Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron
Hiesel, Rudolf; Brennicke, Axel
1983-01-01
The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484
Directory of Open Access Journals (Sweden)
Verónica Loera-Castañeda
2014-01-01
Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.
Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.
Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D
2017-01-23
The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.
Angiotensin II inhibits the Na+-K+ pump via PKC-dependent activation of NADPH oxidase.
White, Caroline N; Figtree, Gemma A; Liu, Chia-Chi; Garcia, Alvaro; Hamilton, Elisha J; Chia, Karin K M; Rasmussen, Helge H
2009-04-01
The sarcolemmal Na(+)-K(+) pump, pivotal in cardiac myocyte function, is inhibited by angiotensin II (ANG II). Since ANG II activates NADPH oxidase, we tested the hypothesis that NADPH oxidase mediates the pump inhibition. Exposure to 100 nmol/l ANG II increased superoxide-sensitive fluorescence of isolated rabbit ventricular myocytes. The increase was abolished by pegylated superoxide dismutase (SOD), by the NADPH oxidase inhibitor apocynin, and by myristolated inhibitory peptide to epsilon-protein kinase C (epsilonPKC), previously implicated in ANG II-induced Na(+)-K(+) pump inhibition. A role for epsilonPKC was also supported by an ANG II-induced increase in coimmunoprecipitation of epsilonPKC with the receptor for the activated kinase and with the cytosolic p47(phox) subunit of NADPH oxidase. ANG II decreased electrogenic Na(+)-K(+) pump current in voltage-clamped myocytes. The decrease was abolished by SOD, by the gp91ds inhibitory peptide that blocks assembly and activation of NADPH oxidase, and by epsilonPKC inhibitory peptide. Since colocalization should facilitate NADPH oxidase-dependent regulation of the Na(+)-K(+) pump, we examined whether there is physical association between the pump subunits and NADPH oxidase. The alpha(1)-subunit coimmunoprecipitated with caveolin 3 and with membrane-associated p22(phox) and cytosolic p47(phox) NADPH oxidase subunits at baseline. ANG II had no effect on alpha(1)/caveolin 3 or alpha(1)/p22(phox) interaction, but it increased alpha(1)/p47(phox) coimmunoprecipitation. We conclude that ANG II inhibits the Na(+)-K(+) pump via PKC-dependent NADPH oxidase activation.
A role for NADPH oxidase in antigen presentation
Directory of Open Access Journals (Sweden)
Gail J Gardiner
2013-09-01
Full Text Available The nicotinamide adenine dinucleotide phosphate (NADPH oxidase expressed in phagocytes is a multi-subunit enzyme complex that generates superoxide (O2.-. This radical is an important precursor of hydrogen peroxide (H2O2 and other reactive oxygen species (ROS needed for microbicidal activity during innate immune responses. Inherited defects in NADPH oxidase give rise to chronic granulomatous disease (CGD, a primary immunodeficiency characterized by recurrent infections and granulomatous inflammation. Interestingly, CGD, CGD carrier status, and oxidase gene polymorphisms have all been associated with autoinflammatory and autoimmune disorders, suggesting a potential role for NADPH oxidase in regulating adaptive immune responses. Here, NADPH oxidase function in antigen processing and presentation is reviewed. NADPH oxidase influences dendritic cell (DC crosspresentation by major histocompatibility complex class I molecules (MHC-I through regulation of the phagosomal microenvironment, while in B lymphocytes, NADPH oxidase alters epitope selection by major histocompatibility complex class II molecules (MHC-II.
Tan, Siew Hwa; Aris, Edah Mohd; Surin, Johari; Omar, Baharudin; Kurahashi, Hiromu; Mohamed, Zulqarnain
2009-08-01
The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.
Diane Dietrich; Casey Crooks
2009-01-01
A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5âUTR...
Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes
International Nuclear Information System (INIS)
Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver
2005-01-01
Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin
Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans
Directory of Open Access Journals (Sweden)
Coppée Jean-Yves
2010-02-01
Full Text Available Abstract Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III to As(V as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III. To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54 of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III in this microorganism.
Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase
Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.
2013-01-01
Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs. PMID:23818588
Molecular evolution of the polyamine oxidase gene family in Metazoa
Directory of Open Access Journals (Sweden)
Polticelli Fabio
2012-06-01
Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported
Gene cloning and characterization of NADH oxidase from ...
African Journals Online (AJOL)
The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...
Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V
2002-08-06
The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.
Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...
African Journals Online (AJOL)
The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...
Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha
Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.
1989-01-01
We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence
Divergence and adaptive evolution of the gibberellin oxidase genes in plants.
Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan
2015-09-29
The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.
Galán, María; Varona, Saray; Guadall, Anna; Orriols, Mar; Navas, Miquel; Aguiló, Silvia; de Diego, Alicia; Navarro, María A; García-Dorado, David; Rodríguez-Sinovas, Antonio; Martínez-González, José; Rodriguez, Cristina
2017-09-01
Lysyl oxidase (LOX) controls matrix remodeling, a key process that underlies cardiovascular diseases and heart failure; however, a lack of suitable animal models has limited our knowledge with regard to the contribution of LOX to cardiac dysfunction. Here, we assessed the impact of LOX overexpression on ventricular function and cardiac hypertrophy in a transgenic LOX (TgLOX) mouse model with a strong cardiac expression of human LOX. TgLOX mice exhibited high expression of the transgene in cardiomyocytes and cardiofibroblasts, which are associated with enhanced LOX activity and H 2 O 2 production and with cardiofibroblast reprogramming. LOX overexpression promoted an age-associated concentric remodeling of the left ventricle and impaired diastolic function. Furthermore, LOX transgenesis aggravated angiotensin II (Ang II)-induced cardiac hypertrophy and dysfunction, which triggered a greater fibrotic response that was characterized by stronger collagen deposition and cross-linking and high expression of fibrotic markers. In addition, LOX transgenesis increased the Ang II-induced myocardial inflammatory infiltrate, exacerbated expression of proinflammatory markers, and decreased that of cardioprotective factors. Mechanistically, LOX overexpression enhanced oxidative stress and potentiated the Ang II-mediated cardiac activation of p38 MAPK while reducing AMPK activation. Our findings suggest that LOX induces an age-dependent disturbance of diastolic function and aggravates Ang II-induced hypertrophy, which provides novel insights into the role of LOX in cardiac performance.-Galán, M., Varona, S., Guadall, A., Orriols, M., Navas, M., Aguiló, S., de Diego, A., Navarro, M. A., García-Dorado, D., Rodríguez-Sinovas, A., Martínez-González, J., Rodriguez, C. Lysyl oxidase overexpression accelerates cardiac remodeling and aggravates angiotensin II-induced hypertrophy. © FASEB.
Energy Technology Data Exchange (ETDEWEB)
Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)
1997-03-01
An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.
Directory of Open Access Journals (Sweden)
O.I. Grabelnych
2017-02-01
Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.
The terminal oxidases of Paracoccus denitrificans
de Gier, J.-W.; Lübben, M; Reijnders, W N; Tipker, C A; Slotboom, D.J.; van Spanning, R J; Stouthamer, A.H.; van der Oost, J.
Three distinct types of terminal oxidases participate in the aerobic respiratory pathways of Paracoccus denitrificans. Two alternative genes encoding subunit I of the aa3-type cytochrome c oxidase have been isolated before, namely ctaDI and ctaDII. Each of these genes can be expressed separately to
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...
Molecular characterisation and expression analysis of acc oxidase gene from guzmania ruiz and pav
International Nuclear Information System (INIS)
Jianxin, L.; Huaqiao, D.; Weiyong, W.; Danqing, T.
2017-01-01
ACC oxidase is the last key enzyme of ethylene synthesis pathway, while ethylene is a key factor affecting flowering in ornamental bromeliad. To understand ACC oxidase gene's characteristics and its effect on ornamental bromeliad flowering, we cloned 1504bp full-length cDNA sequence (GenBank: JX972145) and 2546bp corresponding genomic sequence (GenBank: JX972146)of GoACO1 (ACC oxidase gene) from Guzmania variety: Ostara. Prokaryotic expression study showed that expression of GoACO1 can produced a 41 KD protein precipitation in Escherichia coli DE3(BL-21); Real-time quantitative analysis showed that GoACO1 can express in all tested tissues including floral organ, bract, leaf and scape, and expression quantity in bract was the highest. Through constructing plant overexpression vector, transforming into Arabidopsis thaliana, and investigating blossom character of T2 generation seeds, we found that first flowering time of the goal Arabidopsis thaliana was 1.5 days earlier, and their peak flowering time(the number of flowering more than 50%) was 1.8 days earlier, compared with wild type one. Taken together, our results suggested that GoACO1can express in all kinds of tissues and seems to promote Arabidopsis thaliana flowering earlier. (author)
Characterization of Cu(II)-reconstituted ACC Oxidase using experimental and theoretical approaches.
El Bakkali-Tahéri, Nadia; Tachon, Sybille; Orio, Maylis; Bertaina, Sylvain; Martinho, Marlène; Robert, Viviane; Réglier, Marius; Tron, Thierry; Dorlet, Pierre; Simaan, A Jalila
2017-06-01
1-Aminocyclopropane-1-carboxylic acid oxidase (ACCO) is a non heme iron(II) containing enzyme that catalyzes the final step of the ethylene biosynthesis in plants. The iron(II) ion is bound in a facial triad composed of two histidines and one aspartate (H177, D179 and H234). Several active site variants were generated to provide alternate binding motifs and the enzymes were reconstituted with copper(II). Continuous wave (cw) and pulsed Electron Paramagnetic Resonance (EPR) spectroscopies as well as Density Functional Theory (DFT) calculations were performed and models for the copper(II) binding sites were deduced. In all investigated enzymes, the copper ion is equatorially coordinated by the two histidine residues (H177 and H234) and probably two water molecules. The copper-containing enzymes are inactive, even when hydrogen peroxide is used in peroxide shunt approach. EPR experiments and DFT calculations were undertaken to investigate substrate's (ACC) binding on the copper ion and the results were used to rationalize the lack of copper-mediated activity. Copyright © 2017 Elsevier Inc. All rights reserved.
Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A
2015-11-01
The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.
NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis
Kwak, June M.; Mori, Izumi C.; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L.; Bloom, Rachel E.; Bodde, Sara; Jones, Jonathan D.G.; Schroeder, Julian I.
2003-01-01
Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca2+ increases and ABA- activation of plasma membrane Ca2+-permeable channels in guard cells. Exogenous H2O2 rescues both Ca2+ channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction. PMID:12773379
Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O
1998-01-01
In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.
Micheal, S.; Khan, M.I.; Akhtar, F.; Ali, M.; Ahmed, A.; Hollander, A.I. den; Qamar, R.
2012-01-01
PURPOSE: Single nucleotide polymorphisms (SNPs) rs1048661 (p.R141L) and rs3825942 (p.G153D) in the lysyl oxidase-like 1 (LOXL1) gene have been previously reported to be associated with pseudoexfoliation glaucoma (PEXG) in various Asian and European populations, but these SNPs have not yet been
Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan
2016-08-01
Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.
Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G
1999-10-01
To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.
Catalytic aspects of a copper(II) complex: biological oxidase to ...
Indian Academy of Sciences (India)
BISWAJIT CHOWDHURY
2017-10-03
Oct 3, 2017 ... made with a Jasco model V-730 UV-Vis spectrophotometer. ..... Ligand-induced coordination changes ... Fet3 protein from yeast, a multinuclear copper oxidase ... of mutants of the multicopper oxidase Fet3p Biochem-.
Niazi, Zahid Rasul; Silva, Grazielle C; Ribeiro, Thais Porto; León-González, Antonio J; Kassem, Mohamad; Mirajkar, Abdur; Alvi, Azhar; Abbas, Malak; Zgheel, Faraj; Schini-Kerth, Valérie B; Auger, Cyril
2017-12-01
Eicosapentaenoic acid:docosahexaenoic acid (EPA:DHA) 6:1, an omega-3 polyunsaturated fatty acid formulation, has been shown to induce a sustained formation of endothelial nitric oxide (NO) synthase-derived NO, a major vasoprotective factor. This study examined whether chronic intake of EPA:DHA 6:1 prevents hypertension and endothelial dysfunction induced by angiotensin II (Ang II) in rats. Male Wister rats received orally corn oil or EPA:DHA 6:1 (500 mg kg -1 per day) before chronic infusion of Ang II (0.4 mg kg -1 per day). Systolic blood pressure was determined by tail cuff sphingomanometry, vascular reactivity using a myograph, oxidative stress using dihydroethidium and protein expression by immunofluorescence and western blot analysis. Ang II-induced hypertension was associated with reduced acetylcholine-induced relaxations of secondary branch mesenteric artery rings affecting the endothelium-dependent hyperpolarization (EDH)- and the NO-mediated relaxations, both of which were improved by the NADPH oxidase inhibitor VAS-2870. The Ang II treatment induced also endothelium-dependent contractile responses (EDCFs), which were abolished by the cyclooxygenase (COX) inhibitor indomethacin. An increased level of vascular oxidative stress and expression of NADPH oxidase subunits (p47 phox and p22 phox ), COX-1 and COX-2, endothelial NO synthase and Ang II type 1 receptors were observed in the Ang II group, whereas SK Ca and connexin 37 were downregulated. Intake of EPA:DHA 6:1 prevented the Ang II-induced hypertension and endothelial dysfunction by improving both the NO- and EDH-mediated relaxations, and by reducing EDCFs and the expression of target proteins. The present findings indicate that chronic intake of EPA:DHA 6:1 prevented the Ang II-induced hypertension and endothelial dysfunction in rats, most likely by preventing NADPH oxidase- and COX-derived oxidative stress.
Czech Academy of Sciences Publication Activity Database
Kovářová, Nikola; Vrbacká-Čížková, Alena; Pecina, Petr; Stránecký, V.; Pronicka, E.; Kmoch, S.; Houštěk, Josef
2012-01-01
Roč. 1822, č. 7 (2012), s. 1114-1124 ISSN 0925-4439 R&D Projects: GA MZd(CZ) NS9759; GA MZd(CZ) NT12370; GA ČR(CZ) GD305/08/H037 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : mitochondrial disorder * SURF1 gene * Leigh syndrome * gene expression * oxidative phosphorylation * cytochrome c oxidase Subject RIV: FG - Pediatrics Impact factor: 4.910, year: 2012
Directory of Open Access Journals (Sweden)
Jagna Chmielowska-Bąk
2017-06-01
Full Text Available Cadmium-induced oxidative burst is partially mediated by NADPH oxidase. The aim of the present research was to evaluate the role of NADPH oxidase in soybeans’ response to short-term cadmium stress. The application of an NADPH oxidase inhibitor, diphenyleneiodonium chloride (DPI, affected expression of two Cd-inducible genes, encoding DOF1 and MYBZ2 transcription factors. This effect was observed after 3 h of treatment. Interestingly, Cd-dependent increases in NADPH oxidase activity occurred only after a period of time ranging from 6 and 24 h of stress. Stimulation of the enzyme correlated in time with a significant accumulation of reactive oxygen species (ROS. Further analysis revealed that pharmacological inhibition of NADPH oxidase activity during 24 h of Cd stress does not affect Cd uptake, seedling growth, or the level of lipid peroxidation. The role of NADPH oxidase in the response of soybean seedlings to short-term Cd exposure is discussed.
Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin
2014-01-01
Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870
Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung
1999-01-01
To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828
Directory of Open Access Journals (Sweden)
Hong-Xia Wang
Full Text Available Our previous studies have demonstrated that the urotensin (UII and its receptor are up-regulated in the skeletal muscle of mice with type II diabetes mellitus (T2DM, but the significance of UII in skeletal muscle insulin resistance remains unknown. The purpose of this study was to investigate the effect of UII on NADPH oxidase and glucose transport signaling pathways in the skeletal muscle of mice with T2DM and in C2C12 mouse myotube cells. KK/upj-AY/J mice (KK mice were divided into the following groups: KK group, with saline treatment for 2 weeks; KK+ urantide group, with daily 30 µg/kg body weight injections over the same time period of urantide, a potent urotensin II antagonist peptide; Non-diabetic C57BL/6J mice were used as normal controls. After urantide treatment, mice were subjected to an intraperitoneal glucose tolerance test, in addition to measurements of the levels of ROS, NADPH oxidase and the phosphorylated AKT, PKC and ERK. C2C12 cells were incubated with serum-free DMEM for 24 hours before conducting the experiments, and then administrated with 100 nM UII for 2 hours or 24 hours. Urantide treatment improved glucose tolerance, decreased the translocation of the NADPH subunits p40-phox and p47-phox, and increased levels of the phosphorylated PKC, AKT and ERK. In contrast, UII treatment increased ROS production and p47-phox and p67-phox translocation, and decreased the phosphorylated AKT, ERK1/2 and p38MAPK; Apocynin abrogated this effect. In conclusion, UII increased ROS production by NADPH oxidase, leading to the inhibition of signaling pathways involving glucose transport, such as AKT/PKC/ERK. Our data imply a role for UII at the molecular level in glucose homeostasis, and possibly in skeletal muscle insulin resistance in T2DM.
Directory of Open Access Journals (Sweden)
Shaomei He
2017-08-01
Full Text Available Extracellular electron transfer (EET is recognized as a key biochemical process in circumneutral pH Fe(II-oxidizing bacteria (FeOB. In this study, we searched for candidate EET genes in 73 neutrophilic FeOB genomes, among which 43 genomes are complete or close-to-complete and the rest have estimated genome completeness ranging from 5 to 91%. These neutrophilic FeOB span members of the microaerophilic, anaerobic phototrophic, and anaerobic nitrate-reducing FeOB groups. We found that many microaerophilic and several anaerobic FeOB possess homologs of Cyc2, an outer membrane cytochrome c originally identified in Acidithiobacillus ferrooxidans. The “porin-cytochrome c complex” (PCC gene clusters homologous to MtoAB/PioAB are present in eight FeOB, accounting for 19% of complete and close-to-complete genomes examined, whereas PCC genes homologous to OmbB-OmaB-OmcB in Geobacter sulfurreducens are absent. Further, we discovered gene clusters that may potentially encode two novel PCC types. First, a cluster (tentatively named “PCC3” encodes a porin, an extracellular and a periplasmic cytochrome c with remarkably large numbers of heme-binding motifs. Second, a cluster (tentatively named “PCC4” encodes a porin and three periplasmic multiheme cytochromes c. A conserved inner membrane protein (IMP encoded in PCC3 and PCC4 gene clusters might be responsible for translocating electrons across the inner membrane. Other bacteria possessing PCC3 and PCC4 are mostly Proteobacteria isolated from environments with a potential niche for Fe(II oxidation. In addition to cytochrome c, multicopper oxidase (MCO genes potentially involved in Fe(II oxidation were also identified. Notably, candidate EET genes were not found in some FeOB, especially the anaerobic ones, probably suggesting EET genes or Fe(II oxidation mechanisms are different from the searched models. Overall, based on current EET models, the search extends our understanding of bacterial EET and
Intramolecular electron transfer in ascorbate oxidase is enhanced in the presence of oxygen
DEFF Research Database (Denmark)
Farver, O; Wherland, S; Pecht, I
1994-01-01
Intramolecular electron transfer from the type 1 copper center to the type 3 copper(II) pair is induced in the multi-copper enzyme, ascorbate oxidase, following pulse radiolytic reduction of the type 1 Cu(II) ion. In the presence of a slight excess of dioxygen over ascorbate oxidase, interaction...... between the trinuclear copper center and O2 is observed even with singly reduced ascorbate oxidase molecules. Under these conditions, the rate constant for intramolecular electron transfer from type 1 Cu(I) to type 3 Cu(II) increases 5-fold to 1100 +/- 300 s-1 (20 degrees C, pH 5.8) as compared...
El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K
2012-01-01
Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.
Isolated sulfite oxidase deficiency.
Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R
1996-12-01
Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.
Directory of Open Access Journals (Sweden)
Hamed Esmaeil Lashgarian
2016-10-01
Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.
Energy Technology Data Exchange (ETDEWEB)
Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Lee, Eun Ju [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Choi, Inho, E-mail: inhochoi@ynu.ac.kr [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of)
2014-08-08
Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.
Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing
2015-02-01
Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-05-01
Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of
Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna
2004-01-01
A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...
Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo
2003-04-01
We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.
Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L
2017-03-01
It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.
Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.
Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo
2009-01-01
The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.
Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-12-01
Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.
Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng
2017-04-01
The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
Gene cloning and characterization of NADH oxidase from ...
African Journals Online (AJOL)
use
2011-12-07
Dec 7, 2011 ... potent inhibitors of NADH oxidases, silver nitrate and potassium cyanide did not show any significant ... anaerobes, a class of organisms that have not been ... DNA and amino acid sequence analyses were performed using.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Genetics Home Reference: isolated sulfite oxidase deficiency
... and Management Resources (1 link) GeneReview: Isolated Sulfite Oxidase Deficiency General Information from MedlinePlus (5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and ...
Directory of Open Access Journals (Sweden)
Yan Zhao
Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
Burger, Dylan; Montezano, Augusto C; Nishigaki, Nobuhiro; He, Ying; Carter, Anthony; Touyz, Rhian M
2011-08-01
Circulating microparticles are increased in cardiovascular disease and may themselves promote oxidative stress and inflammation. Molecular mechanisms underlying their formation and signaling are unclear. We investigated the role of reactive oxygen species (ROS), Rho kinase, and lipid rafts in microparticle formation and examined their functional significance in endothelial cells (ECs). Microparticle formation from angiotensin II (Ang II)-stimulated ECs and apolipoprotein E(-/-) mice was assessed by annexin V or by CD144 staining and electron microscopy. Ang II promoted microparticle formation and increased EC O(2)(-) generation and Rho kinase activity. Ang II-stimulated effects were inhibited by irbesartan (Ang II receptor type I blocker) and fasudil (Rho kinase inhibitor). Methyl-β-cyclodextrin and nystatin, which disrupt lipid rafts/caveolae, blocked microparticle release. Functional responses, assessed in microparticle-stimulated ECs, revealed increased O(2)(-) production, enhanced vascular cell adhesion molecule/platelet-EC adhesion molecule expression, and augmented macrophage adhesion. Inhibition of epidermal growth factor receptor blocked the prooxidative and proinflammatory effects of microparticles. In vitro observations were confirmed in apolipoprotein E(-/-) mice, which displayed vascular inflammation and high levels of circulating endothelial microparticles, effects that were reduced by apocynin. We demonstrated direct actions of Ang II on endothelial microparticle release, mediated through NADPH oxidase, ROS, and Rho kinase targeted to lipid rafts. Microparticles themselves stimulated endothelial ROS formation and inflammatory responses. Our findings suggest a feedforward system whereby Ang II promotes EC injury through its own endothelial-derived microparticles.
Pöggeler, Stefanie
2011-04-01
Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.
Oxidative Ce"3"+ sequestration by fungal manganese oxides with an associated Mn(II) oxidase activity
International Nuclear Information System (INIS)
Zheng, Haisu; Tani, Yukinori; Naitou, Hirotaka; Miyata, Naoyuki; Tojo, Fuyumi
2016-01-01
Sequestration of Ce"3"+ by biogenic manganese oxides (BMOs) formed by a Mn(II)-oxidizing fungus, Acremonium strictum strain KR21-2, was examined at pH 6.0. In anaerobic Ce"3"+ solution, newly formed BMOs exhibited stoichiometric Ce"3"+ oxidation, where the molar ratio of Ce"3"+ sequestered (Ce_s_e_q) relative to Mn"2"+ released (Mn_r_e_l) was maintained at approximately two throughout the reaction. A similar Ce"3"+ sequestration trend was observed in anaerobic treatment of BMOs in which the associated Mn(II) oxidase was completely inactivated by heating at 85 °C for 1 h or by adding 50 mM NaN_3. Aerobic Ce"3"+ treatment of newly formed BMO (enzymatically active) resulted in excessive Ce"3"+ sequestration over Mn"2"+ release, yielding Ce_s_e_q/Mn_r_e_l > 200, whereas heated or poisoned BMOs released a significant amount of Mn"2"+ with lower Ce"3"+ sequestration efficiency. Consequently, self-regeneration by the Mn(II) oxidase in newly formed BMO effectively suppressed Mn"2"+ release and enhanced oxidative Ce"3"+ sequestration under aerobic conditions. Repeated treatments of heated or poisoned BMOs under aerobic conditions confirmed that oxidative Ce"3"+ sequestration continued even after most Mn oxide was released from the solid phase, indicating auto-catalytic Ce"3"+ oxidation at the solid phase produced through primary Ce"3"+ oxidation by BMO. From X-ray diffraction analysis, the resultant solid phases formed through Ce"3"+ oxidation by BMO under both aerobic and anaerobic conditions consisted of cerianite with crystal sizes of 5.00–7.23 Å. Such nano-sized CeO_2 (CeO_2_,_B_M_O) showed faster auto-catalytic Ce"3"+ oxidation than that on well-crystalized cerianite under aerobic conditions, where the normalized pseudo-first order rate constants for auto-catalytic Ce"3"+ oxidation on CeO_2_,_B_M_O was two orders of magnitude higher. Consequently, we concluded that Ce"3"+ contact with BMOs sequesters Ce"3"+ through two oxidation paths: primary Ce"3
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-01-01
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially exp...
Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence
Energy Technology Data Exchange (ETDEWEB)
Ruvolo, M.; Disotell, T.R.; Allard, M.W. (Harvard Univ., Cambridge, MA (United States)); Brown, W.M. (Univ. of Michigan, Ann Arbor (United States)); Honeycutt, R.L. (Texas A and M Univ., College Station (United States))
1991-02-15
Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time.
Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence
International Nuclear Information System (INIS)
Ruvolo, M.; Disotell, T.R.; Allard, M.W.; Brown, W.M.; Honeycutt, R.L.
1991-01-01
Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time
Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre
2000-01-01
The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359
Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O
1991-01-01
Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.
Ojima, Yoshihiro; Kawase, Daisuke; Nishioka, Motomu; Taya, Masahito
2009-01-01
Real-time PCR analysis showed that yggE gene was about two and three times up-regulated in Escherichia coli cells exposed to UVA irradiation and thermal elevation, respectively, suggesting that this gene is responsive to physiological stress. The yggE gene was introduced into E. coli BL21 cells, together with a monoamine oxidase (MAO) gene as a model source for oxidative stress generation. The distribution of independently isolated transformants (two dozen isolates) was examined in terms of MAO activity and cell vitality. In the case of control strain expressing MAO alone, the largest number of transformants existed in the low range of MAO activity less than 2 units mg(-1) and the number significantly decreased at increased MAO activity. On the other hand, the distribution of MAO/YggE-coexpressing transformants shifted to higher MAO activity with frequent appearance in the activity range of 4-8 units mg(-1). The yggE gene product therefore has a possible function for alleviating the stress generated in the cells.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Basset, Olivier; Deffert, Christine; Foti, Michelangelo; Bedard, Karen; Jaquet, Vincent; Ogier-Denis, Eric; Krause, Karl-Heinz
2009-10-01
The superoxide-generating NADPH oxidase NOX1 is thought to be involved in signaling by the angiotensin II-receptor AT1R. However, underlying signaling steps are poorly understood. In this study, we investigated the effect of AngII on aortic smooth muscle from wild-type and NOX1-deficient mice. NOX1-deficient cells showed decreased basal ROS generation and did not produce ROS in response to AngII. Unexpectedly, AngII-dependent Ca(2+) signaling was markedly decreased in NOX1-deficient cells. Immunostaining demonstrated that AT1R was localized on the plasma membrane in wild-type, but intracellularly in NOX1-deficient cells. Immunohistochemistry and immunoblotting showed a decreased expression of AT1R in the aorta of NOX1-deficient mice. To investigate the basis of the abnormal AT1R targeting, we studied caveolin expression and phosphorylation. The amounts of total caveolin and of caveolae were not different in NOX1-deficient mice, but a marked decrease occurred in the phosphorylated form of caveolin. Exogenous H(2)O(2) or transfection of a NOX1 plasmid restored AngII responses in NOX1-deficient cells. Based on these findings, we propose that NOX1-derived reactive oxygen species regulate cell-surface expression of AT1R through mechanisms including caveolin phosphorylation. The lack cell-surface AT1R expression in smooth muscle could be involved in the decreased blood pressure in NOX1-deficient mice.
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K
2010-06-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.
Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants
Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.
2001-01-01
Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962
Directory of Open Access Journals (Sweden)
Dinesh Kumar
2015-10-01
Full Text Available A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the central nervous system. In this study, we used Tet1 gene knockout (Tet1KO mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.
Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana
Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling
2016-01-01
Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726
De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M
2016-08-01
Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.
Liu, Chia-Chi; Karimi Galougahi, Keyvan; Weisbrod, Robert M; Hansen, Thomas; Ravaie, Ramtin; Nunez, Andrea; Liu, Yi B; Fry, Natasha; Garcia, Alvaro; Hamilton, Elisha J; Sweadner, Kathleen J; Cohen, Richard A; Figtree, Gemma A
2013-12-01
Glutathionylation of the Na(+)-K(+) pump's β1-subunit is a key molecular mechanism of physiological and pathophysiological pump inhibition in cardiac myocytes. Its contribution to Na(+)-K(+) pump regulation in other tissues is unknown, and cannot be assumed given the dependence on specific β-subunit isoform expression and receptor-coupled pathways. As Na(+)-K(+) pump activity is an important determinant of vascular tone through effects on [Ca(2+)]i, we have examined the role of oxidative regulation of the Na(+)-K(+) pump in mediating angiotensin II (Ang II)-induced increases in vascular reactivity. β1-subunit glutathione adducts were present at baseline and increased by exposure to Ang II in rabbit aortic rings, primary rabbit aortic vascular smooth muscle cells (VSMCs), and human arterial segments. In VSMCs, Ang II-induced glutathionylation was associated with marked reduction in Na(+)-K(+)ATPase activity, an effect that was abolished by the NADPH oxidase inhibitory peptide, tat-gp91ds. In aortic segments, Ang II-induced glutathionylation was associated with decreased K(+)-induced vasorelaxation, a validated index of pump activity. Ang II-induced oxidative inhibition of Na(+)-K(+) ATPase and decrease in K(+)-induced relaxation were reversed by preincubation of VSMCs and rings with recombinant FXYD3 protein that is known to facilitate deglutathionylation of β1-subunit. Knock-out of FXYD1 dramatically decreased K(+)-induced relaxation in a mouse model. Attenuation of Ang II signaling in vivo by captopril (8 mg/kg/day for 7 days) decreased superoxide-sensitive DHE levels in the media of rabbit aorta, decreased β1-subunit glutathionylation, and enhanced K(+)-induced vasorelaxation. Ang II inhibits the Na(+)-K(+) pump in VSMCs via NADPH oxidase-dependent glutathionylation of the pump's β1-subunit, and this newly identified signaling pathway may contribute to altered vascular tone. FXYD proteins reduce oxidative inhibition of the Na(+)-K(+) pump and may have an
Production of recombinant cholesterol oxidase containing covalently bound FAD in Escherichia coli
Directory of Open Access Journals (Sweden)
Molla Gianluca
2010-04-01
Full Text Available Abstract Background Cholesterol oxidase is an alcohol dehydrogenase/oxidase flavoprotein that catalyzes the dehydrogenation of C(3-OH of cholesterol. It has two major biotechnological applications, i.e. in the determination of serum (and food cholesterol levels and as biocatalyst providing valuable intermediates for industrial steroid drug production. Cholesterol oxidases of type I are those containing the FAD cofactor tightly but not covalently bound to the protein moiety, whereas type II members contain covalently bound FAD. This is the first report on the over-expression in Escherichia coli of type II cholesterol oxidase from Brevibacterium sterolicum (BCO. Results Design of the plasmid construct encoding the mature BCO, optimization of medium composition and identification of the best cultivation/induction conditions for growing and expressing the active protein in recombinant E. coli cells, concurred to achieve a valuable improvement: BCO volumetric productivity was increased from ~500 up to ~25000 U/L and its crude extract specific activity from 0.5 up to 7.0 U/mg protein. Interestingly, under optimal expression conditions, nearly 55% of the soluble recombinant BCO is produced as covalently FAD bound form, whereas the protein containing non-covalently bound FAD is preferentially accumulated in insoluble inclusion bodies. Conclusions Comparison of our results with those published on non-covalent (type I COs expressed in recombinant form (either in E. coli or Streptomyces spp., shows that the fully active type II BCO can be produced in E. coli at valuable expression levels. The improved over-production of the FAD-bound cholesterol oxidase will support its development as a novel biotool to be exploited in biotechnological applications.
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Discovery, characterization, and kinetic analysis of an alditol oxidase from streptomyces coelicolor
Heuts, Dominic P. H. M.; van Hellemond, Erik W.; Janssen, Dick B.; Fraaije, Marco W.
2007-01-01
A gene encoding an alditol oxidase was found in the genome of Streptomyces coelicolor A3(2). This newly identified oxidase, AldO, was expressed at extremely high levels in Escherichia coli when fused to maltose-binding protein. AldO is a soluble monomeric flavoprotein with subunits of 45.1 kDa, each
Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming
2013-05-01
A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.
Mills, Philippa B; Surtees, Robert A H; Champion, Michael P; Beesley, Clare E; Dalton, Neil; Scambler, Peter J; Heales, Simon J R; Briddon, Anthony; Scheimberg, Irene; Hoffmann, Georg F; Zschocke, Johannes; Clayton, Peter T
2005-04-15
In the mouse, neurotransmitter metabolism can be regulated by modulation of the synthesis of pyridoxal 5'-phosphate and failure to maintain pyridoxal phosphate (PLP) levels results in epilepsy. This study of five patients with neonatal epileptic encephalopathy suggests that the same is true in man. Cerebrospinal fluid and urine analyses indicated reduced activity of aromatic L-amino acid decarboxylase and other PLP-dependent enzymes. Seizures ceased with the administration of PLP, having been resistant to treatment with pyridoxine, suggesting a defect of pyridox(am)ine 5'-phosphate oxidase (PNPO). Sequencing of the PNPO gene identified homozygous missense, splice site and stop codon mutations. Expression studies in Chinese hamster ovary cells showed that the splice site (IVS3-1g>a) and stop codon (X262Q) mutations were null activity mutations and that the missense mutation (R229W) markedly reduced pyridox(am)ine phosphate oxidase activity. Maintenance of optimal PLP levels in the brain may be important in many neurological disorders in which neurotransmitter metabolism is disturbed (either as a primary or as a secondary phenomenon).
Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David
2015-10-01
A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.
Gene expression profiles in stages II and III colon cancers
DEFF Research Database (Denmark)
Thorsteinsson, Morten; Kirkeby, Lene T; Hansen, Raino
2012-01-01
PURPOSE: A 128-gene signature has been proposed to predict outcome in patients with stages II and III colorectal cancers. In the present study, we aimed to reproduce and validate the 128-gene signature in external and independent material. METHODS: Gene expression data from the original material...... were retrieved from the Gene Expression Omnibus (GEO) (n¿=¿111) in addition to a Danish data set (n¿=¿37). All patients had stages II and III colon cancers. A Prediction Analysis of Microarray classifier, based on the 128-gene signature and the original training set of stage I (n¿=¿65) and stage IV (n...... correctly predicted as stage IV-like, and the remaining patients were predicted as stage I-like and unclassifiable, respectively. Stage II patients could not be stratified. CONCLUSIONS: The 128-gene signature showed reproducibility in stage III colon cancer, but could not predict recurrence in stage II...
Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun
2017-11-01
Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.
Directory of Open Access Journals (Sweden)
Xiuchun Ge
Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.
Directory of Open Access Journals (Sweden)
Efthimios A. Andronis
2014-04-01
Full Text Available Homeostasis of reactive oxygen species (ROS in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd and spermine (Spm to putrescine (Put and Spd, respectively is catalyzed by two peroxisomal PA oxidases (AtPAO. However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI. Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2.-, but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX. On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2.-. These results suggest that the ratio of O2.-/H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2.- by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed.
Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin
2015-06-03
In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV).
Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis
Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie
2001-01-01
The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that
Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese
Directory of Open Access Journals (Sweden)
Li Sheng-Bin
2011-10-01
Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.
Directory of Open Access Journals (Sweden)
Yuange Wang
2014-08-01
Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC.1.5.99.12 regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.
Directory of Open Access Journals (Sweden)
Buades-Rotger M
2014-07-01
Full Text Available Macià Buades-Rotger,1,2 David Gallardo-Pujol1,3 1Department of Personality, Faculty of Psychology, University of Barcelona, Barcelona, Spain; 2Department of Neurology, University of Lübeck, Lübeck, Germany; 3Institute for Brain, Cognition and Behavior (IR3C, University of Barcelona, Barcelona, Spain Abstract: Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. Keywords: behavioral genetics, antisocial behaviors, monoamine oxidase A
Winter, Remko T.; Heuts, Dominic P. H. M.; Rijpkema, Egon M. A.; van Bloois, Edwin; Wijma, Hein J.; Fraaije, Marco W.
We describe the discovery, isolation and characterization of a highly thermostable alditol oxidase from Acidothermus cellulolyticus 11B. This protein was identified by searching the genomes of known thermophiles for enzymes homologous to Streptomyces coelicolor A3(2) alditol oxidase (AldO). A gene
Directory of Open Access Journals (Sweden)
Victoria Campuzano
2012-02-01
Full Text Available A hallmark feature of Williams-Beuren Syndrome (WBS is a generalized arteriopathy due to elastin deficiency, presenting as stenoses of medium and large arteries and leading to hypertension and other cardiovascular complications. Deletion of a functional NCF1 gene copy has been shown to protect a proportion of WBS patients against hypertension, likely through reduced NADPH-oxidase (NOX-mediated oxidative stress. DD mice, carrying a 0.67 Mb heterozygous deletion including the Eln gene, presented with a generalized arteriopathy, hypertension, and cardiac hypertrophy, associated with elevated angiotensin II (angII, oxidative stress parameters, and Ncf1 expression. Genetic (by crossing with Ncf1 mutant and/or pharmacological (with ang II type 1 receptor blocker, losartan, or NOX inhibitor apocynin reduction of NOX activity controlled hormonal and biochemical parameters in DD mice, resulting in normalized blood pressure and improved cardiovascular histology. We provide strong evidence for implication of the redox system in the pathophysiology of the cardiovascular disease in a mouse model of WBS. The phenotype of these mice can be ameliorated by either genetic or pharmacological intervention reducing NOX activity, likely through reduced angII-mediated oxidative stress. Therefore, anti-NOX therapy merits evaluation to prevent the potentially serious cardiovascular complications of WBS, as well as in other cardiovascular disorders mediated by similar pathogenic mechanism.
Xanthine oxidase activity and free radical generation in patients with sepsis syndrome
DEFF Research Database (Denmark)
Galley, H F; Davies, Michael Jonathan; Webster, N R
1996-01-01
OBJECTIVE: To determine xanthine oxidase activity, free radical concentrations, and lipid peroxidation in patients with sepsis syndrome compared with noninfected critically ill patients. DESIGN: A prospective observational study. SETTING: A nine-bed intensive care unit in a university teaching......). CONCLUSIONS: Patients with sepsis have xanthine oxidase activation, high free-radical concentrations, and evidence of free radical damage. The finding that xanthine oxidase activity was lower in those patients who died, coupled with increased lactate concentrations implies more severe ischemia with incomplete...... to the Acute Physiology and Chronic Health Evaluation (APACHE) II score or to the presence of organ dysfunction. The mean ascorbyl radical concentration (arbitrary units) determined by electron paramagnetic resonance following spin trapping was increased in patients compared with healthy subjects (p
Eco RI RFLP in the human IGF II gene
Energy Technology Data Exchange (ETDEWEB)
Cocozza, S; Garofalo, S; Robledo, R; Monticelli, A; Conti, A; Chiarotti, L; Frunzio, R; Bruni, C B; Varrone, S
1988-03-25
The probe was a 500 bp cDNA containing exons 2-3 and 4 of the human IGF II gene. The clone was isolated by screening a human liver cDNA library with synthetic oligonucleotides. Eco RI digestion of genomic DNA and hybridization with the IGF II probe detects a two allele polymorphism with allelic fragments of 13.5 kb and 10.5 kb. The frequency was studied 38 unrelated Caucasians: Human IGF II gene was localized on the short arm of chromosome 11 (p15) by in situ hybridization. Codominant segregation was observed in 2 Caucasian families (10 individuals).
Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1
Frisse, Andrea; Pimenta, Maria João; Lange, Theo
2003-01-01
Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672
Directory of Open Access Journals (Sweden)
Shan Xin
Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Effect of a heme oxygenase-1 inducer on NADPH oxidase ...
African Journals Online (AJOL)
Effect of a heme oxygenase-1 inducer on NADPH oxidase expression in ... and immunohistochemistry of hepatic NOX1 and NOX4 were investigated in week 4. ... (HO-1 inhibitor) administration caused upregulation of NOX gene expression ...
Directory of Open Access Journals (Sweden)
Rogayah Sekeli
2014-06-01
Full Text Available The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6. Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.
Oxidized low-density lipoproteins upregulate proline oxidase to initiate ROS-dependent autophagy.
Zabirnyk, Olga; Liu, Wei; Khalil, Shadi; Sharma, Anit; Phang, James M
2010-03-01
Epidemiological studies showed that high levels of oxidized low-density lipoproteins (oxLDLs) are associated with increased cancer risk. We examined the direct effect of physiologic concentrations oxLDL on cancer cells. OxLDLs were cytotoxic and activate both apoptosis and autophagy. OxLDLs have ligands for peroxisome proliferator-activated receptor gamma and upregulated proline oxidase (POX) through this nuclear receptor. We identified 7-ketocholesterol (7KC) as a main component responsible for the latter. To elucidate the role of POX in oxLDL-mediated cytotoxicity, we knocked down POX via small interfering RNA and found that this (i) further reduced viability of cancer cells treated with oxLDL; (ii) decreased oxLDL-associated reactive oxygen species generation; (iii) decreased autophagy measured via beclin-1 protein level and light-chain 3 protein (LC3)-I into LC3-II conversion. Using POX-expressing cell model, we established that single POX overexpression was sufficient to activate autophagy. Thus, it led to autophagosomes accumulation and increased conversion of LC3-I into LC3-II. Moreover, beclin-1 gene expression was directly dependent on POX catalytic activity, namely the generation of POX-dependent superoxide. We conclude that POX is critical in the cellular response to the noxious effects of oxLDL by activating protective autophagy.
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Structure and Chromosomal Organization of Yeast Genes Regulated by Topoisomerase II.
Joshi, Ricky S; Nikolaou, Christoforos; Roca, Joaquim
2018-01-03
Cellular DNA topoisomerases (topo I and topo II) are highly conserved enzymes that regulate the topology of DNA during normal genome transactions, such as DNA transcription and replication. In budding yeast, topo I is dispensable whereas topo II is essential, suggesting fundamental and exclusive roles for topo II, which might include the functions of the topo IIa and topo IIb isoforms found in mammalian cells. In this review, we discuss major findings of the structure and chromosomal organization of genes regulated by topo II in budding yeast. Experimental data was derived from short (10 min) and long term (120 min) responses to topo II inactivation in top-2 ts mutants. First, we discuss how short term responses reveal a subset of yeast genes that are regulated by topo II depending on their promoter architecture. These short term responses also uncovered topo II regulation of transcription across multi-gene clusters, plausibly by common DNA topology management. Finally, we examine the effects of deactivated topo II on the elongation of RNA transcripts. Each study provides an insight into the particular chromatin structure that interacts with the activity of topo II. These findings are of notable clinical interest as numerous anti-cancer therapies interfere with topo II activity.
Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*
Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun
2010-01-01
Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109
Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F
2017-01-06
Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis
Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G
2015-03-01
Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.
Overview of BioCreative II gene mention recognition
Smith, L.; Tanabe, L.K.; Johnson, R.; Kuo, C.-J.; Chung, I-F.; Hsu, C.-N.; Lin, Y.-S.; Klinger, R.; Friedrich, C.M.; Ganchev, K.; Torii, M.; Liu, H.; Haddow, B.; Struble, C.A.; Povinelli, R.J.; Vlachos, A.; Baumgartner (jr.), W.A.; Hunter, L.; Carpenter, B.; Tsai, R.T.-H.; Dai, H.-J.; Liu, F.; Chen, Y.; Sun, C.; Katrenko, S.; Adriaans, P.; Blaschke, C.; Torres, R.; Neves, M.; Nakov, P.; Divoli, A.; Maña-López, M.; Mata, J.; Wilbur, W.J.
2008-01-01
Nineteen teams presented results for the Gene Mention Task at the BioCreative II Workshop. In this task participants designed systems to identify substrings in sentences corresponding to gene name mentions. A variety of different methods were used and the results varied with a highest achieved F1
Genetic effect of monoamine oxidase B (MAOB gene on ASD associated behavior phenotypes
Directory of Open Access Journals (Sweden)
Deepak Verma
2017-10-01
Full Text Available Autism spectrum disorder (ASD is a male predominance, behaviorally defined neurodevelopmental disorder which is characterized by impairment in social communication and restricted and repetitive activities. Abnormalities in serotoninergic function play a major role in ASD pathophysiology. Monoamine oxidases, encoded by two X-chromosomal genes MAOA and MAOB regulate the serotonergic function by the degradation of serotonin and other biological amines. Therefore, the objective of present study is to investigate genetic correlation of MAOB markers with the severity of specific behavioral traits as scored by Childhood Autism Rating Scale (CARS has been examined as quantitative trait (QT analysis using IBM-SPSS program. A total of 225 ASD patients (190 male and 35 female were recruited after psychometric evaluation done by DSM-IV-TR/DSM-5 criteria and assessment by CARS. Genotyping carried by PCR/RFLP/sequencing methods, and population were found in Hardy-Weinberg equilibrium. The outcome of the QT analysis indicating the increased score in overall CARS were associated with G and C allele of MAOB marker rs3027449 (p-value: 0.03 and rs1040399 (p-value: 0.01, respectively in male ASD children. In addition to this, major alleles of studied polymorphisms of gene were found to be statistically associated with the higher impairment in social communication domain only in male ASD children. Overall outcome of the study suggests likely involvement of MAOB with ASD in a gender-specific manner with the severity in behavior phenotypes. Considering the cumulative impact of these markers in regulating the severity of the behavioral symptoms of ASD, it is likely that MAOB gene is associated with the disorder.
Syndromes associated with Homo sapiens pol II regulatory genes.
Bina, M; Demmon, S; Pares-Matos, E I
2000-01-01
The molecular basis of human characteristics is an intriguing but an unresolved problem. Human characteristics cover a broad spectrum, from the obvious to the abstract. Obvious characteristics may include morphological features such as height, shape, and facial form. Abstract characteristics may be hidden in processes that are controlled by hormones and the human brain. In this review we examine exaggerated characteristics presented as syndromes. Specifically, we focus on human genes that encode transcription factors to examine morphological, immunological, and hormonal anomalies that result from deletion, insertion, or mutation of genes that regulate transcription by RNA polymerase II (the Pol II genes). A close analysis of abnormal phenotypes can give clues into how sequence variations in regulatory genes and changes in transcriptional control may give rise to characteristics defined as complex traits.
Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.
Haruta, M; Murata, M; Kadokura, H; Homma, S
1999-03-01
An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.
A novel TBP-TAF complex on RNA polymerase II-transcribed snRNA genes.
Zaborowska, Justyna; Taylor, Alice; Roeder, Robert G; Murphy, Shona
2012-01-01
Initiation of transcription of most human genes transcribed by RNA polymerase II (RNAP II) requires the formation of a preinitiation complex comprising TFIIA, B, D, E, F, H and RNAP II. The general transcription factor TFIID is composed of the TATA-binding protein and up to 13 TBP-associated factors. During transcription of snRNA genes, RNAP II does not appear to make the transition to long-range productive elongation, as happens during transcription of protein-coding genes. In addition, recognition of the snRNA gene-type specific 3' box RNA processing element requires initiation from an snRNA gene promoter. These characteristics may, at least in part, be driven by factors recruited to the promoter. For example, differences in the complement of TAFs might result in differential recruitment of elongation and RNA processing factors. As precedent, it already has been shown that the promoters of some protein-coding genes do not recruit all the TAFs found in TFIID. Although TAF5 has been shown to be associated with RNAP II-transcribed snRNA genes, the full complement of TAFs associated with these genes has remained unclear. Here we show, using a ChIP and siRNA-mediated approach, that the TBP/TAF complex on snRNA genes differs from that found on protein-coding genes. Interestingly, the largest TAF, TAF1, and the core TAFs, TAF10 and TAF4, are not detected on snRNA genes. We propose that this snRNA gene-specific TAF subset plays a key role in gene type-specific control of expression.
Li, Bao; Tian, Jing; Sun, Yi; Xu, Tao-Rui; Chi, Rui-Fang; Zhang, Xiao-Li; Hu, Xin-Ling; Zhang, Yue-An; Qin, Fu-Zhong; Zhang, Wei-Fang
2015-05-01
Nicotinamide adenine dinucleotide 3-phosphate (NADPH) oxidase activity and endoplasmic reticulum (ER) stress are increased after myocardial infarction (MI). In this study, we proposed to test whether activation of the NADPH oxidase in the remote non-infarcted myocardium mediates ER stress and left ventricular (LV) remodeling after MI. Rabbits with MI or sham operation were randomly assigned to orally receive an NADPH oxidase inhibitor apocynin or placebo for 30 days. The agents were administered beginning at 1 week after surgery. MI rabbits exhibited decreases in LV fractional shortening, LV ejection fraction and the first derivative of the LV pressure rise, which were abolished by apocynin treatment. NADPH oxidase Nox2 protein and mRNA expressions were increased in the remote non-infarcted myocardium after MI. Immunolabeling further revealed that Nox2 was increased in cardiac myocytes in the remote myocardium. The apocynin treatment prevented increases in the Nox2 expression, NADPH oxidase activity, oxidative stress, myocyte apoptosis and GRP78, CHOP and cleaved caspase 12 protein expression in the remote myocardium. The apocynin treatment also attenuated increases in myocyte diameter and cardiac fibrosis. In cultured H9C2 cardiomyocytes exposed to angiotensin II, an important stimulus for post-MI remodeling, Nox2 knockdown with siRNA significantly inhibited angiotensin II-induced NADPH oxidase activation, reactive oxygen species and GRP78 and CHOP protein expression. We conclude that NADPH oxidase inhibition attenuates increased ER stress in the remote non-infarcted myocardium and LV remodeling late after MI in rabbits. These findings suggest that the activation of NADPH oxidase in the remote non-infarcted myocardium mediates increased ER stress, contributing to myocyte apoptosis and LV remodeling after MI. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Wirgenes, Katrine V; Djurovic, Srdjan; Agartz, Ingrid
2009-01-01
-amino-acid-oxidase (DAO) gene, both involved in glutamate receptor function, reported associations with negative symptoms and with anxiety and depression, respectively, when measured with the Positive and Negative Syndrome Scale (PANSS). METHODS: In the present study, the suggested association between dysbindin and DAO...... single nucleotide polymorphisms (SNPs) and PANSS scores was analyzed in 155 Norwegian schizophrenia patients. RESULTS: There was a significant association between the dysbindin SNP rs3213207 and severity of both negative symptoms and total symptom load, as well as between the DAO SNP rs2070587 and total...... symptom score and severity of anxiety and depression. CONCLUSION: The present association of dysbindin SNPs with negative symptoms and DAO SNPs with anxiety and depression is a replication of earlier findings and strengthens the hypothesis of a genetic association. It further indicates involvement...
Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong
2016-11-05
As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.
Angiotensin II induced catabolic effect and muscle atrophy are redox dependent
Semprun-Prieto, Laura C.; Sukhanov, Sergiy; Yoshida, Tadashi; Rezk, Bashir M.; Gonzalez-Villalobos, Romer A.; Vaughn, Charlotte; Tabony, A. Michael; Delafontaine, Patrice
2011-01-01
Angiotensin II (Ang II) causes skeletal muscle wasting via an increase in muscle catabolism. To determine whether the wasting effects of Ang II were related to its ability to increase NADPH oxidase-derived reactive oxygen species (ROS) we infused wild-type C57BL/6J or p47phox−/− mice with vehicle or Ang II for 7 days. Superoxide production was increased 2.4 fold in the skeletal muscle of Ang II infused mice, and this increase was prevented in p47phox−/− mice. Apocynin treatment prevented Ang II-induced superoxide production in skeletal muscle, consistent with Ang II increasing NADPH oxidase derived ROS. Ang II induced loss of body and skeletal muscle weight in C57BL/6J mice, whereas the reduction was significantly attenuated in p47phox−/− animals. The reduction of skeletal muscle weight caused by Ang II was associated with an increase of proteasome activity, and this increase was completely prevented in the skeletal muscle of p47phox−/− mice. In conclusion, Ang II-induced skeletal muscle wasting is in part dependent on NADPH oxidase derived ROS. PMID:21570954
Obayashi, Takeshi; Kinoshita, Kengo
2010-05-01
Gene coexpression analyses are a powerful method to predict the function of genes and/or to identify genes that are functionally related to query genes. The basic idea of gene coexpression analyses is that genes with similar functions should have similar expression patterns under many different conditions. This approach is now widely used by many experimental researchers, especially in the field of plant biology. In this review, we will summarize recent successful examples obtained by using our gene coexpression database, ATTED-II. Specifically, the examples will describe the identification of new genes, such as the subunits of a complex protein, the enzymes in a metabolic pathway and transporters. In addition, we will discuss the discovery of a new intercellular signaling factor and new regulatory relationships between transcription factors and their target genes. In ATTED-II, we provide two basic views of gene coexpression, a gene list view and a gene network view, which can be used as guide gene approach and narrow-down approach, respectively. In addition, we will discuss the coexpression effectiveness for various types of gene sets.
Czech Academy of Sciences Publication Activity Database
Paukner, R.; Staudigl, P.; Choosri, W.; Sygmund, Ch.; Halada, Petr; Haltrich, D.; Leitner, CH.
2014-01-01
Roč. 9, č. 6 (2014) E-ISSN 1932-6203 Grant - others:Austrian Science Foundation(AT) L 504-B11 Institutional support: RVO:61388971 Keywords : galactose oxidase * gene * Fusarium * gene expression Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014
Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.
Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine
2017-08-01
Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.
Cytokinin oxidase/dehydrogenase genes in barley and wheat. Cloning and heterologous expression
Czech Academy of Sciences Publication Activity Database
Galuszka, P.; Frébortová, Jitka; Werner, T.; Yamada, M.; Strnad, Miroslav; Schmülling, T.; Frébort, I.
2004-01-01
Roč. 271, č. 20 (2004), s. 3990-4002 ISSN 0014-2956 Institutional research plan: CEZ:AV0Z5038910 Keywords : cereals * cloning * cytokinin oxidase/dehydrogenase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.260, year: 2004
Ding, Kang; Wang, Yan; Jiang, Weimin; Zhang, Yu; Yin, Hongping; Fang, Zhuyuan
2015-03-25
Qian Yang Yu Yin Granule (QYYYG), a traditional Chinese herbal medicine, has been indicated for renal damage in hypertension for decades in China, but little remains known regarding its underlying molecular mechanism. Therefore, we performed the current study in order to investigate the underlying molecular mechanism of QYYYG in the treatment of hypertensive renal damage. We hypothesize that QYYYG relieves hypertensive renal injury through an angiotensin II (Ang II)-nicotinamide adenine dinucleotide phosphate (NAPDH)-oxidase (NOX)-reactive oxygen species (ROS) pathway. In this study, we investigated the effects of QYYYG-containing serum (QYGS) in human mesangial cells (HMCs) against Ang II-induced cell proliferation, ROS production, and inflammation through the seropharmacological method. We found that QYGS could inhibit cell proliferation in Ang II-treated HMCs. In addition, QYGS considerably suppressed production of ROS, decreased mRNA and protein expression of NAPDH-oxidase 4 (NOX4), p22 (phox) , and activated Ras-related C3 botulinum toxin substrate 1 (GTP-Rac1); as well as counteracted the up-regulation of inflammatory markers including tumor necrosis factor-α (TNF-α), nuclear factor-κB (NF-κB) p65, and interleukin 6 (IL-6). These effects were further confirmed in HMCs transfected with specific small interfering RNA (siRNA) targeting NOX4. Taken together, these results suggest that a NOX4-dependent pathway plays an important role in regulating the inhibitory effect of QYGS. Our findings provide new insights into the molecular mechanisms of QYYYG and their role in the treatment of hypertensive nephropathy.
Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne
2012-01-01
The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell
Regulated gene expression in cultured type II cells of adult human lung.
Ballard, Philip L; Lee, Jae W; Fang, Xiaohui; Chapin, Cheryl; Allen, Lennell; Segal, Mark R; Fischer, Horst; Illek, Beate; Gonzales, Linda W; Kolla, Venkatadri; Matthay, Michael A
2010-07-01
Alveolar type II cells have multiple functions, including surfactant production and fluid clearance, which are critical for lung function. Differentiation of type II cells occurs in cultured fetal lung epithelial cells treated with dexamethasone plus cAMP and isobutylmethylxanthine (DCI) and involves increased expression of 388 genes. In this study, type II cells of human adult lung were isolated at approximately 95% purity, and gene expression was determined (Affymetrix) before and after culturing 5 days on collagen-coated dishes with or without DCI for the final 3 days. In freshly isolated cells, highly expressed genes included SFTPA/B/C, SCGB1A, IL8, CXCL2, and SFN in addition to ubiquitously expressed genes. Transcript abundance was correlated between fetal and adult cells (r = 0.88), with a subset of 187 genes primarily related to inflammation and immunity that were expressed >10-fold higher in adult cells. During control culture, expression increased for 8.1% of expressed genes and decreased for approximately 4% including 118 immune response and 10 surfactant-related genes. DCI treatment promoted lamellar body production and increased expression of approximately 3% of probed genes by > or =1.5-fold; 40% of these were also induced in fetal cells. Highly induced genes (> or =10-fold) included PGC, ZBTB16, DUOX1, PLUNC, CIT, and CRTAC1. Twenty-five induced genes, including six genes related to surfactant (SFTPA/B/C, PGC, CEBPD, and ADFP), also had decreased expression during control culture and thus are candidates for hormonal regulation in vivo. Our results further define the adult human type II cell molecular phenotype and demonstrate that a subset of genes remains hormone responsive in cultured adult cells.
Angiotensin-II type 1 receptor gene polymorphism and diabetic microangiopathy
DEFF Research Database (Denmark)
Tarnow, L; Cambien, Francois; Rossing, P
1996-01-01
with proliferative retinopathy and without diabetic retinopathy was found either: 77 (50%) / 66 (42%) / 13 (8%) vs. 42 (63%) / 22 (33%) / 3 (4%) had AA/AC/CC genotypes, respectively. CONCLUSIONS: The A1166-->C polymorphism in the angiotensin-II type 1 receptor gene does not contribute to the genetic susceptibility...... is present particularly in vascular smooth muscle cells, myocardium and the kidney. A transversion of adenine to cytosine at nucleotide position 1166 in the gene coding for the angiotensin-II type 1 receptor has been associated with hypertension in the non-diabetic population. METHODS: We studied...... the relationship between the A1166-->C polymorphism in the angiotensin-II type 1 receptor gene in patients with insulin dependent diabetes mellitus (IDDM) and diabetic nephropathy (121 men, 77 women, age 41 +/- 10 years, diabetes duration 27 +/- 8 years) and in IDDM patients with normoalbuminuria (116 men, 74...
Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto
2015-09-01
Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with
Characterization of Two VAO-Type Flavoprotein Oxidases from Myceliophthora thermophila
Directory of Open Access Journals (Sweden)
Alessandro R. Ferrari
2018-01-01
Full Text Available The VAO flavoprotein family consists mostly of oxidoreductases harboring a covalently linked flavin cofactor. The linkage can be either monocovalent at position 8 with a histidine or tyrosine or bicovalent at position 8 with a histidine and at position 6 with a cysteine. Bicovalently bound flavoproteins show a preference for bulkier substrates such as oligosaccharides or secondary metabolites. The genome of the thermophilic fungus Myceliophthora thermophila C1 was found to be rich in genes encoding putative covalent VAO-type flavoproteins. Enzymes from this fungus have the advantage of being rather thermostable and homologous overexpression in M. thermophila C1 is feasible. Recently we discovered a new and VAO-type carbohydrate oxidase from this fungus: xylooligosaccharide oxidase. In this study, two other putative VAO-type oxidases, protein sequence XP_003663615 (MtVAO615 and XP_003665713 (MtVAO713, were expressed in M. thermophila C1, purified and characterized. Enzyme MtVAO615 was found to contain a bicovalently bound FAD, while enzyme MtVAO713 contained a monocovalent histidyl-bound FAD. The crystal structures of both proteins were obtained which revealed atypical active site architectures. It could be experimentally verified that both proteins, when reduced, rapidly react with molecular oxygen, a hallmark of flavoprotein oxidases. A large panel of alcohols, including carbohydrates, steroids and secondary alcohols were tested as potential substrates. For enzyme MtVAO713 low oxidase activity was discovered towards ricinoleic acid.
Regulated gene expression in cultured type II cells of adult human lung
Ballard, Philip L.; Lee, Jae W.; Fang, Xiaohui; Chapin, Cheryl; Allen, Lennell; Segal, Mark R.; Fischer, Horst; Illek, Beate; Gonzales, Linda W.; Kolla, Venkatadri; Matthay, Michael A.
2010-01-01
Alveolar type II cells have multiple functions, including surfactant production and fluid clearance, which are critical for lung function. Differentiation of type II cells occurs in cultured fetal lung epithelial cells treated with dexamethasone plus cAMP and isobutylmethylxanthine (DCI) and involves increased expression of 388 genes. In this study, type II cells of human adult lung were isolated at ∼95% purity, and gene expression was determined (Affymetrix) before and after culturing 5 days...
Glucose oxidase variants with improved properities
Fischer, Rainer; Ostafe, Raluca; Prodanovic, Radivoje
2014-01-01
Source: WO14173822A3 [EN] The technology provided herein relates to novel variants of microbial glucose oxidase with improved properties, more specifically to polypeptides having glucose oxidase activity as their major enzymatic activity; to nucleic acid molecules encoding said glucose oxidases; vectors and host cells containing the nucleic acids and methods for producing the glucose oxidase; compositions comprising said glucose oxidase; methods for the preparation and production of such enzy...
Dungan, Victoria J; Ortin, Yannick; Mueller-Bunz, Helge; Rutledge, Peter J
2010-04-07
Non-heme iron(II) oxidases (NHIOs) catalyse a diverse array of oxidative chemistry in Nature. As part of ongoing efforts to realize biomimetic, iron-mediated C-H activation, we report the synthesis of a new 'three-amine-one-carboxylate' ligand designed to complex with iron(II) and mimic the NHIO active site. The tetradentate ligand has been prepared as a single enantiomer in nine synthetic steps from N-Cbz-L-alanine, pyridine-2,6-dimethanol and diphenylamine, using Seebach oxazolidinone chemistry to control the stereochemistry. X-Ray crystal structures are reported for two important intermediates, along with variable temperature NMR experiments to probe the hindered interconversion of conformational isomers of several key intermediates, 2,6-disubstituted pyridine derivatives. The target ligand and an N-Cbz-protected precursor were each then complexed with iron(II) and tested for their ability to promote alkene dihydroxylation, using hydrogen peroxide as the oxidant.
Identification and characterization of the human type II collagen gene (COL2A1).
Cheah, Kathryn; Stoker, N.G.; Griffin, J.R.; Grosveld, Frank; Solomon, E.
1985-01-01
textabstractThe gene contained in the human cosmid clone CosHcol1, previously designated an alpha 1(I) collagen-like gene, has now been identified. CosHcol1 hybridizes strongly to a single 5.9-kilobase mRNA species present only in tissue in which type II collagen is expressed. DNA sequence analysis shows that this clone is highly homologous to the chicken alpha 1(II) collagen gene. These data together suggest that CosHcol1 contains the human alpha 1(II) collagen gene COL2A1. The clone appears...
Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten
2004-01-01
Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...
Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase
Gandara, Ana Caroline Paiva; Torres, Andr?; Bahia, Ana Cristina; Oliveira, Pedro L.; Schama, Renata
2017-01-01
Background NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not b...
Bragina, Olga; Gurjanova, Karina; Krishtal, Jekaterina; Kulp, Maria; Karro, Niina; Tõugu, Vello; Palumaa, Peep
2015-06-01
Metallothioneins (MT) are involved in a broad range of cellular processes and play a major role in protection of cells towards various stressors. Two functions of MTs, namely the maintaining of the homeostasis of transition metal ions and the redox balance, are directly linked to the functioning of mitochondria. Dyshomeostasis of MTs is often related with malfunctioning of mitochondria; however, the mechanism by which MTs affect the mitochondrial respiratory chain is still unknown. We demonstrated that overexpression of MT-2A in HEK cell line decreased the oxidative phosphorylation capacity of the cells. HEK cells overexpressing MT-2A demonstrated reduced oxygen consumption and lower cellular ATP levels. MT-2A did not affect the number of mitochondria, but reduced specifically the level of cytochrome c oxidase subunit II protein, which resulted in lower activity of the complex IV.
Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi
2012-01-01
Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.
Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.
Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori
2017-11-01
Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jianhong Chen
2010-01-01
Full Text Available Objective. To compare the difference of imprinting status of insulin-like growth factor II (IGF-II gene in villus between normal embryo development group and abnormal embryo development group and to investigate the relationship between karyotype and the imprinting status of IGF-II gene. Methods. A total of 85 pregnant women with singleton pregnancy were divided into two groups: one with abnormal embryo development (n=38 and the other with normal embryo development (n=47. Apa I polymorphism of IGF-II gene in chorionic villus was assayed with reverse transcriptase polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. The relationship between chromosomal abnormal karyotype and IGF-II gene imprinting status was analyzed by primary cell culture and G-banding chromosomal karyotype analysis. Results. IGF-II imprinting loss rate was higher in the abnormal embryo development group than the normal embryo development group (44.7% versus 31.6%, but without significant difference (P>.05. The percentage of abnormal chromosomes of chorionic villus in the abnormal embryo development group was 42.5%, in which IGF-II imprinting loss rate reached 64.7%. No abnormal karyotypes were found in the normal embryo development group. However, there was significant difference in IGF-II imprinting loss rate between two groups (P>.05. Conclusion. During weeks 6–10 of gestation, abnormal embryonic development is correlated with chromosomal abnormalities. The imprinting status of IGF-II gene played important roles in embryonic development, and imprinting loss might be related to chromosomal abnormalities.
Norrie disease gene is distinct from the monoamine oxidase genes
Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.
1989-01-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...
Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K
2000-06-01
Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.
Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth
2015-09-01
Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.
2016-01-01
Transition metal ions (Zn(II), Cu(II)/(I), Fe(III)/(II), Mn(II)) are essential for life and participate in a wide range of biological functions. Cellular Zn(II) levels must be high enough to ensure that it can perform its essential roles. Yet, since Zn(II) binds to ligands with high avidity, excess Zn(II) can lead to protein mismetallation. The major targets of mismetallation, and the underlying causes of Zn(II) intoxication, are not well understood. Here, we use a forward genetic selection to identify targets of Zn(II) toxicity. In wild-type cells, in which Zn(II) efflux prevents intoxication of the cytoplasm, extracellular Zn(II) inhibits the electron transport chain due to the inactivation of the major aerobic cytochrome oxidase. This toxicity can be ameliorated by depression of an alternate oxidase or by mutations that restrict access of Zn(II) to the cell surface. Conversely, efflux deficient cells are sensitive to low levels of Zn(II) that do not inhibit the respiratory chain. Under these conditions, intracellular Zn(II) accumulates and leads to heme toxicity. Heme accumulation results from dysregulation of the regulon controlled by PerR, a metal-dependent repressor of peroxide stress genes. When metallated with Fe(II) or Mn(II), PerR represses both heme biosynthesis (hemAXCDBL operon) and the abundant heme protein catalase (katA). Metallation of PerR with Zn(II) disrupts this coordination, resulting in depression of heme biosynthesis but continued repression of catalase. Our results support a model in which excess heme partitions to the membrane and undergoes redox cycling catalyzed by reduced menaquinone thereby resulting in oxidative stress. PMID:27935957
Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai
2014-01-01
A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.
Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes
Phil Kersten; Dan Cullen
2014-01-01
Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...
Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E
1992-01-01
Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
A broad distribution of the alternative oxidase in microsporidian parasites.
Directory of Open Access Journals (Sweden)
Bryony A P Williams
2010-02-01
Full Text Available Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX, a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1 as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes.
A cII-dependent promoter is located within the Q gene of bacteriophage lambda.
Hoopes, B C; McClure, W R
1985-01-01
We have found a cII-dependent promoter, PaQ, within the Q gene of bacteriophage lambda. Transcription experiments and abortive initiation assays performed in vitro showed that the promoter strength and the cII affinity of PaQ were comparable to the other cII-dependent lambda promoters, PE and PI. The location and leftward direction of PaQ suggests a possible role in the delay of lambda late-gene expression by cII protein, a phenomenon that has been called cII-dependent inhibition. We have con...
Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip
2017-01-01
The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship.
International Nuclear Information System (INIS)
Kowara, Renata; Karaczyn, Aldona; Cheng, Robert Y.S.; Salnikow, Konstantin; Kasprzak, Kazimierz S.
2005-01-01
B200 cells are Ni(II)-transformed mouse BALB/c-3T3 fibroblasts displaying a malignant phenotype and increased resistance to Ni(II) toxicity. In an attempt to find genes whose expression has been altered by the transformation, the Atlas Mouse Stress/Toxicology cDNA Expression Array (Clontech Laboratories, Inc., Palo Alto, CA) was used to analyze the levels of gene expression in both parental and Ni(II)-transformed cells. Comparison of the results revealed a significant up- or downregulation of the expression of 62 of the 588 genes present in the array (approximately 10.5%) in B200 cells. These genes were assigned to different functional groups, including transcription factors and oncogenes (9/14; fractions in parentheses denote the number of up-regulated versus the total number of genes assigned to this group), stress and DNA damage response genes (11/12), growth factors and hormone receptors (6/9), metabolism (7/7), cell adhesion (2/7), cell cycle (3/6), apoptosis (3/4), and cell proliferation (2/3). Among those genes, overexpression of beta-catenin and its downstream targets c-myc and cyclin D1, together with upregulated cyclin G, points at the malignant character of B200 cells. While the increased expression of glutathione (GSH) synthetase, glutathione-S-transferase A4 (GSTA4), and glutathione-S-transferase theta (GSTT), together with high level of several genes responding to oxidative stress, suggests the enforcement of antioxidant defenses in Ni-transformed cells
Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J
2014-01-01
Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.
Pils, D; Schmetterer, G
2001-09-25
Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.
Directory of Open Access Journals (Sweden)
Judith A. James
2012-12-01
Full Text Available Anthrax Lethal Toxin consists of Protective Antigen (PA and Lethal Factor (LF, and current vaccination strategies focus on eliciting antibodies to PA. In human vaccination, the response to PA can vary greatly, and the response is often directed toward non-neutralizing epitopes. Variable vaccine responses have been shown to be due in part to genetic differences in individuals, with both MHC class II and other genes playing roles. Here, we investigated the relative contribution of MHC class II versus non-MHC class II genes in the humoral response to PA and LF immunization using three immunized strains of inbred mice: A/J (H-2k at the MHC class II locus, B6 (H-2b, and B6.H2k (H-2k. IgG antibody titers to LF were controlled primarily by the MHC class II locus, whereas IgG titers to PA were strongly influenced by the non-MHC class II genetic background. Conversely, the humoral fine specificity of reactivity to LF appeared to be controlled primarily through non-MHC class II genes, while the specificity of reactivity to PA was more dependent on MHC class II. Common epitopes, reactive in all strains, occurred in both LF and PA responses. These results demonstrate that MHC class II differentially influences humoral immune responses to LF and PA.
Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E
2016-10-01
Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.
Crystallization of carbohydrate oxidase from Microdochium nivale
International Nuclear Information System (INIS)
Dušková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Štěpánková, Andrea; Hašek, Jindřich
2009-01-01
Industrially used carbohydrate oxidase was successfully crystallized in several forms, diffraction data suitable for structural analysis were collected. Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The enzyme crystallizes with varying crystal morphologies depending on the crystallization conditions. Several different crystal forms were obtained using the hanging-drop vapour-diffusion method, two of which were used for diffraction measurements. Hexagon-shaped crystals (form I) diffracted to 2.66 Å resolution, with unit-cell parameters a = b = 55.7, c = 610.4 Å and apparent space group P6 2 22. Analysis of the data quality showed almost perfect twinning of the crystals. Attempts to solve the structure by molecular replacement did not give satisfactory results. Recently, clusters of rod-shaped crystals (form II) were grown in a solution containing PEG MME 550. These crystals belonged to the monoclinic system C2, with unit-cell parameters a = 132.9, b = 56.6, c = 86.5 Å, β = 95.7°. Data sets were collected to a resolution of 2.4 Å. The structure was solved by the molecular-replacement method. Model refinement is currently in progress
Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo
2006-11-01
Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P times of posture change and standing up against walls were also higher than those in CC (P time in CC genotype puppies were higher than that in TT (P walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P open-field test and TT genotype has favorable effects in these behavior traits.
Stasia, Marie-José
2007-05-01
Chronic granulomatous disease (CGD) is a rare inherited disorder in which phagocytes lack NADPH oxidase activity. Patients with CGD suffer from recurrent bacterial and fungal infections because of the absence of superoxide anions (O2- degrees ) generatingsystem. The NADPH oxidase complex is composed of a membranous cytochrome b558, cytosolic proteins p67phox, p47phox, p40phox and two small GTPases Rac2 and Rap1A. Cytochrome b558 consists of two sub-units gp91phox and p22phox. The most common form of CGD is due to mutations in CYBB gene encoding gp91phox. In some rare cases, the mutated gp91phox is normally expressed but is devoided of oxidase activity. These variants called X+ CGD, have provided interesting informations about oxidase activation mechanisms. However modelization of such variants is necessary to obtain enough biological material for studies at the molecular level. A cellular model (knock-out PLB-985 cells) has been developed for expressing recombinant mutated gp91phox for functional analysis of the oxidase complex. Recent works demonstrated that this cell line genetically deficient in gp91phox is a powerful tool for functional analysis of the NADPH oxidase complex activation.
Norrie disease gene is distinct from the monoamine oxidase genes.
Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A
1989-09-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.
Oxidase-based biocatalytic processes
DEFF Research Database (Denmark)
Ramesh, Hemalata; Woodley, John; Krühne, Ulrich
interestingbiocatalystsbecause they use a mild oxidant (oxygen) as a substrateas opposed to their chemical counterparts which use strong oxidants such as permanganates. A class of oxidases calledmonoamine oxidases has been used as the central case study for the thesis. The rationale for choosing thissystemis that it has been...
Directory of Open Access Journals (Sweden)
Suriana
2012-08-01
Full Text Available The study was conducted to assess the characteristics of partial gene of cytochrome C oxidase subunit I (COI of wild silkmoth Cricula trifenestrata, and to detect the diagnostic sites from these gene for evaluation as species marker. A total of fifteen larvae of C. tifenestrata were collected from Bogor, Purwakarta, and Bantul Regencies. Genomic DNA was extracted from silk gland of individual larvae, then amplified by PCR method and sequenced. DNA sequencing was done to characterize their nucleotide and amino acid contents. The results showed that 595 nucleotides at the 5 ‘end of COI gene of C. tifenestrata was conserved at the species level, but varies at the family level. Nucleotide dominated by thymine and adenine bases (± 70%. There were 25 diagnostic sites for C. tifenestrata, and four diagnostic sites for genus level. One hundred eigthty nine (189 amino acids were alignment, and only one percent of the genes was varied among species. The 107th amino acid (valine and 138th (threonine were diagnostics amino acid for C. tifenestrata. Based on nucleotides and amino acids sequences, the phylogeny showed that C. tifenestrata lied on the same nodes with Antheraea, so the Saturniidae family is monophyletic.
Directory of Open Access Journals (Sweden)
Hoi-Sen Yong
Full Text Available The tephritid fruit fly Zeugodacus tau (Walker is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1 the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2 the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3 and 15835 bp for the China specimen (ZT1, with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes and a non-coding A + T-rich control region (D-loop. Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China and Z. tau ZT1 (China formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia. Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes instead of partial sequence is more appropriate for determining phylogenetic relationship.
Paulus, Angela; Rossius, Sebastiaan Gijsbertus Hendrik; Dijk, Madelon; de Vries, Simon
2012-01-01
The quinol-linked cytochrome bd oxidases are terminal oxidases in respiration. These oxidases harbor a low spin heme b558 that donates electrons to a binuclear heme b595/heme d center. The reaction with O2 and subsequent catalytic steps of the Escherichia coli cytochrome bd-I oxidase were investigated by means of ultra-fast freeze-quench trapping followed by EPR and UV-visible spectroscopy. After the initial binding of O2, the O–O bond is heterolytically cleaved to yield a kinetically competent heme d oxoferryl porphyrin π-cation radical intermediate (compound I) magnetically interacting with heme b595. Compound I accumulates to 0.75–0.85 per enzyme in agreement with its much higher rate of formation (∼20,000 s−1) compared with its rate of decay (∼1,900 s−1). Compound I is next converted to a short lived heme d oxoferryl intermediate (compound II) in a phase kinetically matched to the oxidation of heme b558 before completion of the reaction. The results indicate that cytochrome bd oxidases like the heme-copper oxidases break the O–O bond in a single four-electron transfer without a peroxide intermediate. However, in cytochrome bd oxidases, the fourth electron is donated by the porphyrin moiety rather than by a nearby amino acid. The production of reactive oxygen species by the cytochrome bd oxidase was below the detection level of 1 per 1000 turnovers. We propose that the two classes of terminal oxidases have mechanistically converged to enzymes in which the O–O bond is broken in a single four-electron transfer reaction to safeguard the cell from the formation of reactive oxygen species. PMID:22287551
Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.
2012-01-01
Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227
Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J
2012-12-14
Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism.
Directory of Open Access Journals (Sweden)
Laura A Nucci
Full Text Available Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients.Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0, and after 7 days (D7, N = 10 of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant.Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients.Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by changes in JAK-STAT modulation, had prominent changes in
International Nuclear Information System (INIS)
Wang, Chaoyun; He, Yanhao; Yang, Ming; Sun, Hongliu; Zhang, Shuping; Wang, Chunhua
2013-01-01
Intracellular reactive oxygen species (ROS) are derived from nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Angiotensin II (Ang II) can cause endothelial dysfunction by promoting intracellular ROS generation. Safflor yellow B (SYB) effectively inhibits ROS generation by upregulating Bcl-2 expression. In this study, we examined the effects of SYB on Ang II-induced injury to human umbilical vein endothelial cells (HUVECs), and elucidated the roles of NADPH oxidase and Bcl-2. We treated cultured HUVECs with Ang II, SYB, and Bcl-2 siRNA, and determined NADPH oxidase activity and ROS levels. Furthermore, cellular and mitochondrial physiological states were evaluated, and the expression levels of target proteins were analyzed. Ang II significantly enhanced intracellular ROS levels, caused mitochondrial membrane dysfunction, and decreased cell viability, leading to apoptosis. This was associated with increased expression of AT1R and p22 phox , increased NADPH oxidase activity, and an increased ratio of Bax/Bcl-2, leading to decreases in antioxidant enzyme activities, which were further strengthened after blocking Bcl-2. Compared to Ang II treatment alone, co-treatment with SYB significantly reversed HUVEC injury. Taken together, these results demonstrate that SYB could significantly protect endothelial cells from Ang II-induced cell damage, and that it does so by upregulating Bcl-2 expression and inhibiting ROS generation. - Highlights: • Angiotensin II depresses mitochondria physiological function. • Angiotensin II activates NADPH oxidase via up-regulating expresion of p22 phox . • Bcl-2 plays a pivotal role in improving mitochondria function and regulates ROS level. • Inhibitor of Bcl-2 promotes angiotensin II mediated HUVEC injury. • SYB attenuates angiotensin II mediated HUVEC injury via up regulating Bcl-2 expression
Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli
2013-07-01
Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
International Nuclear Information System (INIS)
Hou, Liyan; Zhang, Cong; Wang, Ke; Liu, Xiaofang; Wang, Hongwei; Che, Yuning; Sun, Fuqiang; Zhou, Xueying; Zhao, Xiulan; Wang, Qingshan
2017-01-01
Highlights: • Microglial activation induced by paraquat and maneb precedes noradrenergic neurodegeneration in locus coeruleus. • NADPH oxidase activation contributes to microglia-mediated neuroinflammation and related noradrenergic neurodegeneration. • Inhibition of NADPH oxidase by apocynin protects noradrenergic neurons against paraquat and maneb-induced toxicity. - Abstract: Co-exposure to paraquat (PQ) and maneb (Mb) has been shown to increase the risk of Parkinson’s disease (PD) and dopaminergic (DA) neurodegeneration in the substantia nigra pars compacta (SNpc) is observed in PQ and Mb-treated experimental animals. The loss of noradrenergic locus coeruleus (LC/NE) neurons in brainstem is a common feature shared by multiple neurodegenerative diseases, including PD. However, whether PQ and Mb is able to damage LC/NE neurons remains undefined. In this study, mice treated with combined PQ and Mb displayed progressive LC/NE neurodegeneration. Time course studies revealed that the activation of microglia preceded LC/NE neurodegeneration. Mechanistically, the activation of NADPH oxidase contributed to microglial activation and subsequent LC/NE neurodegeneration. We found that PQ and Mb co-exposure induced activation of NADPH oxidase as shown by increased superoxide production and membrane translocation of p47 phox , a cytosolic subunit of NADPH oxidase. Inhibition of NADPH oxidase by apocynin, a widely used NADPH oxidase inhibitor, suppressed microglial activation and gene expressions of proinflammatory factors. Furthermore, reduced activation of nuclear factor-κB (NF-κB) pathway was observed in apocynin-treated mice. More importantly, inhibition of NADPH oxidase by apocynin afforded LC/NE neuroprotection against PQ and Mb-induced neurotoxicity. Thus, our findings revealed the critical role NADPH oxidase-mediated microglial activation in driving LC/NE neurodegeneration induced by PQ and Mb, providing new insights into the pathogenesis of environmental
DNA sequence of the Peromyscus leucopus MHC class II gene Aa (MhcPeleAa)
Energy Technology Data Exchange (ETDEWEB)
Crew, M.D.; Bates, L.M. [Univ. of Arkansas for Medical Sciences, Little Rock, AR (United States)
1996-09-01
The genus Peromyscus has been extensively studied by populations biologists and ecologists for over eighty years, with P. leucopus (the white-footed mouse) being one of the most intensively investigated species. Polymorphic major histocompatibility complex (MHC) genes have proven useful in population genetic studies and might be helpful in understanding the population dynamics of Peromyscus species which are ubiquitously distributed over North and Central America. Polymorphism of P. leucopus MHC (MhcPele) class II genes was evident by restriction fragment length polymorphism (RFLP) analyses using human and mouse probes and Pele class II loci exhibited degrees of polymorphism similar to H2 class II genes (A-like>E-like). 8 refs., 2 figs.
Honda, Yuki; Hattori, Takasumi; Kirimura, Kohtaro
2012-03-01
The citric acid-producing filamentous fungus Aspergillus niger WU-2223L shows cyanide-insensitive respiration catalyzed by alternative oxidase in addition to the cytochrome pathway. Sequence analysis of the 5' flanking region of the alternative oxidase gene (aox1) revealed a potential heat shock element (HSE) and a stress response element (STRE). We have previously confirmed aox1 expression in conidia. In this study, to confirm whether the upstream region of aox1 responds to various stresses, we used a visual expression analysis system for single-cell conidia of the A. niger strain AOXEGFP-1. This strain harbored a fusion gene comprising aox1 and egfp, which encodes the enhanced green fluorescent protein (EGFP). The fluorescence intensity of EGFP increased in conidia of A. niger AOXEGFP-1 that were subjected to heat shock at 35-45 °C, oxidative stress by exposure to 5mM paraquat or 1 mM t-butylhydroperoxide, or osmotic stresses by exposure to 0.5 M KCl or 1.0 M mannitol. These results indicate that the putative HSE and STRE in the upstream region of aox1 directly or indirectly respond to heat shock, oxidative, and osmotic stresses. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Blume, B; Grierson, D
1997-10-01
The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
Exploring flavin-containing carbohydrate oxidases
Ferrari, Alessandro Renato
2017-01-01
Oxidases are enzymes capable of removing one or more electrons from their substrate and transfer them to molecular oxygen, forming hydrogen peroxide. Due to their high regio- and enantioselectivity, their use is preferred over traditional organic chemistry methods. Among the oxidases, flavoprotein
International Nuclear Information System (INIS)
Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong
2008-01-01
Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91 phox was dose-dependent. Meanwhile, the cytoplasmic subunit p47 phox was translocated to the cell membrane and localized with p22 phox and gp91 phox to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.
International Nuclear Information System (INIS)
Morishita, Hirotoshi; Kurita, Daisuke; Kataoka, Kunishige; Sakurai, Takeshi
2014-01-01
Highlights: • Proton transport pathway in bilirubin oxidase was mutated. • Two intermediates in the dioxygen reduction steps were trapped and characterized. • A specific glutamate for dioxygen reduction by multicopper oxidases was identified. - Abstract: The hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase is constructed with Glu463 and water molecules to transport protons for the four-electron reduction of dioxygen. Substitutions of Glu463 with Gln or Ala were attributed to virtually complete loss or significant reduction in enzymatic activities due to an inhibition of the proton transfer steps to dioxygen. The single turnover reaction of the Glu463Gln mutant afforded the highly magnetically interacted intermediate II (native intermediate) with a broad g = 1.96 electron paramagnetic resonance signal detectable at cryogenic temperatures. Reactions of the double mutants, Cys457Ser/Glu463Gln and Cys457Ser/Glu463Ala afforded the intermediate I (peroxide intermediate) because the type I copper center to donate the fourth electron to dioxygen was vacant in addition to the interference of proton transport due to the mutation at Glu463. The intermediate I gave no electron paramagnetic resonance signal, but the type II copper signal became detectable with the decay of the intermediate I. Structural and functional similarities between multicopper oxidases are discussed based on the present mutation at Glu463 in bilirubin oxidase
Energy Technology Data Exchange (ETDEWEB)
Morishita, Hirotoshi; Kurita, Daisuke; Kataoka, Kunishige; Sakurai, Takeshi, E-mail: tsakurai@se.kanazawa-u.ac.jp
2014-07-18
Highlights: • Proton transport pathway in bilirubin oxidase was mutated. • Two intermediates in the dioxygen reduction steps were trapped and characterized. • A specific glutamate for dioxygen reduction by multicopper oxidases was identified. - Abstract: The hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase is constructed with Glu463 and water molecules to transport protons for the four-electron reduction of dioxygen. Substitutions of Glu463 with Gln or Ala were attributed to virtually complete loss or significant reduction in enzymatic activities due to an inhibition of the proton transfer steps to dioxygen. The single turnover reaction of the Glu463Gln mutant afforded the highly magnetically interacted intermediate II (native intermediate) with a broad g = 1.96 electron paramagnetic resonance signal detectable at cryogenic temperatures. Reactions of the double mutants, Cys457Ser/Glu463Gln and Cys457Ser/Glu463Ala afforded the intermediate I (peroxide intermediate) because the type I copper center to donate the fourth electron to dioxygen was vacant in addition to the interference of proton transport due to the mutation at Glu463. The intermediate I gave no electron paramagnetic resonance signal, but the type II copper signal became detectable with the decay of the intermediate I. Structural and functional similarities between multicopper oxidases are discussed based on the present mutation at Glu463 in bilirubin oxidase.
Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio
2016-01-01
Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.
Ariyarathna, H A Chandima K; Oldach, Klaus H; Francki, Michael G
2016-01-19
Although the HKT transporter genes ascertain some of the key determinants of crop salt tolerance mechanisms, the diversity and functional role of group II HKT genes are not clearly understood in bread wheat. The advanced knowledge on rice HKT and whole genome sequence was, therefore, used in comparative gene analysis to identify orthologous wheat group II HKT genes and their role in trait variation under different saline environments. The four group II HKTs in rice identified two orthologous gene families from bread wheat, including the known TaHKT2;1 gene family and a new distinctly different gene family designated as TaHKT2;2. A single copy of TaHKT2;2 was found on each homeologous chromosome arm 7AL, 7BL and 7DL and each gene was expressed in leaf blade, sheath and root tissues under non-stressed and at 200 mM salt stressed conditions. The proteins encoded by genes of the TaHKT2;2 family revealed more than 93% amino acid sequence identity but ≤52% amino acid identity compared to the proteins encoded by TaHKT2;1 family. Specifically, variations in known critical domains predicted functional differences between the two protein families. Similar to orthologous rice genes on chromosome 6L, TaHKT2;1 and TaHKT2;2 genes were located approximately 3 kb apart on wheat chromosomes 7AL, 7BL and 7DL, forming a static syntenic block in the two species. The chromosomal region on 7AL containing TaHKT2;1 7AL-1 co-located with QTL for shoot Na(+) concentration and yield in some saline environments. The differences in copy number, genes sequences and encoded proteins between TaHKT2;2 homeologous genes and other group II HKT gene families within and across species likely reflect functional diversity for ion selectivity and transport in plants. Evidence indicated that neither TaHKT2;2 nor TaHKT2;1 were associated with primary root Na(+) uptake but TaHKT2;1 may be associated with trait variation for Na(+) exclusion and yield in some but not all saline environments.
Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette
2006-01-01
The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-03-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.
Role of pH in oxidase variability of Aeromonas hydrophila.
Hunt, L K; Overman, T L; Otero, R B
1981-01-01
Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...
A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.
Rogalski, T M; Riddle, D L
1988-01-01
The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.
Neves, A.R.; Ramos, A.; Costa, H.; Swam, van I.I.; Hugenholtz, J.; Kleerebezem, M.; Vos, de W.M.; Santos, H.
2002-01-01
Three isogenic strains of Lactococcus lactis with different levels of H2O-forming NADH oxidase activity were used to study the effect of oxygen on glucose metabolism: the parent strain L. lactis MG1363, a NOX- strain harboring a deletion of the gene coding for H2O-forming NADH oxidase, and a NOX
Isolated cytochrome c oxidase deficiency in G93A SOD1 mice overexpressing CCS protein.
Son, Marjatta; Leary, Scot C; Romain, Nadine; Pierrel, Fabien; Winge, Dennis R; Haller, Ronald G; Elliott, Jeffrey L
2008-05-02
G93A SOD1 transgenic mice overexpressing CCS protein develop an accelerated disease course that is associated with enhanced mitochondrial pathology and increased mitochondrial localization of mutant SOD1. Because these results suggest an effect of mutant SOD1 on mitochondrial function, we assessed the enzymatic activities of mitochondrial respiratory chain complexes in the spinal cords of CCS/G93A SOD1 and control mice. CCS/G93A SOD1 mouse spinal cord demonstrates a 55% loss of complex IV (cytochrome c oxidase) activity compared with spinal cord from age-matched non-transgenic or G93A SOD1 mice. In contrast, CCS/G93A SOD1 spinal cord shows no reduction in the activities of complex I, II, or III. Blue native gel analysis further demonstrates a marked reduction in the levels of complex IV but not of complex I, II, III, or V in spinal cords of CCS/G93A SOD1 mice compared with non-transgenic, G93A SOD1, or CCS/WT SOD1 controls. With SDS-PAGE analysis, spinal cords from CCS/G93A SOD1 mice showed significant decreases in the levels of two structural subunits of cytochrome c oxidase, COX1 and COX5b, relative to controls. In contrast, CCS/G93A SOD1 mouse spinal cord showed no reduction in levels of selected subunits from complexes I, II, III, or V. Heme A analyses of spinal cord further support the existence of cytochrome c oxidase deficiency in CCS/G93A SOD1 mice. Collectively, these results establish that CCS/G93A SOD1 mice manifest an isolated complex IV deficiency which may underlie a substantial part of mutant SOD1-induced mitochondrial cytopathy.
Directory of Open Access Journals (Sweden)
Sluse F.E.
1998-01-01
Full Text Available Plants and some other organisms including protists possess a complex branched respiratory network in their mitochondria. Some pathways of this network are not energy-conserving and allow sites of energy conservation to be bypassed, leading to a decrease of the energy yield in the cells. It is a challenge to understand the regulation of the partitioning of electrons between the various energy-dissipating and -conserving pathways. This review is focused on the oxidase side of the respiratory chain that presents a cyanide-resistant energy-dissipating alternative oxidase (AOX besides the cytochrome pathway. The known structural properties of AOX are described including transmembrane topology, dimerization, and active sites. Regulation of the alternative oxidase activity is presented in detail because of its complexity. The alternative oxidase activity is dependent on substrate availability: total ubiquinone concentration and its redox state in the membrane and O2 concentration in the cell. The alternative oxidase activity can be long-term regulated (gene expression or short-term (post-translational modification, allosteric activation regulated. Electron distribution (partitioning between the alternative and cytochrome pathways during steady-state respiration is a crucial measurement to quantitatively analyze the effects of the various levels of regulation of the alternative oxidase. Three approaches are described with their specific domain of application and limitations: kinetic approach, oxygen isotope differential discrimination, and ADP/O method (thermokinetic approach. Lastly, the role of the alternative oxidase in non-thermogenic tissues is discussed in relation to the energy metabolism balance of the cell (supply in reducing equivalents/demand in energy and carbon and with harmful reactive oxygen species formation.
Directory of Open Access Journals (Sweden)
Veerachat Muangsombut
2017-08-01
Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence
Glaberman, Scott; Moreno, Maria A; Caccone, Adalgisa
2009-08-01
Major histocompatibility complex (MHC) class II molecules play a key role in the adaptive immune system of vertebrates. Class II B genes appear to evolve in a very different manner in mammals and birds. Orthology is commonly observed among mammal loci, while genes tend to cluster phylogenetically within bird species. Here we present class II B data from a representative of another major group of amniotes, the squamates (i.e. lizards, snakes, amphisbaenians), with the ultimate goal of placing mammalian and avian MHC evolution into a broader context. In this study, eight class II B cDNA sequences were obtained from the Galápagos marine iguana (Amblyrhynchus cristatus) which were divided into five locus groups, Amcr-DAB1 through -DAB5, based on similarities along most of the coding and noncoding portions of the transcribed gene. All marine iguana sequences were monophyletic with respect to class II genes from other vertebrates indicating that they originated from a common ancestral locus after squamates split from other reptiles. The beta-1 domain, which is involved in antigen binding, exhibited signatures of positive selection as well as interlocus gene conversion in both long and short tracts-a pattern also observed in birds and fish, but not in mammals. On the other hand, the beta-2 domain was divergent between gene groups, which is characteristic of mammals. Based on these results, we preliminarily show that squamate class II B genes have been shaped by a unique blend of evolutionary forces that have been observed in differing degrees in other vertebrates.
International Nuclear Information System (INIS)
Gilmour, D.S.; Lis, J.T.
1986-01-01
By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation
Sytykiewicz, Hubert
2016-07-22
Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Manera, Matias; Miro, Manuel; Estela, Jose Manuel; Cerda, Victor
2004-01-01
In this paper, enzyme containing reactors are for the first time implemented in the multisyringe flow injection analysis (MSFIA) technique interfaced with chemiluminescence detection for biochemical assays. The automated methodology is based on the on-line substrate conversion in an oxidase packed-bed reactor and the post-column chemiluminogenic catalysed-reaction of the generated oxidising species with an organic molecule (namely, 3-aminophthalhydrazide) in front of the photosensor module. Various catalysts in homogeneous phase are compared taking advantage of the benefits of the MSFIA concept. On one hand, mineral catalysts (namely, Co(II)) are assessed, on the other hand, minute and accurate volumes of soluble organic species (viz., horseradish peroxidase (HRP)) are readily handled without requiring further immobilization protocols. The potentials of the MSFIA-CL concept with immobilisation of the proper oxidase protein are demonstrated using glucose as a model of substrate. Despite the different pH and kinetic requirements for both the substrate conversion in the enzyme-reactor and the Co(II)/HRP-mediated luminol oxidation integrated in the flow system, the MSFIA approach warrants maximum yields owing to the independent optimisation of the physical and chemical parameters of the various reactions involved. Under the optimised configurations and experimental variables, dynamic working ranges from 2.5x10 -6 to 1.0x10 -3 mol l -1 glucose may be obtained for both detection schemes by proper photomultiplier gain selection. The detection and determination limits calculated at the 3σ and 10σ level were 8.6x10 -7 and 2.0x10 -6 mol l -1 glucose, respectively, for the Co(II)-luminol system, and 1.3x10 -6 and 2.3x10 -6 mol l -1 glucose, respectively, for the HRP-luminol procedure. The repeatability (n=10) at the 1.0x10 -5 mol l -1 level was slightly better for the Co(II)-catalysed reaction (2.5% versus 4.0%). The developed MSFIA-CL methodology was used for kinetic
SVMRFE based approach for prediction of most discriminatory gene target for type II diabetes
Directory of Open Access Journals (Sweden)
Atul Kumar
2017-06-01
Full Text Available Type II diabetes is a chronic condition that affects the way our body metabolizes sugar. The body's important source of fuel is now becoming a chronic disease all over the world. It is now very necessary to identify the new potential targets for the drugs which not only control the disease but also can treat it. Support vector machines are the classifier which has a potential to make a classification of the discriminatory genes and non-discriminatory genes. SVMRFE a modification of SVM ranks the genes based on their discriminatory power and eliminate the genes which are not involved in causing the disease. A gene regulatory network has been formed with the top ranked coding genes to identify their role in causing diabetes. To further validate the results pathway study was performed to identify the involvement of the coding genes in type II diabetes. The genes obtained from this study showed a significant involvement in causing the disease, which may be used as a potential drug target.
Directory of Open Access Journals (Sweden)
Makkonen J.
2015-01-01
Full Text Available The IUCN Red List indexes the noble crayfish (Astacus astacus as vulnerable, with a declining population trend. The main threats to the species are the crayfish plague caused by the oomycete Aphanomyces astaci and the introduced North American crayfish that act as the carriers of this disease. In Finland, the noble crayfish is considered as a native species, which original distribution area covers the southern part of the country, but the species distribution has been dispersed to cover almost the whole country. The aim of this study was to survey the genetic diversity among the Finnish noble crayfish populations. The mitochondrial cytochrome oxidase I (COI-gene was sequenced from 742 individuals representing 59 populations from Finland and Estonia. As a result, only a single haplotype was found. Based on these results, the genetic diversity of noble crayfish in its Northern distribution range is remarkably low. The observed lack of variation can result from several mechanisms including small size of the founder population and the intense spreading of the species by manmade stockings. The restricted diversity can also be caused by eradication of the original populations due to crayfish plague epidemics and spreading of the invasive crayfish species carrying the crayfish plague. It is also possible that all contemporary Finnish noble crayfish populations originate from stockings with no variation in respect to COI-gene.
Energy Technology Data Exchange (ETDEWEB)
Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Park, Ji-hoon [Department of Biochemistry, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Kim, Soon Ha, E-mail: shakim@lgls.com [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of)
2012-08-15
Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.
Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo
2013-07-01
The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer
2009-01-01
The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...
Energy Technology Data Exchange (ETDEWEB)
Johnson, J.L.; Rajagopalan, K.V. (Duke Univ. Medical Center, Durham, NC (USA)); London, R.E. (National Institute of Environmental Health Science, Research Triangle Park, NC (USA))
1989-09-01
The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and {sup 31}P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well.
International Nuclear Information System (INIS)
Johnson, J.L.; Rajagopalan, K.V.; London, R.E.
1989-01-01
The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and 31 P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well
Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers
Directory of Open Access Journals (Sweden)
Pattana Srifah Huehne
2013-08-01
Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
DEFF Research Database (Denmark)
Hezel, M.; Peleli, Maria; Liu, M.
2016-01-01
. Finally, nitrate treatment in aged rats normalized the gene expression profile of ANG II receptors (AT1A, AT2, AT1A/AT2 ratio) in the renal and cardiovascular systems without altering plasma levels of renin or ANG II. Our results show that boosting the nitrate-nitrite-NO pathway can partly compensate...... that increased angiotensin II (ANG II) signaling is also implicated in the pathogenesis of endothelial dysfunction and hypertension by accelerating formation of reactive oxygen species. This study was designed to test the hypothesis that dietary nitrate supplementation could reduce blood pressure and improve...... glucose tolerance in aged rats, via attenuation of NADPH oxidase activity and ANG II receptor signaling. Dietary nitrate supplementation for two weeks reduced blood pressure (10–15 mmHg) and improved glucose clearance in old, but not in young rats. These favorable effects were associated with increased...
Polyphenol Oxidase Enzyme and Inactivation Methods
Directory of Open Access Journals (Sweden)
Leman Yılmaz
2018-03-01
Full Text Available Polyphenol oxidase enzyme is found in vegetables and fruits, as well as in some animal organs and microorganisms. Polyphenol oxidase enzyme responsible for enzymatic browning is a group of copper proteins that catalyses the oxidation of phenolic compounds to quinones, which produce brown pigments, commonly found in fruits and vegetables. During the industrial preparation of fruits and vegetables, results of catalytic effect of polyphenol oxidase causes enzymatic browning. Enzymatic browning impairs the appearance of products containing phenolic compounds along with undesirable colour, odor and taste formation and significant loss of nutritional value of the products. This affects the acceptability of the products by the consumers and causes economic losses. In this review, some characteristics of polyphenol oxidase enzyme in different fruits and vegetables have been reviewed and information about chemical antibrowning agents, thermal applications, irradiation applications and alternative methods such as high pressure processing, pulse electric field, supercritical carbon dioxide and ultrasound applications to inactivate this enzyme has been presented.
Institute of Scientific and Technical Information of China (English)
LI; Chijun; (
2001-01-01
[1]Liang, Z., Liang, H. G., The respiratory metabolism of plants, in Plant Physiology and Molecular Biology (eds. Yu, S. W., Tang, Z. C.) (in Chinese), 2nd ed., Beijing: Science Press, 1998, 344-365.[2]Lü, C. S., Liang, H. G., Induced respiration in melon fruits, Scientia Sinica, 1963, 12(4): 616.[3]Liang, H. G., Lü, C. S., A comparative study of CN-resistant respiration in different cultures of tobacco callus, Plant Physiol., 1984, 75: 876.[4]Elthon, T. E., McIntosh, L., Identification of the alternative terminal oxidase of higher plant mitochondria, Proc. Natl. Acad. Sci. USA, 1987, 84: 8399.[5]Elthon, T. E., Nickels, R. L., McIntosh, L., Monoclonal antibodies to the alternative oxidase of higher plant mitochondria, Plant Physiol., 1989, 89: 1311.[6]Liang, W. S., Liang, H. G., Progress of the alternative oxidase, Chinese Bulletin of Botany (in Chinese), 1997, 14(2): 9.[7]Liang, W. S., Liang, H. G., Induction of alternative oxidase expression by endogenous ethylene in aging potato slices, Acta Phytophysiol. Sin. (in Chinese), 1999, 25(2): 205.[8]He, J. X., Wei, Z. Q., Liang, H. G., Effects of water stress on development, and operation and gene expression of cyanide-resistant respiratory pathway in wheat, Science in China, Ser. C, 1999, 42(3): 300.[9]McIntosh, L., Molecular biology of the alternative oxidase, Plant Physiol., 1994, 105: 781.[10] Wang, J., Zhang, L. X., Liu, Z. L. et al., A possible calcium binding site in D1 protein: A fluorescence and FTIR study of the interaction between lanthanides and a synthetic peptide, Photosynthesis Research, 1995, 44: 297.[11] Li, X. P., Du, L. F., Liang, H. G. et al., Preparation and identification of antidodecapeptide of polypeptide D1 or photosys-tem II reaction center, Prog. Biochem. Biophys. (in Chinese), 1997, 24(3): 283.[12] Wen, J. Q., Liang, H. G., Studies on energy status and mitochondria respiration during growth and senescence of mung bean cotyledons, Physiol
Characterization of class II alpha genes and DLA-D region allelic associations in the dog.
Sarmiento, U M; Storb, R F
1988-10-01
Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the alpha genes of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (BamHI, EcoRI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I and Bgl II), separated by agarose gel electrophoresis and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabelled HLA cDNA probes corresponding to DQ, DP, DZ and DR alpha genes. Clear evidence was obtained for the canine homologues of DQ and DR alpha genes with simple bi- or tri-allelic polymorphism respectively. Evidence for a single, nonpolymorphic DP alpha gene was also obtained. However, the presence of a DZ alpha gene could not be clearly demonstrated in canine genomic DNA. This report extends our previous RFLP analysis documenting polymorphism of DLA class II beta genes in the same panel of homozygous typing cell dogs, and provides the basis for DLA-D genotyping at a population level. This study also characterizes the RFLP-defined preferential allelic associations across the DLA-D region in nine different homozygous typing cell specificities.
Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm
Xu, Wei; Liao, Yalin
2017-12-01
Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.
Rathinam, T; Gadde, U; Chapman, H D
2015-07-01
Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.
Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.
Hinkkanen, A; Maly, F E; Decker, K
1983-04-01
The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.
Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E
2013-09-10
Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.
Adventitial gene transfer of catalase attenuates angiotensin II-induced vascular remodeling.
Liu, Cun-Fei; Zhang, Jia; Shen, Kai; Gao, Ping-Jin; Wang, Hai-Ya; Jin, Xin; Meng, Chao; Fang, Ning-Yuan
2015-04-01
Vascular adventitia and adventitia‑derived reactive oxygen species (ROS) contribute to vascular remodeling following vascular injury. A previous ex vivo study in adventitial fibroblasts showed that catalase, one of most important anti‑oxide enzymes, was downregulated by angiotensin II (AngII). The aim of the present study was to investigate whether adventitial gene transfer of catalase affects AngII‑induced vascular remodeling in vivo. Adenoviruses co‑expressing catalase and enhanced green fluorescent protein (eGFP) or expressing eGFP only were applied to the adventitial surface of common carotid arteries of Sprague‑Dawley rats. Alzet minipumps administering AngII (0.75 mg/kg/day) were then implanted subcutaneously for 14 days. Systolic blood pressure and biological parameters of vascular remodeling were measured in each group. Adventitial fibroblasts were cultured and p38 mitogen‑activated protein kinase (MAPK) phosphorylation was measured using western blot analysis. The results showed that adventitial gene transfer of catalase had no effect on AngII‑induced systolic blood pressure elevation. However, catalase adenovirus transfection significantly inhibited AngII‑induced media hypertrophy compared with that of the control virus (Padventitial α‑smooth muscle actin expression. Furthermore, catalase transfection significantly inhibited the AngII‑induced increase in p38MAPK phosphorylation. In conclusion, the results of the present study demonstrated that adventitial gene transfer of catalase significantly attenuated AngII‑induced vascular remodeling in rats via inhibition of adventitial p38MAPK phosphorylation.
Vargas, Teodoro; Moreno-Rubio, Juan; Herranz, Jesús; Cejas, Paloma; Molina, Susana; González-Vallinas, Margarita; Mendiola, Marta; Burgos, Emilio; Aguayo, Cristina; Custodio, Ana B.; Machado, Isidro; Ramos, David; Gironella, Meritxell; Espinosa-Salinas, Isabel; Ramos, Ricardo; Martín-Hernández, Roberto; Risueño, Alberto; De Las Rivas, Javier; Reglero, Guillermo; Yaya, Ricardo; Fernández-Martos, Carlos; Aparicio, Jorge; Maurel, Joan; Feliu, Jaime; de Molina, Ana Ramírez
2015-01-01
Lipid metabolism plays an essential role in carcinogenesis due to the requirements of tumoral cells to sustain increased structural, energetic and biosynthetic precursor demands for cell proliferation. We investigated the association between expression of lipid metabolism-related genes and clinical outcome in intermediate-stage colon cancer patients with the aim of identifying a metabolic profile associated with greater malignancy and increased risk of relapse. Expression profile of 70 lipid metabolism-related genes was determined in 77 patients with stage II colon cancer. Cox regression analyses using c-index methodology was applied to identify a metabolic-related signature associated to prognosis. The metabolic signature was further confirmed in two independent validation sets of 120 patients and additionally, in a group of 264 patients from a public database. The combined analysis of these 4 genes, ABCA1, ACSL1, AGPAT1 and SCD, constitutes a metabolic-signature (ColoLipidGene) able to accurately stratify stage II colon cancer patients with 5-fold higher risk of relapse with strong statistical power in the four independent groups of patients. The identification of a group of 4 genes that predict survival in intermediate-stage colon cancer patients allows delineation of a high-risk group that may benefit from adjuvant therapy, and avoids the toxic and unnecessary chemotherapy in patients classified as low-risk group. PMID:25749516
Polyphyly and gene flow between non-sibling Heliconius species
Directory of Open Access Journals (Sweden)
Jiggins Chris D
2006-04-01
Full Text Available Abstract Background The view that gene flow between related animal species is rare and evolutionarily unimportant largely antedates sensitive molecular techniques. Here we use DNA sequencing to investigate a pair of morphologically and ecologically divergent, non-sibling butterfly species, Heliconius cydno and H. melpomene (Lepidoptera: Nymphalidae, whose distributions overlap in Central and Northwestern South America. Results In these taxa, we sequenced 30–45 haplotypes per locus of a mitochondrial region containing the genes for cytochrome oxidase subunits I and II (CoI/CoII, and intron-spanning fragments of three unlinked nuclear loci: triose-phosphate isomerase (Tpi, mannose-6-phosphate isomerase (Mpi and cubitus interruptus (Ci genes. A fifth gene, dopa decarboxylase (Ddc produced sequence data likely to be from different duplicate loci in some of the taxa, and so was excluded. Mitochondrial and Tpi genealogies are consistent with reciprocal monophyly, whereas sympatric populations of the species in Panama share identical or similar Mpi and Ci haplotypes, giving rise to genealogical polyphyly at the species level despite evidence for rapid sequence divergence at these genes between geographic races of H. melpomene. Conclusion Recent transfer of Mpi haplotypes between species is strongly supported, but there is no evidence for introgression at the other three loci. Our results demonstrate that the boundaries between animal species can remain selectively porous to gene flow long after speciation, and that introgression, even between non-sibling species, can be an important factor in animal evolution. Interspecific gene flow is demonstrated here for the first time in Heliconius and may provide a route for the transfer of switch-gene adaptations for Müllerian mimicry. The results also forcefully demonstrate how reliance on a single locus may give an erroneous picture of the overall genealogical history of speciation and gene flow.
Cytochrome oxidase assembly does not require catalytically active cytochrome C.
Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander
2003-03-14
Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.
Ghanem, S
2011-01-01
In an attempt to clone the ORF of the nptII gene of Escherichia coli K12 (ATCC 10798), two degenerate primers were designed based on the nptII sequence of its Tn5 transposon. The nptII ORF was placed under the control of the E. coli hybrid trc promoter, in the pKK388-1 vector, transformed into E. coli DH5α ΔrecA (recombinant, deficient strain). Transferred cells were tested for ampicillin, tetracycline, kanamycin, neomycin, geneticin, paromomycin, penicillin, and UV resistance. The neomycin phosphotransferase gene of E. coli was cloned successfully and conferred kanamycin, neomycin, geneticin, and paromomycin resistance to recombinant DH5α; this did not inhibit insertion of additional antibiotic resistance against ampicillin and tetracycline, meaning the trc promoter can express two different genes carried by two different plasmids harbored in the same cell. This resistance conferral process could be considered as an emulation of horizontal gene transfer occurring in nature and would be a useful tool for understanding mechanisms of evolution of multidrug-resistant strains.
Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.
Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H
2008-10-05
Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.
DEFF Research Database (Denmark)
Andreou, Dimitrios; Saetre, Peter; Werge, Thomas
2012-01-01
The D-amino acid oxidase activator (DAOA) protein regulates the function of D-amino oxidase (DAO), an enzyme that catalyzes the oxidative deamination of D-3,4-dihydroxyphenylalanine (D-DOPA) and D-serine. D-DOPA is converted to L-3,4-DOPA, a precursor of dopamine, whereas D-serine participates...... in glutamatergic transmission. We hypothesized that DAOA polymorphisms are associated with dopamine, serotonin and noradrenaline turnover in the human brain. Four single-nucleotide polymorphisms, previously reported to be associated with schizophrenia, were genotyped. Cerebrospinal fluid (CSF) samples were drawn...... by lumbar puncture, and the concentrations of the major dopamine metabolite homovanillic acid (HVA), the major serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) and the major noradrenaline metabolite 3-methoxy-4-hydroxyphenylglycol (MHPG) were measured. Two of the investigated polymorphisms, rs...
Confirmation of a blocked amino terminus of sulfhydryl oxidase
International Nuclear Information System (INIS)
Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E.
1990-01-01
The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with [ 14 C]iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 (± 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked
Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak
Directory of Open Access Journals (Sweden)
Marić Slađana
2005-01-01
Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.
Immobilization of oxidases and their analytical applications
International Nuclear Information System (INIS)
Yasinzai, M.
2007-01-01
Immobilized enzymes are replacing their soluble counter-parts in nearly every field of application. These enzyme modifications have evolved from a research curiosity into an entire branch of Biotechnology. An immobilization method for flavin containing oxidases and their use in flow injection system is described. An electrochemical detector for H/sub 2/O/sub 2/ is assembled which is used effectively for the determination of glucose using more common glucose oxidase and the simultaneous determination of sugars. The combination of oxidases with hydrolases have been used for the determination of maltose and starch. (author)
Bastien, C.; Machlin, S.; Zhang, Y.; Donaldson, K.; Hanson, R. S.
1989-01-01
Restriction maps of genes required for the synthesis of active methanol dehydrogenase in Methylobacterium organophilum XX and Methylobacterium sp. strain AM1 have been completed and compared. In these two species of pink-pigmented, type II methylotrophs, 15 genes were identified that were required for the expression of methanol dehydrogenase activity. None of these genes were required for the synthesis of the prosthetic group of methanol dehydrogenase, pyrroloquinoline quinone. The structural gene required for the synthesis of cytochrome cL, an electron acceptor uniquely required for methanol dehydrogenase, and the genes encoding small basic peptides that copurified with methanol dehydrogenases were closely linked to the methanol dehydrogenase structural genes. A cloned 22-kilobase DNA insert from Methylsporovibrio methanica 81Z, an obligate type II methanotroph, complemented mutants that contained lesions in four genes closely linked to the methanol dehydrogenase structural genes. The methanol dehydrogenase and cytochrome cL structural genes were found to be transcribed independently in M. organophilum XX. Only two of the genes required for methanol dehydrogenase synthesis in this bacterium were found to be cotranscribed. PMID:16348074
NADPH Oxidases: Progress and Opportunities
San Martin, Alejandra; Griendling, Kathy K.
2014-01-01
From the initial discovery in 1999 that NADPH oxidases comprise a family of enzymes to our current focus on drug development to treat multiple pathologies related to this enzyme family, progress has been swift and impressive. We have expanded our understanding of the extent of the family, the basic enzymatic biochemistry, the multiple cellular functions controlled by NADPH oxidases, and their varied roles in physiology and diseases. We have developed numerous cell culture tools, animal models...
Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M
2009-01-01
Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.
Murphy, Shawn P; Holtz, Renae; Lewandowski, Nicole; Tomasi, Thomas B; Fuji, Hiroshi
2002-09-15
MHC class II (Ia) Ag expression is inversely correlated with tumorigenicity and directly correlated with immunogenicity in clones of the mouse L1210 lymphoma (1 ). Understanding the mechanisms by which class II Ag expression is regulated in L1210 lymphoma may facilitate the development of immunotherapeutic approaches for the treatment of some types of lymphoma and leukemia. This study demonstrates that the variation in MHC class II Ag expression among clones of L1210 lymphoma is due to differences in the expression of the class II transactivator (CIITA). Analysis of stable hybrids suggests that CIITA expression is repressed by a dominant mechanism in class II-negative L1210 clones. DNA-alkylating agents such as ethyl methanesulfonate and the chemotherapeutic drug melphalan activate CIITA and class II expression in class II negative L1210 cells, and this effect appears to be restricted to transformed cell lines derived from the early stages of B cell ontogeny. Transient transfection assays demonstrated that the CIITA type III promoter is active in class II(-) L1210 cells, despite the fact that the endogenous gene is not expressed, which suggests that these cells have all of the transacting factors necessary for CIITA transcription. An inverse correlation between methylation of the CIITA transcriptional regulatory region and CIITA expression was observed among L1210 clones. Furthermore, 5-azacytidine treatment activated CIITA expression in class II-negative L1210 cells. Collectively, our results suggest that 1) CIITA gene expression is repressed in class II(-) L1210 cells by methylation of the CIITA upstream regulatory region, and 2) treatment with DNA-alkylating agents overcomes methylation-based silencing of the CIITA gene in L1210 cells.
Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan
2012-12-01
Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
Directory of Open Access Journals (Sweden)
Barbaro Michela
2013-01-01
Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.
Directory of Open Access Journals (Sweden)
van der Meijde Jolanda
2007-08-01
Full Text Available Abstract Background Fasting has dramatic effects on small intestinal transport function. However, little is known on expression of intestinal transport and phase I/II metabolism genes during fasting and the role the fatty acid-activated transcription factor PPARα may play herein. We therefore investigated the effects of fasting on expression of these genes using Affymetrix GeneChip MOE430A arrays and quantitative RT-PCR. Results After 24 hours of fasting, expression levels of 33 of the 253 analyzed transporter and phase I/II metabolism genes were changed. Upregulated genes were involved in transport of energy-yielding molecules in processes such as glycogenolysis (G6pt1 and mitochondrial and peroxisomal oxidation of fatty acids (Cact, Mrs3/4, Fatp2, Cyp4a10, Cyp4b1. Other induced genes were responsible for the inactivation of the neurotransmitter serotonin (Sert, Sult1d1, Dtd, Papst2, formation of eicosanoids (Cyp2j6, Cyp4a10, Cyp4b1, or for secretion of cholesterol (Abca1 and Abcg8. Cyp3a11, typically known because of its drug metabolizing capacity, was also increased. Fasting had no pronounced effect on expression of phase II metabolic enzymes, except for glutathione S-transferases which were down-regulated. Time course studies revealed that some genes were acutely regulated, whereas expression of other genes was only affected after prolonged fasting. Finally, we identified 8 genes that were PPARα-dependently upregulated upon fasting. Conclusion We have characterized the response to fasting on expression of transporters and phase I/II metabolic enzymes in murine small intestine. Differentially expressed genes are involved in a variety of processes, which functionally can be summarized as a increased oxidation of fat and xenobiotics, b increased cholesterol secretion, c increased susceptibility to electrophilic stressors, and d reduced intestinal motility. This knowledge increases our understanding of gut physiology, and may be of relevance
Kirschner, Doris B; vom Baur, Elmar; Thibault, Christelle; Sanders, Steven L; Gangloff, Yann-Gaël; Davidson, Irwin; Weil, P Anthony; Tora, Làszlò
2002-05-01
The RNA polymerase II transcription factor TFIID, composed of the TATA-binding protein (TBP) and TBP-associated factors (TAF(II)s), nucleates preinitiation complex formation at protein-coding gene promoters. SAGA, a second TAF(II)-containing multiprotein complex, is involved in transcription regulation in Saccharomyces cerevisiae. One of the essential protein components common to SAGA and TFIID is yTAF(II)25. We define a minimal evolutionarily conserved 91-amino-acid region of TAF(II)25 containing a histone fold domain that is necessary and sufficient for growth in vivo. Different temperature-sensitive mutations of yTAF(II)25 or chimeras with the human homologue TAF(II)30 arrested cell growth at either the G(1) or G(2)/M cell cycle phase and displayed distinct phenotypic changes and gene expression patterns. Immunoprecipitation studies revealed that TAF(II)25 mutation-dependent gene expression and phenotypic changes correlated at least partially with the integrity of SAGA and TFIID. Genome-wide expression analysis revealed that the five TAF(II)25 temperature-sensitive mutant alleles individually affect the expression of between 18 and 33% of genes, whereas taken together they affect 64% of all class II genes. Thus, different yTAF(II)25 mutations induce distinct phenotypes and affect the regulation of different subsets of genes, demonstrating that no individual TAF(II) mutant allele reflects the full range of its normal functions.
Hossain, Ekhtear; Anand-Srivastava, Madhu B
2017-08-01
We previously showed that augmented levels of endogenous angiotensin II (AngII) contribute to vascular smooth muscle cell (VSMC) hypertrophy through the transactivation of growth factor receptors in spontaneously hypertensive rats. Resveratrol (RV), a polyphenolic component of red wine, has also been shown to attenuate AngII-evoked VSMC hypertrophy; however, the molecular mechanism mediating this response is obscure. The present study was therefore undertaken to examine whether RV could prevent AngII-induced VSMC hypertrophy through the transactivation of growth factor receptor and associated signaling pathways. AngII treatment of VSMC enhanced the protein synthesis that was attenuated towards control levels by RV pretreatment as well as by the inhibitors of NADPH oxidase, c-Src, and growth factor receptors. Furthermore, RV pretreatment also inhibited enhanced levels of superoxide anion, NADPH oxidase activity, increased expression of NADPH oxidase subunits, and phosphorylation of c-Src, EGF-R, PDGE-R, ERK1/2, and AKT1/2. In conclusion, these results indicate that RV attenuates AngII-induced VSMC hypertrophy through the inhibition of enhanced oxidative stress and activation of c-Src, growth factor receptors, and MAPK/AKT signaling. We suggest that RV could be used as a therapeutic agent in the treatment of vascular complications associated with hypertension and hypertrophy.
dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C
2007-02-01
Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.
Govindarajan, Rangaswamy; Posey, James; Chao, Calvin Y; Lu, Ruixiao; Jadhav, Trafina; Javed, Ahmed Y; Javed, Awais; Mahmoud, Fade A; Osarogiagbon, Raymond U; Manne, Upender
2016-06-18
African American (AA) colon cancer patients have a worse prognosis than Caucasian (CA) colon cancer patients, however, reasons for this disparity are not well understood. To determine if tumor biology might contribute to differential prognosis, we measured recurrence risk and gene expression using the Oncotype DX® Colon Cancer Assay (12-gene assay) and compared the Recurrence Score results and gene expression profiles between AA patients and CA patients with stage II colon cancer. We retrieved demographic, clinical, and archived tumor tissues from stage II colon cancer patients at four institutions. The 12-gene assay and mismatch repair (MMR) status were performed by Genomic Health (Redwood City, California). Student's t-test and the Wilcoxon rank sum test were used to compare Recurrence Score data and gene expression data from AA and CA patients (SAS Enterprise Guide 5.1). Samples from 122 AA and 122 CA patients were analyzed. There were 118 women (63 AA, 55 CA) and 126 men (59 AA, 67 CA). Median age was 66 years for AA patients and 68 for CA patients. Age, gender, year of surgery, pathologic T-stage, tumor location, the number of lymph nodes examined, lymphovascular invasion, and MMR status were not significantly different between groups (p = 0.93). The mean Recurrence Score result for AA patients (27.9 ± 12.8) and CA patients (28.1 ± 11.8) was not significantly different and the proportions of patients with high Recurrence Score values (≥41) were similar between the groups (17/122 AA; 15/122 CA). None of the gene expression variables, either single genes or gene groups (cell cycle group, stromal group, BGN1, FAP, INHBA1, Ki67, MYBL2, cMYC and GADD45B), was significantly different between the racial groups. After controlling for clinical and pathologic covariates, the means and distributions of Recurrence Score results and gene expression profiles showed no statistically significant difference between patient groups. The distribution of
International Nuclear Information System (INIS)
Govindarajan, Rangaswamy; Posey, James; Chao, Calvin Y.; Lu, Ruixiao; Jadhav, Trafina; Javed, Ahmed Y.; Javed, Awais; Mahmoud, Fade A.; Osarogiagbon, Raymond University; Manne, Upender
2016-01-01
African American (AA) colon cancer patients have a worse prognosis than Caucasian (CA) colon cancer patients, however, reasons for this disparity are not well understood. To determine if tumor biology might contribute to differential prognosis, we measured recurrence risk and gene expression using the Oncotype DX® Colon Cancer Assay (12-gene assay) and compared the Recurrence Score results and gene expression profiles between AA patients and CA patients with stage II colon cancer. We retrieved demographic, clinical, and archived tumor tissues from stage II colon cancer patients at four institutions. The 12-gene assay and mismatch repair (MMR) status were performed by Genomic Health (Redwood City, California). Student’s t-test and the Wilcoxon rank sum test were used to compare Recurrence Score data and gene expression data from AA and CA patients (SAS Enterprise Guide 5.1). Samples from 122 AA and 122 CA patients were analyzed. There were 118 women (63 AA, 55 CA) and 126 men (59 AA, 67 CA). Median age was 66 years for AA patients and 68 for CA patients. Age, gender, year of surgery, pathologic T-stage, tumor location, the number of lymph nodes examined, lymphovascular invasion, and MMR status were not significantly different between groups (p = 0.93). The mean Recurrence Score result for AA patients (27.9 ± 12.8) and CA patients (28.1 ± 11.8) was not significantly different and the proportions of patients with high Recurrence Score values (≥41) were similar between the groups (17/122 AA; 15/122 CA). None of the gene expression variables, either single genes or gene groups (cell cycle group, stromal group, BGN1, FAP, INHBA1, Ki67, MYBL2, cMYC and GADD45B), was significantly different between the racial groups. After controlling for clinical and pathologic covariates, the means and distributions of Recurrence Score results and gene expression profiles showed no statistically significant difference between patient groups. The distribution of Recurrence Score
Directory of Open Access Journals (Sweden)
Feuer Gerold
2004-11-01
Full Text Available Abstract Background Human T-lymphotropic virus type-1 (HTLV-1 is a deltaretrovirus that causes adult T-cell leukemia/lymphoma and is implicated in a variety of lymphocyte-mediated disorders. HTLV-1 contains both regulatory and accessory genes in four pX open reading frames. pX ORF-II encodes two proteins, p13II and p30II, which are incompletely defined in the virus life cycle or HTLV-1 pathogenesis. Proviral clones of the virus with pX ORF-II mutations diminish the ability of the virus to maintain viral loads in vivo. Exogenous expression of p30II differentially modulates CREB and Tax-responsive element-mediated transcription through its interaction with CREB-binding protein/p300 and represses tax/rex RNA nuclear export. Results Herein, we further characterized the role of p30II in regulation of cellular gene expression, using stable p30II expression system employing lentiviral vectors to test cellular gene expression with Affymetrix U133A arrays, representing ~33,000 human genes. Reporter assays in Jurkat T cells and RT-PCR in Jurkat and primary CD4+ T-lymphocytes were used to confirm selected gene expression patterns. Our data reveals alterations of interrelated pathways of cell proliferation, T-cell signaling, apoptosis and cell cycle in p30II expressing Jurkat T cells. In all categories, p30II appeared to be an overall repressor of cellular gene expression, while selectively increasing the expression of certain key regulatory genes. Conclusions We are the first to demonstrate that p30II, while repressing the expression of many genes, selectively activates key gene pathways involved in T-cell signaling/activation. Collectively, our data suggests that this complex retrovirus, associated with lymphoproliferative diseases, relies upon accessory gene products to modify cellular environment to promote clonal expansion of the virus genome and thus maintain proviral loads in vivo.
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-05-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.
Molecular organization of the 5S rDNA gene type II in elasmobranchs.
Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian
2016-01-01
The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.
Modulation of NADPH oxidase activity by known uraemic retention solutes
DEFF Research Database (Denmark)
Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera
2014-01-01
chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. RESULTS: Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized......BACKGROUND: Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased...... inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. METHODS: Mononuclear leucocytes...
Gravity Responsive NADH Oxidase of the Plasma Membrane
Morre, D. James (Inventor)
2002-01-01
A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.
International Nuclear Information System (INIS)
Kim, Hyo Jung; Ham, Sun Ah; Paek, Kyung Shin; Hwang, Jung Seok; Jung, Si Young; Kim, Min Young; Jin, Hanna; Kang, Eun Sil; Woo, Im Sun; Kim, Hye Jung; Lee, Jae Heun; Chang, Ki Churl; Han, Chang Woo; Seo, Han Geuk
2011-01-01
Research highlights: → Activation of PPARδ by GW501516 significantly inhibited Ang II-induced premature senescence in hVSMCs. → Agonist-activated PPARδ suppressed generation of Ang II-triggered ROS with a concomitant reduction in DNA damage. → GW501516 up-regulated expression of antioxidant genes, such as GPx1, Trx1, Mn-SOD and HO-1. → Knock-down of these antioxidant genes abolished the effects of GW501516 on ROS production and premature senescence. -- Abstract: This study evaluated peroxisome proliferator-activated receptor (PPAR) δ as a potential target for therapeutic intervention in Ang II-induced senescence in human vascular smooth muscle cells (hVSMCs). Activation of PPARδ by GW501516, a specific agonist of PPARδ, significantly inhibited the Ang II-induced premature senescence of hVSMCs. Agonist-activated PPARδ suppressed the generation of Ang II-triggered reactive oxygen species (ROS) with a concomitant reduction in DNA damage. Notably, GW501516 up-regulated the expression of antioxidant genes, such as glutathione peroxidase 1, thioredoxin 1, manganese superoxide dismutase and heme oxygenase 1. siRNA-mediated down-regulation of these antioxidant genes almost completely abolished the effects of GW501516 on ROS production and premature senescence in hVSMCs treated with Ang II. Taken together, the enhanced transcription of antioxidant genes is responsible for the PPARδ-mediated inhibition of premature senescence through sequestration of ROS in hVSMCs treated with Ang II.
Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin
2017-01-01
Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407
Butterfield, Cristina N; Tebo, Bradley M
2017-02-22
Manganese(ii) oxidation in the environment is thought to be driven by bacteria because enzymatic catalysis is many orders of magnitude faster than the abiotic processes. The heterologously purified Mn oxidase (Mnx) from marine Bacillus sp. PL-12 is made up of the multicopper oxidase (MCO) MnxG and two small Cu and heme-binding proteins of unknown function, MnxE and MnxF. Mnx binds Cu and oxidizes both Mn(ii) and Mn(iii), generating Mn(iv) oxide minerals that resemble those found on the Bacillus spore surface. Spectroscopic techniques have illuminated details about the metallo-cofactors of Mnx, but very little is known about their requirement for catalytic activity, and even less is known about the substrate specificity of Mnx. Here we quantify the canonical MCO Cu and persistent peripheral Cu bound to Mnx, and test Mnx oxidizing ability toward different substrates at varying pH. Mn(ii) appears to be the best substrate in terms of k cat , but its oxidation does not follow Michaelis-Menten kinetics, instead showing a sigmoidal cooperative behavior. Mnx also oxidizes Fe(ii) substrate, but in a Michaelis-Menten manner and with a decreased activity, as well as organic substrates. The reduced metals are more rapidly consumed than the larger organic substrates, suggesting the hypothesis that the Mnx substrate site is small and tuned for metal oxidation. Of biological relevance is the result that Mnx has the highest catalytic efficiency for Mn(ii) at the pH of sea water, especially when the protein is loaded with greater than the requisite four MCO copper atoms, suggesting that the protein has evolved specifically for Mn oxidation.
Directory of Open Access Journals (Sweden)
Nikola Kovářová
2016-06-01
Full Text Available This paper describes data related to a research article entitled “Tissue- and species-specific differences in cytochrome c oxidase assembly induced by SURF1 defects” [1]. This paper includes data of the quantitative analysis of individual forms of respiratory chain complexes I, III and IV present in SURF1 knockout (SURF1−/− and control (SURF1+/+ mouse fibroblasts and tissues and in fibroblasts of human control and patients with SURF1 gene mutation. Also it includes data demonstrating response of complex IV, cytochrome c oxidase (COX, to reversible inhibition of mitochondrial translation in SURF1−/− mouse and SURF1 patient fibroblast cell lines.
International Nuclear Information System (INIS)
Long, C.M.; Rohrmann, G.F.; Merrill, G.F.
2009-01-01
Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.
Das, Biva; Medhi, Okhil K
2013-03-01
The formation of phenolate free radical is the factor of high turnover for catalytic activity of galactose oxidase (GO) compared to that by inorganic complexes. A new active center analog of GO, [Cu(II)(Salphenylalanine)H(2)O] have been synthesized and its single crystal X-ray analysis was done. In aqueous surfactant micellar solution chemical oxidation as well as electrochemical oxidation of structural models of galactose oxidase - [Cu(II)Salgly·H(2)O] and [Cu(II)(Salphenylalanine)·H(2)O], have been found to generate free radical originating at the phenolate group. Formation of the free radical have been proved by electron paramagnetic resonance spectroscopy, electronic spectroscopy and electrochemistry. Copyright © 2012 Elsevier B.V. All rights reserved.
Identification of 42 Genes Linked to Stage II Colorectal Cancer Metastatic Relapse
Directory of Open Access Journals (Sweden)
Rabeah A. Al-Temaimi
2016-04-01
Full Text Available Colorectal cancer (CRC is one of the leading causes of cancer mortality. Metastasis remains the primary cause of CRC death. Predicting the possibility of metastatic relapse in early-stage CRC is of paramount importance to target therapy for patients who really need it and spare those with low-potential of metastasis. Ninety-six stage II CRC cases were stratified using high-resolution array comparative genomic hybridization (aCGH data based on a predictive survival algorithm and supervised clustering. All genes included within the resultant copy number aberrations were each interrogated independently at mRNA level using CRC expression datasets available from public repositories, which included 1820 colon cancers, and 167 normal colon tissues. Reduced mRNA expression driven by copy number losses and increased expression driven by copy number gains revealed 42 altered transcripts (29 reduced and 13 increased transcripts associated with metastatic relapse, short disease-free or overall survival, and/or epithelial to mesenchymal transition (EMT. Resultant genes were classified based on gene ontology (GO, which identified four functional enrichment groups involved in growth regulation, genomic integrity, metabolism, and signal transduction pathways. The identified 42 genes may be useful for predicting metastatic relapse in stage II CRC. Further studies are necessary to validate these findings.
Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin
2011-01-01
Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292
Kozubal, M.; Macur, R.; Inskeep, W. P.
2007-12-01
Acidic geothermal springs within Yellowstone National Park (YNP) provide an excellent opportunity to study microbial populations and their relationship with geochemical processes such as redox cycling and biomineralization of iron. Fourteen acid-sulfate-chloride (ASC) and acid-sulfate (AS) geothermal springs located in (YNP) have been extensively characterized for aqueous chemistry, solid phase mineral deposition and microbial diversity and distribution. The oxidation of Fe(II) with oxygen as an electron acceptor is exergonic under these conditions, consequently, Fe(II) may be an important electron donor driving primary production in ASC and AS habitats, and products of biomineralization (e.g. Fe[III]-oxides of varying crystallinity and structure, as well as jarosite in some cases) are common in the outflow channels of these environments. Recently, we isolated a novel Metallosphaera-like microorganism (Metallosphaera strain MK1) from an ASC spring in Norris Geyser Basin, YNP. Clone libraries (16S rRNA gene) from multiple sites suggest that microorganisms closely related to strain MK1 (between 98-100 percent similarity) dominate many spring locations between 55-80 C. The in situ abiotic oxidation rate of Fe(II) has been shown to be very slow in these systems and Metallosphaera strain MK1 has been directly implicated in biotic Fe(II) oxidation. Metallosphaera strain MK1 has been submitted for full genome sequencing and is yielding gene sequences related to the terminal oxidases SOXABC and SOXM super-complex. In addition, sequences from a recently characterized terminal oxidase FOX complex involved in Fe(II) and pyrite oxidation from Sulfolobus metallicus have been found in Metallosphaera strain MK1. A protein complex analogous to Metallosphaera sedula has been identified in strain MK1 and this complex has also been expressed in cells grown on pyrite and Fe(II). Other sequences identified in Metallosphaera strain MK1 that are involved in respiration are the TQO
Calcium transport in vesicles energized by cytochrome oxidase
Energy Technology Data Exchange (ETDEWEB)
Rosier, Randy N. [Univ. of Rochester, NY (United States)
1979-01-01
Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K+ selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K+ flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interaction with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.
Directory of Open Access Journals (Sweden)
Meng-Qiu Dang
2015-01-01
Full Text Available Background/Aims: Angiotensin II (Ang II plays a critical role in the cardiac remodeling contributing to heart failure. However, the gene expression profiles induced by Ang II in the early stage of cardiac remodeling remain unknown. Methods: Wild-type male mice (C57BL/6 background, 10-weeek-old were infused with Ang II (1500 ng/kg/min for 7 days. Blood pressure was measured. Cardiac function and remodeling were examined by echocardiography, H&E and Masson staining. The time series microarrays were then conducted to detected gene expression profiles. Results: Microarray results identified that 1,489 genes were differentially expressed in the hearts at day 1, 3 and 7 of Ang II injection. These genes were further classified into 26 profiles by hierarchical cluster analysis. Of them, 4 profiles were significant (No. 19, 8, 21 and 22 and contained 904 genes. Gene Ontology showed that these genes mainly participate in metabolic process, oxidation-reduction process, extracellular matrix organization, apoptotic process, immune response, and others. Significant pathways included focal adhesion, ECM-receptor interaction, cytokine-cytokine receptor interaction, MAPK and insulin signaling pathways, which were known to play important roles in Ang II-induced cardiac remodeling. Moreover, gene co-expression networks analysis suggested that serine/cysteine peptidase inhibitor, member 1 (Serpine1, also known as PAI-1 localized in the core of the network. Conclusions: Our results indicate that many genes are mainly involved in metabolism, inflammation, cardiac fibrosis and hypertrophy. Serpine1 may play a central role in the development of Ang II-induced cardiac remodeling at the early stage.
Directory of Open Access Journals (Sweden)
Chun-Ki Kim
2012-01-01
Full Text Available Ginseng berry possesses higher ginsenoside content than its root, which has been traditionally used in herbal medicine for many human diseases, including atherosclerosis. We here examined the antiatherogenic effects of the Korean ginseng berry extract (KGBE and investigated its underlying mechanism of action in vitro and in vivo. Administration of KGBE decreased atherosclerotic lesions, which was inversely correlated with the expression levels of phase II genes to include heme oxygenase-1 (HO-1 and glutamine-cysteine ligase (GCL. Furthermore, KGBE administration suppressed NF-κB-mediated expression of atherogenic inflammatory genes (TNF-α, IL-1β, iNOS, COX-2, ICAM-1, and VCAM-1, without altering serum cholesterol levels, in ApoE-/- mice fed a high fat-diet. Treatment with KGBE increased phase II gene expression and suppressed lipopolysaccharide-induced reactive oxygen species production, NF-κB activation, and inflammatory gene expression in primary macrophages. Importantly, these cellular events were blocked by selective inhibitors of HO-1 and GCL. In addition, these inhibitors reversed the suppressive effect of KGBE on TNF-α-mediated induction of ICAM-1 and VCAM-1, resulting in decreased interaction between endothelial cells and monocytes. These results suggest that KGBE ameliorates atherosclerosis by inhibiting NF-κB-mediated expression of atherogenic genes via upregulation of phase II enzymes and thus has therapeutic or preventive potential for atherosclerosis.
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Key role of alternative oxidase in lovastatin solid-state fermentation.
Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier
2017-10-01
Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.
Wang, Xiaohui; Dong, Xianjuan; Feng, Yingying; Liu, Xiao; Wang, Jinling; Zhang, Zhongxiu; Li, Jun; Zhao, Yunfang; Shi, Shepo; Tu, Pengfei
2018-04-01
2-(2-Phenylethyl)chromones are the main compounds responsible for the quality of agarwood, which is widely used in traditional medicines, incenses and perfumes. H 2 O 2 and NADPH oxidases (also known as respiratory burst oxidase homologs, Rbohs) mediate diverse physiological and biochemical processes in environmental stress responses. However, little is known about the function of H 2 O 2 and NADPH oxidases in 2-(2-phenylethyl)chromones accumulation. In this study, we found that salt stress induced a transient increase in content of H 2 O 2 and 2-(2-phenylethyl)chromones accumulation in Aquilaria sinensis calli. Exogenous H 2 O 2 remarkably decreased the production of 2-(2-phenylethyl)chromones, while dimethylthiourea (DMTU), a scavenger of H 2 O 2 , significantly increased 2-(2-phenylethyl)chromones accumulation in salt treated calli. Three new H 2 O 2 -generating genes, named AsRbohA-C, were isolated and characterized from A. sinensis. Salt stress also induced a transient increase in AsRbohA-C expression and NADPH oxidase activity. Furthermore, exogenous H 2 O 2 increased AsRbohA-C expression and NADPH oxidase activity, while DMTU inhibited AsRbohA-C expression and NADPH oxidase activity under salt stress. Moreover, diphenylene iodonium (DPI), the inhibitor of NADPH oxidases, reduced AsRbohA-C expression and NADPH oxidase activity, but significantly induced 2-(2-phenylethyl)chromones accumulation during salt stress. These results clearly demonstrated the central role of H 2 O 2 and NADPH oxidases in regulation of salt-induced 2-(2-phenylethyl)chromones accumulation in A. sinensis calli. Copyright © 2018 Elsevier B.V. All rights reserved.
Modulation of NADPH oxidase activity by known uraemic retention solutes.
Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera; Cohen, Gerald; Schaefer, Mandy; Boehringer, Falko; Tepel, Martin; Kunkel, Desiree; Zidek, Walter; Jankowski, Joachim
2014-08-01
Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. Mononuclear leucocytes isolated from buffy coats of healthy volunteers were isolated, lysed and incubated with NADH in the presence of plasma from healthy controls and patients with CKD-5D. Furthermore, the leucocytes were lysed and incubated in the presence of uraemic retention solute of interest and diphenyleneiodonium chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized as the strongest inhibitor of NADPH oxidase (90% of DPI inhibition). Surprisingly, none of the uraemic retention solutes we investigated was found to increase NADPH oxidase activity. Furthermore, plasma from patients with CKD-5D before dialysis caused significantly higher inhibitory effect on NADPH oxidase activity compared with plasma from healthy subjects. However, this effect was significantly decreased in plasma from patients with CKD-5D after dialysis. The results of this study show that uraemic retention solutes modulated the activity of the NADPH oxidase. The results of this study might be the basis for the development of inhibitors applicable as drug in the situation of increased oxidative stress. © 2014 Stichting European Society for Clinical Investigation Journal Foundation.
Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B
1995-09-01
Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.
Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E
2017-02-09
In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.
Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M
2014-07-15
Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.
Madureira, Tânia Vieira; Castro, L Filipe C; Rocha, Eduardo
2016-02-01
Acyl-coenzyme A oxidases 1 (Acox1) and 3 (Acox3) are key enzymes in the regulation of lipid homeostasis. Endogenous and exogenous factors can disrupt their normal expression/activity. This study presents for the first time the isolation and characterization of Acox1 and Acox3 in brown trout (Salmo trutta f. fario). Additionally, as previous data point to the existence of a cross-talk between two nuclear receptors, namely peroxisome proliferator-activated receptors and estrogen receptors, it was here evaluated after in vitro exposures of trout hepatocytes the interference caused by ethynylestradiol in the mRNA levels of an inducible (by peroxisome proliferators) and a non-inducible oxidase. The isolated Acox1 and Acox3 show high levels of sequence conservation compared to those of other teleosts. Additionally, it was found that Acox1 has two alternative splicing isoforms, corresponding to 3I and 3II isoforms of exon 3 splicing variants. Both isoforms display tissue specificity, with Acox1-3II presenting a more ubiquitous expression in comparison with Acox1-3I. Acox3 was expressed in almost all brown trout tissues. According to real-time PCR data, the highest estrogenic stimulus was able to cause a down-regulation of Acox1 and an up-regulation of Acox3. So, for Acox1 we found a negative association between an estrogenic input and a directly activated PPARα target gene. In conclusion, changes in hormonal estrogenic stimulus may impact the mobilization of hepatic lipids to the gonads, with ultimate consequences in reproduction. Further studies using in vivo assays will be fundamental to clarify these issues.
Lysyl oxidase in colorectal cancer
DEFF Research Database (Denmark)
Cox, Thomas R; Erler, Janine T
2013-01-01
Colorectal cancer is the third most prevalent form of cancer worldwide and fourth-leading cause of cancer-related mortality, leading to ~600,000 deaths annually, predominantly affecting the developed world. Lysyl oxidase is a secreted, extracellular matrix-modifying enzyme previously suggested...... to act as a tumor suppressor in colorectal cancer. However, emerging evidence has rapidly implicated lysyl oxidase in promoting metastasis of solid tumors and in particular colorectal cancer at multiple stages, affecting tumor cell proliferation, invasion, and angiogenesis. This emerging research has...... advancements in the field of colorectal cancer....
Identification and characterization of the human type II collagen gene (COL2A1).
K.S.E. Cheah (Kathryn); N.G. Stoker; J.R. Griffin; F.G. Grosveld (Frank); E. Solomon
1985-01-01
textabstractThe gene contained in the human cosmid clone CosHcol1, previously designated an alpha 1(I) collagen-like gene, has now been identified. CosHcol1 hybridizes strongly to a single 5.9-kilobase mRNA species present only in tissue in which type II collagen is expressed. DNA sequence analysis
Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.
Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof
2010-05-01
Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching.
Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo
2013-01-01
Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901
Directory of Open Access Journals (Sweden)
Tao Zhan
Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.
Directory of Open Access Journals (Sweden)
Saied Reza Naddaf
2012-12-01
Full Text Available Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran.Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P model of neighbor-joining method.Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%.Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
The gene expressions of DNA methylation/demethylation enzymes ...
African Journals Online (AJOL)
A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases (Dnmts), DNA ...
Unprecedented hetero-geometric discrete copper(II) complexes ...
Indian Academy of Sciences (India)
Copper; X-ray structure; radical activity; catechol oxidase activity. 1. Introduction ... dylamine and thiocyanate ions but none of these groups .... Independent reflections. 7978 ... was added to it to achieve the ultimate concentration of .... as exchange couples so as to form a single species with ... cantly on central Cu(II) ion.
Chemical labeling studies on isolated and vesicular bovine heart mitochondrial cytochrome c oxidase
International Nuclear Information System (INIS)
Venzke, K.S.; Reynolds, K.A.; Prochaska, L.J.
1987-01-01
Bovine heart cytochrome c oxidase dispersed in Triton X-100, Tween 80, or dodecyl maltoside was reacted with the water-soluble reagents [ 35 S]-diazonium benzene sulfonate (DABS) (10-100 μM) or [ 125 I]-iodo-DABS (34-55 nM) to map the surface topography of the enzyme in different protein aggregation states. Both reagents gave similar labeling profiles of the enzyme under all conditions. Subunits II, III, and VII were extensively labeled by DABS, while subunits I and VI were unreactive with DABS in each detergent. Subunit V exhibited an increase in DABS labeling when the enzyme was reacted in Tween 80 as compared to the enzyme in Triton X-100 or dodecyl maltoside. Also, components b and c showed an increase in DABS reactivity when the enzyme was modified in dodecyl maltoside. In general, the labeling profile of the enzyme in dodecyl maltoside resembled that of the enzyme in Triton X-100, emphasizing that the mechanism of dispersal of the enzyme by both detergents is similar. Cytochrome c oxidase incorporated into phosphatidylglycerol:phosphatidylcholine(1:20)(w:w) phospholipid vesicles (COV) by cholate dialysis was reacted with DABS and subunits II and III were significantly labeled. Approximately 65-70% of the enzyme in COV was oriented with the cytochrome c binding domain facing the extravesicular medium, as determined by comparison of the DABS labeling in subunit IV in detergent-lysed and intact COV
Production of rabbit antibodies against purified Glucose oxidase
Directory of Open Access Journals (Sweden)
Muhammad Anjum Zia
2012-02-01
Full Text Available Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex G-200 column for gel filtration chromatography. It was observed that enzyme achieved 59.37 U mg-1of specific activity with 27.08 fold purity and 64.36% recovery. Purified glucose oxidase was injected into rabbits through intravenous route, to raise the glucose oxidase antibodies. After 30 days incubation period, the rabbits were slaughtered and serum was separated from blood. The antibodies were isolated by ammonium sulfate precipitation and confirmed by agar gel precipitation test. This could be a convenient and low cost alternate assay for the estimation of glucose oxidase in biological fluids. Moreover, such antibodies against the said enzyme could be used in various therapeutic and diagnostic applications.
Czech Academy of Sciences Publication Activity Database
Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, I.T.; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, T.; Schmülling, T.; Vaňková, Radomíra
2013-01-01
Roč. 64, č. 10 (2013), s. 2805-2815 ISSN 0022-0957 R&D Projects: GA ČR GA206/09/2062 Institutional support: RVO:61389030 ; RVO:60077344 ; RVO:67985939 Keywords : cytokinin oxidase * cytokinin * Abscisic acid Subject RIV: ED - Physiology Impact factor: 5.794, year: 2013
Evolution of major histocompatibility complex class I and class II genes in the brown bear
Directory of Open Access Journals (Sweden)
Kuduk Katarzyna
2012-10-01
Full Text Available Abstract Background Major histocompatibility complex (MHC proteins constitute an essential component of the vertebrate immune response, and are coded by the most polymorphic of the vertebrate genes. Here, we investigated sequence variation and evolution of MHC class I and class II DRB, DQA and DQB genes in the brown bear Ursus arctos to characterise the level of polymorphism, estimate the strength of positive selection acting on them, and assess the extent of gene orthology and trans-species polymorphism in Ursidae. Results We found 37 MHC class I, 16 MHC class II DRB, four DQB and two DQA alleles. We confirmed the expression of several loci: three MHC class I, two DRB, two DQB and one DQA. MHC class I also contained two clusters of non-expressed sequences. MHC class I and DRB allele frequencies differed between northern and southern populations of the Scandinavian brown bear. The rate of nonsynonymous substitutions (dN exceeded the rate of synonymous substitutions (dS at putative antigen binding sites of DRB and DQB loci and, marginally significantly, at MHC class I loci. Models of codon evolution supported positive selection at DRB and MHC class I loci. Both MHC class I and MHC class II sequences showed orthology to gene clusters found in the giant panda Ailuropoda melanoleuca. Conclusions Historical positive selection has acted on MHC class I, class II DRB and DQB, but not on the DQA locus. The signal of historical positive selection on the DRB locus was particularly strong, which may be a general feature of caniforms. The presence of MHC class I pseudogenes may indicate faster gene turnover in this class through the birth-and-death process. South–north population structure at MHC loci probably reflects origin of the populations from separate glacial refugia.
Evolution of major histocompatibility complex class I and class II genes in the brown bear.
Kuduk, Katarzyna; Babik, Wiesław; Bojarska, Katarzyna; Sliwińska, Ewa B; Kindberg, Jonas; Taberlet, Pierre; Swenson, Jon E; Radwan, Jacek
2012-10-02
Major histocompatibility complex (MHC) proteins constitute an essential component of the vertebrate immune response, and are coded by the most polymorphic of the vertebrate genes. Here, we investigated sequence variation and evolution of MHC class I and class II DRB, DQA and DQB genes in the brown bear Ursus arctos to characterise the level of polymorphism, estimate the strength of positive selection acting on them, and assess the extent of gene orthology and trans-species polymorphism in Ursidae. We found 37 MHC class I, 16 MHC class II DRB, four DQB and two DQA alleles. We confirmed the expression of several loci: three MHC class I, two DRB, two DQB and one DQA. MHC class I also contained two clusters of non-expressed sequences. MHC class I and DRB allele frequencies differed between northern and southern populations of the Scandinavian brown bear. The rate of nonsynonymous substitutions (dN) exceeded the rate of synonymous substitutions (dS) at putative antigen binding sites of DRB and DQB loci and, marginally significantly, at MHC class I loci. Models of codon evolution supported positive selection at DRB and MHC class I loci. Both MHC class I and MHC class II sequences showed orthology to gene clusters found in the giant panda Ailuropoda melanoleuca. Historical positive selection has acted on MHC class I, class II DRB and DQB, but not on the DQA locus. The signal of historical positive selection on the DRB locus was particularly strong, which may be a general feature of caniforms. The presence of MHC class I pseudogenes may indicate faster gene turnover in this class through the birth-and-death process. South-north population structure at MHC loci probably reflects origin of the populations from separate glacial refugia.
Evolution of major histocompatibility complex class I and class II genes in the brown bear
2012-01-01
Background Major histocompatibility complex (MHC) proteins constitute an essential component of the vertebrate immune response, and are coded by the most polymorphic of the vertebrate genes. Here, we investigated sequence variation and evolution of MHC class I and class II DRB, DQA and DQB genes in the brown bear Ursus arctos to characterise the level of polymorphism, estimate the strength of positive selection acting on them, and assess the extent of gene orthology and trans-species polymorphism in Ursidae. Results We found 37 MHC class I, 16 MHC class II DRB, four DQB and two DQA alleles. We confirmed the expression of several loci: three MHC class I, two DRB, two DQB and one DQA. MHC class I also contained two clusters of non-expressed sequences. MHC class I and DRB allele frequencies differed between northern and southern populations of the Scandinavian brown bear. The rate of nonsynonymous substitutions (dN) exceeded the rate of synonymous substitutions (dS) at putative antigen binding sites of DRB and DQB loci and, marginally significantly, at MHC class I loci. Models of codon evolution supported positive selection at DRB and MHC class I loci. Both MHC class I and MHC class II sequences showed orthology to gene clusters found in the giant panda Ailuropoda melanoleuca. Conclusions Historical positive selection has acted on MHC class I, class II DRB and DQB, but not on the DQA locus. The signal of historical positive selection on the DRB locus was particularly strong, which may be a general feature of caniforms. The presence of MHC class I pseudogenes may indicate faster gene turnover in this class through the birth-and-death process. South–north population structure at MHC loci probably reflects origin of the populations from separate glacial refugia. PMID:23031405
Chemoenzymatic combination of glucose oxidase with titanium silicalite -1
DEFF Research Database (Denmark)
Vennestrøm, Peter Nicolai Ravnborg; Taarning, Esben; Christensen, Claus H.
2010-01-01
Zeozymes: A proof-of-concept is presented for the chemoenzymatic combination of titanium silicalite-1 zeolite with glucose oxidase. In this combination, glucose is oxidized to gluconic acid and the H2O2 byproduct formed in situ is used for the simultaneous oxidation of chemical substrates. Both...... a soluble glucose oxidase and a truly integrated heterogeneous combination whereby the oxidase enzyme is anchored onto the zeolite surface are reported....
Directory of Open Access Journals (Sweden)
Qingzhong Liu
Full Text Available Microarray data has a high dimension of variables but available datasets usually have only a small number of samples, thereby making the study of such datasets interesting and challenging. In the task of analyzing microarray data for the purpose of, e.g., predicting gene-disease association, feature selection is very important because it provides a way to handle the high dimensionality by exploiting information redundancy induced by associations among genetic markers. Judicious feature selection in microarray data analysis can result in significant reduction of cost while maintaining or improving the classification or prediction accuracy of learning machines that are employed to sort out the datasets. In this paper, we propose a gene selection method called Recursive Feature Addition (RFA, which combines supervised learning and statistical similarity measures. We compare our method with the following gene selection methods: Support Vector Machine Recursive Feature Elimination (SVMRFE, Leave-One-Out Calculation Sequential Forward Selection (LOOCSFS, Gradient based Leave-one-out Gene Selection (GLGS. To evaluate the performance of these gene selection methods, we employ several popular learning classifiers on the MicroArray Quality Control phase II on predictive modeling (MAQC-II breast cancer dataset and the MAQC-II multiple myeloma dataset. Experimental results show that gene selection is strictly paired with learning classifier. Overall, our approach outperforms other compared methods. The biological functional analysis based on the MAQC-II breast cancer dataset convinced us to apply our method for phenotype prediction. Additionally, learning classifiers also play important roles in the classification of microarray data and our experimental results indicate that the Nearest Mean Scale Classifier (NMSC is a good choice due to its prediction reliability and its stability across the three performance measurements: Testing accuracy, MCC values, and
Cell Wall Amine Oxidases: New Players in Root Xylem Differentiation under Stress Conditions
Directory of Open Access Journals (Sweden)
Sandip A. Ghuge
2015-07-01
Full Text Available Polyamines (PAs are aliphatic polycations present in all living organisms. A growing body of evidence reveals their involvement as regulators in a variety of physiological and pathological events. They are oxidatively deaminated by amine oxidases (AOs, including copper amine oxidases (CuAOs and flavin adenine dinucleotide (FAD-dependent polyamine oxidases (PAOs. The biologically-active hydrogen peroxide (H2O2 is a shared compound in all of the AO-catalyzed reactions, and it has been reported to play important roles in PA-mediated developmental and stress-induced processes. In particular, the AO-driven H2O2 biosynthesis in the cell wall is well known to be involved in plant wound healing and pathogen attack responses by both triggering peroxidase-mediated wall-stiffening events and signaling modulation of defense gene expression. Extensive investigation by a variety of methodological approaches revealed high levels of expression of cell wall-localized AOs in root xylem tissues and vascular parenchyma of different plant species. Here, the recent progresses in understanding the role of cell wall-localized AOs as mediators of root xylem differentiation during development and/or under stress conditions are reviewed. A number of experimental pieces of evidence supports the involvement of apoplastic H2O2 derived from PA oxidation in xylem tissue maturation under stress-simulated conditions.
Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje
2014-01-01
Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369
BanII dimorphic site located in the third intron of the human apolipoprotein AI (APOA1) gene
Energy Technology Data Exchange (ETDEWEB)
Coleman, R T; Kresnak, M T; Frossard, P M
1988-02-11
A 0.7kb fragment generated by AvaII digestion of pBL13AI, a 0.965kb full-length human apolipoprotein AI cDNA was cloned into the EcoRI site of pBR322. The apoAI cDNA was isolated from a lambdagt10 human fetal liver cDNA library. BanII (GPuGCPyC) (International Biotechnologies, Inc.) identifies two invariant bands at 1122bp and 417bp, and a single two-allele polymorphism with bands at either 274bp or 452bp. The human apolipoprotein AI-CIII-AIV gene complex has been localized on the long arm of chromosome 11 by Southern blot analysis of human-chinese hamster cell hybrids. Co-dominant segregation has been observed in two families (13 individuals). The BanII restriction map was constructed from DNA sequence data of the human apoAI gene. The 452bp fragment is generated by the loss of a BanII dimorphic site in the third intron of the apoAI gene, between the 178bp and the 274bp fragments.
DEFF Research Database (Denmark)
Leick, Lotte; Wojtaszewski, Jørgen F P; Johansen, Sune T.
2008-01-01
The aim of the present study was to test the hypothesis that peroxisome proliferator activated receptor-gamma coactivator (PGC) 1alpha is required for exercise-induced adaptive gene responses in skeletal muscle. Whole body PGC-1alpha knockout (KO) and littermate wild-type (WT) mice performed....... Resting muscles of the PGC-1alpha KO mice had lower ( approximately 20%) cytochrome c (cyt c), cytochrome oxidase (COX) I, and aminolevulinate synthase (ALAS) 1 mRNA and protein levels than WT, but similar levels of AMP-activated protein kinase (AMPK) alpha1, AMPKalpha2, and hexokinase (HK) II compared...
Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na
2018-03-16
Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.
Interaction between alcohol dehydrogenase II gene, alcohol consumption, and risk for breast cancer
St?rmer, T; Wang-Gohrke, S; Arndt, V; Boeing, H; Kong, X; Kreienberg, R; Brenner, H
2002-01-01
MaeIII Restriction Fragment Length Polymorphism in exon 3 of the alcohol dehydrogenase II was assessed in serum from 467 randomly selected German women and 278 women with invasive breast cancer to evaluate the interaction between a polymorphism of the alcohol dehydrogenase II gene, alcohol consumption and risk for breast cancer. In both groups, usual consumption of different alcoholic beverages was asked for using semiquantitative food frequency questionnaires. We used multivariable logistic ...
Yang, Li; Cai, Jifeng; Wen, Jifang; Guo, Yadong
2010-08-01
To detect the 278 bp region of gene of the cytochrome oxidase subunit I (COI) in mitochondral DNA (mtDNA) of sarcosaphagous flies, identify the species of sarcosaphagous flies, and provide reference for forensic application. Samples were collected in Baotou and Chifeng of Inner Mongolia, Tianjin, Nanning, Fuzhou, Linyi of Shandong, Shijiazhuang, Yinchuan, Lanzhou, Huairou of Beijing, Xinxiang and Nanyang of Henan, Datong of Shanxi, Wuhu of Anhui, Quzhou of Zhejiang, Changsha, Zhuzhou and Yongzhou of Hunan. A total of 38 flies were randomly collected from rabbits, dogs and pigs which were set outdoors, then the flies' mitochondrial DNA (mtDNA) were extracted by the improved small insects DNA homogenate method. Amplification was conducted by Perkin-Elmer 9600 thermal cycler, then vertical non-denaturing 7% polyacrylamide gelectrophoresis. PCR products were purified using the nucleic acid purification kit. Sequences of both strands were obtained by direct sequence of the double-stranded PCR product using one of the PCR primers and the ABI PRISM big dye terminator cycle sequencing dit. Sequence reactions were electrophorsed on ABI Model 3730 DNA Sequencers. A UPGMA tree was contrasted using the maximum composite likelihood method in MEGA4. The 38 sarcosaphagous flies belonged to 3 families(Muscidae, Calliphoridae, and Sarcophagidae), 10 genuses (Musca Linnaeus, Hydrotaea Robineau-Desvoidy, Aldrichina Townsend, Hemipyrellia Townsend, Achoetandrus Bezzi, Protophormia Townsend, Chrysomya Robineau-Desvoidy, Lucilia Robineau-Desvoidy, Helicophagella Enderlein, and Boettcherisca Rohdendorf), and 12 species [Musca domestica (Linnaeus), Hydrotaea (Ophyra) capensis (Wiedemann), Lucilia caesar (Linnaeus), Lucilia illustris (Meigen), Aldrichina graham (Aldrich), Hemipyrellia ligurriens, Achoetandrus (Chrysomya) rufifacies (Macquary), Protophormia terraenovae (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Lucilia sericata (Meigen), Helicophagella melanura (Meigen), and
Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.
Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang
2013-02-01
Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.
The gene expressions of DNA methylation/demethylation enzymes ...
African Journals Online (AJOL)
user
2011-01-31
Jan 31, 2011 ... A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases.
Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.
Gudkova, O O; Latyshko, N V; Shandrenko, S G
2016-01-01
In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.
Directory of Open Access Journals (Sweden)
Patti Hayes
2015-09-01
Full Text Available Background & Aims: Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD. Reactive oxygen species (ROS generated by nicotinamide-adenine dinucleotide phosphate (NADPH oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods: After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 59 children with very early onset inflammatory bowel disease (VEOIBD, the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results: We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. Patients with both NOX1 and DUOX2 variants showed abnormal Paneth cell metaplasia. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions: This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. Keywords: Inflammatory Bowel Disease, NADPH Oxidase
DNA polymorphism of HLA class II genes in primary biliary cirrhosis
DEFF Research Database (Denmark)
Morling, Niels; Dalhoff, K; Fugger, L
1992-01-01
We investigated the DNA restriction fragment length polymorphism of the major histocompatibility complex class II genes: HLA-DRB, -DQA, -DQB, DPA, -DPB, the serologically defined HLA-A, B, C, DR antigens, and the primed lymphocyte typing defined HLA-DP antigens in 23 Danish patients with primary...... than 0.05, 'corrected' P greater than 0.05). No DNA fragments specific for DRB1*0301 (DR3) could be identified. The frequencies in PBC of other genetic markers including DRw8, DRB1*08, HLA-DP antigens, DPA, and DPB genes did not differ significantly from those in controls. The associations between PBC...
Laboratory-evolved vanillyl-alcohol oxidase produces natural vanillin
Heuvel, van den R.H.H.; Berg, van den W.A.M.; Rovida, S.; Berkel, van W.J.H.
2004-01-01
The flavoenzyme vanillyl-alcohol oxidase was subjected to random mutagenesis to generate mutants with enhanced reactivity to creosol (2-methoxy-4-methylphenol). The vanillyl-alcohol oxidase-mediated conversion of creosol proceeds via a two-step process in which the initially formed vanillyl alcohol
BcII RFLP for the human vimentin gene
Energy Technology Data Exchange (ETDEWEB)
Marcus, E M; Smith, B A; Telenius, H; Ponder, B A.J.; Mathew, C G.P. [Haddow Laboratories, Surrey (England); Landsvater, R M; Buys, C H.C.M. [State Univ. of Groningen (Netherlands); Ferrari, S [Temple University Medical School, Philadelphia, PA (USA)
1988-09-26
A 1.1 kb cDNA clone (hp4F1) encoding the human vimentin gene was identified in a human library by screening with 4F1, a hamster vimentin cDNA. BcII (TGATCA) recognizes a two allele polymorphism: bands A1 at 8.1 kb, and A2 at 3.6 kb. The allele frequency was determined in 47 unrelated Caucasian individuals. The RFLP was mapped to chromosome 10pter-10q23 using somatic cell hybrids and to 10p13 by in situ hybridization. Co-dominant segregation was observed in 2 informative families.
Directory of Open Access Journals (Sweden)
Qiu-Hong Wan
Full Text Available To gain an understanding of the genomic structure and evolutionary history of the giant panda major histocompatibility complex (MHC genes, we determined a 636,503-bp nucleotide sequence spanning the MHC class II region. Analysis revealed that the MHC class II region from this rare species contained 26 loci (17 predicted to be expressed, of which 10 are classical class II genes (1 DRA, 2 DRB, 2 DQA, 3 DQB, 1 DYB, 1 DPA, and 2 DPB and 4 are non-classical class II genes (1 DOA, 1 DOB, 1 DMA, and 1 DMB. The presence of DYB, a gene specific to ruminants, prompted a comparison of the giant panda class II sequence with those of humans, cats, dogs, cattle, pigs, and mice. The results indicated that birth and death events within the DQ and DRB-DY regions led to major lineage differences, with absence of these regions in the cat and in humans and mice respectively. The phylogenetic trees constructed using all expressed alpha and beta genes from marsupials and placental mammals showed that: (1 because marsupials carry loci corresponding to DR, DP, DO and DM genes, those subregions most likely developed before the divergence of marsupials and placental mammals, approximately 150 million years ago (MYA; (2 conversely, the DQ and DY regions must have evolved later, but before the radiation of placental mammals (100 MYA. As a result, the typical genomic structure of MHC class II genes for the giant panda is similar to that of the other placental mammals and corresponds to BTNL2 approximately DR1 approximately DQ approximately DR2 approximately DY approximately DO_box approximately DP approximately COL11A2. Over the past 100 million years, there has been birth and death of mammalian DR, DQ, DY, and DP genes, an evolutionary process that has brought about the current species-specific genomic structure of the MHC class II region. Furthermore, facing certain similar pathogens, mammals have adopted intra-subregion (DR and DQ and inter-subregion (between DQ and DP
DNA polymorphism of HLA class II genes in pauciarticular juvenile rheumatoid arthritis
DEFF Research Database (Denmark)
Morling, N; Friis, J; Fugger, L
1991-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) class II genes: HLA-DRB, -DQA, -DQB, DPA, and -DPB in 54 patients with pauciarticular juvenile rheumatoid arthritis (PJRA) and in healthy Danes. The frequencies of DNA fragments a...
Glucose 6P binds and activates HlyIIR to repress Bacillus cereus haemolysin hlyII gene expression.
Directory of Open Access Journals (Sweden)
Elisabeth Guillemet
Full Text Available Bacillus cereus is a Gram-positive spore-forming bacterium causing food poisoning and serious opportunistic infections. These infections are characterized by bacterial accumulation despite the recruitment of phagocytic cells. We have previously shown that B. cereus Haemolysin II (HlyII induces macrophage cell death by apoptosis. In this work, we investigated the regulation of the hlyII gene. We show that HlyIIR, the negative regulator of hlyII expression in B. cereus, is especially active during the early bacterial growth phase. We demonstrate that glucose 6P directly binds to HlyIIR and enhances its activity at a post-transcriptional level. Glucose 6P activates HlyIIR, increasing its capacity to bind to its DNA-box located upstream of the hlyII gene, inhibiting its expression. Thus, hlyII expression is modulated by the availability of glucose. As HlyII induces haemocyte and macrophage death, two cell types that play a role in the sequestration of nutrients upon infection, HlyII may induce host cell death to allow the bacteria to gain access to carbon sources that are essential components for bacterial growth.
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-03-17
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.
Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo
2017-06-05
Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.
International Nuclear Information System (INIS)
Boxtel, Antonius L. van; Kamstra, Jorke H.; Fluitsma, Donna M.; Legler, Juliette
2010-01-01
Dithiocarbamates (DTCs) are a class of compounds that are extensively used in agriculture as pesticides. As such, humans and wildlife are undoubtedly exposed to these chemicals. Although DTCs are thought to be relatively safe due to their short half lives, it is well established that they are teratogenic to vertebrates, especially to fish. In zebrafish, these teratogenic effects are characterized by distorted notochord development and shortened anterior to posterior axis. DTCs are known copper (Cu) chelators but this does not fully explain the observed teratogenic effects. We show here that DTCs cause malformations in zebrafish that highly resemble teratogenic effects observed by direct inhibition of a group of cuproenzymes termed lysyl oxidases (LOX). Additionally, we demonstrate that partial knockdown of three LOX genes, lox, loxl1 and loxl5b, sensitizes the developing embryo to DTC exposure. Finally, we show that DTCs directly inhibit zebrafish LOX activity in an ex vivo amine oxidase assay. Taken together, these results provide the first evidence that DTC induced teratogenic effects are, at least in part, caused by direct inhibition of LOX activity.
Directory of Open Access Journals (Sweden)
Man K. Xu
2017-10-01
Full Text Available Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD. The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606. Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042, as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036. No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.
Putting together a plasma membrane NADH oxidase: a tale of three laboratories.
Löw, Hans; Crane, Frederick L; Morré, D James
2012-11-01
The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.
Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li
2016-07-09
In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.
Monoamine Oxidase Inhibitors (MAOIs)
... health-medications/index.shtml. Accessed May 16, 2016. Hirsch M, et al. Monoamine oxidase inhibitors (MAOIs) for ... www.uptodate.com/home. Accessed May 16, 2016. Hirsch M, et al. Discontinuing antidepressant medications in adults. ...
Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du
2016-12-01
Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.
Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.
Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M
2003-12-01
Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.
DEFF Research Database (Denmark)
Versteyhe, Soetkin; Klaproth, Birgit; Borup, Rehannah
2013-01-01
Insulin and the insulin-like growth factors (IGF)-I and -II are closely related peptides important for regulation of metabolism, growth, differentiation, and development. The IGFs exert their main effects through the IGF-I receptor. Although the insulin receptor is the main physiological receptor...... for insulin, this peptide hormone can also bind at higher concentrations to the IGF-I receptor and exert effects through it. We used microarray gene expression profiling to investigate the gene expression regulated by IGF-I, IGF-II, and insulin after stimulation of the IGF-I receptor. Fibroblasts from mice......, knockout for IGF-II and the IGF-II/cation-independent mannose-6-phosphate receptor, and expressing functional IGF-I but no insulin receptors, were stimulated for 4 h with equipotent saturating concentrations of insulin, IGF-I, and IGF-II. Each ligand specifically regulated a group of transcripts...
Directory of Open Access Journals (Sweden)
Jingxin Li
Full Text Available Agrobacterium tumefaciens GW4 is a heterotrophic arsenite [As(III]/antimonite [Sb(III]-oxidizing strain. The As(III oxidase AioAB is responsible for As(III oxidation in the periplasm and it is also involved in Sb(III oxidation in Agrobacterium tumefaciens 5A. In addition, Sb(III oxidase AnoA and cellular H2O2 are also responsible for Sb(III oxidation in strain GW4. However, the deletion of aioA increased the Sb(III oxidation efficiency in strain GW4. In the present study, we found that the cell mobility to Sb(III, ATP and NADH contents and heat release were also increased by Sb(III and more significantly in the aioA mutant. Proteomics and transcriptional analyses showed that proteins/genes involved in Sb(III oxidation and resistance, stress responses, carbon metabolism, cell mobility, phosphonate and phosphinate metabolism, and amino acid and nucleotide metabolism were induced by Sb(III and were more significantly induced in the aioA mutant. The results suggested that Sb(III oxidation may produce energy. In addition, without periplasmic AioAB, more Sb(III would enter bacterial cells, however, the cytoplasmic AnoA and the oxidative stress response proteins were significantly up-regulated, which may contribute to the increased Sb(III oxidation efficiency. Moreover, the carbon metabolism was also activated to generate more energy against Sb(III stress. The generated energy may be used in Sb transportation, DNA repair, amino acid synthesis, and cell mobility, and may be released in the form of heat.
Cheng, Robert Y S; Zhao, Ailian; Alvord, W Gregory; Powell, Douglas A; Bare, Robert M; Masuda, Akira; Takahashi, Takashi; Anderson, Lucy M; Kasprzak, Kazimierz S
2003-08-15
Occupational exposure to nickel compounds is associated with lung cancer risk; both genotoxic and epigenetic mechanisms have been proposed. For comprehensive examination of the acute effects of nickel(II) acetate on gene expression in cultured human peripheral lung epithelial HPL1D cells, microarray analyses were carried out with cDNA chips (approximately 8000 cDNAs). Cells were exposed for 24 h to nontoxic (50, 100, and 200 microM) or toxic (400, 800, and 1600 microM) nickel(II) concentrations. Cluster analysis was applied to the 868 genes with > or = 2-fold change at any concentration. Two main clusters showed marked up- or down-regulation at the highest, toxic concentrations. The data further subdivided into 10 highly cohesive clusters with high probability, and of these only 2 had the same response trend at low nontoxic as at high concentrations, an observation of clear relevance to the process of high- to low-dose extrapolation in risk assessment. There were 113 genes showing > or = 2-fold change at the three lower nontoxic concentrations, those most relevant to in vivo carcinogenesis. In addition to expected responses of metallothionein, ferritin, and heat-shock proteins, the results revealed for the first time changed expression of some potential cancer-related genes in response to low-dose Ni(II): RhoA, dyskerin, interferon regulatory factor 1, RAD21 homologue, and tumor protein, translationally controlled. Overall, most of the genes impacted by nontoxic concentrations of nickel(II) acetate related to gene transcription, protein synthesis and stability, cytoskeleton, signaling, metabolism, cell membrane, and extracellular matrix.
Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R
2013-07-01
Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus.
Optimization of glucose oxidase production by Aspergillus niger
African Journals Online (AJOL)
user
2011-02-28
Feb 28, 2011 ... manganese, cobalt, thioglycolic acid, and gluconic acid according to (Liu et al., .... In this experiment duplicate media of glucose 10% were adjusted at different ... Glucose oxidase as a pharmaceutical anti oxidant Drug. Devt. ... Plush KS, Hellmuth K, Rinas U (1996). kinetics of glucose oxidase excretion by ...
Isolation of a cotton NADP(H oxidase homologue induced by drought stress
Directory of Open Access Journals (Sweden)
NEPOMUCENO ALEXANDRE LIMA
2000-01-01
Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.
Willems, M; Geneviève, D; Borck, G; Baumann, C; Baujat, G; Bieth, E; Edery, P; Farra, C; Gerard, M; Héron, D; Leheup, B; Le Merrer, M; Lyonnet, S; Martin-Coignard, D; Mathieu, M; Thauvin-Robinet, C; Verloes, A; Colleaux, L; Munnich, A; Cormier-Daire, V
2010-12-01
Microcephalic osteodysplastic primordial dwarfism type II (MOPD II, MIM 210720) and Seckel syndrome (SCKL, MIM 210600) belong to the primordial dwarfism group characterised by intrauterine growth retardation, severe proportionate short stature, and pronounced microcephaly. MOPD II is distinct from SCKL by more severe growth retardation, radiological abnormalities, and absent or mild mental retardation. Seckel syndrome is associated with defective ATR dependent DNA damage signalling. In 2008, loss-of-function mutations in the pericentrin gene (PCNT) have been identified in 28 patients, including 3 SCKL and 25 MOPDII cases. This gene encodes a centrosomal protein which plays a key role in the organisation of mitotic spindles. The aim of this study was to analyse PCNT in a large series of SCKL-MOPD II cases to further define the clinical spectrum associated with PCNT mutations. Among 18 consanguineous families (13 SCKL and 5 MOPDII) and 6 isolated cases (3 SCKL and 3 MOPD II), 13 distinct mutations were identified in 5/16 SCKL and 8/8 MOPDII including five stop mutations, five frameshift mutations, two splice site mutations, and one apparent missense mutation affecting the last base of exon 19. Moreover, we demonstrated that this latter mutation leads to an abnormal splicing with a predicted premature termination of translation. The clinical analysis of the 5 SCKL cases with PCNT mutations showed that they all presented minor skeletal changes and clinical features compatible with MOPDII diagnosis. It is therefore concluded that, despite variable severity, MOPDII is a genetically homogeneous condition due to loss-of-function of pericentrin.
Cytochrome cbb3 of Thioalkalivibrio is a Na+-pumping cytochrome oxidase
Muntyan, M.S.; Cherepanov, D.A.; Malinen, A.M.; Bloch, D.A.; Sorokin, D.Y.; Severina, I.I.; Ivashina, T.V.; Lahti, R.; Muyzer, G.; Skulachev, V.P.
2015-01-01
Cytochrome c oxidases (Coxs) are the basic energy transducers in the respiratory chain of the majority of aerobic organisms. Coxs studied to date are redox-driven proton-pumping enzymes belonging to one of three subfamilies: A-, B-, and C-type oxidases. The C-type oxidases (cbb3 cytochromes), which
Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T
2013-11-01
Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.
Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P
2015-03-28
Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.
Prevalence of qnr, intI, and intII genes in extendedspectrum beta ...
African Journals Online (AJOL)
Purpose: To investigate the prevalence of qnr, intI, and intII genes in extended spectrum betalactamase (ESBL)-producing Escherichia coli isolated from clinical samples in Kerman, Iran. Methods: A total of 127 E. coli were collected from clinical samples in Kerman hospitals. The antibiotic susceptibility test was performed ...
Czech Academy of Sciences Publication Activity Database
Kopečný, D.; Tarkowski, Petr; Majira, M.; Bouchez-Mahiout, I.; Nogué, F.; Laurière, M.; Sandberg, G.; Laloue, M.; Houba-Hérin, N.
2006-01-01
Roč. 171, č. 1 (2006), s. 114-122 ISSN 0168-9452 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * Cytokinin oxidase/dehydrogenase * Homeostasis Subject RIV: CE - Biochemistry Impact factor: 1.631, year: 2006
Serum diamine oxidase activity in patients with histamine intolerance.
Manzotti, G; Breda, D; Di Gioacchino, M; Burastero, S E
2016-03-01
Intolerance to various foods, excluding bona fide coeliac disease and lactose intolerance, represents a growing cause of patient visits to allergy clinics.Histamine intolerance is a long-known, multifaceted clinical condition triggered by histamine-rich foods and alcohol and/or by drugs that liberate histamine or block diamine oxidase (DAO), the main enzyme involved in the metabolism of ingested histamine. Histamine limitation diets impose complex, non-standardized restrictions that may severely impact the quality of life of patients. We retrospectively evaluated 14 patients who visited allergy outpatient facilities in northern Italy with a negative diagnosis for IgE-mediated food hypersensitivity, coeliac disease, conditions related to gastric hypersecretion, and systemic nickel hypersensitivity, and who previously underwent a histamine limitation diet with benefits for their main symptoms. Serum diamine oxidase levels and the clinical response to diamine oxidase supplementation were investigated. We found that 10 out of 14 patients had serum DAO activityintolerance. Moreover, 13 out of 14 patients subjectively reported a benefit in at least one of the disturbances related to food intolerances following diamine oxidase supplementation. The mean value (±SD) of diamine oxidase activity in the cohort of patients with histamine intolerance symptoms was 7.04±6.90 U/mL compared to 39.50±18.16 U/mL in 34 healthy controls (P=0.0031). In patients with symptoms triggered by histamine-rich food, measuring the serum diamine oxidase activity can help identify subjects who can benefit from a histamine limitation diet and/or diamine oxidase supplementation.Properly designed, controlled studies investigating histamine intolerance that include histamine provocation are indispensable for providing insights into the area of food intolerances, which are currently primarily managed with non-scientific approaches in Italy. © The Author(s) 2015.
International Nuclear Information System (INIS)
Peschek, G.A.; Wastyn, M.; Trnka, M.; Molitor, V.; Fry, I.V.; Packer, L.
1989-01-01
Functionally intact plasma membranes were isolated from the cyanobacterium (blue-green alga) Anacystis nidulans through French pressure cell extrusion of lysozyme/EDTA-treated cells, separated from thylakoid membranes by discontinuous sucrose density gradient centrifugation, and purified by repeated recentrifugation. Origin and identity of the chlorophyll-free plasma membrane fraction were confirmed by labeling of intact cells with impermeant protein markers, [ 35 S]diazobenzenesulfonate and fluorescamine, prior to membrane isolation. Rates of oxidation of reduced horse heart cytochrome c by purified plasma and thylakoid membranes were 90 and 2 nmol min -1 (mg of protein) -1 , respectively. The cytochrome oxidase in isolated plasma membranes was identified as a copper-containing aa 3 -type enzyme from the properties of its redox-active and EDTA-resistant Cu 2+ ESR signal, the characteristic inhibition profile, reduced minus oxidized difference spectra, carbon monoxide difference spectra, photoaction and photodissociation spectra of the CO-inhibited enzyme, and immunological cross-reaction of two subunits of the enzyme with antibodies against subunits I and II, and the holoenzyme, of Paracoccus denitrificans aa 3 -type cytochrome oxidase. The data presented are the first comprehensive evidence for the occurrence of aa 3 -type cytochrome oxidase in the plasma membrane of a cyanobacterium similar to the corresponding mitochondrial enzyme
Directory of Open Access Journals (Sweden)
Young-Moo Choo
Full Text Available Antennae-specific odorant-degrading enzymes (ODEs are postulated to inactivate odorant molecules after they convey their signal. Different classes of insect ODEs are specific to esters, alcohols, and aldehydes--the major functional groups of female-produced, hydrophobic sex pheromones from moth species. Esterases that rapidly inactive acetate and other esters have been well-studied, but less is known about aldehyde oxidases (AOXs. Here we report cloning of an aldehyde oxidase, AtraAOX2, from the antennae of the navel orangeworm (NOW, Amyelois transitella, and the first activity characterization of a recombinant insect AOX. AtraAOX2 gene spans 3,813 bp and encodes a protein with 1,270 amino acid residues. AtraAOX2 cDNA was expressed in baculovirus-infected insect Sf21 cells as a ≈280 kDa homodimer with 140 kDa subunits. Recombinant AtraAOX2 degraded Z11Z13-16Ald and plant volatile aldehydes as substrates. However, as expected for aldehyde oxidases, recombinant AtraAOX2 did not show specificity for Z11Z13-16Ald, the main constituent of the sex pheromone, but showed high activity for plant volatile aldehydes. Our data suggest AtraAOX2 might be involved in degradation of a diversity of aldehydes including sex pheromones, plant-derived semiochemicals, and chemical cues for oviposition sites. Additionally, AtraAOX2 could protect the insect's olfactory system from xenobiotics, including pesticides that might reach the sensillar lymph surrounding the olfactory receptor neurons.
Structure and activity of Aspergillus nidulans copper amine oxidase
DEFF Research Database (Denmark)
McGrath, Aaron P; Mithieux, Suzanne M; Collyer, Charles A
2011-01-01
Aspergillus nidulans amine oxidase (ANAO) has the unusual ability among the family of copper and trihydroxyphenylalanine quinone-containing amine oxidases of being able to oxidize the amine side chains of lysine residues in large peptides and proteins. We show here that in common with the related...... enzyme from the yeast Pichia pastoris, ANAO can promote the cross-linking of tropoelastin and oxidize the lysine residues in α-casein proteins and tropoelastin. The crystal structure of ANAO, the first for a fungal enzyme in this family, has been determined to a resolution of 2.4 Å. The enzyme is a dimer...... with the archetypal fold of a copper-containing amine oxidase. The active site is the most open of any of those of the structurally characterized enzymes in the family and provides a ready explanation for its lysine oxidase-like activity....
Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James
2017-11-30
Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.
The roles of MHC class II genes and post-translational modification in celiac disease.
Sollid, Ludvig M
2017-08-01
Our increasing understanding of the etiology of celiac disease, previously considered a simple food hypersensitivity disorder caused by an immune response to cereal gluten proteins, challenges established concepts of autoimmunity. HLA is a chief genetic determinant, and certain HLA-DQ allotypes predispose to the disease by presenting posttranslationally modified (deamidated) gluten peptides to CD4 + T cells. The deamidation of gluten peptides is mediated by transglutaminase 2. Strikingly, celiac disease patients generate highly disease-specific autoantibodies to the transglutaminase 2 enzyme. The dual role of transglutaminase 2 in celiac disease is hardly coincidental. This paper reviews the genetic mapping and involvement of MHC class II genes in disease pathogenesis, and discusses the evidence that MHC class II genes, via the involvement of transglutaminase 2, influence the generation of celiac disease-specific autoantibodies.
NASA's GeneLab Phase II: Federated Search and Data Discovery
Berrios, Daniel C.; Costes, Sylvain V.; Tran, Peter B.
2017-01-01
GeneLab is currently being developed by NASA to accelerate 'open science' biomedical research in support of the human exploration of space and the improvement of life on earth. Phase I of the four-phase GeneLab Data Systems (GLDS) project emphasized capabilities for submission, curation, search, and retrieval of genomics, transcriptomics and proteomics ('omics') data from biomedical research of space environments. The focus of development of the GLDS for Phase II has been federated data search for and retrieval of these kinds of data across other open-access systems, so that users are able to conduct biological meta-investigations using data from a variety of sources. Such meta-investigations are key to corroborating findings from many kinds of assays and translating them into systems biology knowledge and, eventually, therapeutics.
NASAs GeneLab Phase II: Federated Search and Data Discovery
Berrios, Daniel C.; Costes, Sylvain; Tran, Peter
2017-01-01
GeneLab is currently being developed by NASA to accelerate open science biomedical research in support of the human exploration of space and the improvement of life on earth. Phase I of the four-phase GeneLab Data Systems (GLDS) project emphasized capabilities for submission, curation, search, and retrieval of genomics, transcriptomics and proteomics (omics) data from biomedical research of space environments. The focus of development of the GLDS for Phase II has been federated data search for and retrieval of these kinds of data across other open-access systems, so that users are able to conduct biological meta-investigations using data from a variety of sources. Such meta-investigations are key to corroborating findings from many kinds of assays and translating them into systems biology knowledge and, eventually, therapeutics.
Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.
Legge, M; Duff, G B
1981-01-01
Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less ga...
Cloning and identification of the gene coding for the 140-kd subunit of Drosophila RNA polymerase II
Faust, Daniela M.; Renkawitz-Pohl, Renate; Falkenburg, Dieter; Gasch, Alexander; Bialojan, Siegfried; Young, Richard A.; Bautz, Ekkehard K. F.
1986-01-01
Genomic clones of Drosophila melanogaster were isolated from a λ library by cross-hybridization with the yeast gene coding for the 150-kd subunit of RNA polymerase II. Clones containing a region of ∼2.0 kb with strong homology to the yeast gene were shown to code for a 3.9-kb poly(A)+-RNA. Part of the coding region was cloned into an expression vector. A fusion protein was obtained which reacted with an antibody directed against RNA polymerase II of Drosophila. Peptide mapping of the fusion p...
Metavanadate causes cellular accumulation of copper and decreased lysyl oxidase activity
International Nuclear Information System (INIS)
Cui, Changtai T.; Uriu-Adams, Janet Y.; Tchaparian, Eskouhie H.; Keen, Carl L.; Rucker, Robert B.
2004-01-01
Selected indices of copper metabolism in weanling rats and fibroblast cultures were progressively altered in response to increased levels of sodium metavanadate. In diets, vanadium was added in amounts ranging from 0 to 80 μg V/g of diet, that is, 0-1.6 μmol V/g of diet. In fibroblast cultures, vanadium ranged from 0 to 400 nmol V/ml. The inhibition of P-ATPase-7A activity by metavanadate, important to copper egress from cells, was a primary focus. In skin, and tendon, the copper concentration was increased in response to increased dietary levels of metavanadate, whereas lysyl oxidase activity, a secreted cuproprotein, was reduced. The reduction in lysyl oxidase activity was also accompanied by reduced redox cycling potential of isolated fractions of lysyl oxidase, presumably due to reduced lysyltyrosyl quinone (LTQ) formation at the active site of lysyl oxidase. In contrast, liver copper concentrations and plasma ceruloplasmin activity were not affected by metavanadate exposure. However, semicarbazide-sensitive benzylamine oxidase (SCBO) activity, which was taken as an indirect measure of vascular adhesive protein-1 (VAP-1), was increased. In cultured fibroblasts, cellular copper was also increased and lysyl oxidase decreased in response to metavanadate. Moreover, the steady-state levels of atp7a and lysyl oxidase mRNAs were not affected by addition of metavanadate to culture medium up to 200 nmol/ml. Taken together, these data suggest that pathways involving copper egress and lysyl oxidase activation are particularly sensitive to metavanadate exposure through processes that are predominately posttranslational
Evolutionary Trails of Plant Group II Pyridoxal Phosphate-Dependent Decarboxylase Genes.
Kumar, Rahul
2016-01-01
Type II pyridoxal phosphate-dependent decarboxylase (PLP_deC) enzymes play important metabolic roles during nitrogen metabolism. Recent evolutionary profiling of these genes revealed a sharp expansion of histidine decarboxylase genes in the members of Solanaceae family. In spite of the high sequence homology shared by PLP_deC orthologs, these enzymes display remarkable differences in their substrate specificities. Currently, limited information is available on the gene repertoires and substrate specificities of PLP_deCs which renders their precise annotation challenging and offers technical challenges in the immediate identification and biochemical characterization of their full gene complements in plants. Herein, we explored their evolutionary trails in a comprehensive manner by taking advantage of high-throughput data accessibility and computational approaches. We discussed the premise that has enabled an improved reconstruction of their evolutionary lineage and evaluated the factors offering constraints in their rapid functional characterization, till date. We envisage that the synthesized information herein would act as a catalyst for the rapid exploration of their biochemical specificity and physiological roles in more plant species.
DNA typing of HLA class II genes in native inhabitants of Chukotka
Energy Technology Data Exchange (ETDEWEB)
Krylov, M.Yu.; Erdesz, S.; Alexeeva, L.I. [Institute of Rheumatology, Moscow (Russian Federation)
1995-06-01
Polymorphism of HLA class II genes was studied in native Chukotka inhabitants with the use of DNA oligotyping. The characteristics of the distribution of allelic variants of the loci HLA-DRB1, -DQA1, -DQB1, and -DPB1 were revealed; they were similar to those of other Subarctic Mongoloid populations and different from those for comparable populations of other climatic and geographic zones. Our data suggest that the specific features found for the distributions of some alleles of the loci examined are related to the geographic variation in the HLA gene system studied. 20 refs., 4 tabs.
Oxidases as Breast Cancer Oncogens
National Research Council Canada - National Science Library
Yeldandi, Anjana
2000-01-01
...) in a non-tumorigenic human mammary epithelial cell line to ascertain whether oxidase overexpressing cells undergo transformation when exposed to substrate xanthine for XOX and uric acid for UOX...
Jankowski, J M; Dixon, G H
1985-02-01
A series of plasmids containing new fusion genes in which the trout protamine gene is placed under the control of the complete herpes virus (HSV-1) tk promoter Pvu II-Bgl II fragment (pM8), or a shortened thymidine kinase (tk) promoter in which the region between the TATA box and the cap site is altered by using the Pvu II-Mlu I fragment (pM7), have been constructed. An additional recombinant plasmid was constructed in which the Bgl II-Ava II fragment of the protamine gene containing the entire protamine promoter but missing the protamine coding region was cloned into pBR322 between the Xho II 1666 and Hind III sites (pP5). For in vitro transcription, a HeLa cell lysate system was prepared and the RNA transcription products, after glyoxalation, were electrophoretically analyzed on 5% polyacrylamide gels. In constructing pM8 the DNA sequence between the tk promoter and the cap site was present while in pM7 it was deleted. Similar multiple transcripts were seen in both cases, indicating that the region between the promoter and the cap site has no effect upon transcription in vitro. The multiple transcripts appear to be due to the presence of a cryptic promoter in the complementary strand of the protamine gene. The activity of this cryptic promoter has been confirmed by comparison of the transcription of plasmid pP5, in which the protamine mRNA coding region has been deleted, with a previously described plasmid, pJBRP (Jankowski JM and Dixon GH (1984) Can. J. Biochem. Cell. Biol. 62, 291-300), containing the intact protamine gene.
Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.
2011-01-01
The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791
Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.
Legge, M; Duff, G B
1981-02-01
Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information.
Directory of Open Access Journals (Sweden)
Nana Pei
Full Text Available Increased expression of angiotensin II type 2 receptor (AT2R induces apoptosis in numerous tumor cell lines, with either Angiotensin II-dependent or Angiotensin II-independent regulation, but its molecular mechanism remains poorly understood. Here, we used PCR Array analysis to determine the gene and microRNA expression profiles in human prostate cancer cell lines transduced with AT2R recombinant adenovirus. Our results demonstrated that AT2R over expression leads to up-regulation of 6 apoptosis-related genes (TRAIL-R2, BAG3, BNIPI, HRK, Gadd45a, TP53BP2, 2 cytokine genes (IL6 and IL8 and 1 microRNA, and down-regulation of 1 apoptosis-related gene TNFSF10 and 2 cytokine genes (BMP6, BMP7 in transduced DU145 cells. HRK was identified as an up-regulated gene in AT2R-transduced PC-3 cells by real-time RT-PCR. Next, we utilized siRNAs to silence the up-regulated genes to further determine their roles on AT2R overexpression mediated apoptosis. The results showed downregulation of Gadd45a reduced the apoptotic effect by ∼30% in DU145 cells, downregulation of HRK reduced AT2R-mediated apoptosis by more than 50% in PC-3 cells, while downregulation of TRAIL-R2 enhanced AT2R-mediated apoptosis more than 4 times in DU145 cells. We also found that the effects on AT2R-mediated apoptosis caused by downregulation of Gadd45a, TRAIL-R2 and HRK were independent in activation of p38 MAPK, p44/42 MAPK and p53. Taken together, our results demonstrated that TRAIL-R2, Gadd45a and HRK may be novel target genes for further study of the mechanism of AT2R-mediated apoptosis in prostate cancer cells.
DEFF Research Database (Denmark)
Climent, Victor; Zhang, Jingdong; Friis, Esben Peter
2012-01-01
Laccases (E.C. 1.10.3.2) are multicopper oxidases catalytically active in the oxidation of diphenolics and related compounds by molecular dioxygen. The laccases contain a single-copper type I center and a trinuclear cluster of a single-copper type II and a dinuclear type III center. The oxidation...
Kim, Ji Min; Lee, Eun Kyeong; Kim, Dae Hyun; Yu, Byung Pal
2010-01-01
Advanced glycation endproducts (AGE) are oxidative products formed from the reaction between carbohydrates and a free amino group of proteins that are provoked by reactive species (RS). It is also known that AGE enhance the generation of RS and that the binding of AGE to a specific AGE receptor (RAGE) induces the activation of the redox-sensitive, pro-inflammatory transcription factor, nuclear factor-kappa B (NF-ĸB). In this current study, we investigated the anti-oxidative effects of short-term kaempferol supplementation on the age-related formation of AGE and the binding activity of RAGE in aged rat kidney. We further investigated the suppressive action of kaempferol against AGE's ability to stimulate activation of pro-inflammatory NF-ĸB and its molecular mechanisms. For this study, we utilized young (6 months old), old (24 months old), and kaempferol-fed (2 and 4 mg/kg/day for 10 days) old rats. In addition, for the molecular work, the rat endothelial cell line, YPEN-1 was used. The results show that AGE and RAGE were increased during aging and that these increases were blunted by kaempferol. In addition, dietary kaempferol reduced age-related increases in NF-κB activity and NF-ĸB-dependant pro-inflammatory gene activity. The most significant new finding from this study is that kaempferol supplementation prevented age-related NF-κB activation by suppressing AGE-induced nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Taken together, our results demonstrated that dietary kaempferol exerts its anti-oxidative and anti-inflammatory actions by modulating the age-related NF-κB signaling cascade and its pro-inflammatory genes by suppressing AGE-induced NADPH oxidase activation. Based on these data, dietary kaempferol is proposed as a possible anti-AGE agent that may have the potential for use in anti-inflammation therapies. PMID:20431987
Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin
2010-02-01
Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.
Guerin, Andrea; Aziz, Aly S; Mutch, Carly; Lewis, Jillian; Go, Cristina Y; Mercimek-Mahmutoglu, Saadet
2015-08-01
Pyridox(am)ine-5-phosphate oxidase deficiency is an autosomal recessive disorder of pyridoxine metabolism. Intractable neonatal epileptic encephalopathy is the classical presentation. Pyridoxal-5-phosphate or pyridoxine supplementation improves symptoms. We report a patient with myoclonic and tonic seizures at the age of 1 hour. Pyridoxal-5-phosphate was started on the first day of life and seizures stopped at the age of 3 days, but encephalopathy persisted for 4 weeks. She had normal neurodevelopmental outcome at the age of 12 months on pyridoxal-5-phosphate monotherapy. She had novel homozygous pathogenic frameshift mutation (c.448_451del;p.Pro150Argfs*27) in the PNPO gene. Long-lasting encephalopathy despite well-controlled clinical seizures does neither confirm nor exclude pyridox(am)ine-5-phosphate oxidase deficiency. Normal neurodevelopmental outcome of our patient emphasizes the importance of pyridoxal-5-phosphate treatment. Pyridox(am)ine-5-phosphate oxidase deficiency should be included in the differential diagnosis of Ohtahara syndrome and neonatal myoclonic encephalopathy as a treatable underlying cause. In addition, we reviewed the literature for pyridox(am)ine-5-phosphate oxidase deficiency and summarized herein all confirmed cases. © The Author(s) 2014.
21 CFR 866.2420 - Oxidase screening test for gonorrhea.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420... screening test for gonorrhea. (a) Identification. An oxidase screening test for gonorrhea is an in vitro... of gonorrhea. (b) Classification. Class III (premarket approval) (transitional device). (c) Date PMA...
Institute of Scientific and Technical Information of China (English)
Changhe Fan; Lihua Li; Yan Fu; Hehuang Deng; Xiangjiao Liao; Youcai Zhou
2006-01-01
BACKGROUND: The pathophysiology of tardive dyskinesia (TD) is not yet fully understood. With the hypothesis of altered dopaminergic neurotransmission, altered activities of dopamine degrading enzymes such as monoamine oxidase A (MAOA) and their coding genes are supposed to be related to the pathophysiology of TD.OBJECTIVE: To investigate possible association between 30 bp variable number tandem repeat (VNTR) polymorphism in the promoter of MAOA gene and susceptibility, severity of neuroleptic induced TD in Chinese Han people in Guandong Province.DESIGN: Non-randomization-synchronization controlled study. SETTING: Guangdong Mental Health Institute, Guangdong Provincial People's Hospital; Guangzhou Psychiatric Hospital; Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration. PARTICIPANTS: A total of 179 subjects were enrolled in the study. All subjects were sporadic and genetically unrelated Chinese schizophrenic patients who were hospitalizing in Guangzhou Psychiatric Hospital or Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration during January to April 2005. The diagnosis of schizophrenia was made according to the criteria of Diagnostic and Statistic Manual of Mental Disorder-the third edition-revised (DSM-Ⅲ-R). Among all patients, 88 were diagnosed as with TD and 91 without TD according to the research diagnostic criteria described by Schooler-Kane. Informed consent was obtained from all subjects or their relatives.METHODS: ① TD severity was assessed with the AIMS which was a 5-degree rating scale from 0 to 4 (corresponding to none, minimal, mild, moderate and severe, respectively). The study was approved by the Ethics Committees of the two hospitals and informed consent was obtained from all subjects or their relatives. ② The polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis (PAGE) techniques were used to detect MAOA gene 30 bp VNTR polymorphism in schizophrenic patients
Platelet monoamine oxidase: specific activity and turnover number in headache
International Nuclear Information System (INIS)
Summers, K.M.; Brown, G.K.; Craig, I.W.; Peatfield, R.; Rose, F.C.
1982-01-01
Monoamine oxidase turnover numbers (molecules of substrate converted to product per minute per active site) have been calculated for the human platelet enzyme using [ 3 H]pargyline. Headache patients with high and low monoamine oxidase specific activities relative to controls were found to have turnover numbers very close to those for controls. This finding suggests that their specific activities vary because of differences in the concentration of active monoamine oxidase molecules, rather than differences in the ability of those enzyme molecules to catalyse the deamination reaction. (Auth.)
Leonurine (SCM-198) attenuates myocardial fibrotic response via inhibition of NADPH oxidase 4.
Liu, Xin-Hua; Pan, Li-Long; Deng, Hai-Yan; Xiong, Qing-Hui; Wu, Dan; Huang, Guo-Ying; Gong, Qi-Hai; Zhu, Yi-Zhun
2013-01-01
In our previous studies, we have reported that leonurine, a plant phenolic alkaloid in Herba leonuri, exerted cardioprotective properties in a number of preclinical experiments. Herein, we investigated the roles and the possible mechanisms of leonurine for reducing fibrotic responses in angiotensin II (Ang II)-stimulated primary neonatal rat cardiac fibroblasts and post-myocardial infarction (MI) rats. In in vitro experiments performed in neonatal rat cardiac fibroblasts, leonurine (10-20 μM) pretreatment attenuated Ang II-induced activation of extracellular signal-regulated kinase 1/2, production of intracellular reactive oxygen species (ROS), expression and activity of matrix metalloproteinase (MMP)-2/9, and expression of α-smooth muscle actin and types I and III collagen. A small interfering RNA-mediated knockdown strategy for NADPH oxidase 4 (Nox4) revealed that Nox4 was required for Ang II-induced activation of cardiac fibroblasts. In vivo studies using a post-MI model in rats indicated that administration of leonurine inhibited myocardial fibrosis while reducing cardiac Nox4 expression, ROS production, NF-κB activation, and plasma MMP-2 activity. In conclusion, our results provide the first evidence that leonurine could prevent cardiac fibrosis and the activation of cardiac fibroblasts partly through modulation of a Nox4-ROS pathway. Copyright © 2012 Elsevier Inc. All rights reserved.
Seo, M.; Peeters, A.J.M.; Koiwai, H.; Oritani, T.; Marion-Poll, A.; Zeevaart, J.A.D.; Koornneef, M.; Kamiya, Y.; Koshiba, T.
2000-01-01
Abscisic acid (ABA) is a plant hormone involved in seed development and germination and in responses to various environmental stresses. The last step of ABA biosynthesis involves oxidation of abscisic aldehyde, and aldehyde oxidase (EC 1.2.3.1) is thought to catalyze this reaction. An aldehyde
Czech Academy of Sciences Publication Activity Database
Conrad, K.; Motyka, Václav; Schlüter, T.
2007-01-01
Roč. 130, č. 4 (2007), s. 572-579 ISSN 0031-9317 R&D Projects: GA ČR GA206/03/0313 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : OXIDASE ACTIVITY * GENE-EXPRESSION * ZEA - MAYS Subject RIV: EF - Botanics Impact factor: 2.192, year: 2007
Directory of Open Access Journals (Sweden)
Hahner Stefanie
2008-07-01
Full Text Available Abstract Background Polymorphisms within the insulin gene can influence insulin expression in the pancreas and especially in the thymus, where self-antigens are processed, shaping the T cell repertoire into selftolerance, a process that protects from β-cell autoimmunity. Methods We investigated the role of the -2221Msp(C/T and -23HphI(A/T polymorphisms within the insulin gene in patients with a monoglandular autoimmune endocrine disease [patients with isolated type 1 diabetes (T1D, n = 317, Addison's disease (AD, n = 107 or Hashimoto's thyroiditis (HT, n = 61], those with a polyglandular autoimmune syndrome type II (combination of T1D and/or AD with HT or GD, n = 62 as well as in healthy controls (HC, n = 275. Results T1D patients carried significantly more often the homozygous genotype "CC" -2221Msp(C/T and "AA" -23HphI(A/T polymorphisms than the HC (78.5% vs. 66.2%, p = 0.0027 and 75.4% vs. 52.4%, p = 3.7 × 10-8, respectively. The distribution of insulin gene polymorphisms did not show significant differences between patients with AD, HT, or APS-II and HC. Conclusion We demonstrate that the allele "C" of the -2221Msp(C/T and "A" -23HphI(A/T insulin gene polymorphisms confer susceptibility to T1D but not to isolated AD, HT or as a part of the APS-II.
Immobilization of xanthine oxidase on a polyaniline silicone support.
Nadruz, W; Marques, E T; Azevedo, W M; Lima-Filho, J L; Carvalho, L B
1996-03-01
A polyaniline silicone support to immobilize xanthine oxidase is proposed as a reactor coil to monitor the action of xanthine oxidase on hypoxanthine, xanthine and 6-mercaptopurine. A purified xanthine oxidase immobilized on this support lost 80% of the initial activity after 12 min of use. Co-immobilization of superoxide dismutase and catalase increased the stability of immobilized xanthine oxidase so that the derivative maintained 79% of its initial activity after 4.6 h of continuous use in which 1.5 mumol purine bases were converted by the immobilized enzyme system. There is no evidence of either polyaniline or protein leaching from the coil during 3 h of continuous use. When solutions (10 ml) of hypoxanthine, xanthine and 6-mercaptopurine were circulated individually through the xanthine oxidase-superoxide dismutase-catalase-polyaniline coil (1 mm internal diameter and 3 m in length, 3 ml internal volume) activities of 8.12, 11.17 and 1.09 nmol min-1 coil-1, respectively, were obtained. The advantages of the reactor configuration and the redox properties of the polymer, particularly with respect to immobilized oxidoreductases, make this methodology attractive for similar enzyme systems. This immobilized enzyme system using polyaniline-silicone as support converted 6-mercaptopurine to 6-thiouric acid with equal efficiency as resins based on polyacrylamide and polyamide 11.
Monerawela, Chandre; James, Tharappel C; Wolfe, Kenneth H; Bond, Ursula
2015-03-01
Lager yeasts, Saccharomyces pastorianus, are interspecies hybrids between S. cerevisiae and S. eubayanus and are classified into Group I and Group II clades. The genome of the Group II strain, Weihenstephan 34/70, contains eight so-called 'lager-specific' genes that are located in subtelomeric regions. We evaluated the origins of these genes through bioinformatic and PCR analyses of Saccharomyces genomes. We determined that four are of cerevisiae origin while four originate from S. eubayanus. The Group I yeasts contain all four S. eubayanus genes but individual strains contain only a subset of the cerevisiae genes. We identified S. cerevisiae strains that contain all four cerevisiae 'lager-specific' genes, and distinct patterns of loss of these genes in other strains. Analysis of the subtelomeric regions uncovered patterns of loss in different S. cerevisiae strains. We identify two classes of S. cerevisiae strains: ale yeasts (Foster O) and stout yeasts with patterns of 'lager-specific' genes and subtelomeric regions identical to Group I and II S. pastorianus yeasts, respectively. These findings lead us to propose that Group I and II S. pastorianus strains originate from separate hybridization events involving different S. cerevisiae lineages. Using the combined bioinformatic and PCR data, we describe a potential classification map for industrial yeasts. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.
Pvu-II RFLP at the human lipoprotein lipase (LPL) gene locus
Energy Technology Data Exchange (ETDEWEB)
Li, S; Oka, K; Galton, D; Stocks, J
1988-03-25
Human lipoprotein lipase (LPL) cDNA, 1.6 Kbp, was isolated from human adipose cDNA library and subcloned into Bam HI site of pIB131. Pvu-II identifies a two allele polymorphism with bands at 7.0 Kb, 4.4 Kb and 2.5 Kb. The frequency was studied in 34 caucasians. The gene was assigned to 8p22. Co-dominant inheritance was demonstrated in a 2 generation family.
Martínez-Revelles, Sonia; García-Redondo, Ana B; Avendaño, María S; Varona, Saray; Palao, Teresa; Orriols, Mar; Roque, Fernanda R; Fortuño, Ana; Touyz, Rhian M; Martínez-González, Jose; Salaices, Mercedes; Rodríguez, Cristina; Briones, Ana M
2017-09-01
Vascular stiffness, structural elastin abnormalities, and increased oxidative stress are hallmarks of hypertension. Lysyl oxidase (LOX) is an elastin crosslinking enzyme that produces H 2 O 2 as a by-product. We addressed the interplay between LOX, oxidative stress, vessel stiffness, and elastin. Angiotensin II (Ang II)-infused hypertensive mice and spontaneously hypertensive rats (SHR) showed increased vascular LOX expression and stiffness and an abnormal elastin structure. Mice over-expressing LOX in vascular smooth muscle cells (TgLOX) exhibited similar mechanical and elastin alterations to those of hypertensive models. LOX inhibition with β-aminopropionitrile (BAPN) attenuated mechanical and elastin alterations in TgLOX mice, Ang II-infused mice, and SHR. Arteries from TgLOX mice, Ang II-infused mice, and/or SHR exhibited increased vascular H 2 O 2 and O 2 .- levels, NADPH oxidase activity, and/or mitochondrial dysfunction. BAPN prevented the higher oxidative stress in hypertensive models. Treatment of TgLOX and Ang II-infused mice and SHR with the mitochondrial-targeted superoxide dismutase mimetic mito-TEMPO, the antioxidant apocynin, or the H 2 O 2 scavenger polyethylene glycol-conjugated catalase (PEG-catalase) reduced oxidative stress, vascular stiffness, and elastin alterations. Vascular p38 mitogen-activated protein kinase (p38MAPK) activation was increased in Ang II-infused and TgLOX mice and this effect was prevented by BAPN, mito-TEMPO, or PEG-catalase. SB203580, the p38MAPK inhibitor, normalized vessel stiffness and elastin structure in TgLOX mice. We identify LOX as a novel source of vascular reactive oxygen species and a new pathway involved in vascular stiffness and elastin remodeling in hypertension. LOX up-regulation is associated with enhanced oxidative stress that promotes p38MAPK activation, elastin structural alterations, and vascular stiffness. This pathway contributes to vascular abnormalities in hypertension. Antioxid. Redox Signal. 27
Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry
The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the
Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying
2017-02-01
Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Xanthine oxidase in human skeletal muscle following eccentric exercise
DEFF Research Database (Denmark)
Hellsten, Ylva; Frandsen, Ulrik; Orthenblad, N.
1997-01-01
the increase in xanthine oxidase in the muscle there were no detectable changes in the levels of muscle malondialdehyde or in plasma antioxidant capacity up to 4 days post-exercise. 5. It is concluded that eccentric exercise leads to an increased level of xanthine oxidase in human muscle and that the increase...
De novo dominant mutation of SOX10 gene in a Chinese family with Waardenburg syndrome type II.
Chen, Kaitian; Zong, Ling; Liu, Min; Zhan, Yuan; Wu, Xuan; Zou, Wenting; Jiang, Hongyan
2014-06-01
Waardenburg syndrome is a rare genetic disorder, inherited as an autosomal dominant trait. The condition is characterized by sensorineural hearing loss and pigment disturbances of the hair, skin, and iris. The de novo mutation in the SOX10 gene, responsible for Waardenburg syndrome type II, is rarely seen. The present study aimed to identify the genetic causes of Waardenburg syndrome type II in a Chinese family. Clinical and molecular evaluations were conducted in a Chinese family with Waardenburg syndrome type II. A novel SOX10 heterozygous c.259-260delCT mutation was identified. Heterozygosity was not observed in the parents and sister of the proband, indicating that the mutation has arisen de novo. The novel frameshift mutation, located in exon 3 of the SOX10 gene, disrupted normal amino acid coding from Leu87, leading to premature termination at nucleotide 396 (TGA). The high mobility group domain of SOX10 was inferred to be partially impaired. The novel heterozygous c.259-260delCT mutation in the SOX10 gene was considered to be the cause of Waardenburg syndrome in the proband. The clinical and genetic characterization of this family would help elucidate the genetic heterogeneity of SOX10 in Waardenburg syndrome type II. Moreover, the de novo pattern expanded the mutation data of SOX10. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Construction of mutant glucose oxidases with increased dye-mediated dehydrogenase activity.
Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji
2012-11-02
Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.
Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity
Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji
2012-01-01
Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056
Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger
Tamayo Ramos, J.A.; Berkel, van W.J.H.; Graaff, de L.H.
2012-01-01
BACKGROUND: Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. RESULTS: The
DNA polymorphism of HLA class II genes in pauciarticular juvenile rheumatoid arthritis
DEFF Research Database (Denmark)
Morling, N; Friis, J; Fugger, L
1991-01-01
associated with the following HLA class II genes were increased in PJRA when compared to normal controls: DRB1*08 (DRw8) (35.2% vs 10.3%, RR = 4.6, p less than 10(-3), DRB3*01/02/03 (DRw52) (76.3% vs 48.1%, RR 3.5, p less than 10(-3)), DQA1*0401 (41.0% vs 7.4%, RR = 7.9, p less than 10(-3)), DQA1*0501 (55...... of DNA fragments associated with the following HLA class II genes were decreased in PJRA although not statistically significantly so after 'correction' of p values: DRB1*04 (14.8% vs 40.2%, RR = 0.27; p less than 10(-3)), DRB1*07 (0% vs 25.9%, RR = 0.04, p less than 10(-3)), DRB4*0101 (DRw53) (25.9% vs...... 53.6%, RR = 0.31, p less than 10(-3)), DQA1*0102 (11.6% vs 36.0%, RR = 0.25, p less than 10(-4)), and DQA1*0201 (2.6% vs 34.2%, RR = 0.05, p less than 10(-2)).(ABSTRACT TRUNCATED AT 250 WORDS)...
Directory of Open Access Journals (Sweden)
Xiaohui eLi
2015-06-01
Full Text Available NADPH oxidases (also known as respiratory burst oxidase homologues, Rbohs are the enzymes that catalyze the generation of reactive oxygen species (ROS in plants. In the present study, eight SlRboh genes were identified in tomato and their possible involvement in resistance to Botrytis cinerea and drought tolerance was examined. Expression of SlRbohs was induced by B. cinerea and Pseudomonas syringae pv. tomato but displayed distinct patterns. Virus-induced gene silencing (VIGS-based silencing of SlRbohB resulted in reduced resistance to B. cinerea but silencing of each of other SlRbohs did not affect the resistance. The SlRbohB-silenced plants accumulated more ROS and attenuated expression of defense genes after infection of B. cinerea than the nonsilenced plants. Silencing of SlRbohB also suppressed flg22-induced ROS burst and the expression of SlLrr22, a marker gene related to PAMP-triggered immunity (PTI. Transient expression of SlRbohB in Nicotiana benthamiana led to enhanced resistance to B. cinerea. Furthermore, silencing of SlRbohB resulted in decreased drought tolerance, accelerated water loss in leaves and altered expression of drought-responsive genes. Our data demonstrate that SlRbohB positively regulates the resistance to B. cinerea, flg22-induced PTI and drought tolerance in tomato.
International Nuclear Information System (INIS)
Katayama, Seiichi; Ashizawa, Koji; Gohma, Hiroshi; Fukuhara, Tadahiro; Narumi, Kazunori; Tsuzuki, Yasuhiro; Tatemoto, Hideki; Nakada, Tadashi; Nagai, Kenji
2006-01-01
The objective of this study was to investigate the effects of estrogen receptor (ER) agonists and an ER antagonist on the expression of Hedgehog genes (Indian hedgehog: Ihh; Desert hedgehog: Dhh) and Hedgehog target genes (Patched 1: Ptc1; glioma-associated oncogene homolog 1: Gli1; chicken ovalbumin upstream promoter transcription factor II: Coup-TfII) in the rat uterus. Immature female rats were administered once with 17α-ethynyl estradiol (EE, an ER agonist), propyl pyrazole triole (PPT, an ERα-selective agonist), diarylpropionitrile (DPN, an ERβ-selective agonist), or ICI 182,780 (an ER antagonist). Expression of mRNA for Ihh, Dhh, and Ptc1 was dose-dependently downregulated by EE in the uterus of immature rats, mediated by ER as confirmed by coadministration of ICI 182,780. The mRNA expression levels of Ptc1, Gli1, and Coup-TfII were simultaneously downregulated during the period in which the mRNA expression levels of Ihh and Dhh were downregulated in the uterus after administration of EE. PPT downregulated the transcription of Ihh, Dhh, Ptc1, Gli1, and Coup-TfII, indicating that expression of these genes was regulated by the ERα-dependent pathway. DPN also downregulated the transcription of Ihh and Dhh, although the effect was weaker than that of PPT, indicating that the regulation of uterine Ihh and Dhh transcription was also affected by the ERβ-dependent pathway. These results suggest that the expression of Hedgehog genes (Ihh, Dhh) and Hedgehog target genes (Ptc1, Gli1, Coup-TfII) is affected by estrogenic stimuli in the uterus of immature female rats
Katayama, Seiichi; Ashizawa, Koji; Gohma, Hiroshi; Fukuhara, Tadahiro; Narumi, Kazunori; Tsuzuki, Yasuhiro; Tatemoto, Hideki; Nakada, Tadashi; Nagai, Kenji
2006-12-15
The objective of this study was to investigate the effects of estrogen receptor (ER) agonists and an ER antagonist on the expression of Hedgehog genes (Indian hedgehog: Ihh; Desert hedgehog: Dhh) and Hedgehog target genes (Patched 1: Ptc1; glioma-associated oncogene homolog 1: Gli1; chicken ovalbumin upstream promoter transcription factor II: Coup-TfII) in the rat uterus. Immature female rats were administered once with 17alpha-ethynyl estradiol (EE, an ER agonist), propyl pyrazole triole (PPT, an ERalpha-selective agonist), diarylpropionitrile (DPN, an ERbeta-selective agonist), or ICI 182,780 (an ER antagonist). Expression of mRNA for Ihh, Dhh, and Ptc1 was dose-dependently downregulated by EE in the uterus of immature rats, mediated by ER as confirmed by coadministration of ICI 182,780. The mRNA expression levels of Ptc1, Gli1, and Coup-TfII were simultaneously downregulated during the period in which the mRNA expression levels of Ihh and Dhh were downregulated in the uterus after administration of EE. PPT downregulated the transcription of Ihh, Dhh, Ptc1, Gli1, and Coup-TfII, indicating that expression of these genes was regulated by the ERalpha-dependent pathway. DPN also downregulated the transcription of Ihh and Dhh, although the effect was weaker than that of PPT, indicating that the regulation of uterine Ihh and Dhh transcription was also affected by the ERbeta-dependent pathway. These results suggest that the expression of Hedgehog genes (Ihh, Dhh) and Hedgehog target genes (Ptc1, Gli1, Coup-TfII) is affected by estrogenic stimuli in the uterus of immature female rats.
Chowdhury, Animesh; Sarkar, Jaganmay; Pramanik, Pijush Kanti; Chakraborti, Tapati; Chakraborti, Sajal
2016-08-01
The aim of the present study is to establish the mechanism associated with the proliferation of PASMCs under ANG II stimulation. The results showed that treatment of PASMCs with ANG II induces an increase in cell proliferation and 100 nM was the optimum concentration for maximum increase in proliferation of the cells. Pretreatment of the cells with AT1, but not AT2, receptor antagonist inhibited ANG II induced cell proliferation. Pretreatment with pharmacological and genetic inhibitors of sphingomyelinase (SMase) and sphingosine kinase (SPHK) prevented ANG II-induced cell proliferation. ANG II has also been shown to induce SMase activity, SPHK phosphorylation and S1P production. In addition, ANG II caused an increase in proMMP-2 expression and activation, ERK1/2 phosphorylation and NADPH oxidase activation. Upon inhibition of MMP-2, SMase activity and S1P level were curbed leading to inhibition of cell proliferation. SPHK was phosphorylated by ERK1/2 during ET-1 stimulation of the cells. ANG II-induced ERK1/2 phosphorylation and proMMP-2 expression and activation in the cells were abrogated upon inhibition of NADPH oxidase activity. Overall, NADPH oxidase plays an important role in proMMP-2 expression and activation and that MMP-2 mediated SMC proliferation occurs through the involvement of Spm-Cer-S1P signaling axis under ANG II stimulation of PASMCs. Copyright © 2016 Elsevier Inc. All rights reserved.
Cytochemical Localization of Glucose Oxidase in Peroxisomes of Aspergillus niger
Veenhuis, Marten; Dijken, Johannes Pieter van
1980-01-01
The subcellular localization of glucose oxidase (E.C. 1.1.3.4) in mycelia of Aspergillus niger has been investigated using cytochemical staining techniques. Mycelia from fermenter cultures, which produced gluconic acid from glucose, contained elevated levels of glucose oxidase and catalase. Both
Directory of Open Access Journals (Sweden)
G.H.M. eSagor
2016-02-01
Full Text Available The link between polyamine oxidases (PAOs, which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5 or the peroxisomal PAO pathway (pao2 pao3 pao4 silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5 decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81% and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions.
International Nuclear Information System (INIS)
Vujaskovic, Z.; Rabbani, Z.; Zhang, X.; Samulski, T.V.; Li, C.-Y.; Anscher, M.S.
2003-01-01
Full text: The objective was to determine whether administration of recombinant human adenoviral vector carrying soluble TGF-β1 type II receptor (TβR-II) gene reduces availability of active TGFβ1 and protects lung from radiation-induced injury. Female Fisher-344 rats were randomized into four groups to receive: 1) Control 2) Adenoviral green fluorescent protein vector (AdGFP) alone 3) Radiation (RT) + Adenoviral vector with TGF-β1 type II receptor gene (AdexTβR-II-Fc) 4) RT alone. Animals were irradiated to right hemithorax using a single dose of 30 Gy. The packaging and production of a recombinant adenovirus carrying the fused human TβR-II-IgG1 Fc gene was achieved by use of the AdEasy system. The treatment vector AdexTbR-II-Fc (1.5*1010 PFU) and control vector AdGFP (1*109 PFU) were injected i.v. 24 hrs after RT. Respiratory rate was measured as an index of pulmonary function weekly for 5 weeks post RT. Structural damage was scored histologically. Immunohistochemistry was performed to identify activated macrophages. ELISA was used to quantify active TGF-β1 in tissue homogenate. Western blot was used to determine TβR-II expression in plasma and lung tissue. Animals receiving treatment vector AdexTbR-II-Fc have elevated plasma levels of soluble TβR-II at 24 and 48 hours after injection. In the RT+AdexTbR-II-Fc group, there was a significant reduction in respiratory rate (p = 0.002) at four weeks after treatment compared to RT alone group. Histology revealed a significant reduction in lung structural damage in animals receiving gene therapy after RT vs RT alone (p=0.0013). There was also a decrease in the number of activated macrophage (p= 0.02) in RT+AdexTbR-II-Fc group vs RT alone. The tissue protein expression of active TGF-β1 was significantly reduced in rats receiving RT+AdexTbR-II-Fc treatment (p<0.05). This study shows the ability of adenovirus mediated soluble TβR-II gene therapy to reduce tissue levels of active TGF-β1 and ameliorate radiation
Set, Eric; Saez, Ignacio; Zhu, Lusha; Houser, Daniel E; Myung, Noah; Zhong, Songfa; Ebstein, Richard P; Chew, Soo Hong; Hsu, Ming
2014-07-01
Game theory describes strategic interactions where success of players' actions depends on those of coplayers. In humans, substantial progress has been made at the neural level in characterizing the dopaminergic and frontostriatal mechanisms mediating such behavior. Here we combined computational modeling of strategic learning with a pathway approach to characterize association of strategic behavior with variations in the dopamine pathway. Specifically, using gene-set analysis, we systematically examined contribution of different dopamine genes to variation in a multistrategy competitive game captured by (i) the degree players anticipate and respond to actions of others (belief learning) and (ii) the speed with which such adaptations take place (learning rate). We found that variation in genes that primarily regulate prefrontal dopamine clearance--catechol-O-methyl transferase (COMT) and two isoforms of monoamine oxidase--modulated degree of belief learning across individuals. In contrast, we did not find significant association for other genes in the dopamine pathway. Furthermore, variation in genes that primarily regulate striatal dopamine function--dopamine transporter and D2 receptors--was significantly associated with the learning rate. We found that this was also the case with COMT, but not for other dopaminergic genes. Together, these findings highlight dissociable roles of frontostriatal systems in strategic learning and support the notion that genetic variation, organized along specific pathways, forms an important source of variation in complex phenotypes such as strategic behavior.
International Nuclear Information System (INIS)
Gamache, D.A.; Kornberg, L.J.; Bartolf, M.; Franson, R.C.
1986-01-01
Incubation of cardiac sarcoplasmic reticulum with xanthine oxidase alone at pH 7.0 resulted in a loss of lipid phosphorus that was potentiated by the addition of xanthine. Using autoclaved E.coli with 1- 14 C-oleate in the 2-acyl position of membrane phospholipids, the authors demonstrate that many, but not all, commercial preparations of xanthine oxidase contain significant phospholipase A 2 (PLA 2 ) activity (64.3-545.6 nmols/min/mg). The PLA 2 was maximally active in the neutral-alkaline pH range, was Ca 2+ -dependent, and was unaffected by the addition of xanthine. PLA 2 activity was totally inhibited by 1mM EDTA whereas radical production by optimal concentrations of xanthine/xanthine oxidase (X/XO) was unaffected by EDTA. Chromatographically purified xanthine oxidase (Sigma Grade III) contained high levels of PLA 2 activity (64.3 nmols/min/mg) compared to endogenous levels of neutral-active, Ca 2+ -dependent PLA 2 measured in various tissue homogenates (≤ 0.5 nmols/ min/mg). Because X/XO mixtures are used extensively to study oxygen free radical-induced cell injury and membrane phospholipid alterations, the presence of a potent extracellular PLA 2 may have influenced previously published reports, and such studies should be interpreted cautiously
Directory of Open Access Journals (Sweden)
Ruifang Ma
2017-08-01
Full Text Available Lignans, such as lariciresinol and its derivatives, have been identified as effective antiviral ingredients in Isatis indigotica. Evidence suggests that the APETALA2/ethylene response factor (AP2/ERF family might be related to the biosynthesis of lignans in I. indigotica. However, the special role played by the AP2/ERF family in the metabolism and its underlying putative mechanism still need to be elucidated. One novel AP2/ERF gene, named Ii049, was isolated and characterized from I. indigotica in this study. The quantitative real-time PCR analysis revealed that Ii049 was expressed highest in the root and responded to methyl jasmonate, salicylic acid (SA and abscisic acid treatments to various degrees. Subcellular localization analysis indicated that Ii049 protein was localized in the nucleus. Knocking-down the expression of Ii049 caused a remarkable reduction of lignan/lignin contents and transcript levels of genes involved in the lignan/lignin biosynthetic pathway. Ii049 bound to the coupled element 1, RAV1AAT and CRTAREHVCBF2 motifs of genes IiPAL and IiCCR, the key structural genes in the lignan/lignin pathway. Furthermore, Ii049 was also essential for SA biosynthesis, and SA induced lignan accumulation in I. indigotica. Notably, the transgenic I. indigotica hairy roots overexpressing Ii049 showed high expression levels of lignan/lignin biosynthetic genes and SA content, resulting in significant accumulation of lignan/lignin. The best-engineered line (OVX049-10 produced 425.60 μg·g−1 lariciresinol, an 8.3-fold increase compared with the wild type production. This study revealed the function of Ii049 in regulating lignan/lignin biosynthesis, which had the potential to increase the content of valuable lignan/lignin in economically significant medicinal plants.
Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan
2013-04-01
A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.
Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi
2015-12-10
D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.
Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R
1996-04-01
We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.
Gómez-Herreros, Fernando; Zagnoli-Vieira, Guido; Ntai, Ioanna; Martínez-Macías, María Isabel; Anderson, Rhona M; Herrero-Ruíz, Andrés; Caldecott, Keith W
2017-08-10
DNA double-strand breaks (DSBs) induced by abortive topoisomerase II (TOP2) activity are a potential source of genome instability and chromosome translocation. TOP2-induced DNA double-strand breaks are rejoined in part by tyrosyl-DNA phosphodiesterase 2 (TDP2)-dependent non-homologous end-joining (NHEJ), but whether this process suppresses or promotes TOP2-induced translocations is unclear. Here, we show that TDP2 rejoins DSBs induced during transcription-dependent TOP2 activity in breast cancer cells and at the translocation 'hotspot', MLL. Moreover, we find that TDP2 suppresses chromosome rearrangements induced by TOP2 and reduces TOP2-induced chromosome translocations that arise during gene transcription. Interestingly, however, we implicate TDP2-dependent NHEJ in the formation of a rare subclass of translocations associated previously with therapy-related leukemia and characterized by junction sequences with 4-bp of perfect homology. Collectively, these data highlight the threat posed by TOP2-induced DSBs during transcription and demonstrate the importance of TDP2-dependent non-homologous end-joining in protecting both gene transcription and genome stability.DNA double-strand breaks (DSBs) induced by topoisomerase II (TOP2) are rejoined by TDP2-dependent non-homologous end-joining (NHEJ) but whether this promotes or suppresses translocations is not clear. Here the authors show that TDP2 suppresses chromosome translocations from DSBs introduced during gene transcription.
Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity
Directory of Open Access Journals (Sweden)
Koji Sode
2012-11-01
Full Text Available Mutagenesis studies on glucose oxidases (GOxs were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe and Aspergillus niger GOx (PDB ID; 1cf3. We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.
Takemoto, Y; Sakatani, M; Takami, S; Tachibana, T; Higaki, J; Ogihara, T; Miki, T; Katsuya, T; Tsuchiyama, T; Yoshida, A; Yu, H; Tanio, Y; Ueda, E
1998-06-01
Serum angiotensin converting enzyme (SACE) is considered to reflect disease activity in sarcoidosis. SACE activity is increased in many patients with active sarcoid lesions. The mechanism for the increased SACE activity in this disease has not been clarified. ACE insertion/deletion (I/D) gene polymorphism has been reported to have an association with SACE levels in sarcoidosis, but no evidence of an association between angiotensin II receptor gene polymorphism and SACE in this disease has been found. A study of the association of angiotensin II receptor gene polymorphisms with sarcoidosis was therefore undertaken. ACE (I/D), angiotensin II type 1 receptor (AGTR1), and angiotensin II type 2 receptor (AGTR2) gene polymorphisms were investigated by polymerase chain reaction (PCR) and SACE levels were measured in three groups of patients: those with sarcoidosis or tuberculosis and normal controls. There was no difference in allele frequency of AGTR1 and AGTR2 polymorphism among the three groups. Neither AGTR1 nor AGTR2 polymorphisms were associated with sarcoidosis. SACE activity was higher in patients with sarcoidosis with the AGTR1 A/C genotype than in others. However, this tendency was not detected in patients with tuberculosis. The AGTR1 allele C is associated with high activity of SACE in patients with sarcoidosis. It is another predisposing factor for high levels of SACE in patients with sarcoidosis and is considered to be an independent factor from the ACE D allele for high levels of SACE in sarcoidosis. This fact could be one of the explanations for the increased SACE activity in sarcoidosis.
Isolation of a candidate gene for Norrie disease by positional cloning
Berger, W.; Meindl, A.; van de Pol, T. J.; Cremers, F. P.; Ropers, H. H.; Döerner, C.; Monaco, A.; Bergen, A. A.; Lebo, R.; Warburg, M.
1992-01-01
The gene for Norrie disease, an X-linked disorder characterized by progressive atrophy of the eyes, mental disturbances and deafness, has been mapped to chromosome Xp11.4 close to DXS7 and the monoamine oxidase (MAO) genes. By subcloning a YAC with a 640 kilobases (kb) insert which spans the
Wang, Lei; Fan, Daming; Fu, Lulu; Jiao, Xidong; Huang, Jianlian; Zhao, Jianxin; Yan, Bowen; Zhou, Wenguo; Zhang, Wenhai; Ye, Weijian; Zhang, Hao
2018-01-01
This study investigated the effect of glucose oxidase on the gel properties of threadfin bream surimi. The gel strength of surimi increased with the addition of 0.5‰ glucose oxidase after two-step heating. Based on the results of the chemical interactions, the hydrophobic interaction and disulfide bond of glucose oxidase-treated surimi samples increased compared with the control samples at the gelation temperature and gel modori temperature. The surface hydrophobicity of samples with glucose oxidase and glucose increased significantly ( p glucose oxidase induced more α-helixes to turn into a more elongated random and flocculent structure. Glucose oxidase changes the secondary structure of the surimi protein, making more proteins depolarize and stretch and causing actomyosin to accumulate to each other, resulting in the formation of surimi gel.
Production of rabbit antibodies against purified Glucose oxidase
Zia,Muhammad Anjum; Ain,Qurat-ul; Iftikhar,Tehreema; Abbas,Rao Zahid; Rahman,Khalil-ur
2012-01-01
Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose) resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex ...
The use of galactose oxidase in lipid labeling
International Nuclear Information System (INIS)
Radin, N.S.; Evangelatos, G.P.
1981-01-01
Galactose oxidase can be used to oxidize the terminal carbon atom of lipids containing galactose or N-acetylgalactosamine, and the resultant aldehyde group can be reduced back to the original carbinol with radioactive borohydride. The efficiency of the first reaction has been investigated systematically by using [6- 3 H]galactosyl ceramide as substrate and measuring the amount of radioactive water formed. This enabled us to establish that the addition of catalase and peroxidase greatly speeded the oxidation, that phosphate and PIPES buffers were the best among those tested, that the reaction continued for 24 hr without a second addition of galactose oxidase, and that the optimum concentration of organic solvent (tetrahydrofuran) was 50%. The suggestion if made that a similar set of variables be studied for each lipid or nonlipid by the same basic technique: labeling by the oxidase/borohydride method and use of the resultant compound as substrate
Directory of Open Access Journals (Sweden)
Schiöth Helgi B
2011-07-01
Full Text Available Abstract Background Spinal muscular atrophy (SMA type I, II and III is an autosomal recessive neuromuscular disorder caused by mutations in the survival motor neuron gene (SMN1. SMN2 is a centromeric copy gene that has been characterized as a major modifier of SMA severity. SMA type I patients have one or two SMN2 copies while most SMA type II patients carry three SMN2 copies and SMA III patients have three or four SMN2 copies. The SMN1 gene produces a full-length transcript (FL-SMN while SMN2 is only able to produce a small portion of the FL-SMN because of a splice mutation which results in the production of abnormal SMNΔ7 mRNA. Methods In this study we performed quantification of the SMN2 gene copy number in Russian patients affected by SMA type II and III (42 and 19 patients, respectively by means of real-time PCR. Moreover, we present two families consisting of asymptomatic carriers of a homozygous absence of the SMN1 gene. We also developed a novel RT-qPCR-based assay to determine the FL-SMN/SMNΔ7 mRNA ratio as SMA biomarker. Results Comparison of the SMN2 copy number and clinical features revealed a significant correlation between mild clinical phenotype (SMA type III and presence of four copies of the SMN2 gene. In both asymptomatic cases we found an increased number of SMN2 copies in the healthy carriers and a biallelic SMN1 absence. Furthermore, the novel assay revealed a difference between SMA patients and healthy controls. Conclusions We suggest that the SMN2 gene copy quantification in SMA patients could be used as a prognostic tool for discrimination between the SMA type II and SMA type III diagnoses, whereas the FL-SMN/SMNΔ7 mRNA ratio could be a useful biomarker for detecting changes during SMA pharmacotherapy.
Houde, Mario; Diallo, Amadou Oury
2008-08-27
Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.
Heshmati, Elaheh; Shirpoor, Alireza; Kheradmand, Fatemeh; Alizadeh, Mohammad; Gharalari, Farzaneh Hosseini
2018-01-01
Association between chronic alcohol intake and cardiac abnormality is well known; however, the precise underlying molecular mediators involved in ethanol-induced heart abnormalities remain elusive. This study investigated the effect of chronic ethanol exposure on calcium/calmodulin-dependent protein kinase IIδ (CaMKIIδ) gene expression and monoamine oxidase (MAO) levels and histological changes in rat heart. It was also planned to find out whether Zingiber officinale (ginger) extract mitigated the abnormalities induced by ethanol in rat heart. Male wistar rats were divided into three groups of eight animals each: control, ethanol, and ginger extract treated-ethanol (GETE) groups. After 6 weeks of treatment, the results revealed a significant increase in CaMKIIδtotal and isoforms δ2 and δ3 of CaMKIIδ gene expression as well as a significant decrease in the MAO levels in the ethanol group compared to that in the control group. Moreover, compared to the control group, the ethanol group showed histological changes, such as fibrosis, heart muscle cells proliferation, myocyte hypertrophy, vacuolization, and focal lymphocytic infiltration. Consumption of ginger extract along with ethanol ameliorated CaMKIIδtotal. In addition, compared to the ethanol group, isoforms gene expression changed and increased the reduced MAO levels and mitigated heart structural changes. These findings indicate that ethanol-induced heart abnormalities may, in part, be associated with Ca 2+ homeostasis changes mediated by overexpression of CaMKIIδ gene and the decrease of MAO levels and that these effects can be alleviated by using ginger extract as an antioxidant and anti-inflammatory agent.
Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H
2006-06-01
The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca(2+) channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli.
Zhang, Hongtao; Setubal, Joao Carlos; Zhan, Xiaobei; Zheng, Zhiyong; Yu, Lijun; Wu, Jianrong; Chen, Dingqiang
2011-06-01
Agrobacterium sp. ATCC 31749 (formerly named Alcaligenes faecalis var. myxogenes) is a non-pathogenic aerobic soil bacterium used in large scale biotechnological production of curdlan. However, little is known about its genomic information. DNA partial sequence of electron transport chains (ETCs) protein genes were obtained in order to understand the components of ETC and genomic-specificity in Agrobacterium sp. ATCC 31749. Degenerate primers were designed according to ETC conserved sequences in other reported species. DNA partial sequences of ETC genes in Agrobacterium sp. ATCC 31749 were cloned by the PCR method using degenerate primers. Based on comparative genomic analysis, nine electron transport elements were ascertained, including NADH ubiquinone oxidoreductase, succinate dehydrogenase complex II, complex III, cytochrome c, ubiquinone biosynthesis protein ubiB, cytochrome d terminal oxidase, cytochrome bo terminal oxidase, cytochrome cbb (3)-type terminal oxidase and cytochrome caa (3)-type terminal oxidase. Similarity and phylogenetic analyses of these genes revealed that among fully sequenced Agrobacterium species, Agrobacterium sp. ATCC 31749 is closest to Agrobacterium tumefaciens C58. Based on these results a comprehensive ETC model for Agrobacterium sp. ATCC 31749 is proposed.
Molecular Basis for Converting (2S-Methylsuccinyl-CoA Dehydrogenase into an Oxidase
Directory of Open Access Journals (Sweden)
Simon Burgener
2017-12-01
Full Text Available Although flavoenzymes have been studied in detail, the molecular basis of their dioxygen reactivity is only partially understood. The members of the flavin adenosine dinucleotide (FAD-dependent acyl-CoA dehydrogenase and acyl-CoA oxidase families catalyze similar reactions and share common structural features. However, both enzyme families feature opposing reaction specificities in respect to dioxygen. Dehydrogenases react with electron transfer flavoproteins as terminal electron acceptors and do not show a considerable reactivity with dioxygen, whereas dioxygen serves as a bona fide substrate for oxidases. We recently engineered (2S-methylsuccinyl-CoA dehydrogenase towards oxidase activity by rational mutagenesis. Here we characterized the (2S-methylsuccinyl-CoA dehydrogenase wild-type, as well as the engineered (2S-methylsuccinyl-CoA oxidase, in detail. Using stopped-flow UV-spectroscopy and liquid chromatography-mass spectrometry (LC-MS based assays, we explain the molecular base for dioxygen reactivity in the engineered oxidase and show that the increased oxidase function of the engineered enzyme comes at a decreased dehydrogenase activity. Our findings add to the common notion that an increased activity for a specific substrate is achieved at the expense of reaction promiscuity and provide guidelines for rational engineering efforts of acyl-CoA dehydrogenases and oxidases.
The increasing role of monoamine oxidase type B inhibitors in Parkinson's disease therapy.
Elmer, Lawrence W; Bertoni, John M
2008-11-01
The role of monoamine oxidase type B inhibitors in the treatment of Parkinson's disease has expanded with the new monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets. As primary therapy in early disease monoamine oxidase B inhibitors reduce motor disability and delay the need for levodopa. In more advanced disease requiring levodopa, adjunctive monoamine oxidase B inhibitors reduce 'off' time and may improve gait and freezing. Rasagiline and selegiline oral disintegrating tablets may reduce the safety risks associated with the amfetamine and methamfetamine metabolites of conventional oral selegiline while retaining or improving therapeutic efficacy. Articles were identified by searches of PubMed and searches on the Internet and reviewed. All articles and other referenced materials were retrieved using the keywords 'Parkinson's disease', 'treatment' and 'monoamine oxidase B inhibitor' and were published between 1960 and 2007, with older references selected for historical significance. Only papers published in English were reviewed. Accumulating data support the use of monoamine oxidase B inhibitors as monotherapy for early and mild Parkinson's disease and as adjunctive therapy for more advanced Parkinson's disease with levodopa-associated motor fluctuations. The recently released monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets, have potential advantages over conventional oral selegiline.
Amine oxidase from lentil seedlings: energetic domains and effect of temperature on activity.
Moosavi-Nejad, S Z; Rezaei-Tavirani, M; Padiglia, A; Floris, G; Moosavi-Movahedi, A A
2001-07-01
Copper/TPQ amine oxidases from mammalian and plant sources have shown many differences in substrate specificity and molecular properties. In this work the activity of lentil seedling amine oxidase was followed at various temperatures in 100 mM potassium phosphate buffer, pH 7, using benzylamine as substrate. The discontinuous Arrhenius plot of lentil amine oxidase showed two distinct phases with a jump between them. Thermal denaturation of the enzyme, using differential scanning calorimetry under the same experimental conditions, showed a transition at the same temperature ranges in the absence of substrate, indicating the occurrence of conformational changes, with an enthalpy change of about 175.9 kJ/mole. The temperature-induced changes of the activity of lentil amine oxidase are compared with those of bovine serum amine oxidase (taken from the literature).
Martin, I; Giralt, M; Viñas, O; Iglesias, R; Mampel, T; Villarroya, F
1995-01-01
The relative abundance of the mitochondrial-encoded mRNAs for cytochrome c oxidase subunit II and NADH dehydrogenase subunit I was lower in brown adipose tissue (BAT) from lactating rats than in virgin controls. This decrease was in parallel with a significant decrease in mitochondrial 16 S rRNA levels and in the relative content of mitochondrial DNA in the tissue. BAT from lactating rats showed lowered mRNA expression of the nuclear-encoded genes for the mitochondrial uncoupling protein, subunit IV of cytochrome c oxidase and the adenine nucleotide translocase isoforms ANT1 and ANT2, whereas mRNA levels for the ATP synthase beta-subunit were unchanged. However, the relative content of this last protein was lower in BAT mitochondria from lactating rats than in virgin controls. It is concluded that lactation-induced mitochondrial hypotrophy in BAT is associated with a co-ordinate decrease in the expression of the mitochondrial genome and nuclear genes for mitochondrial proteins. This decrease is caused by regulatory events acting at different levels, including pre- and post-transcriptional regulation. BAT appears to be a useful model with which to investigate the molecular mechanisms involved in the co-ordination of the expression of the mitochondrial and nuclear genomes during mitochondrial biogenesis. Images Figure 1 Figure 2 PMID:8948428
Directory of Open Access Journals (Sweden)
Lincoln Matthew R
2008-07-01
Full Text Available Abstract Background Multiple sclerosis (MS is a complex trait in which alleles at or near the class II loci HLA-DRB1 and HLA-DQB1 contribute significantly to genetic risk. The MHC class II transactivator (MHC2TA is the master controller of expression of class II genes, and methylation of the promoter of this gene has been previously been shown to alter its function. In this study we sought to assess whether or not methylation of the MHC2TA promoter pIV could contribute to MS disease aetiology. Methods In DNA from peripheral blood mononuclear cells from a sample of 50 monozygotic disease discordant MS twins the MHC2TA promoter IV was sequenced and analysed by methylation specific PCR. Results No methylation or sequence variation of the MHC2TA promoter pIV was found. Conclusion The results of this study cannot support the notion that methylation of the pIV promoter of MHC2TA contributes to MS disease risk, although tissue and timing specific epigenetic modifications cannot be ruled out.
[Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].
Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen
2018-02-10
OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.
Cao, Bangrong; Luo, Liping; Feng, Lin; Ma, Shiqi; Chen, Tingqing; Ren, Yuan; Zha, Xiao; Cheng, Shujun; Zhang, Kaitai; Chen, Changmin
2017-12-13
The clinical benefit of adjuvant chemotherapy for stage II colorectal cancer (CRC) is controversial. This study aimed to explore novel gene signature to predict outcome benefit of postoperative 5-Fu-based therapy in stage II CRC. Gene-expression profiles of stage II CRCs from two datasets with 5-Fu-based adjuvant chemotherapy (training dataset, n = 212; validation dataset, n = 85) were analyzed to identify the indicator. A systemic approach by integrating gene-expression and protein-protein interaction (PPI) network was implemented to develop the predictive signature. Kaplan-Meier curves and Cox proportional hazards model were used to determine the survival benefit of adjuvant chemotherapy. Experiments with shRNA knock-down were carried out to confirm the signature identified in this study. In the training dataset, we identified 44 PPI sub-modules, by which we separate patients into two clusters (1 and 2) having different chemotherapeutic benefit. A predictor of 11 PPI sub-modules (11-PPI-Mod) was established to discriminate the two sub-groups, with an overall accuracy of 90.1%. This signature was independently validated in an external validation dataset. Kaplan-Meier curves showed an improved outcome for patients who received adjuvant chemotherapy in Cluster 1 sub-group, but even worse survival for those in Cluster 2 sub-group. Similar results were found in both the training and the validation dataset. Multivariate Cox regression revealed an interaction effect between 11-PPI-Mod signature and adjuvant therapy treatment in the training dataset (RFS, p = 0.007; OS, p = 0.006) and the validation dataset (RFS, p = 0.002). From the signature, we found that PTGES gene was up-regulated in CRC cells which were more resistant to 5-Fu. Knock-down of PTGES indicated a growth inhibition and up-regulation of apoptotic markers induced by 5-Fu in CRC cells. Only a small proportion of stage II CRC patients could benefit from adjuvant therapy. The 11-PPI-Mod as
Ma, Ming-Ming; Gao, Min; Guo, Kai-Min; Wang, Mi; Li, Xiang-Yu; Zeng, Xue-Lin; Sun, Lu; Lv, Xiao-Fei; Du, Yan-Hua; Wang, Guan-Lei; Zhou, Jia-Guo; Guan, Yong-Yuan
2017-05-01
Ca 2+ -activated Cl - channels play a crucial role in various physiological processes. However, the role of TMEM16A in vascular endothelial dysfunction during hypertension is unclear. In this study, we investigated the specific involvement of TMEM16A in regulating endothelial function and blood pressure and the underlying mechanism. Reverse transcription-polymerase chain reaction, Western blotting, coimmunoprecipitation, confocal imaging, patch-clamp recordings, and TMEM16A endothelial-specific transgenic and knockout mice were used. We found that TMEM16A was expressed abundantly and functioned as a Ca 2+ -activated Cl - channel in endothelial cells. Angiotensin II induced endothelial dysfunction with an increase in TMEM16A expression. The knockout of endothelial-specific TMEM16A significantly lowered the blood pressure and ameliorated endothelial dysfunction in angiotensin II-induced hypertension, whereas the overexpression of endothelial-specific TMEM16A resulted in the opposite effects. These results were related to the increased reactive oxygen species production, Nox2-containing NADPH oxidase activation, and Nox2 and p22phox protein expression that were facilitated by TMEM16A on angiotensin II-induced hypertensive challenge. Moreover, TMEM16A directly bound with Nox2 and reduced the degradation of Nox2 through the proteasome-dependent degradation pathway. Therefore, TMEM16A is a positive regulator of endothelial reactive oxygen species generation via Nox2-containing NADPH oxidase, which induces endothelial dysfunction and hypertension. Modification of TMEM16A may be a novel therapeutic strategy for endothelial dysfunction-associated diseases. © 2017 American Heart Association, Inc.
Energy Technology Data Exchange (ETDEWEB)
Vandenberg, P.; Khillan, J.S.; Prockop, D.J.; Helminen, H.; Kontusaari, S.; Ala-Kokko, L. (Thomas Jefferson Univ., Philadelphia, PA (United States))
1991-09-01
A minigene version of the human gene for type II procollagen (COL2AI) was prepared that lacked a large central region containing 12 of the 52 exons and therefore 291 of the 1523 codons of the gene. The construct was modeled after sporadic in-frame deletions of collagen genes that cause synthesis of shortened pro{alpha} chains that associate with normal pro{alpha} chains and thereby cause degradation of the shortened and normal pro{alpha} chains through a process called procollagen suicide. The gene construct was used to prepare five lines of transgenic mice expressing the minigene. A large proportion of the mice expressing the minigene developed a phenotype of a chondrodysplasia with dwarfism, short and thick limbs, a short snout, a cranial bulge, a cleft palate, and delayed mineralization of bone. A number of mice died shortly after birth. Microscopic examination of cartilage revealed decreased density and organization of collagen fibrils. In cultured chondrocytes from the transgenic mice, the minigene was expressed as shortened pro{alpha}1(II) chains that were disulfide-linked to normal mouse pro{alpha}1(II) chains. Therefore, the phenotype is probably explained by depletion of the endogenous mouse type II procollagen through the phenomenon of procollagen suicide.
Lysyl oxidase in cancer research
DEFF Research Database (Denmark)
Perryman, Lara; Erler, Janine Terra
2014-01-01
Metastasis is the main reason for cancer-associated deaths and therapies are desperately needed to target the progression of cancer. Lysyl oxidase (LOX) plays a pivotal role in cancer progression, including metastasis, and is therefore is an attractive therapeutic target. In this review we...
Jänsch, André; Freiding, Simone; Behr, Jürgen; Vogel, Rudi F
2011-02-01
Lactobacillus sanfranciscensis is the key bacterium in traditional sourdough fermentation. The molecular background of its oxygen tolerance was investigated by comparison of wild type and NADH-oxidase (Nox) knock out mutants. The nox gene of L. sanfranciscensis DSM20451(T) coding for a NADH-oxidase (Nox) was inactivated by single crossover integration to yield strain L. sanfranciscensis DSM20451Δnox. By inactivation of the native NADH-oxidase gene, it was ensured that besides fructose, O(2) can react as an electron acceptor. In aerated cultures the mutant strain was only able to grow in MRS media supplemented with fructose as electron acceptor, whereas the wild type strain showed a fructose independent growth response. The use of oxygen as an external electron acceptor enables L. sanfranciscensis to shift from acetyl-phosphate into the acetate branch and gain an additionally ATP, while the reduced cofactors were regenerated by Nox-activity. In aerated cultures the wild type strain formed a fermentation ratio of lactate to acetate of 1.09 in MRS supplemented with fructose after 24 h of fermentation, while the mutant strain formed a fermentation ratio of 3.05. Additionally, L. sanfranciscensis showed manganese-dependent growth response in aerated cultures, the final OD and growth velocity was increased in media supplemented with manganese. The expression of two predicted Mn(2+)/Fe(2+) transporters MntH1 and MntH2 in L. sanfranciscensis DSM20451(T) was verified by amplification of a 318 bp fragment of MntH1 and a 239 bp fragment of MntH2 from cDNA library obtained from aerobically, exponentially growing cells of L. sanfranciscensis DSM20451(T) in MRS. Moreover, the mutant strain DSM20451Δnox was more sensitive to the superoxide generating agent paraquat and showed inhibition of growth on diamide-treated MRS-plates without fructose supplementation. Copyright © 2010 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Penkowa, Milena; Cáceres, Mario; Borup, Rehannah
2006-01-01
of the somatosensorial cortex and killed at 0, 1, 4, 8, and 16 days postlesion (dpl) using Affymetrix genechips/oligonucleotide arrays interrogating approximately 10,000 different murine genes (MG_U74Av2). Hierarchical clustering analysis of these genes readily shows an orderly pattern of gene responses at specific...... and opened new avenues that were confirmed by immunohistochemistry. Data in KO, MT-I-overexpressing, and MT-II-injected mice strongly suggest a role of these proteins in postlesional activation of neural stem cells....
Mural granulosa cell gene expression associated with oocyte developmental competence
Directory of Open Access Journals (Sweden)
Jiang Jin-Yi
2010-03-01
Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and
Jakubowska, Dagmara; Janicka, Małgorzata
2017-11-01
The present research aim was to define the role of brassinosteroids (BRs) in plant adaptation to cadmium stress. We observed a stimulating effect of exogenous BR on the activity of two plasma membrane enzymes which play a key role in plants adaptation to cadmium stress, H + -ATPase (EC 3.6.3.14) and NADPH oxidase (EC 1.6.3.1). Using anti-phosphothreonine antibody we showed that modification of PM H + -ATPase activity under BR action could result from phosphorylation of the enzyme protein. Also the relative expression of genes encoding both PM H + -ATPase and NADPH oxidase was affected by BR. To confirm the role of BR in the cadmium stimulating effect on activity of both studied plasma membrane enzymes, an assay in the presence of a BR biosynthesis inhibitor (propiconazole) was performed. Moreover, as a tool in our work we used commercially available plant mutants unable to BR biosynthesis or with dysfunctional BR signaling pathway, to further confirm participation of BR in plant adaptation to heavy metal stress. Presented results demonstrate some elements of the brassinosteroid-induced pathway activated under cadmium stress, wherein H + -ATPase and NADPH oxidase are key factors. Copyright © 2017 Elsevier B.V. All rights reserved.
Fluorescent Probes for Analysis and Imaging of Monoamine Oxidase Activity
Energy Technology Data Exchange (ETDEWEB)
Kim, Dokyoung; Jun, Yong Woong; Ahn, Kyo Han [POSTECH, Pohang (Korea, Republic of)
2014-05-15
Monoamine oxidases catalyze the oxidative deamination of dietary amines and amine neurotransmitters, and assist in maintaining the homeostasis of the amine neurotransmitters in the brain. Dysfunctions of these enzymes can cause neurological and behavioral disorders including Parkinson's and Alzheimer's diseases. To understand their physiological roles, efficient assay methods for monoamine oxidases are essential. Reviewed in this Perspective are the recent progress in the development of fluorescent probes for monoamine oxidases and their applications to enzyme assays in cells and tissues. It is evident that still there is strong need for a fluorescent probe with desirable substrate selectivity and photophysical properties to challenge the much unsolved issues associated with the enzymes and the diseases.
A new fatal case of pyridox(am)ine 5'-phosphate oxidase (PNPO) deficiency.
Ruiz, Angeles; García-Villoria, Judit; Ormazabal, Aida; Zschocke, Johannes; Fiol, Miquel; Navarro-Sastre, Aleix; Artuch, Rafael; Vilaseca, Maria Antonia; Ribes, Antonia
2008-02-01
We present a patient with severe pyridox(am)ine 5'-phosphate oxidase deficiency and homozygosity for a novel nonsense-mutation, p.A174X, in the PNPO gene who died with pyridoxal phosphate (PLP) treatment despite initial clinical recovery. He presented neonatally, with the classical clinical symptoms of the disease. Increase of urinary vanillactate was the first biochemical factor of alert. Amino acid and neurotransmitter analysis in CSF indicated reduced activity of several PLP-dependent enzymes. The diagnosis was confirmed by mutational studies. From this and the other reported patients it may be concluded that the administration of PLP should not be delayed until the complete biochemical evidence is obtained.
Deficiency of Nox2 prevents angiotensin II-induced inward remodeling in cerebral arterioles
Directory of Open Access Journals (Sweden)
Siu-Lung eChan
2013-06-01
Full Text Available Angiotensin II is an important determinant of inward remodeling in cerebral arterioles. Many of the vascular effects of angiotensin II are mediated by reactive oxygen species generated from homologues of NADPH oxidase with Nox2 predominating in small arteries and arterioles. Therefore, we tested the hypothesis that superoxide generated by Nox2 plays a role in angiotensin II-induced cerebral arteriolar remodeling. We examined Nox2-deficient and wild-type mice in which a pressor or a non-pressor dose of angiotensin II (1000 or 200 ng/kg/day or saline was infused for 4 weeks via osmotic minipumps. Systolic arterial pressure was measured by a tail-cuff method. Pressure and diameter of cerebral arterioles were measured through an open cranial window in anesthetized mice. Cross-sectional area (by histology and superoxide level (by hydroethidine staining of cerebral arterioles were determined ex vivo. The pressor, but not the non-pressor, dose of angiotensin II significantly increased systolic arterial pressure in both wild-type and Nox2-deficient mice. Both doses of angiotensin II increased superoxide levels and significantly reduced external diameter in maximally dilated cerebral arterioles in wild-type mice. Increased superoxide and inward remodeling were prevented in Nox2-deficient mice. Moreover, only the pressor dose of AngII increased cross-sectional area of arteriolar wall in wild-type mice and was prevented in Nox2-deficient mice. In conclusion, superoxide derived from Nox2-containing NADPH oxidase plays an important role in angiotensin II-mediated inward remodeling in cerebral arterioles. This effect appears to be independent of pressure and different from that of hypertrophy.
[Experimental rationale for the parameters of a rapid method for oxidase activity determination].
Butorina, N N
2010-01-01
Experimental rationale is provided for the parameters of a rapid (1-2-min) test to concurrently determine the oxidase activity of all bacteria grown on the membrane filter after water filtration. Oxidase reagents that are the aqueous solutions of tetramethyl-p-phenylenediamine dihydrochloride and demethyl-p-phenylenediamine dihydrochloride have been first ascertained to exert no effect on the viability and enzymatic activity of bacteria after one-hour contact. An algorithm has been improved for the rapid oxidase activity test: the allowable time for bacteria to contact oxidase reagents and procedures for minimizing the effect on bacterial biochemical activity following the contact. An accelerated method based on lactose medium with tergitol 7 and Endo agar has been devised to determine coliform bacteria, by applying the rapid oxidase test: the time of a final response is 18-24 hours. The method has been included into GOST 52426-2005.
Action of DCCD on the H+/O stoichiometry of mitoplast cytochrome c oxidase.
Lehninger, A L; Reynafarje, B; Costa, L
1985-01-01
The mechanistic H+/O ejection stoichiometry of the cytochrome c oxidase reaction in rat liver mitoplasts is close to 4 at level flow when the reduced oxidase is pulsed with O2. Dicyclohexylcarbodiimide (DCCD) up to 30 nmol/mg protein fails to influence the rate of electron flow through the mitoplast oxidase, but inhibits H+ ejection. The inhibition of H+ ejection appears to be biphasic; ejection of 2-3 H+ per O is completely inhibited by very low DCCD, whereas inhibition of the remaining H+ ejection requires very much higher concentrations of DCCD. This effect suggests the occurrence of two types of H+ pumps in the native cytochrome oxidase of mitoplasts.
Cox1 mutation abrogates need for Cox23 in cytochrome c oxidase biogenesis
Directory of Open Access Journals (Sweden)
Richard Dela Cruz
2016-06-01
Full Text Available Cox23 is a known conserved assembly factor for cytochrome c oxidase, although its role in cytochrome c oxidase (CcO biogenesis remains unresolved. To gain additional insights into its role, we isolated spontaneous suppressors of the respiratory growth defect in cox23∆ yeast cells. We recovered independent colonies that propagated on glycerol/lactate medium for cox23∆ cells at 37°C. We mapped these mutations to the mitochondrial genome and specifically to COX1 yielding an I101F substitution. The I101F Cox1 allele is a gain-of-function mutation enabling yeast to respire in the absence of Cox23. CcO subunit steady-state levels were restored with the I101F Cox1 suppressor mutation and oxygen consumption and CcO activity were likewise restored. Cells harboring the mitochondrial genome encoding I101F Cox1 were used to delete genes for other CcO assembly factors to test the specificity of the Cox1 mutation as a suppressor of cox23∆ cells. The Cox1 mutant allele fails to support respiratory growth in yeast lacking Cox17, Cox19, Coa1, Coa2, Cox14 or Shy1, demonstrating its specific suppressor activity for cox23∆ cells.
DEFF Research Database (Denmark)
Blume, N; Petersen, J S; Andersen, L C
1992-01-01
is induced in the transformed heterogeneous rat islet cell clone, NHI-6F, by transient in vivo passage. During this process a transfected human insulin gene is coactivated with the endogenous nonallelic rat insulin I and II genes. Newly established cultures from NHI-6F insulinomas having a high frequency...
DEFF Research Database (Denmark)
Farver, Ole; Wherland, Scot; Antholine, William E
2010-01-01
The functioning of cytochrome c oxidases involves orchestration of long-range electron transfer (ET) events among the four redox active metal centers. We report the temperature dependence of electron transfer from the Cu(A)(r) site to the low-spin heme-(a)b(o) site, i.e., Cu(A)(r) + heme-a(b)(o) ......The functioning of cytochrome c oxidases involves orchestration of long-range electron transfer (ET) events among the four redox active metal centers. We report the temperature dependence of electron transfer from the Cu(A)(r) site to the low-spin heme-(a)b(o) site, i.e., Cu(A)(r) + heme...... in cytochrome ba(3) had no effect on the rate of this reaction whereas the II-Met160Leu Cu(A)-mutation was slower by an amount corresponding to a decreased driving force of ∼0.06 eV. The structures support the presence of a common, electron-conducting "wire" between Cu(A) and heme-a(b). The transfer...
Vanillyl-alcohol oxidase, a tasteful biocatalyst
Heuvel, van den R.H.H.; Fraaije, M.W.; Mattevi, A.; Laane, C.; Berkel, van W.J.H.
2001-01-01
The covalent flavoenzyme vanillyl-alcohol oxidase (VAO) is a versatile biocatalyst. It converts a wide range of phenolic compounds by catalysing oxidation, deamination, demethylation, dehydrogenation and hydroxylation reactions. The production of natural vanillin, 4-hydroxybenzaldehyde, coniferyl
Directory of Open Access Journals (Sweden)
Diallo Amadou
2008-08-01
Full Text Available Abstract Background Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive that differ in their response to Al were performed. Results Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. Conclusion In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.
Unique role of NADPH oxidase 5 in oxidative stress in human renal proximal tubule cells
Directory of Open Access Journals (Sweden)
Peiying Yu
2014-01-01
Full Text Available NADPH oxidases are the major sources of reactive oxygen species in cardiovascular, neural, and kidney cells. The NADPH oxidase 5 (NOX5 gene is present in humans but not rodents. Because Nox isoforms in renal proximal tubules (RPTs are involved in the pathogenesis of hypertension, we tested the hypothesis that NOX5 is differentially expressed in RPT cells from normotensive (NT and hypertensive subjects (HT. We found that NOX5 mRNA, total NOX5 protein, and apical membrane NOX5 protein were 4.2±0.7-fold, 5.2±0.7-fold, and 2.8±0.5-fold greater in HT than NT. Basal total NADPH oxidase activity was 4.5±0.2-fold and basal NOX5 activity in NOX5 immunoprecipitates was 6.2±0.2-fold greater in HT than NT (P=<0.001, n=6–14/group. Ionomycin increased total NOX and NOX5 activities in RPT cells from HT (P<0.01, n=4, ANOVA, effects that were abrogated by pre-treatment of the RPT cells with diphenylene-iodonium or superoxide dismutase. Silencing NOX5 using NOX5-siRNA decreased NADPH oxidase activity (−45.1±3.2% vs. mock-siRNA, n=6–8 in HT. D1-like receptor stimulation decreased NADPH oxidase activity to a greater extent in NT (−32.5±1.8% than HT (−14.8±1.8. In contrast to the marked increase in expression and activity of NOX5 in HT, NOX1 mRNA and protein were minimally increased in HT, relative to NT; total NOX2 and NOX4 proteins were not different between HT and NT, while the increase in apical RPT cell membrane NOX1, NOX2, and NOX4 proteins in HT, relative to NT, was much less than those observed with NOX5. Thus, we demonstrate, for the first time, that NOX5 is expressed in human RPT cells and to greater extent than the other Nox isoforms in HT than NT. We suggest that the increased expression of NOX5, which may be responsible for the increased oxidative stress in RPT cells in human essential hypertension, is caused, in part, by a defective renal dopaminergic system.
Prdm5 Regulates Collagen Gene Transcription by Association with RNA Polymerase II in Developing Bone
DEFF Research Database (Denmark)
Galli, Giorgio Giacomo; Honnens de Lichtenberg, Kristian; Carrara, Matteo
2012-01-01
and fibrillogenesis by binding inside the Col1a1 gene body and maintaining RNA polymerase II occupancy. In vivo, Prdm5 loss results in delayed ossification involving a pronounced impairment in the assembly of fibrillar collagens. Collectively, our results define a novel role for Prdm5 in sustaining...
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Heuvel, L.P.W.J. van den; Koul, K. Op de; Knots, E.; Knoers, N.V.A.M.; Monnens, L.A.H.
2001-01-01
BACKGROUND: At present the genetic defect for autosomal recessive and autosomal dominant hypophosphataemic rickets with hypercalciuria (HHRH) is unknown. Type II sodium/phosphate cotransporter (NPT2) gene is a serious candidate for being the causative gene in either or both autosomal recessive and
Zn(II)-dipicolylamine-based metallo-lipids as novel non-viral gene vectors.
Su, Rong-Chuan; Liu, Qiang; Yi, Wen-Jing; Zhao, Zhi-Gang
2017-08-01
In this study, a series of Zn(II)-dipicolylamine (Zn-DPA) based cationic lipids bearing different hydrophobic tails (long chains, α-tocopherol, cholesterol or diosgenin) were synthesized. Structure-activity relationship (SAR) of these lipids was studied in detail by investigating the effects of several structural aspects including the type of hydrophobic tails, the chain length and saturation degree. In addition, several assays were used to study their interactions with plasmid DNA, and results reveal that these lipids could condense DNA into nanosized particles with appropriate size and zeta-potentials. MTT-based cell viability assays showed that lipoplexes 5 had low cytotoxicity. The in vitro gene transfection studies showed the hydrophobic tails clearly affected the TE, and hexadecanol-containing lipid 5b gives the best TE, which was 2.2 times higher than bPEI 25k in the presence of 10% serum. The results not only demonstrate that these lipids might be promising non-viral gene vectors, but also afford us clues for further optimization of lipidic gene delivery materials.
Veenhuis, M.; Wendelaar Bonga, S.E.
1979-01-01
The distribution of catalase, amino acid oxidase, α-hydroxy acid oxidase, urate oxidase and alcohol oxidase was studied cytochemically in rat hepatocytes. The presence of catalase was demonstrated with the conventional diaminobenzidine technique. Oxidase activities were visualized with methods based
Directory of Open Access Journals (Sweden)
Bouziane Moumen
2012-01-01
Full Text Available Diarrheic food poisoning by bacteria of the Bacillus cereus group is mostly due to several toxins encoded in the genomes. One of them, cytotoxin K, was recently identified as responsible for severe necrotic syndromes. Cytotoxin K is similar to a class of proteins encoded by genes usually annotated as haemolysin II (hlyII in the majority of genomes of the B. cereus group. The partially sequenced genome of Bacillus thuringiensis var israelensis ATCC35646 contains several potentially induced prophages, one of them integrated into the hlyII gene. We determined the complete sequence and established the genomic organization of this prophage-designated phIS3501. During induction of excision of this prophage with mitomycin C, intact hlyII gene is formed, thus providing to cells a genetic ability to synthesize the active toxin. Therefore, this prophage, upon its excision, can be implicated in the regulation of synthesis of the active toxin and thus in the virulence of bacterial host. A generality of selection for such systems in bacterial pathogens is indicated by the similarity of this genetic arrangement to that of Staphylococcus aureus β-haemolysin.
Lysyl Oxidase and the Tumor Microenvironment
Directory of Open Access Journals (Sweden)
Tong-Hong Wang
2016-12-01
Full Text Available The lysyl oxidase (LOX family of oxidases contains a group of extracellular copper-dependent enzymes that catalyze the cross-linking of collagen and elastin by oxidation, thus maintaining the rigidity and structural stability of the extracellular matrix (ECM. Aberrant expression or activation of LOX alters the cellular microenvironment, leading to many diseases, including atherosclerosis, tissue fibrosis, and cancer. Recently, a number of studies have shown that LOX is overexpressed in most cancers and that it is involved in the regulation of tumor progression and metastasis. In contrast, a few reports have also indicated the tumor-suppressing role of LOX. In this short review, we discuss recent research on the correlations between LOX and cancer. Further, the role of LOX in tumor microenvironment remodeling, tumorigenesis, and metastasis and the underlying mechanisms have also been elucidated.
International Nuclear Information System (INIS)
Wang Haoyang; Hou Yanning; Cui Yingxia; Huang Yufeng; Shi Yichao; Xia Xinyi; Lu Hongyong; Wang Yunhua; Li Xiaojun
2009-01-01
Twenty-four individuals were investigated that spanned six generations in a Chinese family affected with an apparently autosomal dominant form of dentinogenesis imperfecta type II (DGI-II, OMIM 125490). All affected individuals presented with typical, clinical and radiographic features of DGI-II, but without bilateral progressive high-frequency sensorineural hearing loss. To investigate the mutated molecule, a positional candidate approach was used to determine the mutated gene in this family. Genomic DNA was obtained from 24 affected individuals, 18 unaffected relatives of the family and 50 controls. Haplotype analysis was performed using leukocyte DNA for 6 short tandem repeat (STR) markers present in chromosome 4 (D4S1534, GATA62A11, DSPP, DMP1, SPP1 and D4S1563). In the critical region between D4S1534 and DMP1, the dentin sialophosphoprotein (DSPP) gene (OMIM *125485) was considered as the strongest candidate gene. The first four exons and exon/intron boundaries of the gene were analyzed using DNA from 24 affected individuals and 18 unaffected relatives of the same family. DNA sequencing revealed a heterozygous deletion mutation in intron 2 (at positions -3 to -25), which resulted in a frameshift mutation, that changed the acceptor site sequence from CAG to AAG (IVS2-3C→A) and may also have disrupted the branch point consensus sequence in intron 2. The mutation was found in the 24 affected individuals, but not in the 18 unaffected relatives and 50 controls. The deletion was identified by allele-specific sequencing and denaturing high-performance liquid chromatography (DHPLC) analysis. We conclude that the heterozygous deletion mutation contributed to the pathogenesis of DGI-II
Directory of Open Access Journals (Sweden)
Xinchi Shi
2016-09-01
Full Text Available Redox homeostasis is fundamental to the maintenance of metabolism. Redox imbalance can cause oxidative stress, which affects metabolism and growth. Water-forming NADH oxidase regulates the redox balance by oxidizing cytosolic NADH to NAD+, which relieves cytosolic NADH accumulation through rapid glucose consumption in Saccharomyces cerevisiae, thus decreasing the production of the byproduct glycerol in industrial ethanol production. Here, we studied the effects of overexpression of a water-forming NADH oxidase from Lactococcus lactis on the stress response of S. cerevisiae in aerobic batch fermentation, and we constructed an interaction network of transcriptional regulation and metabolic networks to study the effects of and mechanisms underlying NADH oxidase regulation. The oxidase-overexpressing strain (NOX showed increased glucose consumption, growth, and ethanol production, while glycerol production was remarkably lower. Glucose was exhausted by NOX at 26 h, while 18.92 ± 0.94 g/L residual glucose was left in the fermentation broth of the control strain (CON at this time point. At 29.5 h, the ethanol concentration for NOX peaked at 35.25 ± 1.76 g/L, which was 14.37 % higher than that for CON (30.82 ± 1.54 g/L. Gene expression involved in the synthesis of thiamine, which is associated with stress responses in various organisms, was increased in NOX. The transcription factor HAP4 was significantly upregulated in NOX at the late-exponential phase, indicating a diauxic shift in response to starvation. The apoptosis-inducing factor Nuc1 was downregulated while the transcription factor Sok2, which regulates the production of the small signaling molecule ammonia, was upregulated at the late-exponential phase, benefiting young cells on the rim. Reactive oxygen species production was decreased by 10% in NOX, supporting a decrease in apoptosis. The HOG pathway was not activated, although the osmotic stress was truly higher, indicating improved
International Nuclear Information System (INIS)
Kedzierska, Barbara; Glinkowska, Monika; Iwanicki, Adam; Obuchowski, Michal; Sojka, Piotr; Thomas, Mark S.; Wegrzyn, Grzegorz
2003-01-01
The bacteriophage λ cII gene codes for a transcriptional activator protein which is a crucial regulator at the stage of the 'lysis-versus-lysogeny' decision during phage development. The CII protein is highly toxic to the host, Escherichia coli, when overproduced. However, the molecular mechanism of this toxicity is not known. Here we demonstrate that DNA synthesis, but not total RNA synthesis, is strongly inhibited in cII-overexpressing E. coli cells. The toxicity was also observed when the transcriptional stimulator activity of CII was abolished either by a point mutation in the cII gene or by a point mutation, rpoA341, in the gene coding for the RNA polymerase α subunit. Moreover, inhibition of cell growth, caused by both wild-type and mutant CII proteins in either rpoA + or rpoA341 hosts, could be relieved by overexpression of the E. coli dnaB and dnaC genes. In vitro replication of an oriC-based plasmid DNA was somewhat impaired by the presence of the CII, and several CII-resistant E. coli strains contain mutations near dnaC. We conclude that the DNA replication machinery may be a target for the toxic activity of CII
Pang, Lijuan; Qiu, Tao; Cao, Xu; Wan, Mei
2011-07-01
Smad4, originally isolated from the human chromosome 18q21, is a key factor in transducing the signals of the TGF-β superfamily of growth hormones and plays a pivotal role in mediating antimitogenic and proapoptotic effects of TGF-β, but the mechanisms by which Smad4 induces apoptosis are elusive. Here we report that Smad4 directly translocates to the mitochondria of apoptotic cells. Smad4 gene silencing by siRNA inhibits TGF-β-induced apoptosis in Hep3B cells and UV-induced apoptosis in PANC-1 cells. Cell fractionation assays demonstrated that a fraction of Smad4 translocates to mitochondria after long time TGF-β treatment or UV exposure, during which the cells were under apoptosis. Smad4 mitochondria translocation during apoptosis was also confirmed by fluorescence observation of Smad4 colocalization with MitoTracker Red. We searched for mitochondria proteins that have physical interactions with Smad4 using yeast two-hybrid screening approach. DNA sequence analysis identified 34 positive clones, five of which encoded subunits in mitochondria complex IV, i.e., one clone encoded cytochrome c oxidase COXII, three clones encoded COXIII and one clone encoded COXVb. Strong interaction between Smad4 with COXII, an important apoptosis regulator, was verified in yeast by β-gal activity assays and in mammalian cells by immunoprecipitation assays. Further, mitochondrial portion of cells was isolated and the interaction between COXII and Smad4 in mitochondria upon TGF-β treatment or UV exposure was confirmed. Importantly, targeting Smad4 to mitochondria using import leader fusions enhanced TGF-β-induced apoptosis. Collectively, the results suggest that Smad4 promote apoptosis of the cells through its mitochondrial translocation and association with mitochondria protein COXII. Copyright © 2011 Elsevier Inc. All rights reserved.
Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.
Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J
1997-03-25
1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.
Up-Streaming Process for Glucose Oxidase by Thermophilic Penicillium sp. in Shake Flask
Muhammad Mohsin JAVED; Aroosh SHABIR; Sana ZAHOOR; Ikram UL-HAQ
2012-01-01
The present study is concerned with the production of glucose oxidase (GOD) from thermophilic Penicillium sp. in 250 mL shake flask. Fourteen different strains of thermophilic Penicillium sp. were isolated from the soil and were screened for glucose oxidase production. IIBP-13 strain gave maximum extra-cellular glucose oxidase production as compared to other isolates. Effect of submerged fermentation in shaking and static conditions, different carbon sources and incubation period on the produ...
Association analysis of class II cytokine and receptor genes in vitiligo patients.
Traks, Tanel; Karelson, Maire; Reimann, Ene; Rätsep, Ranno; Silm, Helgi; Vasar, Eero; Kõks, Sulev; Kingo, Külli
2016-05-01
The loss of melanocytes in vitiligo is mainly attributed to defective autoimmune mechanisms and lately autoinflammatory mediators have become more emphasized. Among these, a number of class II cytokines and their receptors have displayed altered expression patterns in vitiligo. Thus, we selected 30 SNPs from the regions of respective genes to be genotyped in Estonian case-control sample (109 and 328 individuals, respectively). For more precise analyses, patients were divided into subgroups based on vitiligo progression activity, age of onset, sex, occurrence of vitiligo among relatives, extent of depigmented areas, appearance of Köbner's phenomenon, existence of halo nevi, occurrence of spontaneous repigmentation, and amount of thyroid peroxidase antibodies. No associations appeared in whole vitiligo group. In subgroups, several allelic and haplotype associations were found. The strongest involved SNPs rs12301088 (near IL26 gene), that was associated with familial vitiligo and existence of halo nevi, and rs2257167 (IFNAR1 gene), that was associated with female vitiligo. Additionally, haplotypes consisting of rs12301088 and rs12321603 alleles (IL26-IL22 genes), that were associated with familial vitiligo and existence of halo nevi. In conclusion, several genetic associations with vitiligo subphenotypes were revealed and functional explanations to these remain to be determined in respective studies. Copyright © 2016. Published by Elsevier Inc.
Ridge, Justin P; Lin, Marianne; Larsen, Eloise I; Fegan, Mark; McEwan, Alastair G; Sly, Lindsay I
2007-04-01
Pedomicrobium sp. ACM 3067 is a budding-hyphal bacterium belonging to the alpha-Proteobacteria which is able to oxidize soluble Mn2+ to insoluble manganese oxide. A cosmid, from a whole-genome library, containing the putative genes responsible for manganese oxidation was identified and a primer-walking approach yielded 4350 bp of novel sequence. Analysis of this sequence showed the presence of a predicted three-gene operon, moxCBA. The moxA gene product showed homology to multicopper oxidases (MCOs) and contained the characteristic four copper-binding motifs (A, B, C and D) common to MCOs. An insertion mutation of moxA showed that this gene was essential for both manganese oxidation and laccase-like activity. The moxB gene product showed homology to a family of outer membrane proteins which are essential for Type I secretion in Gram-negative bacteria. moxBA has not been observed in other manganese-oxidizing bacteria but homologues were identified in the genomes of several bacteria including Sinorhizobium meliloti 1021 and Agrobacterium tumefaciens C58. These results suggest that moxBA and its homologues constitute a family of genes encoding an MCO and a predicted component of the Type I secretion system.
NADPH oxidases as novel pharmacologic targets against influenza A virus infection.
Vlahos, Ross; Selemidis, Stavros
2014-12-01
Influenza A viruses represent a major global health care challenge, with imminent pandemics, emerging antiviral resistance, and long lag times for vaccine development, raising a pressing need for novel pharmacologic strategies that ideally target the pathology irrespective of the infecting strain. Reactive oxygen species (ROS) pervade all facets of cell biology with both detrimental and protective properties. Indeed, there is compelling evidence that activation of the NADPH oxidase 2 (NOX2) isoform of the NADPH oxidase family of ROS-producing enzymes promotes lung oxidative stress, inflammation, injury, and dysfunction resulting from influenza A viruses of low to high pathogenicity, as well as impeding virus clearance. By contrast, the dual oxidase isoforms produce ROS that provide vital protective antiviral effects for the host. In this review, we propose that inhibitors of NOX2 are better alternatives than broad-spectrum antioxidant approaches for treatment of influenza pathologies, for which clinical efficacy may have been limited owing to poor bioavailability and inadvertent removal of beneficial ROS. Finally, we briefly describe the current suite of NADPH oxidase inhibitors and the molecular features of the NADPH oxidase enzymes that could be exploited by drug discovery for development of more specific and novel inhibitors to prevent or treat disease caused by influenza. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.
Two X-linked chronic granulomatous disease patients with unusual NADPH oxidase properties
Wolach, Baruch; Broides, Arnon; Zeeli, Tal; Gavrieli, Ronit; de Boer, Martin; van Leeuwen, Karin; Levy, Jacov; Roos, Dirk
2011-01-01
Chronic granulomatous disease (CGD) is an immune deficiency syndrome caused by defects in the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, the enzyme that generates reactive oxygen species (ROS) in phagocytizing leukocytes. This study evaluates the NADPH oxidase capacity in two
Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao
2016-01-01
The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066
Jonathan M. LaMantia; Ambika Chandra; David R. Huff
2018-01-01
Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO) has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning prime...
International Nuclear Information System (INIS)
Xu, Shanqin; Zhi, Hui; Hou, Xiuyun; Jiang, Bingbing
2011-01-01
Highlights: → We examine how angiotensin II modulates ERK-NF-κB crosstalk and gene expression. → Angiotensin II suppresses IL-1β-induced prolonged ERK and NF-κB activation. → ERK-RSK1 signaling is required for IL-1β-induced prolonged NF-κB activation. → Angiotensin II modulates NF-κB responsive genes via regulating ERK-NF-κB crosstalk. → ERK-NF-κB crosstalk is a novel mechanism regulating inflammatory gene expression. -- Abstract: Angiotensin II is implicated in cardiovascular diseases, which is associated with a role in increasing vascular inflammation. The present study investigated how angiotensin II modulates vascular inflammatory signaling and expression of inducible nitric oxide synthase (iNOS) and vascular cell adhesion molecule (VCAM)-1. In cultured rat aortic vascular smooth muscle cells (VSMCs), angiotensin II suppressed interleukin-1β-induced prolonged phosphorylation of extracellular signal-regulated kinase (ERK) and ribosomal S6 kinase (RSK)-1, and nuclear translocation of nuclear factor (NF)-κB, leading to decreased iNOS but enhanced VCAM-1 expression, associated with an up-regulation of mitogen-activated protein kinase phosphatase-1 expression. Knock-down of RSK1 selectively down regulated interleukin-1β-induced iNOS expression without influencing VCAM-1 expression. In vivo experiments showed that interleukin-1β, iNOS, and VCAM-1 expression were detectable in the aortic arches of both wild-type and apolipoprotein E-deficient (ApoE -/- ) mice. VCAM-1 and iNOS expression were higher in ApoE -/- than in wild type mouse aortic arches. Angiotensin II infusion (3.2 mg/kg/day, for 6 days, via subcutaneous osmotic pump) in ApoE -/- mice enhanced endothelial and adventitial VCAM-1 and iNOS expression, but reduced medial smooth muscle iNOS expression associated with reduced phosphorylation of ERK and RSK-1. These results indicate that angiotensin II can differentially modulate inflammatory gene expression in aortic smooth muscle cells
Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.
2015-01-01
Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614
International Nuclear Information System (INIS)
Anouar, Y.; Duval, J.
1991-01-01
Secretogranin II (SgII) is a protein of pituitary secretory granules released by LHRH-stimulated gonadotrope cells. Estrogens and androgens are modulators of SgII release. Experiments were performed to determine the regulation of expression of the SgII gene in the female rat pituitary, during sexual maturation and according to the estrous cycle. Age- and cycle-related changes in SgII mRNA content were estimated through cytoplasmic slot blot; SgII content was determined by western blotting; maturation of the protein was controlled through [35S]sulfate labeling. Variations in chromogranin A (CgA), another protein of secretory granules, were analyzed in the same experimental conditions to assess the specificity of SgII regulation. The pituitary SgII concentration increased between days 7 and 21 (2.2-fold) and then declined to the initial 7-day-old value. Simultaneously, the CgA concentration went through a maximum between days 14 and 21 and then strongly dropped to barely detectable levels in the adult pituitary. The SgII mRNA concentration followed roughly the same pattern as the protein. Moreover, the sulfation level remained constant between days 14 and 60. These results demonstrated a regulatory mechanism operating, during sexual maturation, on the SgII gene and not on the protein processing or on storage/release steps. In the 4-day cycling females, the pituitary SgII mRNA and protein contents were the lowest during estrus. They then increased to their highest values in diestrus II. Moreover, the sulfation level of SgII was significantly higher during estrus than during any other stage. Due to its low content level, variations in pituitary CgA could not be demonstrated during the cycle
Goodman, Stephen I; Binard, Robert J; Woontner, Michael R; Frerman, Frank E
2002-01-01
Glutaric acidemia type II is a human inborn error of metabolism which can be due to defects in either subunit of electron transfer flavoprotein (ETF) or in ETF:ubiquinone oxidoreductase (ETF:QO), but few disease-causing mutations have been described. The ETF:QO gene is located on 4q33, and contains 13 exons. Primers to amplify these exons are presented, together with mutations identified by molecular analysis of 20 ETF:QO-deficient patients. Twenty-one different disease-causing mutations were identified on 36 of the 40 chromosomes.
An association study of suicide and candidate genes in the serotonergic system
DEFF Research Database (Denmark)
Buttenschøn, Henriette N; Flint, Tracey J; Foldager, Leslie
2013-01-01
Introduction: Strong evidence demonstrates a genetic susceptibility to suicidal behaviour and a relationship between suicide and mental disorders. The aim of this study was to test for association between suicide and five selected genetic variants, which had shown association with suicide in other...... populations. Method: We performed a nationwide case-control study on all suicide cases sent for autopsy in Denmark between the years 2000 and 2007. The study comprised 572 cases and 1049 controls and is one of the largest genetic studies in completed suicide to date. The analysed markers were located within...... the Serotonin Transporter (SLC6A4), Monoamine Oxidase-A (MAOA) and the Ttyptophan Hydroxylase I and II (TPH1 and TPH2) genes. Results: None of the genetic markers within SLC6A4, MAOA, TPH1 and TPH2 were significantly associated with completed suicide or suicide method in the basic association tests. Exploratory...
Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence
2015-03-01
Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Myrothecium verrucaria 3.2190 is a nonligninolytic fungus that produces bilirubin oxidase. Both Myrothecium verrucaria and the extracellular bilirubin oxidase were tested for their ability to decolorize indigo carmine. The biosorption and biodegradation of the dye were detected during the process of...
Konaté, K; Souza, A; Coulibaly, A Y; Meda, N T R; Kiendrebeogo, M; Lamien-Meda, A; Millogo-Rasolodimby, J; Lamidi, M; Nacoulma, O G
2010-11-15
In this study polyphenol content, antioxidant activity, lipoxygenase (LOX) and Xanthine Oxidase (XO) inhibitory effects of n-hexane, dichloromethane, ethyl acetate and n-butanol fractions of aqueous acetone extracts from S. alba L., S. acuta Burn f and Cienfuegosia digitata Cav. were investigated. The total phenolics, flavonoids, flavonols and total tannins were determined by spectrophotometric methods using Folin-ciocalteu, AlCl3 reagents and tannic acid, respectively. The antioxidant potential was evaluated using three methods: inhibition of free radical 2,2-diphenyl-1-picrylhydramzyl (DPPH), ABTS radical cation decolorization assay and Iron (III) to iron (II) reduction activity (FRAP). For enzymatic activity, lipoxygenase and xanthine oxidase inhibitory activities were used. This study shows a relationship between polyphenol contents, antioxidant and enzymatic activities. Present results showed that ethyl acetate and dichloromethane fractions elicit the highest polyphenol content, antioxidant and enzymatic activities.
Blockade of TGF-β 1 Signalling Inhibits Cardiac NADPH Oxidase Overactivity in Hypertensive Rats
Directory of Open Access Journals (Sweden)
José Luis Miguel-Carrasco
2012-01-01
Full Text Available NADPH oxidases constitute a major source of superoxide anion (⋅O2 - in hypertension. Several studies suggest an important role of NADPH oxidases in different effects mediated by TGF-β 1. In this study we show that chronic administration of P144, a peptide synthesized from type III TGF-β 1 receptor, significantly reduced the cardiac NADPH oxidase expression and activity as well as in the nitrotyrosine levels observed in control spontaneously hypertensive rats (V-SHR to levels similar to control normotensive Wistar Kyoto rats. In addition, P144 was also able to reduce the significant increases in the expression of collagen type I protein and mRNA observed in hearts from V-SHR. In addition, positive correlations between collagen expression, NADPH oxidase activity, and nitrotyrosine levels were found in all animals. Finally, TGF-β 1-stimulated Rat-2 exhibited significant increases in NADPH oxidase activity that was inhibited in the presence of P144. It could be concluded that the blockade of TGF-β 1 with P144 inhibited cardiac NADPH oxidase in SHR, thus adding new data to elucidate the involvement of this enzyme in the profibrotic actions of TGF-β 1.
Herbivore-plant interactions: mixed-function oxidases and secondary plant substances.
Brattsten, L B; Wilkinson, C F; Eisner, T
1977-06-17
The mixed-function oxidases of a polyphagous insect larva (the southern armyworm, Spodoptera eridania) were found to be induced by a diversity of secondary plant substances. The induction proceeds rapidly and in response to a small quantity of secondary substance. Following induction, the larva is less susceptible to dietary poisoning. It is argued that mixed-function oxidases play a major role in protecting herbivores against chemical stress from secondary plant substances.
Directory of Open Access Journals (Sweden)
Karim Zouaoui Boudjeltia
2013-01-01
Full Text Available The present paradigm of atherogenesis proposes that low density lipoproteins (LDLs are trapped in subendothelial space of the vascular wall where they are oxidized. Previously, we showed that oxidation is not restricted to the subendothelial location. Myeloperoxidase (MPO, an enzyme secreted by neutrophils and macrophages, can modify LDL (Mox-LDL at the surface of endothelial cells. In addition we observed that the activation of the endothelial cells by angiotensin II amplifies this process. We suggested that induction of the NADPH oxidase complex was a major step in the oxidative process. Based on these data, we asked whether there was an independent association, in 121 patients, between NADPH oxidase modulators, such as angiotensin II, adiponectin, and levels of circulating Mox-LDL. Our observations suggest that the combination of blood angiotensin II, MPO activity, and adiponectin explains, at least partially, serum Mox-LDL levels.
Functional heterogeneity of NADPH oxidase-mediated contractions to endothelin with vascular aging.
Meyer, Matthias R; Barton, Matthias; Prossnitz, Eric R
2014-11-24
Aging, a physiological process and main risk factor for cardiovascular and renal diseases, is associated with endothelial cell dysfunction partly resulting from NADPH oxidase-dependent oxidative stress. Because increased formation of endothelium-derived endothelin-1 (ET-1) may contribute to vascular aging, we studied the role of NADPH oxidase function in age-dependent contractions to ET-1. Renal arteries and abdominal aortas from young and old C57BL6 mice (4 and 24 months of age) were prepared for isometric force measurements. Contractions to ET-1 (0.1-100 nmol/L) were determined in the presence and absence of the NADPH oxidase-selective inhibitor gp91ds-tat (3 μmol/L). To exclude age-dependent differential effects of NO bioactivity between vascular beds, all experiments were conducted in the presence of the NO synthase inhibitor L-NAME (300 μmol/L). In young animals, ET-1-induced contractions were 6-fold stronger in the renal artery than in the aorta (prenal artery and aorta, respectively (pAging had no effect on NADPH oxidase-dependent and -independent contractions to ET-1 in the renal artery. In contrast, contractions to ET-1 were markedly reduced in the aged aorta (5-fold, page-dependent heterogeneity of NADPH oxidase-mediated vascular contractions to ET-1, demonstrating an inherent resistance to functional changes in the renal artery but not in the aorta with aging. Thus, local activity of NADPH oxidase differentially modulates responses to ET-1 with aging in distinct vascular beds. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Isolation and characterization of major histocompatibility complex class II B genes in cranes.
Kohyama, Tetsuo I; Akiyama, Takuya; Nishida, Chizuko; Takami, Kazutoshi; Onuma, Manabu; Momose, Kunikazu; Masuda, Ryuichi
2015-11-01
In this study, we isolated and characterized the major histocompatibility complex (MHC) class II B genes in cranes. Genomic sequences spanning exons 1 to 4 were amplified and determined in 13 crane species and three other species closely related to cranes. In all, 55 unique sequences were identified, and at least two polymorphic MHC class II B loci were found in most species. An analysis of sequence polymorphisms showed the signature of positive selection and recombination. A phylogenetic reconstruction based on exon 2 sequences indicated that trans-species polymorphism has persisted for at least 10 million years, whereas phylogenetic analyses of the sequences flanking exon 2 revealed a pattern of concerted evolution. These results suggest that both balancing selection and recombination play important roles in the crane MHC evolution.
A positive feedback-based gene circuit to increase the production of a membrane protein
Directory of Open Access Journals (Sweden)
Gennis Robert B
2010-05-01
Full Text Available Abstract Background Membrane proteins are an important class of proteins, playing a key role in many biological processes, and are a promising target in pharmaceutical development. However, membrane proteins are often difficult to produce in large quantities for the purpose of crystallographic or biochemical analyses. Results In this paper, we demonstrate that synthetic gene circuits designed specifically to overexpress certain genes can be applied to manipulate the expression kinetics of a model membrane protein, cytochrome bd quinol oxidase in E. coli, resulting in increased expression rates. The synthetic circuit involved is an engineered, autoinducer-independent variant of the lux operon activator LuxR from V. fischeri in an autoregulatory, positive feedback configuration. Conclusions Our proof-of-concept experiments indicate a statistically significant increase in the rate of production of the bd oxidase membrane protein. Synthetic gene networks provide a feasible solution for the problem of membrane protein production.
López, Greizy; Gelvez, Nancy Yaneth; Tamayo, Martalucía
2011-03-01
Usher syndrome is a disorder characterized by progressive retinitis pigmentosa, prelingual sensory hearing loss and vestibular dysfunction. It is the most frequent cause of deaf-blindness in humans. Three clinical types and twelve genetic subtypes have been characterized. Type II is the most common, and among these cases, nearly 80% have mutations in the USH2A gene. The aim of the study was to establish the mutational frequencies for the short isoform of USH2A gene in Usher syndrome type II. Twenty-six Colombian individuals with Usher syndrome type II were included. SSCP analysis for 20 exons of the short isoform was performed and abnormal patterns were sequenced. Sequencing of exon 13 of the USH2A gene was performed for all the individuals because the most frequent mutation is located in this exon. The most frequent mutation was c.2299delG, identified in the 27% (n=8) of the sample. The second mutation, p.R334W, showed a frequency of 15%. A new variant identified in the 5’UTR region, g.129G>T, was present in 1 individual (4%). Four polymorphisms were identified; one of them is a new deletion in exon 20, first reported in this study. Mutations in the usherin short isoform were identified in 38% of a sample of 26 USH2 cases. Molecular diagnosis was established in 7 of the 26.
Evaluation of the Expression of Amine Oxidase Proteins in Breast Cancer
Directory of Open Access Journals (Sweden)
Woo Young Sun
2017-12-01
Full Text Available We aimed to evaluate the expression of amine oxidase proteins in breast cancer and their clinical implications. We performed immunohistochemical staining of amine oxidase proteins (LOX, lysyl oxidase, AOC3, amine oxidase, MAOA, monoamine oxidase A, MAOB, monoamine oxidase B. Based on their hormone receptors, such as estrogen receptor (ER and progesterone receptor (PR, human epidermal growth factor receptor 2 (HER-2, and Ki-67 immunohistochemical staining, breast cancer was divided into four molecular subtypes: luminal A, luminal B, HER-2 type, and triple-negative breast cancer (TNBC. Luminal A was observed in 380 cases (49.4%, luminal B in 224 (29.1%, HER-2 type in 68 (8.8%, and TNBC in 98 (12.7%. Stromal AOC3, MAO-A, and MAO-B expression varied according to molecular subtypes. Stromal AOC3 expression was high in luminal B and HER-2 type and MAO-A expression was high in luminal A and luminal B (p < 0.001. MAO-B expression was higher in TNBC than in other subtypes (p = 0.020. LOX positivity was associated with high histological grade (p < 0.001 and high Ki-67 labeling index (LI (p = 0.009, and stromal AOC3 positivity was associated with high histological grade (p = 0.001, high Ki-67 LI (p < 0.001, and HER-2 positivity (p = 0.002. MAO-A positivity was related to low histological grade (p < 0.001, ER positivity, PR positivity (p < 0.001, and low Ki-67 LI (p < 0.001. In univariate analysis, MAO-A positivity was related to short disease-free survival in HER-2 type (p = 0.013, AOC3 negativity was related to short disease-free survival and overall survival in ER-positive breast cancer, PR-positive breast cancer, HER-2-negative breast cancer, and lymph node metastasis. In conclusion, the expression of amine oxidase proteins varies depending on the molecular subtype of breast cancer. Stromal AOC3 expression was high in luminal B and HER-2 type, and MAO-A expression was high in luminal A and luminal B.
Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom
2013-01-01
A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786
Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom
2013-01-01
A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets.
Targeting NADPH oxidase decreases oxidative stress in the transgenic sickle cell mouse penis.
Musicki, Biljana; Liu, Tongyun; Sezen, Sena F; Burnett, Arthur L
2012-08-01
Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) ), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Relative to hemi mice, SCD increased (Ppenis. Apocynin treatment of sickle mice reversed (P0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a potential target for improving vascular function in the SCD mouse penis. © 2012 International Society for Sexual Medicine.
DEFF Research Database (Denmark)
Brøndsted, Lone; Atlung, Tove
1996-01-01
The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...
Monoamine oxidase and agitation in psychiatric patients.
Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela
2016-08-01
Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. Copyright © 2016 Elsevier Inc. All rights reserved.
de Fost, M.; van Trotsenburg, A. S. P.; van Santen, H. M.; Endert, E.; van den Elzen, C.; Kamsteeg, E. J.; Swaab, D. F.; Fliers, E.
2011-01-01
Familial neurohypophyseal (central) diabetes insipidus (DI) is caused by mutations in the arginine vasopressin-neurophysin II (AVP-NPII) gene. The majority of cases is inherited in an autosomal dominant way. In this study, we present the clinical features of a mother and her son with autosomal
Fost, M. de; Trotsenburg, A.S. van; Santen, H.M. van; Endert, E.; Elzen, C. van den; Kamsteeg, E.J.; Swaab, D.F.; Fliers, E.A.
2011-01-01
BACKGROUND: Familial neurohypophyseal (central) diabetes insipidus (DI) is caused by mutations in the arginine vasopressin-neurophysin II (AVP-NPII) gene. The majority of cases is inherited in an autosomal dominant way. In this study, we present the clinical features of a mother and her son with
Characterization of wheat germin (oxalate oxidase) expressed by Pichia pastoris
International Nuclear Information System (INIS)
Pan, Heng-Yen; Whittaker, Mei M.; Bouveret, Romaric; Berna, Anne; Bernier, Francois; Whittaker, James W.
2007-01-01
High-level secretory expression of wheat (Triticum aestivum) germin/oxalate oxidase was achieved in Pichia pastoris fermentation cultures as an α-mating factor signal peptide fusion, based on the native wheat cDNA coding sequence. The oxalate oxidase activity of the recombinant enzyme is substantially increased (7-fold) by treatment with sodium periodate, followed by ascorbate reduction. Using these methods, approximately 1 g (4 x 10 4 U) of purified, activated enzyme was obtained following eight days of induction of a high density Pichia fermentation culture, demonstrating suitability for large-scale production of oxalate oxidase for biotechnological applications. Characterization of the recombinant protein shows that it is glycosylated, with N-linked glycan attached at Asn47. For potential biomedical applications, a nonglycosylated (S49A) variant was also prepared which retains essentially full enzyme activity, but exhibits altered protein-protein interactions
Yamamura, Yoshimi; Taguchi, Yukari; Ichitani, Kei; Umebara, Io; Ohshita, Ayako; Kurosaki, Fumiya; Lee, Jung-Bum
2018-03-01
Gibberellins (GAs) are ubiquitous diterpenoids in higher plants, whereas some higher plants produce unique species-specific diterpenoids. In GA biosynthesis, ent-kaurene synthase (KS) and ent-kaurene oxidase (KO) are key players which catalyze early step(s) of the cyclization and oxidation reactions. We have studied the functional characterization of gene products of a KS (SdKS) and two KOs (SdKO1 and SdKO2) involved in GA biosynthesis in Scoparia dulcis. Using an in vivo heterologous expression system of Escherichia coli, we found that SdKS catalyzed a cyclization reaction from ent-CPP to ent-kaurene and that the SdKOs oxidized ent-kaurene to ent-kaurenoic acid after modification of the N-terminal region for adaptation to the E. coli expression system. The real-time PCR results showed that the SdKS, SdKO1 and SdKO2 genes were mainly expressed in the root and lateral root systems, which are elongating tissues. Based on these results, we suggest that these three genes may be responsible for the metabolism of GAs in S. dulcis.
Directory of Open Access Journals (Sweden)
Mingguang Shi
2016-03-01
Full Text Available Colorectal cancer (CRC is a heterogeneous disease with a high mortality rate and is still lacking an effective treatment. Our goal is to develop a robust prognosis model for predicting the prognosis in CRC patients. In this study, 871 stage II and III CRC samples were collected from six gene expression profilings. ColoFinder was developed using a 9-gene signature based Random Survival Forest (RSF prognosis model. The 9-gene signature recurrence score was derived with a 5-fold cross validation to test the association with relapse-free survival, and the value of AUC was gained with 0.87 in GSE39582(95% CI [0.83–0.91]. The low-risk group had a significantly better relapse-free survival (HR, 14.8; 95% CI [8.17–26.8]; P < 0.001 than the high-risk group. We also found that the 9-gene signature recurrence score contributed more information about recurrence than standard clinical and pathological variables in univariate and multivariate Cox analyses when applied to GSE17536(p = 0.03 and p = 0.01 respectively. Furthermore, ColoFinder improved the predictive ability and better stratified the risk subgroups when applied to CRC gene expression datasets GSE14333, GSE17537, GSE12945and GSE24551. In summary, ColoFinder significantly improves the risk assessment in stage II and III CRC patients. The 9-gene prognostic classifier informs patient prognosis and treatment response.
Multi-Copper Oxidases and Human Iron Metabolism
Vashchenko, Ganna; MacGillivray, Ross T. A.
2013-01-01
Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651
Cataplexy and monoamine oxidase deficiency in Norrie disease.
Vossler, D G; Wyler, A R; Wilkus, R J; Gardner-Walker, G; Vlcek, B W
1996-05-01
Norrie disease (ND) is an X-linked recessive disorder causing ocular atrophy, mental retardation, deafness, and dysmorphic features. Virtually absent monoamine oxidase (MAO) type-A and -B activity has been found in some boys with chromosome deletions. We report the coexistence of cataplexy and abnormal REM sleep organization with ND. Three related boys, referred for treatment of medically refractory atonic spells and apneas, underwent extended EEG-video-polysomnographic monitoring. They demonstrated attacks of cataplexy and inappropriate periods of REM sleep during which they were unarousable. One boy also had generalized tonic-clonic seizures. Previous testing revealed that all three have complete ND gene deletions. In all subjects, platelet MAO-B activity was absent, serum serotonin levels were markedly increased, and plasma catecholamine levels were normal. Data from the canine narcolepsy syndrome model implicate abnormal catecholaminergic and cholinergic activities in the pathogenesis of cataplexy. Our findings suggest that abnormal MAO activity or an imbalance between serotonin and other neurotransmitter levels may be involved in the pathogenesis of human cataplexy.
Patel, Jinish; Jagia, Moksh; Bansal, Arvind Kumar; Patel, Sarsvatkumar
2015-11-01
Febuxostat (FXT), a xanthine oxidase inhibitor, is an interesting and unique molecule, which exhibits extensive polymorphism, with over 15 polymorphic forms reported to date. The primary purpose of the study was to characterize the three polymorphic forms with respect to their thermodynamic quantities and establish thermodynamic relationship between them. The polymorphs were characterized by thermal and powder X-ray diffraction methods. Three different methods were used to calculate the transition temperatures (Ttr) and thereby their thermodynamic relationships. Although the first and second method used calorimetric data (melting point and heat of fusion), the third method employed the use of configurational free energy phase diagram. The onset melting points of three polymorphic forms were found to be 482.89 ± 0.37 K for form I, 476.30 ± 1.21 K for form II, and 474.19 ± 0.11 K for form III. Moreover, the powder X-ray diffraction patterns for each form were also unique. The polymorphic pair of form I and II and of form I and III was found to be enantiotropic, whereas pair of form II and III was monotropic. Besides the relative thermodynamic aspects (free energy differences, enthalpy, entropy contributions) using different methods, the pharmaceutical implications and phase transformation aspects have also been covered. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.
Engineering glucose oxidase to minimize the influence of oxygen on sensor response
International Nuclear Information System (INIS)
Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji
2014-01-01
Glucose oxidase (GOx) is an important industrial enzyme and is recognized as the gold standard for monitoring blood glucose. However, due to its inherent oxidase property, the presence of oxygen affects electrochemical measurements of venous blood glucose employing artificial electron mediators. We therefore attempted to engineer Penicillium amagasakiense-derived GOx into a dehydrogenase by focusing on the amino acid residues predicted to interact with oxygen. Our rational amino acid substitution approach resulted in the construction of the Ser114Ala/Phe355Leu mutant, which has an 11-fold decrease in oxidase activity and 2.8-fold increase in dehydrogenase activity compared with wild-type GOx. As a result, the dehydrogenase/oxidase activity ratio of the engineered enzyme was 32-fold greater than that of the wild-type enzyme. The enzyme sensor constructed with Ser114Ala/Phe355Leu was considerably less affected by oxygen than the wild-type GOx-based sensor at lower glucose concentrations
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
International Nuclear Information System (INIS)
Dubey, G.P.; Srivastava, V.K.; Agrawal, A.; Udupa, K.N.
1988-01-01
Platelet monoamine oxidase is a mitochondrial enzyme taking part in the deamination reaction of total catecholamine. Recent studies of monoamine oxidase inhibitors have gained its importance in the control of variety of psychosomatic disorders like mental depression, arterial hypertension and anxiety neurosis. 30 apparently normal individuals and 42 diagnosed cases of essential hypertension were selected for the present study. The platelet monoamine oxidase activity was measured by using 14 C-tryptamine bisuccinate. Comparatively low activity of platelet monoamine oxidase was noticed in hypertension cases than in the normal. After oral administration of an indigenous drug 'Geriforte' for three months, a significant rise in platelet monoamine oxidase activity was noticed in hypertension cases. It can be concluded that this indigenous formulation has the capacity to regulate the monoamine oxidase activity, as such, it may provide an alternative remedy in the management of psychosomatic disorders. (author). 11 refs
Wongnate, Thanyaporn; Chaiyen, Pimchai
2013-07-01
Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.
Vuong, Thu V; Foumani, Maryam; MacCormick, Benjamin; Kwan, Rachel; Master, Emma R
2016-11-21
Glucose oxidase (GO) activity is generally restricted to glucose and is susceptible to inactivation by H 2 O 2 . By comparison, the Y300A variant of gluco-oligosaccharide oxidase (GOOX) from Sarocladium strictum showed broader substrate range and higher H 2 O 2 stability. Specifically, Y300A exhibited up to 40 times higher activity on all tested sugars except glucose, compared to GO. Moreover, fusion of the Y300A variant to a family 22 carbohydrate binding module from Clostridium thermocellum (CtCBM22A) nearly doubled its catalytic efficiency on glucose, while retaining significant activity on oligosaccharides. In the presence of 200 mM of H 2 O 2 , the recombinant CtCBM22A_Y300A retained 80% of activity on glucose and 100% of activity on cellobiose, the preferred substrate for this enzyme. By contrast, a commercial glucose oxidase reported to contain ≤0.1 units catalase/ mg protein, retained 60% activity on glucose under the same conditions. GOOX variants appear to undergo a different mechanism of inactivation, as a loss of histidine instead of methionine was observed after H 2 O 2 incubation. The addition of CtCBM22A also promoted functional binding of the fusion enzyme to xylan, facilitating its simultaneous purification and immobilization using edible oat spelt xylan, which might benefit the usage of this enzyme preparation in food and baking applications.
Busnadiego, O; Gorbenko Del Blanco, D; González-Santamaría, J; Habashi, J P; Calderon, J F; Sandoval, P; Bedja, D; Guinea-Viniegra, J; Lopez-Cabrera, M; Rosell-Garcia, T; Snabel, J M; Hanemaaijer, R; Forteza, A; Dietz, H C; Egea, G; Rodriguez-Pascual, F
2015-08-01
Patients with Marfan syndrome (MFS) are at high risk of life-threatening aortic dissections. The condition is caused by mutations in the gene encoding fibrillin-1, an essential component in the formation of elastic fibers. While experimental findings in animal models of the disease have shown the involvement of transforming growth factor-β (TGF-β)- and angiotensin II-dependent pathways, alterations in the vascular extracellular matrix (ECM) may also play a role in the onset and progression of the aortic disease. Lysyl oxidases (LOX) are extracellular enzymes, which initiates the formation of covalent cross-linking of collagens and elastin, thereby contributing to the maturation of the ECM. Here we have explored the role of LOX in the formation of aortic aneurysms in MFS. We show that aortic tissue from MFS patients and MFS mouse model (Fbn1(C1039G/+)) displayed enhanced expression of the members of the LOX family, LOX and LOX-like 1 (LOXL1), and this is associated with the formation of mature collagen fibers. Administration of a LOX inhibitor for 8weeks blocked collagen accumulation and aggravated elastic fiber impairment, and these effects correlated with the induction of a strong and rapidly progressing aortic dilatation, and with premature death in the more severe MFS mouse model, Fbn1(mgR/mgR), without any significant effect on wild type animals. This detrimental effect occurred preferentially in the ascending portion of the aorta, with little or no involvement of the aortic root, and was associated to an overactivation of both canonical and non-canonical TGF-β signaling pathways. The blockade of angiotensin II type I receptor with losartan restored TGF-β signaling activation, normalized elastic fiber impairment and prevented the aortic dilatation induced by LOX inhibition in Fbn1(C1039G/+) mice. Our data indicate that LOX enzymes and LOX-mediated collagen accumulation play a critical protective role in aneurysm formation in MFS. Copyright © 2015 Elsevier
Wang, Ke; Li, Nan; Zhang, Jing; Zhang, Zhiqi; Dang, Fuquan
2017-01-15
In this work, we proposed a novel and facile method to monitor oxidase activities based on size-selective fluorescent quantum dot (QD)@metal-organic framework (MOF) core-shell nanocomposites (CSNCPs). The CSNCPs were synthesized from ZIF-8 and CdTe QDs in aqueous solution in 40min at room temperature with stirring. The prepared CdTe@ZIF-8 CSNCPs , which have excellent water dispersibility and stability, displays distinct fluorescence responses to hole scavengers of different molecular sizes (e.g., H 2 O 2 , substrate, and oxidase) due to the aperture limitation of the ZIF-8 shell. H 2 O 2 can efficiently quench the fluorescence of CdTe@ZIF-8 CSNCPs over a linearity range of 1-100nM with a detection limit of 0.29nM, whereas large molecules such as substrate and oxidase have very little effect on its fluorescence. Therefore, the highly sensitive detection of oxidase activities was achieved by monitoring the fluorescence quenching of CdTe@ZIF-8 CSNCPs by H 2 O 2 produced in the presence of substrate and oxidase, which is proportional to the oxidase activities. The linearity ranges of the uricase and glucose oxidase activity are 0.1-50U/L and 1-100U/L, respectively, and their detection limits are 0.024U/L and 0.26U/L, respectively. Therefore, the current QD@MOF CSNCPs based sensing system is a promising, widely applicable means of monitoring oxidase activities in biochemical research. Copyright © 2016 Elsevier B.V. All rights reserved.
The antioxidant properties, cytotoxicity and monoamine oxidase ...
African Journals Online (AJOL)
ajl yemi
2011-11-28
Nov 28, 2011 ... Department of Pharmaceutical Chemistry, North-West University, Private Bag X6001, Potchefstroom 2520, ..... on the inhibition of the catabolism of serotonin, .... Structure of human monoamine oxidase B, a drug target for.
Investigation of antihemolytic, xanthine oxidase inhibition ...
African Journals Online (AJOL)
Abbreviations: SVEs: Salvia Verbenaca L. aerial part Extracts; CrE: Crud Extract; ChE: Chloroform Extract ; EAE: Ethyl Acetate Extract; AqE : Aqueous Extract ; ROS: Reactive Oxygen Spices; AAPH : 2,2, -Azobis (2-AmidinoPropane) Dihydrochloride ; DPPH: DiPhenyl- Picryl-Hydrazyl; XO: Xanthine Oxidase; Gen: Gentamicin ...
Garman, Lori; Dumas, Eric K.; Kurella, Sridevi; Hunt, Jonathan J.; Crowe, Sherry R.; Nguyen, Melissa L.; Cox, Philip M.; James, Judith A.; Farris, A. Darise
2012-01-01
Anthrax Lethal Toxin consists of Protective Antigen (PA) and Lethal Factor (LF), and current vaccination strategies focus on eliciting antibodies to PA. In human vaccination, the response to PA can vary greatly, and the response is often directed toward non-neutralizing epitopes. Variable vaccine responses have been shown to be due in part to genetic differences in individuals, with both MHC class II and other genes playing roles. Here, we investigated the relative contribution of MHC class I...
Directory of Open Access Journals (Sweden)
Federica Sandri
2017-06-01
Full Text Available Pseudomonas pseudoalcaligenes KF707 is a soil bacterium which is known for its capacity to aerobically degrade harmful organic compounds such as polychlorinated biphenyls (PCBs using biphenyl as co-metabolite. Here we provide the first genetic and functional analysis of the KF707 respiratory terminal oxidases in cells grown with two different carbon sources: glucose and biphenyl. We identified five terminal oxidases in KF707: two c(caa3 type oxidases (Caa3 and Ccaa3, two cbb3 type oxidases (Cbb31 and Cbb32, and one bd type cyanide-insensitive quinol oxidase (CIO. While the activity and expression of both Cbb31 and Cbb32 oxidases was prevalent in glucose grown cells as compared to the other oxidases, the activity and expression of the Caa3 oxidase increased considerably only when biphenyl was used as carbon source in contrast to the Cbb32 oxidase which was repressed. Further, the respiratory activity and expression of CIO was up-regulated in a Cbb31 deletion strain as compared to W.T. whereas the CIO up-regulation was not present in Cbb32 and C(caa3 deletion mutants. These results, together, reveal that both function and expression of cbb3 and caa3 type oxidases in KF707 are modulated by biphenyl which is the co-metabolite needed for the activation of the PCBs-degradation pathway.
Directory of Open Access Journals (Sweden)
Yong Wang
2013-01-01
Full Text Available We aim to investigate the therapeutic effects of QSYQ, a drug of heart failure (HF in clinical practice in China, on a rat heart failure (HF model. 3 groups were divided: HF model group (LAD ligation, QSYQ group (LAD ligation and treated with QSYQ, and sham-operated group. After 4 weeks, rats were sacrificed for cardiac injury measurements. Rats with HF showed obvious histological changes including necrosis and inflammation foci, elevated ventricular remodeling markers levels(matrix metalloproteinases-2, MMP-2, deregulated ejection fraction (EF value, increased formation of oxidative stress (Malondialdehyde, MDA, and up-regulated levels of apoptotic cells (caspase-3, p53 and tunnel in myocardial tissue. Treatment of QSYQ improved cardiac remodeling through counter-acting those events. The improvement of QSYQ was accompanied with a restoration of NADPH oxidase 4 (NOX4 and NADPH oxidase 2 (NOX2 pathways in different patterns. Administration of QSYQ could attenuate LAD-induced HF, and AngII-NOX2-ROS-MMPs pathway seemed to be the critical potential targets for QSYQ to reduce the remodeling. Moreover, NOX4 was another key targets to inhibit the p53 and Caspase3, thus to reduce the hypertrophy and apoptosis, and eventually provide a synergetic cardiac protective effect.
Steady-state kinetics of substrate binding and iron release in tomato ACC oxidase.
Thrower, J S; Blalock, R; Klinman, J P
2001-08-14
1-Aminocyclopropane-1-carboxylate oxidase (ACC oxidase) catalyzes the last step in the biosynthetic pathway of the plant hormone, ethylene. This unusual reaction results in the oxidative ring cleavage of 1-aminocyclopropane carboxylate (ACC) into ethylene, cyanide, and CO2 and requires ferrous ion, ascorbate, and molecular oxygen for catalysis. A new purification procedure and assay method have been developed for tomato ACC oxidase that result in greatly increased enzymatic activity. This method allowed us to determine the rate of iron release from the enzyme and the effect of the activator, CO2, on this rate. Initial velocity studies support an ordered kinetic mechanism where ACC binds first followed by O2; ascorbate can bind after O2 or possibly before ACC. This kinetic mechanism differs from one recently proposed for the ACC oxidase from avocado.
Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor
2011-01-01
Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.
Intracellular lysyl oxidase: Effect of a specific inhibitor on nuclear mass in proliferating cells
Energy Technology Data Exchange (ETDEWEB)
Saad, Fawzy A. [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States); Torres, Marie [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Wang, Hao [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States); Graham, Lila, E-mail: lilagraham@cs.com [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States)
2010-06-11
LOX, the principal enzyme involved in crosslinking of collagen, was the first of several lysyl oxidase isotypes to be characterized. Its active form was believed to be exclusively extracellular. Active LOX was later reported to be present in cell nuclei; its function there is unknown. LOX expression opposes the effect of mutationally activated Ras, which is present in about 30% of human cancers. The mechanism of LOX in countering the action of Ras is also unknown. In the present work, assessment of nuclear protein for possible effects of lysyl oxidase activity led to the discovery that proliferating cells dramatically increase their nuclear protein content when exposed to BAPN ({beta}-aminopropionitrile), a highly specific lysyl oxidase inhibitor that reportedly blocks LOX inhibition of Ras-induced oocyte maturation. In three cell types (PC12 cells, A7r5 smooth muscle cells, and NIH 3T3 fibroblasts), BAPN caused a 1.8-, 1.7-, and 2.1-fold increase in total nuclear protein per cell, respectively, affecting all major components in both nuclear matrix and chromatin fractions. Since nuclear size is correlated with proliferative status, enzyme activity restricting nuclear growth may be involved in the lysyl oxidase tumor suppressive effect. Evidence is also presented for the presence of apparent lysyl oxidase isotype(s) containing a highly conserved LOX active site sequence in the nuclei of PC12 cells, which do not manufacture extracellular lysyl oxidase substrates. Results reported here support the hypothesis that nuclear lysyl oxidase regulates nuclear growth, and thereby modulates cell proliferation.
Piane, Maria; Della Monica, Matteo; Piatelli, Gianluca; Lulli, Patrizia; Lonardo, Fortunato; Chessa, Luciana; Scarano, Gioacchino
2009-11-01
We report on a 3-year-old boy with prenatal onset of proportionate dwarfism, postnatal severe microcephaly, high forehead with receded hairline, sparse scalp hair, beaked nose, mild retrognathia and hypotonia diagnosed at birth as Seckel syndrome. At age 3 years, he became paralyzed due to a cerebrovascular malformation. Based on the clinical and radiological features showing evidence of skeletal dysplasia, the diagnosis was revised to Majewski osteodysplastic primordial dwarfism type II (MOPD II) syndrome. Western blot analysis of the patient's lymphoblastoid cell line lysate showed the absence of the protein pericentrin. Subsequent molecular analysis identified a novel homozygous single base insertion (c.1527_1528insA) in exon 10 of the PCNT gene, which leads to a frameshift (Treo510fs) and to premature protein truncation. PCNT mutations must be considered diagnostic of MOPD II syndrome. A possible role of pericentrin in the development of cerebral vessels is suggested. Copyright 2009 Wiley-Liss, Inc.
Bastian, Thomas W; Rice, Stephen A
2009-01-01
Previous studies have shown that the herpes simplex virus type 1 (HSV-1) immediate-early protein ICP22 alters the phosphorylation of the host cell RNA polymerase II (Pol II) during viral infection. In this study, we have engineered several ICP22 plasmid and virus mutants in order to map the ICP22 sequences that are involved in this function. We identify a region in the C-terminal half of ICP22 (residues 240 to 340) that is critical for Pol II modification and further show that the N-terminal half of the protein (residues 1 to 239) is not required. However, immunofluorescence analysis indicates that the N-terminal half of ICP22 is needed for its localization to nuclear body structures. These results demonstrate that ICP22's effects on Pol II do not require that it accumulate in nuclear bodies. As ICP22 is known to enhance viral late gene expression during infection of certain cultured cells, including human embryonic lung (HEL) cells, we used our engineered viral mutants to map this function of ICP22. It was found that mutations in both the N- and C-terminal halves of ICP22 result in similar defects in viral late gene expression and growth in HEL cells, despite having distinctly different effects on Pol II. Thus, our results genetically uncouple ICP22's effects on Pol II from its effects on viral late gene expression. This suggests that these two functions of ICP22 may be due to distinct activities of the protein.
Megens, H.J.W.C.; Nes, Van W.J.; Moorsel, van C.H.M.; Pierce, N.E.; Jong, de R.
2004-01-01
We present a phylogeny for a selection of species of the butterfly genus Arhopala Boisduval, 1832 based on molecular characters. We sequenced 1778 bases of the mitochondrial genes Cytochrome Oxidase 1 and 2 including tRNALeu, and a 393-bp fragment of the nuclear wingless gene for a total of 42
Takemoto, Y.; Sakatani, M.; Takami, S.; Tachibana, T.; Higaki, J.; Ogihara, T.; Miki, T.; Katsuya, T.; Tsuchiyama, T.; Yoshida, A.; Yu, H.; Tanio, Y.; Ueda, E.
1998-01-01
BACKGROUND—Serum angiotensin converting enzyme (SACE) is considered to reflect disease activity in sarcoidosis. SACE activity is increased in many patients with active sarcoid lesions. The mechanism for the increased SACE activity in this disease has not been clarified. ACE insertion/deletion (I/D) gene polymorphism has been reported to have an association with SACE levels in sarcoidosis, but no evidence of an association between angiotensin II receptor gene polymorphism and SA...
Increased xanthine oxidase during labour--implications for oxidative stress.
Many, A; Roberts, J M
1997-11-01
Xanthine dehydrogenase/oxidase (XDH/XO) produces uric acid. When in the oxidase form, this production is coupled with the generation of free radicals. Hypoxia-reperfusion enhances conversion of XDH to XO. Since the placenta is exposed to short periods of hypoxia reperfusion during labour, 17 placentae of pregnancy terminated by elective caesarean section and five placentae of pregnancies terminated by caesarean section during labour were examined for XDH/XO activity. It was found that XO activity was higher in the placentae of labouring women (P = 0.003), which suggests that labour enhances conversion of XDH to XO, facilitating free radical production.
Production of a new D-amino acid oxidase from the fungus Fusarium oxysporum.
Gabler, M; Fischer, L
1999-08-01
The fungus Fusarium oxysporum produced a D-amino acid oxidase (EC 1. 4.3.3) in a medium containing glucose as the carbon and energy source and ammonium sulfate as the nitrogen source. The specific D-amino acid oxidase activity was increased up to 12.5-fold with various D-amino acids or their corresponding derivatives as inducers. The best inducers were D-alanine (2.7 microkat/g of dry biomass) and D-3-aminobutyric acid (2.6 microkat/g of dry biomass). The addition of zinc ions was necessary to permit the induction of peroxisomal D-amino acid oxidase. Bioreactor cultivations were performed on a 50-liter scale, yielding a volumetric D-amino acid oxidase activity of 17 microkat liter(-1) with D-alanine as an inducer. Under oxygen limitation, the volumetric activity was increased threefold to 54 microkat liter(-1) (3,240 U liter(-1)).
Fraser, D M; Zakeeruddin, S M; Grätzel, M
1992-01-30
A ferrocene-derivatised detergent, (11-ferrocenylundecyl) trimethylammonium bromide (FTMAB), when oxidised to the corresponding ferricinium ion, was found by electrochemical studies to be an effective electron acceptor for reduced glucose oxidase of Aspergillus niger (EC 1.13.4) and thus acts as a electron-transfer mediator between glucose oxidase and a working electrode held at a potential sufficiently positive to reoxidise reduced FTMAB. An increase in mediating activity was produced when FTMAB was present in concentrations above its critical micelle concentration. An 'enzyme electrode' was formed by adsorption of glucose oxidase and FTMAB surfactant on a graphite rod. The electrode functioned as an amperometric biosensor for glucose in phosphate-buffered saline solution. A mixed micelle of glucose oxidase and FTMAB, probably adsorbed on the electrode surface, appears to be advantageous for the amperometric determination of glucose. Additionally, glucose oxidase was treated with alpha-mannosidase. When this partially-deglycosylated glucose oxidase was incorporated in an enzyme electrode, a 100-fold increase in the second-order rate constant (k) for electron transfer between the enzyme and FTMAB was observed, together with increased current densities, with respect to the equivalent values for FTMAB and commercial glucose oxidase. The use of deglycosylated enzymes in biosensors is suggested.
Gao, Shanwu; Tibiche, Chabane; Zou, Jinfeng; Zaman, Naif; Trifiro, Mark; O'Connor-McCourt, Maureen; Wang, Edwin
2016-01-01
Decisions regarding adjuvant therapy in patients with stage II colorectal cancer (CRC) have been among the most challenging and controversial in oncology over the past 20 years. To develop robust combinatory cancer hallmark-based gene signature sets (CSS sets) that more accurately predict prognosis and identify a subset of patients with stage II CRC who could gain survival benefits from adjuvant chemotherapy. Thirteen retrospective studies of patients with stage II CRC who had clinical follow-up and adjuvant chemotherapy were analyzed. Respective totals of 162 and 843 patients from 2 and 11 independent cohorts were used as the discovery and validation cohorts, respectively. A total of 1005 patients with stage II CRC were included in the 13 cohorts. Among them, 84 of 416 patients in 3 independent cohorts received fluorouracil-based adjuvant chemotherapy. Identification of CSS sets to predict relapse-free survival and identify a subset of patients with stage II CRC who could gain substantial survival benefits from fluorouracil-based adjuvant chemotherapy. Eight cancer hallmark-based gene signatures (30 genes each) were identified and used to construct CSS sets for determining prognosis. The CSS sets were validated in 11 independent cohorts of 767 patients with stage II CRC who did not receive adjuvant chemotherapy. The CSS sets accurately stratified patients into low-, intermediate-, and high-risk groups. Five-year relapse-free survival rates were 94%, 78%, and 45%, respectively, representing 60%, 28%, and 12% of patients with stage II disease. The 416 patients with CSS set-defined high-risk stage II CRC who received fluorouracil-based adjuvant chemotherapy showed a substantial gain in survival benefits from the treatment (ie, recurrence reduced by 30%-40% in 5 years). The CSS sets substantially outperformed other prognostic predictors of stage 2 CRC. They are more accurate and robust for prognostic predictions and facilitate the identification of patients with stage
Directory of Open Access Journals (Sweden)
Shanqing Zheng
Full Text Available DAF-16 target genes are employed as reporters of the insulin/IGF-1 like signal pathway (IIS, and this is notably true when Caenorhabditis elegans (C. elegans is used to study the action of anti-aging compounds on IIS activity. However, some of these genes may not be specific to DAF-16, even if their expression levels are altered when DAF-16 is activated. Celecoxib was reported to extend the lifespan of C. elegans through activation of DAF-16. Our results confirmed the function of celecoxib on aging; however, we found that the expression of ins-7, a DAF-16 target gene, was abnormally regulated by celecoxib. ins-7 plays an important role in regulating aging, and its expression is suppressed in C. elegans when DAF-16 is activated. However, we found that celecoxib upregulated the expression of ins-7 in contrast to its role in DAF-16 activation. Our subsequent analysis indicated that the expression level of ins-7 in C. elegans was negatively regulated by DAF-16 activity. Additionally, its expression was also positively regulated by DAF-16-independent mechanisms, at least following external pharmacological intervention. Our study suggests that ins-7 is not a specific target gene of DAF-16, and should not be chosen as a reporter for IIS activity. This conclusion is important in the study of INSs on aging in C. elegans, especially under the circumstance of drug intervention.
Zheng, Shanqing; Liao, Sentai; Zou, Yuxiao; Qu, Zhi; Liu, Fan
2014-01-01
DAF-16 target genes are employed as reporters of the insulin/IGF-1 like signal pathway (IIS), and this is notably true when Caenorhabditis elegans (C. elegans) is used to study the action of anti-aging compounds on IIS activity. However, some of these genes may not be specific to DAF-16, even if their expression levels are altered when DAF-16 is activated. Celecoxib was reported to extend the lifespan of C. elegans through activation of DAF-16. Our results confirmed the function of celecoxib on aging; however, we found that the expression of ins-7, a DAF-16 target gene, was abnormally regulated by celecoxib. ins-7 plays an important role in regulating aging, and its expression is suppressed in C. elegans when DAF-16 is activated. However, we found that celecoxib upregulated the expression of ins-7 in contrast to its role in DAF-16 activation. Our subsequent analysis indicated that the expression level of ins-7 in C. elegans was negatively regulated by DAF-16 activity. Additionally, its expression was also positively regulated by DAF-16-independent mechanisms, at least following external pharmacological intervention. Our study suggests that ins-7 is not a specific target gene of DAF-16, and should not be chosen as a reporter for IIS activity. This conclusion is important in the study of INSs on aging in C. elegans, especially under the circumstance of drug intervention.
Zheng, Hui; Shao, Chong; Zheng, Yan; He, Jin-Wei; Fu, Wen-Zhen; Wang, Chun; Zhang, Zhen-Lin
2016-07-01
Autosomal dominant osteopetrosis type II (ADO-II) is a heritable bone disorder characterized by osteosclerosis, predominantly involving the spine (vertebral end-plate thickening, or rugger-jersey spine), the pelvis ("bone-within-bone" structures) and the skull base. Chloride channel 7 (CLCN7) has been reported to be the causative gene. In this study, we aimed to identify the pathogenic mutation in four Chinese families with ADO-II. All 25 exons of the CLCN7 gene, including the exon-intron boundaries, were amplified and sequenced directly in four probands from the Chinese families with ADO-II. The mutation site was then identified in other family members and 250 healthy controls. In family 1, a known missense mutation c.296A>G in exon 4 of CLCN7 was identified in the proband, resulting in a tyrosine (UAU) to cysteine (UGU) substitution at p.99 (Y99C); the mutation was also identified in his affected father. In family 2, a novel missense mutation c.865G>C in exon 10 was identified in the proband, resulting in a valine (GUC) to leucine (CUC) substitution at p.289 (V289L); the mutation was also identified in her healthy mother and sister. In family 3, a novel missense mutation c.1625C>T in exon 17 of CLCN7 was identified in the proband, resulting in an alanine (GCG) to valine (GUG) substitution at p.542 (A542V); the mutation was also identified in her father. In family 4, a hot spot, R767W (c.2299C>T, CGG>TGG), in exon 24 was found in the proband which once again proved the susceptibility of the site or the similar genetic background in different races. Moreover, two novel mutations, V289L and A542V, occurred at a highly conserved position, found by a comparison of the protein sequences from eight vertebrates, and were predicted to have a pathogenic effect by PolyPhen-2 software, which showed "probably damaging" with a score of approximately 1. These mutation sites were not identified in 250 healthy controls. Our present findings suggest that the novel missense
Iida, Hiroki; Iida, Mami; Takenaka, Motoyasu; Fukuoka, Naokazu; Dohi, Shuji
2008-06-01
We previously reported that acute cigarette smoking can cause a dysfunction of endothelium-dependent vasodilation in cerebral vessels, and that blocking the angiotensin II (Ang II) type 1 (AT1) receptor with valsartan prevented this impairment. Our aim was to investigate the effects of a Rho-kinase inhibitor (fasudil) and a Nicotinamide Adenine Dinucleotide PHosphate (NADPH) oxidase inhibitor (apocynin) on smoking-induced endothelial dysfunction in cerebral arterioles. In Sprague-Dawley rats, we used a closed cranial window preparation to measure changes in pial vessel diameters following topical acetylcholine (ACh) before smoking. After one-minute smoking, we again examined the arteriolar responses to ACh. Finally, after intravenous fasudil or apocynin pre-treatment we re-examined the vasodilator responses to topical ACh (before and after cigarette smoking). Under control conditions, cerebral arterioles were dose-dependently dilated by topical ACh (10(-6) M and 10(-5) M). One hour after a one-minute smoking (1 mg-nicotine cigarette), 10(-5) M ACh constricted cerebral arterioles. However, one hour after a one-minute smoking, 10(-5) M ACh dilated cerebral pial arteries both in the fasudil pre-treatment and the apocynin pre-treatment groups, responses that were significantly different from those obtained without fasudil or apocynin pre-treatment. Thus, inhibition of Rho-kinase and NADPH oxidase activities may prevent the above smoking-induced impairment of endothelium-dependent vasodilation.
Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Herbert, Eric; Ferrari, Roselyne; Chapeland-Leclerc, Florence
2018-07-01
The Podospora anserina genome contains a large family of 15 multicopper oxidases (MCOs), including three genes encoding a FET3-like protein, an ABR1-like protein and an ascorbate oxidase (AO)-like protein. FET3, ABR1 and AO1 are involved in global laccase-like activity since deletion of the relevant genes led to a decrease of activity when laccase substrate (ABTS) was used as substrate. However, contrary to the P. anserina MCO proteins previously characterized, none of these three MCOs seemed to be involved in lignocellulose degradation and in resistance to phenolic compounds and oxidative stress. We showed that the bulk of ferroxidase activity was clearly due to ABR1, and only in minor part to FET3, although ABR1 does not contain all the residues typical of FET3 proteins. Moreover, we showed that ABR1, related to the Aspergillus fumigatus ABR1 protein, was clearly and specifically involved in pigmentation of ascospores. Surprisingly, phenotypes were more severe in mutants lacking both abr1 and ao1. Deletion of the ao1 gene led to an almost total loss of AO activity. No direct involvement of AO1 in fungal developmental process in P. anserina was evidenced, except in a abr1 Δ background. Overall, unlike other previously characterized MCOs, we thus evidence a clear involvement of ABR1 protein in fungal development. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ming-Horng Tsai
2017-08-01
Full Text Available Ang II has been involved in the pathogenesis of cardiovascular diseases, and matrix metalloproteinase-9 (MMP-9 induced migration of human aortic smooth muscle cells (HASMCs is the most common and basic pathological feature. Carbon monoxide (CO, a byproduct of heme breakdown by heme oxygenase, exerts anti-inflammatory effects in various tissues and organ systems. In the present study, we aimed to investigate the effects and underlying mechanisms of carbon monoxide releasing molecule-2 (CORM-2 on Ang II-induced MMP-9 expression and cell migration of HASMCs. Ang II significantly up-regulated MMP-9 expression and cell migration of HASMCs, which was inhibited by transfection with siRNA of p47phox, Nox2, Nox4, p65, angiotensin II type 1 receptor (AT1R and pretreatment with the inhibitors of NADPH oxidase, ROS, and NF-κB. In addition, Ang II also induced NADPH oxidase/ROS generation and p47phox translocation from the cytosol to the membrane. Moreover, Ang II-induced oxidative stress and MMP-9-dependent cell migration were inhibited by pretreatment with CORM-2. Finally, we observed that Ang II induced IL-6 release in HASMCs via AT1R, but not AT2R, which could further caused MMP-9 secretion and cell migration. Pretreatment with CORM-2 reduced Ang II-induced IL-6 release. In conclusion, CORM-2 inhibits Ang II-induced HASMCs migration through inactivation of suppression of NADPH oxidase/ROS generation, NF-κB inactivation and IL-6/MMP-9 expression. Thus, application of CO, especially CORM-2, is a potential countermeasure to reverse the pathological changes of various cardiovascular diseases. Further effects aimed at identifying novel antioxidant and anti-inflammatory substances protective for heart and blood vessels that targeting CO and establishment of well-designed in vivo models properly evaluating the efficacy of these agents are needed. Keywords: Angiotensin II, Carbon monoxide, Human aortic smooth muscle cell, Inflammation, Matrix metallopeptidase
Cloning and molecular analysis of L-asparaginase II gene (ansB
Directory of Open Access Journals (Sweden)
ZEINAT K. MOHAMED
2015-12-01
Full Text Available The deamination of L-asparagine to L-aspartic acid and ammonia is catalyzed by L-asparaginases (L-asparagine amino hydrolase. The enzyme L-asparaginase is widely distributed in nature from different living organisms, starting from bacteria till mammals and plants. It has been recently thought to be a therapeutic agent in treatment of various lymphoblastic leukemia diseases. There have been many attempts to isolate microorganisms that produce L-asparaginase. L-ASNase producing bacteria, Escherichia coli MG27, was previously isolated from the River Nile and identified. In this study, ansB gene, encoding L-ASNase II from E. coli MG27, was amplified by PCR, cloned and characterized by DNA sequencing. The DNA sequence was then analyzed using bioinformatics analysis and translated into amino acid sequence. Identification of highly conserved amino acid sequence motifs was conducted by comparison against the InterPro database. Analysis revealed that the protein sequence had a catalytic domain of L-asparaginase type II (IPR004550 that belong to asparaginase/glutaminase family (IPR006034 and has asparaginase/glutaminase conserved site (IPR020827. According to results predicted using PSIpred tool, ansB consists of eight α-helices and 13 β-strands.
Feng, Xiu-Li; Liu, Qing-Tao; Cao, Rui-Bing; Zhou, Bin; Ma, Zhi-Yong; Deng, Wen-Lei; Wei, Jian-Chao; Qiu, Ya-Feng; Wang, Fang-Quan; Gu, Jin-Yan; Wang, Feng-Juan; Zheng, Qi-Sheng; Ishag, Hassan; Chen, Pu-Yan
2012-01-01
The bursa of Fabricius, the acknowledged central humoral immune organ, plays a vital role in B lymphocyte differentiation. However, there are few reports of the molecular basis of the mechanism on immune induction and potential antitumor activity of bursal-derived peptides. In this paper, a novel bursal-derived pentapeptide-II (BPP-II, MTLTG) was isolated and exerted immunomodulatory functions on antibody responses in vitro. Gene microarray analyses demonstrated that BPP-II regulated expression of 2478 genes in a mouse-derived hybridoma cell line. Immune-related gene ontology functional procedures were employed for further functional analysis. Furthermore, the majority of BPP-II-regulated pathways were associated with immune responses and tumor processes. Moreover, BPP-II exhibited immunomodulatory effects on antigen-specific immune responses in vivo, including enhancement of avian influenza virus (H9N2 subtype)-specific antibody and cytokine production and modification of T cell immunophenotypes and lymphocyte proliferation. Finally, BPP-II triggered p53 expression and stabilization and selectively inhibited tumor cell proliferation. These data identified the multifunctional factor, BPP-II, as a novel biomaterial representing an important linking between the humoral central immune system and immune induction, including antitumor. Information generated in this study elucidates further the mechanisms involved in humoral immune system and represents the potential basis of effective immunotherapeutic strategies for treating human tumors and immune improvement. PMID:22184121
Feng, Xiu-Li; Liu, Qing-Tao; Cao, Rui-Bing; Zhou, Bin; Ma, Zhi-Yong; Deng, Wen-Lei; Wei, Jian-Chao; Qiu, Ya-Feng; Wang, Fang-Quan; Gu, Jin-Yan; Wang, Feng-Juan; Zheng, Qi-Sheng; Ishag, Hassan; Chen, Pu-Yan
2012-02-03
The bursa of Fabricius, the acknowledged central humoral immune organ, plays a vital role in B lymphocyte differentiation. However, there are few reports of the molecular basis of the mechanism on immune induction and potential antitumor activity of bursal-derived peptides. In this paper, a novel bursal-derived pentapeptide-II (BPP-II, MTLTG) was isolated and exerted immunomodulatory functions on antibody responses in vitro. Gene microarray analyses demonstrated that BPP-II regulated expression of 2478 genes in a mouse-derived hybridoma cell line. Immune-related gene ontology functional procedures were employed for further functional analysis. Furthermore, the majority of BPP-II-regulated pathways were associated with immune responses and tumor processes. Moreover, BPP-II exhibited immunomodulatory effects on antigen-specific immune responses in vivo, including enhancement of avian influenza virus (H9N2 subtype)-specific antibody and cytokine production and modification of T cell immunophenotypes and lymphocyte proliferation. Finally, BPP-II triggered p53 expression and stabilization and selectively inhibited tumor cell proliferation. These data identified the multifunctional factor, BPP-II, as a novel biomaterial representing an important linking between the humoral central immune system and immune induction, including antitumor. Information generated in this study elucidates further the mechanisms involved in humoral immune system and represents the potential basis of effective immunotherapeutic strategies for treating human tumors and immune improvement.
Rational redesign of glucose oxidase for improved catalytic function and stability.
Directory of Open Access Journals (Sweden)
J Todd Holland
Full Text Available Glucose oxidase (GOx is an enzymatic workhorse used in the food and wine industries to combat microbial contamination, to produce wines with lowered alcohol content, as the recognition element in amperometric glucose sensors, and as an anodic catalyst in biofuel cells. It is naturally produced by several species of fungi, and genetic variants are known to differ considerably in both stability and activity. Two of the more widely studied glucose oxidases come from the species Aspergillus niger (A. niger and Penicillium amagasakiense (P. amag., which have both had their respective genes isolated and sequenced. GOx from A. niger is known to be more stable than GOx from P. amag., while GOx from P. amag. has a six-fold superior substrate affinity (K(M and nearly four-fold greater catalytic rate (k(cat. Here we sought to combine genetic elements from these two varieties to produce an enzyme displaying both superior catalytic capacity and stability. A comparison of the genes from the two organisms revealed 17 residues that differ between their active sites and cofactor binding regions. Fifteen of these residues in a parental A. niger GOx were altered to either mirror the corresponding residues in P. amag. GOx, or mutated into all possible amino acids via saturation mutagenesis. Ultimately, four mutants were identified with significantly improved catalytic activity. A single point mutation from threonine to serine at amino acid 132 (mutant T132S, numbering includes leader peptide led to a three-fold improvement in k(cat at the expense of a 3% loss of substrate affinity (increase in apparent K(M for glucose resulting in a specify constant (k(cat/K(M of 23.8 (mM(-1 · s(-1 compared to 8.39 for the parental (A. niger GOx and 170 for the P. amag. GOx. Three other mutant enzymes were also identified that had improvements in overall catalysis: V42Y, and the double mutants T132S/T56V and T132S/V42Y, with specificity constants of 31.5, 32.2, and 31.8 mM(-1 · s
Ratiometric glucose sensing based on fluorescent oxygen films and glucose oxidase
Directory of Open Access Journals (Sweden)
Fengyu Su
2017-06-01
Full Text Available A new two-layer sensor film was constructed for sensing glucose based on glucose oxidase and oxygen sensing material. The first layer of film containing the oxygen sensor and intra-reference material was polymerized, then the second layer of glucose oxidase and glutaraldehyde was formed on the oxygen sensor layer. The two-layer sensor film has a resolution up to 0.05 mM and a detection range from 0 to 5 mM to glucose. The effects of pH and temperature on the sensing performance were systematically investigated. The selective detection of glucose among other monosaccharides, such as fructose, mannose and galactose indicated that the sensing film has excellent selectivity. The prepared sensor was successfully applied for glucose sample detection of glucose concentration in artificial tears. Keywords: Glucose sensor, Glucose oxidase, Fluorescence, Oxygen film, Diabetes
Angiotensin II stimulates superoxide production by nitric oxide synthase in thick ascending limbs.
Gonzalez-Vicente, Agustin; Saikumar, Jagannath H; Massey, Katherine J; Hong, Nancy J; Dominici, Fernando P; Carretero, Oscar A; Garvin, Jeffrey L
2016-02-01
Angiotensin II (Ang II) causes nitric oxide synthase (NOS) to become a source of superoxide (O2 (-)) via a protein kinase C (PKC)-dependent process in endothelial cells. Ang II stimulates both NO and O2 (-) production in thick ascending limbs. We hypothesized that Ang II causes O2 (-) production by NOS in thick ascending limbs via a PKC-dependent mechanism. NO production was measured in isolated rat thick ascending limbs using DAF-FM, whereas O2 (-) was measured in thick ascending limb suspensions using the lucigenin assay. Consistent stimulation of NO was observed with 1 nmol/L Ang II (P thick ascending limbs via a PKC- and NADPH oxidase-dependent process; and (2) the effect of Ang II is not due to limited substrate. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Directory of Open Access Journals (Sweden)
Edy Listanto
2017-05-01
Full Text Available Maize (Zea mays L. productivity in Indonesia is challenged to be increased using genetic engineering. Recent advances in Agrobacterium tumefaciens-mediated in-planta transforma-tion makes it possible to transform maize with low cost, and simple method. This study aimed to confirm pIG121Hm-Cs plasmid in A. tumefaciens, and to estimate the efficiency level of A. tumefaciens-mediated in-planta transformation of Indonesian maize by using pIG121Hm-Cs plasmid containing nptII and hpt genes. A series of studies were conducted including confirmation of gene construct of pIG121Hm-Cs plasmid in A. tumefaciens, transformation of four maize lines through A. tumefaciens-mediated in-planta technique, acclimatization of transformant plants and molecular analysis of selected plants using polymerase chain reaction (PCR. The pIG121Hm-Cs plasmid was confirmed via PCR analysis using specific primers of nptII and hpt genes and resulted 700 bp and 500 bp for fragments of nptII and hpt, respectively. After selection, acclimatization and molecular analysis steps, the efficiency levels of transformation of four maize lines were low, ranging from 3.8% to 12.8%. The level of transformation efficiency of ST-27 line was the highest accounting for 12.8% of 45 planted embryos on selection medium based on PCR analysis using specific primer for nptII gene. Overall, A. tumefaciens-mediated in planta transformation on maize floral pistil in this study proved to be successful and rapid. Therefore, this enhanced transformation method will be beneficial for Indonesian maize genetic engineering.
Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger
Directory of Open Access Journals (Sweden)
Tamayo-Ramos Juan Antonio
2012-12-01
Full Text Available Abstract Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA and 2,2-azino-di(3-ethylbenzthiazoline sulfonic acid (ABTS, and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst.
Glucose oxidase-functionalized fluorescent gold nanoclusters as probes for glucose
International Nuclear Information System (INIS)
Xia, Xiaodong; Long, Yunfei; Wang, Jianxiu
2013-01-01
Highlights: ► A glucose oxidase/gold nanocluster conjugates formed by etching chemistry. ► Integration of the bioactivities and fluorescence properties within a single unit. ► These conjugates serve as novel fluorescent probe for glucose. -- Abstract: Creation and application of noble metal nanoclusters have received continuous attention. By integrating enzyme activity and fluorescence for potential applications, enzyme-capped metal clusters are more desirable. This work demonstrated a glucose oxidase (an enzyme for glucose)-functionalized gold cluster as probe for glucose. Under physiological conditions, such bioconjugate was successfully prepared by an etching reaction, where tetrakis (hydroxylmethyl) phosphonium-protected gold nanoparticle and thioctic acid-modified glucose oxidase were used as precursor and etchant, respectively. These bioconjugates showed unique fluorescence spectra (λ em max = 650 nm, λ ex max = 507 nm) with an acceptable quantum yield (ca. 7%). Moreover, the conjugated glucose oxidase remained active and catalyzed reaction of glucose and dissolved O 2 to produce H 2 O 2 , which quenched quantitatively the fluorescence of gold clusters and laid a foundation of glucose detection. A linear range of 2.0 × 10 −6 –140 × 10 −6 M and a detection limit of 0.7 × 10 −6 M (S/N = 3) were obtained. Also, another horseradish peroxidase/gold cluster bioconjugate was produced by such general synthesis method. Such enzyme/metal cluster bioconjugates represented a promising class of biosensors for biologically important targets in organelles or cells
Energy Technology Data Exchange (ETDEWEB)
Wang, Yinxi; Liu, Dan; Zhang, Huifeng; Wang, Yixin [Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, 100191 (China); Wei, Ling [Beijing Center for Physical & Chemical Analysis, Beijing 100089 (China); Liu, Yutong [School of Life Science, Beijing Normal University, Beijing 100875 (China); Liao, Jieying [Department of Translational Medicine, Xiamen Institute of Rare Earth Materials, Chinese Academy of Sciences, Xiamen 361024 (China); Gao, Hui-Ming [Model Animal Research Center of Nanjing University, Nanjing 211800 (China); Zhou, Hui, E-mail: hardhui@gmail.com [Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, 100191 (China)
2017-05-01
Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPH oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm{sup 2} induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm{sup 2}) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91{sup phox}, p47{sup phox} and p40{sup phox}); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47{sup phox} and p67{sup phox} translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to
International Nuclear Information System (INIS)
Wang, Yinxi; Liu, Dan; Zhang, Huifeng; Wang, Yixin; Wei, Ling; Liu, Yutong; Liao, Jieying; Gao, Hui-Ming; Zhou, Hui
2017-01-01
Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPH oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm 2 induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm 2 ) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91 phox , p47 phox and p40 phox ); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47 phox and p67 phox translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to oxidative damage to DA neurons. Our
Analysis of cellulase and polyphenol oxidase production by southern pine beetle associated fungi
Abduvali Valiev; Zumrut B. Ogel; Dier D. Klepzig
2009-01-01
In this study, the production of extracellular enzymes by fungi associated with southern pine beetle was investigated for the first time. Cellulase and polyphenol oxidase production were analyzed for three beetle associated fungi. Only the mutualistic symbiont Entomocorticium sp. A was found to produce cellulases and polyphenol oxidase....
Ozone affects pollen viability and NAD(P)H oxidase release from Ambrosia artemisiifolia pollen
International Nuclear Information System (INIS)
Pasqualini, Stefania; Tedeschini, Emma; Frenguelli, Giuseppe; Wopfner, Nicole; Ferreira, Fatima; D'Amato, Gennaro; Ederli, Luisa
2011-01-01
Air pollution is frequently proposed as a cause of the increased incidence of allergy in industrialised countries. We investigated the impact of ozone (O 3 ) on reactive oxygen species (ROS) and allergen content of ragweed pollen (Ambrosia artemisiifolia). Pollen was exposed to acute O 3 fumigation, with analysis of pollen viability, ROS and nitric oxide (NO) content, activity of nicotinamide adenine dinucleotide phosphate (NAD[P]H) oxidase, and expression of major allergens. There was decreased pollen viability after O 3 fumigation, which indicates damage to the pollen membrane system, although the ROS and NO contents were not changed or were only slightly induced, respectively. Ozone exposure induced a significant enhancement of the ROS-generating enzyme NAD(P)H oxidase. The expression of the allergen Amb a 1 was not affected by O 3 , determined from the mRNA levels of the major allergens. We conclude that O 3 can increase ragweed pollen allergenicity through stimulation of ROS-generating NAD(P)H oxidase. - Highlights: → O 3 reduces the viability of ragweed pollen. → ROS and allergens of ragweed pollen were not affected by O 3 exposure. → O 3 enhances the activity of the ROS-generating enzyme NAD(P)H oxidase. → O 3 increases ragweed pollen allergenicity through NAD(P)H-oxidase stimulation. - This study focuses on the effects of the atmospheric pollutant ozone on ROS content and NAD(P)H oxidase activity of ragweed pollen grains.
Ozone affects pollen viability and NAD(P)H oxidase release from Ambrosia artemisiifolia pollen
Energy Technology Data Exchange (ETDEWEB)
Pasqualini, Stefania, E-mail: spas@unipg.it [Department of Applied Biology, University of Perugia, Perugia (Italy); Tedeschini, Emma; Frenguelli, Giuseppe [Department of Applied Biology, University of Perugia, Perugia (Italy); Wopfner, Nicole; Ferreira, Fatima [Department of Molecular Biology, CD Laboratory for Allergy Diagnosis and Therapy, University of Salzburg, Salzburg (Austria); D' Amato, Gennaro [Division of Respiratory and Allergic Diseases, ' A. Cardarelli' High Speciality Hospital, Naples (Italy); Ederli, Luisa [Department of Applied Biology, University of Perugia, Perugia (Italy)
2011-10-15
Air pollution is frequently proposed as a cause of the increased incidence of allergy in industrialised countries. We investigated the impact of ozone (O{sub 3}) on reactive oxygen species (ROS) and allergen content of ragweed pollen (Ambrosia artemisiifolia). Pollen was exposed to acute O{sub 3} fumigation, with analysis of pollen viability, ROS and nitric oxide (NO) content, activity of nicotinamide adenine dinucleotide phosphate (NAD[P]H) oxidase, and expression of major allergens. There was decreased pollen viability after O{sub 3} fumigation, which indicates damage to the pollen membrane system, although the ROS and NO contents were not changed or were only slightly induced, respectively. Ozone exposure induced a significant enhancement of the ROS-generating enzyme NAD(P)H oxidase. The expression of the allergen Amb a 1 was not affected by O{sub 3}, determined from the mRNA levels of the major allergens. We conclude that O{sub 3} can increase ragweed pollen allergenicity through stimulation of ROS-generating NAD(P)H oxidase. - Highlights: > O{sub 3} reduces the viability of ragweed pollen. > ROS and allergens of ragweed pollen were not affected by O{sub 3} exposure. > O{sub 3} enhances the activity of the ROS-generating enzyme NAD(P)H oxidase. > O{sub 3} increases ragweed pollen allergenicity through NAD(P)H-oxidase stimulation. - This study focuses on the effects of the atmospheric pollutant ozone on ROS content and NAD(P)H oxidase activity of ragweed pollen grains.
Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao
2016-03-18
The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Functional Assembly of Soluble and Membrane Recombinant Proteins of Mammalian NADPH Oxidase Complex.
Souabni, Hajer; Ezzine, Aymen; Bizouarn, Tania; Baciou, Laura
2017-01-01
Activation of phagocyte cells from an innate immune system is associated with a massive consumption of molecular oxygen to generate highly reactive oxygen species (ROS) as microbial weapons. This is achieved by a multiprotein complex, the so-called NADPH oxidase. The activity of phagocyte NADPH oxidase relies on an assembly of more than five proteins, among them the membrane heterodimer named flavocytochrome b 558 (Cytb 558 ), constituted by the tight association of the gp91 phox (also named Nox2) and p22 phox proteins. The Cytb 558 is the membrane catalytic core of the NADPH oxidase complex, through which the reducing equivalent provided by NADPH is transferred via the associated prosthetic groups (one flavin and two hemes) to reduce dioxygen into superoxide anion. The other major proteins (p47 phox , p67 phox , p40 phox , Rac) requisite for the complex activity are cytosolic proteins. Thus, the NADPH oxidase functioning relies on a synergic multi-partner assembly that in vivo can be hardly studied at the molecular level due to the cell complexity. Thus, a cell-free assay method has been developed to study the NADPH oxidase activity that allows measuring and eventually quantifying the ROS generation based on optical techniques following reduction of cytochrome c. This setup is a valuable tool for the identification of protein interactions, of crucial components and additives for a functional enzyme. Recently, this method was improved by the engineering and the production of a complete recombinant NADPH oxidase complex using the combination of purified proteins expressed in bacterial and yeast host cells. The reconstitution into artificial membrane leads to a fully controllable system that permits fine functional studies.
International Nuclear Information System (INIS)
Su Jin; Zhang Xueqin; Yan Qiusheng; Chen Zhangliang; You Chongbiao
1993-08-01
The glnA gene encoding glutamine synthetase (GS) was amplified from Azospirillum brasilense Sp7 by PCR technique. the amplified 1.4 kb DNA fragment was cloned at the EcoRV site of Bluescript-SK. Both sequencing and restriction digestion data showed that the 1.4 kb DNA fragment flanked with BamHI site at each end was really the glnA gene of A. brasilense Sp7. The glnA gene was ligated with Bg1 II site of pCo24. As a result, an expression vector pGSC35 with CaMV35S promoter was obtained. Using colony in situ hybridization with α- 32 P-dATP labelled probes to screen the positive clones, another glnA gene expression vector pAGNB92 with rice actin 1 promoter was constructed after three rounds of ligation and transformation. Protoplasts isolated from rice cell suspension line cv. T986 were transformed with glnA expression vectors pGSC35 and pAGNB92 containing neomycin phosphotransferase II (NPTII) gene by using PEG fusion and electroporation. Transformed microcalli were selected on media containing G418 disulfate salt. NPT II activity was detected in 37% of G418 resistant calli by using dot blot hybridization with γ- 32 P-ATP and kanamycin as substrate
Pérez-Bravo, Francisco; Martinez-Laso, Jorge; Martin-Villa, Jose M; Moscoso, Juan; Moreno, Almudena; Serrano-Vela, Juan I; Zamora, Jorge; Asenjo, Silvia; Gleisner, Andrea; Arnaiz-Villena, Antonio
2006-01-01
A rare case of type I diabetes is studied in an Amerindian (Mapuche) family from Chile, analyzing glutamic acid decarboxylase, islet-cell autoantibodies and human leukocyte antigen (HLA) genes. The affected sib is the only one that has one specific HLA haplotype combination that differs from the other sibs only in the HLA class I genes. It is concluded that HLA diabetes susceptibility factors may be placed outside the class II region or even that susceptibility factors do not exist in the HLA region in this Amerindian family.
Characterisation of genes induced during memory formation in the chick
International Nuclear Information System (INIS)
Bailey, K.A.; Luermans, J.; Gibbs, M.
2002-01-01
Full text: Memory formation can be divided into short-term and long-term. Short-term memory involves electro-chemical activity in the neurons whereas long-term memory requires a permanent change that includes protein synthesis. One of the problems involved with identifying late memory related genes is determining an optimal system in which to study gene expression. We have used a discriminated passive avoidance task in chicks to identify genes that are differentially regulated during memory formation. A mRNA subtraction method was previously used to specifically identify several genes that are expressed in the chick intermediate medial hyperstriatum ventrale (IMHV) within two hours of training. Eight bands ranging in size from 400bp to 1100bp were obtained in the initially screen. We are currently cloning these PCR products into suitable vectors for further analysis. Two of these clones have been sequenced and analysed using both the blastn and blastx programs in ANGIS. The first clone was found to correspond to cytochrome c oxidase subunit 2. Cytochrome C oxidase (COX) is a transmembrane protein localized in the inner mitochondrial membrane and forms part of the mitochondrial respiratory chain complex. The second clone codes for the ferritin heavy chain. Ferritin is a ubiquitous protein that is involved in iron homeostasis. At present it is unclear what role these two proteins play in memory formation but further studies are being undertaken to determine the expression profiles of these genes following memory induction. Copyright (2002) Australian Neuroscience Society
DEFF Research Database (Denmark)
Salomonsen, Jan; Marston, Denise; Avila, David
2003-01-01
for the cloning and sequencing of the cDNA. We found only one class II alpha chain transcript, which bears the major features of a classical class II alpha sequence, including the critical peptide-binding residues. The chicken sequence is more similar to human DR than to the DQ, DP, DO or DM isotypes, most...... the mammalian DR and E isotypes in three properties: the presence of the critical peptide-binding residues, the low level of polymorphism and sequence diversity, and the recombinational separation from the class II beta chain genes. These results indicate that the sequence features of this lineage are both......In mammals, there are MHC class II molecules with distinctive sequence features, such as the classical isotypes DR, DQ and DP. These particular isotypes have not been reported in non-mammalian vertebrates. We have isolated the class II (B-L) alpha chain from outbred chickens as the basis...
Li, Fei-Feng; Wang, Xu-Dong; Zhu, Min-Wei; Lou, Zhi-Hong; Zhang, Qiong; Zhu, Chun-Yu; Feng, Hong-Lin; Lin, Zhi-Guo; Liu, Shu-Lin
2015-12-01
Microcephalic osteodysplastic primordial dwarfism type II (MOPD II) is a highly detrimental human autosomal inherited recessive disorder. The hallmark characteristics of this disease are intrauterine and postnatal growth restrictions, with some patients also having cerebrovascular problems such as cerebral aneurysms. The genomic basis behind most clinical features of MOPD II remains largely unclear. The aim of this work was to identify the genetic defects in a Chinese family with MOPD II associated with multiple intracranial aneurysms. The patient had typical MOPD II syndrome, with subarachnoid hemorrhage and multiple intracranial aneurysms. We identified three novel mutations in the PCNT gene, including one single base alteration (9842A>C in exon 45) and two deletions (Del-C in exon 30 and Del-16 in exon 41). The deletions were co-segregated with the affected individual in the family and were not present in the control population. Computer modeling demonstrated that the deletions may cause drastic changes on the secondary and tertiary structures, affecting the hydrophilicity and hydrophobicity of the mutant proteins. In conclusion, we identified two novel mutations in the PCNT gene associated with MOPD II and intracranial aneurysms, and the mutations were expected to alter the stability and functioning of the protein by computer modeling.
Hansel, Colleen M; Zeiner, Carolyn A; Santelli, Cara M; Webb, Samuel M
2012-07-31
Manganese (Mn) oxides are among the most reactive minerals within the environment, where they control the bioavailability of carbon, nutrients, and numerous metals. Although the ability of microorganisms to oxidize Mn(II) to Mn(III/IV) oxides is scattered throughout the bacterial and fungal domains of life, the mechanism and physiological basis for Mn(II) oxidation remains an enigma. Here, we use a combination of compound-specific chemical assays, microspectroscopy, and electron microscopy to show that a common Ascomycete filamentous fungus, Stilbella aciculosa, oxidizes Mn(II) to Mn oxides by producing extracellular superoxide during cell differentiation. The reactive Mn oxide phase birnessite and the reactive oxygen species superoxide and hydrogen peroxide are colocalized at the base of asexual reproductive structures. Mn oxide formation is not observed in the presence of superoxide scavengers (e.g., Cu) and inhibitors of NADPH oxidases (e.g., diphenylene iodonium chloride), enzymes responsible for superoxide production and cell differentiation in fungi. Considering the recent identification of Mn(II) oxidation by NADH oxidase-based superoxide production by a common marine bacterium (Roseobacter sp.), these results introduce a surprising homology between some prokaryotic and eukaryotic organisms in the mechanisms responsible for Mn(II) oxidation, where oxidation appears to be a side reaction of extracellular superoxide production. Given the versatility of superoxide as a redox reactant and the widespread ability of fungi to produce superoxide, this microbial extracellular superoxide production may play a central role in the cycling and bioavailability of metals (e.g., Hg, Fe, Mn) and carbon in natural systems.
Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.
Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria
2018-05-01
RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.
Jeske, Y W A; So, A; Kelemen, L; Sukor, N; Willys, C; Bulmer, B; Gordon, R D; Duffy, D; Stowasser, M
2008-04-01
1. There are two types of familial hyperaldosteronism (FH): FH-I and FH-II. FH-I is caused by a hybrid CYP11B1/CYP11B2 gene mutation. The genetic cause of FH-II, which is more common, is unknown. Adrenal hyperplasia and adenomas are features. We previously reported linkage of FH-II to a approximately 5 Mb region on chromosome 7p22. We subsequently reported finding no causative mutations in the retinoblastoma-associated Kruppel-associated box gene (RBaK), a candidate at 7p22 involved in tumorigenesis and cell cycle control. 2. In the current study we investigated RBaK regulatory regions and two other candidate genes: postmeiotic segregation increased 2 (PMS2, involved in DNA mismatch repair and tumour predisposition) and guanine nucleotide-binding protein alpha-12 (GNA12, a transforming oncogene). 3. The GNA12 and PMS2 genes were examined in two affected (A1, A2) and two unaffected (U1, U2) subjects from a large 7p22-linked FH-II family (family 1). No mutations were found. 4. The RBaK and PMS2 distal promoters were sequenced to -2150 bp from the transcription start site for RBaK and-2800 bp for PMS2. Five unreported single nucleotide polymorphisms (SNPs) were found in subjects A1, A2 but not in U1 or U2; A(-2031 bp)T, T(-2030 bp)G, G(-834 bp)C, C(-821 bp)G in RBaK and A(-876 bp)G in PMS2. Additional affected and unaffected subjects from family 1 and from two other 7p22-linked FH-II families and 58 unrelated normotensive control subjects were genotyped for these SNPs. 5. The five novel SNPs were found to be present in a significant proportion of normotensive controls. The four RBaK promoter SNPs were found to be in linkage disequilibrium in the normal population. The RBaK promoter (-)2031T/2030G/834C/821T allele was found to be in linkage disequilibrium with the causative mutation in FH-II family 1, but not in families 2 and 3. The PMS2 promoter (-)876G allele was also found to be linked to affected phenotypes in family 1. 6. The RBaK and PMS2 promoter SNPs alter the
Determination of catechin in green tea using a catechol oxidase biomimetic sensor
International Nuclear Information System (INIS)
Fernandes, Suellen C.; Osorio, Renata El-Hage M. de Barros; Anjos, Ademir dos; Neves, Ademir; Micke, Gustavo Amadeu; Vieira, Iolanda C.
2008-01-01
A catechol oxidase biomimetic sensor, based on a novel copper(II) complex, was developed for the determination of catechin in green tea and the results were compared with those obtained by capillary electrophoresis. The dinuclear copper(II) complex, [Cu 2 (HL)(μ-CH 3 COO)](ClO 4 ), containing the ligand N,N-[bis-(2-pyridylmethyl)]-N',N'-[(2-hydroxybenzyl)(2-hydroxy-3,5-di-tert - butylbenzyl)]-1,3-propanediamine-2-ol (H 3 L), was synthesized and characterized by IR, 1 H NMR and elemental analysis. The best conditions for the optimization of the biomimetic sensor were established by square wave voltammetry. The best performance for this sensor was obtained in 75:15:10% (m/m/m) of the graphite powder:nujol:copper(II) complex, 0.05 mol L -1 phosphate buffer solution (pH 7.5) and frequency, pulse amplitude, scan increment at 30 Hz, 80 mV, 3.3 mV, respectively. The analytical curve was linear in the concentration range 4.95 x 10 -6 to 3.27 x 10 -5 mol L -1 (r = 0.9993) with a detection limit of 2.8 x 10 -7 mol L -1 . This biomimetic sensor demonstrated long-term stability (9 months; 800 determinations) and reproducibility with a relative standard deviation of 3.5%. The recovery of catechin from green tea samples ranged from 93.8 to 106.9% and the determination, compared with that obtained using capillary electrophoresis, was found to be acceptable at the 95% confidence level. (author)
Ehsan, Muhammad; Akhter, Nasreen; Bhutto, Bachal; Arijo, Abdullah; Ali Gadahi, Javaid
2017-05-30
Cystic echinococcosis is an important zoonotic disease; it has serious impacts on animals as well as human health throughout the world. Genotypic characterization of Echinocossus granulosus (E. granulosus) in buffaloes has not been addressed in Pakistan. Therefore, the present study was conducted to evaluate the incidence and genotypic characterization of bovine E. granulosus. Out of 832 buffaloes examined, 112 (13.46%) were found infected. The favorable site for hydatid cyst development was liver (8.65%) followed by lungs (4.80%). The rate of cystic echinococcosis was found higher in females 14.43% than males 9.77%. The females above seven years aged were more infected as compared to the young ones. The partial sequence of mitochondrial cytochrome oxidase 1 (CO1) gene was used for identification and molecular analysis of buffalo's E. granulosus isolates. The alignment of redundant sequences were compared with already identified 10 genotypes available at National Centre for Biotechnology Information (NCBI) GenBank. The sequencing and phylogenetic analysis of all randomly selected buffalo isolates were belong to the G1- G3 complex (E. granulosus sensu stricto). All sequences were diverse from the reference sequence. No one showed complete identity to the buffalo strain (G3), representing substantial microsequence variability in G1, G2 and G3 genotypes. We evaluated the echinococcal infectivity and first time identification of genotypes in buffaloes in Sindh, Pakistan. This study will lead to determine accurate source of this zoonotic disease to humans in Pakistan. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Marta Berrocal-Lobo
2010-12-01
Full Text Available Pathogen associated molecular patterns (PAMPs are signals detected by plants that activate basal defenses. One of these PAMPs is chitin, a carbohydrate present in the cell walls of fungi and in insect exoskeletons. Previous work has shown that chitin treatment of Arabidopsis thaliana induced defense-related genes in the absence of a pathogen and that the response was independent of the salicylic acid (SA, jasmonic acid (JA and ethylene (ET signaling pathways. One of these genes is ATL9 ( = ATL2G, which encodes a RING zinc-finger like protein. In the current work we demonstrate that ATL9 has E3 ubiquitin ligase activity and is localized to the endoplasmic reticulum. The expression pattern of ATL9 is positively correlated with basal defense responses against Golovinomyces cichoracearum, a biotrophic fungal pathogen. The basal levels of expression and the induction of ATL9 by chitin, in wild type plants, depends on the activity of NADPH oxidases suggesting that chitin-mediated defense response is NADPH oxidase dependent. Although ATL9 expression is not induced by treatment with known defense hormones (SA, JA or ET, full expression in response to chitin is compromised slightly in mutants where ET- or SA-dependent signaling is suppressed. Microarray analysis of the atl9 mutant revealed candidate genes that appear to act downstream of ATL9 in chitin-mediated defenses. These results hint at the complexity of chitin-mediated signaling and the potential interplay between elicitor-mediated signaling, signaling via known defense pathways and the oxidative burst.
Erives, Albert J
2017-11-28
While the genomes of eukaryotes and Archaea both encode the histone-fold domain, only eukaryotes encode the core histone paralogs H2A, H2B, H3, and H4. With DNA, these core histones assemble into the nucleosomal octamer underlying eukaryotic chromatin. Importantly, core histones for H2A and H3 are maintained as neofunctionalized paralogs adapted for general bulk chromatin (canonical H2 and H3) or specialized chromatin (H2A.Z enriched at gene promoters and cenH3s enriched at centromeres). In this context, the identification of core histone-like "doublets" in the cytoplasmic replication factories of the Marseilleviridae (MV) is a novel finding with possible relevance to understanding the origin of eukaryotic chromatin. Here, we analyze and compare the core histone doublet genes from all known MV genomes as well as other MV genes relevant to the origin of the eukaryotic replisome. Using different phylogenetic approaches, we show that MV histone domains encode obligate H2B-H2A and H4-H3 dimers of possible proto-eukaryotic origin. MV core histone moieties form sister clades to each of the four eukaryotic clades of canonical and variant core histones. This suggests that MV core histone moieties diverged prior to eukaryotic neofunctionalizations associated with paired linear chromosomes and variant histone octamer assembly. We also show that MV genomes encode a proto-eukaryotic DNA topoisomerase II enzyme that forms a sister clade to eukaryotes. This is a relevant finding given that DNA topo II influences histone deposition and chromatin compaction and is the second most abundant nuclear protein after histones. The combined domain architecture and phylogenomic analyses presented here suggest that a primitive origin for MV histone genes is a more parsimonious explanation than horizontal gene transfers + gene fusions + sufficient divergence to eliminate relatedness to eukaryotic neofunctionalizations within the H2A and H3 clades without loss of relatedness to each of
El Sayed, S M; El-Magd, R M Abou; Shishido, Y; Yorita, K; Chung, S P; Tran, D H; Sakai, T; Watanabe, H; Kagami, S; Fukui, K
2012-10-01
Angiogenesis is critical for cancer growth and metastasis. Steps of angiogenesis are energy consuming, while vascular endothelial cells are highly glycolytic. Glioblastoma multiforme (GBM) is a highly vascular tumor and this enhances its aggressiveness. D-amino acid oxidase (DAO) is a promising therapeutic protein that induces oxidative stress upon acting on its substrates. Oxidative stress-energy depletion (OSED) therapy was recently reported (El Sayed et al., Cancer Gene Ther, 19, 1-18, 2012). OSED combines DAO-induced oxidative stress with energy depletion caused by glycolytic inhibitors such as 3-bromopyruvate (3BP), a hexokinase II inhibitor that depleted ATP in cancer cells and induced production of hydrogen peroxide. 3BP disturbs the Warburg effect and antagonizes effects of lactate and pyruvate (El Sayed et al., J Bioenerg Biomembr, 44, 61-79, 2012). Citrate is a natural organic acid capable of inhibiting glycolysis by targeting phosphofructokinase. Here, we report that DAO, 3BP and citrate significantly inhibited angiogenesis, decreased the number of vascular branching points and shortened the length of vascular tubules. OSED delayed the growth of C6/DAO glioma cells. 3BP combined with citrate delayed the growth of C6 glioma cells and decreased significantly the number and size of C6 glioma colonies in soft agar. Human GBM cells (U373MG) were resistant to chemotherapy e.g. cisplatin and cytosine arabinoside, while 3BP was effective in decreasing the viability and disturbing the morphology of U373MG cells.