUDC-Mpl ligand-receptor relationship by utilizing interference RNA (RNAi) to knockdown Mpl expression in a megakaryocyte cell line. We created U6 promoter driven constructs to express short hairpin RNAs (shRNA) with affinity for different sites on Mpl mRNA. By including Mpl-EGFP fusion protein in these constructs, we were able to effectively screen the shRNA that was most efficient in inhibiting Mpl mRNA expression. This shRNA was subsequently transferred into a lentivirus vector and transduced into Dami cells, a cell line which constitutively expresses endogenous Mpl. This lentiviral vector was also designed to simultaneously express EGFP to monitor transfection efficiency. Our results show that lentivirus can be used to effectively deliver shRNAs into Dami cells and cause specific inhibition of Mpl protein expression after transduction. Furthermore, we show the functional effects of shRNA-mediated Mpl silencing by demonstrating reduced hNUDC stimulated megakaryocyte proliferation and differentiation. Thus, the use of a RNAi knockdown strategy has allowed us to pinpoint the connection of hNUDC with Mpl in the regulation of megakaryocyte maturation.

  14. Lithium-induced neuroprotection in stroke involves increased miR-124 expression, reduced RE1-silencing transcription factor abundance and decreased protein deubiquitination by GSK3β inhibition-independent pathways.

    Science.gov (United States)

    Doeppner, Thorsten R; Kaltwasser, Britta; Sanchez-Mendoza, Eduardo H; Caglayan, Ahmet B; Bähr, Mathias; Hermann, Dirk M

    2017-03-01

    Lithium promotes acute poststroke neuronal survival, which includes mechanisms that are not limited to GSK3β inhibition. However, whether lithium induces long-term neuroprotection and enhanced brain remodeling is unclear. Therefore, mice were exposed to transient middle cerebral artery occlusion and lithium (1 mg/kg bolus followed by 2 mg/kg/day over up to 7 days) was intraperitoneally administered starting 0-9 h after reperfusion onset. Delivery of lithium no later than 6 h reduced infarct volume on day 2 and decreased brain edema, leukocyte infiltration, and microglial activation, as shown by histochemistry and flow cytometry. Lithium-induced neuroprotection persisted throughout the observation period of 56 days and was associated with enhanced neurological recovery. Poststroke angioneurogenesis and axonal plasticity were also enhanced by lithium. On the molecular level, lithium increased miR-124 expression, reduced RE1-silencing transcription factor abundance, and decreased protein deubiquitination in cultivated cortical neurons exposed to oxygen-glucose deprivation and in brains of mice exposed to cerebral ischemia. Notably, this effect was not mimicked by pharmacological GSK3β inhibition. This study for the first time provides efficacy data for lithium in the postacute ischemic phase, reporting a novel mechanism of action, i.e. increased miR-124 expression facilitating REST degradation by which lithium promotes postischemic neuroplasticity and angiogenesis.

  15. Silencing criticism in Mexico

    Directory of Open Access Journals (Sweden)

    Ximena Suárez

    2017-10-01

    Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

  16. Ombuds’ corner: Employee silence

    CERN Multimedia

    Vincent Vuillemin

    2013-01-01

    Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

  17. Silêncios Silences

    Directory of Open Access Journals (Sweden)

    Luciano Marcondes Godoy

    1999-01-01

    Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

  18. Memories Persist in Silence

    Directory of Open Access Journals (Sweden)

    Sandra Patricia Arenas Grisales

    2012-08-01

    Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

  19. Active compressor engine silencer reduces exhaust noise

    International Nuclear Information System (INIS)

    Denenberg, J.N.; Miller, S.K.; Jay, M.A.

    1994-01-01

    An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

  20. The Gift of Silence

    Science.gov (United States)

    Haskins, Cathleen

    2011-01-01

    Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

  1. Breaking the silence

    DEFF Research Database (Denmark)

    Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

    2012-01-01

    and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

  2. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  3. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  4. The Silence of Michelangelo

    DEFF Research Database (Denmark)

    Foote, Jonathan

    2016-01-01

    In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....

  5. Control of thermoacoustic instability with a drum-like silencer

    Science.gov (United States)

    Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng

    2017-10-01

    Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.

  6. Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

    Directory of Open Access Journals (Sweden)

    Rita Marta

    2014-10-01

    Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

  7. Voice and silence in organizations

    Directory of Open Access Journals (Sweden)

    Moaşa, H.

    2011-01-01

    Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

  8. "Listening Silence" and Its Discursive Effects

    Science.gov (United States)

    Applebaum, Barbara

    2016-01-01

    While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

  9. Bodies, Spaces, Voices, Silences

    Directory of Open Access Journals (Sweden)

    Donatella Mazzoleni

    2013-07-01

    Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

  10. Organizational Silence in Sports Employees

    Science.gov (United States)

    Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

    2016-01-01

    Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

  11. Silence, an Eye of Knowledge

    Science.gov (United States)

    Aghamohammadi, Mehdi

    2017-01-01

    One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

  12. Judicial review of administrative silence

    Directory of Open Access Journals (Sweden)

    Radošević Ratko S.

    2015-01-01

    Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

  13. Silence, an Eye of Knowledge

    Directory of Open Access Journals (Sweden)

    Mehdi Aghamohammadi

    2017-04-01

    Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

  14. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    . Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

  15. Communicative Silences: Forms and Functions

    Science.gov (United States)

    Bruneau, Thomas J.

    1973-01-01

    The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

  16. Breaching cultural silence: enhancing resilience among Ugandan ...

    African Journals Online (AJOL)

    Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

  17. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  18. [E. M. Jellinek's silenced and silencing transgenerational story].

    Science.gov (United States)

    Kelemen, Gábor; Márk, Mónika

    2013-01-01

    Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

  19. Silence

    Science.gov (United States)

    Cogswell, J.

    2011-06-01

    On the occasion of the International Year of Astronomy, I was commissioned to create a mural for the University of Michigan Department of Astronomy, responding to an array of scientific images based on astronomical research, with special focus on the work of University of Michigan astronomers carried out within the building. My paper illustrates the development of this and several subsequent projects, explaining the implications for my artistic practice of entering into this conversation with astronomers and their work.

  20. Hush… : The Dangers of Silence in Academic Libraries

    Directory of Open Access Journals (Sweden)

    Jessica Schomberg

    2017-04-01

    Full Text Available In Brief This article critiques the idea that civility rhetoric decreases workplace bullying or discrimination. We use Critical Discourse Analysis (CDA to do a rhetorical analysis of a campus-wide civility campaign in contrast with literature about civility in libraries. To combat discrimination and bullying, we need to be attentive to systemic power dynamics and to rhetoric designed to enforce compliance and conformity. We conclude with recommendations about how to raise our voices instead of silencing our peers.

  1. The dynamics and efficacy of antiviral RNA silencing: A model study

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-03-01

    Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

  2. How Silent is the Right to Silence?

    Directory of Open Access Journals (Sweden)

    Katherine Biber

    2012-11-01

    Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

  3. Tospovirus : induction and suppression of RNA silencing

    NARCIS (Netherlands)

    Hedil, Marcio

    2016-01-01

    While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

  4. Listen and the question of silence

    DEFF Research Database (Denmark)

    Doubinsky, Sebastien

    2018-01-01

    Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

  5. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2004-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  6. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2005-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  7. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2006-01-01

    ...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

  8. 5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

    Science.gov (United States)

    Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

    2017-08-01

    Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

  9. Silence as a Response to Everyday Violence

    DEFF Research Database (Denmark)

    Gammeltoft, Tine

    2016-01-01

    Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

  10. Epigenetic silencing of CYP24 in the tumor microenvironment

    Science.gov (United States)

    Johnson, Candace S.; Chung, Ivy; Trump, Donald L.

    2010-01-01

    Calcitriol (1,25 dihydroxycholecalciferol) has significant antitumor activity in vitro and in vivo in a number of tumor model systems. We developed a system for isolation of fresh endothelial cells from tumors and Matrigel environments which demonstrate that CYP24, the catabolic enzyme involved in vitamin D signaling, is epigenetically silenced selectively in tumor-derived endothelial cells (TDEC). TDEC maintain phenotypic characteristics which are distinct from endothelial cells isolated from normal tissues and from Matrigel plugs (MDEC). In TDEC, calcitriol induces G0/G1 arrest, modulates p27 and p21, and induces apoptotic cell death and decreases P-Erk and P-Akt. In contrast, endothelial cells isolated from normal tissues and MDEC are unresponsive to calcitriol-mediated anti-proliferative effects despite intact signaling through the vitamin D receptor (VDR). In TDEC, which is sensitive to calcitriol, the CYP24 promoter is hypermethylated in two CpG island regions located at the 5′end; this hypermethylation may contribute to gene silencing of CYP24. The extent of methylation in these two regions is significantly less in MDEC. Lastly, treatment of TDEC with a DNA methyltransferase inhibitor restores calcitriol-mediated induction of CYP24 and resistance to calcitriol. These data suggest that epigenetic silencing of CYP24 modulates cellular responses to calcitriol. PMID:20304059

  11. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts

    2012-01-01

    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  12. Public privacy: Reciprocity and Silence

    Directory of Open Access Journals (Sweden)

    Jenny Kennedy

    2014-10-01

    Full Text Available In his 1958 poem 'Dedication to my Wife' TS Eliot proclaims "these are private words addressed to you in public". Simultaneously written for his wife, Valerie Fletcher, and to the implied you of a discourse network, Eliot's poem helps to illustrate the narrative voices and silences that are constitutive of an intimate public sphere. This paper situates reciprocity as a condition of possibility for public privacy. It shows how reciprocity is enabled by systems of code operating through material and symbolic registers. Code promises to control communication, to produce neutral, systemic forms of meaning. Yet such automation is challenged by uneven and fragmented patterns of reciprocity. Moreover, examining the media of public privacy reveals historical trajectories important for understanding contemporary socio­technical platforms of reciprocity. To explore the implicit requirement of reciprocity in publicly private practices, three sites of communication are investigated framed by a media archaeology perspective: postal networks, the mail­art project PostSecret and the anonymous zine 'You'.

  13. Durability of timber silencers at Wairakei geothermal steam field

    Energy Technology Data Exchange (ETDEWEB)

    Hedley, M E

    1979-02-01

    After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.

  14. Titration and hysteresis in epigenetic chromatin silencing

    International Nuclear Information System (INIS)

    Dayarian, Adel; Sengupta, Anirvan M

    2013-01-01

    Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

  15. DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

    Science.gov (United States)

    Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

    2003-04-24

    Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

  16. Appetite - decreased

    Science.gov (United States)

    Loss of appetite; Decreased appetite; Anorexia ... Any illness can reduce appetite. If the illness is treatable, the appetite should return when the condition is cured. Loss of appetite can cause weight ...

  17. Discovery and characterization of ACT-335827, an orally available, brain penetrant orexin receptor type 1 selective antagonist.

    Science.gov (United States)

    Steiner, Michel A; Gatfield, John; Brisbare-Roch, Catherine; Dietrich, Hendrik; Treiber, Alexander; Jenck, Francois; Boss, Christoph

    2013-06-01

    Stress relief: Orexin neuropeptides regulate arousal and stress processing through orexin receptor type 1 (OXR-1) and 2 (OXR-2) signaling. A selective OXR-1 antagonist, represented by a phenylglycine-amide substituted tetrahydropapaverine derivative (ACT-335827), is described that is orally available, penetrates the brain, and decreases fear, compulsive behaviors and autonomic stress reactions in rats. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Calcium signalling silencing in atrial fibrillation.

    Science.gov (United States)

    Greiser, Maura

    2017-06-15

    Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

  19. Musashi-2 Silencing Exerts Potent Activity against Acute Myeloid Leukemia and Enhances Chemosensitivity to Daunorubicin.

    Directory of Open Access Journals (Sweden)

    Yixiang Han

    Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.

  20. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  1. Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.

    Science.gov (United States)

    Suhor, Charles

    1991-01-01

    Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)

  2. Histone Methylation and Epigenetic Silencing in Breast Cancer

    National Research Council Canada - National Science Library

    Simon, Jeffrey A; Lange, Carol A

    2008-01-01

    .... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

  3. Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

    Science.gov (United States)

    Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

    2017-08-15

    Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

  4. [Effects of ezrin silencing on pancreatic cancer cell line Panc-1].

    Science.gov (United States)

    Meng, Yun-xiao; Yu, Shuang-ni; Lu, Zhao-hui; Chen, Jie

    2012-12-01

    To explore the effects of ezrin silencing on pancreatic cancer cell line Panc-1. Pancreatic cancer cell line Panc-1 was transfected with ezrin silencing plasmid. The proliferation and the cell cycle status were determined by CCK-8 assay and flow cytometry analysis, respectively. Cellular membrane protrusions/microvilli formation were visualized by scanning election microscopy. Colony formation assay was used to determine the cell anchor-independent growth ability in vitro. Trans-filter migration and invasion assays were performed with 8 µm pore inserts in a 24-well BioCoat chamber with/without Matrigel. Ezrin silencing decreased cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion, but had no effects on cell proliferation in vitro and cell cycle, in pancreatic cancer cell line Panc-1. Ezrin expression affects the cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion in pancreatic cancer cell line Panc-1.

  5. Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

    Science.gov (United States)

    Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

    2017-05-01

    Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Silence in the second language classroom

    CERN Document Server

    King, J

    2013-01-01

    Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.

  7. Veiled Word(s) – Sacred Silence

    DEFF Research Database (Denmark)

    Isar, Nicoletta

    2014-01-01

    or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...

  8. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  9. PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

    2017-02-01

    Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  10. Mutuality, Self-Silencing, and Disordered Eating in College Women

    Science.gov (United States)

    Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.

    2006-01-01

    The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…

  11. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    NARCIS (Netherlands)

    Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

  12. After the Blackbird Whistles: Listening to Silence in Classrooms

    Science.gov (United States)

    Schultz, Katherine

    2010-01-01

    Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…

  13. Choosing Silence for Equality in and through Schooling

    Science.gov (United States)

    Lees, Helen E.

    2016-01-01

    This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…

  14. Patient safety: break the silence.

    Science.gov (United States)

    Johnson, Hope L; Kimsey, Diane

    2012-05-01

    A culture of patient safety requires commitment and full participation from all staff members. In 2008, results of a culture of patient safety survey conducted in the perioperative division of the Lehigh Valley Health Network in Pennsylvania revealed a lack of patient-centered focus, teamwork, and positive communication. As a result, perioperative leaders assembled a multidisciplinary team that designed a safety training program focusing on Crew Resource Management, TeamSTEPPS, and communication techniques. The team used video vignettes and an audience response system to engage learners and promote participation. Topics included using preprocedural briefings and postprocedural debriefings, conflict resolution, and assertiveness techniques. Postcourse evaluations showed that the majority of respondents believed they were better able to question the decisions or actions of someone with more authority. The facility has experienced a marked decrease in the number of incidents requiring a root cause analysis since the program was conducted. Copyright © 2012 AORN, Inc. Published by Elsevier Inc. All rights reserved.

  15. Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

    Directory of Open Access Journals (Sweden)

    Thibaut Josse

    2007-09-01

    Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

  16. Silencing Intersectin 1 Slows Orthotopic Neuroblastoma Growth in Mice.

    Science.gov (United States)

    Harris, Jamie; Herrero-Garcia, Erika; Russo, Angela; Kajdacsy-Balla, Andre; O'Bryan, John P; Chiu, Bill

    2017-11-01

    Neuroblastoma accounts for 15% of all pediatric cancer deaths. Intersectin 1 (ITSN1), a scaffold protein involved in phosphoinositide 3-kinase (PI3K) signaling, regulates neuroblastoma cells independent of MYCN status. We hypothesize that by silencing ITSN1 in neuroblastoma cells, tumor growth will be decreased in an orthotopic mouse tumor model. SK-N-AS neuroblastoma cells transfected with empty vector (pSR), vectors expressing scrambled shRNA (pSCR), or shRNAs targeting ITSN1 (sh#1 and sh#2) were used to create orthotopic neuroblastoma tumors in mice. Volume was monitored weekly with ultrasound. End-point was tumor volume >1000 mm. Tumor cell lysates were analyzed with anti-ITSN1 antibody by Western blot. Orthotopic tumors were created in all cell lines. Twenty-five days post injection, pSR tumor size was 917.6±247.7 mm, pSCR was 1180±159.9 mm, sh#1 was 526.3±212.8 mm, and sh#2 was 589.2±74.91 mm. sh#1-tumors and sh#2-tumors were smaller than pSCR (P=0.02), no difference between sh#1 and sh#2. Survival was superior in sh#2-tumors (P=0.02), trended towards improved survival in sh#1-tumors (P=0.09), compared with pSCR-tumors, no difference in pSR tumors. Western blot showed decreased ITSN1 expression in sh#1 and sh#2 compared with pSR and pSCR. Silencing ITSN1 in neuroblastoma cells led to decreased tumor growth in an orthotopic mouse model. Orthotopic animal models can provide insight into the role of ITSN1 pathways in neuroblastoma tumorigenesis.

  17. Epigenetic silencing of the DNA mismatch repair gene, MLH1, induced by hypoxic stress in a pathway dependent on the histone demethylase, LSD1

    Science.gov (United States)

    Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.

    2014-01-01

    SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185

  18. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  19. Underground laboratories: Cosmic silence, loud science

    Energy Technology Data Exchange (ETDEWEB)

    Coccia, Eugenio, E-mail: coccia@lngs.infn.i [Department of Physics, University of Rome ' Tor Vergata' and INFN Gran Sasso National Laboratory (Italy)

    2010-01-01

    Underground laboratories provide the low radioactive background environment necessary to host key experiments in the field of particle and astroparticle physics, nuclear astrophysics and other disciplines that can profit of their characteristics and of their infrastructures. The cosmic silence condition existing in these laboratories allows the search for extremely rare phenomena and the exploration of the highest energy scales that cannot be reached with accelerators. I briefly describe all the facilities that are presently in operation around the world.

  20. Silencing cinema: film censorship around the world

    OpenAIRE

    Biltereyst, Daniël; Vande Winkel, Roel

    2013-01-01

    Why does oppression by censorship affect the film industry far more frequently than any other mass media? "Silencing Cinema" brings together the key issues and authors to examine instances of film censorship throughout the world. Including essays by some of today's leading film historians, the book offers groundbreaking historical research on film censorship in major film production countries, including the United States, the United Kingdom, Russia/Soviet Union, India, China, and Nigeria, amo...

  1. Gas turbine exhaust system silencing design

    International Nuclear Information System (INIS)

    Ozgur, D.

    1991-01-01

    Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting

  2. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

    2010-01-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  3. Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

    Science.gov (United States)

    Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

    2018-02-01

    Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian

    2010-07-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  5. Conifers have a unique small RNA silencing signature

    OpenAIRE

    Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

    2008-01-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

  6. Small silencing RNAs: an expanding universe.

    Science.gov (United States)

    Ghildiyal, Megha; Zamore, Phillip D

    2009-02-01

    Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.

  7. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    International Nuclear Information System (INIS)

    Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

    2012-01-01

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  8. Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers

    Science.gov (United States)

    Ussher, Jane M.; Perz, Janette

    2010-01-01

    This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…

  9. Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans

    OpenAIRE

    Takahashi, Megumi; Takagi, Shin

    2017-01-01

    Feeding, a vital behavior in animals, is modulated depending on internal and external factors. In the nematode Caenorhabditis elegans, the feeding organ called the pharynx ingests food by pumping driven by the pharyngeal muscles. Here we report that optical silencing of the body wall muscles, which drive the locomotory movement of worms, affects pumping. In worms expressing the Arch proton pump or the ACR2 anion channel in the body wall muscle cells, the pumping rate decreases after activatio...

  10. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

    Science.gov (United States)

    Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

  11. Organizational Silence in Universities as the Predictor of Organizational Culture

    Directory of Open Access Journals (Sweden)

    Erkan YAMAN

    2014-04-01

    Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and

  12. Antiviral RNA silencing viral counter defense in plants

    NARCIS (Netherlands)

    Bucher, E.C.

    2006-01-01

    The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

  13. No-Big-Silence teeb klubituuri / Urmas Hännile

    Index Scriptorium Estoniae

    Hännile, Urmas

    2009-01-01

    Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar

  14. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    NARCIS (Netherlands)

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

  15. Chinanteco children’s silences in different classroom situations

    Directory of Open Access Journals (Sweden)

    Valeria Rebolledo Angulo

    2016-01-01

    Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.

  16. The RNA silencing pathway: the bits and pieces that matter.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

  17. Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

    Science.gov (United States)

    Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

  18. The ethics of silence: Does conflict of interest explain employee silence?

    Science.gov (United States)

    Anderson, James

    2018-03-01

    Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.

  19. The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence

    Directory of Open Access Journals (Sweden)

    Michael Gary Duncan

    2012-03-01

    Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.

  20. RNA interference: ready to silence cancer?

    Science.gov (United States)

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  1. MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

    Science.gov (United States)

    Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

    2014-01-01

    Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

  2. Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum.

    Directory of Open Access Journals (Sweden)

    Jose C Garcia-Garcia

    2009-06-01

    Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.

  3. Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

    Science.gov (United States)

    Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

    2017-09-11

    To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

    Science.gov (United States)

    Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

    2012-11-07

    CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

  5. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    OpenAIRE

    Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

  6. Silencing of beta-carotene hydroxylase increases total carotenoid and beta-carotene levels in potato tubers

    Directory of Open Access Journals (Sweden)

    Pizzichini Daniele

    2007-03-01

    Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.

  7. Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

    Science.gov (United States)

    Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

    2017-11-30

    Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Duplication of an upstream silencer of FZP increases grain yield in rice.

    Science.gov (United States)

    Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

    2017-11-01

    Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

  9. Metabolic engineering of potato tuber carotenoids through tuber-specific silencing of lycopene epsilon cyclase

    Directory of Open Access Journals (Sweden)

    Papacchioli Velia

    2006-06-01

    Full Text Available Abstract Background Potato is a major staple food, and modification of its provitamin content is a possible means for alleviating nutritional deficiencies. beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein, antheraxanthin, violaxanthin, and of xanthophyll esters. None of these carotenoids have provitamin A activity. Results We silenced the first dedicated step in the beta-epsilon- branch of carotenoid biosynthesis, lycopene epsilon cyclase (LCY-e, by introducing, via Agrobacterium-mediated transformation, an antisense fragment of this gene under the control of the patatin promoter. Real Time measurements confirmed the tuber-specific silencing of Lcy-e. Antisense tubers showed significant increases in beta-beta-carotenoid levels, with beta-carotene showing the maximum increase (up to 14-fold. Total carotenoids increased up to 2.5-fold. These changes were not accompanied by a decrease in lutein, suggesting that LCY-e is not rate-limiting for lutein accumulation. Tuber-specific changes in expression of several genes in the pathway were observed. Conclusion The data suggest that epsilon-cyclization of lycopene is a key regulatory step in potato tuber carotenogenesis. Upon tuber-specific silencing of the corresponding gene, beta-beta-carotenoid and total carotenoid levels are increased, and expression of several other genes in the pathway is modified.

  10. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

  11. Engineering nanoparticles to silence bacterial communication

    Directory of Open Access Journals (Sweden)

    Kristen Publicover Miller

    2015-03-01

    Full Text Available The alarming spread of bacterial resistance to traditional antibiotics has warranted the study of alternative antimicrobial agents. Quorum sensing is a chemical cell-to-cell communication mechanism utilized by bacteria to coordinate group behaviors and establish infections. Quorum sensing is integral to bacterial survival, and therefore provides a unique target for antimicrobial therapy. In this study, silicon dioxide nanoparticles (Si-NP were engineered to target the signaling molecules (i.e. acylhomoserine lactones (HSL used for quorum sensing in order to halt bacterial communication. Specifically, when Si-NP were surface functionalized with beta-cyclodextrin (beta-CD, then added to cultures of bacteria (Vibrio fischeri, whose luminous output depends upon HSL-mediated quorum sensing, the cell-to-cell communication was dramatically reduced. Reductions in luminescence were further verified by quantitative polymerase chain reaction (qPCR analyses of luminescence genes. Binding of AHLs to Si-NPs was examined using nuclear magnetic resonance (NMR spectroscopy. The results indicated that by delivering high concentrations of engineered NPs with associated quenching compounds, the chemical signals were removed from the immediate bacterial environment. In actively-metabolizing cultures, this treatment blocked the ability of bacteria to communicate and regulate quorum sensing, effectively silencing and isolating the cells. Si-NPs provide a scaffold and critical stepping-stone for more pointed developments in antimicrobial therapy, especially with regard to quorum sensing – a target that will reduce resistance pressures imposed by traditional antibiotics.

  12. Breaking the Silence: Feminism and Post humanism

    Directory of Open Access Journals (Sweden)

    Debika Saha

    2015-10-01

    Full Text Available Postmodernism starts its journey by challenging the master narratives of metaphysics and philosophy. In this journey the narrative get replaced either by an emancipation from narratives that claim to possess eternal truth or by a turn to a kind of informative technology. But both the ways keep at their centre the process of “denaturing” or disassociating something of its natural qualities. This postmodernist turn has now taken a new form. The choice is not limited between the natural body and the culturally constructed body, but between different areas of bodily reconstruction bearing different social and cultural implications. As Spivak in her famous writing raises the question «Can the subaltern speak?» In fact, Spivak narrates how the marginalized, the less privileged depend upon the benevolence of the more privileged. To engage with the other means not only to talk, listen, learn or know about her but also to identify with her. There must be some ways for open dialogues that can diminish the effects of cultural dominance. The imperial silence should be broken.

  13. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

    Science.gov (United States)

    Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

    2016-01-01

    This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

  14. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  15. ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL

    Directory of Open Access Journals (Sweden)

    Berta Bekti Retnawati

    2016-11-01

    Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity

  16. FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

    Science.gov (United States)

    Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

    2014-01-01

    Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

  17. The organisational silence of midwives and nurses: reasons and results.

    Science.gov (United States)

    Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra

    2016-07-01

    The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.

  18. Things talked about while we remain silence and things we’re silence about while talking: The starting assumptions for an anthropology of silence about the nearest past

    Directory of Open Access Journals (Sweden)

    Đerić Gordana

    2007-01-01

    Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.

  19. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  20. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

    2012-05-10

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  1. Silencing the Transcriptional Repressor, ZCT1, Illustrates the Tight Regulation of Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus Hairy Roots.

    Directory of Open Access Journals (Sweden)

    Noreen F Rizvi

    Full Text Available The Catharanthus roseus plant is the source of many valuable terpenoid indole alkaloids (TIAs, including the anticancer compounds vinblastine and vincristine. Transcription factors (TFs are promising metabolic engineering targets due to their ability to regulate multiple biosynthetic pathway genes. To increase TIA biosynthesis, we elicited the TIA transcriptional activators (ORCAs and other unidentified TFs with the plant hormone, methyl jasmonate (MJ, while simultaneously silencing the expression of the transcriptional repressor ZCT1. To silence ZCT1, we developed transgenic hairy root cultures of C. roseus that expressed an estrogen-inducible Zct1 hairpin for activating RNA interference. The presence of 17β-estradiol (5μM effectively depleted Zct1 in hairy root cultures elicited with MJ dosages that either optimize or inhibit TIA production (250 or 1000μM. However, silencing Zct1 was not sufficient to increase TIA production or the expression of the TIA biosynthetic genes (G10h, Tdc, and Str, illustrating the tight regulation of TIA biosynthesis. The repression of the TIA biosynthetic genes at the inhibitory MJ dosage does not appear to be solely regulated by ZCT1. For instance, while Zct1 and Zct2 levels decreased through activating the Zct1 hairpin, Zct3 levels remained elevated. Since ZCT repressors have redundant yet distinct functions, silencing all three ZCTs may be necessary to relieve their repression of alkaloid biosynthesis.

  2. Expression of cancer stem markers could be influenced by silencing of p16 gene in HeLa cervical carcinoma cells.

    Science.gov (United States)

    Wu, H; Zhang, J; Shi, H

    2016-01-01

    Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.

  3. Anti-viral RNA silencing: do we look like plants ?

    Directory of Open Access Journals (Sweden)

    Lecellier Charles-Henri

    2006-01-01

    Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

  4. Precedents and consequences of prosocial behaviors of voice and silence

    Directory of Open Access Journals (Sweden)

    Alicia Omar

    2015-09-01

    Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization. 

  5. Silencing by H-NS potentiated the evolution of Salmonella.

    Directory of Open Access Journals (Sweden)

    Sabrina S Ali

    2014-11-01

    Full Text Available The bacterial H-NS protein silences expression from sequences with higher AT-content than the host genome and is believed to buffer the fitness consequences associated with foreign gene acquisition. Loss of H-NS results in severe growth defects in Salmonella, but the underlying reasons were unclear. An experimental evolution approach was employed to determine which secondary mutations could compensate for the loss of H-NS in Salmonella. Six independently derived S. Typhimurium hns mutant strains were serially passaged for 300 generations prior to whole genome sequencing. Growth rates of all lineages dramatically improved during the course of the experiment. Each of the hns mutant lineages acquired missense mutations in the gene encoding the H-NS paralog StpA encoding a poorly understood H-NS paralog, while 5 of the mutant lineages acquired deletions in the genes encoding the Salmonella Pathogenicity Island-1 (SPI-1 Type 3 secretion system critical to invoke inflammation. We further demonstrate that SPI-1 misregulation is a primary contributor to the decreased fitness in Salmonella hns mutants. Three of the lineages acquired additional loss of function mutations in the PhoPQ virulence regulatory system. Similarly passaged wild type Salmonella lineages did not acquire these mutations. The stpA missense mutations arose in the oligomerization domain and generated proteins that could compensate for the loss of H-NS to varying degrees. StpA variants most able to functionally substitute for H-NS displayed altered DNA binding and oligomerization properties that resembled those of H-NS. These findings indicate that H-NS was central to the evolution of the Salmonellae by buffering the negative fitness consequences caused by the secretion system that is the defining characteristic of the species.

  6. FHL2 silencing reduces Wnt signaling and osteosarcoma tumorigenesis in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Julia Brun

    Full Text Available BACKGROUND: The molecular mechanisms that are involved in the growth and invasiveness of osteosarcoma, an aggressive and invasive primary bone tumor, are not fully understood. The transcriptional co-factor FHL2 (four and a half LIM domains protein 2 acts as an oncoprotein or as a tumor suppressor depending on the tissue context. In this study, we investigated the role of FHL2 in tumorigenesis in osteosarcoma model. METHODOLOGY/PRINCIPAL FINDINGS: Western blot analyses showed that FHL2 is expressed above normal in most human and murine osteosarcoma cells. Tissue microarray analysis revealed that FHL2 protein expression is high in human osteosarcoma and correlates with osteosarcoma aggressiveness. In murine osteosarcoma cells, FHL2 silencing using shRNA decreased canonical Wnt/β-catenin signaling and reduced the expression of Wnt responsive genes as well as of the key Wnt molecules Wnt5a and Wnt10b. This effect resulted in inhibition of osteosarcoma cell proliferation, invasion and migration in vitro. Using xenograft experiments, we showed that FHL2 silencing markedly reduced tumor growth and lung metastasis occurence in mice. The anti-oncogenic effect of FHL2 silencing in vivo was associated with reduced cell proliferation and decreased Wnt signaling in the tumors. CONCLUSION/SIGNIFICANCE: Our findings demonstrate that FHL2 acts as an oncogene in osteosarcoma cells and contributes to tumorigenesis through Wnt signaling. More importantly, FHL2 depletion greatly reduces tumor cell growth and metastasis, which raises the potential therapeutic interest of targeting FHL2 to efficiently impact primary bone tumors.

  7. siRNA-Mediated Silencing of doublesex during Female Development of the Dengue Vector Mosquito Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Keshava Mysore

    2015-11-01

    Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.

  8. Toward a science of silence: The consequences of leaving a memory unsaid

    DEFF Research Database (Denmark)

    Stone, Charles; Coman, Alin; Brown, Adam

    2012-01-01

    of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...

  9. Is our knowledge of voice and silence in organizations growing?

    DEFF Research Database (Denmark)

    Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine

    2016-01-01

    This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...

  10. RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION

    Directory of Open Access Journals (Sweden)

    Fitnat Nazlı Sayğan

    2011-07-01

    Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested

  11. A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

    Directory of Open Access Journals (Sweden)

    Tanurdzic Milos

    2004-04-01

    Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

  12. Friction coefficient measurements of silencers on specialized duct tract

    Directory of Open Access Journals (Sweden)

    Sehnalek Stanislav

    2016-01-01

    Full Text Available This article describes test methods on air duct track in Laboratory of Environmental Engineering. It focuses on measurement of silencer parameter like is pressure loss coeffcient. Firstly, the paper describe the measurement apparatus with description of calculation method by standard ISO 7235 and energy equation. Then the paper presents three ways how to accomplish measurement because such way is not covered by procedure in standard. Then follows the evaluation of results of measurements on three types of silencer designed for HVAC applications. The article is concluded with discussion over measured data with outline for further research.

  13. SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

    Science.gov (United States)

    Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

    2011-01-01

    In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

  14. Silencing VDAC1 Expression by siRNA Inhibits Cancer Cell Proliferation and Tumor Growth In Vivo

    Directory of Open Access Journals (Sweden)

    Tasleem Arif

    2014-01-01

    Full Text Available Alterations in cellular metabolism and bioenergetics are vital for cancer cell growth and motility. Here, the role of the mitochondrial protein voltage-dependent anion channel (VDAC1, a master gatekeeper regulating the flux of metabolites and ions between mitochondria and the cytoplasm, in regulating the growth of several cancer cell lines was investigated by silencing VDAC1 expression using small interfering RNA (siRNA. A single siRNA specific to the human VDAC1 sequence at nanomolar concentrations led to some 90% decrease in VDAC1 levels in the lung A549 and H358, prostate PC-3, colon HCT116, glioblastoma U87, liver HepG2, and pancreas Panc-1 cancer cell lines. VDAC1 silencing persisted 144 hours post-transfection and resulted in profound inhibition of cell growth in cancer but not in noncancerous cells, with up to 90% inhibition being observed over 5 days that was prolonged by a second transfection. Cells expressing low VDAC1 levels showed decreased mitochondrial membrane potential and adenoside triphosphate (ATP levels, suggesting limited metabolite exchange between mitochondria and cytosol. Moreover, cells silenced for VDAC1 expression showed decreased migration, even in the presence of the wound healing accelerator basic fibroblast growth factor (bFGF. VDAC1-siRNA inhibited cancer cell growth in a Matrigel-based assay in host nude mice. Finally, in a xenograft lung cancer mouse model, chemically modified VDAC1-siRNA not only inhibited tumor growth but also resulted in tumor regression. This study thus shows that VDAC1 silencing by means of RNA interference (RNAi dramatically inhibits cancer cell growth and tumor development by disabling the abnormal metabolic behavior of cancer cells, potentially paving the way for a more effective pipeline of anticancer drugs.

  15. Giving Voice: Narrating silence, history and memory in André Brink ...

    African Journals Online (AJOL)

    Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.

  16. Gendered Communication in Iranian University Classrooms: The Relationship between Politeness and Silence in Persian Culture

    Directory of Open Access Journals (Sweden)

    Saeedeh Shafiee Nahrkhalaji

    2013-05-01

    Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.

  17. Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.

    OpenAIRE

    Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki

    2011-01-01

    Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...

  18. PPAR-γ Silencing Inhibits the Apoptosis of A549 Cells by Upregulating Bcl-2

    Directory of Open Access Journals (Sweden)

    Jingyu YANG

    2013-03-01

    Full Text Available Background and objective Drug resistance is the one of primary causes of death in patients with lung cancer, PPAR-γ could induce the apoptosis and reverse drug resistance. The aim of this study is to investigate the expression of PPAR-γ on cisplatin sensitivity and apoptosis response of human lung cancer cell line A549. Methods Reconstruction of PPAR-γ silencing A549 cells (A549/PPAR-γ(- by siRNA. MTT assay was employed to determine the effect of cisplatin on the proliferation of A549/PPAR-γ(-, flow cytometry to determine the effect of cisplatin on the cell apoptosis, Western blot to determine the change of phosphorylation of Akt, caspase-3 and expression of bcl-2/bax. Finally, RT-PCR was employed to determine the transcriptional level of bcl-2. Results Two PPAR-γ silencing A549 cell clones were established successfully, and the expression of PPAR-γ was downregulated significantly as confirmed by RT-PCR and Western blot. After PPAR-γ silencing, the resistance of these two A549 clones to cisplatin was increased by 1.29-fold and 1.60-fold respectively. Flow cytometry showed that the apoptosis rate was decreased, and Western Blot showed that the phosphorylation of Akt and expression of bcl-2/bax were upregulated, caspase-3 was downregulated. Finally, RT-PCR showed that the transcriptional level of bcl-2 was upregulated as well. Conclusion Downregulation of PPAR-γ in A549 cells led to increase of cisplatin resistance. One of the mechanisms was upregulatin of phosphorylation of Akt and expression of bcl-2, which inhibited the apoptosis of cells. The downregulation of PPAR-γ is a possible mechanism that leads to the clinical drug resistance of cancer.

  19. RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

    Directory of Open Access Journals (Sweden)

    Jian Liu

    2014-01-01

    Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.

  20. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

    Directory of Open Access Journals (Sweden)

    Marcio Hedil

    2016-07-01

    Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  1. Speaking of Silence: Comments from an Irish Studies Perspective

    DEFF Research Database (Denmark)

    McQuaid, Sara Dybris; Beville, Maria

    2012-01-01

    argue that silence in its own right is a unique and important route to understanding the complexities of modern Ireland in cultural, contemporary and historical terms. This is true, not least in the case of Northern Ireland where the difficult struggle to construct a unified political consciousness...

  2. Breaking Classroom Silences: A View from Linguistic Ethnography

    Science.gov (United States)

    Rampton, Ben; Charalambous, Constadina

    2016-01-01

    This paper addresses potentially problematic classroom episodes in which someone foregrounds a social division that is normally taken for granted. It illustrates the way in which linguistic ethnography can unpack the layered processes that collide in the breaking of silence, showing how linguistic form and practice, individual positioning, local…

  3. Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

    Directory of Open Access Journals (Sweden)

    Sirjana Devi Shrestha

    Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

  4. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

    Science.gov (United States)

    Hedil, Marcio; Kormelink, Richard

    2016-07-23

    The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  5. Marie Nimier, au cœur du silence

    Directory of Open Access Journals (Sweden)

    Joëlle Papillon

    2012-01-01

    Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.

  6. Identification of a maize chlorotic dwarf virus silencing suppressor protein

    Science.gov (United States)

    Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

  7. Shame and Silence | Janz | South African Journal of Philosophy

    African Journals Online (AJOL)

    Samantha Vice's proposal on how to live in 'this strange place' of contemporary South Africa, includes an appeal to the concepts of shame and silence. In this paper, I use Emmanuel Levinas and Giorgio Agamben to move the discussion of shame from a moral to an existential question. The issue is not about how one ...

  8. Bureaucratic Constructions of Sexual Diversity: "Sensitive", "Controversial" and Silencing

    Science.gov (United States)

    Ullman, Jacqueline; Ferfolja, Tania

    2015-01-01

    National research illustrates the high degree of discrimination that prevails against lesbian, gay, bisexual, transgender and queer (LGBTQ) students resulting in diminished educational outcomes, both academic and social. This phenomenon is influenced by the prevalence of whole-school silences around LGBTQ topics in many Australian schools. This…

  9. 47 CFR 80.304 - Watch requirement during silence periods.

    Science.gov (United States)

    2010-10-01

    ....304 Section 80.304 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES STATIONS IN THE MARITIME SERVICES Safety Watch Requirements and Procedures Ship Station Safety Watches § 80.304 Watch requirement during silence periods. Each ship station operating on...

  10. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  11. Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity

    Directory of Open Access Journals (Sweden)

    Dawn Llewellyn

    2016-06-01

    Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.

  12. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  13. Relationship between Organizational Mobbing and Silence Behavior among Teachers

    Science.gov (United States)

    Hüsrevsahi, Selda Polat

    2015-01-01

    This study mainly aims to investigate the correlation between teachers' exposure to mobbing in their workplaces and their display of the act of silence. This study is based on a survey design where data from 312 teachers were collected and analyzed using correlation and regression analyses. Specifically, "The Structure and Dimensions of…

  14. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  15. Tacit Authorization : A Legal Solution for Administrative Silence

    NARCIS (Netherlands)

    Hoogstra, Nicole; de Graaf, K.J.

    2016-01-01

    This article discusses one of the current legal instruments to stimulate timely decision-making by administrative authorities, namely the ‘Lex silencio positivo’ or the ‘Silence is Consent’ rule. Tacit authorization prescribes that the license sought by the applicant will be granted automatically if

  16. Two classes of silencing RNAs move between C. elegans tissues

    Science.gov (United States)

    Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

    2011-01-01

    Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

  17. Surface functionalisation of PLGA nanoparticles for gene silencing

    DEFF Research Database (Denmark)

    Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

    2010-01-01

    . In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....

  18. The effects of thinking in silence on creativity and innovation

    NARCIS (Netherlands)

    de Vet, A.J.

    2007-01-01

    This dissertation consists of three empirical studies on the effects of thinking in silence on creativity and innovation. In these studies I use a social psychology and cognitive psychology lens to study creativity and innovation at the individual and at the team level of analysis, using randomized

  19. Resounding Silences : Subtle Norm Regulation in Everyday Interactions

    NARCIS (Netherlands)

    Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.

    In this article we suggest a mechanism for norm regulation that does not rely on explicit information exchange or costly reinforcement, but rather on the sensitivity of group members to social cues in their environment. We examine whether brief conversational silences can (a) signal a threat to

  20. Breaking the Silence Surrounding Mental Health on Campus

    Science.gov (United States)

    Roper, Larry D.

    2013-01-01

    Mentally ill students are able to participate in higher education at unprecedented rates. While colleges and universities have been responsive to the therapeutic needs, we have failed to successfully create supportive campus climates. Campus leaders are challenged to demonstrate ethical leadership that breaks the silence and confronts the stigma…

  1. Strategic Silence as a Tool of Political Communication: A Reflection ...

    African Journals Online (AJOL)

    Politics is said to be a game of intrigues and part of that is the use of silence as a means of communication. This may sound strange as communication itself connotes the art of expression. However in politics, a political actor may chose to remain silent as a means of passing a message across to the public in a trouble ...

  2. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  3. Assessment of RNAi-induced silencing in banana (Musa spp.).

    Science.gov (United States)

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

  4. Motor Responses and Weight Gaining in Neonates through Use of Two Methods of Earmuff and Receiving Silence in NICU

    Directory of Open Access Journals (Sweden)

    Z. Abdeyazdan

    2014-01-01

    Full Text Available Background and Aims. With technological advances in NICUs the survival rate of preterm infants has been increased. Because NICU environment is a potent source of stress for infants, its modification is an essential measure to decrease infants’ morbidity. The purposes of this study were to compare the effects of wearing earmuff and provision silence for infants on their motor responses and gaining weight. Methods. In a randomized clinical trial 96 preterm infants were enrolled. Their motor responses were evaluated for two consecutive days in the morning and afternoon shifts, in the groups of earmuff and silence, and at similar time points in the control group. Also their weight was measured at days 1 and 10. Results. In the two intervention groups, means of motor responses in infants were significantly less than in the control group, and weight gain of infants was more than the control group. However weight gain was more pronounced in the earmuff group. Conclusion. Both interventions led to decreasing number of motor responses and improvement of weight gain pattern, but these effects were more pronounced in earmuff group; thus because implementation of silence in NICUs has many barriers, it is suggested to use earmuff for preterm infants in these units. This trial obtained IRCT registration number IRCT2012092010812N2.

  5. Motor responses and weight gaining in neonates through use of two methods of earmuff and receiving silence in NICU.

    Science.gov (United States)

    Abdeyazdan, Z; Ghasemi, S; Marofi, M; Berjis, N

    2014-01-01

    With technological advances in NICUs the survival rate of preterm infants has been increased. Because NICU environment is a potent source of stress for infants, its modification is an essential measure to decrease infants' morbidity. The purposes of this study were to compare the effects of wearing earmuff and provision silence for infants on their motor responses and gaining weight. In a randomized clinical trial 96 preterm infants were enrolled. Their motor responses were evaluated for two consecutive days in the morning and afternoon shifts, in the groups of earmuff and silence, and at similar time points in the control group. Also their weight was measured at days 1 and 10. In the two intervention groups, means of motor responses in infants were significantly less than in the control group, and weight gain of infants was more than the control group. However weight gain was more pronounced in the earmuff group. Both interventions led to decreasing number of motor responses and improvement of weight gain pattern, but these effects were more pronounced in earmuff group; thus because implementation of silence in NICUs has many barriers, it is suggested to use earmuff for preterm infants in these units. This trial obtained IRCT registration number IRCT2012092010812N2.

  6. Eloquent silences: A musical and lexical analysis of conversation between oncologists and their patients.

    Science.gov (United States)

    Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald

    2016-10-01

    Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Néstor García

    2017-12-01

    Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

  8. The propensity to bi-stability of bursting and silence of the leech heart interneuron

    Science.gov (United States)

    Malaschenko, Tatiana; Williams, Diana; Shilnikov, Andrey; Cymbalyuk, Gennady

    2009-11-01

    Bursting is one of primary activity regimes of neurons. Our previous study was focused on determining a generic biophysical mechanism underlying the transition between bursting and silence and the co-existence of these two regimes observed in a neuron model. We show that this co-existence can be explained by the unstable sub-threshold oscillations (USTO) separating silence and bursting. The range of the controlling parameters, where the co-existence is observed, is limited by the critical values of the system at which the Andronov-Hopf and homoclinic bifurcations occur. We investigate how different parameters of the model affect the width of the co-existence area. We study the effects of the variations of maximal conductances of every voltage-dependent current. The influence of each current was tested individually, one at the time. We found that only two of them had a significant effect on the range of co-existence. The increase of the maximal conductance of the hyperpolarization-activated cationic current Ih would expand the area of co-existence. The decrease of the conductance of the LVA fast Ca^2+ current has the opposite effect.

  9. The orphan nuclear receptor GCNF recruits DNA methyltransferase for Oct-3/4 silencing

    International Nuclear Information System (INIS)

    Sato, Noriko; Kondo, Mitsumasa; Arai, Ken-ichi

    2006-01-01

    Somatic DNA methylation patterns are determined in part by the de novo methylation that occurs after early embryonic demethylation. Oct-3/4, a pluripotency gene, is unmethylated in the blastocyst, but undergoes de novo methylation and silencing during gastrulation. Here we show that the transcriptional repressor GCNF recruits DNA methyltransferase to the Oct-3/4 promoter and facilitates its methylation. Although acetylation of histone H3 at lysine 9 (K9) and/or 14 (K14) and methylation of H3 at lysine 4 (K4) decrease during this period, as do Oct-3/4 transcript levels, H3K9 and H3K27 methylation levels remain constant, indicating that DNA methylation does not require repressive histone modifications. We found that GCNF interacts directly with Dnmt3 molecule(s) and verified that this interaction induces the methylation of the Oct-3/4 promoter. Our finding suggests a model in which differentiation-induced GCNF recruits de novo DNA methyltransferase and facilitates the silencing of a pluripotency gene

  10. Silencing, positive selection and parallel evolution: busy history of primate cytochromes C.

    Science.gov (United States)

    Pierron, Denis; Opazo, Juan C; Heiske, Margit; Papper, Zack; Uddin, Monica; Chand, Gopi; Wildman, Derek E; Romero, Roberto; Goodman, Morris; Grossman, Lawrence I

    2011-01-01

    Cytochrome c (cyt c) participates in two crucial cellular processes, energy production and apoptosis, and unsurprisingly is a highly conserved protein. However, previous studies have reported for the primate lineage (i) loss of the paralogous testis isoform, (ii) an acceleration and then a deceleration of the amino acid replacement rate of the cyt c somatic isoform, and (iii) atypical biochemical behavior of human cyt c. To gain insight into the cause of these major evolutionary events, we have retraced the history of cyt c loci among primates. For testis cyt c, all primate sequences examined carry the same nonsense mutation, which suggests that silencing occurred before the primates diversified. For somatic cyt c, maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses yielded the same tree topology. The evolutionary analyses show that a fast accumulation of non-synonymous mutations (suggesting positive selection) occurred specifically on the anthropoid lineage root and then continued in parallel on the early catarrhini and platyrrhini stems. Analysis of evolutionary changes using the 3D structure suggests they are focused on the respiratory chain rather than on apoptosis or other cyt c functions. In agreement with previous biochemical studies, our results suggest that silencing of the cyt c testis isoform could be linked with the decrease of primate reproduction rate. Finally, the evolution of cyt c in the two sister anthropoid groups leads us to propose that somatic cyt c evolution may be related both to COX evolution and to the convergent brain and body mass enlargement in these two anthropoid clades.

  11. Simultaneous silencing of two arginine decarboxylase genes alters development in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Diana eSánchez-Rangel

    2016-03-01

    Full Text Available Polyamines (PAs are small aliphatic polycations that are found ubiquitously in all organisms. In plants, PAs are involved in diverse biological processes such as growth, development, and stress responses. In Arabidopsis thaliana, the arginine decarboxylase enzymes (ADC1 and 2 catalyze the first step of PA biosynthesis. For a better understanding of PA biological functions, mutants in PA biosynthesis have been generated; however, the double adc1/adc2 mutant is not viable in A. thaliana. In this study, we generated non-lethal A. thaliana lines through an artificial microRNA that simultaneously silenced the two ADC genes (amiR:ADC. The generated transgenic lines (amiR:ADC-L1 and -L2 showed reduced AtADC1 and AtADC2 transcript levels. For further analyses the amiR:ADC-L2 line was selected. We found that the amiR:ADC-L2 line showed a significant decrease of their PA levels. The co-silencing revealed a stunted growth in A. thaliana seedlings, plantlets and delay in its flowering rate; these phenotypes were reverted with PA treatment. In addition, amiR:ADC-L2 plants displayed two seed phenotypes, such as yellow and brownish seeds. The yellow mutant seeds were smaller than adc1, adc2 mutants and wild type seeds; however, the brownish were the smallest seeds with arrested embryos at the torpedo stage. These data reinforce the importance of PA homeostasis in the plant development processes.

  12. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

    Directory of Open Access Journals (Sweden)

    Liu X

    2016-04-01

    Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial

  13. Effects of gene silencing of CypB on gastric cancer cells.

    Science.gov (United States)

    Guo, Feng; Zhang, Ying; Zhao, Chun-Na; Li, Lin; Guo, Yan-Jun

    2015-04-01

    To determine the effect of gene silencing of cyclophilin B (CypB) on growth and proliferation of gastric cancer cells. CypB siRNA lentivirus (LV-CypB-si) and control lentivirus (LV-si-con) were produced. CypB expression in gastric cancer cell lines was detected by Western blot. BGC823 and SGC7901 cells were chosen to be infected with LV-si-con and LV-CypB-si, and stable transfectants were isolated. The cell groups transfected with LV-CypB-siRNA, LV-siRNA-con and transfected no carrier were served as the experimental group, the implicit control group and the blank control group respectively. MTT and colony formation assays were used to examine the effect of CypB on the cell growth and proliferation in vitro. Cell cycle was analyzed with flow cytometry. The expression of VEGFR of BGC823-si and SGC7901-si was detected by Western blot. Gene silencing of CypB can inhibit gastric cancer cell growth, proliferation, cell cycle progress and tumorigenesis. CypB expression level was obviously higher in SGC7901 and BGC823 than MKN28 and GES. These two cell lines were infected with LV-si-con and LV-CypB-si respectively. MTT and cloney formation assays showed a significantly decreased rate of cell proliferation from the forth day or the fifth day in cells transfected with LV-CypB-si (PCypB resulted in slightly decreased percentage of S phase and increased percentage of G1 (PCypB could promote the G1-S transition of gastric cancer cell. In addition, the expression of VEGF of BGC823 and SGC7901 transfected with CypB siRNA was reduced in comparison with the implicit control group and the blank control group. Gene silencing of CypB decreases gastric cancer cells proliferation and in vivo tumorigenesis. These findings indiccate CypB could be a potential biomarker and therapeutic target for gastric cancer. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

  14. HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

    Directory of Open Access Journals (Sweden)

    Lehto Kirsi

    2011-04-01

    Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

  15. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  16. Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer.

    Science.gov (United States)

    Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène

    2007-11-01

    Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

  17. The great silence science and philosophy of Fermi's paradox

    CERN Document Server

    Cirkovic, Milan M

    2018-01-01

    The Great Silence explores the multifaceted problem named after the great Italian physicist Enrico Fermi and his legendary 1950 lunchtime question "Where is everybody?" In many respects, Fermi's paradox is the richest and the most challenging problem for the entire field of astrobiology and the Search for ExtraTerrestrial Intelligence (SETI) studies. This book shows how Fermi's paradox is intricately connected with many fields of learning, technology, arts, and even everyday life. It aims to establish the strongest possible version of the problem, to dispel many related confusions, obfuscations, and prejudices, as well as to offer a novel point of entry to the many solutions proposed in existing literature. Cirkovic argues that any evolutionary worldview cannot avoid resolving the Great Silence problem in one guise or another.

  18. An analysis of suppressing migratory effect on human urinary bladder cancer cell line by silencing of snail-1.

    Science.gov (United States)

    Salehi, Shima; Mansoori, Behzad; Mohammadi, Ali; Davoudian, Sadaf; Musavi Shenas, Seyed Mohammad Hossein; Shajari, Neda; Majidi, Jafar; Baradaran, Behzad

    2017-12-01

    Snail-1 actively participates in tumor progression, invasion, and migration. Targeting snail-1 expression can suppress the EMT process in cancer. The aim of this study was to investigate the effect of snail1 silencing on urinary bladder cancer. Quantitative RT-PCR was used to detect snail-1 and other related metastatic genes expression following siRNA knockdown in urinary bladder cancer EJ-138 cells. The protein level of snail1 was assessed by Western blot. MTT and TUNEL assays were assessed to understand if snail-1 had survival effects on EJ-138 cells. Scratch wound healing assay measured cell motility effects after snail1 suppression. The significant silencing of snail-1 reached 60pmol siRNA in a 48-h post-transfection. The result of scratch assay showed that snail-1 silencing significantly decreased Vimentin, MMPs, and CXCR4 expression; however, expression of E-cadherin was induced. The cell death assay indicated that snail-1 played the crucial role in bladder cancer survival rate. These results propose that snail-1 plays a major role in the progression and migration of urinary bladder cancer, and can be a potential therapeutic target for target therapy of invasive urinary bladder cancer. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  19. Optical silencing of C. elegans cells with arch proton pump.

    Directory of Open Access Journals (Sweden)

    Ayako Okazaki

    Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.

  20. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

  1. Organizational Silence: suatu Penghambat dalam Mewujudkan Kreatifitas Organisasional

    OpenAIRE

    Retnawati, Berta Bekti

    2003-01-01

    There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and...

  2. Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

    Science.gov (United States)

    Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

    2017-12-01

    Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

  3. Silencing of a putative immunophilin gene in the cattle tick Rhipicephalus (Boophilus microplus increases the infection rate of Babesia bovis in larval progeny

    Directory of Open Access Journals (Sweden)

    Knowles Donald P

    2009-11-01

    Full Text Available Abstract Background The cattle tick Rhipicephalus (Boophilus microplus is involved in the transmission of the protozoan Babesia bovis, the etiological agent of bovine babesiosis. Interactions between ticks and protozoa are poorly understood and the investigation of tick genes that affect tick fitness and protozoan infection can set the stage for dissecting the molecular interactions between the two species. Results In this study, RNA interference was used to silence R. microplus genes that had been previously shown to be up-regulated in response to B. bovis infection. The silencing of a putative immunophilin gene (Imnp in female ticks fed on a calf acutely infected with B. bovis decreased the hatching rate and survival of larval progeny. Interestingly, Imnp was up-regulated significantly in ovaries of R. microplus in response to B. bovis infection and its silencing in female ticks significantly increased the infection rate of the protozoan in larval progeny. The results also showed that the silencing of a putative Kunitz-type serine protease inhibitor (Spi gene and a putative lipocalin (Lpc gene decreased the fitness of R. microplus females, but had no significant effect on the infection rate of B. bovis in larval progeny. Conclusion The silencing of the Imnp, Spi or Lpc genes decreased the fitness of R. microplus females fed on a calf during acute B. bovis infection. The Imnp gene data suggest that this putative immunophilin gene is involved in the defense system of R. microplus against B. bovis and may play a role in controlling the protozoan infection in tick ovaries and larval progeny.

  4. Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.

    Science.gov (United States)

    Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni

    2015-12-02

    Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. The Application of Coconut Fiber as Dissipative Silencer

    Science.gov (United States)

    Madlan, M. A.; Ghazali, M. I.; Zaman, I.; Kasron, M. Z.; Ying, T. C.

    2017-01-01

    Heat ventilation air conditioning system (HVAC) is one of the ducting systems that broadly applied in the building. There are HVAC silencers in the market, however the sound absorptive material commonly used is mineral wool. In this research study, a sound absorptive material made of coconut fiber was tested to identify its performance as a potential replacement of green material for ducting silencer. The experiment was carried out in a testing apparatus that follows the BS EN ISO 11691:2009 standard. Different configurations of sound absorptive material and contents of coconut fiber were investigated in the study. The trend of insertion loss at 1/3 octave frequency was identified where at frequency below 3000Hz, the insertion loss of dissipative silencer is observed high at certain frequency with a very narrow range. At 3000Hz, the insertion loss of 4dB to 6dB is constant until 4000Hz and drops until 5000Hz before it increases again steadily up to 13dB at 10000Hz. A similar trend was observed for different configuration of sound absorptive material. Despite the configuration different, the outcome shows that the insertion loss is increasing with higher content of coconut fiber.

  6. Conifers have a unique small RNA silencing signature.

    Science.gov (United States)

    Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J

    2008-08-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

  7. Silencing Deafness: Displacing Disability in the Nineteenth Century

    Directory of Open Access Journals (Sweden)

    Esme Cleall

    2015-03-01

    Full Text Available This article traces the way in which the language of displacement and silence were used in nineteenth-century discussions of deafness and connects this tendency to the marginalised place deaf experience occupies historically. Throughout the nineteenth century, a period which saw the consolidation of ‘the deaf and dumb’ as a social category, the word ‘forgetting’ crept into numerous discussions of deafness by both deaf and hearing commentators. Some, such as the educationalist Alexander Graeme Bell, were overt in their desire to forget deafness, demanding disability was ‘bred out’ and deaf culture condemned to the forgotten past. Others used the term ambivalently and sometimes metaphorically discussing the deaf as ‘forgotten’ by society, and ‘children of silence’. Some even pleaded that people who were deaf were not forgotten. But, though varied, the use of the imagery of forgetting and silence to evoke deafness is recurrent, and may, therefore, be seen to reveal something about how deaf experience can be approached as a displacement where deafness was spatially and imaginatively marginalised. I argue that one of the consequences of the conceptual framing of deafness through the language of forgetting was actively to silence deafness and to neutralise the idea that disability should be marginal and could be forgotten.

  8. MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

    Science.gov (United States)

    Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

    2014-01-01

    Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

  9. MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

    Directory of Open Access Journals (Sweden)

    Bushuai Zhong

    Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

  10. Characterization of a Brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts.

    Science.gov (United States)

    Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S

    2006-11-01

    Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.

  11. Decreasing Relative Risk Premium

    DEFF Research Database (Denmark)

    Hansen, Frank

    relative risk premium in the small implies decreasing relative risk premium in the large, and decreasing relative risk premium everywhere implies risk aversion. We finally show that preferences with decreasing relative risk premium may be equivalently expressed in terms of certain preferences on risky......We consider the risk premium demanded by a decision maker with wealth x in order to be indifferent between obtaining a new level of wealth y1 with certainty, or to participate in a lottery which either results in unchanged present wealth or a level of wealth y2 > y1. We define the relative risk...... premium as the quotient between the risk premium and the increase in wealth y1–x which the decision maker puts on the line by choosing the lottery in place of receiving y1 with certainty. We study preferences such that the relative risk premium is a decreasing function of present wealth, and we determine...

  12. Decreasing Serial Cost Sharing

    DEFF Research Database (Denmark)

    Hougaard, Jens Leth; Østerdal, Lars Peter

    The increasing serial cost sharing rule of Moulin and Shenker [Econometrica 60 (1992) 1009] and the decreasing serial rule of de Frutos [Journal of Economic Theory 79 (1998) 245] have attracted attention due to their intuitive appeal and striking incentive properties. An axiomatic characterization...... of the increasing serial rule was provided by Moulin and Shenker [Journal of Economic Theory 64 (1994) 178]. This paper gives an axiomatic characterization of the decreasing serial rule...

  13. Decreasing serial cost sharing

    DEFF Research Database (Denmark)

    Hougaard, Jens Leth; Østerdal, Lars Peter Raahave

    2009-01-01

    The increasing serial cost sharing rule of Moulin and Shenker (Econometrica 60:1009-1037, 1992) and the decreasing serial rule of de Frutos (J Econ Theory 79:245-275, 1998) are known by their intuitive appeal and striking incentive properties. An axiomatic characterization of the increasing serial...... rule was provided by Moulin and Shenker (J Econ Theory 64:178-201, 1994). This paper gives an axiomatic characterization of the decreasing serial rule....

  14. DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Sizolwenkosi Mlotshwa

    2008-03-01

    Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

  15. Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

    Science.gov (United States)

    Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

    2016-11-01

    Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

  16. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  17. Decreasing relative risk premium

    DEFF Research Database (Denmark)

    Hansen, Frank

    2007-01-01

    such that the corresponding relative risk premium is a decreasing function of present wealth, and we determine the set of associated utility functions. We find a new characterization of risk vulnerability and determine a large set of utility functions, closed under summation and composition, which are both risk vulnerable...

  18. Decreasing asthma morbidity

    African Journals Online (AJOL)

    1994-12-12

    Dec 12, 1994 ... Apart from the optimal use of drugs, various supplementary methods have been tested to decrease asthma morbidity, usually in patients from reiatively affluent socio-economic backgrounds. A study of additional measures taken in a group of moderate to severe adult asthmatics from very poor socio- ...

  19. Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

    Science.gov (United States)

    Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

    2016-06-17

    In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

  20. Analysing the significance of silence in qualitative interviewing: questioning and shifting power relations

    DEFF Research Database (Denmark)

    Bengtsson, Tea Torbenfeldt; Fynbo, Lars

    2017-01-01

    In this article we analyse the significance of silence in qualitative interviews with 36 individuals interviewed about high-risk, illegal activities. We describe how silence expresses a dynamic power relationship between interviewer and interviewee. In the analysis, we focus on two different types...... significant data. We conclude that silence constitutes possibilities for interviewees and interviewers to handle the complex power at play in qualitative interviewing either by maintaining or by losing control of the situation....

  1. Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

    Science.gov (United States)

    Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

    2016-09-15

    Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  2. Exon silencing by UAGG motifs in response to neuronal excitation.

    Directory of Open Access Journals (Sweden)

    Ping An

    2007-02-01

    Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.

  3. Silent God in a Wordy World. Silence in Ignatian Spirituality

    OpenAIRE

    García de Castro Valdés, S.J., José

    2016-01-01

    The Society of Jesus is an apostolic religious order involved in many different activities and missions. Jesuits live far away from monasteries and strict contemplative life. Nevertheless, one of the most well-known peculiarities of the Ignatian Spiritual Exercises is that a complete and absolute silence is required during the time of the retreat. Where and how should we place “silence” in the life of an Ignatian spiritual and mystical experience?

  4. Sibling violence silenced: rivalry, competition, wrestling, playing, roughhousing, benign.

    Science.gov (United States)

    Phillips, Debby A; Phillips, Kate H; Grupp, Kitty; Trigg, Lisa J

    2009-01-01

    In this article, sibling violence and the silence surrounding it is explicated through professional literature and research findings, exemplars from clinical practice, and statistics. Theoretical positions and discourse analysis have been used to help explain how regular broken bones, bruises, lacerations, and verbal humiliation can be minimized as normal sibling rivalry or roughhousing, which does not cause serious consequences. Nursing should be on the front lines of ending practices of violence. Recognizing sibling violence as such is part of this work and is a social justice issue.

  5. PERK silence inhibits glioma cell growth under low glucose stress by blockage of p-AKT and subsequent HK2's mitochondria translocation

    KAUST Repository

    Hou, Xu

    2015-03-12

    Glioma relies on glycolysis to obtain energy and sustain its survival under low glucose microenvironment in vivo. The mechanisms on glioma cell glycolysis regulation are still unclear. Signaling mediated by Double-stranded RNA-activated protein kinase (PKR) - like ER kinase (PERK) is one of the important pathways of unfolded protein response (UPR) which is comprehensively activated in cancer cells upon the hypoxic and low glucose stress. Here we show that PERK is significantly activated in human glioma tissues. PERK silencing results in decreased glioma cell viability and ATP/lactate production upon low glucose stress, which is mediated by partially blocked AKT activation and subsequent inhibition of Hexokinase II (HK2)\\'s mitochondria translocation. More importantly, PERK silenced glioma cells show decreased tumor formation capacity. Our results reveal that PERK activation is involved in glioma glycolysis regulation and may be a potential molecular target for glioma treatment.

  6. PERK silence inhibits glioma cell growth under low glucose stress by blockage of p-AKT and subsequent HK2's mitochondria translocation

    KAUST Repository

    Hou, Xu; Liu, Yaohua; Liu, Huailei; Chen, Xin; Liu, Min; Che, Hui; Guo, Fei; Wang, Chunlei; Zhang, Daming; Wu, Jianing; Chen, Xiaofeng; Shen, Chen; Li, Chenguang; Peng, Fei; Bi, Yunke; Yang, Zhuowen; Yang, Guang; Ai, Jing; Gao, Xin; Zhao, Shiguang

    2015-01-01

    Glioma relies on glycolysis to obtain energy and sustain its survival under low glucose microenvironment in vivo. The mechanisms on glioma cell glycolysis regulation are still unclear. Signaling mediated by Double-stranded RNA-activated protein kinase (PKR) - like ER kinase (PERK) is one of the important pathways of unfolded protein response (UPR) which is comprehensively activated in cancer cells upon the hypoxic and low glucose stress. Here we show that PERK is significantly activated in human glioma tissues. PERK silencing results in decreased glioma cell viability and ATP/lactate production upon low glucose stress, which is mediated by partially blocked AKT activation and subsequent inhibition of Hexokinase II (HK2)'s mitochondria translocation. More importantly, PERK silenced glioma cells show decreased tumor formation capacity. Our results reveal that PERK activation is involved in glioma glycolysis regulation and may be a potential molecular target for glioma treatment.

  7. Selective elimination/RNAi silencing of FMRF-related peptides and their receptors decreases the locomotor activity in Drosophila melanogaster

    Czech Academy of Sciences Publication Activity Database

    Kiss, B.; Szlanka, T.; Zvara, Á.; Žurovec, Michal; Šerý, Michal; Kakaš, Štefan; Ramasz, B.; Hegedűs, Z.; Lukacsovich, T.; Puskás, L.; Fónagy, A.; Kiss, I.

    2013-01-01

    Roč. 191, SEP 15 (2013), s. 137-145 ISSN 0016-6480 Institutional support: RVO:60077344 Keywords : Drosophila melanogaster * FMRF-related peptides * G protein-coupled receptors Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.674, year: 2013 http://www.sciencedirect.com/science/article/pii/S0016648013002621

  8. Novel siRNA delivery system using a ternary polymer complex with strong silencing effect and no cytotoxicity.

    Science.gov (United States)

    Kodama, Yukinobu; Shiokawa, Yumi; Nakamura, Tadahiro; Kurosaki, Tomoaki; Aki, Keisei; Nakagawa, Hiroo; Muro, Takahiro; Kitahara, Takashi; Higuchi, Norihide; Sasaki, Hitoshi

    2014-01-01

    We developed a novel small interfering RNA (siRNA) delivery system using a ternary complex with polyethyleneimine (PEI) and γ-polyglutamic acid (γ-PGA), which showed silencing effect and no cytotoxicity. The binary complexes of siRNA with PEI were approximately 73-102 nm in particle size and 45-52 mV in ζ-potential. The silencing effect of siRNA/PEI complexes increased with an increase of PEI, and siRNA/PEI complexes with a charge ratio greater than 16 showed significant luciferase knockdown in a mouse colon carcinoma cell line regularly expressing luciferase (Colon26/Luc cells). However, strong cytotoxicity and blood agglutination were observed in the siRNA/Lipofectamine complex and siRNA/PEI16 complex. Recharging cationic complexes with an anionic compound was reported to be a promising method for overcoming these toxicities. We therefore prepared ternary complexes of siRNA with PEI (charge ratio 16) by the addition of γ-PGA to reduce cytotoxicity and deliver siRNA. As expected, the cytotoxicity of the ternary complexes decreased with an increase of γ-PGA content, which decreased the ζ-potential of the complexes. A strong silencing effect comparable to siRNA/Lipofectamine complex was discovered in ternary complexes including γ-PGA with an anionic surface charge. The high incorporation of ternary complexes into Colon26/Luc cells was confirmed with fluorescence microcopy. Having achieved knockdown of an exogenously transfected gene, the ability of the complex to mediate knockdown of an endogenous housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), was assessed in B16-F10 cells. The ternary complex (siRNA/PEI16/γ-PGA12 complex) exhibited a significant GAPDH knockdown effect. Thus, we developed a useful siRNA delivery system.

  9. Proline oxidase silencing induces proline-dependent pro-survival pathways in MCF-7 cells

    Science.gov (United States)

    Zareba, Ilona; Celinska-Janowicz, Katarzyna; Surazynski, Arkadiusz; Miltyk, Wojciech; Palka, Jerzy

    2018-01-01

    Proline degradation by proline dehydrogenase/proline oxidase (PRODH/POX) contributes to apoptosis or autophagy. The identification of specific pathway of apoptosis/survival regulation is the aim of this study. We generated knocked-down PRODH/POX MCF-7 breast cancer cells (MCF-7shPRODH/POX). PRODH/POX silencing did not affect cell viability. However, it contributed to decrease in DNA and collagen biosynthesis, increase in prolidase activity and intracellular proline concentration as well as increase in the expression of iNOS, NF-κB, mTOR, HIF-1α, COX-2, AMPK, Atg7 and Beclin-1 in MCF-7shPRODH/POX cells. In these cells, glycyl-proline (GlyPro, substrate for prolidase) further inhibited DNA and collagen biosynthesis, maintained high prolidase activity, intracellular concentration of proline and up-regulated HIF-1α, AMPK, Atg7 and Beclin-1, compared to GlyPro-treated MCF-7 cells. In MCF-7 cells, GlyPro increased collagen biosynthesis, concentration of proline and expression of caspase-3, cleaved caspases -3 and -9, iNOS, NF-κB, COX-2 and AMPKβ. PRODH/POX knock-down contributed to pro-survival autophagy pathways in MCF-7 cells and GlyPro-derived proline augmented this process. However, GlyPro induced apoptosis in PRODH/POX-expressing MCF-7 cells as detected by up-regulation of active caspases -3 and -9. The data suggest that PRODH/POX silencing induces autophagy in MCF-7 cells and GlyPro-derived proline supports this process. PMID:29568391

  10. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-06-01

    Full Text Available Weiyi Huang,* Haihua Huang,* Lei Wang, Jiong Hu, Weifeng Song Department of Oncology, The First People’s Hospital Affiliated to Shanghai Jiaotong University, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: Cytoskeleton is critical for carcinoma cell proliferation, migration, and invasion. Sad-1 and UNC-84 domain containing 1 (SUN1 is one of the core linkers of nucleoskeleton and cytoskeleton. However, the functions of SUN1 in lung adenocarcinoma are largely unknown.Methods: In this study, we first transduced the lentivirus delivering the short hairpin RNA (shRNA against SUN1 to lung adenocarcinoma cells (A549 and 95D cells with high efficiency. After lentivirus infection, quantitative real-time polymerase chain reaction and Western blotting were used to detect the expressions of SUN1 mRNA and protein. The cell proliferation and colony formation were detected by MTT assay and colony formation assay, respectively. The cell distribution in the cell cycle was analyzed by flow cytometry.Results: Both mRNA and protein levels of SUN1 were significantly decreased in A549 and 95D cells after lentivirus infection, as indicated by quantitative real-time polymerase chain reaction and Western blot. Next, we found that cell proliferation and colony formation were markedly reduced in SUN1 silenced cells. Moreover, suppression of SUN1 led to cell cycle arrest at G0/G1 phase. Furthermore, Cyclin D1, CDK6, and CDK2 expressions were obviously reduced in A549 cells after SUN1 silencing.Conclusion: These results suggest that SUN1 plays an essential role in proliferation of lung adenocarcinoma cells in vitro and may be used as a potential therapeutic target for the treatment of lung adenocarcinoma in the future. Keywords: SUN1, lung cancer, proliferation

  11. Methylation and silencing of the retinoic acid receptor-β2 gene in cervical cancer

    International Nuclear Information System (INIS)

    Ivanova, Tatyana; Petrenko, Anatolii; Gritsko, Tatyana; Vinokourova, Svetlana; Eshilev, Ernest; Kobzeva, Vera; Kisseljov, Fjodor; Kisseljova, Natalia

    2002-01-01

    Expression of the retinoic acid receptor β2 (RAR-β2), a putative tumor suppressor gene, is reduced in various human cancers, including squamous cell carcinomas (SCC) of the uterine cervix. The mechanism of the inhibition of RAR-β2 expression remains obscure. We examined whether methylation of RAR-β2 gene could be responsible for this silencing in cervical SCC. Expression of RAR-β2 mRNA and methylation status of the 5' region of RAR-β2 gene were examined in 20 matched specimens from patients with cervical SCC and in three cervical cancer cell lines by Northern blot analysis and methylation-specific PCR (MSP) assay or Southern blot analysis respectively. In 8 out 20 cervical SCC (40%) the levels of RAR-β2 mRNA were decreased or undetectable in comparison with non-neoplastic cervix tissues. All 8 tumors with reduced levels of RAR-β2 mRNA expression showed methylation of the promoter and the first exon expressed in the RAR-β2 transcript. The RAR-β2 gene from non-neoplastic cervical tissues was mostly unmethylated and expressed, but methylated alleles of the gene were found in three samples of the morphologically normal tissues adjacent to the tumors. Three cervical cancer cell lines with extremely low level of RAR-β2 mRNA expression, SiHA, HeLA and CaSki, also showed methylation of this region of the RAR-β2 gene. These findings suggest that methylation of the 5' region of RAR-β2 gene may contribute to gene silencing and that methylation of this region may be an important and early event in cervical carcinogenesis. These findings may be useful to make retinoids more effective as preventive and therapeutic agents in combination with inhibitors of DNA methylation

  12. Silencing, positive selection and parallel evolution: busy history of primate cytochromes C.

    Directory of Open Access Journals (Sweden)

    Denis Pierron

    Full Text Available Cytochrome c (cyt c participates in two crucial cellular processes, energy production and apoptosis, and unsurprisingly is a highly conserved protein. However, previous studies have reported for the primate lineage (i loss of the paralogous testis isoform, (ii an acceleration and then a deceleration of the amino acid replacement rate of the cyt c somatic isoform, and (iii atypical biochemical behavior of human cyt c. To gain insight into the cause of these major evolutionary events, we have retraced the history of cyt c loci among primates. For testis cyt c, all primate sequences examined carry the same nonsense mutation, which suggests that silencing occurred before the primates diversified. For somatic cyt c, maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses yielded the same tree topology. The evolutionary analyses show that a fast accumulation of non-synonymous mutations (suggesting positive selection occurred specifically on the anthropoid lineage root and then continued in parallel on the early catarrhini and platyrrhini stems. Analysis of evolutionary changes using the 3D structure suggests they are focused on the respiratory chain rather than on apoptosis or other cyt c functions. In agreement with previous biochemical studies, our results suggest that silencing of the cyt c testis isoform could be linked with the decrease of primate reproduction rate. Finally, the evolution of cyt c in the two sister anthropoid groups leads us to propose that somatic cyt c evolution may be related both to COX evolution and to the convergent brain and body mass enlargement in these two anthropoid clades.

  13. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  14. Epigenetic silencing of serine protease HTRA1 drives polyploidy

    International Nuclear Information System (INIS)

    Schmidt, Nina; Irle, Inga; Ripkens, Kamilla; Lux, Vanda; Nelles, Jasmin; Johannes, Christian; Parry, Lee; Greenow, Kirsty; Amir, Sarah; Campioni, Mara; Baldi, Alfonso; Oka, Chio; Kawaichi, Masashi; Clarke, Alan R.; Ehrmann, Michael

    2016-01-01

    Increased numbers and improperly positioned centrosomes, aneuploidy or polyploidy, and chromosomal instability are frequently observed characteristics of cancer cells. While some aspects of these events and the checkpoint mechanisms are well studied, not all players have yet been identified. As the role of proteases other than the proteasome in tumorigenesis is an insufficiently addressed question, we investigated the epigenetic control of the widely conserved protease HTRA1 and the phenotypes of deregulation. Mouse embryonal fibroblasts and HCT116 and SW480 cells were used to study the mechanism of epigenetic silencing of HTRA1. In addition, using cell biological and genetic methods, the phenotypes of downregulation of HTRA1 expression were investigated. HTRA1 is epigenetically silenced in HCT116 colon carcinoma cells via the epigenetic adaptor protein MBD2. On the cellular level, HTRA1 depletion causes multiple phenotypes including acceleration of cell growth, centrosome amplification and polyploidy in SW480 colon adenocarcinoma cells as well as in primary mouse embryonic fibroblasts (MEFs). Downregulation of HTRA1 causes a number of phenotypes that are hallmarks of cancer cells suggesting that the methylation state of the HtrA1 promoter may be used as a biomarker for tumour cells or cells at risk of transformation. The online version of this article (doi:10.1186/s12885-016-2425-8) contains supplementary material, which is available to authorized users

  15. Sexuality and 'silence' among Khasi youth of Meghalaya, Northeast India.

    Science.gov (United States)

    War, Ryntihlin Jennifer; Albert, Sandra

    2013-01-01

    The importance of sex education has been well documented in the literature, but there exists a lack of research involving indigenous youth in India. This paper describes perceptions, knowledge and attitudes towards sex education, sexuality, pre-marital sex, rape and homosexuality among indigenous students from the matrilineal Khasi tribe attending a university in Meghalaya in northeast India. Qualitative and quantitative data were collected during and after reproductive health, sexuality and life skills courses. Despite the impression of sexual permissiveness of indigenous peoples that exists in India, students reported a societal silence on issues related to sexuality. Lack of appropriate words in the indigenous language potentially contributes to this silence. Although co-habitation is common and culturally acceptable, students disapproved of pre-marital sex. The influence of Christianisation was also perceived in the frequent reference to sin and guilt associated with masturbation, homosexuality, pre-marital sex and abortion. Students reported that the sex education received in school was 'childish' and inadequate for their adult needs. Many had unrealistic images of what constituted 'normal' sex and also blamed women for rape. The majority of indigenous students expressed the need for non-judgmental fora for discussions on sexual health and for sexuality education.

  16. BVES regulates EMT in human corneal and colon cancer cells and is silenced via promoter methylation in human colorectal carcinoma.

    Science.gov (United States)

    Williams, Christopher S; Zhang, Baolin; Smith, J Joshua; Jayagopal, Ashwath; Barrett, Caitlyn W; Pino, Christopher; Russ, Patricia; Presley, Sai H; Peng, DunFa; Rosenblatt, Daniel O; Haselton, Frederick R; Yang, Jin-Long; Washington, M Kay; Chen, Xi; Eschrich, Steven; Yeatman, Timothy J; El-Rifai, Wael; Beauchamp, R Daniel; Chang, Min S

    2011-10-01

    The acquisition of a mesenchymal phenotype is a critical step in the metastatic progression of epithelial carcinomas. Adherens junctions (AJs) are required for suppressing this epithelial-mesenchymal transition (EMT) but less is known about the role of tight junctions (TJs) in this process. Here, we investigated the functions of blood vessel epicardial substance (BVES, also known as POPDC1 and POP1), an integral membrane protein that regulates TJ formation. BVES was found to be underexpressed in all stages of human colorectal carcinoma (CRC) and in adenomatous polyps, indicating its suppression occurs early in transformation. Similarly, the majority of CRC cell lines tested exhibited decreased BVES expression and promoter DNA hypermethylation, a modification associated with transcriptional silencing. Treatment with a DNA-demethylating agent restored BVES expression in CRC cell lines, indicating that methylation represses BVES expression. Reexpression of BVES in CRC cell lines promoted an epithelial phenotype, featuring decreased proliferation, migration, invasion, and anchorage-independent growth; impaired growth of an orthotopic xenograft; and blocked metastasis. Conversely, interfering with BVES function by expressing a dominant-negative mutant in human corneal epithelial cells induced mesenchymal features. These biological outcomes were associated with changes in AJ and TJ composition and related signaling. Therefore, BVES prevents EMT, and its epigenetic silencing may be an important step in promoting EMT programs during colon carcinogenesis.

  17. Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

    NARCIS (Netherlands)

    Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

    2017-01-01

    Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

  18. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

    2013-01-01

    .Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  19. RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

    NARCIS (Netherlands)

    Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

    2009-01-01

    RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

  20. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  1. Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women

    Science.gov (United States)

    Shouse, Sarah H.; Nilsson, Johanna

    2011-01-01

    Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…

  2. Giving Voice: Narrating silence, history and memory in André Brink ...

    African Journals Online (AJOL)

    This essay examines André Brink's two most recent novels, The Other Side of Silence (2002) and Before I Forget (2004), in terms of their voicing of silence and the rewriting of history and memory. Each has a theme familiar to Brink's readers – an historical story of colonial violence and violation avenged; and the recounting ...

  3. What does it take to break the silence in teams: Authentic leadership or proactive followership?

    NARCIS (Netherlands)

    Günter, Hannes; Schreurs, Bert; van Emmerik, Hetty; Sun, Shuhua

    2017-01-01

    Leadership may help break the silence in teams, but this may not be equally true for all employees. Using behavioral plasticity theory, we propose that authentic leadership—a set of leadership behaviors through which leaders enact their true selves—reduces silence and motivates speaking up in

  4. An Empirical Study to Determine The Relationship between Occupational Self-Efficacy and Organizational Silence

    Directory of Open Access Journals (Sweden)

    Cem KAHYA

    2015-06-01

    Full Text Available The concept of occupational self-efficacy means the efficacy perceptions of employees in their occupational fields, and the concept of organizational silence means the employees avoid to voice their ideas and suggestions about organizational issues. The main aim of this study is to examine the relationship between the concepts of occupational self-efficacy and organizational silence by revealing employees’ perceptions of occupational self-efficacy and organizational silence level. With this aim, the survey study was conducted on total 114 academicians who work in University of Bayburt. As a result of research, while the significant relationship was found between employees’ perceptions of occupational self-efficacy and organizational silence level, there was reached a result that this relationship incurred the negatively relationship between perceptions of occupational self-efficacy and negative silence.

  5. Piecing Together Past and Present in Bhutan: Narration, Silence and Forgetting in Conflict

    Directory of Open Access Journals (Sweden)

    Line Kikkenborg Christensen

    2018-02-01

    Full Text Available What happens when conflict is silenced in official narratives but not forgotten among a population? This article explores this question using interview data from anthropological fieldwork in Bhutan. In Bhutan, the ethnic conflict of the early 1990s is surrounded by silence and is not openly discussed. Despite this silence, young Bhutanese have formed a multiplicity of narratives about the conflict. The article highlights three different narratives of conflict, as well as the oblivion found among informants. The main argument is that the silence surrounding the conflict in Bhutan has contributed to two forms of societal rift: between the authorities and the people, and between people themselves. The article contributes to the discussion about what role social memories play in conflicts, by suggesting that silence may cause wariness and hinder processes that help societies to move past conflict in a constructive way.

  6. L’architecture du silence de la Shoah dans les fictions de Sylvie Germain

    Directory of Open Access Journals (Sweden)

    José Luis Arráez Llobregat

    2015-11-01

    Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.

  7. Silencing of the Drosophila ortholog of SOX5 in heart leads to cardiac dysfunction as detected by optical coherence tomography.

    Science.gov (United States)

    Li, Airong; Ahsen, Osman O; Liu, Jonathan J; Du, Chuang; McKee, Mary L; Yang, Yan; Wasco, Wilma; Newton-Cheh, Christopher H; O'Donnell, Christopher J; Fujimoto, James G; Zhou, Chao; Tanzi, Rudolph E

    2013-09-15

    The SRY-related HMG-box 5 (SOX5) gene encodes a member of the SOX family of transcription factors. Recently, genome-wide association studies have implicated SOX5 as a candidate gene for susceptibility to four cardiac-related endophenotypes: higher resting heart rate (HR), the electrocardiographic PR interval, atrial fibrillation and left ventricular mass. We have determined that human SOX5 has a highly conserved Drosophila ortholog, Sox102F, and have employed transgenic Drosophila models to quantitatively measure cardiac function in adult flies. For this purpose, we have developed a high-speed and ultrahigh-resolution optical coherence tomography imaging system, which enables rapid cross-sectional imaging of the heart tube over various cardiac cycles for the measurement of cardiac structural and dynamical parameters such as HR, dimensions and areas of heart chambers, cardiac wall thickness and wall velocities. We have found that the silencing of Sox102F resulted in a significant decrease in HR, heart chamber size and cardiac wall velocities, and a significant increase in cardiac wall thickness that was accompanied by disrupted myofibril structure in adult flies. In addition, the silencing of Sox102F in the wing led to increased L2, L3 and wing marginal veins and increased and disorganized expression of wingless, the central component of the Wnt signaling pathway. Collectively, the silencing of Sox102F resulted in severe cardiac dysfunction and structural defects with disrupted Wnt signaling transduction in flies. This implicates an important functional role for SOX5 in heart and suggests that the alterations in SOX5 levels may contribute to the pathogenesis of multiple cardiac diseases or traits.

  8. Beyond Silence: A Randomized, Parallel-Group Trial Exploring the Impact of Workplace Mental Health Literacy Training with Healthcare Employees.

    Science.gov (United States)

    Moll, Sandra E; Patten, Scott; Stuart, Heather; MacDermid, Joy C; Kirsh, Bonnie

    2018-01-01

    This study sought to evaluate whether a contact-based workplace education program was more effective than standard mental health literacy training in promoting early intervention and support for healthcare employees with mental health issues. A parallel-group, randomised trial was conducted with employees in 2 multi-site Ontario hospitals with the evaluators blinded to the groups. Participants were randomly assigned to 1 of 2 group-based education programs: Beyond Silence (comprising 6 in-person, 2-h sessions plus 5 online sessions co-led by employees who personally experienced mental health issues) or Mental Health First Aid (a standardised 2-day training program led by a trained facilitator). Participants completed baseline, post-group, and 3-mo follow-up surveys to explore perceived changes in mental health knowledge, stigmatized beliefs, and help-seeking/help-outreach behaviours. An intent-to-treat analysis was completed with 192 participants. Differences were assessed using multi-level mixed models accounting for site, group, and repeated measurement. Neither program led to significant increases in help-seeking or help-outreach behaviours. Both programs increased mental health literacy, improved attitudes towards seeking treatment, and decreased stigmatized beliefs, with sustained changes in stigmatized beliefs more prominent in the Beyond Silence group. Beyond Silence, a new contact-based education program customised for healthcare workers was not superior to standard mental health literacy training in improving mental health help-seeking or help-outreach behaviours in the workplace. The only difference was a reduction in stigmatized beliefs over time. Additional research is needed to explore the factors that lead to behaviour change.

  9. Persistent ER stress induces the spliced leader RNA silencing pathway (SLS, leading to programmed cell death in Trypanosoma brucei.

    Directory of Open Access Journals (Sweden)

    Hanoch Goldshmidt

    2010-01-01

    Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.

  10. The Silencing of RECK Gene is Associated with Promoter Hypermethylation and Poor Survival in Hepatocellular Carcinoma

    Science.gov (United States)

    Zhang, Changsong; Ling, Yang; Zhang, Chenghui; Xu, Yun; Gao, Lu; Li, Rong; Zhu, Jing; Fan, Lieying; Wei, Lixin

    2012-01-01

    Background: To evaluate the promoter methylation status of RECK gene and mRNA expression in patients with hepatocellular carcinoma (HCC). Methods: We analyzed RECK methylation by MSP, and RECK mRNA by real-time PCR in 74 HCC. The liver cell lines (7721, Chang and Hep-G2) were treated with 5-Aza-CdR and TSA. Results: RECK mRNA were lower in HCC tissues (Mean -∆Ct = -3.29) than that in Non-Hcc tissues (Mean -∆Ct = -2.42). Expression of RECK was elevated in only 24 (32.43%) of the 74 HCC patients but decreased (-∆∆Ct=0.5) (Mean -∆∆Ct = -1.75) than those with demethylation (∆MI<0.5) (Mean -∆∆Ct = 0.05), and there is a decreased tendency for RECK mRNA in HCC patients with promoter hypermethylation (p = 0.002). There was a significantly correlation found between RECK mRNA and poor survival after surgery. After treated by 5-Aza-CdR and TSA, we found that RECK mRNA induced different changes in 7721, Chang and Hep-G2 cells. And RECK demethylation also induced by epigenetic inhibitors. Conclusion: The results suggested that the hypermethylation may lead to promoter silencing of RECK mRNA and associated with poor survival in HCC. PMID:22419890

  11. A Resonant Silence: For an Ethnographic History of Abortion

    Directory of Open Access Journals (Sweden)

    Flávia de Mattos Motta

    2008-05-01

    Full Text Available By using methods of the fields of History and Anthropology, this study investigated the practice of abortion in southern Brazil in the first half of the twentieth century. The examination of primary sources and interviews with elderly women intended to unveil a huge silence around this practice, which leaves very few historical sources to be investigated, and hides those memories. This text presents data collected by this survey and analyzes the diversity of representations over abortion and the ambiguities that this theme causes on the subjects involved. The practice of abortion must be understood as inserted into a context of power. The subjects operate from multiple sources of knowledge and within a morality network composed of contradictory elements.

  12. Postpartum Depression: How Childbirth Educators Can Help Break the Silence

    Science.gov (United States)

    Zauderer, Cheryl

    2009-01-01

    The voices of women suffering from postpartum depression are often silent. Women are reluctant to reveal to others that they are unhappy after the birth of their babies. Much has been written on possible causes, risk factors, and treatments for postpartum depression, but little has been done to investigate why women take so long to seek help. Early detection and treatment are key to a full recovery. Childbirth educators are in the position to offer anticipatory guidance on possible complications of the postpartum period, including postpartum depression. This article explores why women with postpartum depression choose to suffer in silence and suggests how childbirth educators can help new mothers find their voices. PMID:20190853

  13. Prognostic significance of aberrantly silenced ANPEP expression in prostate cancer

    DEFF Research Database (Denmark)

    Sørensen, Karina Dalsgaard; Abildgaard, Mette Opstrup; Haldrup, Christa

    2013-01-01

    Background:Novel biomarkers for prostate cancer (PC) are urgently needed. This study investigates the expression, epigenetic regulation, and prognostic potential of ANPEP in PC.Methods:Aminopeptidase N (APN; encoded by ANPEP) expression was analysed by immunohistochemistry using tissue microarrays...... in three hypermethylated prostate cell lines, suggesting epigenetic silencing. Negative APN immunoreactivity was significantly associated with short RFS and short CSS in the RP and CT cohort, respectively, independently of routine clinicopathological predictors. Combining APN with a known angiogenesis...... representing 267 radical prostatectomy (RP) and 111 conservatively treated (CT) PC patients. Clinical end points were recurrence-free survival (RFS) and cancer-specific survival (CSS), respectively. The ANPEP promoter methylation levels were determined by bisulphite sequencing or MethyLight analysis in 278...

  14. Hearing the Silence: Children’s Voices on Violence

    Directory of Open Access Journals (Sweden)

    Kathryn S. Collins

    2003-05-01

    Full Text Available Each year more than five million children in the United States are exposed to traumatizing events in their communities. This paper presents a discussion of multiple areas in violence and victimization research that needs to be continued as well as provides suggestions on how to un-silence child survivors through bridging the gaps between research and practice. It reviews the overarching problem of violence in the U.S. at the domestic and global levels and the effects of victimization. Suggestions on how to study possible mediators and moderators of victimization and individual and family adjustment, including: 1 The ecological perspective; 2 Court process and verdict; and 3Utilization of victim services, are explored. Finally, a rationale and examples of combining qualitative and quantitative methods in future research that uses children’s attributions of violence as a mediator are presented.

  15. Silencing of voices in a Swedish science classroom

    Science.gov (United States)

    Ramos de Robles, S. Lizette

    2018-03-01

    From a sociocultural perspective, I discuss data from a Swedish science classroom presented in María Gómez's article "Student Explanations of their Science Teachers' Assessments, Grading Practices, and How they learn Science". In this discussion, I focus on the need to change existing conceptions of assessment in the teaching and learning of science. Next, I talk about the importance of taking into consideration the dialectic between agency and passivity as filters in order to understand what student silence may signify in science classes as well as in relation to their perceptions of assessment. I conclude with the importance of the teacher's role in developing formative assessment, along with the challenges in developing assessments which transform science education into a relevant field of knowledge for both students and society at large.

  16. Revival of silenced echo and quantum memory for light

    Energy Technology Data Exchange (ETDEWEB)

    Damon, V; Bonarota, M; Louchet-Chauvet, A; Chaneliere, T; Le Gouet, J-L, E-mail: jean-louis.legouet@lac.u-psud.fr [Laboratoire Aime Cotton, CNRS-UPR 3321, Univ. Paris-Sud, Bat. 505, 91405 Orsay cedex (France)

    2011-09-15

    We propose an original quantum memory protocol. It belongs to the class of rephasing processes and is closely related to two-pulse photon echo. It is known that the strong population inversion produced by the rephasing pulse prevents the plain two-pulse photon echo from serving as a quantum memory scheme. Indeed, gain and spontaneous emission generate prohibitive noise. A second {pi}-pulse can be used to simultaneously reverse the atomic phase and bring the atoms back into the ground state. Then a secondary echo is radiated from a non-inverted medium, avoiding contamination by gain and spontaneous emission noise. However, one must kill the primary echo, in order to preserve all the information for the secondary signal. In the present work, spatial phase mismatching is used to silence the standard two-pulse echo. An experimental demonstration is presented.

  17. Dismantling the Silence: LGBTQ Aging Emerging From the Margins

    Science.gov (United States)

    Fredriksen-Goldsen, Karen I.

    2017-01-01

    Historical, environmental, and cultural contexts intersect with aging, sexuality, and gender across communities and generations. My scholarship investigates health and well-being over the life course across marginalized communities, including LGBTQ (lesbian, gay, bisexual, transgender, and queer) midlife and older adults, native communities experiencing cardiovascular risk, and families in China living with HIV, in order to balance the realities of unique lives in contemporary society. By probing the intersection of age, sexuality, and gender, my analysis is informed by both personal and professional experiences. With the death of my partner occurring at a time of profound invisibility and silence before HIV/AIDS, I found my life out of sync, experiencing a loss without a name. My life was thrust into a paradox: My relationship was defined by a world that refused to recognize it. This essay provides an opportunity for me to weave together how such critical turning points in my own life helped shape my approach to gerontology and how gerontology has informed my work and life. Reflecting on this journey, I illustrate the ways in which historical, structural, environmental, psychosocial, and biological factors affect equity, and the health-promoting and adverse pathways to health and well-being across marginalized communities. Although gerontology as a discipline has historically silenced the lives of marginalized older adults, it has much to learn from these communities. The growing and increasingly diverse older adult population provides us with unique opportunities to better understand both cultural variations and shared experiences in aging over the life course. PMID:28053011

  18. Flexible tools for gene expression and silencing in tomato.

    Science.gov (United States)

    Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

    2009-12-01

    As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

  19. Hypoxia silences retrotrapezoid nucleus respiratory chemoreceptors via alkalosis.

    Science.gov (United States)

    Basting, Tyler M; Burke, Peter G R; Kanbar, Roy; Viar, Kenneth E; Stornetta, Daniel S; Stornetta, Ruth L; Guyenet, Patrice G

    2015-01-14

    In conscious mammals, hypoxia or hypercapnia stimulates breathing while theoretically exerting opposite effects on central respiratory chemoreceptors (CRCs). We tested this theory by examining how hypoxia and hypercapnia change the activity of the retrotrapezoid nucleus (RTN), a putative CRC and chemoreflex integrator. Archaerhodopsin-(Arch)-transduced RTN neurons were reversibly silenced by light in anesthetized rats. We bilaterally transduced RTN and nearby C1 neurons with Arch (PRSx8-ArchT-EYFP-LVV) and measured the cardiorespiratory consequences of Arch activation (10 s) in conscious rats during normoxia, hypoxia, or hyperoxia. RTN photoinhibition reduced breathing equally during non-REM sleep and quiet wake. Compared with normoxia, the breathing frequency reduction (Δf(R)) was larger in hyperoxia (65% FiO2), smaller in 15% FiO2, and absent in 12% FiO2. Tidal volume changes (ΔV(T)) followed the same trend. The effect of hypoxia on Δf(R) was not arousal-dependent but was reversed by reacidifying the blood (acetazolamide; 3% FiCO2). Δf(R) was highly correlated with arterial pH up to arterial pH (pHa) 7.5 with no frequency inhibition occurring above pHa 7.53. Blood pressure was minimally reduced suggesting that C1 neurons were very modestly inhibited. In conclusion, RTN neurons regulate eupneic breathing about equally during both sleep and wake. RTN neurons are the first putative CRCs demonstrably silenced by hypocapnic hypoxia in conscious mammals. RTN neurons are silent above pHa 7.5 and increasingly active below this value. During hyperoxia, RTN activation maintains breathing despite the inactivity of the carotid bodies. Finally, during hypocapnic hypoxia, carotid body stimulation increases breathing frequency via pathways that bypass RTN. Copyright © 2015 the authors 0270-6474/15/350527-17$15.00/0.

  20. Dismantling the Silence: LGBTQ Aging Emerging From the Margins.

    Science.gov (United States)

    Fredriksen-Goldsen, Karen I

    2017-02-01

    Historical, environmental, and cultural contexts intersect with aging, sexuality, and gender across communities and generations. My scholarship investigates health and well-being over the life course across marginalized communities, including LGBTQ (lesbian, gay, bisexual, transgender, and queer) midlife and older adults, native communities experiencing cardiovascular risk, and families in China living with HIV, in order to balance the realities of unique lives in contemporary society. By probing the intersection of age, sexuality, and gender, my analysis is informed by both personal and professional experiences. With the death of my partner occurring at a time of profound invisibility and silence before HIV/AIDS, I found my life out of sync, experiencing a loss without a name. My life was thrust into a paradox: My relationship was defined by a world that refused to recognize it. This essay provides an opportunity for me to weave together how such critical turning points in my own life helped shape my approach to gerontology and how gerontology has informed my work and life. Reflecting on this journey, I illustrate the ways in which historical, structural, environmental, psychosocial, and biological factors affect equity, and the health-promoting and adverse pathways to health and well-being across marginalized communities. Although gerontology as a discipline has historically silenced the lives of marginalized older adults, it has much to learn from these communities. The growing and increasingly diverse older adult population provides us with unique opportunities to better understand both cultural variations and shared experiences in aging over the life course. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Ways to Promote the Classroom Participation of International Students by Understanding the Silence of Japanese University Students

    Science.gov (United States)

    Kim, Soonhyang; Ates, Burcu; Grigsby, Yurimi; Kraker, Stefani; Micek, Timothy A.

    2016-01-01

    The authors explored the role of silence and deciphered its meaning and usefulness as a teaching and learning strategy for Japanese students through a survey of Japanese university students in their home country. This study has revealed that participant responses were evenly divided among comfortable with silence, uncomfortable with silence, and…

  2. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

    NARCIS (Netherlands)

    Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

    2004-01-01

    RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

  3. Renal-Specific Silencing of TNF (Tumor Necrosis Factor) Unmasks Salt-Dependent Increases in Blood Pressure via an NKCC2A (Na+-K+-2Cl- Cotransporter Isoform A)-Dependent Mechanism.

    Science.gov (United States)

    Hao, Shoujin; Hao, Mary; Ferreri, Nicholas R

    2018-06-01

    We tested the hypothesis that TNF (tumor necrosis factor)-α produced within the kidney and acting on the renal tubular system is part of a regulatory mechanism that attenuates increases in blood pressure in response to high salt intake. Intrarenal administration of a lentivirus construct, which specifically silenced TNF in the kidney, did not affect baseline blood pressure. However, blood pressure increased significantly 1 day after mice with intrarenal silencing of TNF ingested 1% NaCl in the drinking water. The increase in blood pressure, which was continuously observed for 11 days, promptly returned to baseline levels when mice were switched from 1% NaCl to tap water. Silencing of renal TNF also increased NKCC2 (Na + -K + -2Cl - cotransporter) phosphorylation and induced a selective increase in NKCC2A (NKCC2 isoform A) mRNA accumulation in both the cortical and medullary thick ascending limb of Henle loop that was neither associated with a compensatory decrease of NKCC2F in the medulla nor NKCC2B in the cortex. The NaCl-mediated increases in blood pressure were completely absent when NKCC2A, using a lentivirus construct that did not alter expression of NKCC2F or NKCC2B, and TNF were concomitantly silenced in the kidney. Moreover, the decrease in urine volume and NaCl excretion induced by renal TNF silencing was abolished when NKCC2A was concurrently silenced, suggesting that this isoform contributes to the transition from a salt-resistant to salt-sensitive phenotype. Collectively, the data are the first to demonstrate a role for TNF produced by the kidney in the modulation of sodium homeostasis and blood pressure regulation. © 2018 American Heart Association, Inc.

  4. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  5. Adaptation of the Four Forms of Employee Silence Scale in a Polish sample

    Directory of Open Access Journals (Sweden)

    Krystyna Adamska

    2017-06-01

    Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.

  6. The physics of chromatin silencing: Bi-stability and front propagation

    Science.gov (United States)

    Sedighi, Mohammad

    A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.

  7. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.

    2013-06-13

    Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  8. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

    Science.gov (United States)

    Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

    2017-10-10

    The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

  9. Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

    International Nuclear Information System (INIS)

    Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan; Yang, Zhihong; Huang, Yi; Bennett, Jason; Wang, Li

    2016-01-01

    It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposure decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of

  10. Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Yang, Zhihong [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (United States); Huang, Yi [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Bennett, Jason [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Wang, Li, E-mail: li.wang@uconn.edu [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (United States); School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Department of Internal Medicine, Section of Digestive Diseases, Yale University, New Haven, CT 06520 (United States)

    2016-08-01

    It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposure decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of

  11. Silencing alpha-fetoprotein inhibits VEGF and MMP-2/9 production in human hepatocellular carcinoma cell.

    Science.gov (United States)

    Meng, Wenbo; Li, Xun; Bai, Zhongtian; Li, Yan; Yuan, Jinqiu; Liu, Tao; Yan, Jun; Zhou, Wence; Zhu, Kexiang; Zhang, Hui; Li, Yumin

    2014-01-01

    Alpha-fetoprotein not only serves as a diagnostic marker for liver cancer, but also posses a variety of biological functions. However, the role of Alpha-fetoprotein on tumor angiogenesis and cell invasion remains incompletely understood. In this study, we aimed to evaluate if Alpha-fetoprotein can regulate the major angiogenic factors and matrix metalloproteinases in human liver cancer cells. Alpha-fetoprotein silencing was achieved by Stealth RNAi. Expression of Alpha-fetoprotein was examined by a full-automatic electrochemistry luminescence immunity analyzer. Expression of VEGF, VEGFR-2, MMP-9, and MMP-2 was examined by Western blot and immunocytochemistry. Apoptosis was detected by TUNEL assay. Angiogenesis was detected by in vitro angiogenesis assay kit. Silencing of Alpha-fetoprotein led to an increased apoptosis, which was associated with a decreased expression of vascular endothelial growth factor, vascular endothelial growth factor receptor 2, matrix metalloproteinases-2/9. These results suggest that Alpha-fetoprotein may play a regulatory role on angiogenesis and cell invasion during liver cancer development.

  12. Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

    Directory of Open Access Journals (Sweden)

    Aaron J Saathoff

    Full Text Available Cinnamyl alcohol dehydrogenase (CAD catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

  13. Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

    Science.gov (United States)

    Saathoff, Aaron J; Sarath, Gautam; Chow, Elaine K; Dien, Bruce S; Tobias, Christian M

    2011-01-27

    Cinnamyl alcohol dehydrogenase (CAD) catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

  14. Driving in unheard silence: Disability and the politics of shutting up.

    Science.gov (United States)

    Lourens, Heidi

    2018-03-01

    The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.

  15. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  16. Relationships between Organizational Climate and Organizational Silence with Psychological Empowerment of Employees in Hospitals Affiliated with Birjand University of Medical Sciences; 2015

    Directory of Open Access Journals (Sweden)

    Parviz Aghaie Borzabad

    2015-10-01

    Full Text Available Background and Aim: Identifying factors associated with employees empowerment of their working centers can promote organizational performance of hospitals. The current study aimed at investigating the relationship of both organizational climate and organizational silence with psychological empowerment in the public hospitals affiliated with Birjand University of Medical Sciences (BUMS. Materials and Methods: This cross-sectional and correlational study was carried out in 2015. Using a stratified randomized sampling, 400 employees were selected from the public. hospitals affiliated with BUMS.  Data collection tools were. three self-administered questionnaires including organizational climate, organizational silence, and psychological empowerment. . Validity and reliability of the questionnaires were verified using experts judgment and Cronbach alpha coefficients more than 0.7, respectively. Data analysis was done by means of SPSS (V: 18 software using one sample t test, independent t test, Pearson correlation coefficient, and one-way ANOVA. The cut-off point of 70%.of Likert-type scale (3.5 was considered as an acceptable mean for each variable. Results: The mean organizational climate and organizational silence was 2.45 and 3.18, respectively which did not correspond with an acceptable mean (P<0.05. Although the mean psychological construct which was 3.6 had an acceptable value, mean of the two other sub-variables i.e. “trust to others” and “self-determination” were 3.2±0.83 and 3.42±0.67, respectively; and they were not at an acceptable level (P<0.05. It is observed that both organizational climate and organizational silence were positively correlated to psychological empowerment with 0.6 and 0.58 coefficients, respectively (P<0.05. Conclusion:  It is suggested that the hospitals administrators should promote the psychological empowerment of their employees  through improving organizational climate and decreasing organizational

  17. Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester

    Directory of Open Access Journals (Sweden)

    Amelia Peral Crespo

    2015-11-01

    Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word

  18. Expression profiling of c-kit and its impact after esiRNA silencing during gonadal development in catfish.

    Science.gov (United States)

    Laldinsangi, C; Senthilkumaran, B

    2018-04-03

    C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.

  19. Morphological regulation of Aspergillus niger to improve citric acid production by chsC gene silencing.

    Science.gov (United States)

    Sun, Xiaowen; Wu, Hefang; Zhao, Genhai; Li, Zhemin; Wu, Xihua; Liu, Hui; Zheng, Zhiming

    2018-04-02

    The mycelial morphology of Aspergillus niger, a major filamentous fungus used for citric acid production, is important for citric acid synthesis during submerged fermentation. To investigate the involvement of the chitin synthase gene, chsC, in morphogenesis and citric acid production in A. niger, an RNAi system was constructed to silence chsC and the morphological mutants were screened after transformation. The compactness of the mycelial pellets was obviously reduced in the morphological mutants, with lower proportion of dispersed mycelia. These morphological changes have caused a decrease in viscosity and subsequent improvement in oxygen and mass transfer efficiency, which may be conducive for citric acid accumulation. All the transformants exhibited improvements in citric acid production; in particular, chsC-3 showed 42.6% higher production than the original strain in the shake flask. Moreover, the high-yield strain chsC-3 exhibited excellent citric acid production potential in the scale-up process.The citric acid yield and the conversion rate of glucose of chsC-3 were both improved by 3.6%, when compared with that of the original strain in the stirred tank bioreactor.

  20. CD147 silencing inhibits tumor growth by suppressing glucose transport in melanoma.

    Science.gov (United States)

    Su, Juan; Gao, Tianyuan; Jiang, Minghao; Wu, Lisha; Zeng, Weiqi; Zhao, Shuang; Peng, Cong; Chen, Xiang

    2016-10-04

    Melanoma is a very malignant disease and there are still no effective treatments. CD147 participates in the carcinogenesis of multiple human cancers and GLUT-1, as a glucose transporter, is associated with tumor growth. However, the function of CD147 and GLUT-1 in melanoma have not been completely understood. Thus, in this study we investigated the expression of CD147 and GLUT-1 in melanoma tissue, which were overexpressed compared with that in nevus tissue. In addition, CD147 and GLUT-1 were co-localized in the cytoplasm of human melanoma A375 cells. Immunoprecipitation proved that CD147 interacted with GLUT-1 at D105-199. Silencing CD147 by specific siRNA could downregulate GLUT-1 level via inhibiting PI3K/Akt signaling and decrease glucose uptake in A375 cells. In vivo experiments also supported that CD147 knockdown suppressed the tumor growth in melanoma subcutaneous mice model, observed by micro PET/CT. Our results could help validate CD147 as a new therapeutic target for treating melanoma.

  1. Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

    Science.gov (United States)

    Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

    2009-01-01

    RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

  2. Epigenetic Silencing of the Protocadherin Family Member PCDH-γ-All in Astrocytomas

    Directory of Open Access Journals (Sweden)

    Anke Waha

    2005-03-01

    Full Text Available In a microarray-based methylation analysis of astrocytomas [World Health Organization (WHO grade II], we identified a CpG island within the first exon of the protocadherin-γ subfamily A11 (PCDH-γ-A11 gene that showed hypermethylation compared to normal brain tissue. Bisulfite sequencing and combined bisulfite restriction analysis (COBRA was performed to screen low- and high-grade astrocytomas for the methylation status of this CpG island. Hypermethylation was detected in 30 of 34 (88% astrocytomas (WHO grades II and III, 20 of 23 (87% glioblastomas (WHO grade IV, 8 of 8 (100% glioma cell lines. There was a highly significant correlation (P = .00028 between PCDH-γ-A11 hypermethylation and decreased transcription as determined by competitive reverse transcription polymerase chain reaction in WHO grades II and III astrocytomas. After treatment of glioma cell lines with a demethylating agent, transcription of PCDH-γ-A11 was restored. In summary, we have identified PCDH-γ-A11 as a new target silenced epigenetically in astrocytic gliomas. The inactivation of this cell-cell contact molecule might be involved in the invasive growth of astrocytoma cells into normal brain parenchyma.

  3. A Convenient In Vivo Model Using Small Interfering RNA Silencing to Rapidly Assess Skeletal Gene Function.

    Directory of Open Access Journals (Sweden)

    Wen Zhang

    Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of

  4. Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

    Directory of Open Access Journals (Sweden)

    Satoshi Iizuka

    Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

  5. Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

    Science.gov (United States)

    Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

    2018-07-01

    Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Double silencing of relevant genes suggests the existence of the direct link between DNA replication/repair and central carbon metabolism in human fibroblasts.

    Science.gov (United States)

    Wieczorek, Aneta; Fornalewicz, Karolina; Mocarski, Łukasz; Łyżeń, Robert; Węgrzyn, Grzegorz

    2018-04-15

    Genetic evidence for a link between DNA replication and glycolysis has been demonstrated a decade ago in Bacillus subtilis, where temperature-sensitive mutations in genes coding for replication proteins could be suppressed by mutations in genes of glycolytic enzymes. Then, a strong influence of dysfunctions of particular enzymes from the central carbon metabolism (CCM) on DNA replication and repair in Escherichia coli was reported. Therefore, we asked if such a link occurs only in bacteria or it is a more general phenomenon. Here, we demonstrate that effects of silencing (provoked by siRNA) of expression of genes coding for proteins involved in DNA replication and repair (primase, DNA polymerase ι, ligase IV, and topoisomerase IIIβ) on these processes (less efficient entry into the S phase of the cell cycle and decreased level of DNA synthesis) could be suppressed by silencing of specific genes of enzymes from CMM. Silencing of other pairs of replication/repair and CMM genes resulted in enhancement of the negative effects of lower expression levels of replication/repair genes. We suggest that these results may be proposed as a genetic evidence for the link between DNA replication/repair and CMM in human cells, indicating that it is a common biological phenomenon, occurring from bacteria to humans. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Silence in liturgy as the space for the Holy Ghost’s activity

    Directory of Open Access Journals (Sweden)

    Adelajda Sielepin

    2006-06-01

    Full Text Available The aim of this article is to clarify the essential and often neglected function of liturgical silence. In practice silence is usually intended to prepare the participants for listening or reflecting upon the word, especially when proclaimed by the minister. Whereas it is vital to know that silence constitutes a creative element of the liturgy, because the involvement of the Holy Spirit. In His action and cooperation with the participants He enables them to get into communion with Christ the Word and the Person and eventually to join effectively His mission. In that sense silence helps the Holy Ghost to fulfill His function in continuing the dialogue between God and man as well as in enhancing one’s spiritual skills for the fruitful participation in the Mystery of Christ and the Church.

  8. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing; Zhu, Jian-Kang

    2010-01-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  9. Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

    Directory of Open Access Journals (Sweden)

    Mustafa Emre Civelek

    2015-10-01

    Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

  10. Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

    Directory of Open Access Journals (Sweden)

    Mustafa Emre Civelek

    2015-12-01

    Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

  11. Reticence in Silence. An Examination of Heidegger's Phenomenology of Language in Contributions to Philosophy

    Czech Academy of Sciences Publication Activity Database

    Nitsche, Martin

    2011-01-01

    Roč. 765, č. 1 (2011), s. 74-79 ISSN 1407-2157 Institutional research plan: CEZ:AV0Z90090514 Keywords : Heidegger * contributions to philosophy * phenomenology * language * reticence in silence Subject RIV: AA - Philosophy ; Religion

  12. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing

    2010-05-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  13. Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

    Directory of Open Access Journals (Sweden)

    2006-02-01

    Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

  14. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.

    Directory of Open Access Journals (Sweden)

    Oliver A Zill

    Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.

  16. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  17. Organizational Silence, from Roots to Solutions: A Case Study in Iran Petroleum Industry

    Directory of Open Access Journals (Sweden)

    Mehdi Afkhami Ardakani

    2015-05-01

    Full Text Available Organizational silence is defined as the lack of effective interactions among staff and it stands opposite to the concept of organizational voice. In the present research, the purpose is to measure the silence behavior among the Research Institute of Petroleum Industry (RIPI staff before and after the implementation of a comprehensive suggestion system. A suggestion system is an internal structure easily accessed by all the staff to state their suggestions in a pre-structured format. The roots of silence behavior are studied based on a deep literature review to find out possible solutions to improve organizational voice. To conduct the research, a self-structured questionnaire has been developed and distributed among all the staff. A quasi-experimental methodology has been adopted to compare pretest and post-test results of silence status before and after implementing the suggestion system. The results show that the silence behavior has been meaningfully reduced. This is based on a simple t-test performed by SPSS software, where there is a meaningful difference between the silence status of pre-test and post-test. In other words, a suggestion system could be a communication opportunity to encourage staff to provide suggestions and to cooperate for promoting the organization, which will finally reduce the organization silence. A major gap within the studies of Iranian scholars about organizational silence is the failure to introduce effective solutions to reduce it. However, this research is innovative in the sense that it fills the mentioned gap. This research shows that large scale organizations like RIPI need to consider methods like suggestion systems to break bureaucratic obstacles so that their staff can easily find open routes to share their ideas and suggestions in a prestructured format. This cooperating will lead to mutual benefits for both parts, since suggestions could be used to enhance organizational structure and performance and

  18. Optimisation of tomato Micro-tom regeneration and selection on glufosinate/Basta and dependency of gene silencing on transgene copy number.

    Science.gov (United States)

    Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano

    2013-09-01

    An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.

  19. The molecular basis for stability of heterochromatin-mediated silencing in mammals

    Directory of Open Access Journals (Sweden)

    Hiragami-Hamada Kyoko

    2009-11-01

    Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

  20. The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

    Directory of Open Access Journals (Sweden)

    Logan M. Decker

    2017-04-01

    Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

  1. The molecular basis for stability of heterochromatin-mediated silencing in mammals.

    Science.gov (United States)

    Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

    2009-11-04

    The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

  2. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  3. AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

    Science.gov (United States)

    Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

    2013-05-01

    AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

  4. Between the Unbearable Weight and Lightness of the Past. Banal Silence in Spain's Post-Dictatorship Memory Politics.

    Science.gov (United States)

    Brescó de Luna, Ignacio

    2018-05-04

    This paper explores the role of silence in Spain's post-dictatorship memory politics. More specifically, the paper examines the forgotten Spanish colonial past in North Africa vis-à-vis the so-called pact of silence that accompanied Spain's transition to democracy after the Franco dictatorship. Drawing on various theoretical approaches in relation to collective memory, traditionally assumed associations between silence and forgetting are questioned. As is argued, silence may nurture and preserve memory just as it may also feed into forgetting. In the former case, silence typically enshrouds a living memory of a past that still weighs on the present, as the pact of silence in Spain clearly illustrates. In the latter case, silence signals a past perceived as already left behind and alien to society's current problems, as is the case of the Spanish colonial past in North Africa. In order to further explore the latter case, the notion of banal silence is introduced. Such notion points to cases where silence over certain contentious historical issues goes unnoticed by society, thus becoming naturalized. The paper concludes with some final reflexions on memory, banal silence and political change.

  5. Facebook's Spiral of Silence and Participation: The Role of Political Expression on Facebook and Partisan Strength in Political Participation.

    Science.gov (United States)

    Kim, Mihee

    2016-12-01

    This study investigated how Facebook's spiral of silence influences political participation. For doing so, this study focused on the roles of politically expressive activities on Facebook and individuals' levels of partisan strength. An online survey (N = 277) was conducted with Facebook users. Results showed that a perceived hostile opinion climate on Facebook was negatively associated with political expression on Facebook, which, in turn, was positively related with political participation. This indirect relationship was conditioned by the degree of Facebook users' partisan strength. Those with weak or moderate levels of partisan strength were less likely to express their minority views, which led to decrease their political participation in the real world. Such indirect relationship was not the case for those with high levels of partisan strength. Theoretical and political implications of these findings were discussed.

  6. Mutations that silence constitutive signaling activity in the allosteric ligand-binding site of the thyrotropin receptor.

    Science.gov (United States)

    Haas, Ann-Karin; Kleinau, Gunnar; Hoyer, Inna; Neumann, Susanne; Furkert, Jens; Rutz, Claudia; Schülein, Ralf; Gershengorn, Marvin C; Krause, Gerd

    2011-01-01

    The thyrotropin receptor (TSHR) exhibits elevated cAMP signaling in the basal state and becomes fully activated by thyrotropin. Previously we presented evidence that small-molecule ligands act allosterically within the transmembrane region in contrast to the orthosteric extracellular hormone-binding sites. Our goal in this study was to identify positions that surround the allosteric pocket and that are sensitive for inactivation of TSHR. Homology modeling combined with site-directed mutagenesis and functional characterization revealed seven mutants located in the allosteric binding site that led to a decrease of basal cAMP signaling activity. The majority of these silencing mutations, which constrain the TSHR in an inactive conformation, are found in two clusters when mapped onto the 3D structural model. We suggest that the amino acid positions identified herein are indicating locations where small-molecule antagonists, both neutral antagonists and inverse agonists, might interfere with active TSHR conformations.

  7. Modulation of histone methylation and MLH1 gene silencing by hexavalent chromium

    International Nuclear Information System (INIS)

    Sun Hong; Zhou Xue; Chen Haobin; Li Qin; Costa, Max

    2009-01-01

    Hexavalent chromium [Cr(VI)] is a mutagen and carcinogen, and occupational exposure can lead to lung cancers and other adverse health effects. Genetic changes resulting from DNA damage have been proposed as an important mechanism that mediates chromate's carcinogenicity. Here we show that chromate exposure of human lung A549 cells increased global levels of di- and tri-methylated histone H3 lysine 9 (H3K9) and lysine 4 (H3K4) but decreased the levels of tri-methylated histone H3 lysine 27 (H3K27) and di-methylated histone H3 arginine 2 (H3R2). Most interestingly, H3K9 dimethylation was enriched in the human MLH1 gene promoter following chromate exposure and this was correlated with decreased MLH1 mRNA expression. Chromate exposure increased the protein as well as mRNA levels of G9a a histone methyltransferase that specifically methylates H3K9. This Cr(VI)-induced increase in G9a may account for the global elevation of H3K9 dimethylation. Furthermore, supplementation with ascorbate, the primary reductant of Cr(VI) and also an essential cofactor for the histone demethylase activity, partially reversed the H3K9 dimethylation induced by chromate. Thus our studies suggest that Cr(VI) may target histone methyltransferases and demethylases, which in turn affect both global and gene promoter specific histone methylation, leading to the silencing of specific tumor suppressor genes such as MLH1.

  8. Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

    Science.gov (United States)

    Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

    2016-01-01

    Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

  9. Silencing of PINK1 expression affects mitochondrial DNA and oxidative phosphorylation in dopaminergic cells.

    Directory of Open Access Journals (Sweden)

    Matthew E Gegg

    Full Text Available Mitochondrial dysfunction has been implicated in the pathogenesis of Parkinson's disease (PD. Impairment of the mitochondrial electron transport chain (ETC and an increased frequency in deletions of mitochondrial DNA (mtDNA, which encodes some of the subunits of the ETC, have been reported in the substantia nigra of PD brains. The identification of mutations in the PINK1 gene, which cause an autosomal recessive form of PD, has supported mitochondrial involvement in PD. The PINK1 protein is a serine/threonine kinase localized in mitochondria and the cytosol. Its precise function is unknown, but it is involved in neuroprotection against a variety of stress signalling pathways.In this report we have investigated the effect of silencing PINK1 expression in human dopaminergic SH-SY5Y cells by siRNA on mtDNA synthesis and ETC function. Loss of PINK1 expression resulted in a decrease in mtDNA levels and mtDNA synthesis. We also report a concomitant loss of mitochondrial membrane potential and decreased mitochondrial ATP synthesis, with the activity of complex IV of the ETC most affected. This mitochondrial dysfunction resulted in increased markers of oxidative stress under basal conditions and increased cell death following treatment with the free radical generator paraquat.This report highlights a novel function of PINK1 in mitochondrial biogenesis and a role in maintaining mitochondrial ETC activity. Dysfunction of both has been implicated in sporadic forms of PD suggesting that these may be key pathways in the development of the disease.

  10. Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

    2016-04-22

    The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.

  11. Lifting the veil of silence: Jamuna's narrative of pain.

    Science.gov (United States)

    Haider, S

    1995-09-01

    This article relates the story of the life of Jamuna, a married mother of two boys and a girl living among a scheduled caste in India. The female researcher had been interviewing Jamuna's husband, who sells excess cloth to wholesalers and is active in the Bahujan Samaj Party, which is seeking to liberate India's lower castes. Jamuna usually ignored the female researcher or treated her curtly. The researcher, however, invited herself to lunch at Jamuna's house one day, and Jamuna unexpectedly began talking about her life while she prepared the food. Jamuna refers to her husband as "Bhim's father" (Bhim is her oldest son). Bhim's father rules the household, controls the money, never consults his wife, and treats her like a servant. Jamuna looks much older than her estimated 25 years. She was engaged when she was 8, never attended school, and was kept indoors. Her children attend an expensive school, and her husband wants them all to stay in school as long as possible and then get jobs. Jamuna was married to Bhim's father because his family did not demand a dowry. Both families have small farms, but her family grows more crops and makes more money. She used to live with her in-laws but now they avoid her. Jamuna feels strongly that girls should be married early to avoid disgrace. Jamuna was shocked by menstruation and intercourse. After her third delivery, Bhim's father allowed her to become sterilized. She hates her husband and believes he hates her. He treats her like a slave and insults her. His only virtue is that he ignores other women. Jamuna has no friends or confidants. She was not consulted about the move from the village to Delhi. When Bhim's father is away, she has to tend to his business and risk his anger over her mistakes. After this outpouring, Jamuna retreated to silence when the interviewer came to visit.

  12. The impact of organizational culture on employees’ organizational silence In Shiraz University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Ebrahim Parcham

    2017-01-01

    Full Text Available Introduction: Organizational Culture is one of the most important factors that can change the climate of silence. The main aim of this research was to investigate the influence of organizational culture on employees’ organizational silence in Shiraz University of Medical Sciences. Method: This research was a descriptive-correlation one. The target population was chosen from 1900 staff of the University of Medical sciences and Health Care headquarter in Shiraz. Thus 311 employees were selected using the Krejcie and Morgan sampling table. The instrument used in this research was Denison (2006 organizational culture questionnaire and Dimitris Buratas and Maria Vacula (2007 organizational culture. Cornbrash’s alpha method was used to calculate the reliability. The Item analysis and expert consensus were applied to calculate the validity of instruments. All gathered data analyzed with PLS software. Results: The results showed that the four dimensions of organizational culture include organizational involvement, organizational adaptability, organizational concistency and organizational mission was moderate and the mean scores obtained for each factor were 2.85, 2.82, 2.94 and 2.93 respectively. Structural equation model showed Organizational culture has a significant positive impact on organizational silence (β=0.68; P<.001. Conclusion: Based on the results and impact of organizational culture on organizational silence that is positive and significant; The organization further efforts to strengthen various aspects of organizational culture, especially the employees’ involvement in decision making; Employees can better express their opinions and thus reduced their organizational silence. In other words strengthening corporate culture is combined with the reduction of organizational silence. Medical organizations can establish appropriate reward system for creative ideas and suggestions to encourage people express their ideas As a result, reduced

  13. Development of a gene silencing DNA vector derived from a broad host range geminivirus

    Directory of Open Access Journals (Sweden)

    Hancock Leandria C

    2009-07-01

    Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

  14. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

    Directory of Open Access Journals (Sweden)

    Adriana F. Fusaro

    2017-10-01

    Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.

  15. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Directory of Open Access Journals (Sweden)

    Adrian Valli

    Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  16. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Science.gov (United States)

    Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

    2012-01-01

    RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  17. Characterization of white shrimp Litopenaeus vannamei integrin β and its role in immunomodulation by dsRNA-mediated gene silencing.

    Science.gov (United States)

    Lin, Yong-Chin; Chen, Jiann-Chu; Chen, Yu-Yuan; Liu, Chun-Hung; Cheng, Winton; Hsu, Chih-Hung; Tsui, Wen-Ching

    2013-06-01

    The full sequence of white shrimp Litopenaeus vannamei integrin β (LV-B) is 2879bp which encodes 787 amino acids (aa) of the open reading frame (ORF). The mature protein (764 aa) contains (1) an extracellular domain (ED) of 692 aa, (2) a transmembrane domain (TD) of 23 aa, and (3) a cytoplasmic domain (CD) of 49 aa. The cloned LV-B grouped together with crayfish Pacifastacus leniusculus integrin β (PL-B1), but was far away from vertebrate integrin β1, β3, β5, β6, β7, and β8, and another L. vannamei integrin β (LV). A Southern blot analysis indicated that the cloned LV-B was a single copy of genomic DNA. LV-B mRNA was expressed in all tissues, and was highly expressed in haemocytes. LV-B was downregulated in shrimp 24 and 96h after having received white spot syndrome virus (WSSV). LV-B expression by haemocytes of shrimp was higher in the postmoult (A and B) stage, and lower in the premoult (D2/D3) stage. LV-B expression was significantly higher by shrimp reared in 2.5‰ and 5‰ salinities. Shrimp injected with integrin β dsRNA showed gene silencing of integrin β after 36h. LV-B-silenced shrimp showed decreased hyaline cells (HCs), granular cells (GCs, including semi-granular cells), the total haemocyte count (THC), respiratory bursts (RBs), and lysozyme activity, but showed increased RB/HC, superoxide dismutase (SOD) activity/HC, and the phenoloxidase (PO) activity/GC. LV-B-silenced shrimp showed upregulated expressions of lipopolysaccharide- and β-glucan-binding protein (LGBP), peroxinectin (PX), prophenoloxidase I (proPO I), proPO II, proPO-activating enzyme (ppA), α2-macroglobulin (α2-M), cytMnSOD, mtMnSOD, and heat shock protein 70 (HSP70). It was concluded that integrin β plays important roles in proPO activation, phagocytosis, and the antioxidant system for immunomodulation in shrimp. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.

    Science.gov (United States)

    Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S

    2004-02-01

    The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.

  19. A conversation analysis of the function of silence in writing conferences

    Directory of Open Access Journals (Sweden)

    Milad Mirzaee

    2016-07-01

    Full Text Available One of the recent issues in English as a Second/Foreign Language (ESL/EFL writing instruction has been the quest for a more effective way to give feedback to L2 learners’ writing drafts. Although teacher- learner writing conferences have been increasingly used for providing ample opportunity for negotiating revisions, relatively little attention has been given to actual teacher-learner conversation. Drawing on sociocultural theory, which holds that all cognitive developments are results of ‘social interactions’, and drawing on conversation analysis as an analytical tool, this study attempts to explore the different functions of ‘silence’ in writing conferences during teacher-learner conversation. The data comes from transcripts of six 1-hour writing conferences video-recorded in a graduate program with 7 candidates in Iran. During the writing conferences, learners’ drafts were discussed. Findings of the study demonstrated that teacher’s silence can play a key role in the management of turns in writing conferences, thereby providing the parties with various opportunities for accomplishing intersubjectivity: the teacher used silence to rethink the information provided during writing conferences, and the learner exploited silence to revise the writing draft. The current study, reporting a range of functions of silence in writing conferences, offers an extension to the existing literature and draws language teachers’, specifically writing instructors’, attention to different functions of silence in writing conferences.

  20. Breaking an epigenetic chromatin switch: curious features of hysteresis in Saccharomyces cerevisiae telomeric silencing.

    Directory of Open Access Journals (Sweden)

    Vijayalakshmi H Nagaraj

    Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.

  1. Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

    Directory of Open Access Journals (Sweden)

    Elisabeth H. Vollmann

    2017-06-01

    Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

  2. Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

    Science.gov (United States)

    Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

    2016-01-01

    Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

  3. Silencing MR-1 attenuates inflammatory damage in mice heart induced by AngII

    International Nuclear Information System (INIS)

    Dai, Wenjian; Chen, Haiyang; Jiang, Jiandong; Kong, Weijia; Wang, Yiguang

    2010-01-01

    Myofibrillogenesis regulator-1(MR-1) can aggravate cardiac hypertrophy induced by angiotensin(Ang) II in mice through activation of NF-κB signaling pathway, and nuclear transcription factor (NF)-κB and activator protein-1(AP-1) regulate inflammatory and immune responses by increasing the expression of specific inflammatory genes in various tissues including heart. Whether inhibition of MR-1 expression will attenuate AngII-induced inflammatory injury in mice heart has not been explored. Herein, we monitored the activation of NF-κB and AP-1, together with expression of pro-inflammatory of interleukin(IL)-6, tumor necrosis factor(TNF)-α, vascular-cell adhesion molecule (VCAM)-1, platelet endothelial cell adhesion molecule (PECAM), and inflammatory cell infiltration in heart of mice which are induced firstly by AngII (PBS),then received MR-1-siRNA or control-siRNA injecting. We found that the activation of NF-κB and AP-1 was inhibited significantly, together with the decreased expression of IL-6, TNF-α, VCAM-1, and PECAM in AngII-induced mice myocardium in MR-1-siRNA injection groups compared with control-siRNA injecting groups. However, the expression level of MR-1 was not an apparent change in PBS-infused groups than in unoperation groups, and MR-1-siRNA do not affect the expression of MR-1 in PBS-infused mice. Our findings suggest that silencing MR-1 protected mice myocardium against inflammatory injury induced by AngII by suppression of pro-inflammatory transcription factors NF-κB and AP-1 signaling pathway.

  4. Silencing of Pokemon enhances caspase-dependent apoptosis via fas- and mitochondria-mediated pathways in hepatocellular carcinoma cells.

    Science.gov (United States)

    Zhang, Yu-Qin; Xiao, Chuan-Xing; Lin, Bi-Yun; Shi, Ying; Liu, Yun-Peng; Liu, Jing-Jing; Guleng, Bayasi; Ren, Jian-Lin

    2013-01-01

    The role of Pokemon (POK erythroid myeloid ontogenic actor), a recently identified POK transcription factor with proto-oncogenic activity, in hepatocellular carcinogenesis has only been assessed by a few studies. Our previous study revealed that Pokemon is overexpressed in hepatocellular carcinomas (HCC) and promotes HCC cell proliferation and migration via an AKT- and ERK- dependent manner. In the present study, we used the TUNEL assay and FACS analysis to demonstrate that oxaliplatin induced apoptosis was significantly increased in cells with silenced Pokemon. Western blots showed that p53 expression and phosphorylation were significantly increased in Pokemon defective cells, thereby initiating the mitochondria-mediated and death receptor-mediated apoptotic pathways. In the mitochondria-mediated pathway, expression of pro-apoptotic Bcl-2 family members (including Bad, Bid, Bim and Puma) as well as AIF was increased and decreasing the mitochondrial membrane potential resulted in cytochrome C released from mitochondrial in HepG2 si-Pokemon cells. In addition, upon oxaliplatin treatment of Pokemon-silenced cells, the FAS receptor, FADD and their downstream targets caspase-10 and caspase-8 were activated, causing increased release of caspase-8 active fragments p18 and p10. Increased activated caspase-8-mediated cleavage and activation of downstream effector caspases such as caspase-9 and caspase-3 was observed in HepG2 si-Pokemon cells as compared to control. Therefore, Pokemon might serve as an important mediator of crosstalk between intrinsic and extrinsic apoptotic pathways in HCC cells. Moreover, our findings suggest that Pokemon could be an attractive therapeutic target gene for human cancer therapy.

  5. Silencing of Pokemon enhances caspase-dependent apoptosis via fas- and mitochondria-mediated pathways in hepatocellular carcinoma cells.

    Directory of Open Access Journals (Sweden)

    Yu-Qin Zhang

    Full Text Available The role of Pokemon (POK erythroid myeloid ontogenic actor, a recently identified POK transcription factor with proto-oncogenic activity, in hepatocellular carcinogenesis has only been assessed by a few studies. Our previous study revealed that Pokemon is overexpressed in hepatocellular carcinomas (HCC and promotes HCC cell proliferation and migration via an AKT- and ERK- dependent manner. In the present study, we used the TUNEL assay and FACS analysis to demonstrate that oxaliplatin induced apoptosis was significantly increased in cells with silenced Pokemon. Western blots showed that p53 expression and phosphorylation were significantly increased in Pokemon defective cells, thereby initiating the mitochondria-mediated and death receptor-mediated apoptotic pathways. In the mitochondria-mediated pathway, expression of pro-apoptotic Bcl-2 family members (including Bad, Bid, Bim and Puma as well as AIF was increased and decreasing the mitochondrial membrane potential resulted in cytochrome C released from mitochondrial in HepG2 si-Pokemon cells. In addition, upon oxaliplatin treatment of Pokemon-silenced cells, the FAS receptor, FADD and their downstream targets caspase-10 and caspase-8 were activated, causing increased release of caspase-8 active fragments p18 and p10. Increased activated caspase-8-mediated cleavage and activation of downstream effector caspases such as caspase-9 and caspase-3 was observed in HepG2 si-Pokemon cells as compared to control. Therefore, Pokemon might serve as an important mediator of crosstalk between intrinsic and extrinsic apoptotic pathways in HCC cells. Moreover, our findings suggest that Pokemon could be an attractive therapeutic target gene for human cancer therapy.

  6. SILENCING THE NUCLEOCYTOPLASMIC O-GLCNAC TRANSFERASE REDUCES PROLIFERATION, ADHESION AND MIGRATION OF CANCER AND FETAL HUMAN COLON CELL LINES

    Directory of Open Access Journals (Sweden)

    AGATA eSTEENACKERS

    2016-05-01

    Full Text Available The post-translational modification of proteins by O-linked β-N-acetylglucosamine (O-GlcNAc is regulated by a unique couple of enzymes. O-GlcNAc transferase (OGT transfers the GlcNAc residue from UDP-GlcNAc, the final product of the hexosamine biosynthetic pathway (HBP, whereas O-GlcNAcase (OGA removes it. This study and others show that OGT and O-GlcNAcylation levels are increased in cancer cell lines. In that context we studied the effect of OGT silencing in the colon cancer cell lines HT29 and HCT116 and the primary colon cell line CCD841CoN. Herein we report that OGT silencing diminished proliferation, in vitro cell survival and adhesion of primary and cancer cell lines. SiOGT dramatically de-creased HT29 and CCD841CoN migration, CCD841CoN harboring high capabilities of mi-gration in Boyden chamber system when compared to HT29 and HCT116. The expression levels of actin and tubulin were unaffected by OGT knockdown but siOGT seemed to disor-ganize microfilament, microtubule and vinculin networks in CCD841CoN. While cancer cell lines harbor higher levels of OGT and O-GlcNAcylation to fulfill their proliferative and migra-tory properties, in agreement with their higher consumption of HBP main substrates glucose and glutamine, our data demonstrate that OGT expression is not only necessary for the biolog-ical properties of cancer cell lines but also for normal cells.

  7. Histone methylation-mediated silencing of miR-139 enhances invasion of non-small-cell lung cancer

    International Nuclear Information System (INIS)

    Watanabe, Kousuke; Amano, Yosuke; Ishikawa, Rie; Sunohara, Mitsuhiro; Kage, Hidenori; Ichinose, Junji; Sano, Atsushi; Nakajima, Jun; Fukayama, Masashi; Yatomi, Yutaka; Nagase, Takahide; Ohishi, Nobuya; Takai, Daiya

    2015-01-01

    MicroRNA expression is frequently altered in human cancers, and some microRNAs act as oncogenes or tumor suppressors. MiR-139-5p (denoted thereafter as miR-139) has recently been reported to function as a tumor suppressor in several types of human cancer (hepatocellular carcinoma, colorectal cancer, breast cancer, and gastric cancer), but its function in non-small-cell lung cancer (NSCLC) and the mechanism of its suppression have not been studied in detail. MiR-139 was suppressed frequently in primary NSCLCs. MiR-139 is located within the intron of PDE2A and its expression was significantly correlated with the expression of PDE2A. A chromatin immunoprecipitation assay revealed that miR-139 was epigenetically silenced by histone H3 lysine 27 trimethylation (H3K27me3) of its host gene PDE2A and this process was independent of promoter DNA methylation. Pharmacological inhibition of both histone methylation and deacetylation-induced miR-139 with its host gene PDE2A. Ectopic expression of miR-139 in lung cancer cell lines did not affect the proliferation nor the migration but significantly suppressed the invasion through the extracellular matrix. In primary NSCLCs, decreased expression of miR-139 was significantly associated with distant lymph node metastasis and histological invasiveness (lymphatic invasion and vascular invasion) on both univariate and multivariate analyses. Collectively, these results suggest that H3K27me3-mediated silencing of miR-139 enhances an invasive and metastatic phenotype of NSCLC

  8. Silencing of ATM expression by siRNA technique contributes to glioma stem cell radiosensitivity in vitro and in vivo.

    Science.gov (United States)

    Li, Yan; Li, Luchun; Wu, Zhijuan; Wang, Lulu; Wu, Yongzhong; Li, Dairong; Ma, Uiwen; Shao, Jianghe; Yu, Huiqing; Wang, Donglin

    2017-07-01

    Evidence has shown that both high expression of the ataxia-telangiectasia mutated (ATM) gene and glioma stem cells (GSCs) are responsible for radioresistance in glioma. Thus, we hypothesized that brain tumor radiosensitivity may be enhanced via silencing of the ATM gene in GSCs. In the present study we successfully induced GSCs from two cell lines and used CD133 and nestin to identify GSCs. A lentivirus was used to deliver siRNA-ATMPuro (A group) to GSCs prior to radiation, while siRNA-HKPuro (N group) and GSCs (C group) were used as negative and blank controls, respectively. RT-qPCR and western blotting were performed to verify the efficiency of the siRNA-ATM technique. The expression of the ATM gene and ATM protein were significantly downregulated post-transfection. Cell Counting Kit-8 (CCK-8) and colony formation assays revealed that the A group demonstrated weak cell proliferation and lower survival fractions post-irradiation compared to the C/N groups. Flow cytometry was used to examine the percentage of cell apoptosis and G2 phase arrest, which were both higher in the A group than in the C/N groups. We found that the comet tail percentage evaluated by comet assay was higher in the A group than in the C/N groups. After radiation treatment, three radiosensitive genes [p53, proliferating cell nuclear antigen (PCNA), survivin] exhibited a decreasing tendency as determined by RT-qPCR. Mice underwent subcutaneous implantation, followed by radiation, and the resulting necrosis and hemorrhage were more obvious in the A group than in the N groups. In conclusion, silencing of ATM via the siRNA technique improved radiosensitivity of GSCs both in vitro and in vivo.

  9. Silencing p75NTR prevents proNGF-induced endothelial cell death and development of acellular capillaries in rat retina

    Directory of Open Access Journals (Sweden)

    Ahmed Y Shanab

    Full Text Available Accumulation of the nerve growth factor precursor (proNGF and its receptor p75NTR have been associated with several neurodegenerative diseases in both brain and retina. However, whether proNGF contributes to microvascular degeneration remain unexplored. This study seeks to investigate the mechanism by which proNGF/p75NTR induce endothelial cell (EC death and development of acellular capillaries, a surrogate marker of retinal ischemia. Stable overexpression of the cleavage-resistant proNGF and molecular silencing of p75NTR were utilized in human retinal EC and rat retinas in vivo. Stable overexpression of proNGF decreased NGF levels and induced retinal vascular cell death evident by 1.9-fold increase in acellular capillaries and activation of JNK and cleaved-PARP that were mitigated by p75NTRshRNA. In vitro, overexpression of proNGF did not alter TNF-α level, reduced NGF, however induced EC apoptosis evident by activation of JNK and p38 MAPK, cleaved-PARP. Silencing p75NTR using siRNA restored expression of NGF and TrkA activation and prevented EC apoptosis. Treatment of EC with human-mutant proNGF induced apoptosis that coincided with marked protein interaction and nuclear translocation of p75NTR and the neurotrophin receptor interacting factor. These effects were abolished by a selective p75NTR antagonist. Therefore, targeting p75NTR represents a potential therapeutic strategy for diseases associated with aberrant expression of proNGF.

  10. Excavating silences and tensions of agency|passivity in science education reform

    Science.gov (United States)

    Rivera Maulucci, Maria S.

    2010-12-01

    I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve to marginalize science. I propose that the current push for top-down reform and accountability diminishes opportunities for receptivity, learning with and from students in order to transform teachers' practices and promote equity in science education. I discuss tensions of agency and passivity in science education reform and argue that attention to authentic caring constitutes another silence in the science education literature. I conclude that the current policy context positions teachers and science education researchers as tempered radicals struggling against opp(reg)ressive reforms and that there is a need for more studies to excavate these and other silences.

  11. An intronic microRNA silences genes that are functionally antagonistic to its host gene.

    Science.gov (United States)

    Barik, Sailen

    2008-09-01

    MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

  12. RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).

    Science.gov (United States)

    Dare, Andrew P; Hellens, Roger P

    2013-08-01

    Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.

  13. High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

    Science.gov (United States)

    Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

    2018-01-01

    Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

  14. Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

    Science.gov (United States)

    Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

    2016-01-01

    Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

  15. Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

    Science.gov (United States)

    Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-01-01

    RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

  16. Transgene-induced gene silencing is not affected by a change in ploidy level.

    Directory of Open Access Journals (Sweden)

    Daniela Pignatta

    Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

  17. The effects of sedative music, arousal music, and silence on electrocardiography signals.

    Science.gov (United States)

    Dousty, Mehdy; Daneshvar, Sabalan; Haghjoo, Majid

    2011-01-01

    Research indicates that music can affect heart rate, blood pressure, and skin conductance. Music can stimulate central emotions in the brain and release biochemical materials that change the physiologic state. We sought to compare changes in the electrical function of the heart in response to music. Subjects were asked to listen to 2 types of music, namely, sedative and arousal music, in conjunction with two 30-second periods of complete silence. The experiment was conducted in 4 segments: the first and third parts were silence, and the second and fourth parts were music. First, the response to each type of music was compared with that to the preceding period of silence. Next, the responses to both types of music were compared. Finally, the response to music regardless of the type was compared with that to silence. The amplitude of polarization and depolarization changed in response to different kinds of music. The electrical function of the heart in response to music, irrespective of the music type, differed from that in response to silence. The 2 types of music impacted the electrical function of the heart in different ways: the arousal music influenced T-wave maximum amplitude, whereas no such change was recorded in response to the sedative music. The bandwidth of the polarization and depolarization of the heart rate and R-wave amplitude increased in response to music by comparison with silence. In addition, the heart did not seem to try to synchronize with music. The mean R-wave amplitude in sedative music is higher than the arousal music, so our heart works differently when different types of music are heard. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Simulation and Measurements of Small Arms Blast Wave Overpressure in the Process of Designing a Silencer

    Directory of Open Access Journals (Sweden)

    Hristov Nebojša

    2015-02-01

    Full Text Available Simulation and measurements of muzzle blast overpressure and its physical manifestations are studied in this paper. The use of a silencer can have a great influence on the overpressure intensity. A silencer is regarded as an acoustic transducer and a waveguide. Wave equations for an acoustic dotted source of directed effect are used for physical interpretation of overpressure as an acoustic phenomenon. Decomposition approach has proven to be suitable to describe the formation of the output wave of the wave transducer. Electroacoustic analogies are used for simulations. A measurement chain was used to compare the simulation results with the experimental ones.

  19. Uudised : Rannap sai raha lõpuks kätte. No Big Silence esitleb uut heliplaati

    Index Scriptorium Estoniae

    2000-01-01

    Pärnus toimunud lühima öö laulukonkursil võitis peaauhinna R. Rannap. Ans. No-Big-Silence on soojendusbändiks 2. juulil Tallinna Lauluväljakul toimuval Iron Maideni kontserdil. Ans. No-Big-Silence esitleb oma uut heliplaati "successful, bitch and beautiful"

  20. Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L

    DEFF Research Database (Denmark)

    Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon

    2017-01-01

    Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...

  1. Airplane radiation dose decrease during a strong Forbush decrease

    Czech Academy of Sciences Publication Activity Database

    Spurný, František; Kudela, K.; Dachev, T.

    2004-01-01

    Roč. 2, S05001 (2004), s. 1-4 ISSN 1542-7390 Grant - others:EC project(XE) FIGM-CT2000-00068 Institutional research plan: CEZ:AV0Z1048901 Keywords : airplane dose * Forbush decrease * cosmic rays Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders

  2. Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human skin cancer cells by targeting epigenetic regulators

    International Nuclear Information System (INIS)

    Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia; Katiyar, Santosh K.

    2012-01-01

    Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16 INK4a and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin

  3. Epigenetic silencing of MAL, a putative tumor suppressor gene, can contribute to human epithelium cell carcinoma

    Directory of Open Access Journals (Sweden)

    Zhang Jun

    2010-11-01

    Full Text Available Abstract Background To identify new and useful candidate biomarkers in head and neck squamous cell carcinoma (HNSCC, we performed a genome-wide survey and found that Myelin and lymphocyte-associated protein (MAL was a gene that was markedly down-regulated in HNSCC. Hence, we investigated the mechanism of MAL silencing and the effects of MAL on the proliferation, invasion, and apoptotic potential in HNSCC. Results MAL was significantly down-regulated in 91.7% of HNSCC specimens at the mRNA level as compared with adjacent normal tissues (P = 0.0004. Moreover, the relative transcript levels of the MAL gene were remarkably decreased by five-fold in nine HNSCC cell lines as compared with normal head and neck epithelium cells. MAL gene expression was restored in 44%, 67%, and 89% in HNSCC cell lines treated with TSA, 5-Aza-dC, and TSA plus 5-Aza-dC, respectively. Furthermore, bisulfate-treated DNA sequencing demonstrated that the two CpG islands (that is, M1 and M2 located in MAL promoter region were completely methylated in the HNSCC cell lines (CpG methylated ratio was more than 90%, and only one CpG island (that is, M1 was partially methylated in HNSCC tissues (CpG methylated ratio between 20% and 90%. A significant reduction in cell proliferation and a change in the cell cycle profile were also observed in MAL transfectants. Matrigel assay demonstrated that the invasiveness of HNSCC cells significantly decreased. A significant increase in the population of apoptotic cells was observed in MAL transfected cells. The exogenous expression of the MAL gene suppressed malignant phenotypes, while the cell death induced by MAL gene transfer was a result of apoptosis as demonstrated by the induction of cleavage of the poly (that is, ADP-ribose polymerase. Additionally, tumor growth was suppressed in cells expressing MAL as compared with cells not expressing MAL. Conclusion Our data suggest that the epigenetic inactivation of MAL, as a candidate tumor

  4. Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

    Science.gov (United States)

    Kant, Ravi; Dasgupta, Indranil

    2017-07-01

    Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

  5. Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

    Science.gov (United States)

    Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

    2000-01-01

    The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

  6. Silencing of HMGA2 promotes apoptosis and inhibits migration and ...

    Indian Academy of Sciences (India)

    2016-04-05

    Apr 5, 2016 ... cancer PC3 and DU145 cells, and then the cellular biology changes after decreased the expression of HMGA2 was examined. ..... to heterodimeric complexes of TGF-β receptors, and then .... sis in bladder cancer. Cancer ...

  7. [Why is bread consumption decreasing?].

    Science.gov (United States)

    Rolland, M F; Chabert, C; Serville, Y

    1977-01-01

    In France bread plays a very special and ambivalent role among our foodstuffs because of the considerable drop in its consumption, its alleged harmful effects on our health and the respect in which it is traditionally held. More than half the 1 089 adults interviewed in this study say they have decreased their consumption of bread in the last 10 years. The reasons given vary according to age, body weight and urbanization level. The main reasons given for this restriction are the desire to prevent or reduce obesity, the decrease in physical activity, the general reduction in food consumption and the possibility of diversifying foods even further. Moreover, the decreasing appeal of bread in relation to other foods, as well as a modification in the structure of meals, in which bread becomes less useful to accompany other food, accentuate this loss of attraction. However, the respect for bread as part of the staple diet remains very acute as 95 p. 100 of those interviewed express a reluctance to throw bread away, more for cultural than economic reasons. Mechanization and urbanization having brought about a decrease in energy needs, the most common alimentary adaptation is general caloric restriction by which glucids, and especially bread, are curtailed.

  8. Silencing of Hsp27 and Hsp72 in glioma cells as a tool for programmed cell death induction upon temozolomide and quercetin treatment

    Energy Technology Data Exchange (ETDEWEB)

    Jakubowicz-Gil, Joanna, E-mail: jjgil@poczta.umcs.lublin.pl [Department of Comparative Anatomy and Anthropology, Maria Curie-Sklodowska University, Akademicka 19, 20-033 Lublin (Poland); Langner, Ewa [Department of Medical Biology, Institute of Agricultural Medicine, Jaczewskiego 2, 20-950 Lublin (Poland); Bądziul, Dorota [Department of Comparative Anatomy and Anthropology, Maria Curie-Sklodowska University, Akademicka 19, 20-033 Lublin (Poland); Wertel, Iwona [1st Department of Gynaecology, University School of Medicine, Staszica 16, 20-081 Lublin (Poland); Rzeski, Wojciech [Department of Medical Biology, Institute of Agricultural Medicine, Jaczewskiego 2, 20-950 Lublin (Poland); Department of Immunology and Virology, Maria Curie-Sklodowska University, Akademicka 19, 20-033 Lublin (Poland)

    2013-12-15

    The aim of the present study was to investigate whether silencing of Hsp27 or Hsp72 expression in glioblastoma multiforme T98G and anaplastic astrocytoma MOGGCCM cells increases their sensitivity to programmed cell death induction upon temozolomide and/or quercetin treatment. Transfection with specific siRNA was performed for the Hsp gene silencing. As revealed by microscopic observation and flow cytometry, the inhibition of Hsp expression was correlated with severe apoptosis induction upon the drug treatment studied. No signs of autophagy were detected. This was correlated with a decreased mitochondrial membrane potential, increased level of cytochrome c in the cytoplasm, and activation of caspase 3 and caspase 9. All these results suggest that the apoptotic signal was mediated by an internal pathway. Additionally, in a large percentage of cells treated with temozolomide, with or without quercetin, granules within the ER system were found, which was accompanied by an increased level of caspase 12 expression. This might be correlated with ER stress. Quercetin and temozolomide also changed the shape of nuclei from circular to “croissant like” in both transfected cell lines. Our results indicate that blocking of Hsp27 and Hsp72 expression makes T98G cells and MOGGCCM cells extremely vulnerable to apoptosis induction upon temozolomide and quercetin treatment and that programmed cell death is initiated by an internal signal. - Highlights: • Hsps gene silencing induced severe apoptosis upon temozolomide–quercetin treatment • Apoptosis in transfected glioma cells was initiated by internal signal • Programmed cell death was preceded by ER stress • Temozolomide–quercetin treatment changed nuclei shape in transfected glioma cells.

  9. Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

    Science.gov (United States)

    Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

    2016-04-15

    Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Directory of Open Access Journals (Sweden)

    Ivyna Pau Ni Bong

    2016-11-01

    Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.

  11. Gene silencing of indoleamine 2,3-dioxygenase 2 in melanoma cells induces apoptosis through the suppression of NAD+ and inhibits in vivo tumor growth.

    Science.gov (United States)

    Liu, Yanling; Zhang, Yujuan; Zheng, Xiufen; Zhang, Xusheng; Wang, Hongmei; Li, Qin; Yuan, Keng; Zhou, Nanjing; Yu, Yanrong; Song, Na; Fu, Jiamin; Min, Weiping

    2016-05-31

    Indoleamine 2,3-dioxygenase 2 (IDO2) is a newly discovered enzyme that catalyzes the initial and rate-limiting step in the degradation of tryptophan. As a homologous protein of IDO1, IDO2 plays an inhibitory role in T cell proliferation, and it is essential for regulatory T cell (Treg) generation in healthy conditions. Little is known about the immune-independent functions of IDO2 relevant to its specific contributions to physiology and pathophysiology in cancer cells. The purpose of this study was to assess the impact of IDO2 gene silencing as a way to inhibit B16-BL6 cancer cells in a murine model. Here, for the first time, we show that knockdown of IDO2 using small interfering RNA (siRNA) inhibits cancer cell proliferation, arrests cell cycle in G1, induces greater cell apoptosis, and reduces cell migration in vitro. Knockdown of IDO2 decreased the generation of nicotinamide adenine dinucleotide (NAD+) while increasing the generation of reactive oxygen species (ROS). We further demonstrate that cell apoptosis, induced by IDO2 downregulation, can be weakened by addition of exogenous NAD+, suggesting a novel mechanism by which IDO2 promotes tumor growth through its metabolite product NAD+. In addition to in vitro findings, we also demonstrate that IDO2 silencing in tumor cells using short hairpin RNA (shRNA) delayed tumor formation and arrested tumor growth in vivo. In conclusion, this study demonstrates a new non-immune-associated mechanism of IDO2 in vitro and IDO2 expression in B16-BL6 cells contributes to cancer development and progression. Our research provides evidence of a novel target for gene silencing that has the potential to enhance cancer therapy.

  12. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Science.gov (United States)

    Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah

    2016-01-01

    Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828

  13. The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

    Directory of Open Access Journals (Sweden)

    Ruilin Wang

    Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

  14. A new component of the Nasonia sex determining cascade is maternally silenced and regulates transformer expression.

    Science.gov (United States)

    Verhulst, Eveline C; Lynch, Jeremy A; Bopp, Daniel; Beukeboom, Leo W; van de Zande, Louis

    2013-01-01

    Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators.

  15. Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

    Science.gov (United States)

    Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

    2013-11-01

    Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

  16. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  17. Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots

    Directory of Open Access Journals (Sweden)

    Ida Bagus Andika

    2016-09-01

    Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.

  18. A Day of Silence, a Day of Truth, and a Lawsuit

    Science.gov (United States)

    Fusarelli, Bonnie C.; Eaton, Lucy E.

    2011-01-01

    This case study focuses on issues of freedom of speech and freedom of religion in public schools. It involves a rural, southern high school where a group of students participated in a Day of Silence. The school allowed the students to participate based on the principal's understanding of the students' First Amendment rights. However, the next day,…

  19. Linguistic and Psychological Perspectives on Prolonged Periods of Silence in Dual-Language Learners

    Science.gov (United States)

    Le Pichon, Emmanuelle; de Jonge, Maretha

    2016-01-01

    In this paper, we present an examination of the literature on prolonged periods of silence in children from the perspective of two different scientific fields. The aim is to call attention to the inherent complexity of the factors that may be involved in the etiology of mutistic behavior during child development. Medical and linguistic literature…

  20. Excavating Silences and Tensions of Agency|Passivity in Science Education Reform

    Science.gov (United States)

    Rivera Maulucci, Maria S.

    2010-01-01

    I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve…

  1. Epigenetic switch from posttranscriptional to transcriptional silencing is correlated with promoter hypermethylation

    Czech Academy of Sciences Publication Activity Database

    Fojtová, Miloslava; Van Houdt, H.; Depicker, A.; Kovařík, Aleš

    2003-01-01

    Roč. 133, č. 3 (2003), s. 1240-1250 ISSN 0032-0889 R&D Projects: GA ČR GA521/01/0037; GA ČR GP521/01/P042 Institutional research plan: CEZ:AV0Z5004920 Keywords : tobacco * gene silencing * transgenic plant Subject RIV: BO - Biophysics Impact factor: 5.634, year: 2003

  2. In trans silencing properties of a tobacco transgene locus depend on its epigenetic state

    Czech Academy of Sciences Publication Activity Database

    Fojtová, Miloslava; Van Houdt, H.; Depicker, A.; Kovařík, Aleš

    2004-01-01

    Roč. 26, č. 3 (2004), s. 147 ISSN 0137-5881. [Congress of the Federation of European Societies of Plant Biology /14./. 23.08.2004-27.08.2004, Cracow] Keywords : plant transgenes * gene expression * silencing Subject RIV: BO - Biophysics

  3. Prediction of the diffuse-field transmission loss of interior natural-ventilation openings and silencers.

    Science.gov (United States)

    Bibby, Chris; Hodgson, Murray

    2017-01-01

    The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.

  4. An Eastern Learning Paradox: Paradoxes in Two Korean Mathematics Teachers' Pedagogy of Silence in the Classroom

    Science.gov (United States)

    Lee, Kyeonghwa; Sriraman, Bharath

    2013-01-01

    Eastern philosophies of education such as Confucianism and Taosim advocate the use of silence in the teacher-pupil tradition of pedagogy. We investigate contemporary classrooms in Korea, and study whether teachers in Korea today incorporate this method implicitly or explicitly in their classrooms. Empirical data in the form of video-taped…

  5. The Relationship among Interactional Justice, Manager Trust and Teachers' Organizational Silence Behavior

    Science.gov (United States)

    Yangin, Demet; Elma, Cevat

    2017-01-01

    The purpose of this study was to determine the relationship between the manager trust and interactional justice perceptions and organizational silence behaviors of those teachers who work in primary and secondary schools. The research is based on the survey model and the population consists of 4761 teachers who worked in Samsun, Turkey. The sample…

  6. The Shadow of Silence on the Sexual Rights of Married Iranian Women

    Directory of Open Access Journals (Sweden)

    Roksana Janghorban

    2015-01-01

    Full Text Available There has been a recent shift in the field of sexual health, representing a move away from biomedical concerns to sexual rights frameworks. However, few studies on sexuality are based on a rights framework. The unspoken nature of sexuality in Iranian culture has led to a lack of national studies on the topic. The objective of this study was to explore the perceptions and experiences of married Iranian women on sexual rights in their sexual relationships. In this grounded theory study, 37 participants (25 married women, 5 husbands, and 7 midwives were selected. Data were collected through in-depth interviews and analyzed through open, axial, and selective coding using MAXQDA software version 2007. The analysis revealed the core category of “sexual interaction in the shadow of silence.” The interrelated categories subsumed under the core category included adopting a strategy of silence, trying to negotiate sex, seeking help, and sexual adjustment. The silence originating from women’s interactions with their families and society, from girlhood to womanhood, was identified as the core concept in Iranian women’s experiences of sexual rights. A focus on husbands’ roles seems salient because they can direct or alter some learned feminine roles, especially silence regarding sexual matters, which then affects the realization of women’s sexual rights.

  7. Gene silencing of stearoyl-ACP desaturase enhances the stearic acid content in Chlamydomonas reinhardtii

    NARCIS (Netherlands)

    Jaeger, de L.; Springer, J.; Wolbert, E.J.H.; Martens, D.E.; Eggink, G.; Wijffels, R.H.

    2017-01-01

    In this study, stearoyl-ACP desaturase (SAD), the enzyme that converts stearic acid into oleic acid, is silenced by artificial microRNA in the green microalga Chlamydomonas reinhardtii. Two different constructs, which target different positions on the mRNA of stearoyl-ACP desaturase, were tested.

  8. Performances of Student Activism: Sound, Silence, Gender, and Dis/ability

    Science.gov (United States)

    Pasque, Penny A.; Vargas, Juanita Gamez

    2014-01-01

    This chapter explores the various performances of activism by students through sound, silence, gender, and dis/ability and how these performances connect to social change efforts around issues such as human trafficking, homeless children, hunger, and children with varying abilities.

  9. Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

    Science.gov (United States)

    Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

    2013-05-01

    We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

  10. Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

    Science.gov (United States)

    Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

    2016-12-01

    Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

  11. Silencing honey bee naked cuticle (nkd) reduces Nosema ceranae replication and disease levels

    Science.gov (United States)

    Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera that has been implicated in alarming colony losses worldwide. RNA interference (RNAi), a post-transcriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling in...

  12. The silence, the subconscious and the mirror: an analysis of Raro de luna by Javier Egea

    Directory of Open Access Journals (Sweden)

    Paula Dvorakova

    2014-02-01

    Full Text Available The aim of this paper is to analyze the last book that Javier Egea published in life-time. It examines Egea’s interest in psychoanalysis, surrealism and subconscious. It analyzes his effort to recognize and escape the contradictions of language and it also focuses on the symbols of silence and water.

  13. The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

    NARCIS (Netherlands)

    Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

    2004-01-01

    Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

  14. The Silencing of the Knowledge-Base in Early Childhood Education and Care Professionalism

    Science.gov (United States)

    Campbell-Barr, Verity

    2018-01-01

    It is widely accepted that the early childhood education and care (ECEC) workforce is central to the quality of services. Modernist constructs of quality signal the importance of qualifications for quality, but the preoccupation with qualification levels silences questions about the knowledge required of ECEC professionals. Postmodern perspectives…

  15. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules

    NARCIS (Netherlands)

    Schnettler, E.; Hemmes, J.C.; Huisman, R.; Goldbach, R.W.; Prins, M.W.; Kormelink, R.J.M.

    2010-01-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs

  16. CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs

    DEFF Research Database (Denmark)

    Mandegar, Mohammad A.; Huebsch, Nathaniel; Frolov, Ekaterina B.

    2016-01-01

    repression system is tunable and has the potential to silence single alleles. Compared with CRISPR nuclease (CRISPRn), CRISPRi gene repression is more efficient and homogenous across cell populations. The CRISPRi system in iPSCs provides a powerful platform to perform genome-scale screens in a wide range...

  17. The Relationship between Organizational Climate and the Organizational Silence of Administrative Staff in Education Department

    Science.gov (United States)

    Pozveh, Asghar Zamani; Karimi, Fariba

    2016-01-01

    The aim of the present study was to determine the relationship between organizational climate and the organizational silence of administrative staff in Education Department in Isfahan. The research method was descriptive and correlational-type method. The study population was administrative staff of Education Department in Isfahan during the…

  18. PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

    Science.gov (United States)

    Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

    2017-07-01

    Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  19. After Brown U.'s Report on Slavery, Silence (So Far)

    Science.gov (United States)

    Bartlett, Thomas

    2006-01-01

    This article, discusses Brown University's slavery report, a 106-page narrative examination of the early connections between Brown University and slavery, that has been greeted--so far--with silence. The report, done at the behest of Ruth J. Simmons, Brown's president and herself a descendant of slaves, is an unsparing look at a shameful side of…

  20. The Ebola virus VP35 protein is a suppressor of RNA silencing

    NARCIS (Netherlands)

    Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.

    2007-01-01

    RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is

  1. Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

    Directory of Open Access Journals (Sweden)

    Chantelle Ahlenstiel

    2015-01-01

    Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

  2. PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

    Science.gov (United States)

    Yang, Weiyuan; Cai, Yuanping; Hu, Li; Wei, Qian; Chen, Guoju; Bai, Mei; Wu, Hong; Liu, Juanxu; Yu, Yixun

    2017-02-02

    Cellulose synthase catalytic subunits (CESAs) play important roles in plant growth, development and disease resistance. Previous studies have shown an essential role of Arabidopsis thaliana CESA3 in plant growth. However, little is known about the role of CESA3 in species other than A. thaliana. To gain a better understanding of CESA3, the petunia (Petunia hybrida) PhCESA3 gene was isolated, and the role of PhCESA3 in plant growth was analyzed in a wide range of plants. PhCESA3 mRNA was present at varying levels in tissues examined. VIGS-mediated PhCESA3 silencing resulted in dwarfing of plant height, which was consistent with the phenotype of the A. thaliana rsw1 mutant (a temperature-sensitive allele of AtCESA1), the A. thaliana cev1 mutant (the AtCESA3 mild mutant), and the antisense AtCESA3 line. However, PhCESA3 silencing led to swollen stems, pedicels, filaments, styles and epidermal hairs as well as thickened leaves and corollas, which were not observed in the A. thaliana cev1 mutant, the rsw1 mutant and the antisense AtCESA3 line. Further micrographs showed that PhCESA3 silencing reduced the length and increased the width of cells, suggesting that PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

  3. Breaking the culture of silence in checkmating HIV/AIDS as a ...

    African Journals Online (AJOL)

    In my investigation I set out to break the HIV/AIDS culture of silence and emphasize the role of the teacher as a researcher and critical change agent in an HIV/AIDS challenged society. My work demonstrates how teachers could play such a role by encouraging learners' participation in sport. The sport, I focussed on in my ...

  4. ATR acts stage specifically to regulate multiple aspects of mammalian meiotic silencing

    NARCIS (Netherlands)

    Royo, Hélène; Prosser, Haydn; Ruzankina, Yaroslava; Mahadevaiah, Shantha K.; Cloutier, Jeffrey M.; Baumann, Marek; Fukuda, Tomoyuki; Höög, Christer; Tóth, Attila; de Rooij, Dirk G.; Bradley, Allan; Brown, Eric J.; Turner, James M. A.

    2013-01-01

    In mammals, homologs that fail to synapse during meiosis are transcriptionally inactivated. This process, meiotic silencing, drives inactivation of the heterologous XY bivalent in male germ cells (meiotic sex chromosome inactivation [MSCI]) and is thought to act as a meiotic surveillance mechanism.

  5. Chinese Cambodian Memory Work: Racial Terror and the Spaces of Haunting and Silence

    OpenAIRE

    Tea, Angela

    2014-01-01

    This thesis explores the terror and horror produced in the reification of ethnic classification and racial categorization of Chinese in Cambodia and its hauntings through memory works. This research relies on the memoirs of Luong Ung-Lai and Loung Ung and a performance piece by Jolie Chea. These cultural productions engages in the hauntings of memory and takes into consideration spaces of silence.

  6. Gene dosage induction of silencing directed against an Arabidopsis Myb transgene in tobacco

    Science.gov (United States)

    An unexpected reduction in petal pigmentation on petunia plants genetically engineered for enhanced flower color was one of the first experimental demonstrations of the natural process of RNA-associated gene silencing. The obvious visual nature of such alterations to pigment patterns of transgenic ...

  7. What Are Business Schools for? On Silence and Voice in Management Education.

    Science.gov (United States)

    Grey, Christopher

    2002-01-01

    The purpose of business schools seems not to be training effective managers but rather socializing them and legitimizing management, leading to silence about the reality of working conditions. Critical management education would expose students to problematic management issues related to gender, ethnicity, power, the environment, and others.…

  8. The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

    Science.gov (United States)

    Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

    2007-09-18

    Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

  9. Breaking the Culture of Silence in Checkmating HIV/AIDS as a Teacher-Researcher

    Science.gov (United States)

    Esau, O.

    2010-01-01

    In my investigation I set out to break the HIV/AIDS culture of silence and emphasize the role of the teacher as a researcher and critical change agent in an HIV/AIDS challenged society. My work demonstrates how teachers could play such a role by encouraging learners' participation in sport. The sport, I focussed on in my action research project…

  10. Protocol: using virus-induced gene silencing to study the arbuscular mycorrhizal symbiosis in Pisum sativum

    DEFF Research Database (Denmark)

    Grønlund, Mette; Olsen, Anne; Johansen, Elisabeth

    2010-01-01

    , the available PEBV-VIGS protocols are inadequate for studying genes involved in the symbiosis with arbuscular mycorrhizal fungi (AMF). Here we describe a PEBV-VIGS protocol suitable for reverse genetics studies in pea of genes involved in the symbiosis with AMF and show its effectiveness in silencing genes...... involved in the early and late stages of AMF symbiosis....

  11. The Role of Silence at the Retreats of a Buddhist Community

    Directory of Open Access Journals (Sweden)

    Orsolya Huszár

    2016-12-01

    Full Text Available The purpose of the study is to establish that the definition of silence as simply an absence of something or as the background of communication proves to be inadequate in a number of communicative instances. The interpretation of silence is culturally determined, and the underappreciation of its role is typical in low-context Western cultures; this is also evinced by the neglect of the topic in the literature. The present study will describe the communicative functions of silence through the findings of field work conducted at the retreats of a Buddhist community in Hungary, providing empirical input for the relevant theoretical constructs. The research findings show that silence is accorded a central role in essentially every component of the retreat (meditations, relaxation, ceremonies, teachings, small-group sharings, meals and rest; and while each event at the retreat focuses primarily on a different specific function of communication, the entire retreat does involve the linkage, affecting, revelational and – to a certain extent – activating functions (to follow the five-element typology of J. Vernon Jensen, as well as – to a lesser extent – the judgmental function. The research also shows that it requires time for individuals in a low-context culture to recognize the “point” of silence – something that the retreats provide the right opportunity for. In fact, the insights the individuals arrived at through these occasions could be put to use in their daily lives, helping their problem-solving and social relationships and in general improving their quality of life.

  12. An investigation of noise produced by unsteady gas flow through silencer elements

    Science.gov (United States)

    Mawhinney, Graeme Hugh

    This thesis presents an investigation of the noise produced by unsteady gas flow through silencer elements. The central aim of the research project was to produce a tool for assistance in the design of the exhaust systems of diesel powered electrical generator sets, with the modelling techniques developed having a much wider application in reciprocating internal combustion engine exhaust systems. An automotive cylinder head was incorporated in a purpose built test rig to supply exhaust pulses, typical of those found in the exhaust system of four stroke diesel engines, to various experimental exhaust systems. Exhaust silencer elements evaluated included expansion, re- entrant, concentric tube resonator and absorptive elements. Measurements taken on the test rig included, unsteady superposition pressure in the exhaust ducting, cyclically averaged mass flow rate through the system and exhaust noise levels radiated into a semi-anechoic measurement chamber. The entire test rig was modelled using the 1D finite volume method developed previously developed at Queen's University Belfast. Various boundary conditions, developed over the years, were used to model the various silencer elements being evaluated. The 1D gas dynamic simulation thus estimated the mass flux history at the open end of the exhaust system. The mass flux history was then broken into its harmonic components and an acoustic radiation model was developed to model the sound pressure level produced by an acoustic monopole over a reflecting plane. The accuracy of the simulation technique was evaluated by correlation of measured and simulated superposition pressure and noise data. In general correlation of superposition pressure was excellent for all of the silencer elements tested. Predicted sound pressure level radiated from the open end of the exhaust tailpipe was seen to be accurate in the 100 Hz to 1 kHz frequency range for all of the silencer elements tested.

  13. Hush… : The Dangers of Silence in Academic Libraries

    OpenAIRE

    Jessica Schomberg; Kirsti Cole

    2017-01-01

    In Brief This article critiques the idea that civility rhetoric decreases workplace bullying or discrimination. We use Critical Discourse Analysis (CDA) to do a rhetorical analysis of a campus-wide civility campaign in contrast with literature about civility in libraries. To combat discrimination and bullying, we need to be attentive to systemic power dynamics and to rhetoric designed to enforce compliance and conformity. We conclude with recommendations about how to raise our voices instead ...

  14. Magical thinking decreases across adulthood.

    Science.gov (United States)

    Brashier, Nadia M; Multhaup, Kristi S

    2017-12-01

    Magical thinking, or illogical causal reasoning such as superstitions, decreases across childhood, but almost no data speak to whether this developmental trajectory continues across the life span. In four experiments, magical thinking decreased across adulthood. This pattern replicated across two judgment domains and could not be explained by age-related differences in tolerance of ambiguity, domain-specific knowledge, or search for meaning. These data complement and extend findings that experience, accumulated over decades, guides older adults' judgments so that they match, or even exceed, young adults' performance. They also counter participants' expectations, and cultural sayings (e.g., "old wives' tales"), that suggest that older adults are especially superstitious. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  15. Does fertility decrease household consumption?

    OpenAIRE

    Jungho Kim; Henriette Engelhardt; Alexia Fürnkranz-Prskawetz; Arnstein Aassve

    2009-01-01

    This paper presents an empirical analysis of the relationship between fertility and a direct measure of poverty for Indonesia, a country, which has experienced unprecedented economic growth and sharp fertility declines over recent decades. It focuses on illustrating the sensitivity of the effect of fertility on household consumption with respect to the equivalence scale by applying the propensity score matching method. The analysis suggests that a newborn child decreases household consumption...

  16. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  17. High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

    Directory of Open Access Journals (Sweden)

    Bianco Linda

    2009-11-01

    Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor

  18. Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

    International Nuclear Information System (INIS)

    Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

    2010-01-01

    Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

  19. Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

    Science.gov (United States)

    Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

    2010-12-15

    N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

  20. Designing and Manufacturing a Noise Controlling Silencer for the Cooling Tower Pump of Sarcheshmeh Copper Power Station

    Directory of Open Access Journals (Sweden)

    Sajad Zare

    2017-08-01

    Full Text Available Background One of the most common harmful factors in the workplace is noise. Noise control is a factor beneficial for health and safety in the workplace. Objectives The current study aimed to design and manufacture a silencer for the cooling tower pump of Sarcheshmeh Copper power station in order to control noise. Methods In this study, sound pressure level was measured by the use of a sound level meter (B & K 2260. Measurement was carried out in the light of ISO 1996 standard. After studying technical and acoustic features of the noise source, a dispersive-absorptive silencer was designed to control noise pollution generated by the cooling tower pump of the thermal station. After analyzing the frequencies of sound pressure level and using available data, a cylindrical silencer (with a diameter of 1.5 m and height of 3 m was designed and manufactured. The internal part of the silencer was filled with different columns of absorbent material covered with punched metal. Therefore, the silencer consisted of (1 acoustic diffuser, (2 acoustic chamber, and (3 acoustic channels. Results Measurements showed that, at a distance of 1 m from the source, sound pressure level reduced from 127 dBA before installing the silencer to 79 dBA after the installation, resulting in a reduction of 48 dBA. Conclusions Using a silencer with absorbent material (glass wool is very effective in reducing the noise generated by the pump.

  1. The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

    Science.gov (United States)

    Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

    2014-02-13

    Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Role of DNA methylation and epigenetic silencing of HAND2 in endometrial cancer development.

    Directory of Open Access Journals (Sweden)

    Allison Jones

    2013-11-01

    Full Text Available Endometrial cancer incidence is continuing to rise in the wake of the current ageing and obesity epidemics. Much of the risk for endometrial cancer development is influenced by the environment and lifestyle. Accumulating evidence suggests that the epigenome serves as the interface between the genome and the environment and that hypermethylation of stem cell polycomb group target genes is an epigenetic hallmark of cancer. The objective of this study was to determine the functional role of epigenetic factors in endometrial cancer development.Epigenome-wide methylation analysis of >27,000 CpG sites in endometrial cancer tissue samples (n = 64 and control samples (n = 23 revealed that HAND2 (a gene encoding a transcription factor expressed in the endometrial stroma is one of the most commonly hypermethylated and silenced genes in endometrial cancer. A novel integrative epigenome-transcriptome-interactome analysis further revealed that HAND2 is the hub of the most highly ranked differential methylation hotspot in endometrial cancer. These findings were validated using candidate gene methylation analysis in multiple clinical sample sets of tissue samples from a total of 272 additional women. Increased HAND2 methylation was a feature of premalignant endometrial lesions and was seen to parallel a decrease in RNA and protein levels. Furthermore, women with high endometrial HAND2 methylation in their premalignant lesions were less likely to respond to progesterone treatment. HAND2 methylation analysis of endometrial secretions collected using high vaginal swabs taken from women with postmenopausal bleeding specifically identified those patients with early stage endometrial cancer with both high sensitivity and high specificity (receiver operating characteristics area under the curve = 0.91 for stage 1A and 0.97 for higher than stage 1A. Finally, mice harbouring a Hand2 knock-out specifically in their endometrium were shown to develop

  3. Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

    Science.gov (United States)

    Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

    2017-10-01

    ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Mitochondrial calcium uniporter silencing potentiates caspase-independent cell death in MDA-MB-231 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)

    2013-05-10

    Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.

  5. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  6. Decreasing Fires in Mediterranean Europe.

    Directory of Open Access Journals (Sweden)

    Marco Turco

    Full Text Available Forest fires are a serious environmental hazard in southern Europe. Quantitative assessment of recent trends in fire statistics is important for assessing the possible shifts induced by climate and other environmental/socioeconomic changes in this area. Here we analyse recent fire trends in Portugal, Spain, southern France, Italy and Greece, building on a homogenized fire database integrating official fire statistics provided by several national/EU agencies. During the period 1985-2011, the total annual burned area (BA displayed a general decreasing trend, with the exception of Portugal, where a heterogeneous signal was found. Considering all countries globally, we found that BA decreased by about 3020 km2 over the 27-year-long study period (i.e. about -66% of the mean historical value. These results are consistent with those obtained on longer time scales when data were available, also yielding predominantly negative trends in Spain and France (1974-2011 and a mixed trend in Portugal (1980-2011. Similar overall results were found for the annual number of fires (NF, which globally decreased by about 12600 in the study period (about -59%, except for Spain where, excluding the provinces along the Mediterranean coast, an upward trend was found for the longer period. We argue that the negative trends can be explained, at least in part, by an increased effort in fire management and prevention after the big fires of the 1980's, while positive trends may be related to recent socioeconomic transformations leading to more hazardous landscape configurations, as well as to the observed warming of recent decades. We stress the importance of fire data homogenization prior to analysis, in order to alleviate spurious effects associated with non-stationarities in the data due to temporal variations in fire detection efforts.

  7. Decreasing Fires in Mediterranean Europe.

    Science.gov (United States)

    Turco, Marco; Bedia, Joaquín; Di Liberto, Fabrizio; Fiorucci, Paolo; von Hardenberg, Jost; Koutsias, Nikos; Llasat, Maria-Carmen; Xystrakis, Fotios; Provenzale, Antonello

    2016-01-01

    Forest fires are a serious environmental hazard in southern Europe. Quantitative assessment of recent trends in fire statistics is important for assessing the possible shifts induced by climate and other environmental/socioeconomic changes in this area. Here we analyse recent fire trends in Portugal, Spain, southern France, Italy and Greece, building on a homogenized fire database integrating official fire statistics provided by several national/EU agencies. During the period 1985-2011, the total annual burned area (BA) displayed a general decreasing trend, with the exception of Portugal, where a heterogeneous signal was found. Considering all countries globally, we found that BA decreased by about 3020 km2 over the 27-year-long study period (i.e. about -66% of the mean historical value). These results are consistent with those obtained on longer time scales when data were available, also yielding predominantly negative trends in Spain and France (1974-2011) and a mixed trend in Portugal (1980-2011). Similar overall results were found for the annual number of fires (NF), which globally decreased by about 12600 in the study period (about -59%), except for Spain where, excluding the provinces along the Mediterranean coast, an upward trend was found for the longer period. We argue that the negative trends can be explained, at least in part, by an increased effort in fire management and prevention after the big fires of the 1980's, while positive trends may be related to recent socioeconomic transformations leading to more hazardous landscape configurations, as well as to the observed warming of recent decades. We stress the importance of fire data homogenization prior to analysis, in order to alleviate spurious effects associated with non-stationarities in the data due to temporal variations in fire detection efforts.

  8. Technologies for Decreasing Mining Losses

    Science.gov (United States)

    Valgma, Ingo; Väizene, Vivika; Kolats, Margit; Saarnak, Martin

    2013-12-01

    In case of stratified deposits like oil shale deposit in Estonia, mining losses depend on mining technologies. Current research focuses on extraction and separation possibilities of mineral resources. Selective mining, selective crushing and separation tests have been performed, showing possibilities of decreasing mining losses. Rock crushing and screening process simulations were used for optimizing rock fractions. In addition mine backfilling, fine separation, and optimized drilling and blasting have been analyzed. All tested methods show potential and depend on mineral usage. Usage in addition depends on the utilization technology. The questions like stability of the material flow and influences of the quality fluctuations to the final yield are raised.

  9. Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing).

    Science.gov (United States)

    Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame

    2014-04-20

    A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.

  10. Specific degradation of 3' regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5'-3' spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  11. Decreasing incidence rates of bacteremia

    DEFF Research Database (Denmark)

    Nielsen, Stig Lønberg; Pedersen, C; Jensen, T G

    2014-01-01

    BACKGROUND: Numerous studies have shown that the incidence rate of bacteremia has been increasing over time. However, few studies have distinguished between community-acquired, healthcare-associated and nosocomial bacteremia. METHODS: We conducted a population-based study among adults with first......-time bacteremia in Funen County, Denmark, during 2000-2008 (N = 7786). We reported mean and annual incidence rates (per 100,000 person-years), overall and by place of acquisition. Trends were estimated using a Poisson regression model. RESULTS: The overall incidence rate was 215.7, including 99.0 for community......-acquired, 50.0 for healthcare-associated and 66.7 for nosocomial bacteremia. During 2000-2008, the overall incidence rate decreased by 23.3% from 254.1 to 198.8 (3.3% annually, p incidence rate of community-acquired bacteremia decreased by 25.6% from 119.0 to 93.8 (3.7% annually, p

  12. Price of forest chips decreasing

    International Nuclear Information System (INIS)

    Hakkila, P.

    2001-01-01

    Use of forest chips was studied in 1999 in the national Puuenergia (Wood Energy) research program. Wood combusting heating plants were questioned about are the main reasons restricting the increment of the use of forest chips. Heating plants, which did not use forest chips at all or which used less than 250 m 3 (625 bulk- m 3 ) in 1999 were excluded. The main restrictions for additional use of forest chips were: too high price of forest chips; lack of suppliers and/or uncertainty of deliveries; technical problems of reception and processing of forest chips; insufficiency of boiler output especially in winter; and unsatisfactory quality of chips. The price of forest chips becomes relatively high because wood biomass used for production of forest chips has to be collected from wide area. Heavy equipment has to be used even though small fragments of wood are processed, which increases the price of chips. It is essential for forest chips that the costs can be pressed down because competition with fossil fuels, peat and industrial wood residues is hard. Low market price leads to the situation in which forest owner gets no price of the raw material, the entrepreneurs operate at the limit of profitability and renovation of machinery is difficult, and forest chips suppliers have to sell the chips at prime costs. Price of forest chips has decreased significantly during the past decade. Nominal price of forest chips is now lower than two decades ago. The real price of chips has decreased even more than the nominal price, 35% during the past decade and 20% during the last five years. Chips, made of small diameter wood, are expensive because the price includes the felling costs and harvesting is carried out at thinning lots. Price is especially high if chips are made of delimbed small diameter wood due to increased the work and reduced amount of chips. The price of logging residue chips is most profitable because cutting does not cause additional costs. Recovery of chips is

  13. A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.

    Directory of Open Access Journals (Sweden)

    Pengfei Ding

    2015-06-01

    Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.

  14. Rigidity spectrum of Forbush decrease

    International Nuclear Information System (INIS)

    Sakakibara, S.; Munakata, K.; Nagashima, K.

    1985-01-01

    Using data from neutron monitors and muon telescopes at surface and underground stations, the average rigidity spectrum of Forbush decreases (Fds) during the period of 1978-1982 were obtained. Thirty eight Ed-events are classified into two groups, Hard Fd and Soft FD according to size of Fd at the Sakashita station. It is found that a spectral form of a fractional-power type (P to the-gamma sub 1 (P+P sub c) to the -gamma sub2) is more suitable than that of a power-exponential type or of a power type with an upper limiting rigidity. The best fitted spectrum of the fractional-power type is expressed by gamma sub1 = 0.37, gamma sub2 = 0.89 and P subc = 10 GV for Hard Fd and gamma sub1 = 0.77, gamma sub2 = 1.02 and P sub c - 14GV for Soft Fd

  15. Method of decreasing nuclear power

    International Nuclear Information System (INIS)

    Masuda, Hiromi

    1987-01-01

    Purpose: To easily attain the power decreasing in a HWLWR type reactor and improve the reactor safety. Method: The method is applied to a nuclear reactor in which the reactor reactivity is controlled by control rods and liquid posions dissolved in moderators. Means for forecasting the control rod operation amount required for the reactor power down and means for removing liquid poisons in the moderators are provided. The control rod operation amount required for the power down is forecast before the power down and the liquid poisons in the moderators are removed. Then, the control rods are inserted into a deep insertion position to reduce the reactor power. This invention can facilitate easy power down, as well as provide effects of improving the controllability in the usual operation and of avoiding abrupt power down which leads to an improved availability. (Kamimura, M.)

  16. shRNA-mediated EMMPRIN silencing inhibits human leukemic monocyte lymphoma U937 cell proliferation and increases chemosensitivity to adriamycin.

    Science.gov (United States)

    Gao, Hui; Jiang, Qixiao; Han, Yantao; Peng, Jianjun; Wang, Chunbo

    2015-03-01

    EMMPRIN is a widely distributed cell surface glycoprotein, which plays an important role in tumor progression and confers resistance to some chemotherapeutic drugs. Recent studies have shown that EMMPRIN overexpression indicates poor prognosis in acute myeloid leukemia (AML). However, little was known on the role of EMMPRIN in leukemia. Human leukemia cell line U937 was stably transfected with a EMMPRIN-targeted shRNA-containing vector to investigate the effect of EMMPRIN on cellular functions. EMMPRIN expression was monitored by qRT-PCR and Western blotting. Cell viability and proliferation were determined by trypan blue exclusion and BrdU labeling, respectively. Cell cycle and apoptosis were analyzed by flow cytometry. Cytotoxicity of chemotherapeutic agent adriamycin on cells was assessed by MTT assay. Knockdown of EMMPRIN gene significantly inhibited cell viability and decreased cell proliferation. Fluorescence-activated cell-sorting analysis revealed that the reduced EMMPRIN expression resulted in cell cycle arrest at G1 phase and induced apoptosis. Meanwhile, western blotting analysis showed that EMMPRIN knockdown was associated with downregulation of cell cycle- and apoptosis-related molecules including cyclin D1, cyclin E, as well as increase in cleavage of caspase-3 and PARP. This study also showed that silencing of EMMPRIN sensitized U937 cells to Adriamycin. EMMPRIN is involved in proliferation, growth, and chemosensitivity of human AML line U937, indicating that EMMPRIN may be a promising therapeutic target for AML.

  17. Effect of specific silencing of EMMPRIN on the growth and cell cycle distribution of MCF-7 breast cancer cells.

    Science.gov (United States)

    Yang, X Q; Yang, J; Wang, R; Zhang, S; Tan, Q W; Lv, Q; Meng, W T; Mo, X M; Li, H J

    2015-12-02

    The extracellular matrix metalloproteinase inducer (EMMPRIN, CD147) is a member of the immunoglobulin family and shows increased expression in tumor cells. We examined the effect of RNAi-mediated EMMPRIN gene silencing induced by lentiviral on the growth and cycle distribution of MCF-7 breast cancer cells. Lentiviral expressing EMMPRIN-short hairpin RNA were packaged to infect MCF-7 cells. The inhibition efficiency of EMMPRIN was validated by real-time fluorescent quantitation polymerase chain reaction and western blotting. The effect of EMMPRIN on cell proliferation ability was detected using the MTT assay and clone formation experiments. Changes in cell cycle were detected by flow cytometry. EMMPRIN-short hairpin RNA-packaged lentiviral significantly down-regulated EMMPRIN mRNA and protein expression, significantly inhibited cell proliferation and in vitro tumorigenicity, and induced cell cycle abnormalities. Cells in the G0/G1 and G2/M phases were increased, while cells in the S phase were decreased after infection of MCF-7 cells for 3 days. The EMMPRIN gene facilitates breast cancer cell malignant proliferation by regulating cell cycle distribution and may be a molecular target for breast cancer gene therapy.

  18. JAK inhibition induces silencing of T Helper cytokine secretion and a profound reduction in T regulatory cells.

    Science.gov (United States)

    Keohane, Clodagh; Kordasti, Shahram; Seidl, Thomas; Perez Abellan, Pilar; Thomas, Nicholas S B; Harrison, Claire N; McLornan, Donal P; Mufti, Ghulam J

    2015-10-01

    CD4(+) T cells maintain cancer surveillance and immune tolerance. Chronic inflammation has been proposed as a driver of clonal evolution in myeloproliferative neoplasms (MPN), suggesting that T cells play an important role in their pathogenesis. Treatment with JAK inhibitors (JAKi) results in improvements in MPN-associated constitutional symptoms as well as reductions in splenomegaly. However, effects of JAKi on T cells in MPN are not well established and the baseline immune signature remains unclear. We investigated the frequency and function of CD4(+) T cell subsets in 50 MPN patients at baseline as well as during treatment with either ruxolitinib or fedratinib in a subset. We show that CD4(+)  CD127(low)  CD25(high)  FOXP3(+) T regulatory cells are reduced in MPN patients compared to healthy controls and that this decrease is even more pronounced following JAKi therapy. Moreover, we show that after 6 months of treatment the number of T helper (Th)-17 cells increased. We also describe a functional 'silencing' of T helper cells both in vivo and in vitro and a blockade of pro-inflammatory cytokines from these cells. This profound effect of JAKi on T cell function may underlay augmented rates of atypical infections that have been reported with use of these drugs. © 2015 John Wiley & Sons Ltd.

  19. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  20. Small ubiquitin-like modifier (SUMO) conjugation impedes transcriptional silencing by the polycomb group repressor Sex Comb on Midleg.

    Science.gov (United States)

    Smith, Matthew; Mallin, Daniel R; Simon, Jeffrey A; Courey, Albert J

    2011-04-01

    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE.

  1. Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg*

    Science.gov (United States)

    Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.

    2011-01-01

    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE. PMID:21278366

  2. Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

    Science.gov (United States)

    Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

    2017-02-01

    Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

  3. Ce que l’on fait dire au silence : posture, ethos, image d’auteur How to make silence talk… Posture, ethos, author’s image

    Directory of Open Access Journals (Sweden)

    Jérôme Meizoz

    2009-10-01

    Full Text Available Après la parution de Postures littéraires (2007 cet article revient sur la visée méthodologique de la notion de « posture », en la confrontant à deux notions voisines, celles d’« ethos » et d’« image d’auteur ». Il propose de hiérarchiser ces trois notions dans un ensemble conceptuel. Une brève analyse du Silence de la mer (1942 de Vercors illustre cette réflexion.After the publication of Literary postures (2007, this article revisits the methodological approach based on the notion of “posture” by comparing it with two related notions, “ethos” and “author’s image”. It shows how these three notions can be organized into a hierarchy inside an integrated conceptual whole. A brief analysis of Vercors’ TheSilence of the Sea (1942 illustrates this proposition.

  4. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  5. Silenced uses and moral ideals in the exchange of Danish blood and plasma

    DEFF Research Database (Denmark)

    Sheikh, Zainab Afshan; Deleuran, Ida; Hoeyer, Klaus

    2016-01-01

    This article explores the interplay between cultural discourses, moral reasoning and silenced uses in the international exchange of Danish blood plasma. Campaigns, policymakers, health professionals working in the blood banks – and even donors – consistently refer to ideals portraying blood....... However, we find that available cultural discourses poorly capture the moral reasoning among many donors. In fact, when informed about the existing forms of tender, plasma trade sounds like a good idea to most of them. Furthermore, they are not particularly interested in information. We argue...... that the silencing of trade is infusing the system with an unnecessary vulnerability that could easily be avoided with a different communication strategy towards donors. To arrive at new and better strategies, however, one must move beyond the immediate words and reactions of donors contemplating trade and seek...

  6. Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain

    Directory of Open Access Journals (Sweden)

    Julia F Alterman

    2015-01-01

    Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.

  7. Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity

    DEFF Research Database (Denmark)

    Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C

    2011-01-01

    expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...

  8. Effects of neoliberal rationality in speeches on inclusion: the teacher’s silence

    Directory of Open Access Journals (Sweden)

    Leandra Boer Possa

    2013-06-01

    Full Text Available This text, which makes use of the National Policy on Special Education in the Perspective of Inclusive Education and the programs that embrace the training of teachers for diversity/ inclusion, puts the discursive effects of these documents in analytic sets. Without attempting at doing an exhaustive analysis, this study aims at problematizing the effect of teacher’s silence that the neoliberal policy has been producing on teachers who work in municipal and state education systems in Santa Maria area. The conceptual and methodological tool of governmentality is used in this enterprise in order to think that the discourses of inclusion have convinced and subjectivized teachers, because in the face of the irreducibility of this discursive network the silence is an effect of the production and consumption of the principle of inclusion and enterprise itself.

  9. Gated audiovisual speech identification in silence vs. noise: effects on time and accuracy

    Science.gov (United States)

    Moradi, Shahram; Lidestam, Björn; Rönnberg, Jerker

    2013-01-01

    This study investigated the degree to which audiovisual presentation (compared to auditory-only presentation) affected isolation point (IPs, the amount of time required for the correct identification of speech stimuli using a gating paradigm) in silence and noise conditions. The study expanded on the findings of Moradi et al. (under revision), using the same stimuli, but presented in an audiovisual instead of an auditory-only manner. The results showed that noise impeded the identification of consonants and words (i.e., delayed IPs and lowered accuracy), but not the identification of final words in sentences. In comparison with the previous study by Moradi et al., it can be concluded that the provision of visual cues expedited IPs and increased the accuracy of speech stimuli identification in both silence and noise. The implication of the results is discussed in terms of models for speech understanding. PMID:23801980

  10. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  11. FMR1 epigenetic silencing commonly occurs in undifferentiated fragile X-affected embryonic stem cells.

    Science.gov (United States)

    Avitzour, Michal; Mor-Shaked, Hagar; Yanovsky-Dagan, Shira; Aharoni, Shira; Altarescu, Gheona; Renbaum, Paul; Eldar-Geva, Talia; Schonberger, Oshrat; Levy-Lahad, Ephrat; Epsztejn-Litman, Silvina; Eiges, Rachel

    2014-11-11

    Fragile X syndrome (FXS) is the most common heritable form of cognitive impairment. It results from epigenetic silencing of the X-linked FMR1 gene by a CGG expansion in its 5'-untranslated region. Taking advantage of a large set of FXS-affected human embryonic stem cell (HESC) lines and isogenic subclones derived from them, we show that FMR1 hypermethylation commonly occurs in the undifferentiated state (six of nine lines, ranging from 24% to 65%). In addition, we demonstrate that hypermethylation is tightly linked with FMR1 transcriptional inactivation in undifferentiated cells, coincides with loss of H3K4me2 and gain of H3K9me3, and is unrelated to CTCF binding. Taken together, these results demonstrate that FMR1 epigenetic gene silencing takes place in FXS HESCs and clearly highlights the importance of examining multiple cell lines when investigating FXS and most likely other epigenetically regulated diseases.

  12. FMR1 Epigenetic Silencing Commonly Occurs in Undifferentiated Fragile X-Affected Embryonic Stem Cells

    Directory of Open Access Journals (Sweden)

    Michal Avitzour

    2014-11-01

    Full Text Available Fragile X syndrome (FXS is the most common heritable form of cognitive impairment. It results from epigenetic silencing of the X-linked FMR1 gene by a CGG expansion in its 5′-untranslated region. Taking advantage of a large set of FXS-affected human embryonic stem cell (HESC lines and isogenic subclones derived from them, we show that FMR1 hypermethylation commonly occurs in the undifferentiated state (six of nine lines, ranging from 24% to 65%. In addition, we demonstrate that hypermethylation is tightly linked with FMR1 transcriptional inactivation in undifferentiated cells, coincides with loss of H3K4me2 and gain of H3K9me3, and is unrelated to CTCF binding. Taken together, these results demonstrate that FMR1 epigenetic gene silencing takes place in FXS HESCs and clearly highlights the importance of examining multiple cell lines when investigating FXS and most likely other epigenetically regulated diseases.

  13. Inhibition of human esophageal squamous cell carcinomas by targeted silencing of tumor enhancer genes: an overview

    International Nuclear Information System (INIS)

    Islamian, Jalil Pirayesh; Mohammadi, Mohsen; Baradaran, Behzad

    2014-01-01

    Esophageal cancer has been reported as the ninth most common malignancy and ranks as the sixth most frequent cause of death worldwide. Esophageal cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy. Novel strategies are needed to boost the oncologic outcome. Recent advances in the molecular biology of esophageal cancer have documented the role of genetic alterations in tumorigenesis. Oncogenes serve a pivotal function in tumorigenesis. Targeted therapies are directed at the unique molecular signature of cancer cells for enhanced efficacy with low toxicity. RNA interference (RNAi) technology is a powerful tool for silencing endogenous or exogenous genes in mammalian cells. Related results have shown that targeting oncogenes with siRNAs, specifically the mRNA, effectively reduces tumor cell proliferation and induces apoptotic cell death. This article will briefly review studies on silencing tumor enhancer genes related to the induction of esophageal cancer

  14. Down-regulation of osmotin (PR5) gene by virus-induced gene silencing (VIGS) leads to susceptibility of resistant Piper colubrinum Link. to the oomycete pathogen Phytophthora capsici Leonian.

    Science.gov (United States)

    Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S

    2015-06-01

    Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.

  15. Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

    KAUST Repository

    Idris, Ali; Tuttle, John Richard; Robertson, Dominique Niki; Haigler, Candace H.; Brown, Judith K.

    2010-01-01

    inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor

  16. Book review: F. Azouvi, Le Mythe du grand silence: Auschwitz, les Français, la mémoire

    OpenAIRE

    Cavaletto , Andrea

    2014-01-01

    International audience; Review of: F. Azouvi, "Le Mythe du grand silence: Auschwitz, les Français, la mémoire", Fayard, 2012. Journal of Interdisciplinary History of Ideas, vol.2, n.4, December 2013

  17. Sound attenuation of a finite length dissipative flow duct silencer with internal mean flow in the absorbent

    Science.gov (United States)

    Cummings, A.; Chang, I.-J.

    1988-11-01

    Internal mean flow within the pores of a bulk-reacting porous acoustic absorbent, driven by mean static pressure gradients, is shown here to be an important feature of the acoustics of dissipative silencers in flow ducts, particularly in the case of internal combustion engine exhaust silencers. Theoretical treatments are presented here, both to describe the effect of internal flow on the bulk acoustic perties of the porous medium and to find the effect of the absorbent in situ, in the form of the sound transmission loss of the silencer. The measured transmission loss of an experimental silencer is compared to predicted data and good agreement between the two is obtained. The effects of mean fluid flow in the central passage and internal flow in the absorbent are separately demonstrated.

  18. Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

    Science.gov (United States)

    Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

    2014-01-01

    We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

  19. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

    OpenAIRE

    Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

    2016-01-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

  20. Speaking to the Hollow: Silence and Memory in the Last Argentine Dictatorship

    OpenAIRE

    Martínez Cabrera, Erika

    2012-01-01

    This article is an analysis of the last Argentinean dictatorship discourse and its articulation through the instances of silence and memory. To elucidate them, we deal with the technologies of violence and its discursive consequences: the exhaustion of the collective ability to tell stories, the denial of collective aberration and the perversion of language. From there, we study the discursive axes through which the fiction of the Process was built on: messianism, manichaeism and organicism. ...

  1. Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

    Science.gov (United States)

    Guleria, Praveen; Yadav, Sudesh Kumar

    2013-01-01

    Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

  2. Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

    Directory of Open Access Journals (Sweden)

    Praveen Guleria

    Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

  3. A New Component of the Nasonia Sex Determining Cascade Is Maternally Silenced and Regulates Transformer Expression

    Science.gov (United States)

    Bopp, Daniel; Beukeboom, Leo W.; van de Zande, Louis

    2013-01-01

    Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators. PMID:23717455

  4. Sexualcoercion: Woman Subordination Undergone By Hanna X In Andre Brink's The Otherside Of Silence Novel

    OpenAIRE

    NUSANTI, RIHAN

    2014-01-01

    Nusanti, Rihan. 2014. “Sexual Coercion: Woman Subordination Undergoneby Hanna X in Andre Brink's The Otherside of Silence novel”. Study Programof English, Department of Languages and Literature, Faculty of Cultural Studies,Universitas Brawijaya. Supervisor: Fariska Pujiyanti, M.Hum; Co-supervisor: Winda Candra Hantari,M.A. Keywords: Feminist-Marxist, sexual coercion, patriarchy, women subordination,German women In traditional view, women occupy secondary position lower than men in society. It...

  5. Silencing Dkk1 expression rescues dexamethasone-induced suppression of primary human osteoblast differentiation.

    LENUS (Irish Health Repository)

    Butler, Joseph S

    2010-09-01

    The Wnt\\/β-catenin pathway is a major signaling cascade in bone biology, playing a key role in bone development and remodeling. The objectives of this study were firstly, to determine the effects of dexamethasone exposure on Wnt\\/β-catenin signaling at an intracellular and transcriptional level, and secondly, to assess the phenotypic effects of silencing the Wnt antagonist, Dickkopf-1 (Dkk1) in the setting of dexamethasone exposure.

  6. Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Maciej Pietrzak

    Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

  7. Deafening silence? Time to reconsider whether organisations are silent or deaf when things go wrong.

    Science.gov (United States)

    Jones, Aled; Kelly, Daniel

    2014-09-01

    Several public inquiries into healthcare failings in the UK have noted that employees of failing organizations attempt to raise concerns about shortcomings in care, often over a prolonged period of time, only for those concerns to be ignored. However, healthcare literature has largely focused on how organizations and their employees are silent in the face of such failings, positioning employees as daring not to speak in response to serious workplace problems or issues. We argue that only focussing on organizational silence is a critical mistake which misrepresents actual events and overly-simplifies the complexities of workplace culture. The disregard shown by academics, practitioners and policy makers to employee voice strategies, which do not amount to whistle-blowing, but equally cannot either be defined as "silence", results in signals being ignored that can be effective in preventing and ending wrongdoing by others. In addition to understanding silence we suggest therefore that better understanding of why organizations are deaf to, or disregard, employee concerns are needed. We propose that a virtuous cycle is possible, whereby the introduction of systems that result in better listening and valuing of employee concerns reinforces a culture of speaking up and, in turn, organizational learning. Similarly, organizations that disregard employees concerns are destined not to learn, ultimately falling silent and failing. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  8. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

    Science.gov (United States)

    Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

    2016-06-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

  9. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

    Science.gov (United States)

    Mei, Yu; Kernodle, Bliss M.; Hill, John H.

    2016-01-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

  10. On the Threshold: Time and the Speaking Subject in Harold Pinter’s Silence

    Directory of Open Access Journals (Sweden)

    Beatrice Nori

    2017-07-01

    Full Text Available The article investigates Harold Pinter’s play Silence from a linguistic and phenomenological point of view. Silence is probably one of the least studied – though one of the most difficult and compelling – of Pinter’s plays. The author iden­tifies the broken syntax and the combi­nation of utterances and silences as indicators of time and space shifts. She claims that the patchwork which appears from the structure of the play depicts the loss of logic, and that the abandonmen­t of chronological time in linguistic terms conveys the subjecti­ve, circular, and illogical elemen­t of the human experience of time. Characters’ bodies and utterances materialize both their own past recollections and their presen­t experiences. The presen­t work may be useful to theatre scholars as an example of drama as a portrayal of philosophical and linguistic theories about time and discourse.

  11. Selective memory retrieval in social groups: When silence is golden and when it is not.

    Science.gov (United States)

    Abel, Magdalena; Bäuml, Karl-Heinz T

    2015-07-01

    Previous research has shown that the selective remembering of a speaker and the resulting silences can cause forgetting of related, but unmentioned information by a listener (Cuc, Koppel, & Hirst, 2007). Guided by more recent work that demonstrated both detrimental and beneficial effects of selective memory retrieval in individuals, the present research explored the effects of selective remembering in social groups when access to the encoding context at retrieval was maintained or impaired. In each of three experiments, selective retrieval by the speaker impaired recall of the listener when access to the encoding context was maintained, but it improved recall of the listener when context access was impaired. The results suggest the existence of two faces of selective memory retrieval in social groups, with a detrimental face when the encoding context is still active at retrieval and a beneficial face when it is not. The role of silence in social recall thus seems to be more complex than was indicated in prior work, and mnemonic silences on the part of a speaker can be "golden" for the memories of a listener under some circumstances, but not be "golden" under others. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  13. RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

    Science.gov (United States)

    Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

    2014-04-01

    Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.

  14. Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

    Science.gov (United States)

    Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

    2017-08-01

    This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

  15. Lentiviral Vector Mediated Claudin1 Silencing Inhibits Epithelial to Mesenchymal Transition in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xianqi Zhao

    2015-06-01

    Full Text Available Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor development. Claudin1 (CLDN1 is a member of the tetraspan transmembrane protein family that plays a major role in tight junctions and is associated with tumor metastasis. However, the role of CLDN1 in breast cancer is largely unexplored. In this study, we tested the therapeutic potential of silencing CLDN1 expression in two breast cancer (MDA-MB-231 and MCF7 cell lines using lentiviral vector mediated RNA interference. We found that a CLDN1 short hairpin (shRNA construct efficiently silenced CLDN1 expression in both breast cancer cell lines, and CLDN1 knockdown resulted in reduced cell proliferation, survival, migration and invasion. Furthermore, silencing CLDN1 inhibited epithelial to mesenchymal transition (EMT by upregulating the epithelial cell marker, E-cadherin, and downregulating mesenchymal markers, smooth muscle cell alpha-actin (SMA and Snai2. Our data demonstrated that lentiviral vector mediated CLDN1 RNA interference has great potential in breast cancer gene therapy by inhibiting EMT and controlling tumor cell growth.

  16. Paul Leni’s Waxworks: Writing Images from Silence, through Media and Philosophy

    Directory of Open Access Journals (Sweden)

    Marcondes Ciro Inácio

    2016-12-01

    Full Text Available The so-called German Weimar Cinema encompasses a profusion of films that used frame narratives. In the case of Paul Leni’s Waxworks (Das Wachsfigurenkabinett, 1924, as the framing stems from a literary act (the stories are framed by the act of narration, the film proposes the mise-en-abyme technique as a sort of immersion into the intermedial when it deals with notions like speaking, writing, silence, image and cinema. In the case of silent cinema, and especially in Waxworks, the presence of a perverse relation with the medium of writing becomes noticeable (producing a fantasy of writing, since every effort to represent the literary act on film results in an infinite production of silent images, creating a parody effect and even postulating an act of aggression against writing. This confrontational relation between the writing code and the code of the mute image in silent cinema allows us to suggest that there is an inherent inflexibility in the language of silent cinema which does not allow the coexistence of written and spoken word as complementary codes. On the contrary, in silent cinema, the image and the silence of the film seem to work against the word, the spoken word being set forth against silence, and the written word against images.

  17. The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

    Science.gov (United States)

    Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

    2013-12-23

    Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

  18. Silence is golden : keeping a lid on noise quiets opposition to oilpatch operations

    International Nuclear Information System (INIS)

    Macedo, R.

    2006-01-01

    Record levels of drilling activity have led to denser well spacings that are often close to residential areas. Many oil and gas operators are now investing in noise suppression technology in order to suppress public concern over noise levels. This article reviewed some new silencing technologies available to the oil and gas industry. Issues concerning permissible sound levels for remote facilities were discussed. Silencing equipment details were presented for turbine exhaust engines, turbo inlet systems, reciprocating engines, and specialty silencers for ventilation systems. Issues concerning acoustical systems and retrofits for existing buildings were also examined. It was noted that a new muffler has been acoustically engineered to provide engine exhaust noise removal along with an internal acoustic treatment to eliminate radiated noise from the muffler shell. The loudest noise source at a compression station is often the engine exhaust of large reciprocating engines. Various computer programs are now available that analyze noise, create models to predict noise levels in decibels for nearby residents, and help to engineer noise control plans. It was concluded that many of the new sound-proofing technologies for the walls and roofs of buildings and enclosures were developed during the design of new compression units built by TransCanada Pipeline on main pipelines across Canada. 2 figs

  19. Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?

    Directory of Open Access Journals (Sweden)

    Subhasis Banerjee

    2001-01-01

    Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.

  20. Silencing of the Wnt transcription factor TCF4 sensitizes colorectal cancer cells to (chemo-) radiotherapy

    Science.gov (United States)

    Kendziorra, Emil; Ahlborn, Kerstin; Spitzner, Melanie; Rave-Fränk, Margret; Emons, Georg; Gaedcke, Jochen; Kramer, Frank; Wolff, Hendrik A.; Becker, Heinz; Beissbarth, Tim; Ebner, Reinhard; Ghadimi, B.Michael; Pukrop, Tobias; Ried, Thomas; Grade, Marian

    2011-01-01

    A considerable percentage of rectal cancers are resistant to standard preoperative chemoradiotherapy. Because patients with a priori-resistant tumors do not benefit from multimodal treatment, understanding and overcoming this resistance remains of utmost clinical importance. We recently reported overexpression of the Wnt transcription factor TCF4, also known as TCF7L2, in rectal cancers that were resistant to 5-fluorouracil-based chemoradiotherapy. Because Wnt signaling has not been associated with treatment response, we aimed to investigate whether TCF4 mediates chemoradioresistance. RNA interference-mediated silencing of TCF4 was employed in three colorectal cancer (CRC) cell lines, and sensitivity to (chemo-) radiotherapy was assessed using a standard colony formation assay. Silencing of TCF4 caused a significant sensitization of CRC cells to clinically relevant doses of X-rays. This effect was restricted to tumor cells with high T cell factor (TCF) reporter activity, presumably in a β-catenin-independent manner. Radiosensitization was the consequence of (i) a transcriptional deregulation of Wnt/TCF4 target genes, (ii) a silencing-induced G2/M phase arrest, (iii) an impaired ability to adequately halt cell cycle progression after radiation and (iv) a compromised DNA double strand break repair as assessed by γH2AX staining. Taken together, our results indicate a novel mechanism through which the Wnt transcription factor TCF4 mediates chemoradioresistance. Moreover, they suggest that TCF4 is a promising molecular target to sensitize resistant tumor cells to (chemo-) radiotherapy. PMID:21983179

  1. The Improved Adaptive Silence Period Algorithm over Time-Variant Channels in the Cognitive Radio System

    Directory of Open Access Journals (Sweden)

    Jingbo Zhang

    2018-01-01

    Full Text Available In the field of cognitive radio spectrum sensing, the adaptive silence period management mechanism (ASPM has improved the problem of the low time-resource utilization rate of the traditional silence period management mechanism (TSPM. However, in the case of the low signal-to-noise ratio (SNR, the ASPM algorithm will increase the probability of missed detection for the primary user (PU. Focusing on this problem, this paper proposes an improved adaptive silence period management (IA-SPM algorithm which can adaptively adjust the sensing parameters of the current period in combination with the feedback information from the data communication with the sensing results of the previous period. The feedback information in the channel is achieved with frequency resources rather than time resources in order to adapt to the parameter change in the time-varying channel. The Monte Carlo simulation results show that the detection probability of the IA-SPM is 10–15% higher than that of the ASPM under low SNR conditions.

  2. Silence and Memories of War: An Autoethnographic Exploration of Family Secrecy.

    Science.gov (United States)

    Rober, Peter; Rosenblatt, Paul C

    2017-03-01

    A personal journey and a scientific challenge, this is an autoethnographic study about my own family's secrecy. I knew my grandfather had been a German prisoner of war during World War II. We all knew. But nobody talked about it. Then one day I decided I wanted to do systematic research on the issue of family secrecy around my grandfather's war experiences. Researching one's own family can be called autoethnography. It could be said that autoethnography is an approach to research that aims to describe and systemically analyze (graphy) personal experience (auto) to understand social and cultural phenomena (ethno). This scientific approach is quite new in the field of family therapy. This study has been an important personal quest, but it also led to important reflections on silences in families, on my own professional development, and on methodological issues concerning autoethnographical research. For one thing, it highlights some of the positive aspects of family secrecy and silences, and invites us-when confronted with family secrecy in clinical practice-to carefully consider the potential destructive and life-giving aspects of the silence. © 2015 Family Process Institute.

  3. Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

    Directory of Open Access Journals (Sweden)

    Tatiana I Novobrantseva

    2012-01-01

    Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

  4. Silencing of Foxp3 delays the growth of murine melanomas and modifies the tumor immunosuppressive environment

    Directory of Open Access Journals (Sweden)

    Franco-Molina MA

    2016-01-01

    Full Text Available Moisés A Franco-Molina,* Diana F Miranda-Hernández,* Edgar Mendoza-Gamboa, Pablo Zapata-Benavides, Erika E Coronado-Cerda, Crystel A Sierra-Rivera, Santiago Saavedra-Alonso, Reyes S Taméz-Guerra, Cristina Rodríguez-Padilla Immunology and Virology Department, Biological Sciences Faculty, University Autonoma of Nuevo León (UANL, San Nicolás de los Garza, Nuevo León, Mexico*These authors contributed equally to this work Abstract: Forkhead box p3 (Foxp3 expression was believed to be specific for T-regulatory cells but has recently been described in non-hematopoietic cells from different tissue origins and in tumor cells from both epithelial and non-epithelial tissues. The aim of this study was to elucidate the role of Foxp3 in murine melanoma. The B16F10 cell line Foxp3 silenced with small interference Foxp3 plasmid transfection was established and named B16F10.1. These cells had lower levels of Foxp3 mRNA (quantitative real-time reverse transcription-polymerase chain reaction [0.235-fold], protein (flow cytometry [0.02%], CD25+ expression (0.06%, cellular proliferation (trypan blue staining, and interleukin (IL-2 production (enzyme-linked immunosorbent assay [72.35 pg/mL] than those in B16F10 wild-type (WT cells (P<0.05. Subcutaneous inoculation of the B16F10.1 cell line into C57BL/6 mice delayed the time of visible tumor appearance, increased the time of survival, and affected the weight of tumors, and also decreased the production of IL-10, IL-2, and transforming growth factor beta compared with mice inoculated with the B16F10 WT cell line. The B16F10.1 cells derived from tumors and free of T-cells (isolated by Dynabeads and plastic attachment expressed relatively lower levels of Foxp3 and CD25+ than B16F10 WT cells (P<0.05 in a time-dependent manner. The population of tumor-infiltrating lymphocytes of T CD4+ cells (CD4+, CD4+CD25+, and CD4+CD25+Foxp3+ increased in a time-dependent manner (P<0.05 in tumors derived from B16F10 WT cells

  5. Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

    Science.gov (United States)

    McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

    2008-10-01

    The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

  6. Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

    Science.gov (United States)

    Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

    2011-01-01

    Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

  7. Amyloid-β and α-synuclein decrease the level of metal-catalyzed reactive oxygen species by radical scavenging and redox silencing

    DEFF Research Database (Denmark)

    Pedersen, Jeppe Trudslev; Chen, Serene W.; Borg, Christian Bernsen

    2016-01-01

    of ROS in vitro in the presence of a biological reductant. We find that the levels of ROS, and the rate by which ROS is generated, are significantly reduced when the Cu2+ is bound to Aβ or α-synuclein, particularly when they are in the oligomeric or fibrillar forms. This effect is attributed...

  8. RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

    Directory of Open Access Journals (Sweden)

    Paul McVeigh

    2014-09-01

    Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

  9. Silencing of cytosolic NADP(+)-dependent isocitrate dehydrogenase by small interfering RNA enhances the sensitivity of HeLa cells toward staurosporine.

    Science.gov (United States)

    Lee, Su-Min; Park, Sin Young; Shin, Seoung Woo; Kil, In Sup; Yang, Eun Sun; Park, Jeen-Woo

    2009-02-01

    Staurosporine induces the production of reactive oxygen species, which play an important causative role in apoptotic cell death. Recently, it was demonstrated that the control of cellular redox balance and the defense against oxidative damage is one of the primary functions of cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) by supplying NADPH for antioxidant systems. The present report shows that silencing of IDPc expression in HeLa cells greatly enhances apoptosis induced by staurosporine. Transfection of HeLa cells with an IDPc small interfering RNA (siRNA) markedly decreased activity of IDPc, enhancing the susceptibility of staurosporine-induced apoptosis reflected by DNA fragmentation, cellular redox status and the modulation of apoptotic marker proteins. These results indicate that IDPc may play an important role in regulating the apoptosis induced by staurosporine and the sensitizing effect of IDPc siRNA on the apoptotic cell death of HeLa cells offers the possibility of developing a modifier of cancer chemotherapy.

  10. Genome-wide analysis of histone H3 acetylation patterns in AML identifies PRDX2 as an epigenetically silenced tumor suppressor gene

    DEFF Research Database (Denmark)

    Agrawal-Singh, Shuchi; Isken, Fabienne; Agelopoulos, Konstantin

    2012-01-01

    to have lower H3Ac levels in AML compared with progenitor cells, which suggested that a large number of genes are epigenetically silenced in AML. Intriguingly, we identified peroxiredoxin 2 (PRDX2) as a novel potential tumor suppressor gene in AML. H3Ac was decreased at the PRDX2 gene promoter in AML......With the use of ChIP on microarray assays in primary leukemia samples, we report that acute myeloid leukemia (AML) blasts exhibit significant alterations in histone H3 acetylation (H3Ac) levels at > 1000 genomic loci compared with CD34+ progenitor cells. Importantly, core promoter regions tended......, which correlated with low mRNA and protein expression. We also observed DNA hypermethylation at the PRDX2 promoter in AML. Low protein expression of the antioxidant PRDX2 gene was clinically associated with poor prognosis in patients with AML. Functionally, PRDX2 acted as inhibitor of myeloid cell...

  11. Epigenetic silencing of BTB and CNC homology 2 and concerted promoter CpG methylation in gastric cancer.

    Science.gov (United States)

    Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung

    2014-09-01

    BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. In vivo therapeutic efficacy of TNFα silencing by folate-PEG-chitosan-DEAE/siRNA nanoparticles in arthritic mice.

    Science.gov (United States)

    Shi, Qin; Rondon-Cavanzo, Elsa-Patricia; Dalla Picola, Isadora Pfeifer; Tiera, Marcio José; Zhang, Xiaoling; Dai, Kerong; Benabdoune, Houda Abir; Benderdour, Mohamed; Fernandes, Julio Cesar

    2018-01-01

    Tumor necrosis factor-alpha (TNFα), a pro-inflammatory cytokine, has been shown to play a role in the pathophysiology of rheumatoid arthritis. Silencing TNFα expression with small interfering RNA (siRNA) is a promising approach to treatment of the condition. Towards this end, our team has developed a modified chitosan (CH) nanocarrier, deploying folic acid, diethylethylamine (DEAE) and polyethylene glycol (PEG) (folate-PEG-CH-DEAE 15 ). The gene carrier protects siRNA against nuclease destruction, its ligands facilitate siRNA uptake via cell surface receptors, and it provides improved solubility at neutral pH with transport of its load into target cells. In the present study, nanoparticles were prepared with siRNA-TNFα, DEAE, and folic acid-CH derivative. Nanoparticle size and zeta potential were verified by dynamic light scattering. Their TNFα-knockdown effects were tested in a murine collagen antibody-induced arthritis model. TNFα expression was examined along with measurements of various cartilage and bone turnover markers by performing histology and microcomputed tomography analysis. We demonstrated that folate-PEG-CH-DEAE 15 /siRNA nanoparticles did not alter cell viability, and significantly decreased inflammation, as demonstrated by improved clinical scores and lower TNFα protein concentrations in target tissues. This siRNA nanocarrier also decreased articular cartilage destruction and bone loss. The results indicate that folate-PEG-CH-DEAE 15 nanoparticles are a safe and effective platform for nonviral gene delivery of siRNA, and their potential clinical applications warrant further investigation.

  13. Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant.

    Science.gov (United States)

    Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit

    2009-08-01

    Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.

  14. Oct4 Methylation-Mediated Silencing As an Epigenetic Barrier Preventing Müller Glia Dedifferentiation in a Murine Model of Retinal Injury.

    Science.gov (United States)

    Reyes-Aguirre, Luis I; Lamas, Monica

    2016-01-01

    Müller glia (MG) is the most abundant glial type in the vertebrate retina. Among its many functions, it is capable of responding to injury by dedifferentiating, proliferating, and differentiating into every cell types lost to damage. This regenerative ability is notoriously absent in mammals. We have previously reported that cultured mammalian MG undergoes a partial dedifferentiation, but fails to fully acquire a progenitor phenotype and differentiate into neurons. This might be explained by a mnemonic mechanism comprised by epigenetic traits, such as DNA methylation. To achieve a better understanding of this epigenetic memory, we studied the expression of pluripotency-associated genes, such as Oct4, Nanog , and Lin28 , which have been reported as necessary for regeneration in fish, at early times after NMDA-induced retinal injury in a mouse experimental model. We found that although Oct4 is expressed rapidly after damage (4 hpi), it is silenced at 24 hpi. This correlates with a significant decrease in the DNA methyltransferase Dnmt3b expression, which returns to basal levels at 24 hpi. By MS-PCR, we observed a decrease in Oct4 methylation levels at 4 and 12 hpi, before returning to a fully methylated state at 24 hpi. To demonstrate that these changes are restricted to MG, we separated these cells using a GLAST antibody coupled with magnetic beads. Finally, intravitreous administration of the DNA-methyltransferase inhibitor SGI-1027 induced Oct4 expression at 24 hpi in MG. Our results suggest that mammalian MG injury-induced dedifferentiation could be restricted by DNA methylation, which rapidly silences Oct4 expression, preventing multipotency acquisition.

  15. A novel type of silencing factor, Clr2, is necessary for transcriptional silencing at various chromosomal locations in the fission yeast Schizosaccharomyces pombe

    DEFF Research Database (Denmark)

    Bjerling, Pernilla; Ekwall, Karl; Egel, Richard

    2004-01-01

    The mating-type region of the fission yeast Schizosaccharomyces pombe comprises three loci: mat1, mat2-P and mat3-M. mat1 is expressed and determines the mating type of the cell. mat2-P and mat3-M are two storage cassettes located in a 17 kb heterochromatic region with features identical to those...... of mammalian heterochromatin. Mutations in the swi6+, clr1+, clr2+, clr3+, clr4+ and clr6+ genes were obtained in screens for factors necessary for silencing the mat2-P-mat3-M region. swi6+ encodes a chromodomain protein, clr3+ and clr6+ histone deacetylases, and clr4+ a histone methyltransferase. Here, we...

  16. Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

    Directory of Open Access Journals (Sweden)

    Jinhuan Pang

    Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

  17. Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

    Science.gov (United States)

    Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

    2012-03-01

    Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

  18. Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

    Directory of Open Access Journals (Sweden)

    Gyöngyi Munkácsy

    2016-01-01

    Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

  19. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    International Nuclear Information System (INIS)

    Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.

    2012-01-01

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.

  20. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    Energy Technology Data Exchange (ETDEWEB)

    Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)

    2012-09-10

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.

  1. Mucin 4 Gene Silencing Reduces Oxidative Stress and Calcium Oxalate Crystal Formation in Renal Tubular Epithelial Cells Through the Extracellular Signal-Regulated Kinase Signaling Pathway in Nephrolithiasis Rat Model

    Directory of Open Access Journals (Sweden)

    Ling Sun

    2018-05-01

    -Px, CAT and SOD levels in the cultured supernatant were increased. Moreover, MUC4 silencing or ERK signaling pathway inactivation may decrease the formation of CaOx crystals. Conclusion: Taken together, silencing of MUC4 can inactivate the ERK signaling pathway and further restrain oxidative stress and CaOx crystal formation in RTEC. Thus, MUC4 represents a potential investigative focus target in nephrolithiasis.

  2. Silencing of the Drosophila ortholog of SOX5 leads to abnormal neuronal development and behavioral impairment.

    Science.gov (United States)

    Li, Airong; Hooli, Basavaraj; Mullin, Kristina; Tate, Rebecca E; Bubnys, Adele; Kirchner, Rory; Chapman, Brad; Hofmann, Oliver; Hide, Winston; Tanzi, Rudolph E

    2017-04-15

    SOX5 encodes a transcription factor that is expressed in multiple tissues including heart, lung and brain. Mutations in SOX5 have been previously found in patients with amyotrophic lateral sclerosis (ALS) and developmental delay, intellectual disability and dysmorphic features. To characterize the neuronal role of SOX5, we silenced the Drosophila ortholog of SOX5, Sox102F, by RNAi in various neuronal subtypes in Drosophila. Silencing of Sox102F led to misorientated and disorganized michrochaetes, neurons with shorter dendritic arborization (DA) and reduced complexity, diminished larval peristaltic contractions, loss of neuromuscular junction bouton structures, impaired olfactory perception, and severe neurodegeneration in brain. Silencing of SOX5 in human SH-SY5Y neuroblastoma cells resulted in a significant repression of WNT signaling activity and altered expression of WNT-related genes. Genetic association and meta-analyses of the results in several large family-based and case-control late-onset familial Alzheimer's disease (LOAD) samples of SOX5 variants revealed several variants that show significant association with AD disease status. In addition, analysis for rare and highly penetrate functional variants revealed four novel variants/mutations in SOX5, which taken together with functional prediction analysis, suggests a strong role of SOX5 causing AD in the carrier families. Collectively, these findings indicate that SOX5 is a novel candidate gene for LOAD with an important role in neuronal function. The genetic findings warrant further studies to identify and characterize SOX5 variants that confer risk for AD, ALS and intellectual disability. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.

    Science.gov (United States)

    Atkinson, Louise E; Stevenson, Michael; McCoy, Ciaran J; Marks, Nikki J; Fleming, Colin; Zamanian, Mostafa; Day, Tim A; Kimber, Michael J; Maule, Aaron G; Mousley, Angela

    2013-02-01

    Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode) that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs) form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i) Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii) Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii) migration rate increases in Gp-flp-32-silenced worms; (iv) the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v) a novel putative Gp-flp-32 receptor (Gp-flp-32R) is expressed in G. pallida; and, (vi) Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R). This is the first functional characterisation of a parasitic nematode FLP-GPCR.

  4. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

    Science.gov (United States)

    Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

    2010-11-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

  5. Slug silencing inhibited perineural invasion through regulation of EMMPRIN expression in human salivary adenoid cystic carcinoma.

    Science.gov (United States)

    Wu, Baolei; Wei, Jianhua; Hu, Zhiqiang; Shan, Chun; Wang, Lei; Zhang, Chenping; Yang, Xi; Yang, Xinjie; Lei, Delin

    2016-02-01

    Salivary adenoid cystic carcinoma (SACC) is the most frequent salivary gland malignancy with a unique characteristic that has been named perineural invasion (PNI). EMMPRIN is a transmembrane glycoprotein that has been demonstrated to promote PNI in SACC. Slug, one of the most effective promoters of the epithelial-to-mesenchymal transition (EMT), has been found to be associated with PNI in SACC. The aim of the present study was to investigate the roles and relationships of Slug, EMMPRIN, and E-cadherin in the PNI process of SACC. The expression levels of Slug, EMMPRIN, and E-cadherin in 115 primary SACC cases were statistically analyzed by immunohistochemistry. Simultaneously, the SACC cell line SACC-83 was transfected with recombinant plasmids of silencing Slug (si-Slug) and/or silencing EMMPRIN (si-EMMPRIN). The functions of Slug and EMMPRIN in the EMT and PNI process were assessed by reverse transcription PCR (RT-PCR), western blotting, morphological observation, scratch test, migration assay, and in vitro perineural invasion assay. The immunohistochemical statistics revealed that the high expression of Slug and EMMPRIN and the low expression of E-cadherin were significantly associated with the PNI of SACC (P EMMPRIN expression (P EMMPRIN expression were both significantly negatively associated with E-cadherin expression (P EMMPRIN silencing both significantly inhibited EMMPRIN expression but promoted E-cadherin expression in SACC-83 cells (P EMMPRIN, or both induced cell morphology changes and inhibited tumor cell motility and PNI ability in SACC-83 cells (P EMMPRIN and then upregulating E-cadherin in the PNI process of SACC. The present study indicated that Slug and EMMPRIN are potential biomarkers and therapeutic targets for the diagnosis and treatment of PNI in human SACC.

  6. Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.

    Science.gov (United States)

    Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian

    2018-06-01

    Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.

  7. flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.

    Directory of Open Access Journals (Sweden)

    Louise E Atkinson

    2013-02-01

    Full Text Available Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii migration rate increases in Gp-flp-32-silenced worms; (iv the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v a novel putative Gp-flp-32 receptor (Gp-flp-32R is expressed in G. pallida; and, (vi Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R. This is the first functional characterisation of a parasitic nematode FLP-GPCR.

  8. Increasing the amylose content of durum wheat through silencing of the SBEIIa genes

    Directory of Open Access Journals (Sweden)

    Masci Stefania

    2010-07-01

    Full Text Available Abstract Background High amylose starch has attracted particular interest because of its correlation with the amount of Resistant Starch (RS in food. RS plays a role similar to fibre with beneficial effects for human health, providing protection from several diseases such as colon cancer, diabetes, obesity, osteoporosis and cardiovascular diseases. Amylose content can be modified by a targeted manipulation of the starch biosynthetic pathway. In particular, the inactivation of the enzymes involved in amylopectin synthesis can lead to the increase of amylose content. In this work, genes encoding starch branching enzymes of class II (SBEIIa were silenced using the RNA interference (RNAi technique in two cultivars of durum wheat, using two different methods of transformation (biolistic and Agrobacterium. Expression of RNAi transcripts was targeted to the seed endosperm using a tissue-specific promoter. Results Amylose content was markedly increased in the durum wheat transgenic lines exhibiting SBEIIa gene silencing. Moreover the starch granules in these lines were deformed, possessing an irregular and deflated shape and being smaller than those present in the untransformed controls. Two novel granule bound proteins, identified by SDS-PAGE in SBEIIa RNAi lines, were investigated by mass spectrometry and shown to have strong homologies to the waxy proteins. RVA analysis showed new pasting properties associated with high amylose lines in comparison with untransformed controls. Finally, pleiotropic effects on other starch genes were found by semi-quantitative and Real-Time reverse transcription-polymerase chain reaction (RT-PCR. Conclusion We have found that the silencing of SBEIIa genes in durum wheat causes obvious alterations in granule morphology and starch composition, leading to high amylose wheat. Results obtained with two different methods of transformation and in two durum wheat cultivars were comparable.

  9. Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.

    Directory of Open Access Journals (Sweden)

    Stella Marie Reamon-Buettner

    Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.

  10. Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

    Science.gov (United States)

    Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2010-09-01

    The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

  11. Visualization of plant viral suppressor silencing activity in intact leaf lamina by quantitative fluorescent imaging

    Directory of Open Access Journals (Sweden)

    Francis Kevin P

    2011-08-01

    Full Text Available Abstract Background Transient expression of proteins in plants has become a favoured method over the production of stably transformed plants because, in addition to enabling high protein yields, it is both fast and easy to apply. An enhancement of transient protein expression can be achieved by plant virus-encoded RNA silencing suppressor proteins. Since viral suppressor proteins differ in their efficiency to enhance transient protein expression in plants, we developed a whole-leaf green fluorescent protein (GFP-based imaging assay to quantitatively assess suppressor protein activity. Results In a transient GFP-expression assay using wild-type and GFP-transgenic N. benthamiana, addition of the plant viral suppressors Beet mild yellowing virus (BMYV-IPP P0 or Plum pox virus (PPV HC-Pro was shown to increase fluorescent protein expression 3-4-fold, 7 days post inoculation (dpi when compared to control plants. In contrast, in agroinfiltrated patches without suppressor activity, near complete silencing of the GFP transgene was observed in the transgenic N. benthamiana at 21 dpi. Both co-infiltrated suppressors significantly enhanced GFP expression over time, with HC-Pro co-infiltrations leading to higher short term GFP fluorescence (at 7 dpi and P0 giving higher long term GFP fluorescence (at 21 dpi. Additionally, in contrast to HC-Pro co-infiltrations, an area of complete GFP silencing was observed at the edge of P0 co-infiltrated areas. Conclusions Fluorescence imaging of whole intact leaves proved to be an easy and effective method for spatially and quantitatively observing viral suppressor efficiency in plants. This suppressor assay demonstrates that plant viral suppressors greatly enhanced transient GFP expression, with P0 showing a more prolonged suppressor activity over time than HC-Pro. Both suppressors could prove to be ideal candidates for enhancing target protein expression in plants.

  12. In planta assays involving epigenetically silenced genes reveal inhibition of cytosine methylation by genistein

    Directory of Open Access Journals (Sweden)

    Arase Sachiko

    2012-03-01

    Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.

  13. Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

    Science.gov (United States)

    Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

    2011-05-01

    There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

  14. The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci.

    Directory of Open Access Journals (Sweden)

    Ana Neves-Costa

    2009-12-01

    Full Text Available Chromatin regulates many key processes in the nucleus by controlling access to the underlying DNA. SNF2-like factors are ATP-driven enzymes that play key roles in the dynamics of chromatin by remodelling nucleosomes and other nucleoprotein complexes. Even simple eukaryotes such as yeast contain members of several subfamilies of SNF2-like factors. The FUN30/ETL1 subfamily of SNF2 remodellers is conserved from yeasts to humans, but is poorly characterized. We show that the deletion of FUN30 leads to sensitivity to the topoisomerase I poison camptothecin and to severe cell cycle progression defects when the Orc5 subunit is mutated. We demonstrate a role of FUN30 in promoting silencing in the heterochromatin-like mating type locus HMR, telomeres and the rDNA repeats. Chromatin immunoprecipitation experiments demonstrate that Fun30 binds at the boundary element of the silent HMR and within the silent HMR. Mapping of nucleosomes in vivo using micrococcal nuclease demonstrates that deletion of FUN30 leads to changes of the chromatin structure at the boundary element. A point mutation in the ATP-binding site abrogates the silencing function of Fun30 as well as its toxicity upon overexpression, indicating that the ATPase activity is essential for these roles of Fun30. We identify by amino acid sequence analysis a putative CUE motif as a feature of FUN30/ETL1 factors and show that this motif assists Fun30 activity. Our work suggests that Fun30 is directly involved in silencing by regulating the chromatin structure within or around silent loci.

  15. Glutamate receptor antibodies in neurological diseases: anti-AMPA-GluR3 antibodies, anti-NMDA-NR1 antibodies, anti-NMDA-NR2A/B antibodies, anti-mGluR1 antibodies or anti-mGluR5 antibodies are present in subpopulations of patients with either: epilepsy, encephalitis, cerebellar ataxia, systemic lupus erythematosus (SLE) and neuropsychiatric SLE, Sjogren's syndrome, schizophrenia, mania or stroke. These autoimmune anti-glutamate receptor antibodies can bind neurons in few brain regions, activate glutamate receptors, decrease glutamate receptor's expression, impair glutamate-induced signaling and function, activate blood brain barrier endothelial cells, kill neurons, damage the brain, induce behavioral/psychiatric/cognitive abnormalities and ataxia in animal models, and can be removed or silenced in some patients by immunotherapy.

    Science.gov (United States)

    Levite, Mia

    2014-08-01

    pathological effects: they activate glutamate/AMPA receptors, kill neurons by 'Excitotoxicity', and/or by complement activation modulated by complement regulatory proteins, cause multiple brain damage, aggravate chemoconvulsant-induced seizures, and also induce behavioral/motor impairments. Some patients with 'Autoimmune Epilepsy' that have anti-AMPA-GluR3B antibodies respond well (although sometimes transiently) to immunotherapy, and thanks to that have reduced seizures and overall improved neurological functions. (2) Anti-NMDA-NR1 antibodies are present in patients with autoimmune 'Anti-NMDA-receptor Encephalitis'. In humans, in animal models and in vitro the anti-NMDA-NR1 antibodies can be very pathogenic since they can cause a pronounced decrease of surface NMDA receptors expressed in hippocampal neurons, and also decrease the cluster density and synaptic localization of the NMDA receptors. The anti-NMDA-NR1 antibodies induce these effects by crosslinking and internalization of the NMDA receptors. Such changes can impair glutamate signaling via the NMDA receptors and lead to various neuronal/behavior/cognitive/psychiatric abnormalities. Anti-NMDA-NR1 antibodies are frequently present in high levels in the CSF of the patients with 'Anti-NMDA-receptor encephalitis' due to their intrathecal production. Many patients with 'Anti-NMDA receptor Encephalitis' respond well to several modes of immunotherapy. (3) Anti-NMDA-NR2A/B antibodies are present in a substantial number of patients with Systemic Lupus Erythematosus (SLE) with or without neuropsychiatric problems. The exact percentage of SLE patients having anti-NMDA-NR2A/B antibodies varies in different studies from 14 to 35%, and in one study such antibodies were found in 81% of patients with diffuse 'Neuropshychiatric SLE', and in 44% of patients with focal 'Neuropshychiatric SLE'. Anti-NMDA-NR2A/B antibodies are also present in subpopulations of patients with Epilepsy of several types, Encephalitis of several types (e

  16. The fission yeast ubiquitin-conjugating enzymes UbcP3, Ubc15, and Rhp6 affect transcriptional silencing of the mating-type region

    DEFF Research Database (Denmark)

    Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M

    2002-01-01

    Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...

  17. A novel artificial microRNA expressing AAV vector for phospholamban silencing in cardiomyocytes improves Ca2+ uptake into the sarcoplasmic reticulum.

    Directory of Open Access Journals (Sweden)

    Tobias Gröβl

    Full Text Available In failing rat hearts, post-transcriptonal inhibition of phospholamban (PLB expression by AAV9 vector-mediated cardiac delivery of short hairpin RNAs directed against PLB (shPLBr improves both impaired SERCA2a controlled Ca2+ cycling and contractile dysfunction. Cardiac delivery of shPLB, however, was reported to cause cardiac toxicity in canines. Thus we developed a new AAV vector, scAAV6-amiR155-PLBr, expressing a novel engineered artificial microRNA (amiR155-PLBr directed against PLB under control of a heart-specific hybrid promoter. Its PLB silencing efficiency and safety were compared with those of an AAV vector expressing shPLBr (scAAV6-shPLBr from an ubiquitously active U6 promoter. Investigations were carried out in cultured neonatal rat cardiomyocytes (CM over a period of 14 days. Compared to shPLBr, amiR155-PLBr was expressed at a significantly lower level, resulting in delayed and less pronounced PLB silencing. Despite decreased knockdown efficiency of scAAV6-amiR155-PLBr, a similar increase of the SERCA2a-catalyzed Ca2+ uptake into sarcoplasmic reticulum (SR vesicles was observed for both the shPLBr and amiR155-PLBr vectors. Proteomic analysis confirmed PLB silencing of both therapeutic vectors and revealed that shPLBr, but not the amiR155-PLBr vector, increased the proinflammatory proteins STAT3, STAT1 and activated STAT1 phosphorylation at the key amino acid residue Tyr701. Quantitative RT-PCR analysis detected alterations in the expression of several cardiac microRNAs after treatment of CM with scAAV6-shPLBr and scAAV6-amiR155-PLBr, as well as after treatment with its related amiR155- and shRNAs-expressing control AAV vectors. The results demonstrate that scAAV6-amiR155-PLBr is capable of enhancing the Ca2+ transport function of the cardiac SR PLB/SERCA2a system as efficiently as scAAV6-shPLBr while offering a superior safety profile.

  18. Realization of the revival of silenced echo (ROSE) quantum memory scheme in orthogonal geometry

    Science.gov (United States)

    Minnegaliev, M. M.; Gerasimov, K. I.; Urmancheev, R. V.; Moiseev, S. A.; Chanelière, T.; Louchet-Chauvet, A.

    2018-02-01

    We demonstrated quantum memory scheme on revival of silenced echo in orthogonal geometry in Tm3+: Y3Al5O12 crystal. The retrieval efficiency of ˜14% was demonstrated with the 36 µs storage time. In this scheme for the first time we also implemented a suppression of the revived echo signal by applying an external electric field and the echo signal has been recovered on demand if we then applied a second electric pulse with opposite polarity. This technique opens the possibilities for realizing addressing in multi-qubit quantum memory in Tm3+: Y3Al5O12 crystal.

  19. The Mechanism of the Silencing of a Transgene, NCED3‐LUC, in Arabidopsis Thaliana

    KAUST Repository

    Zhao, Junsong

    2011-06-20

    The Arabidopsis thaliana NCED3‐LUC transgenic line was constructed by several groups to study the regulatory network of the NCED3 gene, the protein of which catalyzes the rate‐limiting step of ABA biosynthesis under drought. The transgenic luciferase gene is expressed when the plants encounter drought stress. Intriguingly, this transgenic luciferase gene is silenced after propagation for several generations. To determine the mechanism of this gene silencing, we used a forward genetics approach. The seeds of NCED3‐LUC (referred as the ‘wild type’) were mutagenized by ethane methyl sulfonate (EMS). One mutant line, denoted as #73, with recovered luciferase activity was selected for further study. Analysis of the methylation status by bisulfite sequencing revealed that the transgenic NCED3 promoter in the #73 mutant had less methylation than the wild type. Demethylation was also evident for the endogenous NCED3 promoter and retrotransposon AtSN1 in the #73 mutant. The phenotype of #73 mutant includes small size, rapid dehydration rate, altered morphology, and a thin epicuticular wax layer. By use of map‐based cloning, the region containing the mutated gene was delimited to a contig of two BAC clones, F11F19 and F9C22, on chromosome 2. Our results indicate that NCED3‐LUC gene silencing results from hypermethylation of its promoter region, but additional study is required to determine the exact position of the mutated gene and to fully understand the mechanism of NCED3‐LUC silencing. 4 ACKNOWLEDGEMENTS I would like to take this opportunity to thank my committee chair, Professor Jian‐Kang Zhu, who is also the supervisor of my master’s thesis, for his guidance throughout the course of this research. I also would like to thank my committee members, Professor Liming Xiong and Professor Samir Hamdan, for their patience and support in reviewing my thesis. My appreciation also goes to Dr. Zhenyu Wang for taking time to teach me basic experimental skills and

  20. Speaking to the Hollow: Silence and Memory in the Last Argentine Dictatorship

    Directory of Open Access Journals (Sweden)

    Martínez Cabrera, Erika

    2012-01-01

    Full Text Available This article is an analysis of the last Argentinean dictatorship discourse and its articulation through the instances of silence and memory. To elucidate them, we deal with the technologies of violence and its discursive consequences: the exhaustion of the collective ability to tell stories, the denial of collective aberration and the perversion of language. From there, we study the discursive axes through which the fiction of the Process was built on: messianism, manichaeism and organicism. Finally we evaluate the development of new symbolic discourses in response to dogmatism, the creation of partial, fragmented and provisional fictions that challenged the official story.

  1. Polymer nanoparticles for drug and small silencing RNA delivery to treat cancers of different phenotypes

    Science.gov (United States)

    Devulapally, Rammohan; Paulmurugan, Ramasamy

    2013-01-01

    Advances in nanotechnology have provided powerful and efficient tools in development of cancer diagnosis and therapy. There are numerous nanocarriers that are currently approved for clinical use in cancer therapy. In recent years, biodegradable polymer nanoparticles (NPs) have attracted a considerable attention for their ability to function as a possible carrier for target-specific delivery of various drugs, genes, proteins, peptides, vaccines, and other biomolecules in humans without much toxicity. This review will specifically focus on the recent advances in polymer-based nanocarriers for various drugs and small silencing RNA’s loading and delivery to treat different types of cancer. PMID:23996830

  2. MicroRNA silencing in primates: towards development of novel therapeutics

    DEFF Research Database (Denmark)

    Petri, Andreas; Lindow, Morten; Kauppinen, Sakari

    2009-01-01

    MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....

  3. Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

    Czech Academy of Sciences Publication Activity Database

    Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

    2011-01-01

    Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

  4. Hydrogel-Assisted Antisense LNA Gapmer Delivery for In Situ Gene Silencing in Spinal Cord Injury

    DEFF Research Database (Denmark)

    Moreno, Pedro M.D.; Ferreira, Ana R.; Salvador, Daniela

    2018-01-01

    )-modified AON gapmers in combination with a fibrin hydrogel bridging material to induce gene silencing in situ at a SCI lesion site. LNA gapmers were effectively developed against two promising gene targets aiming at enhancing axonal regeneration—RhoA and GSK3β. The fibrin-matrix-assisted AON delivery system......After spinal cord injury (SCI), nerve regeneration is severely hampered due to the establishment of a highly inhibitory microenvironment at the injury site, through the contribution of multiple factors. The potential of antisense oligonucleotides (AONs) to modify gene expression at different levels...

  5. Victims’ language: (noisy silences and (grave parodies to talk (unknowingly about individuals’ forced disappearance

    Directory of Open Access Journals (Sweden)

    Gabriel Gatti

    2011-07-01

    Full Text Available Based on the results of research carried out between 2005 and 2008 about social universes constructed in Argentina and Uruguay around the figure of the disappeared detainee, this piece aims to systematize several answer to one the more complex problems this repression figure bears: that of representation of facts and their consequences. This work focuses no on all possible answers, but on several of the more innovative and creative: those betting on talking about the impossibility to talk (the noisy silences, and those betting on forcing language up to its limit (grave parodies.

  6. F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

    Science.gov (United States)

    Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

    2006-01-01

    Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

  7. Chernobyl silences

    International Nuclear Information System (INIS)

    Grandazzi, G.; Lemarchand, F.

    2006-01-01

    20 years after the Chernobyl nuclear power plant explosion, this book presents the sanitary and ecological actuality of the accident, with direct testimonies translated from russian. It is also a reflexion of women and political men, scientists, philosophers and artists on the changes induced by Chernobyl on the information dissemination and the future of the accident. (A.L.B.)

  8. Persuasive Silence

    OpenAIRE

    Toru Suzuki

    2012-01-01

    In the market where inattentive buyers can fail to notice some feasible choices, the key role of marketing is to make buyers aware of products. However, the effective marketing strategy is often subtle since marketing tactics can make buyers cautious. This paper provides a framework to analyze an effective marketing strategy to persuade an inattentive buyer in an adverse selection environment. We investigate how an attention-grabbing marketing can 'backfire' and when it can be effective.

  9. Amani's Silence

    OpenAIRE

    Baider, Lea; Schapira, Lidia

    2017-01-01

    This narrative reflects on what it means to deliver compassionate and family?centered care when cultural beliefs expose irreconcilable differences in goals, beliefs, and values among members of the multidisciplinary team and between professionals and patients and families.

  10. The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Ling Yang

    2013-01-01

    Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

  11. Resveratrol via sirtuin-1 downregulates RE1-silencing transcription factor (REST) expression preventing PCB-95-induced neuronal cell death.

    Science.gov (United States)

    Guida, Natascia; Laudati, Giusy; Anzilotti, Serenella; Secondo, Agnese; Montuori, Paolo; Di Renzo, Gianfranco; Canzoniero, Lorella M T; Formisano, Luigi

    2015-11-01

    Resveratrol (3,5,4'-trihydroxystilbene) (RSV), a polyphenol widely present in plants, exerts a neuroprotective function in several neurological conditions; it is an activator of class III histone deacetylase sirtuin1 (SIRT1), a crucial regulator in the pathophysiology of neurodegenerative diseases. By contrast, the RE1-silencing transcription factor (REST) is involved in the neurotoxic effects following exposure to polychlorinated biphenyl (PCB) mixture A1254. The present study investigated the effects of RSV-induced activation of SIRT1 on REST expression in SH-SY5Y cells. Further, we investigated the possible relationship between the non-dioxin-like (NDL) PCB-95 and REST through SIRT1 to regulate neuronal death in rat cortical neurons. Our results revealed that RSV significantly decreased REST gene and protein levels in a dose- and time-dependent manner. Interestingly, overexpression of SIRT1 reduced REST expression, whereas EX-527, an inhibitor of SIRT1, increased REST expression and blocked RSV-induced REST downregulation. These results suggest that RSV downregulates REST through SIRT1. In addition, RSV enhanced activator protein 1 (AP-1) transcription factor c-Jun expression and its binding to the REST promoter gene. Indeed, c-Jun knockdown reverted RSV-induced REST downregulation. Intriguingly, in SH-SY5Y cells and rat cortical neurons the NDL PCB-95 induced necrotic cell death in a concentration-dependent manner by increasing REST mRNA and protein expression. In addition, SIRT1 knockdown blocked RSV-induced neuroprotection in rat cortical neurons treated with PCB-95. Collectively, these results indicate that RSV via SIRT1 activates c-Jun, thereby reducing REST expression in SH-SY5Y cells under physiological conditions and blocks PCB-95-induced neuronal cell death by activating the same SIRT1/c-Jun/REST pathway. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Silencing of dehydrin CaDHN1 diminishes tolerance to multiple abiotic stresses in Capsicum annuum L.

    Science.gov (United States)

    Chen, Ru-gang; Jing, Hua; Guo, Wei-li; Wang, Shu-Bin; Ma, Fang; Pan, Bao-Gui; Gong, Zhen-Hui

    2015-12-01

    We cloned a dehydrins gene CaDHN1 from pepper and the expression of CaDHN1 was markedly upregulated by cold, salt, osmotic stresses and salicylic acid (SA) treatment. Dehydrins (DHNs) are a subfamily of group 2 late embryogenesis-abundant (LEA) proteins that are thought to play an important role in enhancing abiotic stress tolerance in plants. In this study, a DHN EST (Expressed Sequence Tag) was obtained from 6 to 8 true leaves seedlings of pepper cv P70 (Capsicum annuum L.) by our laboratory. However, the DHN gene in pepper was not well characterized. According to this EST sequence, we isolated a DHN gene, designated as CaDHN1, and investigated the response and expression of this gene under various stresses. Our results indicated that CaDHN1 has the DHN-specific and conserved K- and S- domain and encodes 219 amino acids. Phylogenetic analysis showed that CaDHN1 belonged to the SKn subgroup. Tissue expression profile analysis revealed that CaDH N1 was expressed predominantly in fruits and flowers. The expression of CaDHN1 was markedly upregulated in response to cold, salt, osmotic stresses and salicylic acid (SA) treatment, but no significant change by abscisic acid (ABA) and heavy metals treatment. Loss of function of CaDHN1 using the virus-induced gene silencing (VIGS) technique led to decreased tolerance to cold-, salt- and osmotic-induced stresses. Overall, these results suggest that CaDHN1 plays an important role in regulating the abiotic stress resistance in pepper plants.

  13. Short Hairpin RNA Silencing of PHD-2 Improves Neovascularization and Functional Outcomes in Diabetic Wounds and Ischemic Limbs.

    Directory of Open Access Journals (Sweden)

    Kevin J Paik

    Full Text Available The transcription factor hypoxia-inducible factor 1-alpha (HIF-1α is responsible for the downstream expression of over 60 genes that regulate cell survival and metabolism in hypoxic conditions as well as those that enhance angiogenesis to alleviate hypoxia. However, under normoxic conditions, HIF-1α is hydroxylated by prolyl hydroxylase 2, and subsequently degraded, with a biological half-life of less than five minutes. Here we investigated the therapeutic potential of inhibiting HIF-1α degradation through short hairpin RNA silencing of PHD-2 in the setting of diabetic wounds and limb ischemia. Treatment of diabetic mouse fibroblasts with shPHD-2 in vitro resulted in decreased levels of PHD-2 transcript demonstrated by qRT-PCR, higher levels of HIF-1α as measured by western blot, and higher expression of the downstream angiogenic genes SDF-1 and VEGFα, as measured by qRT-PCR. In vivo, shPHD-2 accelerated healing of full thickness excisional wounds in diabetic mice compared to shScr control, (14.33 ± 0.45 days vs. 19 ± 0.33 days and was associated with an increased vascular density. Delivery of shPHD-2 also resulted in improved perfusion of ischemic hind limbs compared to shScr, prevention of distal digit tip necrosis, and increased survival of muscle tissue. Knockdown of PHD-2 through shRNA treatment has the potential to stimulate angiogenesis through overexpression of HIF-1α and upregulation of pro-angiogenic genes downstream of HIF-1α, and may represent a viable, non-viral approach to gene therapy for ischemia related applications.

  14. Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant.

    Science.gov (United States)

    Bandaranayake, Pradeepa C G; Yoder, John I

    2013-05-01

    Parasitic species of the family Orobanchaceae are devastating agricultural pests in many parts of the world. The control of weedy Orobanchaceae spp. is challenging, particularly due to the highly coordinated life cycles of the parasite and host plants. Although host genetic resistance often provides the foundation of plant pathogen management, few genes that confer resistance to root parasites have been identified and incorporated into crop species. Members of the family Orobanchaceae acquire water, nutrients, macromolecules, and oligonucleotides from host plants through haustoria that connect parasite and host plant roots. We are evaluating a resistance strategy based on using interfering RNA (RNAi) that is made in the host but inhibitory in the parasite as a parasite-derived oligonucleotide toxin. Sequences from the cytosolic acetyl-CoA carboxylase (ACCase) gene from Triphysaria versicolor were cloned in hairpin conformation and introduced into Medicago truncatula roots by Agrobacterium rhizogenes transformation. Transgenic roots were recovered for four of five ACCase constructions and infected with T. versicolor against parasitic weeds. In all cases, Triphysaria root viability was reduced up to 80% when parasitizing a host root bearing the hairpin ACCase. Triphysaria root growth was recovered by exogenous application of malonate. Reverse-transcriptase polymerase chain reaction (RT-PCR) showed that ACCase transcript levels were dramatically decreased in Triphysaria spp. parasitizing transgenic Medicago roots. Northern blot analysis identified a 21-nucleotide, ACCase-specific RNA in transgenic M. truncatula and in T. versicolor attached to them. One hairpin ACCase construction was lethal to Medicago spp. unless grown in media supplemented with malonate. Quantitative RT-PCR showed that the Medicago ACCase was inhibited by the Triphysaria ACCase RNAi. This work shows that ACCase is an effective target for inactivation in parasitic plants by trans-specific gene

  15. Dysregulated RNA-Induced Silencing Complex (RISC) Assembly within CNS Corresponds with Abnormal miRNA Expression during Autoimmune Demyelination.

    Science.gov (United States)

    Lewkowicz, Przemysław; Cwiklińska, Hanna; Mycko, Marcin P; Cichalewska, Maria; Domowicz, Małgorzata; Lewkowicz, Natalia; Jurewicz, Anna; Selmaj, Krzysztof W

    2015-05-13

    MicroRNAs (miRNAs) associate with Argonaute (Ago), GW182, and FXR1 proteins to form RNA-induced silencing complexes (RISCs). RISCs represent a critical checkpoint in the regulation and bioavailability of miRNAs. Recent studies have revealed dysregulation of miRNAs in multiple sclerosis (MS) and its animal model, experimental autoimmune encephalomyelitis (EAE); however, the function of RISCs in EAE and MS is largely unknown. Here, we examined the expression of Ago, GW182, and FXR1 in CNS tissue, oligodendrocytes (OLs), brain-infiltrating T lymphocytes, and CD3(+)splenocytes (SCs) of EAE mic, and found that global RISC protein levels were significantly dysregulated. Specifically, Ago2 and FXR1 levels were decreased in OLs and brain-infiltrating T cells in EAE mice. Accordingly, assembly of Ago2/GW182/FXR1 complexes in EAE brain tissues was disrupted, as confirmed by immunoprecipitation experiments. In parallel with alterations in RISC complex content in OLs, we found downregulation of miRNAs essential for differentiation and survival of OLs and myelin synthesis. In brain-infiltrating T lymphocytes, aberrant RISC formation contributed to miRNA-dependent proinflammatory helper T-cell polarization. In CD3(+) SCs, we found increased expression of both Ago2 and FXR1 in EAE compared with nonimmunized mice. Therefore, our results demonstrate a gradient in expression of miRNA between primary activated T cells in the periphery and polarized CNS-infiltrating T cells. These results suggest that, in polarized autoreactive effector T cells, miRNA synthesis is inhibited in response to dysregulated RISC assembly, allowing these cells to maintain a highly specific proinflammatory program. Therefore, our findings may provide a mechanism that leads to miRNA dysregulation in EAE/MS. Copyright © 2015 the authors 0270-6474/15/357521-17$15.00/0.

  16. Pokemon decreases the transcriptional activity of RARα in the absence of ligand.

    Science.gov (United States)

    Yang, Yutao; Li, Yueting; Di, Fei; Cui, Jiajun; Wang, Yue; David Xu, Zhi-Qing

    2016-12-20

    Pokemon is a transcriptional repressor that belongs to the POZ and Krüppel (POK) protein family. In this study, we investigated the potential interaction between Pokemon and retinoic acid receptor alpha (RARα) and determined the role of Pokemon in regulation of RARα transcriptional activity in the absence of ligand. We found that Pokemon could directly interact with RARα. Moreover, we demonstrated that Pokemon could decrease the transcriptional activity of RARα in the absence of ligand. Furthermore, we showed that Pokemon could repress the transcriptional activity of RARα by increasing the recruitment of nuclear receptor co-repressor (NCoR) and silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) to the retinoic acid response element (RARE) element. Taken together, these data suggest that Pokemon is a novel partner of RARα that acts as a co-repressor to regulate RARα transcriptional activity in the absence of ligand.

  17. Effects of PKM2 Gene Silencing on the Proliferation and Apoptosis of Colorectal Cancer LS-147T and SW620 Cells

    Directory of Open Access Journals (Sweden)

    Ran Ao

    2017-07-01

    Full Text Available Background/Aims: This paper aims to explore the effects of pyruvate kinase (PK M2 gene silencing on the proliferation and apoptosis of colorectal cancer (CRC LS-147T and SW620 cells. Methods: CRC LS-147T and SW620 cells highly expressing PKM2 were randomly selected by quantitative real-time polymerase chain reaction (qRT-PCR and then assigned into the blank (no transfection, PKM2-shRNA (transfection with shRNA and empty plasmid (transfection with empty plasmid groups. Immunofluorescence was applied to detect PKM2 protein expression. qRT-PCR and Western blotting were conducted to assess mRNA and protein expression of PKM2, p53 and p21. The cell counting kit-8 (CCK-8 assay was used to assess cell proliferation. Flow cytometry was used to assess the cell cycle and apoptosis rate, and a senescence-associated β-galactosidase staining kit was used to assess cell senescence. Results: PKM2 exhibited high mRNA expression among CRC LS-147T and SW620 cells with remarkable protein expression noted in the cytoplasm and nucleus. The PKM2-shRNA group exhibited reduced PKM2 mRNA and protein expression, whereas p53 and p21 expression was increased compared with the blank and empty plasmid groups. Cell proliferation in PKM2-shRNA cells decreased significantly compared with the blank group and empty plasmid groups. The PKM2-shRNA group exhibited more cells in the G1 phase and fewer cells in the G2/M phase compared with the blank and empty plasmid groups. In addition, the PKM2-shRNA group exhibited significantly increased apoptosis rates and β-galactosidase activity compared with the blank and empty plasmid groups. Conclusion: Our study demonstrates that PKM2 gene silencing suppresses proliferation and promotes apoptosis in LS-147T and SW620 cells.

  18. DNA sequence-specific dimeric bisbenzimidazoles DBP(n) and DBPA(n) as inhibitors of H-NS silencing in bacterial cells.

    Science.gov (United States)

    Melkina, Olga E; Koval, Vasilii S; Ivanov, Alexander A; Zhuze, Alexei L; Zavilgelsky, Gennadii B

    2018-03-01

    DNA sequence-specific fluorescent dimeric bisbenzimidazoles DBP(n) and DBPA(n), noncovalently interacting with A-T pairs in the minor groove of double-stranded DNA were used for studying and monitoring the expression of histone-like H-NS-dependent promoters. Histone-like H-NS selectively binds to AT-rich segments of DNA and silences a large number of genes in bacterial chromosomes. The H-NS-dependent promoters of Quorum Sensing (QS)-regulated lux operons of the marine bacteria mesophilic Aliivibrio fischeri, psychrophilic Aliivibrio logei were used. Escherichia coli lux biosensors were constructed by cloning fragments bearing QS-regulated promoters into the vector, thereby placing each fragment upstream of the promoterless Photorhabdus luminescens luxCDABE genes. It was shown that the dimeric bisbenzimidazoles DBP(n) and DBPA(n) counteract the H-NS silencing activity. Thus, the presence of DBP(n) or DBPA(n) in the medium leads to an approximately 10-100-fold increase in the level of transcription of QS promoters in E. coli hns + . The largest decrease in the level of H-NS repression was observed using ligands containing a linker with a length of ca. 18Å, such as DBP(2) and DBPA(2). Ligands containing linkers with n=1 and 3 are an order of magnitude less active; ligands with n=4 are inactive. DBPA(2) exhibits activity starting with a concentration of 0.5μM; the minimum concentration of DBP(2) is 5-7 times higher. It is suggested that A-T pairs located at five nucleotide pair intervals, which correspond to the linker length in highly active ligands with n=2, play a key role in the structure of H-NS-binding sites in QS-regulated promoters. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. VIP and VIP gene silencing modulation of differentiation marker N-cadherin and cell shape of corneal endothelium in human corneas ex vivo.

    Science.gov (United States)

    Koh, Shay-Whey M; Chandrasekara, Krish; Abbondandolo, Cara J; Coll, Timothy J; Rutzen, Allan R

    2008-08-01

    Vasoactive intestinal peptide (VIP) is expressed by corneal endothelial (CE) cells and is present in the aqueous humor, which bathes CE cells in vivo. This study demonstrated the role of CE cell VIP in maintaining the expression level of a CE differentiation marker, N-cadherin, and the hexagonal cell shape. To determine the most effective VIP concentration, bovine corneoscleral explants were treated with 0 (control) and 10(-12) to 10(-6) M VIP. Paired human corneas (nine donors) from an eye bank were used as control; the other corneas were treated with VIP. To silence endogenous VIP, paired fresh human donor corneas (from seven cadavers) were transduced with VIP shRNA or the control lentiviral particles and then bisected/quartered for quantitative analysis by semiquantitative RT-PCR (for mRNA) and Western blot analysis/immunocytochemistry (for protein), whereas alizarin red S staining revealed CE cell shape. VIP concentration dependently increased bovine CE cell N-cadherin mRNA levels, with the maximal effect observed between 10(-10) (1.47 +/- 0.06-fold; P = 0.002) and 10(-8) M VIP (1.48 +/- 0.18-fold; P = 0.012). VIP (10(-8) M) treatment increased N-cadherin protein levels in bovine and human CE cells to 1.98 +/- 0.28-fold (P = 0.005) and 1.17 +/- 0.10 (range, 0.91-1.87)-fold (P = 0.050) of their respective controls. VIP antagonist (SN)VIPhyb diminished the VIP effect. VIP silencing resulted in deterioration of the hexagonal cell shape and decreased levels of VIP protein and mRNA, N-cadherin (but not connexin-43) mRNA and protein, and the antiapoptotic Bcl-2 protein. Through its autocrine VIP, CE cells play an active role in maintaining the differentiated state and suppressing apoptosis in the corneal endothelium in situ.

  20. Soilborne wheat mosaic virus (SBWMV 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing

    Directory of Open Access Journals (Sweden)

    Howard Amanda

    2005-03-01

    Full Text Available Abstract Amino acid sequence analyses indicate that the Soilborne wheat mosaic virus (SBWMV 19K protein is a cysteine-rich protein (CRP and shares sequence homology with CRPs derived from furo-, hordei-, peclu- and tobraviruses. Since the hordei- and pecluvirus CRPs were shown to be pathogenesis factors and/or suppressors of RNA silencing, experiments were conducted to determine if the SBWMV 19K CRP has similar activities. The SBWMV 19K CRP was introduced into the Potato virus X (PVX viral vector and inoculated to tobacco plants. The SBWMV 19K CRP aggravated PVX-induced symptoms and restored green fluorescent protein (GFP expression to GFP silenced tissues. These observations indicate that the SBWMV 19K CRP is a pathogenicity determinant and a suppressor of RNA silencing.