WorldWideScience

Sample records for ovis aries genes

  1. Comparative histology of the femur between mouflon (Ovis aries musimon and sheep (Ovis aries aries

    Directory of Open Access Journals (Sweden)

    Stefano Giua

    2014-12-01

    Full Text Available Mouflon (Ovis aries musimon and sheep (Ovis aries aries are considered as the wild and domestic subspecies of the same species. A comparative study on the microstructure of mouflon and sheep femoral bone diaphysis is here reported. Bone microstructure is described for the first time in the mouflon. More than 200 secondary osteons from both subspecies were analyzed and qualitative evaluation was followed by quantitative determination of perimeter, area, minimum and maximum diameters of secondary osteons and Haversian canals. The basic structural patterns observed in both subspecies can be classified as plexiform and irregular Haversian tissue, in accordance with what reported in the literature for most ruminants. The presence of many secondary osteons in the mouflon means that the bone also consists of dense Haversian bone tissue. Statistical analysis demonstrated that mouflon secondary osteons are larger than in the sheep and made of a greater number of lamellae. Since mouflon and sheep are taxonomically closely related and their body size is very similar, the qualitative and quantitative differences here reported could be primarily explained on account of their different lifestyle. Indeed, the habits of wildlife typical of mouflons may lead to the presence of wide areas of dense Haversian tissue in that subspecies, as mechanical stresses are known to be related to number and size of secondary osteons. Finally, this analysis could provide a useful tool to recognize bones from different species, in forensic exam and archaeozoological studies as well.

  2. A high resolution atlas of gene expression in the domestic sheep (Ovis aries).

    Science.gov (United States)

    Clark, Emily L; Bush, Stephen J; McCulloch, Mary E B; Farquhar, Iseabail L; Young, Rachel; Lefevre, Lucas; Pridans, Clare; Tsang, Hiu G; Wu, Chunlei; Afrasiabi, Cyrus; Watson, Mick; Whitelaw, C Bruce; Freeman, Tom C; Summers, Kim M; Archibald, Alan L; Hume, David A

    2017-09-01

    Sheep are a key source of meat, milk and fibre for the global livestock sector, and an important biomedical model. Global analysis of gene expression across multiple tissues has aided genome annotation and supported functional annotation of mammalian genes. We present a large-scale RNA-Seq dataset representing all the major organ systems from adult sheep and from several juvenile, neonatal and prenatal developmental time points. The Ovis aries reference genome (Oar v3.1) includes 27,504 genes (20,921 protein coding), of which 25,350 (19,921 protein coding) had detectable expression in at least one tissue in the sheep gene expression atlas dataset. Network-based cluster analysis of this dataset grouped genes according to their expression pattern. The principle of 'guilt by association' was used to infer the function of uncharacterised genes from their co-expression with genes of known function. We describe the overall transcriptional signatures present in the sheep gene expression atlas and assign those signatures, where possible, to specific cell populations or pathways. The findings are related to innate immunity by focusing on clusters with an immune signature, and to the advantages of cross-breeding by examining the patterns of genes exhibiting the greatest expression differences between purebred and crossbred animals. This high-resolution gene expression atlas for sheep is, to our knowledge, the largest transcriptomic dataset from any livestock species to date. It provides a resource to improve the annotation of the current reference genome for sheep, presenting a model transcriptome for ruminants and insight into gene, cell and tissue function at multiple developmental stages.

  3. Survival of bighorn sheep (Ovis canadensis) commingled with domestic sheep (Ovis aries) in the absence of Mycoplasma ovipneumoniae.

    Science.gov (United States)

    Besser, Thomas E; Cassirer, E Frances; Yamada, Catherine; Potter, Kathleen A; Herndon, Caroline; Foreyt, William J; Knowles, Donald P; Srikumaran, Subramaniam

    2012-01-01

    To test the hypothesis that Mycoplasma ovipneumoniae is an important agent of the bighorn sheep (Ovis canadensis) pneumonia that has previously inevitably followed experimental commingling with domestic sheep (Ovis aries), we commingled M. ovipneumoniae-free domestic and bighorn sheep (n=4 each). One bighorn sheep died with acute pneumonia 90 days after commingling, but the other three remained healthy for >100 days. This unprecedented survival rate is significantly different (P=0.002) from that of previous bighorn-domestic sheep contact studies but similar to (P>0.05) bighorn sheep survival following commingling with other ungulates. The absence of epizootic respiratory disease in this experiment supports the hypothesized role of M. ovipneumoniae as a key pathogen of epizootic pneumonia in bighorn sheep commingled with domestic sheep.

  4. Passive transfer in domestic and bighorn lambs Total IgG in ewe sera and colostrum and serum IgG kinetics in lambs following colostrum ingestion are similar in domestic sheep and bighorn sheep (ovis aries and ovis canadensis)

    Science.gov (United States)

    Pneumonia is a population-limiting disease of bighorn sheep (BHS; Ovis canadensis) and a recognized disease entity in domestic sheep (DS; Ovis aries) worldwide. Respiratory disease in BHS lambs can persist for years after all-age outbreaks, resulting in suppressed lamb recruitment. It has been sugge...

  5. Transmission of Mannheimia haemolytica from domestic sheep (Ovis aries) to bighorn sheep (Ovis canadensis): unequivocal demonstration with green fluorescent protein-tagged organisms.

    Science.gov (United States)

    Lawrence, Paulraj K; Shanthalingam, Sudarvili; Dassanayake, Rohana P; Subramaniam, Renuka; Herndon, Caroline N; Knowles, Donald P; Rurangirwa, Fred R; Foreyt, William J; Wayman, Gary; Marciel, Ann Marie; Highlander, Sarah K; Srikumaran, Subramaniam

    2010-07-01

    Previous studies demonstrated that bighorn sheep (Ovis canadensis) died of pneumonia when commingled with domestic sheep (Ovis aries) but did not conclusively prove that the responsible pathogens were transmitted from domestic to bighorn sheep. The objective of this study was to determine, unambiguously, whether Mannheimia haemolytica can be transmitted from domestic to bighorn sheep when they commingle. Four isolates of M. haemolytica were obtained from the pharynx of two of four domestic sheep and tagged with a plasmid carrying the genes for green fluorescent protein (GFP) and ampicillin resistance (AP(R)). Four domestic sheep, colonized with the tagged bacteria, were kept about 10 m apart from four bighorn sheep for 1 mo with no clinical signs of pneumonia observed in the bighorn sheep during that period. The domestic and bighorn sheep were then allowed to have fence-line contact for 2 mo. During that period, three bighorn sheep acquired the tagged bacteria from the domestic sheep. At the end of the 2 mo of fence-line contact, the animals were allowed to commingle. All four bighorn sheep died 2 days to 9 days following commingling. The lungs from all four bighorn sheep showed gross and histopathologic lesions characteristic of M. haemolytica pneumonia. Tagged M. haemolytica were isolated from all four bighorn sheep, as confirmed by growth in ampicillin-containing culture medium, PCR-amplification of genes encoding GFP and Ap(R), and immunofluorescent staining of GFP. These results unequivocally demonstrate transmission of M. haemolytica from domestic to bighorn sheep, resulting in pneumonia and death of bighorn sheep.

  6. First report of Taenia ovis infection in Danish sheep (Ovis aries)

    DEFF Research Database (Denmark)

    Petersen, Heidi Huus; Al-Sabi, Mohammad N.S.; Larsen, Gitte

    2018-01-01

    We report Taenia ovis infection in Danish sheep for the first time. In spring 2016, the metocestode stage of T. ovis was at slaughter observed in heart muscles, diaphragm and skeletal muscles from approx. a third of all sheep from one specific farm localised in South Jutland. The diagnosis was co...

  7. X- and Y-chromosome specific variants of the amelogenin gene allow sex determination in sheep (Ovis aries and European red deer (Cervus elaphus

    Directory of Open Access Journals (Sweden)

    Brenig B

    2005-03-01

    Full Text Available Abstract Background Simple and precise methods for sex determination in animals are a pre-requisite for a number of applications in animal production and forensics. However, some of the existing methods depend only on the detection of Y-chromosome specific sequences. Therefore, the abscence of a signal does not necessarily mean that the sample is of female origin, because experimental errors can also lead to negative results. Thus, the detection of Y- and X-chromosome specific sequences is advantageous. Results A novel method for sex identification in mammals (sheep, Ovis aries and European red deer, Cervus elaphus is described, using a polymerase chain reaction (PCR and sequencing of a part of the amelogenin gene. A partial sequence of the amelogenin gene of sheep and red deer was obtained, which exists on both X and Y chromosomes with a deletion region on the Y chromosome. With a specific pair of primers a DNA fragment of different length between the male and female mammal was amplified. Conclusion PCR amplification using the amelogenin gene primers is useful in sex identification of samples from sheep and red deer and can be applied to DNA analysis of micro samples with small amounts of DNA such as hair roots as well as bones or embryo biopsies.

  8. Interactions between Rocky Mountain Bighorn Sheep Ovis canadensis canadensis and Domestic Sheep Ovis aries and the Biological, Social, Economic, and Legal Implications of these Interactions on USDA Forest Service Lands in the Evanston/Mt. View Ranger District

    OpenAIRE

    Herrera, Ashly Nicole

    2012-01-01

    Strong evidence exists indicating domestic sheep (Ovis aries) can infect Rocky Mountain bighorn sheep (Ovis canadensis canadensis), a United States Forest Service (USFS) Region 4 sensitive species, with pneumonia (Callan 1991; Foreyt 1989, 1992, 1994; Foreyt and Lagerquist 1996; George et al 2008; Wehausen et al. 2011). Since the transmission of the pneumonic bacteria between the domestic and wild sheep is a result of bighorn sheep coming into contact with the bacteria carried in the mucous m...

  9. Mannheimia haemolytica serotype A1 exhibits differential pathogenicity in two related species, Ovis canadensis and Ovis aries.

    Science.gov (United States)

    Dassanayake, Rohana P; Shanthalingam, Sudarvili; Herndon, Caroline N; Lawrence, Paulraj K; Frances Cassirer, E; Potter, Kathleen A; Foreyt, William J; Clinkenbeard, Kenneth D; Srikumaran, Subramaniam

    2009-02-02

    Mannheimia haemolytica causes pneumonia in both bighorn sheep (BHS, Ovis canadensis) and domestic sheep (DS, Ovis aries). Under experimental conditions, co-pasturing of BHS and DS results in fatal pneumonia in BHS. It is conceivable that certain serotypes of M. haemolytica carried by DS are non-pathogenic to them, but lethal for BHS. M. haemolytica serotypes A1 and A2 are carried by DS in the nasopharynx. However, it is the serotype A2 that predominantly causes pneumonia in DS. The objectives of this study were to determine whether serotype A1 exhibits differential pathogenicity to BHS and DS, and to determine whether leukotoxin (Lkt) secreted by this organism is its primary virulence factor. Three groups each of BHS and DS were intra-tracheally administered either 1 x 10(9)cfu of serotype A1 wild-type (lktA-Wt group), Lkt-deletion mutant of serotype A1-(lktA-Mt group), or saline (control group), respectively. In the lktA-Wt groups, all four BHS died within 48h while none of the DS died during the 2-week study period. In the lktA-Mt groups, none of the BHS or DS died. In the control groups, one DS died due to an unrelated cause. Necropsy and histopathological findings revealed that death of BHS in the lktA-Wt group was due to bilateral, fibrinohemorrhagic pneumonia. Although the A1-Mt-inoculated BHS were clinically normal, on necropsy, lungs of two BHS showed varying degrees of mild chronic pneumonia. These results indicate that M. haemolytica serotype A1 is non-pathogenic to DS, but highly lethal to BHS, and that Lkt is the primary virulence factor of M. haemolytica.

  10. Identification of Brucella ovis exclusive genes in field isolates from Argentina.

    Science.gov (United States)

    Alvarez, Lucía Paula; García-Effrón, Guillermo; Robles, Carlos Alejandro

    2016-03-01

    Brucellosis caused by Brucella ovis is one of the most important infectious diseases of sheep. The aim of this study was to determine the presence of genes both inside and outside the specific B. ovis pathogenicity island 1 (BOPI-1) in a large collection of field isolates of B. ovis and other Brucella spp. from Argentina. The BOV_A0500 gene from B. ovis BOPI-1 was identified in all 104 B. ovis isolates studied. The BOPI-1 complete sequence was found to be conserved in 10 B. ovis strains from the collection, for which whole genome sequencing was performed. The BOV_0198 gene, which is outside BOPI-1 and considered exclusive to B. ovis, showed 90-100% identity with genomic regions of B. ovis, B. melitensis, B. abortus, B. canis, B. suis, B. microti, B. ceti and B. pinnipedialis. The results demonstrate that BOPI-1 is the only exclusive genetic region of B. ovis and marine Brucella spp. and that it is highly conserved in B. ovis field isolates from Argentina. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Ovis aries CR4 is involved in Mannheimia haemolytica leukotoxin-induced cytotoxicity.

    Science.gov (United States)

    Lawrence, Paulraj K; Dassanayake, Rohana P

    2010-06-15

    Pneumonia caused by Mannheimia haemolytica is an important disease of domestic sheep (DS, Ovis aries) and cattle (BO). M. haemolytica is a normal commensal of the upper respiratory tract in ruminants, but during stress and viral infection it breaches the host innate mucosal defense and descents into lungs causing fibrinous pleuropneumonia. Leukotoxin (Lkt) produced by M. haemolytica is cytolytic to all subsets of ruminant leukocytes. Earlier, we and others have shown that DS and BO LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18) can mediate Lkt-induced cytolysis. It is not clear whether CR4 (CD11c/CD18), which is involved in chemotaxis, phagocytosis and regulates host immune response can also mediate Lkt-induced cytolysis in ruminants. The host innate immune response to M. haemolytica is poorly understood and the involvement of CR4 in M. haemolytica pathogenesis is one of the most understudied. This problem is further compounded by the lack of cd11c genes from any ruminant species. Therefore, the objectives of this study were to clone cd11c and determine whether CR4 can serve as a receptor for Lkt. In this direction we cloned two alleles of cd11c gene from leukocytes isolated from DS blood by RT-PCR. Transfectants developed expressing functional DS CR4 were found to be cytotoxic to Lkt from four different isolates of M. haemolytica. This is the first report confirming the ability of a recombinant ovine CR4 to bind to M. haemolytica Lkt and mediate concentration-dependent lysis of host cells, thus, confirming their role in M. haemolytica pathogenesis. This is a critical step in understanding host innate immunity and the management of pneumonia in sheep. Copyright 2009 Elsevier B.V. All rights reserved.

  12. Glucose 6-phosphate dehydrogenase: isoenzymatic pattern in Oesophagostomum venulosum, Trichuris ovis and T. suis.

    Science.gov (United States)

    Rodriguez, B; Cutillas, C; German, P; Guevara, D

    1991-12-01

    In the present communication we have studied the isoenzymatic pattern activity of the glucose 6-phosphate dehydrogenase (G6PD) in Oesophagostomum venulosum, Trichuris ovis and T. suis, parasites of Capra hircus (goat), Ovis aries (sheep) and Sus scrofa domestica (pig) respectively, by polyacrylamide gel electrophoresis. Different phenotypes have been observed in the G6PD isoenzymatic pattern activity in males and females of Oesophagostomum venulosum. Furthermore, G6PD activity has been assayed in Trichuris ovis collected from Ovis aries and Capra hircus. No differences have been observed in the isoenzymatic patterns attending to the different hosts. All the individuals exhibited one single band or two bands; this suggests a monomeric condition for G6PD in T. ovis. In T. suis the enzyme G6PD appeared as a single electrophoretic band in about 85.7% of the individuals.

  13. Shared Bacterial and Viral Respiratory Agents in Bighorn Sheep (Ovis canadensis, Domestic Sheep (Ovis aries, and Goats (Capra hircus in Montana

    Directory of Open Access Journals (Sweden)

    David S. Miller

    2011-01-01

    Full Text Available Transmission of infectious agents from livestock reservoirs has been hypothesized to cause respiratory disease outbreaks in bighorn sheep (Ovis canadensis, and land management policies intended to limit this transmission have proven controversial. This cross-sectional study compares the infectious agents present in multiple populations of bighorn sheep near to and distant from their interface with domestic sheep (O. aries and domestic goat (Capra hircus and provides critical baseline information needed for interpretations of cross-species transmission risks. Bighorn sheep and livestock shared exposure to Pasteurellaceae, viral, and endoparasite agents. In contrast, although the impact is uncertain, Mycoplasma sp. was isolated from livestock but not bighorn sheep. These results may be the result of historic cross-species transmission of agents that has resulted in a mosaic of endemic and exotic agents. Future work using longitudinal and multiple population comparisons is needed to rigorously establish the risk of outbreaks from cross-species transmission of infectious agents.

  14. Shared bacterial and viral respiratory agents in bighorn sheep (Ovis canadensis), domestic sheep (Ovis aries), and goats (Capra hircus) in Montana

    Science.gov (United States)

    Miller, David S.; Weiser, Glen C.; Aune, Keith; Roeder, Brent; Atkinson, Mark; Anderson, Neil; Roffe, Thomas J.; Keating, Kim A.; Chapman, Phillip L.; Kimberling, Cleon; Rhyan, Jack C.; Clarke, P. Ryan

    2011-01-01

    Transmission of infectious agents from livestock reservoirs has been hypothesized to cause respiratory disease outbreaks in bighorn sheep (Ovis canadensis), and land management policies intended to limit this transmission have proven controversial. This cross-sectional study compares the infectious agents present in multiple populations of bighorn sheep near to and distant from their interface with domestic sheep (O. aries) and domestic goat (Capra hircus) and provides critical baseline information needed for interpretations of cross-species transmission risks. Bighorn sheep and livestock shared exposure to Pasteurellaceae, viral, and endoparasite agents. In contrast, although the impact is uncertain, Mycoplasma sp. was isolated from livestock but not bighorn sheep. These results may be the result of historic cross-species transmission of agents that has resulted in a mosaic of endemic and exotic agents. Future work using longitudinal and multiple population comparisons is needed to rigorously establish the risk of outbreaks from cross-species transmission of infectious agents.

  15. Grazing by sheep Ovis aries reduces island populations of water voles Arvicola amphibius

    Directory of Open Access Journals (Sweden)

    Karl Frafjord

    2014-12-01

    Full Text Available The population of water voles Arvicola amphibius was surveyed on 21 islands in the Solvær archipelago, northern Norway, in August 2012; 11 islands with semi-wild domestic sheep Ovis aries and 10 islands without sheep. Signs from water voles are very easy to detect and were used as a measure of the population (on a scale 0-10, and the numbers of sheep were counted. The ranking of signs on islands with and without sheep was compared, and a significant difference was found. Islands with sheep had, with one exception, only very small and fragmented populations of water voles, the one exception being a fairly large Carex swamp that was not grazed by the sheep and where a moderate-sized population of voles was found. Islands without sheep had much larger populations of water voles, giving a ranking about four times higher. One reason for the devastating effect of sheep on water voles is probably the fact that the sheep are living year-round on these islands with no supplemental food.

  16. Differential Susceptibility of Bighorn Sheep (Ovis canadensis) and Domestic Sheep (Ovis aries) Neutrophils to Mannheimia haemolytica Leukotoxin is not due to Differential Expression of Cell Surface CD18.

    Science.gov (United States)

    Dassanayake, Rohana P; Shanthalingam, Sudarvili; Liu, Weiguo; Casas, Eduardo; Srikumaran, Subramaniam

    2017-07-01

    Bighornsheep ( Ovis canadensis ) are more susceptible to pneumonia caused by Mannheimia haemolytica than are domestic sheep ( Ovis aries ). Leukotoxin produced by M. haemolytica is the principal virulence factor involved in pneumonia pathogenesis. Although leukotoxin is cytolytic to all subsets of ruminant leukocytes, neutrophils are the most susceptible subset. Bighorn sheep neutrophils are four- to eightfold more susceptible to leukotoxin-induced cytolysis than are domestic sheep neutrophils. We hypothesized that the higher susceptibility of bighorn sheep neutrophils, in comparison to domestic sheep neutrophils, is due to higher expression of CD18, the receptor for leukotoxin on leukocytes. Our objective was to quantify CD18 expression on neutrophils of bighorn sheep and domestic sheep. Cell-surface CD18 expression on bighorn sheep and domestic sheep neutrophils was measured as antibody binding capacity of cells by flow cytometric analysis with two fluorochrome-conjugated anti-CD18 monoclonal antibodies (BAQ30A and HUH82A) and microspheres. Contrary to our expectations, CD18 expression was higher (Psheep neutrophils in comparison to bighorn sheep neutrophils. These findings suggest that the higher in vitro susceptibility to leukotoxin of bighorn sheep neutrophils compared to domestic sheep neutrophils is not due to higher expression of the leukotoxin receptor CD18 on bighorn sheep neutrophils.

  17. A comparative study of ketone body metabolism between the camel (Camelus dromedarius) and the sheep (Ovis aries).

    Science.gov (United States)

    Chandrasena, L G; Emmanuel, B; Hamar, D W; Howard, B R

    1979-01-01

    1. Plasma levels of beta-hydroxybutyrate (BHB), and acetoacetate (AcAc) have been measured in camels (Camelus dromedarius) and sheep (Ovis aries). The activity of beta-hydroxybutyrate dehydrogenase (BHB-deH2) (E.C. 1.1.1.30) was studied in the rumen epithelium and the liver of these animals. 2. Concentrations of plasma BHB and AcAc in the camel were in respective order 33 and 4 times lower than that of the sheep. The ratios of BHB to AcAc were 0.61 and 4.8 for the camel and sheep, respectively. 3. The activity of BHB-deH2 in the rumen epithelium of the camel and sheep were 7.15 and 66 mumol/hr/g wet wt tissue, respectively. The activity in both species was higher in the rumen epithelium than in the liver.

  18. Ovis aries (Artiodactyla: Bovidae e Capra hircus (Artiodactyla: Bovidae parasitados por Oestrus ovis (Diptera: Oestridae no Distrito Federal, Brasil

    Directory of Open Access Journals (Sweden)

    Edison Cansi

    2011-12-01

    Abstract. The Oestrosis is an obligatory and cavitary myiasis of sheep and goat, wild and domestic, caused by the larvae of Oestrus ovis (Linnaeus fly. This study records the presence of O. ovis in the West Central region of Brazil as parasites of goats and sheep. We obtained six larvae from sheep and goats with suspects of oestrosis in Brasília (Brazil originate two females adult of O. ovis, after 20 and 23 days respectively of pupation. This finding is probably associated with expansion and diversification of farming in the Cerrado of the Brazilian central plateau.

  19. Differential expression of interleukin-8 by polymorphonuclear leukocytes of two closely related species, Ovis canadensis and Ovis aries, in response to Mannheimia haemolytica infection.

    Science.gov (United States)

    Herndon, Caroline N; Foreyt, William J; Srikumaran, Subramaniam

    2010-08-01

    The pneumonic lesions and mortality caused by Mannheimia haemolytica in bighorn sheep (BHS; Ovis canadensis) are more severe than those in the related species, domestic sheep (DS; Ovis aries), under both natural and experimental conditions. Leukotoxin (Lkt) and lipopolysaccharide (LPS) are the most important virulence factors of this organism. One hallmark of pathogenesis of pneumonia is the influx of polymorphonuclear leukocytes (PMNs) into the lungs. Lkt-induced cytolysis of PMNs results in the release of cytotoxic compounds capable of damaging lung tissue. Interleukin-8 (IL-8) is a potent PMN chemoattractant. The objective of the present study was to determine if there is differential expression of IL-8 by the macrophages and PMNs of BHS and DS in response to M. haemolytica. Macrophages and PMNs of BHS and DS were stimulated with heat-killed M. haemolytica or LPS. IL-8 expression by the cells was measured by enzyme-linked immunosorbent assays and real-time reverse transcription-PCR (RT-PCR). The PMNs of BHS expressed severalfold higher levels of IL-8 than those of DS upon stimulation. Lesional lung tissue of M. haemolytica-infected BHS contained significantly higher levels of IL-8 than nonlesional tissue. The bronchoalveolar lavage (BAL) fluid of infected BHS also contained higher levels of IL-8 than that of infected DS. Depletion of IL-8 reduced migration of PMNs toward BAL fluid by approximately 50%, indicating that IL-8 is integral to PMN recruitment to the lung during M. haemolytica infection. Excessive production of IL-8, enhanced recruitment of PMNs, and PMN lysis by Lkt are likely responsible for the severity of the lung lesions in M. haemolytica-infected BHS.

  20. SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

    Science.gov (United States)

    Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon

    2016-01-01

    Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.

  1. Non-overlapping distributions of feral sheep (Ovis aries) and Stout Iguanas (Cyclura pinguis) on Guana Island, British Virgin Islands

    Science.gov (United States)

    Skipper, Ben R.; Grisham, Blake A.; Kalyvaki, Maria; McGaughey, Kathleen; Mougey, Krista; Navarrete, Laura; Rondeau, Renée; Boal, Clint W.; Perry, Gad

    2013-01-01

    Stout Iguanas (Cyclura pinguis) remain one of the most critically endangered reptiles in the world. Factors contributing to that status include habitat loss, predation by introduced species, and competition with introduced herbivores. On Guana Island, British Virgin Islands, the presence of feral sheep (Ovis aries) has been a hypothesized detriment to iguanas. Using motion sensitive cameras, we documented the distribution of feral sheep on Guana Island in 2010. We also quantified the impact of feral sheep on ground vegetation by comparing plant abundance at longterm sheep exclosures and areas where sheep were absent to areas where sheep were present. Finally, we compared sheep distribution to iguana distribution on the island. The co-occurrence of sheep and Stout Iguanas was less than expected, indicating possible competition. Although we detected no difference in vegetative cover between areas where sheep were present and absent, the long-term exclosures showed that the exclusion of sheep allowed the abundance of many plant species to increase. Our data support the hypothesis that feral sheep are altering the abundance of ground-level vegetation and limiting iguana distribution on the island.

  2. Histomorphometric, fractal and lacunarity comparative analysis of sheep (Ovis aries), goat (Capra hircus) and roe deer (Capreolus capreolus) compact bone samples.

    Science.gov (United States)

    Gudea, A I; Stefan, A C

    2013-08-01

    Quantitative and qualitative studies dealing with histomorphometry of the bone tissue play a new role in modern legal medicine/forensic medicine and archaeozoology nowadays. This study deals with the differences found in case of humerus and metapodial bones of recent sheep (Ovis aries), goat (Capra hircus) and roedeer (Capreolus capreolus) specimens, both from a qualitative point of view, but mainly from a quantitative perspective. A novel perspective given by the fractal analysis performed on the digital histological images is approached. This study shows that the qualitative assessment may not be a reliable one due to the close resemblance of the structures. From the quantitative perspective (several measurements performed on osteonal units and statistical processing of data),some of the elements measured show significant differences among 3 species(the primary osteonal diameter, etc.). The fractal analysis and the lacunarity of the images show a great deal of potential, proving that this type of analysis can be of great help in the separation of the material from this perspective.

  3. Development of a cDNA microarray for the measurement of gene expression in the sheep scab mite Psoroptes ovis

    Directory of Open Access Journals (Sweden)

    Burgess Stewart TG

    2012-02-01

    Full Text Available Abstract Background Sheep scab is caused by the ectoparasitic mite Psoroptes ovis which initiates a profound cutaneous inflammatory response, leading to the development of the skin lesions which are characteristic of the disease. Existing control strategies rely upon injectable endectocides and acaricidal dips but concerns over residues, eco-toxicity and the development of acaricide resistance limit the sustainability of this approach. In order to identify alternative means of disease control, a deeper understanding of both the parasite and its interaction with the host are required. Methods Herein we describe the development and utilisation of an annotated P. ovis cDNA microarray containing 3,456 elements for the measurement of gene expression in this economically important ectoparasite. The array consists of 981 P. ovis EST sequences printed in triplicate along with 513 control elements. Array performance was validated through the analysis of gene expression differences between fed and starved P. ovis mites. Results Sequences represented on the array include homologues of major house dust mite allergens and tick salivary proteins, along with factors potentially involved in mite reproduction and xenobiotic metabolism. In order to validate the performance of this unique resource under biological conditions we used the array to analyse gene expression differences between fed and starved P. ovis mites. These analyses identified a number of house dust mite allergen homologues up-regulated in fed mites and P. ovis transcripts involved in stress responses, autophagy and chemosensory perception up-regulated in starved mites. Conclusion The P. ovis cDNA microarray described here has been shown to be both robust and reproducible and will enable future studies to analyse gene expression in this important ectoparasite.

  4. Three Thousand Years of Continuity in the Maternal Lineages of Ancient Sheep (Ovis aries) in Estonia

    Science.gov (United States)

    Rannamäe, Eve; Lõugas, Lembi; Speller, Camilla F.; Valk, Heiki; Maldre, Liina; Wilczyński, Jarosław; Mikhailov, Aleksandr; Saarma, Urmas

    2016-01-01

    Although sheep (Ovis aries) have been one of the most exploited domestic animals in Estonia since the Late Bronze Age, relatively little is known about their genetic history. Here, we explore temporal changes in Estonian sheep populations and their mitochondrial genetic diversity over the last 3000 years. We target a 558 base pair fragment of the mitochondrial hypervariable region in 115 ancient sheep from 71 sites in Estonia (c. 1200 BC–AD 1900s), 19 ancient samples from Latvia, Russia, Poland and Greece (6800 BC–AD 1700), as well as 44 samples of modern Kihnu native sheep breed. Our analyses revealed: (1) 49 mitochondrial haplotypes, associated with sheep haplogroups A and B; (2) high haplotype diversity in Estonian ancient sheep; (3) continuity in mtDNA haplotypes through time; (4) possible population expansion during the first centuries of the Middle Ages (associated with the establishment of the new power regime related to 13th century crusades); (5) significant difference in genetic diversity between ancient populations and modern native sheep, in agreement with the beginning of large-scale breeding in the 19th century and population decline in local sheep. Overall, our results suggest that in spite of the observed fluctuations in ancient sheep populations, and changes in the natural and historical conditions, the utilisation of local sheep has been constant in the territory of Estonia, displaying matrilineal continuity from the Middle Bronze Age through the Modern Period, and into modern native sheep. PMID:27732668

  5. Withers height of pig - Sus scrofa domestica L. 1758, domestic cow - Bos taurus L. 1758 and sheep - Ovis aries L. 1758 at the “Gornja šuma” archaeological site (Novi Sad

    Directory of Open Access Journals (Sweden)

    Radmanović Darko P

    2016-01-01

    Full Text Available In spring 2012, osteological material was collected at the “Gornja Šuma” site (site no. 47, located in the territory of Novi Sad, and it was dated to the early 9th century. The withers heights of pig - Sus scrofa domestica, domestic cow - Bos taurus and sheep - Ovis aries, as the three most dominant species at this archaeological site, were analysed based on the length of bones and according to various authors [Boessneck 1956; Zalkin 1960; Matolcsi 1970; Teichert 1975]. It was determined that in these three species the withers heights mostly corresponded to the data from the Middle Ages.

  6. Establishment of pregnancy after the transfer of nuclear transfer embryos produced from the fusion of argali (Ovis ammon) nuclei into domestic sheep (Ovis aries) enucleated oocytes.

    Science.gov (United States)

    White, K L; Bunch, T D; Mitalipov, S; Reed, W A

    1999-01-01

    Cloning mammalian species from cell lines of adult animals has been demonstrated. Aside from its importance for cloning multiple copies of genetically valuable livestock, cloning now has the potential to salvage endangered or even extinct species. The aim of this study was to investigate the effect of the bovine and domestic (Ovis aries) ovine oocyte cytoplasm on the nucleus of an established cell line from an endangered argali wild sheep (Ovis ammon) after nuclear transplantation. A fibroblast cell line was established from skin biopsies from an adult argali ram from the People's Republic of China. Early karyotype analysis of cells between 3-6 passages revealed a normal diploid chromosome number of 56. The argali karyotype consisted of 2 pairs of biarmed and 25 pairs of acrocentric autosomes, a large acrocentric and minute biarmed Y. Bovine ovaries were collected from a local abattoir, oocytes aspirated, and immediately placed in maturation medium consisting of M-199 containing 10% fetal bovine serum, 100 IU/mL penicillin, 100 microg/mL streptomycin, 0.5 microg/mL follicle-stimulating hormone (FSH), 5.0 microg/mL luetinizing hormone (LH) and 1.0 microg/mL estradiol. Ovine (O. aries) oocytes were collected at surgery 25 hours postonset of estrus from the oviducts of superovulated donor animals. All cultures were carried out at 39 degrees C in a humidified atmosphere of 5% CO2 and air. In vitro matured MII bovine oocytes were enucleated 16-20 hours after onset of maturation and ovine oocytes within 2-3 hours after collection. Enucleation was confirmed using Hoechst 33342 and UV light. The donor argali cells were synchronized in G0-G1 phase by culturing in Dulbecco's modified Eagle's medium (DMEM) plus 0.5% fetal bovine serum for 5-10 days. Fusion of nuclear donor cell to an enucleated oocyte (cytoplast) to produce nuclear transfer (NT) embryos was induced by 2 electric pulses of 1.4 kV/cm for 30 microsc. Fused NT embryos were activated after 24 hours of maturation

  7. NCBI nr-aa BLAST: CBRC-PVAM-01-1242 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PVAM-01-1242 ref|NP_001123626.1| adrenergic, beta-2-, receptor, surface [Ovis ...aries] gb|ACD85811.1| beta-2-adrenergic receptor [Ovis aries] gb|ACD85813.1| beta-2-adrenergic receptor [Ovi...s aries] gb|ACD85814.1| beta-2-adrenergic receptor [Ovis aries] NP_001123626.1 0.0 91% ...

  8. Uranium and Associated Heavy Metals in Ovis aries in a Mining Impacted Area in Northwestern New Mexico

    Directory of Open Access Journals (Sweden)

    Christine Samuel-Nakamura

    2017-07-01

    Full Text Available The objective of this study was to determine uranium (U and other heavy metal (HM concentrations (As, Cd, Pb, Mo, and Se in tissue samples collected from sheep (Ovis aries, the primary meat staple on the Navajo reservation in northwestern New Mexico. The study setting was a prime target of U mining, where more than 1100 unreclaimed abandoned U mines and structures remain. The forage and water sources for the sheep in this study were located within 3.2 km of abandoned U mines and structures. Tissue samples from sheep (n = 3, their local forage grasses (n = 24, soil (n = 24, and drinking water (n = 14 sources were collected. The samples were analyzed using Inductively Coupled Plasma-Mass Spectrometry. Results: In general, HMs concentrated more in the roots of forage compared to the above ground parts. The sheep forage samples fell below the National Research Council maximum tolerable concentration (5 mg/kg. The bioaccumulation factor ratio was >1 in several forage samples, ranging from 1.12 to 16.86 for Mo, Cd, and Se. The study findings showed that the concentrations of HMs were greatest in the liver and kidneys. Of the calculated human intake, Se Reference Dietary Intake and Mo Recommended Dietary Allowance were exceeded, but the tolerable upper limits for both were not exceeded. Food intake recommendations informed by research are needed for individuals especially those that may be more sensitive to HMs. Further study with larger sample sizes is needed to explore other impacted communities across the reservation.

  9. Uranium and Associated Heavy Metals in Ovis aries in a Mining Impacted Area in Northwestern New Mexico.

    Science.gov (United States)

    Samuel-Nakamura, Christine; Robbins, Wendie A; Hodge, Felicia S

    2017-07-28

    The objective of this study was to determine uranium (U) and other heavy metal (HM) concentrations (As, Cd, Pb, Mo, and Se) in tissue samples collected from sheep ( Ovis aries ), the primary meat staple on the Navajo reservation in northwestern New Mexico. The study setting was a prime target of U mining, where more than 1100 unreclaimed abandoned U mines and structures remain. The forage and water sources for the sheep in this study were located within 3.2 km of abandoned U mines and structures. Tissue samples from sheep ( n = 3), their local forage grasses ( n = 24), soil ( n = 24), and drinking water ( n = 14) sources were collected. The samples were analyzed using Inductively Coupled Plasma-Mass Spectrometry. Results: In general, HMs concentrated more in the roots of forage compared to the above ground parts. The sheep forage samples fell below the National Research Council maximum tolerable concentration (5 mg/kg). The bioaccumulation factor ratio was >1 in several forage samples, ranging from 1.12 to 16.86 for Mo, Cd, and Se. The study findings showed that the concentrations of HMs were greatest in the liver and kidneys. Of the calculated human intake, Se Reference Dietary Intake and Mo Recommended Dietary Allowance were exceeded, but the tolerable upper limits for both were not exceeded. Food intake recommendations informed by research are needed for individuals especially those that may be more sensitive to HMs. Further study with larger sample sizes is needed to explore other impacted communities across the reservation.

  10. Faecal glucocorticoid metabolites and body temperature in Australian merino ewes (Ovis aries) during summer artificial insemination (AI) program

    Science.gov (United States)

    Sawyer, Gregory; Parisella, Simone

    2018-01-01

    Reproductive wastage is a key issue for sheep producers, both regionally and globally. The reproductive output of farm animals can be influenced by physiological and environmental factors. Rapid and reliable quantification of physiological stress can provide a useful tool for designing and testing on-farm management interventions to improve farm animal welfare and productivity. In this study, we quantified physiological stress non-invasively using faecal glucocorticoid metabolites-FGMs analysis and body temperature measurements of 15 superovulated donor merino ewes (Ovis aries) during participation in artificial insemination (AI) program conducted during 2015/2016 Australian summer. We hypothesized that low percentage transferable embryos in donor merino ewes will be associated positively with higher body temperature and/or higher FGMs in these ewes. Temperature humidity index (THI) was calculated and found within high thermal stress range during the two AI trials. Overall, results showed none of the factors (ewe ID, AI trial no., THI or FGMs) were significant for reduced percentage transferrable embryos, except ewe body temperature was highly significant (p = 0.014). Within AI trial comparisons showed significant positive associations between higher FGMs and body temperature with reduced transferrable embryos. These results suggest that Australian merino ewes participating in summer AI trials can experience physiological stress. Prolonged activation of the stress endocrine response and high body temperature (e.g. ensued from heat stress) could impact on ewe reproductive output. Therefore, future research should apply minimally invasive physiological tools to gather baseline information on physiological stress in merino sheep to enable the development of new farm-friendly methods of managing stress. PMID:29381759

  11. Reliable molecular differentiation of Trichuris ovis and Trichuris discolor from sheep (Ovis orientalis aries) and roe deer (Capreolus capreolus) and morphological characterisation of their females: morphology does not work sufficiently.

    Science.gov (United States)

    Vejl, Pavel; Nechybová, Stanislava; Peřinková, Pavla; Melounová, Martina; Sedláková, Vladimíra; Vašek, Jakub; Čílová, Daniela; Rylková, Kateřina; Jankovská, Ivana; Vadlejch, Jaroslav; Langrová, Iva

    2017-08-01

    The main aim of the study was to evaluate associations between morphological variability of Trichuris females from sheep and roe deer and their rDNA polymorphism in whipworm populations from the Czech Republic. The results introduced the use of new molecular markers based on the internal transcribed spacer (ITS)1-5.8S RNA-ITS2 region polymorphisms, as useful tools for the unambiguous differentiation of congeners Trichuris ovis and Trichuris discolor. These markers revealed both parasites in roe deer and in sheep; however, T. ovis females predominated in sheep while T. discolor females occurred mostly in roe deer. Additional analysis of ITS1-5.8 rRNA-ITS2 discovered the genetic uniformity of the analysed T. discolor but high haplotype variation of T. ovis. Simultaneously, molecularly designated female individuals of both species were categorised into four morphotypes (MT) on the basis of morphology of genital pore area. MT1 and MT4 (vulvar opening on everted vaginal appendage/on visible cuticular bulge) occurred only in T. ovis, MT2 (uneverted vagina-vulvar opening without any elevation) was identified only in T. discolor and MT3 (transient type of vulvar opening on a small swelling) was observed in both species. Statistical analysis of biometric data confirmed that morphology of vulva is not a reliable marker for the species determination. On the basis of the ITS1-5.8S RNA-ITS2 region variability, we carried out a phylogenetic analysis (maximum likelihood method, Hasegawa-Kishino-Yano model) which showed that T. ovis haplotypes from the Czech Republic and Ireland and T. discolor haplotypes from the Czech Republic, Spain, Iran and Japan are sister OTUs.

  12. Preliminary analysis of Psoroptes ovis transcriptome in different developmental stages

    Directory of Open Access Journals (Sweden)

    Man-Li He

    2016-11-01

    Full Text Available Abstract Background Psoroptic mange is a chronic, refractory, contagious and infectious disease mainly caused by the mange mite Psoroptes ovis, which can infect horses, sheep, buffaloes, rabbits, other domestic animals, deer, wild camels, foxes, minks, lemurs, alpacas, elks and other wild animals. Features of the disease include intense pruritus and dermatitis, depilation and hyperkeratosis, which ultimately result in emaciation or death caused by secondary bacterial infections. The infestation is usually transmitted by close contact between animals. Psoroptic mange is widespread in the world. In this paper, the transcriptome of P. ovis is described following sequencing and analysis of transcripts from samples of larvae (i.e. the Pso_L group and nymphs and adults (i.e. the Pso_N_A group. The study describes differentially expressed genes (DEGs and genes encoding allergens, which help understanding the biology of P. ovis and lay foundations for the development of vaccine antigens and drug target screening. Methods The transcriptome of P. ovis was assembled and analyzed using bioinformatic tools. The unigenes of P. ovis from each developmental stage and the unigenes differentially between developmental stages were compared with allergen protein sequences contained in the allergen database website to predict potential allergens. Results We identified 38,836 unigenes, whose mean length was 825 bp. On the basis of sequence similarity with seven databases, a total of 17,366 unigenes were annotated. A total of 1,316 DEGs were identified, including 496 upregulated and 820 downregulated in the Pso_L group compared with the Pso_N_A group. We predicted 205 allergens genes in the two developmental stages similar to genes from other mites and ticks, of these, 14 were among the upregulated DEGs and 26 among the downregulated DEGs. Conclusion This study provides a reference transcriptome of P. ovis in absence of a reference genome. The analysis of DEGs and

  13. Conserved Genetic Architecture Underlying Individual Recombination Rate Variation in a Wild Population of Soay Sheep (Ovis aries).

    Science.gov (United States)

    Johnston, Susan E; Bérénos, Camillo; Slate, Jon; Pemberton, Josephine M

    2016-05-01

    Meiotic recombination breaks down linkage disequilibrium (LD) and forms new haplotypes, meaning that it is an important driver of diversity in eukaryotic genomes. Understanding the causes of variation in recombination rate is important in interpreting and predicting evolutionary phenomena and in understanding the potential of a population to respond to selection. However, despite attention in model systems, there remains little data on how recombination rate varies at the individual level in natural populations. Here we used extensive pedigree and high-density SNP information in a wild population of Soay sheep (Ovis aries) to investigate the genetic architecture of individual autosomal recombination rates. Individual rates were high relative to other mammal systems and were higher in males than in females (autosomal map lengths of 3748 and 2860 cM, respectively). The heritability of autosomal recombination rate was low but significant in both sexes (h(2) = 0.16 and 0.12 in females and males, respectively). In females, 46.7% of the heritable variation was explained by a subtelomeric region on chromosome 6; a genome-wide association study showed the strongest associations at locus RNF212, with further associations observed at a nearby ∼374-kb region of complete LD containing three additional candidate loci, CPLX1, GAK, and PCGF3 A second region on chromosome 7 containing REC8 and RNF212B explained 26.2% of the heritable variation in recombination rate in both sexes. Comparative analyses with 40 other sheep breeds showed that haplotypes associated with recombination rates are both old and globally distributed. Both regions have been implicated in rate variation in mice, cattle, and humans, suggesting a common genetic architecture of recombination rate variation in mammals. Copyright © 2016 by the Genetics Society of America.

  14. Aplikasi Animasi 3 Dimensi Mendem Ari-Ari Berbasis Android

    Directory of Open Access Journals (Sweden)

    I Gusti Agung Sagotri Mahadewi

    2016-04-01

    Full Text Available Mendem Ari-ari merupakan salah satu tradisi umat Hindu yang dilaksanakan saat bayi baru lahir. Banyak kaum muda khususnya pasangan muda belum mengetahui bagaimana prosesi dalam melakukan upacara Mendem Ari-ari. Seiring perkembangan teknologi, permasalahan tersebut dapat ditanggulangi dengan sebuah metode pembelajaran di bidang Teknologi Informasi yaitu dengan memanfaatkan teknologi smartphone berbasis Android sebagai media pembelajaran prosesi upacara Mendem Ari-ari yang diimplementasikan ke dalam sebuah aplikasi animasi 3 dimensi. Aplikasi Mendem Ari-ari yang dibuat dalam aplikasi berbasis Android menggunakan Autodesk Maya sebagai pemodelan dan animasi, sedangkan perancangan aplikasi Android menggunakan Unity. User memberikan input berupa sentuhan pada suatu tombol, aplikasi Mendem Ari-ari kemudian memproses dengan memberikan output sesuai tombol yang disentuh. Hasil dari aplikasi Mendem Ari-ari dapat menjelaskan informasi mengenai prosesi upacara Mendem Ari-ari yang menampilkan objek animasi 3 dimensi dan juga video secara real atau nyata. Kata kunci: Animasi, 3 Dimensi, Mendem Ari-ari, Android

  15. Characterization of the complete mitochondrial genomes of two whipworms Trichuris ovis and Trichuris discolor (Nematoda: Trichuridae).

    Science.gov (United States)

    Liu, Guo-Hua; Wang, Yan; Xu, Min-Jun; Zhou, Dong-Hui; Ye, Yong-Gang; Li, Jia-Yuan; Song, Hui-Qun; Lin, Rui-Qing; Zhu, Xing-Quan

    2012-12-01

    For many years, whipworms (Trichuris spp.) have been described with a relatively narrow range of both morphological and biometrical features. Moreover, there has been insufficient discrimination between congeners (or closely related species). In the present study, we determined the complete mitochondrial (mt) genomes of two whipworms Trichuris ovis and Trichuris discolor, compared them and then tested the hypothesis that T. ovis and T. discolor are distinct species by phylogenetic analyses using Bayesian inference, maximum likelihood and maximum parsimony) based on the deduced amino acid sequences of the mt protein-coding genes. The complete mt genomes of T. ovis and T. discolor were 13,946 bp and 13,904 bp in size, respectively. Both mt genomes are circular, and consist of 37 genes, including 13 genes coding for proteins, 2 genes for rRNA, and 22 genes for tRNA. The gene content and arrangement are identical to that of human and pig whipworms Trichuris trichiura and Trichuris suis. Taken together, these analyses showed genetic distinctiveness and strongly supported the recent proposal that T. ovis and T. discolor are distinct species using nuclear ribosomal DNA and a portion of the mtDNA sequence dataset. The availability of the complete mtDNA sequences of T. ovis and T. discolor provides novel genetic markers for studying the population genetics, diagnostics and molecular epidemiology of T. ovis and T. discolor. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Genetic variability among Trichuris ovis isolates from different hosts in Guangdong Province, China revealed by sequences of three mitochondrial genes.

    Science.gov (United States)

    Wang, Yan; Liu, Guo-Hua; Li, Jia-Yuan; Xu, Min-Jun; Ye, Yong-Gang; Zhou, Dong-Hui; Song, Hui-Qun; Lin, Rui-Qing; Zhu, Xing-Quan

    2013-02-01

    This study examined sequence variation in three mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunit 5 (nad5) and cytochrome b (cytb), among Trichuris ovis isolates from different hosts in Guangdong Province, China. A portion of the cox1 (pcox1), nad5 (pnad5) and cytb (pcytb) genes was amplified separately from individual whipworms by PCR, and was subjected to sequencing from both directions. The size of the sequences of pcox1, pnad5 and pcytb was 618, 240 and 464 bp, respectively. Although the intra-specific sequence variations within T. ovis were 0-0.8% for pcox1, 0-0.8% for pnad5 and 0-1.9% for pcytb, the inter-specific sequence differences among members of the genus Trichuris were significantly higher, being 24.3-26.5% for pcox1, 33.7-56.4% for pnad5 and 24.8-26.1% for pcytb, respectively. Phylogenetic analyses using combined sequences of pcox1, pnad5 and pcytb, with three different computational algorithms (maximum likelihood, maximum parsimony and Bayesian inference), indicated that all of the T. ovis isolates grouped together with high statistical support. These findings demonstrated the existence of intra-specific variation in mtDNA sequences among T. ovis isolates from different hosts, and have implications for studying molecular epidemiology and population genetics of T. ovis.

  17. Genome degradation in Brucella ovis corresponds with narrowing of its host range and tissue tropism.

    Directory of Open Access Journals (Sweden)

    Renee M Tsolis

    Full Text Available Brucella ovis is a veterinary pathogen associated with epididymitis in sheep. Despite its genetic similarity to the zoonotic pathogens B. abortus, B. melitensis and B. suis, B. ovis does not cause zoonotic disease. Genomic analysis of the type strain ATCC25840 revealed a high percentage of pseudogenes and increased numbers of transposable elements compared to the zoonotic Brucella species, suggesting that genome degradation has occurred concomitant with narrowing of the host range of B. ovis. The absence of genomic island 2, encoding functions required for lipopolysaccharide biosynthesis, as well as inactivation of genes encoding urease, nutrient uptake and utilization, and outer membrane proteins may be factors contributing to the avirulence of B. ovis for humans. A 26.5 kb region of B. ovis ATCC25840 Chromosome II was absent from all the sequenced human pathogenic Brucella genomes, but was present in all of 17 B. ovis isolates tested and in three B. ceti isolates, suggesting that this DNA region may be of use for differentiating B. ovis from other Brucella spp. This is the first genomic analysis of a non-zoonotic Brucella species. The results suggest that inactivation of genes involved in nutrient acquisition and utilization, cell envelope structure and urease may have played a role in narrowing of the tissue tropism and host range of B. ovis.

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1597 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1597 sp|Q9XT58|ADRB3_SHEEP Beta-3 adrenergic receptor (Beta-3 adrenoce...ptor) (Beta-3 adrenoreceptor) gb|AAG31165.1|AF314202_1 beta 3 adrenergic receptor [Ovis aries] gb|AAG31167.1|AF314204_1 beta 3 adrene...rgic receptor [Ovis aries] gb|ABB71185.1| beta 3 adrenergic reecptor [Ovis aries] Q9XT58 1e-140 75% ...

  19. First molecular isolation of Mycoplasma ovis from small ruminants in North Africa

    Directory of Open Access Journals (Sweden)

    Mohamed R. Rjeibi

    2015-06-01

    Full Text Available Eperythrozoonosis is a small ruminant disease caused by the bacterium Mycoplasma ovis (formerly known as Eperythrozoon ovis. Whilst acute infection in sheep may result in an anaemia and ill thrift syndrome, most animals do not develop clinical signs. Molecular methods were used to compare and evaluate the prevalence of infection with M. ovis in sheep and goats in Tunisia. A total of 739 whole blood samples from 573 sheep and 166 goats were tested for the M. ovis 16S rRNA gene using PCR. The overall prevalence was 6.28% ± 0.019 (36/573. Only sheep were infected with M. ovis (p < 0.001, and the prevalence was significantly higher in central Tunisia (29.2% compared with other regions (p < 0.05. The prevalence revealed significant differences according to breed and bioclimatic zones (p < 0.001. Furthermore, the prevalence in young sheep (35/330; 10.6% was higher than in adults (1/243; 0.41% (p < 0.001. Only sheep of the Barbarine breed were infected, with a prevalence of 11.8% (p < 0.001. This is the first molecular study and genetic characterisation of M. ovis in North African sheep breeds.

  20. The ARIES-II and ARIES-IV second-stability tokamak reactors

    International Nuclear Information System (INIS)

    Najmabadi, F.; Conn, R.W.; Hasan, M.Z.; Mau, T.-K.; Sharafat, S.; Baxi, C.B.; Leuer, J.A.; McQuillan, B.W.; Puhn, F.A.; Schultz, K.R.; Wong, C.P.C.; Brooks, J.; Ehst, D.A.; Hassanein, A.; Hua, T.; Hull, A.; Mattis, R.; Picologlou, B.; Sze, D.-K.; Dolan, T.J.; Herring, J.S.; Bathke, C.G.; Krakowski, R.A.; Werley, K.A.; Bromberg, L.; Schultz, J.; Davis, F.; Holmes, J.A.; Lousteau, D.C.; Strickler, D.J.; Jardin, S.C.; Kessel, C.; Snead, L.; Steiner, D.; Valenti, M.; El-Guebaly, L.A.; Emmert, G.A.; Khater, H.Y.; Santarius, J.F.; Sawan, M.; Sviatoslavsky, I.N.; Cheng, E.T.

    1992-01-01

    The ARIES research program is a multi-institutional effort to develop several visions of tokamak reactors with enhanced economic, safety, and environmental features. Four ARIES visions are currently planned for the ARIES program. The ARIES-I design is a DT-burning reactor based on modest extrapolations from the present tokamak physics database and relies on either existing technology or technology for which trends are already in place, often in programs outside fusion. The ARIES-III study focuses on the potential of tokamaks to operate with D- 3 He fuel system as an alternative to deuterium and tritium. The ARIES-II and ARIES-IV designs have the same fusion plasma but different fusion-power-core designs. The ARIES-II reactor uses liquid lithium as the coolant and tritium breeder and vanadium alloy as the structural material in order to study the potential of low-activation metallic blankets. The ARIES-IV reactor uses helium as the coolant, a solid tritium-breeding material, and silicon carbide composite as the structural material in order to achieve the safety and environmental characteristic of fusion. In this paper the authors describe the trade-off leading to the optimum regime of operation for the ARIES-II and ARIES-IV second-stability reactors and review the engineering design of the fusion power cores

  1. Generation, analysis and functional annotation of expressed sequence tags from the ectoparasitic mite Psoroptes ovis

    Directory of Open Access Journals (Sweden)

    Kenyon Fiona

    2011-07-01

    Full Text Available Abstract Background Sheep scab is caused by Psoroptes ovis and is arguably the most important ectoparasitic disease affecting sheep in the UK. The disease is highly contagious and causes and considerable pruritis and irritation and is therefore a major welfare concern. Current methods of treatment are unsustainable and in order to elucidate novel methods of disease control a more comprehensive understanding of the parasite is required. To date, no full genomic DNA sequence or large scale transcript datasets are available and prior to this study only 484 P. ovis expressed sequence tags (ESTs were accessible in public databases. Results In order to further expand upon the transcriptomic coverage of P. ovis thus facilitating novel insights into the mite biology we undertook a larger scale EST approach, incorporating newly generated and previously described P. ovis transcript data and representing the largest collection of P. ovis ESTs to date. We sequenced 1,574 ESTs and assembled these along with 484 previously generated P. ovis ESTs, which resulted in the identification of 1,545 unique P. ovis sequences. BLASTX searches identified 961 ESTs with significant hits (E-value P. ovis ESTs. Gene Ontology (GO analysis allowed the functional annotation of 880 ESTs and included predictions of signal peptide and transmembrane domains; allowing the identification of potential P. ovis excreted/secreted factors, and mapping of metabolic pathways. Conclusions This dataset currently represents the largest collection of P. ovis ESTs, all of which are publicly available in the GenBank EST database (dbEST (accession numbers FR748230 - FR749648. Functional analysis of this dataset identified important homologues, including house dust mite allergens and tick salivary factors. These findings offer new insights into the underlying biology of P. ovis, facilitating further investigations into mite biology and the identification of novel methods of intervention.

  2. [Distribution of nematode parasites of the digestive system in sheep (Ovis aries) and goats (Capra hircus) of the Piedmontese and Valdostano Alpine arc].

    Science.gov (United States)

    Balbo, T; Costantini, R; Gallo, M G; Lanfranchi, P

    1977-01-01

    A survey, carried out on gastro-intestinal nematodes of sheep and goats of Piemonte and of Valle d'Aosta (87 sheep and 12 goats) has shown the presence of the following species in sheep, Bunostomum trigonocephalum, Chabertia ovina, Cooperia curticei, Haemonchus contortus, Marshallagia marshalli, Nematodirus abnormalis, Nematodirus filicollis, Nematodirus helvetianus, Nematodirus spathiger, Oesophagostomum venulosum, Ostertagia circumcincta, Ostertagia lyrata, Ostertagia trifurcata, Skrjabinema ovis, Trichostrongylus axei, Trichostronglus colubriformis, Trichostronglus vitrinus, Trichuris ovis and Trichuris skrjabini; in goats, Bunostomum trigonocephalum, Chabertia ovina, Haemonchus contortus, Nematodirus filicollis, Nematodirus helvetianus, Oesophagostomum venulosum, Ostertagia circumcincta, Ostertagia ostertagi, Ostertagia trifurcata, Trichostrongylus axei, Trichostrongylus colubriformis and Trichostrongylus vitrinus. The percentage of each species in the two host is given in the text table.

  3. Anaplasma ovis genetic diversity detected by major surface protein 1a and its prevalence in small ruminants.

    Science.gov (United States)

    Aktas, Munir; Özübek, Sezayi

    2018-04-01

    Anaplasma ovis is a widely distributed tick-borne rickettsial pathogen of sheep, goats, and wild ruminants. The aims of this study were to assess the prevalence, associations of Anaplasma ovis in sheep and goats, as well as its genetic diversity based on analysis of the msp1α gene. A total of 416 DNA samples from sheep (n = 236) and goats (n = 180) from four provinces in southeastern Turkey were analyzed by PCR. The overall A. ovis prevalence was 18% (CI 14.4-22.1). The infection rates of A. ovis varied from 15.9% to 21.8% in sampled provinces, and they were not significantly different. There was no difference between Anaplasma ovis infection in sheep (20.3%, CI 15.4-26.0) and goats (15.0%, CI 10.1-21.1) or in infection rate of animals 1 year (16.4%, CI 12.4-21.2). A significant association between A. ovis infection and the presence of Rhipicephalus bursa and Rhipicephalus turanicus was observed (P diversity of A. ovis were found in small ruminants in Turkey. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Identification of a novel miRNA from the ovine ovary by a combinatorial approach of bioinformatics and experiments

    Science.gov (United States)

    CHANG, Weihua; WANG, Juanhong; TAO, Dayong; ZHANG, Yong; HE, Jianzhong; SHI, Changqing

    2015-01-01

    MicroRNAs (miRNAs) are a class of short endogenous, single-stranded, non-coding small RNA molecules, about 19–25 nucleotides in length that regulate gene expression at the translation level and influence many physiological process, such apoptosis, metabolism, signal transduction, and occurrence and development of diseases. In this study, we constructed a library from the ovine luteal phase ovary by using next-generation sequencing technology (Solexa high-throughput sequencing technique) and identified 267 novel miRNAs by bioinformatics. One of the novel miRNAs (ovis_aries_ovary-m0033_3p), which expressed in the sheep ovary and testis, was confirmed by real time PCR and northern blot. Ovis_aries_ovary-m0033_3p was 21 nucleotides in length and located on chromosome 12, and it had 100% similarity to hsa-miR-214-3p, mmu-miR-214-3p, dre-miR-214and ssc-miR-214. Meanwhile, the pre-miRNA was 82 nucleotides in length and had a standard hairpin stem-loop structure. From the consistency of the sequence and structure, we speculated that ovis_aries_ovary-m0033_3p had a function similar to hsa-miR-214-3p, which is involved in the fine regulation of cell survival, embryonic development, breeding activities and resistance to ovarian cancer, so we defined it as oar-miR-214-3p. These experimental results will enrich the miRNA database for ovis aries and provide the basis for researching the regulation mechanism of miRNA in relation to breeding activities of seasonal breeding animals. PMID:26268666

  5. Harnessing cross-species alignment to discover SNPs and generate a draft genome sequence of a bighorn sheep (Ovis canadensis).

    Science.gov (United States)

    Miller, Joshua M; Moore, Stephen S; Stothard, Paul; Liao, Xiaoping; Coltman, David W

    2015-05-20

    Whole genome sequences (WGS) have proliferated as sequencing technology continues to improve and costs decline. While many WGS of model or domestic organisms have been produced, a growing number of non-model species are also being sequenced. In the absence of a reference, construction of a genome sequence necessitates de novo assembly which may be beyond the ability of many labs due to the large volumes of raw sequence data and extensive bioinformatics required. In contrast, the presence of a reference WGS allows for alignment which is more tractable than assembly. Recent work has highlighted that the reference need not come from the same species, potentially enabling a wide array of species WGS to be constructed using cross-species alignment. Here we report on the creation a draft WGS from a single bighorn sheep (Ovis canadensis) using alignment to the closely related domestic sheep (Ovis aries). Two sequencing libraries on SOLiD platforms yielded over 865 million reads, and combined alignment to the domestic sheep reference resulted in a nearly complete sequence (95% coverage of the reference) at an average of 12x read depth (104 SD). From this we discovered over 15 million variants and annotated them relative to the domestic sheep reference. We then conducted an enrichment analysis of those SNPs showing fixed differences between the reference and sequenced individual and found significant differences in a number of gene ontology (GO) terms, including those associated with reproduction, muscle properties, and bone deposition. Our results demonstrate that cross-species alignment enables the creation of novel WGS for non-model organisms. The bighorn sheep WGS will provide a resource for future resequencing studies or comparative genomics.

  6. Advanced verification methods for OVI security ink

    Science.gov (United States)

    Coombs, Paul G.; McCaffery, Shaun F.; Markantes, Tom

    2006-02-01

    OVI security ink +, incorporating OVP security pigment* microflakes, enjoys a history of effective document protection. This security feature provides not only first-line recognition by the person on the street, but also facilitates machine-readability. This paper explores the evolution of OVI reader technology from proof-of-concept to miniaturization. Three different instruments have been built to advance the technology of OVI machine verification. A bench-top unit has been constructed which allows users to automatically verify a multitude of different banknotes and OVI images. In addition, high speed modules were fabricated and tested in a state of the art banknote sorting machine. Both units demonstrate the ability of modern optical components to illuminate and collect light reflected from the interference platelets within OVI ink. Electronic hardware and software convert and process the optical information in milliseconds to accurately determine the authenticity of the security feature. Most recently, OVI ink verification hardware has been miniaturized and simplified providing yet another platform for counterfeit protection. These latest devices provide a tool for store clerks and bank tellers to unambiguously determine the validity of banknotes in the time period it takes the cash drawer to be opened.

  7. Aries

    Science.gov (United States)

    Murdin, P.

    2000-11-01

    (the Ram; abbrev. Ari, gen. Arietis; area 441 sq. deg.) A northern zodiacal constellation that lies between Taurus and Pisces, and culminates at midnight in late October. It represents the ram in Greek mythology whose golden fleece was the quest of Jason and the Argonauts. Its brightest stars were cataloged by Ptolemy (c. AD 100-175) in the Almagest. In Ptolemy's day the Sun was in Aries at the v...

  8. A mitochondrial genome sequence of the Tibetan antelope (Pantholops hodgsonii)

    DEFF Research Database (Denmark)

    Xu, Shu Qing; Yang, Ying Zhong; Zhou, Jun

    2005-01-01

    To investigate genetic mechanisms of high altitude adaptations of native mammals on the Tibetan Plateau, we compared mitochondrial sequences of the endangered Pantholops hodgsonii with its lowland distant relatives Ovis aries and Capra hircus, as well as other mammals. The complete mitochondrial...... genome of P. hodgsonii (16,498 bp) revealed a similar gene order as of other mammals. Because of tandem duplications, the control region of P. hodgsonii mitochondrial genome is shorter than those of O. aries and C. hircus, but longer than those of Bos species. Phylogenetic analysis based on alignments...... of the entire cytochrome b genes suggested that P. hodgsonii is more closely related to O. aries and C. hircus, rather than to species of the Antilopinae subfamily. The estimated divergence time between P. hodgsonii and O. aries is about 2.25 million years ago. Further analysis on natural selection indicated...

  9. Taxonomy and phylogeny of Trichuris globulosa Von Linstow, 1901 from camels. A review of Trichuris species parasitizing herbivorous.

    Science.gov (United States)

    Callejón, R; Gutiérrez-Avilés, L; Halajian, A; Zurita, A; de Rojas, M; Cutillas, C

    2015-08-01

    At the present work, we carried out a morph-biometrical and molecular study of Trichuris species isolated from Camelus dromedarius from Iran and from Ovis aries from South Africa comparatively with other species of Trichuris from different herbivorous hosts and geographical regions. The population from camels from Iran was identified as Trichuris globulosa. Two different morphometrically populations of Trichuris sp. from sheep from South Africa were identified: Trichuris ovis and Trichuris skrjabini. Ribosomal data did not reveal significate differences in the ITS2 sequences between T. ovis and T. globulosa to assess a specific determination. The mitochondrial data suggest that T. globulosa constitute a different genetic lineage to T. ovis. Cytochrome c-oxidase and cytochrome b partial gene sequences corroborated the existence of a different genetic lineage of T. ovis from sheep of South Africa that would be closely related to the populations of T. globulosa from camels from Iran. The cytochrome c-oxidase and cytochrome b partial gene sequences of T. globulosa have been reported for the first time. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. OVIS 3.2 user's guide.

    Energy Technology Data Exchange (ETDEWEB)

    Mayo, Jackson R.; Gentile, Ann C.; Brandt, James M.; Houf, Catherine A.; Thompson, David C.; Roe, Diana C.; Wong, Matthew H.; Pebay, Philippe Pierre

    2010-10-01

    This document describes how to obtain, install, use, and enjoy a better life with OVIS version 3.2. The OVIS project targets scalable, real-time analysis of very large data sets. We characterize the behaviors of elements and aggregations of elements (e.g., across space and time) in data sets in order to detect meaningful conditions and anomalous behaviors. We are particularly interested in determining anomalous behaviors that can be used as advance indicators of significant events of which notification can be made or upon which action can be taken or invoked. The OVIS open source tool (BSD license) is available for download at ovis.ca.sandia.gov. While we intend for it to support a variety of application domains, the OVIS tool was initially developed for, and continues to be primarily tuned for, the investigation of High Performance Compute (HPC) cluster system health. In this application it is intended to be both a system administrator tool for monitoring and a system engineer tool for exploring the system state in depth. OVIS 3.2 provides a variety of statistical tools for examining the behavior of elements in a cluster (e.g., nodes, racks) and associated resources (e.g., storage appliances and network switches). It provides an interactive 3-D physical view in which the cluster elements can be colored by raw or derived element values (e.g., temperatures, memory errors). The visual display allows the user to easily determine abnormal or outlier behaviors. Additionally, it provides search capabilities for certain scheduler logs. The OVIS capabilities were designed to be highly interactive - for example, the job search may drive an analysis which in turn may drive the user generation of a derived value which would then be examined on the physical display. The OVIS project envisions the capabilities of its tools applied to compute cluster monitoring. In the future, integration with the scheduler or resource manager will be included in a release to enable intelligent

  11. Directions for attractive tokamak reactors: The ARIES-II and ARIES-IV second-stability designs

    International Nuclear Information System (INIS)

    Najmabadi, F.; Conn, R.W.

    1993-01-01

    ARIES is a research program to develop several visions of tokamak reactors with enhanced economic, safety, and environmental features. The ARIES study has developed four visions for tokamaks. All four designs are steady-state, 1000-MWe (net) power reactors. The ARIES-II and ARIES-IV designs assume potential advances in plasma physics (such as second-stability operation) predicted by theory but not yet established experimentally. The two designs have the same fusion plasma but different fusion-power-core. There are only minor differences between the ARIES-II and ARIES-IV plasma parameters. ARIES-IV is a 1000-MWe reactor with an average neutron wall loading of 3 MW/m 2 , and a mass power density of about 120 kWe/tonne of fusion power core. The reactor major radius is 6.1 m, the plasma minor radius is 1.5 m and the plasma elongation is 2, and the plasma triangularity is 0.67. The plasma current is low (6.8 MA), B on-axis is 7.7 T (corresponding to a maximum field at the coil of 16T), and the toroidal beta is 3.4% (Troyon coefficient = 6). The operating regime is optimized such that most of the plasma current (∼ 90%) is provided by the bootstrap current. ARIES-II uses liquid lithium as the coolant and tritium breeder. V-5Cr-5Ti is used as the structural material so that the potential of low-activation metallic blankets can be studied. ARIES-IV uses helium as the coolant, a solid tritium-breeding material (Li 2 O), and silicon carbide composite as structural material. The waste produced by neutron activation in both designs is found to meet the criteria allowing shallow-land burial under U.S. regulations. The cost of electricity for the ARIES-II-IV class of reactors is estimated to be about 20% lower than comparable, steady-state first-stability reactors (e.g. ARIES-I). 25 refs, 2 figs, 1 tab

  12. The first outbreak of Taenia ovis infection in China.

    Science.gov (United States)

    Shi, Wangui; He, Wei; Guo, Xiaola; Liu, Quanyuan; Gao, Shengzhi; Zhan, Fang; Liu, Xu; Pan, Yonghong; Luo, Xuenong; Zheng, Yadong

    2016-10-01

    Infection of Taenia ovis metacestodes in sheep or goats causes great economic losses due to condemnation of carcasses. T. ovis infection is not formally recorded in China to date. In October, 2015, T. ovis infection occurred in Jingtai County, China, and 113 of 192 sheep from one farm were infected. Cysts resided in the cardiac and skeletal muscle, and evaginated metacestodes had four suckers and scolex armed with approximately 23 hooks. Using cox1 and nad1 as molecular markers, the sample was further identified and the results showed that the cox1 and nad1 nucleotide sequences of the sample shared 99% identity with that of T. ovis and 75%-91.3% with those of other Taenia species. Taken together, these results confirm the first occurrence of T. ovis in China. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Taenia ovis: an emerging threat to the Chinese sheep industry?

    Science.gov (United States)

    Zheng, Yadong

    2016-07-26

    Taenia ovis is a tapeworm that is mainly transmitted between dogs and sheep. Although T. ovis infection is not a public health issue, it causes a great financial loss due to condemnation of carcasses.  The first outbreak of T. ovis infection in China occurred in 2015. Reassessment of adverse effects of T. ovis infection on Chinese sheep industry in future is necessary. The first T. ovis outbreak in China suggests that the epidemic situation across the country is underestimated. For the transmission of T. ovis, many factors, including eggs, dogs and wild canids, human behaviours and sheep trade, should be seriously considered. In blocking the transmission chain, regular treatments of the infected dogs using anthelmintics play a crucial step, but at the moment it is difficult to be fully executed in China, largely due to the behaviours, customs and faith of local farmers. Moreover, combined with no clinical symptoms in the infected adult sheep and goats, the lack of pre-mortem diagnostic tools makes it harder to practice a national wide surveillance as well as inspection and quarantine in increasingly frequent free sheep trade activities in China, leading to an inability to restrict T. ovis infection into small areas. Furthermore, the ongoing campaigns against Echinococcus granulosus may have an adverse effect on control of T. ovis infection because of no consideration of a role of dogs in the transmission of the parasite. Lack of national epidemic data, pre-mortem diagnostic reagents and vaccines severely hampers the implementation of disease control campaigns and the restriction of T. ovis infection into small areas. Consequently, sheep and goats are at an increasing risk of T. ovis exposure and the possibility of large-scale outbreaks across China in future is possible, causing great adversity towards sheep industry.

  14. First report of Anaplasma ovis in pupal and adult Melophagus ovinus (sheep ked) collected in South Xinjiang, China.

    Science.gov (United States)

    Zhao, Li; He, Bo; Li, Kai-Rui; Li, Fei; Zhang, Lu-Yao; Li, Xian-Qiang; Liu, Yong-Hong

    2018-04-19

    Melophagus ovinus (sheep ked) is a blood-feeding ectoparasite that belongs to the family Hippoboscidae (Diptera: Hippoboscoidea) and mainly parasitizes sheep. The life-cycle of M. ovinus consists of three stages: larva, pupa and adult. It has a worldwide distribution and has been found in four provinces of China, especially South Xinjiang. In addition to causing direct damage to animal hosts, M. ovinus serves as a vector for disease transmission. In this study, our aim was to investigate the presence of Anaplasma spp. in pupal and adult M. ovinus. A total of 93 specimens (including eight pupal specimens) of M. ovinus collected in South Xinjiang were selected for isolation of genomic DNA, followed by PCR amplification and sequencing of the msp4 gene of Anaplasma spp. The sequences were analyzed in MEGA 7.0 software and via online BLAST. PCR and sequencing results showed that all the specimens collected in 2013 were free of Anaplasma spp., whereas three and 25 specimens (including five pupal specimens) collected in 2016 and 2017, respectively, tested positive for Anaplasma spp. The analysis of 24 msp4 gene sequences (from four pupal specimens) confirmed the presence of A. ovis in M. ovinus specimens collected in South Xinjiang, China. The detected A. ovis isolates belong to Genotypes II and III. To the best of our knowledge, this is the first report of the detection of A. ovis DNA in pupal M. ovinus, confirming the vertical transmission of A. ovis in M. ovinus and the potential of M. ovinus to serve as a vector for A. ovis.

  15. Coprological Assessment of Enteric Parasites in Argali Sheep ( Ovis ammon , Siberian Ibex ( Capra sibirica , and Domestic Sheep and Goats at the Ikh Nart Nature Reserve in Mongolia

    Directory of Open Access Journals (Sweden)

    David E. Kenny

    2009-12-01

    Full Text Available In the spring of 2009 (April/May the Denver Zoological Foundation in collaboration with the Mongolian Academy of Sciences conducted a fi eld coprological assessment feasibility study at the Ikh Nart Nature Reserve in southeastern Mongolia. Our initial effort was directed at fi nding simple methodologies that would work consistently in the fi eld for identifying some of the enteric parasites for argali sheep ( Ovis ammon and Siberian ibex ( Capra sibirica , and then to compare these to samples from local nomad domestic fat-tailed sheep ( Ovis aries and cashmere goats ( Capra hircus . Direct fecal examination yielded less eggs than the fl otation techniques, but was still felt to be useful as a quick screening tool. From the fl otation techniques we settled on using sugar because it appeared to yield the most eggs and sugar is readily available in Mongolia. We successfully recovered Entamoeba sp., Eimeria spp., trichostrongyles, large trichostrongyle species, Trichuris ovis and Strongyloides papillosus . We are using the digital images we captured to create a fi eld guide for common enteric parasites found in wildlife and domestics ungulates found in the reserve. In the future, we plan to use the fi eld guide and the quantitative modi fi ed McMaster technique to compare parasite egg-type numbers in both wild and domestic ungulates during different seasons.

  16. Alternative occupied volume integrity (OVI) tests and analyses.

    Science.gov (United States)

    2013-10-01

    FRA, supported by the Volpe Center, conducted research on alternative methods of evaluating occupied volume integrity (OVI) in passenger railcars. Guided by this research, an alternative methodology for evaluating OVI that ensures an equivalent or gr...

  17. The ARIES tokamak reactor study

    International Nuclear Information System (INIS)

    1989-10-01

    The ARIES study is a community effort to develop several visions of tokamaks as fusion power reactors. The aims are to determine the potential economics, safety, and environmental features of a range of possible tokamak reactors, and to identify physics and technology areas with the highest leverage for achieving the best tokamak reactor. Three ARIES visions are planned, each having a different degree of extrapolation from the present data base in physics and technology. The ARIES-I design assumes a minimum extrapolation from current tokamak physics (e.g., 1st stability) and incorporates technological advances that can be available in the next 20 to 30 years. ARIES-II is a DT-burning tokamak which would operate at a higher beta in the 2nd MHD stability regime. It employs both potential advances in the physics and expected advances in technology and engineering. ARIES-II will examine the potential of the tokamak and the D 3 He fuel cycle. This report is a collection of 14 papers on the results of the ARIES study which were presented at the IEEE 13th Symposium on Fusion Engineering (October 2-6, 1989, Knoxville, TN). This collection describes the ARIES research effort, with emphasis on the ARIES-I design, summarizing the major results, the key technical issues, and the central conclusions

  18. Molecular Epidemiological Survey and Genetic Characterization of Anaplasma Species in Mongolian Livestock.

    Science.gov (United States)

    Ochirkhuu, Nyamsuren; Konnai, Satoru; Odbileg, Raadan; Murata, Shiro; Ohashi, Kazuhiko

    2017-08-01

    Anaplasma species are obligate intracellular rickettsial pathogens that cause great economic loss to the animal industry. Few studies on Anaplasma infections in Mongolian livestock have been conducted. This study examined the prevalence of Anaplasma marginale, Anaplasma ovis, Anaplasma phagocytophilum, and Anaplasma bovis by polymerase chain reaction assay in 928 blood samples collected from native cattle and dairy cattle (Bos taurus), yaks (Bos grunniens), sheep (Ovis aries), and goats (Capra aegagrus hircus) in four provinces of Ulaanbaatar city in Mongolia. We genetically characterized positive samples through sequencing analysis based on the heat-shock protein groEL, major surface protein 4 (msp4), and 16S rRNA genes. Only A. ovis was detected in Mongolian livestock (cattle, yaks, sheep, and goats), with 413 animals (44.5%) positive for groEL and 308 animals (33.2%) positive for msp4 genes. In the phylogenetic tree, we separated A. ovis sequences into two distinct clusters based on the groEL gene. One cluster comprised sequences derived mainly from sheep and goats, which was similar to that in A. ovis isolates from other countries. The other divergent cluster comprised sequences derived from cattle and yaks and appeared to be newly branched from that in previously published single isolates in Mongolian cattle. In addition, the msp4 gene of A. ovis using same and different samples with groEL gene of the pathogen demonstrated that all sequences derived from all animal species, except for three sequences derived from cattle and yak, were clustered together, and were identical or similar to those in isolates from other countries. We used 16S rRNA gene sequences to investigate the genetically divergent A. ovis and identified high homology of 99.3-100%. However, the sequences derived from cattle did not match those derived from sheep and goats. The results of this study on the prevalence and molecular characterization of A. ovis in Mongolian livestock can facilitate

  19. Sarcocystis arieticanis (Apicomplexa: Sarcocystidae) infecting the heart muscles of the domestic sheep, Ovis aries (Artiodactyla: Bovidae), from K. S. A. on the basis of light and electron microscopic data.

    Science.gov (United States)

    Al Quraishy, Saleh; Morsy, Kareem; Bashtar, Abdel-Rahman; Ghaffar, Fathy Abdel; Mehlhorn, Heinz

    2014-10-01

    In the present study, the heteroxenous life cycle of Sarcocystis species from three strains of the slaughtered sheep at Al-Azizia and Al-Saada abattoirs in Riyadh city, K.S.A., was studied. Muscle samples of the oesophagus, diaphragm, tongue, skeletal and heart muscles were examined. Varied natural infection rates in the muscles of the examined sheep strains were recorded as 83% in Niemy, 81.5% in Najdy and 90% in Sawakny sheep. Muscles of the diaphragm showed the highest infection level above all organs except Najdy sheep in which oesophagus has the highest rate. Also, the heart was the lowest infected organ (40% Niemy, 44% Najdy and 53% Sawakny). Microscopic sarcocysts of Sarcocystis arieticanis are easily identified in sections through the heart muscles of the domestic sheep Ovis aries (Artiodactyla: Bovidae). Cysts measured 38.5-64.4 μm (averaged 42.66 μm) in width and 62.4-173.6 μm (averaged 82.14 μm) in length. The validity of this species was confirmed by means of ultrastructural characteristics of the primary cyst wall (0.1-0.27 μm thick) which revealed the presence of irregularly shaped crowded and hairy-like projections underlined by a thin layer of ground substance. This layer consisted mainly of fine, dense homogenous granules enclosing the developing metrocytes and merozoites that usually contain nearly all the structures of the apical complex and fill the interior cavity of the cyst. Several septa derived from the ground substance divided the cyst into compartments. The merozoites were banana-shaped and measured 12-16 μm in length with centrally or posteriorly located nuclei. Experimental infection of carnivores by feeding heavily infected sheep muscles revealed that the dog, Canis familiaris, is the only final host of the present Sarcocystis species. Gamogony, sporogonic stages and characteristics of sporulated oocysts were also investigated.

  20. Selection of reference genes for normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries

    Directory of Open Access Journals (Sweden)

    Fraser John F

    2009-07-01

    Full Text Available Abstract Background Heart and lung transplantation is frequently the only therapeutic option for patients with end stage cardio respiratory disease. Organ donation post brain stem death (BSD is a pre-requisite, yet BSD itself causes such severe damage that many organs offered for donation are unusable, with lung being the organ most affected by BSD. In Australia and New Zealand, less than 50% of lungs offered for donation post BSD are suitable for transplantation, as compared with over 90% of kidneys, resulting in patients dying for lack of suitable lungs. Our group has developed a novel 24 h sheep BSD model to mimic the physiological milieu of the typical human organ donor. Characterisation of the gene expression changes associated with BSD is critical and will assist in determining the aetiology of lung damage post BSD. Real-time PCR is a highly sensitive method involving multiple steps from extraction to processing RNA so the choice of housekeeping genes is important in obtaining reliable results. Little information however, is available on the expression stability of reference genes in the sheep pulmonary artery and lung. We aimed to establish a set of stably expressed reference genes for use as a standard for analysis of gene expression changes in BSD. Results We evaluated the expression stability of 6 candidate normalisation genes (ACTB, GAPDH, HGPRT, PGK1, PPIA and RPLP0 using real time quantitative PCR. There was a wide range of Ct-values within each tissue for pulmonary artery (15–24 and lung (16–25 but the expression pattern for each gene was similar across the two tissues. After geNorm analysis, ACTB and PPIA were shown to be the most stably expressed in the pulmonary artery and ACTB and PGK1 in the lung tissue of BSD sheep. Conclusion Accurate normalisation is critical in obtaining reliable and reproducible results in gene expression studies. This study demonstrates tissue associated variability in the selection of these

  1. ARIES tokamak reactor study

    International Nuclear Information System (INIS)

    Steiner, D.; Embrechts, M.

    1990-07-01

    This is a status report on technical progress relative to the tasks identified for the fifth year of Grant No. FG02-85-ER52118. The ARIES tokamak reactor study is a multi-institutional effort to develop several visions of the tokamak as an attractive fusion reactor with enhanced economic, safety, and environmental features. The ARIES study is being coordinated by UCLA and involves a number of institutions, including RPI. The RPI group has been pursuing the following areas of research in the context of the ARIES-I design effort: MHD equilibrium and stability analyses; plasma-edge modeling and blanket materials issues. Progress in these areas is summarized herein

  2. Analysis of agouti signaling protein (ASIP) gene polymorphisms and association with coat color in Tibetan sheep (Ovis aries).

    Science.gov (United States)

    Han, J L; Yang, M; Yue, Y J; Guo, T T; Liu, J B; Niu, C E; Yang, B H

    2015-02-06

    Tibetan sheep, an indigenous breed, have a wide variety of phenotypes and a colorful coat, which make this breed an interesting model for evaluating the effects of coat-color gene mutations on this phenotypic trait. The agouti signaling protein (ASIP) gene is a positional candidate gene, as was inferred based on previous study. In our research, ASIP gene copy numbers in genomic DNA were detected using a novel approach, and the exon 2 g.100-104 mutation and copy number variation (CNV) of ASIP were associated with coat color in 256 sheep collected from eight populations with different coat colors by high-resolution melting curve assay. We found that the relative copy numbers of ASIP ranged from one to eight in Tibetan sheep. All of the g.100-104 genotypes in the populations were in Hardy-Weinberg equilibrium, and there was no relationship between the g.100-104 genotype and coat color (P > 0.05). The single ASIP CNV allele was found to be almost entirely associated with solid-black coat color; however, not all solid-black sheep displayed the putative single ASIP CNV genotype. From our study, we speculate that the ASIP CNV is under great selective pressure and the single ASIP CNV allows selection for black coat color in Tibetan sheep, but this does not explain all black phenotypes in Tibetan sheep.

  3. Epidemiology of Oestrus ovis (Diptera: Oestridae in sheep in Botucatu, State of São Paulo Epidemiologia de Oestrus ovis (Diptera: Oestridae em ovinos em Botucatu, São Paulo

    Directory of Open Access Journals (Sweden)

    Bruna Fernanda da Silva

    2012-12-01

    Full Text Available The seasonal factors that influence Oestrus ovis infestation in sheep were determined in Botucatu, State of São Paulo, Southwestern Brazil, from April 2008 to March 2011. Two tracer lambs were monthly exposed to natural infestation by O. ovis larvae for 28 consecutive days, by grazing with a sheep flock. Tracer animals were then euthanized and the larvae of O. ovis recovered from nasal and sinus cavities. Of the 72 tracer lambs, 50% were infested with O. ovis larvae and the mean intensity of infestation per head infested was 16.8 larvae, with an average of 7.8 L1, 5.3 L2 and 3.7 L3. O. ovis larvae were present during the four seasons of the year, but the mean larval burden was significantly higher during the spring and summer months, compared to winter (P Os fatores sazonais que influenciam a infestação por larvas de Oestrus ovis, foram determinados no período de abril de 2008 a março de 2011, em ovinos criados em Botucatu, São Paulo, região Sudeste do Brasil. Mensalmente, dois cordeiros traçadores permaneceram em pastejo com um rebanho ovino durante 28 dias consecutivos, expostos à infestação natural por larvas de O. ovis. Em seguida, os cordeiros foram sacrificados, e as larvas de O. ovis recuperadas da cavidade nasal e seios frontais. Dos 72 cordeiros traçadores, 50% estavam infestados por larvas de O. ovis, com intensidade média de infestação de 16,8 larvas/cabeça infestada, com média de 7,8 L1, 5,3 L2 e 3,7 L3. As larvas de O. ovis foram recuperadas durante as quatro estações do ano, mas o número médio de larvas foi significativamente superior durante os meses de primavera e verão comparado aos meses de inverno (P < 0,05. A maior taxa de recuperação larval coincidiu com temperaturas médias entre 20 °C e 25 °C e umidade relativa do ar por volta de 70%. Os resultados sugerem que a evolução e desenvolvimento de O. ovis ocorre praticamente durante o ano inteiro, mas a infestação é mais frequente nos meses de

  4. Brucella ovis PA mutants for outer membrane proteins Omp10, Omp19, SP41, and BepC are not altered in their virulence and outer membrane properties.

    Science.gov (United States)

    Sidhu-Muñoz, Rebeca S; Sancho, Pilar; Vizcaíno, Nieves

    2016-04-15

    Mutants in several genes have been obtained on the genetic background of virulent rough (lacking O-polysaccharide) Brucella ovis PA. The target genes encode outer membrane proteins previously associated with the virulence of smooth (bearing O-polysaccharide chains in the lipopolysaccharide) Brucella strains. Multiple attempts to delete omp16, coding for a homologue to peptidoglycan-associated lipoproteins, were unsuccessful, which suggests that Omp16 is probably essential for in vitro survival of B. ovis PA. Single deletion of omp10 or omp19-that encode two other outer membrane lipoproteins--was achieved, but the simultaneous removal of both genes failed, suggesting an essential complementary function between both proteins. Two other deletion mutants, defective in the Tol-C-homologue BepC or in the SP41 adhesin, were also obtained. Surprisingly when compared to previous results obtained with smooth Brucella, none of the B. ovis mutants showed attenuation in the virulence, either in the mouse model or in cellular models of professional and non-professional phagocytes. Additionally, and in contrast to the observations reported with smooth Brucella strains, several properties related to the outer membrane remained almost unaltered. These results evidence new distinctive traits between naturally rough B. ovis and smooth brucellae. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. The ARIES tokamak fusion reactor study

    International Nuclear Information System (INIS)

    Bartlit, J.R.; Bathke, C.G.; Krakowski, R.A.; Miller, R.L.; Beecraft, W.R.; Hogan, J.T.; Peng, Y.K.M.; Reid, R.L.; Strickler, D.J.; Whitson, J.C.; Blanchard, J.P.; Emmert, G.A.; Santarius, J.F.; Sviatoslavsky, I.N.; Wittenberg, L.J.

    1989-01-01

    The ARIES study is a community effort to develop several visions of the tokamak as fusion power reactors. The aims are to determine their potential economics, safety, and environmental features and to identify physics and technology areas with the highest leverage for achieving the best tokamak reactor. Three ARIES visions are planned, each having a different degree of extrapolation from the present data base in physics and technology. The ARIES-I design assumes a minimum extrapolation from current tokamak physics (e.g., 1st stability) and incorporates technological advances that can be available in the next 20 to 30 years. ARIES-II is a DT-burning tokamak in 2nd stability regime and employs both potential advances in the physics and expected advances in technology and engineering; and ARIES-III is a conceptual D 3 He reactor. This paper focuses on the ARIES-I design. Parametric systems studies show that the optimum 1st stability tokamak has relatively low plasma current (∼ 12 MA), high plasma aspect ratio (∼ 4-6), and high magnetic field (∼ 24 T at the coil). ARIES-I is 1,000 MWe (net) reactor with a plasma major radius of 6.5 m, a minor radius of 1.4 m, a neutron wall loading of about 2.8 MW/m 2 , and a mass power density of about 90 kWe/ton. The ARIES-I reactor operates at steady state using ICRF fast waves to drive current in the plasma core and lower-hybrid waves for edge-plasma current drive. The current-drive system supplements a significant (∼ 57%) bootstrap current contribution. The impurity control system is based on high-recycling poloidal divertors. Because of the high field and large Lorentz forces in the toroidal-field magnets, innovative approaches with high-strength materials and support structures are used. 24 refs., 4 figs., 1 tab

  6. UCLA program in reactor studies: The ARIES tokamak reactor study

    International Nuclear Information System (INIS)

    1991-01-01

    The ARIES research program is a multi-institutional effort to develop several visions of tokamak reactors with enhanced economic, safety, and environmental features. The aims are to determine the potential economics, safety, and environmental features of a range of possible tokamak reactors, and to identify physics and technology areas with the highest leverage for achieving the best tokamak reactor. Four ARIES visions are currently planned for the ARIES program. The ARIES-1 design is a DT-burning reactor based on ''modest'' extrapolations from the present tokamak physics database and relies on either existing technology or technology for which trends are already in place, often in programs outside fusion. ARIES-2 and ARIES-4 are DT-burning reactors which will employ potential advances in physics. The ARIES-2 and ARIES-4 designs employ the same plasma core but have two distinct fusion power core designs; ARIES-2 utilize the lithium as the coolant and breeder and vanadium alloys as the structural material while ARIES-4 utilizes helium is the coolant, solid tritium breeders, and SiC composite as the structural material. Lastly, the ARIES-3 is a conceptual D- 3 He reactor. During the period Dec. 1, 1990 to Nov. 31, 1991, most of the ARIES activity has been directed toward completing the technical work for the ARIES-3 design and documenting the results and findings. We have also completed the documentation for the ARIES-1 design and presented the results in various meetings and conferences. During the last quarter, we have initiated the scoping phase for ARIES-2 and ARIES-4 designs

  7. Improved verification methods for OVI security ink

    Science.gov (United States)

    Coombs, Paul G.; Markantes, Tom

    2000-04-01

    Together, OVP Security Pigment in OVI Security Ink, provide an excellent method of overt banknote protection. The effective use of overt security feature requires an educated public. The rapid rise in computer-generated counterfeits indicates that consumers are not as educate das to banknote security features as they should be. To counter the education issue, new methodologies have been developed to improve the validation of banknotes using the OVI ink feature itself. One of the new methods takes advantage of the overt nature of the product's optically variable effect. Another method utilizes the unique optical interference characteristics provided by the OVP platelets.

  8. Neutronics assessment for the ARIES advanced reactor studies

    International Nuclear Information System (INIS)

    El-Guebaly, L.A.

    1995-01-01

    The ARIES tokamak designs have incorporated environmental and safety constraints in the design from the beginning. Low activation materials such as SiC or SiC composites, vanadium alloy, and modified HT-9 ferritic steel were utilized as the main structures in ARIES-IV, II, and III, respectively. All designs employ D-T fuel cycles except ARIES-III which is D- 3 He fuelled. An overall tritium breeding ratio of 1.12 seems adequate for ARIES-II and IV. The Li 2 O breeder requires a beryllium multiplier to achieve T self-sufficiency in the ARIES-IV design while the lithium has the ability to breed sufficient T in ARIES-II without a multiplier. Radiation damage concerns for the structures are the burn-up of the SiC and SiC composites and the atomic displacement in the vanadium. The first wall and blanket require frequent replacement (every 3-4 years) during reactor operation. The end-of-life fluences are 16.5MW yearsm -2 and 13MW yearsm -2 based on the 200dpa and 3% burn-up limits for the V and SiC structures respectively. Because of the lower neutron production, the ARIES-III first wall and shield are permanent components and require no replacement over the plant lifetime. A variety of shield options was examined and the ability of various materials to protect the magnets was assessed. At least 1.2m and 1.4m of inboard blanket-shield are required for magnet protection in ARIES-II and ARIES-IV respectively. The lack of T breeding and the lower wall loading result in a much thinner shield (0.65m) for ARIES-III. (orig.)

  9. Bloat in sheep (Ovis aries).

    Science.gov (United States)

    Colvin, H W; Backus, R C

    1988-01-01

    1. Most of the field studies on bloat are conducted with cattle and most of the laboratory experiments seeking to explain the various parameters associated with bloat are done with sheep. 2. Based on grazing behaviour, it would be expected that sheep might bloat more severely than cattle because they selectively choose to eat leaves over stems and chew what they ingest more frequently than cattle. Furthermore, sheep appear to select legumes over grasses because the legumes can be eaten more rapidly. However, because they are selective, sheep eat more slowly than cattle. Despite a higher bloat expectation, bloating in sheep is reported to be less of a problem than in cattle. 3. Although frothing of rumen ingesta was described earlier in cattle as the cause of acute legume bloat, experiments with frothy bloat in sheep preceded those in cattle. 4. Anti-frothing agents were used in sheep before cattle to treat acute legume bloat. 5. Experiments devoted to the study of eructation in ruminants were carried out on sheep, then cattle. 6. Convincing evidence that rumen motility does not cease during acute legume bloat was gathered using sheep. 7. Although the transected tracheal technique for the determination of the volume of eructated gas was developed with cattle, the pathway of eructated gas was confirmed with sheep. 8. All the current evidence accumulated from experiments with sheep supports the hypothesis that death due to legume bloat is caused by acute neural, respiratory, and cardiovascular insult resulting from the effect of the distended rumen on thoracic viscera, diaphragm, intercostal muscles, and the abdominal vena cava. 9. Experiments with sheep and cattle being fed scabrous and nonscabrous diets similar in chemical composition show that sheep are more resistant than cattle to the increase in intrarumen pressure, decline in rumen contraction amplitude, and decrease in rumen contraction frequency caused by nonscabrous diets. 10. The sequence of events in the reticulorumen during primary and secondary contractions previously described following visual and palpation experiments with cattle was confirmed by the use of myoelectrodes implanted in the various sacs of the reticulorumen of sheep. 11. Elevated intrarumen pressure is associated with an increase in the frequency of primary (mixing) and secondary (eructation) contractions (more secondaries than primaries).(ABSTRACT TRUNCATED AT 400 WORDS)

  10. Optically Variable Inks (OVI): versatility in formulation and usage

    Science.gov (United States)

    Degott, Pierre

    2000-04-01

    Optically Variable Inks (OVI) are printing inks containing high precision, multi-layer interference filters as their constituent pigment. They display a strong and unique color change form a normal to an angled viewing position. During the last 10 years OVI has gained wide acceptance as an overt protection for numerous value documents including banknotes and ID cards. Meanwhile, continuous improvement has taken place over the last two years in a variety of areas.

  11. Nelson's big horn sheep (Ovis canadensis nelsoni) trample Agassiz's desert tortoise (Gopherus agassizii) burrow at a California wind energy facility

    Science.gov (United States)

    Agha, Mickey; Delaney, David F.; Lovich, Jeffrey E.; Briggs, Jessica; Austin, Meaghan; Price, Steven J.

    2015-01-01

    Research on interactions between Agassiz's desert tortoises (Gopherus agassizii) and ungulates has focused exclusively on the effects of livestock grazing on tortoises and their habitat (Oldemeyer, 1994). For example, during a 1980 study in San Bernardino County, California, 164 desert tortoise burrows were assessed for vulnerability to trampling by domestic sheep (Ovis aries). Herds of grazing sheep damaged 10% and destroyed 4% of the burrows (Nicholson and Humphreys 1981). In addition, a juvenile desert tortoise was trapped and an adult male was blocked from entering a burrow due to trampling by domestic sheep. Another study found that domestic cattle (Bos taurus) trampled active desert tortoise burrows and vegetation surrounding burrows (Avery and Neibergs 1997). Trampling also has negative impacts on diversity of vegetation and intershrub soil crusts in the desert southwest (Webb and Stielstra 1979). Trampling of important food plants and overgrazing has the potential to create competition between desert tortoises and domestic livestock (Berry 1978; Coombs 1979; Webb and Stielstra 1979).

  12. High-throughput identification of miRNAs of Taenia ovis, a cestode threatening sheep industry.

    Science.gov (United States)

    Zheng, Yadong

    2017-07-01

    Taenia ovis is a tapeworm that is mainly transmitted between dogs and sheep or goats and has an adverse effect on sheep industry. miRNAs are short regulatory non-coding RNAs, involved in parasite development and growth as well as parasite infection. The miRNA profile of T. ovis remains to be established. Herein, 33 known miRNAs belonging to 23 different families were identified in T. ovis metacestodes using deep sequencing approach. Of them, expression of some miRNAs such as tov-miR-10 and -let-7 was absolutely predominant. Moreover, comparative analysis revealed the presence of a miR-71/2b/2c cluster in T. ovis, which was also completely conserved in other 6 cestodes. The study provides rich data for further understandings of T. ovis biology. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. ARIES: Further description of its Assessment Process

    Energy Technology Data Exchange (ETDEWEB)

    Rabago, I.; Sierra, I.; Vidania, R. de

    1993-07-01

    ARIES* is an integrated system designed in order to facilitate the effects assessment produced by accidental release of toxic chemicals. ARIES has been developed for inhalation exposures to estimate short term consequences over the exposed population. ARIES works with mathematical algorithms and is complemented with an additional system that executes the selection of relevant information, giving an additional support to the assessment. ARIES Methodology is based, on one side, in the development of a system of mathematical models joint sequentially in order to obtain a quick answer about the severity of the expected human effects as a function of the toxic concentration released to the environment (Quantitative process), and on the other side in the analysis and optimization of the contrasted existing information about chemicals toxicity (Qualitative process). Both processes are sequential and complementary. ARIES methodology is physically supported by an informatics system. ARIES works with relational databases and mathematical algorithms programmed in dbase/SQL language which let relate the above process, and furthermore add or incorporate progressively new models or complementary information. It has been developed a first prototype PC's of ARIES including several products of 82/505/EEC Directive. In a previous report we described the system as a whole, and specially, their qualitative step. This report is directed to describe the quantitative assessment process of the system, specifically those aspects included in the present version of the prototype. Developed parts of quantitative steps are designed for situations in which only basic data like TLV's, DL, etc., are available for the assessment. (Author) 8 refs.

  14. ARIES: Further description of its assessment process

    International Nuclear Information System (INIS)

    Rabago, I.; Sierra, I.; Vidania, R.

    1993-01-01

    ARIES is an integrated system designed in order to facilitate the effects assessment produced by accidental release of toxic chemicals. ARIES has been developed for inhalation exposures to estimate short term consequences over the exposed population. ARIES works with mathematical algorithms and is complemented with an additional system that executes the selection of relevant information, giving and additional support to the assessment. ARIES Methodology is based, on one side, in the development of a system of mathematical models joint sequentially in order to obtain a quick answer about the severity of the expected human effects as a function of the toxic concentration released to the environment (Quantitative process), and on the other side in the analysis and optimisation of the contrasted existing information about chemicals toxicity (Qualitative process). Both processes are sequential and complementary. ARIES methodology is physically supported by an informatic system. ARIES works with relational databases and mathematical algorithms programmed in dbase/sql language which let relate the above process, and furthermore add or incorporate progressively new models or complementary information. It has been developed a first prototype PC's of ARIES including several products of 82/505/EEC Directive. In a previous report we described the systems as a whole, and specially, their qualitative step. This report is directed to describe the quantitative assessment process of the system, specifically those aspects included in the present version of the prototype. Developed parts of quantitative steps are designed for situations in which only basic data like TLV's, DL, etc., are available for the assessment

  15. ARIES: Further description of its Assessment Process

    International Nuclear Information System (INIS)

    Rabago, I.; Sierra, I.; Vidania, R. de

    1993-01-01

    ARIES* is an integrated system designed in order to facilitate the effects assessment produced by accidental release of toxic chemicals. ARIES has been developed for inhalation exposures to estimate short term consequences over the exposed population. ARIES works with mathematical algorithms and is complemented with an additional system that executes the selection of relevant information, giving an additional support to the assessment. ARIES Methodology is based, on one side, in the development of a system of mathematical models joint sequentially in order to obtain a quick answer about the severity of the expected human effects as a function of the toxic concentration released to the environment (Quantitative process), and on the other side in the analysis and optimization of the contrasted existing information about chemicals toxicity (Qualitative process). Both processes are sequential and complementary. ARIES methodology is physically supported by an informatics system. ARIES works with relational databases and mathematical algorithms programmed in dbase/SQL language which let relate the above process, and furthermore add or incorporate progressively new models or complementary information. It has been developed a first prototype PC's of ARIES including several products of 82/505/EEC Directive. In a previous report we described the system as a whole, and specially, their qualitative step. This report is directed to describe the quantitative assessment process of the system, specifically those aspects included in the present version of the prototype. Developed parts of quantitative steps are designed for situations in which only basic data like TLV's, DL, etc., are available for the assessment. (Author) 8 refs

  16. Tritium Inventory in ARIES-AT

    International Nuclear Information System (INIS)

    Longhurst, Glen R.

    2001-01-01

    This report documents an investigation into the tritium inventory expected in the ARIES-AT fusion reactor. ARIES-AT features silicon carbide fibers in a silicon carbide matrix as its primary construction. It uses the same fusion power core as the previous ARIES-RS. Based on experimental results of several researchers, consideration was given to swelling, sputtering, film coatings, erosion, and implantation. Estimates were made of tritium inventory using the TMAP4 code. About 700 g of tritium may be expected in the machine, two thirds of which would reside in the first wall. Under assumed accident conditions that involve first wall temperatures up to 1000 C, evolution of retained tritium may be expected to vary from 0.8 to nearly 40 percent depending on the temperature of the first wall

  17. OVIS 2.0 user%3CU%2B2019%3Es guide.

    Energy Technology Data Exchange (ETDEWEB)

    Mayo, Jackson R.; Gentile, Ann C.; Brandt, James M.; Thompson, David C.; Roe, Diana C.; Wong, Matthew H.; Pebay, Philippe Pierre

    2009-04-01

    This document describes how to obtain, install, use, and enjoy a better life with OVIS version 2.0. The OVIS project targets scalable, real-time analysis of very large data sets. We characterize the behaviors of elements and aggregations of elements (e.g., across space and time) in data sets in order to detect anomalous behaviors. We are particularly interested in determining anomalous behaviors that can be used as advance indicators of significant events of which notification can be made or upon which action can be taken or invoked. The OVIS open source tool (BSD license) is available for download at ovis.ca.sandia.gov. While we intend for it to support a variety of application domains, the OVIS tool was initially developed for, and continues to be primarily tuned for, the investigation of High Performance Compute (HPC) cluster system health. In this application it is intended to be both a system administrator tool for monitoring and a system engineer tool for exploring the system state in depth. OVIS 2.0 provides a variety of statistical tools for examining the behavior of elements in a cluster (e.g., nodes, racks) and associated resources (e.g., storage appliances and network switches). It calculates and reports model values and outliers relative to those models. Additionally, it provides an interactive 3D physical view in which the cluster elements can be colored by raw element values (e.g., temperatures, memory errors) or by the comparison of those values to a given model. The analysis tools and the visual display allow the user to easily determine abnormal or outlier behaviors. The OVIS project envisions the OVIS tool, when applied to compute cluster monitoring, to be used in conjunction with the scheduler or resource manager in order to enable intelligent resource utilization. For example, nodes that are deemed less healthy, that is, nodes that exhibit outlier behavior in some variable, or set of variables, that has shown to be correlated with future failure

  18. Proteomic analysis of Taenia ovis metacestodes by high performance liquid chromatography-coupled tandem mass spectrometry.

    Science.gov (United States)

    Zheng, Yadong

    2017-03-15

    Taenia ovis metacestodes reside in the muscle of sheep and goats, and may cause great economic loss due to condemnation of carcasses if not effectively controlled. Although advances have been made in the control of T. ovis infection, our knowledge of T. ovis biology is limited. Herein the protein profiling of T. ovis metacestodes was determined by liquid chromatography-linked tandem mass spectrometry. A total of 966 proteins were identified and 25.1% (188/748) were annotated to be associated with metabolic pathways. Consistently, GO analysis returned a metabolic process (16.27%) as one of two main biological process terms. Moreover, it was found that 24 proteins, including very low-density lipoprotein receptor, enolase, paramyosin and endophilin B1, were abundant in T. ovis metacestodes. These proteins may be associated with motility, metabolism, signaling, stress, drug resistance and immune responses. Furthermore, comparative analysis of 5 cestodes revealed the presence of Taenia-specific enolases. These data provide clues for better understanding of T. ovis biology, which is informative for effective control of infection. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Aris Angelis (1954-2003)

    CERN Multimedia

    2003-01-01

    The value of a person is recognized more by what he leaves behind. Aris Angelis has left a plethora of people: teachers, friends, colleagues, associates, acquaintances, all of whom were shocked and devastated by his untimely and "unjust" departure. Some thought of him as their "mentor" during their crucial and difficult first steps in science... Some others as the ever-giving friend, who put the "common good" in front of himself... Others feel an "unpaid debt" to him, who left so soon and so unexpected... Some feel an enormous loss and a huge vacuum left behind where he was... Others had looked forward to working with him in his new scientific environment... But, ALL of us shall remember Aris with love and joy for what he was and what he has given and left to us. Apostolos D. Panagiotou (Teacher, colleague & friend) Aris was very sensitive to the need for science communication. A CERN guide since 1999, he took part in all special events, such as open days and the Oracle de Delphi, always with the same ...

  20. Research of antibodies anti-brucella ovis in ovine the eight city of recôncavo baiano Detecção de anticorpos anti-"Brucella ovis" em ovinos do Estado da Bahia

    Directory of Open Access Journals (Sweden)

    Alessandra Estrela Silva Lima

    2009-12-01

    Full Text Available Ovine brucellosis is a contagious disease caused by Brucella ovis, characterized by clinical marked as epididymitis, abortion and lambs neonatal mortality, leading to reduction in reproductive efficiency of livestock and causing great economic damage. Considering the lack of seroepidemiologic data about B. Ovis in the State of Bahia and the importance of this disease in the economic sphere of sheep rearing, the design of this study aimed to achieve serum inquiry to investigate toe occurrence of anti-Brucella ovis in sheep in the Recôncavo Baiano. 183 serum samples were submited to the test of agar gel immunodiffusion (AGIO using soluble antigens produced by the Veterinary Research Center Oesidério Finamor (CPVOF in Rio Grande do Sul. Six (3.27% showed serological evidence of infection by B. Ovis Of 183 sera from sheep investigated by the AGIO to search for evidence of anti-Brucella ovis, with no significant difference between age and sex (p = 2.0 and p = 0.60, respectively of animais with the proportion of sheep seropositives. The results obtained by serological survey have been lead to accept that the infection by B. Ovis it is present in commercial herds of sheep in the state of Bahia, and requiring more extensive studies in sheep population, adoption of sanitary measures of prevention and control to prevent the spread of the disease.A brucelose ovina é uma doença de caráter contagioso, causada por Brucella ovis, caracterizada por um quadro clínico de epididimite, abortamento e mortalidade neonatal de cordeiros, levando a redução da eficiência reprodutiva dos rebanhos e provocando grandes perdas econômicas. Considerando a ausência de dados epidemiológicos, sobre a B. ovis no estado da Bahia e sua importância econômica para ovinocultura, o presente trabalho teve por objetivo realizar inquérito sorológico para investigar a ocorrência de anticorpos anti-Brucella ovis em ovinos no recôncavo baiano. Foram submetidas 183 amostras

  1. Respuesta humoral y consecuencias reproductivas en ovejas desafiadas con Brucella ovis al final de la gestación Immune response and reproductive consequences in experimentally infected ewes with Brucella ovis during late pregnancy

    Directory of Open Access Journals (Sweden)

    Fernando A Paolicchi

    2013-03-01

    Full Text Available La brucelosis ovina por Brucella ovis es una enfermedad de prevalencia alta en Argentina. Para evaluar la patogenicidad de B. ovis y la respuesta serológica durante el último mes de gestación, 6 ovejas se distribuyeron en dos grupos: G1, ovejas preñadas, n = 4 y G2, ovejas no preñadas, n = 2. Tres ovejas del G1 (15 días preparto y una del G2 fueron inoculadas con B. ovis. Se analizaron muestras de suero mediante diferentes pruebas serológicas. Se realizó aislamiento y PCR a partir de mucus cérvico-vaginal (mcv, placenta y leche. En las muestras de placenta se realizó histopatología. Las hembras del G1 parieron corderos vivos; se detectaron anticuerpos en las ovejas desafiadas del G1 a partir de los 5 días posinoculación. El mcv de las ovejas desafiadas resultó negativo al aislamiento en ambos grupos. Las muestras de leche del G1 fueron positivas por cultivo y PCR a B. ovis. La técnica de PCR resultó positiva en las placentas de las ovejas desafiadas del G1. La histopatología reveló una placentitis necrótica supurativa en una de las ovejas desafiadas. El desafío con B. ovis preparto resultó en la invasión de la placenta y de la glándula mamaria, con la consecuente excreción de la bacteria por leche. La infección con B. ovis indujo una respuesta humoral temprana en las ovejas. La colonización de la placenta por B. ovis y la excreción de la bacteria por la leche sugieren un potencial riesgo de infección activa para los corderos y la posibilidad de que estos se comporten como portadores latentes de la infección.Ovine brucellosis by Brucella ovis is a highly prevalent disease in Argentina. This study aimed to evaluate the pathogenicity of B. ovis and the serological response in ewes during late pregnancy and in their offspring. Six adult ewes were distributed in two groupsGI (pregnant females, n = 4 and G2 (nonpregnant females, n = 2. Three pregnant ewes at 15 days prepartum and one nonpregnant eve were inoculated with B

  2. ARIES nondestructive assay system operation and performance

    International Nuclear Information System (INIS)

    Cremers, Teresa L.; Hansen, Walter J.; Herrera, Gary D.; Nelson, David C.; Sampson, Thomas E.; Scheer, Nancy L.

    2000-01-01

    The ARIES (Advanced Recovery and Integrated Extraction System) Project is an integrated system at the Los Alamos Plutonium Facility for the dismantlement of nuclear weapons. The plutonium produced by the ARIES process was measured by an integrated nondestructive assay (NDA) system. The performance of the NDA systems was monitored by a measurement control program which is a part of a nuclear material control and accountability system. In this paper we will report the results of the measurements of the measurement control standards as well as an overview of the measurement of the ARIES process materials

  3. The ARIES-I tokamak reactor study

    International Nuclear Information System (INIS)

    1991-01-01

    This report contains an overview of the Aries-I tokamak reactor study. The following topics are discussed on this tokamak: Systems studies; equilibrium, stability, and transport; summary and conclusions; current drive; impurity control system; tritium systems; magnet engineering; fusion-power-core engineering; power conversion; Aries-I safety design and analysis; design layout and maintenance; and start-up and operations

  4. ARIES-I tritium system

    International Nuclear Information System (INIS)

    Sze, D.K.; Tam, S.W.; Billone, M.C.; Hassanein, A.M.; Martin, R.

    1990-09-01

    A key safety concern in a D-T fusion reactor is the tritium inventory. There are three components in a fusion reactor with potentially large inventories, i.e., the blanket, the fuel processing system and the plasma facing components. The ARIES team selected the material combinations, decided the operating conditions and refined the processing systems, with the aiming of minimizing the tritium inventories and leakage. The total tritium inventory for the ARIES-I reactor is only 700 g. This paper discussed the calculations and assumptions we made for the low tritium inventory. We also addressed the uncertainties about the tritium inventory. 13 refs., 2 figs., 3 tabs

  5. Blanket concepts for the ARIES commercial tokamak reactor study

    International Nuclear Information System (INIS)

    Grotz, S.P.; Ghoniem, N.M.; Hasan, M.Z.; Martin, R.C.; Najmabadi, F.; Sharafat, S.; Hua, T.; Sze, D.K.; Cheng, E.T.; Creedon, R.L.; Wong, C.P.C.; Herring, J.S.; Klein, A.; Snead, L.; Steiner, D.

    1989-01-01

    The ARIES study is a 3-year effort, started in 1988, exploring the potential of the tokamak to be an attractive and competitive commercial power reactor. Several different versions of the tokamak are being considered, combining different levels of extrapolations in physics and engineering databases. The first version studied in detail, ARIES-I, combines present-day physics (with minimal extrapolation) with aggressive engineering technology such as very high-field, superconducting magnets and low-activation silicon carbide composite materials. The ARIES-I version is designed to meet acceptable safety and environmental criteria. In particular, achieving a passively safe concept that meets Class-C waste disposal is one of the high leverage items in the design. This paper summarizes the scoping analysis and engineering design of the ARIES-I fusion-power-core subsystems. The ARIES-I design is a 1000 MW e power reactor, operating at steady state in the 1 st stability regime and uses a high magnetic field. Typical operating parameters of the ARIES-I strawman design are listed

  6. WAZA-ARI. A dose assessment system for patients in CT scan

    International Nuclear Information System (INIS)

    Sato, Kaoru; Takahashi, Fumiaki; Endo, Akira; Ono, Koji; Ban, Nobuhiko; Hasegawa, Takayuki; Katsunuma, Yasushi; Yoshitake, Takayasu; Kai, Michiaki

    2015-01-01

    The Japan Atomic Energy Agency (JAEA) are now developing WAZA-ARI for improvement of management of exposure doses due to CT examination under the joint research with the Oita University of Nursing and Health Sciences. The trial version of WAZA-ARI has been released on 21 December 2012. In trial version, users can perform dose assessment by using organ dose database based on the average adult Japanese male (JM-103) and female (JF-103) voxel phantoms and a 4 years old female voxel phantom (UFF4). The homepage of WAZA-ARI has been accessed over 1000 times per month and 28421 times by the end of September 2014. We are developing WAZA-ARI version 2 as the extension version of dose calculation functions of WAZA-ARI. WAZA-ARI version 2 will be released by the end of March 2015. In WAZA-ARI version 2. Users can upload dose calculation results to WAZA-ARI version 2 server, and utilize improvement of the dose management of patients and the optimization of CT scan conditions. (author)

  7. The ARIES-III D-3He tokamak reactor

    International Nuclear Information System (INIS)

    Bathke, C.G.; Werley, K.A.; Miller, R.L.; Krakowski, R.A.; Santarius, J.F.

    1992-01-01

    The multi-institutional ARIES study has generated a conceptual design of another tokamak fusion reactor in a series that varies the assumed advances in technology and physics. The ARIES-III design uses a D- 3 He fuel cycle and requires advances in technology and physics for economical attractiveness. The optimal design was characterized through systems analyses for eventual conceptual engineering design. In this paper, results from the systems analysis are summarized, and a comparison with the high-field, D-T fueled ARIES-I is included

  8. A case of nasal myiasis due to Oestrus ovis (Diptera: Oestridae) in a llama (Lama glama).

    Science.gov (United States)

    Gomez-Puerta, Luis Antonio; Alroy, Karen Ann; Ticona, Daniel Santiago; Lopez-Urbina, Maria Teresa; Gonzalez, Armando Emiliano

    2013-01-01

    Infection by the larval form of Oestrus ovis (sheep bot fly) is common in many areas of Peru. This is an obligate parasite of sheep and goats, and it is the cause of oestrosis, or nasal myiasis, which can lead to severe clinical manifestations in livestock. A case of myiasis caused by O. ovis in a llama (Lama glama) in Cuzco, Peru, is reported here. This llama presented with respiratory distress and died due to bilateral hemorrhagic pneumonia. During the necropsy, six intact dipterous larvae were recovered from the nasal fossae and cranial sinuses being identified as O. ovis. This is the first report of nasal myiasis in llamas due to O. ovis in Peru.

  9. A case of nasal myiasis due to Oestrus ovis (Diptera: Oestridae in a llama (Lama glama

    Directory of Open Access Journals (Sweden)

    Luis Antonio Gomez-Puerta

    Full Text Available Infection by the larval form of Oestrus ovis (sheep bot fly is common in many areas of Peru. This is an obligate parasite of sheep and goats, and it is the cause of oestrosis, or nasal myiasis, which can lead to severe clinical manifestations in livestock. A case of myiasis caused byO. ovis in a llama (Lama glama in Cuzco, Peru, is reported here. This llama presented with respiratory distress and died due to bilateral hemorrhagic pneumonia. During the necropsy, six intact dipterous larvae were recovered from the nasal fossae and cranial sinuses being identified as O. ovis. This is the first report of nasal myiasis in llamas due to O. ovis in Peru.

  10. [Immune response and reproductive consequences in experimentally infected ewes with Brucella ovis during late pregnancy].

    Science.gov (United States)

    Paolicchi, Fernando A; Nuñez, Marta; Fiorentino, María A; Malena, Rosana C; Trangoni, Marcos; Cravero, Silvio; Estein, Silvia M

    2013-01-01

    Ovine brucellosis by Brucella ovis is a highly prevalent disease in Argentina. This study aimed to evaluate the pathogenicity of B. ovis and the serological response in ewes during late pregnancy and in their offspring. Six adult ewes were distributed in two groupsG1 (pregnant females, n = 4) and G2 (nonpregnant females, n = 2). Three pregnant ewes at 15 days prepartum and one nonpregnant eve were inoculated with B. ovis. Sera of sheep and their offspring were analyzed by different serological tests. Samples of cervicovaginal mucus, placenta and milk were studied by bacteriology. A Brucella genus-specific PCR assay was carried out in placenta and milk samples. Placenta samples were hystopathologically processed. g1 females gave birth to live lambs, but one died hours postpartum. Serological techniques employed detected antibodies in serum of inoculated pregnant animal 5 days postchallenge. sera of female controls G1 and G2 remained negative throughout the study. Cervicovaginal mucus of infected ewes in G1 and G2 yielded negative results to bacteriology, but B. ovis was isolated from milk. The PCR assay was positive for the placenta and milk from inoculated pregnant ewes. Histopathology revealed necrotic suppurative placentitis in one placenta. However, although results demonstrated that B. ovis can invade the placenta and mammary gland, this bacterium did not cause abortion when it was inoculated intravenously at 15 days prepartum. B. ovis infection induced an early humoral response in pregnant ewes, but their lambs remained seronegative, indicating that there was no transfer of antibodies in infancy. Placenta colonization and milk excretion of B. ovis involves a potential source of infection for lambs, which could play a role as latent carriers of infection.

  11. ARIES-AT safety design and analysis

    Energy Technology Data Exchange (ETDEWEB)

    Petti, D.A. [Idaho National Engineering and Environmental Laboratory, Fusion Safety Program, P.O. Box 1625, Idaho Falls, ID 83415 (United States)]. E-mail: David.Petti@inl.gov; Merrill, B.J. [Idaho National Engineering and Environmental Laboratory, Fusion Safety Program, P.O. Box 1625, Idaho Falls, ID 83415 (United States); Moore, R.L. [Idaho National Engineering and Environmental Laboratory, Fusion Safety Program, P.O. Box 1625, Idaho Falls, ID 83415 (United States); Longhurst, G.R. [Idaho National Engineering and Environmental Laboratory, Fusion Safety Program, P.O. Box 1625, Idaho Falls, ID 83415 (United States); El-Guebaly, L. [Fusion Technology Institute, 1500 Engineering Drive, University of Wisconsin-Madison, Madison, WI 53706 (United States); Mogahed, E. [Fusion Technology Institute, 1500 Engineering Drive, University of Wisconsin-Madison, Madison, WI 53706 (United States); Henderson, D. [Fusion Technology Institute, 1500 Engineering Drive, University of Wisconsin-Madison, Madison, WI 53706 (United States); Wilson, P. [Fusion Technology Institute, 1500 Engineering Drive, University of Wisconsin-Madison, Madison, WI 53706 (United States); Abdou, A. [Fusion Technology Institute, 1500 Engineering Drive, University of Wisconsin-Madison, Madison, WI 53706 (United States)

    2006-01-15

    ARIES-AT is a 1000 MWe conceptual fusion power plant design with a very low projected cost of electricity. The design contains many innovative features to improve both the physics and engineering performance of the system. From the safety and environmental perspective, there is greater depth to the overall analysis than in past ARIES studies. For ARIES-AT, the overall spectrum of off-normal events to be examined has been broadened. They include conventional loss of coolant and loss of flow events, an ex-vessel loss of coolant, and in-vessel off-normal events that mobilize in-vessel inventories (e.g., tritium and tokamak dust) and bypass primary confinement such as a loss of vacuum and an in-vessel loss of coolant with bypass. This broader examination of accidents improves the robustness of the design from the safety perspective and gives additional confidence that the facility can meet the no-evacuation requirement under average weather conditions. We also provide a systematic assessment of the design to address key safety functions such as confinement, decay heat removal, and chemical energy control. In the area of waste management, both the volume of the component and its hazard are used to classify the waste. In comparison to previous ARIES designs, the overall waste volume is less because of the compact design.

  12. Species identification in meat products: A new screening method based on high resolution melting analysis of cyt b gene.

    Science.gov (United States)

    Lopez-Oceja, A; Nuñez, C; Baeta, M; Gamarra, D; de Pancorbo, M M

    2017-12-15

    Meat adulteration by substitution with lower value products and/or mislabeling involves economic, health, quality and socio-religious issues. Therefore, identification and traceability of meat species has become an important subject to detect possible fraudulent practices. In the present study the development of a high resolution melt (HRM) screening method for the identification of eight common meat species is reported. Samples from Bos taurus, Ovis aries, Sus scrofa domestica, Equus caballus, Oryctolagus cuniculus, Gallus gallus domesticus, Meleagris gallopavo and Coturnix coturnix were analyzed through the amplification of a 148 bp fragment from the cyt b gene with a universal primer pair in HRM analyses. Melting profiles from each species, as well as from several DNA mixtures of these species and blind samples, allowed a successful species differentiation. The results demonstrated that the HRM method here proposed is a fast, reliable, and low-cost screening technique. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Fusion power core engineering for the ARIES-ST power plant

    International Nuclear Information System (INIS)

    Tillack, M.S.; Wang, X.R.; Pulsifer, J.; Malang, S.; Sze, D.K.; Billone, M.; Sviatoslavsky, I.

    2003-01-01

    ARIES-ST is a 1000 MWe fusion power plant based on a low aspect ratio 'spherical torus' (ST) plasma. The ARIES-ST power core was designed to accommodate the unique features of an ST power plant, to meet the top-level requirements of an attractive fusion energy source, and to minimize extrapolation from the fusion technology database under development throughout the world. The result is an advanced helium-cooled ferritic steel blanket with flowing PbLi breeder and tungsten plasma-interactive components. Design improvements, such as the use of SiC inserts in the blanket to extend the outlet coolant temperature range were explored and the results are reported here. In the final design point, the power and particle loads found in ARIES-ST are relatively similar to other advanced tokamak power plants (e.g. ARIES-RS [Fusion Eng. Des. 38 (1997) 3; Fusion Eng. Des. 38 (1997) 87]) such that exotic technologies were not required in order to satisfy all of the design criteria. Najmabadi and the ARIES Team [Fusion Eng. Des. (this issue)] provide an overview of ARIES-ST design. In this article, the details of the power core design are presented together with analysis of the thermal-hydraulic, thermomechanical and materials behavior of in-vessel components. Detailed engineering analysis of ARIES-ST TF and PF systems, nuclear analysis, and safety are given in the companion papers

  14. External ophthalmomyiasis by Oestrus ovis: A case report from Davangere

    Directory of Open Access Journals (Sweden)

    Sridhar Rao

    2018-01-01

    Full Text Available External ophthalmomyiasis is an infestation of the eye with larvae of Dermatobia hominis or Oestrus ovis (sheep bot fly. We describe a case of ophthalmomyiasis in a 38-year-old male, who presented with ocular foreign body sensation, redness, pain, and watering of the eye. The causative larvae were removed and sent to the laboratory for identification. By studying morphological features, it was identified as the first instar larvae of O. ovis. The patient was put on topical and oral antibiotics but was lost to follow-up. This is probably the first report from this part of Karnataka.

  15. Undergraduate Observations of Separation and Position Angle of Double Stars ARY 6 AD and ARY 6 AE at Manzanita Observatory

    Science.gov (United States)

    Hoffert, Michael J.; Weise, Eric; Clow, Jenna; Hirzel, Jacquelyn; Leeder, Brett; Molyneux, Scott; Scutti, Nicholas; Spartalis, Sarah; Tokuhara, Corey

    2014-05-01

    Six beginning astronomy students, part of an undergraduate stellar astronomy course, one advanced undergraduate student assistant, and a professor measured the position angles and separations of Washington Double Stars (WDS) 05460 + 2119 (also known as ARY 6 AD and ARY 6 AE). The measurements were made at the Manzanita Observatory (116° 20'42" W, 32° 44' 5" N) of the Tierra Astronomical Institute on 10 Blackwood Rd. in Boulevard, California (www.youtube.com/watch?v=BHVdcMGBGDU), at an elevation of 4,500 ft. A Celestron 11" HD Edge telescope was used to measure the position angles and separations of ARY 6 AD and ARY 6 AE. The averages of our measurements are as follows: separation AD: trial 1 124.1 arcseconds and trial 2 124.5 arcseconds. The average of separation for AE: trial 1 73.3 arcseconds and trial 2 73.8 arcseconds. The averages of position angle for AD: trial 1 159.9 degrees and trial 2 161.3 degrees. The averages of position angle for AE: trial 1 232.6 degrees and trial 2 233.7 degrees.

  16. Miasis ocular por Oestrus ovis

    Directory of Open Access Journals (Sweden)

    María Beltrán F

    2006-01-01

    Full Text Available Se presentan tres casos de miasis ocular (dos adultos y un niñoprocedentes de zonas ganaderas de la provincia de Huaura,departamento de Lima,que acudieron al Hospital Regional de Huacho por presentar el ojo rojo,fotofobia, edema palpebral y sensación de cuerpo extraño;se extrajeron larvas adheridas al canto interno del ojo,las cuales se recibieron en el Instituto Nacional de Salud y fueron identificadas como Oestrus ovis .

  17. Investigation of hematological and biochemical parameters in small ruminants naturally infected with Babesia ovis

    Directory of Open Access Journals (Sweden)

    Bijan Esmaeilnejad

    2012-03-01

    Full Text Available Babesia ovis plays an important role in causing anemia and kidney dysfunction in affected animals. There are few extensive studies about hematological and biochemical findings of small ruminants' babesiosis caused by B. ovis. The aim of this study was to evaluate the effect of babesiosis on some hematological and biochemical parameters in infected small ruminants with B. ovis. A total of 280 sheep and 122 goats from 40 herds were randomly examined for the presence of B. ovis in blood samples. Of 402 samples, 67 animals (16.7% were positive for B. ovis of which 52 (18.5% were sheep and 15 (12.2% goats, respectively. The infected animals were divided into four subgroups according to parasitemia rates (<1%, 1%, 2%, and 3%. As a control group, 67 uninfected animals were also selected from the same farms. With increase in parasitemia rates, hemoglobin concentration (Hb, packed cell volume (PCV, red blood cells (RBCs, mean corpuscular volume (MCV and mean corpuscular hemoglobin concentration (MCHC significantly decreased (P < 0.05, while, total leukocyte count, number of lymphocyte, monocyte, neutrophil and eosinophil showed a significant increase (P < 0.05. Infected animals presented a significant elevation (P < 0.05 of total proteins and significantly lower level (P < 0.05 of albumin compared to non-infected animals. Significant elevation (P < 0.05 of BUN, creatinine, cholestrol, triglyceride, HDL and LDL level were found with parasitemia progression.

  18. Trans-species polymorphism and selection in the MHC class II DRA genes of domestic sheep.

    Directory of Open Access Journals (Sweden)

    Keith T Ballingall

    Full Text Available Highly polymorphic genes with central roles in lymphocyte mediated immune surveillance are grouped together in the major histocompatibility complex (MHC in higher vertebrates. Generally, across vertebrate species the class II MHC DRA gene is highly conserved with only limited allelic variation. Here however, we provide evidence of trans-species polymorphism at the DRA locus in domestic sheep (Ovis aries. We describe variation at the Ovar-DRA locus that is far in excess of anything described in other vertebrate species. The divergent DRA allele (Ovar-DRA*0201 differs from the sheep reference sequences by 20 nucleotides, 12 of which appear non-synonymous. Furthermore, DRA*0201 is paired with an equally divergent DRB1 allele (Ovar-DRB1*0901, which is consistent with an independent evolutionary history for the DR sub-region within this MHC haplotype. No recombination was observed between the divergent DRA and B genes in a range of breeds and typical levels of MHC class II DR protein expression were detected at the surface of leukocyte populations obtained from animals homozygous for the DRA*0201, DRB1*0901 haplotype. Bayesian phylogenetic analysis groups Ovar-DRA*0201 with DRA sequences derived from species within the Oryx and Alcelaphus genera rather than clustering with other ovine and caprine DRA alleles. Tests for Darwinian selection identified 10 positively selected sites on the branch leading to Ovar-DRA*0201, three of which are predicted to be associated with the binding of peptide antigen. As the Ovis, Oryx and Alcelaphus genera have not shared a common ancestor for over 30 million years, the DRA*0201 and DRB1*0901 allelic pair is likely to be of ancient origin and present in the founding population from which all contemporary domestic sheep breeds are derived. The conservation of the integrity of this unusual DR allelic pair suggests some selective advantage which is likely to be associated with the presentation of pathogen antigen to T

  19. Cloisonné kidney in mouflon sheep (Ovis orientalis musimon

    Directory of Open Access Journals (Sweden)

    Hervás, J.

    2002-12-01

    Full Text Available This study describes a case of cloisonné kidney associated with infection by Babesia ovis in a wild mouflon (Ovis orientalis musimonj found dead in year in eastern Sierra Morena (Andalusia, Spain. The major macroscopic lesions were a icteric coloration in ocular and oral mucosa, and b dark metal coloration on the kidneys' external surface. Intense dark coloration alternating with intense greyish strips was observed on renal cortex sections. Blood samples were collected for haematological and parasitological analyses, as well as samples from various organs for histopathological examination. Infection by B. ovis was confirmed by using the Polymerase Chain Reaction test (PCR. Histopathological examination revealed tubulonephrosis associated with thickening of the basal membrane of the convoluted portions of the renal tubules (both proximal and distal, which took on an intense brownish pigmentation. These renal lesions have been described as "cloisonné" kidney. Cloisonné kidneys show uncommon coloring of the renal tubular system, associated with ferritin and hemosiderin deposits in these structures resulting from a chronic hemolitic process (hemoparasites, toxins, etc.. In our case, hemolitic phenomena are associated with infection by B. ovis. The seroprevalence of this hemoparasite in wild mouflon populations in other regions of Spain (Catalonia is up to 15%.

    [fr]
    Nous étudions un cas de rein cloisonné associé à l'infection par Babesia ovis sur un mouflon sauvage (Ovis orientalis musimon qui a été trouvé la même année dans la partie orientale de la Sierra Morena (Andalousie, Espagne. Les principales lésions macroscopiques étaient: a coloration ictérique sur les muqueuses oculaire et orale, et b coloration métallique foncée sur la partie extérieure du rein. Cette coloration foncée intense alternait avec des bandes grisâtres dans les sections du cortex rénal. Nous avons pris

  20. Studies on antigenic cross-reactivity of Trichuris ovis with host mucosal antigens in goat

    OpenAIRE

    Gautam Patra; Seikh Sahanawaz Alam; Sonjoy Kumar Borthakur; Hridayesh Prasad

    2015-01-01

    Objective: To ascertain whether immunodominant antigens of Trichuris ovis might share and cross react with host molecule. Methods: Two crude protein preparations from anterior and posterior parts of Trichuris ovis were characterized along with host mucosal antigen by double immunodiffusion, sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blotting technique. Conventional scanning electron microscopy was performed as per standard procedure. Results: Sharp...

  1. The ARIES-AT advanced tokamak, Advanced technology fusion power plant

    International Nuclear Information System (INIS)

    Najmabadi, Farrokh; Abdou, A.; Bromberg, L.

    2006-01-01

    The ARIES-AT study was initiated to assess the potential of high-performance tokamak plasmas together with advanced technology in a fusion power plant and to identifying physics and technology areas with the highest leverage for achieving attractive and competitive fusion power in order to guide fusion R and D. The 1000-MWe ARIES-AT design has a major radius of 5.2 m, a minor radius of 1.3 m, a toroidal β of 9.2% (β N = 5.4) and an on-axis field of 5.6 T. The plasma current is 13 MA and the current-drive power is 35 MW. The ARIES-AT design uses the same physics basis as ARIES-RS, a reversed-shear plasma. A distinct difference between ARIES-RS and ARIES-AT plasmas is the higher plasma elongation of ARIES-AT (κ x = 2.2) which is the result of a 'thinner' blanket leading to a large increase in plasma β to 9.2% (compared to 5% for ARIES-RS) with only a slightly higher β N . ARIES-AT blanket is a simple, low-pressure design consisting of SiC composite boxes with a SiC insert for flow distribution that does not carry any structural load. The breeding coolant (Pb-17Li) enters the fusion core from the bottom, and cools the first wall while traveling in the poloidal direction to the top of the blanket module. The coolant then returns through the blanket channel at a low speed and is superheated to ∼1100 deg. C. As most of the fusion power is deposited directly into the breeding coolant, this method leads to a high coolant outlet temperature while keeping the temperature of the SiC structure as well as interface between SiC structure and Pb-17Li to about 1000 deg. C. This blanket is well matched to an advanced Brayton power cycle, leading to an overall thermal efficiency of ∼59%. The very low afterheat in SiC composites results in exceptional safety and waste disposal characteristics. All of the fusion core components qualify for shallow land burial under U.S. regulations (furthermore, ∼90% of components qualify as Class-A waste, the lowest level). The ARIES

  2. Current drive studies for the ARIES steady-state tokamak reactors

    International Nuclear Information System (INIS)

    Mau, T.K.; Ehst, D.A.; Mandrekas, J.

    1994-01-01

    Steady-state plasma operating scenarios are designed for three versions of the ARIES reactor, using non-inductive current drive techniques that have an established database. R.f. waves, including fast and lower hybrid waves, are the reference drivers for the D-T burning ARIES-I and ARIES-II/IV, while neutral beam injection is employed for ARIES-III which burns D- 3 He. Plasma equilibria with a high bootstrap-current component have been used, in order to minimize the recirculating power fraction and cost of electricity. To maintain plasma stability, the driven current profile has been aligned with that of equilibrium by proper choices of the plasma profiles and power launch parameters. Except for ARIES-III, the current-drive power requirements and the relevant technology developments are found to be quite reasonable. The wave-power spectrum and launch requirements are also considered achievable with a modest development effort. Issues such as an improved database for fast-wave current drive, lower-hybrid power coupling to the plasma edge, profile control in the plasma core, and access to the design point of operation remain to be addressed. ((orig.))

  3. Some parasitological, pathological and immunohistochemical examinations in sheep naturally infected by Trichuris Ovis

    OpenAIRE

    P. T. Iliev; A. Ivanov; Z. Kirkova; K. Hristov; K. Dinkova; J. Ananiev

    2017-01-01

    A case of Trichuris ovis infection in a lamb is presented. In June 2012 a herd of 12 infected with T. ovis lambs in Brestnik (Southern Bulgaria) were discovered. A diarrhea and loss in body weight in 2 lambs have been observed. Despite antibiotic treatment one of the animals died. Parasitological examination was done. During necropsy of the gastro-intestinal tract, adult worms in the caecum were found. Standart staining and immunohistochemistry were performed to detect the cell population in ...

  4. Brucella ovis: invasion, traffic, virulence factors and immune responseBrucella ovis: invasão, tráfego, fatores de virulência e resposta imune

    Directory of Open Access Journals (Sweden)

    João Marcelo Azevedo de Paula Antunes

    2013-06-01

    Full Text Available Brucellosis remains an economic problem in animals and public health. Worldwide ovine brucellosis caused by Brucella ovis is considered a major cause of infertility in sheep. The factors responsible for persistence of the agent in these locations are not known, as well as the mechanisms involved in immune defense and possibly the persistence of the agent. Brucella spp. induces moderate inflammatory response. The nature of the intracellular agent stimulates immune response of the type 1 helper T lymphocytes. Studies of the pathogenesis of ovine brucellosis are scarce. Recent developments have shown that the inflammatory response induced by moderate brucelas represent probably the result of an attempt to escape the immune response and suppression of host immune response. Were reviewed by the mechanisms described by brucelas and Brucella ovis for penetration into the host, escape of the immune response and the immune response generated by the infection. A brucelose permanece como problema econômico em animais e de saúde pública. Em todo o mundo a brucelose ovina ocasionada pela Brucella ovis é considerada uma das principais causas de infertilidade em ovinos. Os fatores responsáveis pela persistência do agente nestes locais não são conhecidos, bem como os mecanismos imunes envolvidos na defesa e eventualmente na persistência do agente. Brucella spp. induz resposta inflamatória moderada. A natureza intracelular do agente estimula resposta imune celular do tipo linfócito T helper 1. Os estudos de patogenia da brucelose ovina são escassos. Recentes avanços demonstraram que a resposta inflamatória moderada induzida pelas brucelas representam provavelmente o resultado de tentativa de escape da resposta imune e supressão da resposta imune hospedeira. Foram revisados os mecanismos descritos pelas brucelas e pela Brucella ovis para penetração no hospedeiro, escape da resposta imune, bem como a resposta imunológica gerada pela infecção.

  5. The role of health education in promoting acceptance of an ARI control project.

    Science.gov (United States)

    Dhar, G M

    1993-01-01

    In India, acute respiratory infection (ARI) is responsible for 20% of all annual deaths of children under 5 years old (600,000-800,000 deaths). Children have from 3 to 5 ARI episodes a year. Thus, it is important to inform communities about ARI prevention and control. Health education activities of ARI control projects should convey knowledge, improve attitudes, and encourage health-inducing practices in such a way that a community should voluntarily assume responsibility to actively prevent and control ARI in children. These activities should empower communities to identify and report ARI in children, provide home care and supportive therapy, use the UIP cover to protect all infants, promote breast feeding, reduce indoor air pollution, and cooperate with health workers in ARI control as well as use oral rehydration therapy as soon as diarrhea starts. To design an effective health education program, planners need to interview a sample of the local population to learn the people's knowledge, attitudes, and practices toward ARI in children. Any ARI health education program should also include UIP, oral rehydration therapy, maternal and child health, and family welfare. The health educator can use 1 or more educational methods. Discussion is a 2-way process of exchanging ideas and should raise questions about ARI control, provide answers, and yield solutions. If an educator chooses the demonstration method, he or she should take the target audience to a health facility so the staff can demonstrate the clinical signs of a child with ARI, including the fast breathing, chest indrawing, cyanosis, wheezing, and stridor. The display method involves audiovisual aids, such as posters, puppet shows, and films. The health educator can use any of these methods when dealing with individuals, groups, or crowds. He or she must attune the approach and materials to the values of the community and present them so the individual can readily adapt the messages into his or her way of

  6. Virtual Array Receiver Options for 64-ary Pulse Position Modulation (PPM)

    Energy Technology Data Exchange (ETDEWEB)

    Mendez, A J; Hernandez, V J; Gagliardi, R M; Bennett, C V

    2009-01-12

    NASA is developing technology for 64 64-ary PPM using relatively large PPM time slots (10 ns) an and relatively simple d electronic electronic-based receiver logic. In this paper we describe photonic photonics-based receiver options for the case of much higher data rates and inherently shorter decision times. The receivers take the form of virtual ( array or quadrant) arrays with associated comparison tests. Previously we explored this concept for 4-ary and 16-ary PPM at data rates of up to 10 Gb/s. The lessons learned are applied to the case of 64 64-ary PPM at 1.25 Gb/s s. Various receiver designs are compare, and t the optimum design, based on virtual array he arrays, is s, evaluated using numerical simulations.

  7. Gene Expression Profiling and Association with Prion-Related Lesions in the Medulla Oblongata of Symptomatic Natural Scrapie Animals

    Science.gov (United States)

    Filali, Hicham; Martin-Burriel, Inmaculada; Harders, Frank; Varona, Luis; Lyahyai, Jaber; Zaragoza, Pilar; Pumarola, Martí; Badiola, Juan J.; Bossers, Alex; Bolea, Rosa

    2011-01-01

    The pathogenesis of natural scrapie and other prion diseases remains unclear. Examining transcriptome variations in infected versus control animals may highlight new genes potentially involved in some of the molecular mechanisms of prion-induced pathology. The aim of this work was to identify disease-associated alterations in the gene expression profiles of the caudal medulla oblongata (MO) in sheep presenting the symptomatic phase of natural scrapie. The gene expression patterns in the MO from 7 sheep that had been naturally infected with scrapie were compared with 6 controls using a Central Veterinary Institute (CVI) custom designed 4×44K microarray. The microarray consisted of a probe set on the previously sequenced ovine tissue library by CVI and was supplemented with all of the Ovis aries transcripts that are currently publicly available. Over 350 probe sets displayed greater than 2-fold changes in expression. We identified 148 genes from these probes, many of which encode proteins that are involved in the immune response, ion transport, cell adhesion, and transcription. Our results confirm previously published gene expression changes that were observed in murine models with induced scrapie. Moreover, we have identified new genes that exhibit differential expression in scrapie and could be involved in prion neuropathology. Finally, we have investigated the relationship between gene expression profiles and the appearance of the main scrapie-related lesions, including prion protein deposition, gliosis and spongiosis. In this context, the potential impacts of these gene expression changes in the MO on scrapie development are discussed. PMID:21629698

  8. NPS ARIES Forward Look Sonar Integration

    National Research Council Canada - National Science Library

    Healey, A. J; Horner, D. P

    2004-01-01

    This work integrated an experimental Blazed Array Forward Looking Sonar (FLS) developed by the University of Washington, Applied Physics Laboratories into the ARIES autonomous underwater vehicle (AUV...

  9. Safety analyses of the ARIES tokamak reactor designs

    International Nuclear Information System (INIS)

    Herring, J.S.; McCarthy, K.A.; Dolan, T.J.

    1994-01-01

    The ARIES design has sought to maximize environmental and safety advantages of fusion through careful selection of materials and design. The ARIES-I tokamak reactor design consists of an SiC composite structure for the first wall and blanket, cooled by 10MPa helium. The breeder is Li 2 ZrO 3 . The divertor consists of SiC composite tubes coated with 2mm tungsten. Loss-of-cooling accident (LOCA) calculations indicate maximum temperatures will not cause damage if the plasma is promptly extinguished. The ARIES-II design includes liquid lithium and vanadium, both of which have low activation, multiple barriers between the lithium and air and an inert cover gas to prevent lithium-air reactions. The ARIES-II reactor is passively safe with a total 1km early dose of about 88rem (0.88Sv). ARIES-III was an extensive examination of the viability of a D- 3 He fueled tokamak power reactor. Because neutrons are produced only through side reactions (D+D→ 3 He+n, and D+D→T+p followed by D+T→ 4 He+n), the reactor has a reduced activation of the first wall and shield, low afterheat and class A or C low level waste disposal. Since no tritium is required for operation, no lithium-containing breeding blanket is necessary. We modeled a LOCA in which the organic coolant was burning in order to estimate the amount of radionuclides released from the first wall. Because the maximum temperature is low, below 600 C, release fractions are small. We analyzed the disposition of the 20g per day of tritium that is produced by D-D reactions and removed by vacuum pumps. The ARIES-IV coolant is helium and the breeder is lithium oxide. The structure is silicon carbide. Since the neutron multiplier, beryllium metal, is combustible, releasing about 60MJkg -1 , beryllium is the chief source of chemical energy. Less than 10% of the 24 Na inventory is likely to diffuse out of the SiC during a fire in which the beryllium is consumed. Therefore, the offsite dose would be less than 200rem. ((orig.))

  10. The size of domestic cattle, sheep, goats and pigs in the Czech Neolithic and Eneolithic Periods: Temporal variations and their causes

    Czech Academy of Sciences Publication Activity Database

    Kyselý, René

    2016-01-01

    Roč. 25, Junio (2016), s. 33-78 ISSN 1132-6891 Institutional support: RVO:67985912 Keywords : osteometry * body mass * domestication * cross-breeding * Chalcolithic * Bos taurus * Ovis aries * Capra hircus * Sus domesticus * aurochs * wild boar * archaeozoology Subject RIV: AC - Archeology, Anthropology, Ethnology

  11. Some parasitological, pathological and immunohistochemical examinations in sheep naturally infected by Trichuris Ovis

    Directory of Open Access Journals (Sweden)

    P. T. Iliev

    2017-06-01

    Full Text Available A case of Trichuris ovis infection in a lamb is presented. In June 2012 a herd of 12 infected with T. ovis lambs in Brestnik (Southern Bulgaria were discovered. A diarrhea and loss in body weight in 2 lambs have been observed. Despite antibiotic treatment one of the animals died. Parasitological examination was done. During necropsy of the gastro-intestinal tract, adult worms in the caecum were found. Standart staining and immunohistochemistry were performed to detect the cell population in the affected areas of the caecum

  12. Physico-chemical and biological studies on water from Aries River (Romania).

    Science.gov (United States)

    Butiuc-Keul, A; Momeu, L; Craciunas, C; Dobrota, C; Cuna, S; Balas, G

    2012-03-01

    Our work was focused on physico-chemical and biological characteristics of Aries River, one of the largest rivers from Romania. Water samples were collected from 11 sites along Aries River course. We have measured de (18)O and D isotopic composition of Aries River water in these locations and correlated these data with the isotopic composition of aquatic plants and with the pollution degree. Some ions from Aries River water were also analyzed: NO(3)(-), NO(2)(-), PO(4)(3-) Cu(2+), Fe(3+). Analysis of diatom communities has been performed in order to quantify the level of water pollution of Aries River. All physico-chemical analyses revealed that the most polluted site is Abrud; the source of pollution is most probably the mining enterprise from Rosia Montana. Water isotope content increases from upstream to downstream of the locations analyzed. The structure of diatom communities is strongly influenced by the different pollution sources from this area: mine waters, industrial waters, waste products, land cleaning, tourism etc. The water eutrophication increases from upstream of Campeni to downstream of Campia Turzii. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. The ARIES-I tokamak reactor study

    International Nuclear Information System (INIS)

    1991-01-01

    This report discusses the following topics on the Aries-I Tokamak: Design description; systems studies and economics; reactor plasma physics; magnet engineering; fusion-power-ore engineering; and environmental and safety features

  14. From Monologue to Dialogue: Natural Language Generation in OVIS

    NARCIS (Netherlands)

    Theune, Mariet; Freedman, R.; Callaway, C.

    This paper describes how a language generation system that was originally designed for monologue generation, has been adapted for use in the OVIS spoken dialogue system. To meet the requirement that in a dialogue, the system’s utterances should make up a single, coherent dialogue turn, several

  15. Marginal costs of abating greenhouse gases in the global ruminant livestock sector

    NARCIS (Netherlands)

    Henderson, B.; Falcucci, A.; Early, L.; Gerber, P.J.

    2017-01-01

    Livestock [inclusive of ruminant species, namely cattle (Bos Taurus and Bos indicus), sheep (Ovis aries), goats (Capra hircus), and buffaloes (Bubalus bubalis), and non-ruminant species, namely pigs (Sus scrofa domesticus) and chickens (Gallus domesticus)] are both affected by climate change and

  16. ARIES-I Fusion-Power-Core Engineering

    International Nuclear Information System (INIS)

    Sharafat, S.; Najmabadi, F.; Wong, C.P.C.

    1991-01-01

    The ARIES research program is a multi-institutional project, the goal of which is to determine the economic, safety, and environmental potential of tokamak fusion reactors. The ARIES-I steady-state tokamak reactor is a conceptual, DT-burning, 1000 MWe reactor with a major radius of 6.75 m, a minor radius of 1.5 m, and an average neutron wall loading of 2.5 MW/m 2 . The ARIES-I plasma operates in the first MHD stability regime with a toroidal beta of 1.9%. The choice to operate in the first stability regime, with a high aspect ratio and with a low plasma current, leads to the need for high magnetic field to achieve adequate fusion power density (β 2 B 4 ). The toroidal field at the plasma center is 11 T and the maximum field at the coil is 21 T. Nonetheless, it is found that the maximum stress in the structural material of these magnets is ∝700 MPa and industrially available alloys can be used. The impurity-control and particle-exhaust system is based on a high recycling double-null divertor system. The low-activation silicon-carbide (SiC) composite is used as structural material. The breeder material, Li 2 ZrO 3 , and the multiplier material, Be, are both sphere-packed between poloidally nested SiC-composite shells. The divertor plates consist of SiC-composite tube shells protected with 2 mm-thick tungsten armor. The first wall, blanket, shield, and divertor are all helium cooled with an inlet coolant temperature of 350deg C at a pressure of 10 MPa. The high helium-outlet temperature of 650deg C ensures a relatively high gross thermal efficiency of 49%. The ARIES-I design has demonstrated that tokamak reactors have the potential to achieve a high level of safety coupled with a Class-C waste-disposal rating. (orig.)

  17. ARIES-III divertor engineering design

    International Nuclear Information System (INIS)

    Wong, C.P.C.; Schultz, K.R.; Cheng, E.T.; Grotz, S.; Hasan, M.A.; Najmabadi, F.; Sharafat, S.; Herring, J.S.; Valenti, M.; Steiner, D.

    1992-01-01

    This paper reports the engineering design of the ARIES-III double- null divertor. The divertor coolant tubes are made from W-3Re alloy and cooled by subcooled flow boiling of organic coolant. A coating of 4 mm thick tungsten is plasma sprayed onto the divertor surface. This W layer can withstand the thermal deposition of a few disruptions. At a maximum surface heat flux of 5.4 MW/m 2 , a conventional divertor design can be used. The divertor surface is contoured to have a constant heat flux of 5.4 MW/m 2 . The net erosion of the W-surface was found to be negligible at about 0.1 mm/year. After 3 years of operation, the W-3Re alloy ARIES-III divertor can be disposed of as Class A waste. In order to control the prompt dose release at site boundary to less than 200 Rem, isotopic tailoring of the W-alloy will be needed

  18. ARIES-III divertor engineering design

    Energy Technology Data Exchange (ETDEWEB)

    Wong, C.P.C.; Schultz, K.R. [General Atomics, San Diego, CA (United States); Cheng, E.T. [TSI Research, Solana Beach, CA (United States); Grotz, S.; Hasan, M.A.; Najmabadi, F.; Sharafat, S. [California Univ., Los Angeles, CA (United States). Dept. of Mechanical, Aerospace and Nuclear Engineering; Brooks, J.N.; Ehst, D.A.; Sze, D.K. [Argonne National Lab., IL (United States); Herring, J.S. [EG and G Idaho, Inc., Idaho Falls, ID (United States); Valenti, M.; Steiner, D. [Rensselaer Polytechnic Inst., Troy, NY (United States). Plasma Dynamics Lab.

    1992-01-01

    This paper reports the engineering design of the ARIES-III double- null divertor. The divertor coolant tubes are made from W-3Re alloy and cooled by subcooled flow boiling of organic coolant. A coating of 4 mm thick tungsten is plasma sprayed onto the divertor surface. This W layer can withstand the thermal deposition of a few disruptions. At a maximum surface heat flux of 5.4 MW/m{sup 2}, a conventional divertor design can be used. The divertor surface is contoured to have a constant heat flux of 5.4 MW/m{sup 2}. The net erosion of the W-surface was found to be negligible at about 0.1 mm/year. After 3 years of operation, the W-3Re alloy ARIES-III divertor can be disposed of as Class A waste. In order to control the prompt dose release at site boundary to less than 200 Rem, isotopic tailoring of the W-alloy will be needed.

  19. Micropropagation of caçari under different nutritive culture media ...

    African Journals Online (AJOL)

    The caçari (Myrciaria dubia) is a native fruit tree from Amazon with high concentrations of vitamin C. This study aimed to adjust a culture medium that meets the nutritional needs for the in vitro development of caçari, evaluating the effect of different concentrations and nutritive culture media, antioxidant, and levels of agar and ...

  20. Novel immune-modulator identified by a rapid, functional screen of the parapoxvirus ovis (Orf virus genome

    Directory of Open Access Journals (Sweden)

    McGuire Michael J

    2012-01-01

    Full Text Available Abstract Background The success of new sequencing technologies and informatic methods for identifying genes has made establishing gene product function a critical rate limiting step in progressing the molecular sciences. We present a method to functionally mine genomes for useful activities in vivo, using an unusual property of a member of the poxvirus family to demonstrate this screening approach. Results The genome of Parapoxvirus ovis (Orf virus was sequenced, annotated, and then used to PCR-amplify its open-reading-frames. Employing a cloning-independent protocol, a viral expression-library was rapidly built and arrayed into sub-library pools. These were directly delivered into mice as expressible cassettes and assayed for an immune-modulating activity associated with parapoxvirus infection. The product of the B2L gene, a homolog of vaccinia F13L, was identified as the factor eliciting immune cell accumulation at sites of skin inoculation. Administration of purified B2 protein also elicited immune cell accumulation activity, and additionally was found to serve as an adjuvant for antigen-specific responses. Co-delivery of the B2L gene with an influenza gene-vaccine significantly improved protection in mice. Furthermore, delivery of the B2L expression construct, without antigen, non-specifically reduced tumor growth in murine models of cancer. Conclusion A streamlined, functional approach to genome-wide screening of a biological activity in vivo is presented. Its application to screening in mice for an immune activity elicited by the pathogen genome of Parapoxvirus ovis yielded a novel immunomodulator. In this inverted discovery method, it was possible to identify the adjuvant responsible for a function of interest prior to a mechanistic study of the adjuvant. The non-specific immune activity of this modulator, B2, is similar to that associated with administration of inactivated particles to a host or to a live viral infection. Administration

  1. Engineering design of the Aries-IV gaseous divertor

    International Nuclear Information System (INIS)

    Hasan, M.Z.; Najmabadi, F.; Sharafat, S.

    1994-01-01

    ARIES-IV is a conceptual, D-T burning, steady-state tokamak fusion reactor producing 1000 MWe net. It operates in the second plasma stability regime. The structural material is SiC composite and the primary coolant is helium at 10MPa base pressure. ARIES-IV uses double-null divertors for particle control. Total thermal power recovered from the divertors is 425MW, which is 16% of the total reactor thermal power. Among the desirable goals of divertor design were to avoid the use of tungsten and to use the same structural material and primary coolant as in the blanket design. In order to reduce peak heat flux, the innovative gaseous divertor has been used in ARIES-IV. A gaseous divertor reduces peak heat flux by increasing the surface area and by distributing particle and radiation energy more uniformly. Another benefit of gaseous divertor is the reduction of plasma temperature in the divertor chamber, so that material erosion due to sputtering, can be diminished. This makes the use of low-Z material possible in a gaseous divertor

  2. Superconducting poloidal field magnet engineering for the ARIES-ST

    International Nuclear Information System (INIS)

    Bromberg, Leslie; Pourrahimi, S.; Schultz, J.H.; Titus, P.; Jardin, S.; Kessel, C.; Reiersen, W.

    2003-01-01

    The critical issues of the poloidal systems for the ARIES-ST design have been presented in this paper. Because of the large plasma current and the need of highly shaped plasmas, the poloidal field (PF) coils should be located inside the toroidal field in order to reduce their current. Even then, the divertor coils carry large currents. The ARIES-ST PF coils are superconducting using the internally cooled cable-in-conduit conductor. The peak self field in the divertor coils is about 15 T and the highest field in the non-divertor coils is about 6 T. The PF magnets have built-in margins that are sufficient to survive disruptions without quenching. The costing study indicates that the specific cost of the PF system is $80/kg. Detailed design and trade-off studies of ARIES-ST are presented and remaining R and D issues are identified

  3. ARIES: System for Health effects Assessment in industrial risk

    Energy Technology Data Exchange (ETDEWEB)

    Rabago, I.; Vidania, R. de; Inmaculada, S.

    1992-07-01

    In this work we present a general description of ARIES*, a tool designed in order to support the assessment of expected health effects derived from an accidental release of toxic compounds. ARIES includes two sequential and complementary steps. The first one (a quantitative phase) is being developed. for inhalation exposures, using numerical models, empirical correlations, physiological parameters and toxicological index, to estimate short term consequences over the exposed population. Next it will be published a new report were It will be described with detail the procedure designed to the quantitative assessment of the exposure. The system starts the assessment process with values of external concentrations which are processed, together with different exposure values (existing for humans and scaled up irom animals), as inputs for different kinds of models. From these, and other physiological values ARIES calculates the inhaled equivalent doses and the expected associated effects as a function of the exposure limes. Once overcome this first step, ARIES is complemented with an additional system that executes the selection of relevant information from toxicological data bases (qualitative phase). The system works , applying a string of filters and searches that displays selected Information, giving an additional support to the assessment. Both steps, just referred, are integrated into a logical informatics support. The informatics code is developed in dbase language even for the design of the procedure as for the mathematical models linked to the system ( extrapolation, dose inhaled models, etc.) to execute the numerical analysis of the assessment. The system has been designed in order to include progressively new chemicals and the improvements obtained in the development of mathematical models related with dose-effect relationships. At this moment, is programmed a first prototype of ARIES that can be executed in PC's and it can run for several products

  4. ARIES: System for Health effects Assessment in industrial risk

    Energy Technology Data Exchange (ETDEWEB)

    Rabago, I; Vidania, R de; Inmaculada, S

    1992-07-01

    In this work we present a general description of ARIES*, a tool designed in order to support the assessment of expected health effects derived from an accidental release of toxic compounds. ARIES includes two sequential and complementary steps. The first one (a quantitative phase) is being developed. for inhalation exposures, using numerical models, empirical correlations, physiological parameters and toxicological index, to estimate short term consequences over the exposed population. Next it will be published a new report were It will be described with detail the procedure designed to the quantitative assessment of the exposure. The system starts the assessment process with values of external concentrations which are processed, together with different exposure values (existing for humans and scaled up irom animals), as inputs for different kinds of models. From these, and other physiological values ARIES calculates the inhaled equivalent doses and the expected associated effects as a function of the exposure limes. Once overcome this first step, ARIES is complemented with an additional system that executes the selection of relevant information from toxicological data bases (qualitative phase). The system works , applying a string of filters and searches that displays selected Information, giving an additional support to the assessment. Both steps, just referred, are integrated into a logical informatics support. The informatics code is developed in dbase language even for the design of the procedure as for the mathematical models linked to the system ( extrapolation, dose inhaled models, etc.) to execute the numerical analysis of the assessment. The system has been designed in order to include progressively new chemicals and the improvements obtained in the development of mathematical models related with dose-effect relationships. At this moment, is programmed a first prototype of ARIES that can be executed in PC's and it can run for several products

  5. ARIES: System for Health effects Assessment in industrial risk

    International Nuclear Information System (INIS)

    Rabago, I.; Vidania, R. de; Inmaculada, S.

    1992-01-01

    In this work we present a general description of ARIES*, a tool designed in order to support the assessment of expected health effects derived from an accidental release of toxic compounds. ARIES includes two sequential and complementary steps. The first one (a quantitative phase) is being developed. for inhalation exposures, using numerical models, empirical correlations, physiological parameters and toxicological index, to estimate short term consequences over the exposed population. Next it will be published a new report were It will be described with detail the procedure designed to the quantitative assessment of the exposure. The system starts the assessment process with values of external concentrations which are processed, together with different exposure values (existing for humans and scaled up irom animals), as inputs for different kinds of models. From these, and other physiological values ARIES calculates the inhaled equivalent doses and the expected associated effects as a function of the exposure limes. Once overcome this first step, ARIES is complemented with an additional system that executes the selection of relevant information from toxicological data bases (qualitative phase). The system works , applying a string of filters and searches that displays selected Information, giving an additional support to the assessment. Both steps, just referred, are integrated into a logical informatics support. The informatics code is developed in dbase language even for the design of the procedure as for the mathematical models linked to the system ( extrapolation, dose inhaled models, etc.) to execute the numerical analysis of the assessment. The system has been designed in order to include progressively new chemicals and the improvements obtained in the development of mathematical models related with dose-effect relationships. At this moment, is programmed a first prototype of ARIES that can be executed in PC's and it can run for several products

  6. Novel Detection of Coxiella spp., Theileria luwenshuni, and T. ovis Endosymbionts in Deer Keds (Lipoptena fortisetosa.

    Directory of Open Access Journals (Sweden)

    Seung-Hun Lee

    Full Text Available We describe for the first time the detection of Coxiella-like bacteria (CLB, Theileria luwenshuni, and T. ovis endosymbionts in blood-sucking deer keds. Eight deer keds attached to a Korean water deer were identified as Lipoptena fortisetosa (Diptera: Hippoboscidae by morphological and genetic analyses. Among the endosymbionts assessed, CLB, Theileria luwenshuni, and T. ovis were identified in L. fortisetosa by PCR and nucleotide sequencing. Based on phylogeny, CLB 16S rRNA sequences were classified into clade B, sharing 99.4% identity with CLB from Haemaphysalis longicornis in South Korea. Although the virulence of CLB to vertebrates is still controversial, several studies have reported clinical symptoms in birds due to CLB infections. The 18S rRNA sequences of T. luwenshuni and T. ovis in this study were 98.8-100% identical to those in GenBank, and all of the obtained sequences of T. ovis and T. luwenshuni in this study were 100% identical to each other, respectively. Although further studies are required to positively confirm L. fortisetosa as a biological vector of these pathogens, strong genetic relationships among sequences from this and previous studies suggest potential transmission among mammalian hosts by ticks and keds.

  7. Undergraduate Observations of Separation and Position Angle of Double Stars WDS J05460+2119AB (ARY 6AD and ARY 6 AE) at Manzanita Observatory (Abstract)

    Science.gov (United States)

    HOffert, M. J.; Weise, E.; Clow, J.; Hirzel, J.; Leeder, B.; Molyneux, S.; Scutti, N.; Spartalis, S.; Takuhara, C.

    2014-12-01

    (Abstract only) Six beginning astronomy students, part of an undergraduate stellar astronomy course, one advanced undergraduate student assistant, and a professor measured the position angles and separations of Washington Double Stars (WDS) J05460+2119 (= WDS J05460+2119AB; also known as ARY 6 AD and ARY 6 AE). The measurements were made at the Manzanita Observatory (116º 20' 42" W, 32º 44' 5" N) of the Tierra Astronomical Institute on 10 Blackwood Road in Boulevard, California (www.youtube.com/watch?v=BHVdeMGBGDU), at an elevation of 4,500 ft. A Celestron 11-inch HD Edge telescope was used to measure the position angles and separations of ARY 6 AD and ARY 6 AE. The averages of our measurements are as follows: separation AD: trial 1 124.1 arcseconds and trial 2 124.5 arcseconds; separation AE: trial 1 73.3 arcseconds and trial 2 73.8 arcseconds. The averages of positon angle for AD: trial 1 159.9 degrees and trial 2 161.3 degrees, for AE: trial 1 232.6 degrees and trial 2 233.7 degrees.

  8. The anthelmintic efficacy of fenbendazole in the control of Moniezia expansa and Trichuris ovis in sheep.

    Science.gov (United States)

    Townsend, R B; Kelly, J D; James, R; Weston, I

    1977-11-01

    The anthelmintic efficacy of fenbendazole (methyl 5-(phenyl-thio)-2-benzimidazole-carbamate) against Moniezia expansa and Trichuris ovis was tested. At dose rates of 5 mg per kg and above, efficacies were found to be greater than 91 percent against M expansa and greater than 92 per cent against T ovis. At these dose rates efficacy on egg suppression was 100 per cent for Moniezia and greater than 97 per cent for Trichuris.

  9. The power and pain of market-based carbon policies

    NARCIS (Netherlands)

    Henderson, B.; Golub, A.; Pambudi, D.; Hertel, T.; Godde, C.; Herrero, M.; Cacho, O.; Gerber, P.

    2018-01-01

    The objectives of this research are to assess the greenhouse gas mitigation potential of carbon policies applied to the ruminant livestock sector [inclusive of the major ruminant species—cattle (Bos Taurus and Bos indicus), sheep (Ovis aries), and goats (Capra hircus)]—with particular emphasis on

  10. Overview of the ARIES-RS reversed-shear tokamak power plant study

    International Nuclear Information System (INIS)

    Najmabadi, F.; Billone, M.C.

    1997-01-01

    The ARIES-RS tokamak is a conceptual, D-T-burning 1000 MWe power plant. As with earlier ARIES design studies, the final design of ARIES-RS was obtained in a self-consistent manner using the best available physics and engineering models. Detailed analyses of individual systems together with system interfaces and interactions were incorporated into the ARIES systems code in order to assure self-consistency and to optimize towards the lowest cost system. The ARIES-RS design operates with a reversed-shear plasma and employs a moderate aspect ratio (A=4.0). The plasma current is relatively low (I p =11.32 MA) and bootstrap current fraction is high (f BC =0.88). Consequently, the auxiliary power required for RF current drive is relatively low (∝80 MW). At the same time, the average toroidal beta is high (β=5%), providing power densities near practical engineering limits (the peak neutron wall loading is 5.7 MW m -2 ). The toroidal-field (TF) coil system is designed with relatively 'conventional' materials (Nb 3 Sn and NbTi conductor with 316SS structures), and is operated at a design limit of ∝16 T at the coil in order to optimize the design point. The ARIES-RS design uses a self-cooled lithium blanket with vanadium alloy as the structural material. The V-alloy has low activation, low afterheat, high temperature capability and can handle high heat flux. A self-cooled liquid lithium blanket is simple, and with the development of an insulating coating, has low operating pressure. Also, this blanket gives excellent neutronics performance. Detailed analysis has been performed to minimize the cost and maximize the performance of the blanket and shield. (orig.)

  11. HpARI Protein Secreted by a Helminth Parasite Suppresses Interleukin-33.

    Science.gov (United States)

    Osbourn, Megan; Soares, Dinesh C; Vacca, Francesco; Cohen, E Suzanne; Scott, Ian C; Gregory, William F; Smyth, Danielle J; Toivakka, Matilda; Kemter, Andrea M; le Bihan, Thierry; Wear, Martin; Hoving, Dennis; Filbey, Kara J; Hewitson, James P; Henderson, Holly; Gonzàlez-Cìscar, Andrea; Errington, Claire; Vermeren, Sonja; Astier, Anne L; Wallace, William A; Schwarze, Jürgen; Ivens, Alasdair C; Maizels, Rick M; McSorley, Henry J

    2017-10-17

    Infection by helminth parasites is associated with amelioration of allergic reactivity, but mechanistic insights into this association are lacking. Products secreted by the mouse parasite Heligmosomoides polygyrus suppress type 2 (allergic) immune responses through interference in the interleukin-33 (IL-33) pathway. Here, we identified H. polygyrus Alarmin Release Inhibitor (HpARI), an IL-33-suppressive 26-kDa protein, containing three predicted complement control protein (CCP) modules. In vivo, recombinant HpARI abrogated IL-33, group 2 innate lymphoid cell (ILC2) and eosinophilic responses to Alternaria allergen administration, and diminished eosinophilic responses to Nippostrongylus brasiliensis, increasing parasite burden. HpARI bound directly to both mouse and human IL-33 (in the cytokine's activated state) and also to nuclear DNA via its N-terminal CCP module pair (CCP1/2), tethering active IL-33 within necrotic cells, preventing its release, and forestalling initiation of type 2 allergic responses. Thus, HpARI employs a novel molecular strategy to suppress type 2 immunity in both infection and allergy. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. Advanced Recovery and Integrated Extraction System (ARIES) program plan. Rev. 1

    International Nuclear Information System (INIS)

    Nelson, T.O.; Massey, P.W.; Cremers, T.L.

    1996-01-01

    The Advanced Recovery and Integrated Extraction System (ARIES) demonstration combines various technologies, some of which were/are being developed under previous/other Department of Energy (DOE) funded programs. ARIES is an overall processing system for the dismantlement of nuclear weapon primaries. The program will demonstrate dismantlement of nuclear weapons and retrieval of the plutonium into a form that is compatible with long term storage and that is inspectable in an unclassified form appropriate for the application of traditional international safeguards. The success of the ARIES demonstration would lead to the development of a transportable modular or other facility type systems for weapons dismantlement to be used at other DOE sites as well as in other countries

  13. Influence of some plant extracts on the ovi-position behavior of Aedes fluviatilis and Culex quinquifasciatus

    Directory of Open Access Journals (Sweden)

    Abdulhakim A. El Maghrbi

    2014-06-01

    Full Text Available Alcoholic/acetone extracts of nine species of plants (Allium tuberosum, Apium leptophylum, Carica papaya, Cymbopogon citratus, Euphorbia cotinofolia, Melia azedarach, Ocimum canum, Ricinus communis and Tagetes erecta were tested in respect to their influence on the ovi-position behavior of the mosquito, Aedes fluviatilis and Culex quinquifasciatus in concentrations of 100, 10 and 1 mg/L. Three days after mosquito females had fed on blood of anesthetized mice and pigeon respectively, experimental and control dishes were placed into cages for 24 h then number of eggs laid in each dish was counted. Alcoholic/acetone extracts of C. papaya, C. citratus and T. erecta at 100 mg/L; E. cotinofolia and O. canum at 100 and 10 mg/L were proved to be repulsive for ovi-position of Ae. fluviatilis. On the other hand, acetone extracts of A. tuberosum and M. azederach at 100 and 10 mg/L; A. leptophyllum, O. canum, E. cotinofolia and R. communis at 100 mg/L produced same effect on ovi-position behavior of Ae. fluviatilis. Alcoholic extracts E. cotinofolia, R. communis (100 mg/L and M. azedarach (100 and 10 mg/L were attractive to Cx. quinquifasciatus. Five acetone extracts (A. tuberosum, A. leptophylum, C. papaya, C. Citrates and M. azedarach were repulsive for ovi-position at 100 mg/L. Acetone extract of A. tuberosum and M. azedarach at 10 and 1 mg/L and C. citratus at 10 mg/L maintained the same properties. Our results concluded that each plant extract has the potential to control ovi-position behavior of mosquito. The differences in obtained responses necessitate the adoption of deeper research to isolate the active principle of such plants for potential use in mosquito control program.

  14. Enhanced 2/3 four-ary modulation code using soft-decision Viterbi decoding for four-level holographic data storage systems

    Science.gov (United States)

    Kong, Gyuyeol; Choi, Sooyong

    2017-09-01

    An enhanced 2/3 four-ary modulation code using soft-decision Viterbi decoding is proposed for four-level holographic data storage systems. While the previous four-ary modulation codes focus on preventing maximum two-dimensional intersymbol interference patterns, the proposed four-ary modulation code aims at maximizing the coding gains for better bit error rate performances. For achieving significant coding gains from the four-ary modulation codes, we design a new 2/3 four-ary modulation code in order to enlarge the free distance on the trellis through extensive simulation. The free distance of the proposed four-ary modulation code is extended from 1.21 to 2.04 compared with that of the conventional four-ary modulation code. The simulation result shows that the proposed four-ary modulation code has more than 1 dB gains compared with the conventional four-ary modulation code.

  15. Aries: system for health effects assessment in industrial Risk

    International Nuclear Information System (INIS)

    Rabago, I.; Vidania, R. de; Sierra, I.

    1992-01-01

    In this word we present a general description of ARIES*, a tool designed in order to support the assessment of expected heath derived from an accidental release of toxic compounds. ARIES includes two secuential and complementary steps. the first one (a quantitative phase) is being developed, for inhalation exposures, using numerical models, empirical correlations, physiological parameters and toxicological index, to estimate short term consequences over the exposed population. Next it will be published a new report were it will be described with detail the procedure designed for the quantitative published a new report were it will be described with detail the procedure designed for the quantitative assessment of the exposure. the system starts the assessment process with values of external concentrations which are processed, together with different exposure values (existing for humans and scaled up from animals), as inputs for different kinds of models. from these, and other physilogical values ARIES calculates the inhaled equivalent doses and the expected associated effects as a function of the exposure times. Once overcome this first step, ARIES is complemented with an additional system that executes the selection of relevant information from toxicological data bases (qualitative phase). The system works applying a string of filters and searches that displays selected information, giving and additional support to the assessment. Both steps, just refered, are integrated into a logical informatic support. The informatic code is developed in dbase languaje even for the design of the procedure as for the mathematical models linked to the system (extrapolation, dose inhaled models, etc) to execute the numerical analisys of the assessment. The system has been designed in order to include progressively new chemicals and the improvements obtained in the development of mathematical models related with dose-effect relationships. At this moment, is programmed a first

  16. Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams

    Directory of Open Access Journals (Sweden)

    L.F. Costa

    2013-02-01

    Full Text Available The aim of the present study was to evaluate a species-specific nested PCR based on a previously described species-specific PCR for detection of B. ovis in semen and urine samples of experimentally infected rams. The performance of the species-specific nested PCR was compared with the results of a genus-specific PCR. Fourteen rams were experimentally infected with the Brucella ovis REO 198 strain and samples of semen and urine were collected every week up to 180 days post infection. Out of 83 semen samples collected, 42 (50.6% were positive for the species-specific nested PCR, and 23 (27.7% were positive for the genus-specific PCR. Out of 75 urine samples, 49 (65.3% were positive for the species-specific nested PCR, whereas 11 (14.6% were genus-specific PCR positive. Species-specific nested PCR was significantly more sensitive (P<0.001 than the genus-specific PCR in semen and urine from experimentally infected rams. In conclusion, the species-specific nested PCR developed in this study may be used as a diagnostic tool for the detection of B. ovis in semen and urine samples from suspected rams.

  17. The Sheep Genome Illuminates Biology of the Rumen and Lipid Metabolism

    Science.gov (United States)

    Talbot, Richard; Maddox, Jillian F.; Faraut, Thomas; Wu, Chunhua; Muzny, Donna M.; Li, Yuxiang; Zhang, Wenguang; Stanton, Jo-Ann; Brauning, Rudiger; Barris, Wesley C.; Hourlier, Thibaut; Aken, Bronwen L.; Searle, Stephen M.J.; Adelson, David L.; Bian, Chao; Cam, Graham R.; Chen, Yulin; Cheng, Shifeng; DeSilva, Udaya; Dixen, Karen; Dong, Yang; Fan, Guangyi; Franklin, Ian R.; Fu, Shaoyin; Guan, Rui; Highland, Margaret A.; Holder, Michael E.; Huang, Guodong; Ingham, Aaron B.; Jhangiani, Shalini N.; Kalra, Divya; Kovar, Christie L.; Lee, Sandra L.; Liu, Weiqing; Liu, Xin; Lu, Changxin; Lv, Tian; Mathew, Tittu; McWilliam, Sean; Menzies, Moira; Pan, Shengkai; Robelin, David; Servin, Bertrand; Townley, David; Wang, Wenliang; Wei, Bin; White, Stephen N.; Yang, Xinhua; Ye, Chen; Yue, Yaojing; Zeng, Peng; Zhou, Qing; Hansen, Jacob B.; Kristensen, Karsten; Gibbs, Richard A.; Flicek, Paul; Warkup, Christopher C.; Jones, Huw E.; Oddy, V. Hutton; Nicholas, Frank W.; McEwan, John C.; Kijas, James; Wang, Jun; Worley, Kim C.; Archibald, Alan L.; Cockett, Noelle; Xu, Xun; Wang, Wen; Dalrymple, Brian P.

    2014-01-01

    Sheep (Ovis aries) are a major source of meat, milk and fiber in the form of wool, and represent a distinct class of animals that have a specialized digestive organ, the rumen, which carries out the initial digestion of plant material. We have developed and analyzed a high quality reference sheep genome and transcriptomes from 40 different tissues. We identified highly expressed genes encoding keratin cross-linking proteins associated with rumen evolution. We also identified genes involved in lipid metabolism that had been amplified and/or had altered tissue expression patterns. This may be in response to changes in the barrier lipids of the skin, an interaction between lipid metabolism and wool synthesis, and an increased role of volatile fatty acids in ruminants, compared to non-ruminant animals. PMID:24904168

  18. ARIES-AT: An advanced tokamak, advanced technology fusion power plant

    International Nuclear Information System (INIS)

    Najmabadi, F.; Jardin, S.C.; Tillack, M.; Waganer, L.M.

    2001-01-01

    The ARIES-AT study was initiated to assess the potential of high-performance tokamak plasmas together with advanced technology in a fusion power plant. Several avenues were pursued in order to arrive at plasmas with a higher β and better bootstrap alignment compared to ARIES-RS that led to plasmas with higher β N and β. Advanced technologies that are examined in detail include: (1) Possible improvements to the overall system by using high-temperature superconductors, (2) Innovative SiC blankets that lead to a high thermal cycle efficiency of ∼60%; and (3) Advanced manufacturing techniques which aim at producing near-finished products directly from raw material, resulting in low-cost, and reliable components. The 1000-MWe ARIES-AT design has a major radius of 5.4 m, minor radius of 1.3 M, a toroidal β of 9.2% (β N =6.0) and an on-axis field of 5.6 T. The plasma current is 13 MA and the current drive power is 24 MW. The ARIES-AT study shows that the combination of advanced tokamak modes and advanced technology leads to attractive fusion power plant with excellent safety and environmental characteristics and with a cost of electricity (5c/kWh), which is competitive with those projected for other sources of energy. (author)

  19. Sirenophila ovis-atra a new species of maritime Teloschistaceae from the Southern Hemisphere

    DEFF Research Database (Denmark)

    Søchting, Ulrik; Søgaard, Majbrit Zeuthen; Sancho, Leopoldo G.

    2016-01-01

    A new species, Sirenophila ovis-atra is described from maritime rocks of southern Patagonia, the Falkland Islands and Macquarie Island, where it grows in the upper part of the black ‘Verrucaria-zone’, most often on members of the genus Hydropunctaria. It is so far the only known species of Sireno......A new species, Sirenophila ovis-atra is described from maritime rocks of southern Patagonia, the Falkland Islands and Macquarie Island, where it grows in the upper part of the black ‘Verrucaria-zone’, most often on members of the genus Hydropunctaria. It is so far the only known species...

  20. Cardiotoxicity of Senna occidentalis in sheep (Ovis aries)

    African Journals Online (AJOL)

    tulyasys

    2016-02-09

    Feb 9, 2016 ... Alterations in the liver, central nervous system, and heart muscle have ..... mean heart rate of 119 bpm in normal sheep (Tório et al., 1997). In this ... heart samples could reveal information on remodeling of the extracellular ...

  1. Engineering design of ARIES-III

    International Nuclear Information System (INIS)

    Sze, D.K.; Wong, C.; Cheng, E.

    1993-07-01

    An efficient organic cooled low activation ferritic steel first wall and shield has been designed for the D- 3 He power reactor ARIES-III. The design allows removal of the large surface heat load without exceeding temperature and stress design limits. The structure is expected to last for the whole reactor life. The major concerns regarding using the organic coolant in fusion reactors have been greatly alleviated

  2. Organic coolant for ARIES-III

    International Nuclear Information System (INIS)

    Sze, D.K.; Sviatoslavsky, I.; Sawan, M.; Gierszewski, P.; Hollies, R.; Sharafat, S.; Herring, S.

    1991-04-01

    ARIES-III is a D-He 3 reactor design study. It is found that the organic coolant is well suited for the D-He 3 reactor. This paper discusses the unique features of the D-He 3 reactor, and the reason that the organic coolant is compatible with those features. The problems associated with the organic coolant are also discussed. 8 refs., 2 figs., 6 tabs

  3. ARIES segmented gamma-ray scanner user manual

    International Nuclear Information System (INIS)

    Biddle, R.S.; Sheppard, G.A.; Schneider, C.M.

    1998-01-01

    The segmented gamma-ray scatter (SGS) designated as Win SGS at the Los Alamos Plutonium Facility has been installed and is intended for use in quantifying the radioisotope content of DOE-STD-3013-96 equivalent containers. The SGS features new software written in C and a new user interface that runs under Microsoft Windows trademark. The operation of the ARIES Segmented Gamma-ray Scanner is documented in this manual. It covers user instructions as well as hardware and software details. Additional information is found in the documentation for the commercially available components and modules that compose the SGS. The objective of the ARIES project is to demonstrate technology to dismantle plutonium pits from excess nuclear weapons, convert the plutonium to a metal ingot or an oxide powder, package the metal or oxide, and verify the contents of the package by nondestructive assay

  4. The ARIES-III D-3He tokamak reactor: Design-point determination and parametric studies

    International Nuclear Information System (INIS)

    Bathke, C.G.; Werley, K.A.; Miller, R.L.; Krakowski, R.A.; Santarius, J.F.

    1991-01-01

    The multi-institutional ARIES study has generated a conceptual design of another tokamak fusion reactor in a series that varies the assumed advances in technology and physics. The ARIES-3 design uses a D- 3 He fuel cycle and requires advances in technology and physics for economical attractiveness. The optimal design was characterized through systems analyses for eventual conceptual engineering design. Results from the systems analysis are summarized, and a comparison with the high-field, D-T fueled ARIES-1 is included. 11 refs., 5 figs

  5. Host transcription factors in the immediate pro-inflammatory response to the parasitic mite Psoroptes ovis.

    Directory of Open Access Journals (Sweden)

    Stewart T G Burgess

    Full Text Available BACKGROUND: Sheep scab, caused by infestation with the ectoparasitic mite Psoroptes ovis, results in the rapid development of cutaneous inflammation and leads to the crusted skin lesions characteristic of the disease. We described previously the global host transcriptional response to infestation with P. ovis, elucidating elements of the inflammatory processes which lead to the development of a rapid and profound immune response. However, the mechanisms by which this response is instigated remain unclear. To identify novel methods of intervention a better understanding of the early events involved in triggering the immune response is essential. The objective of this study was to gain a clearer understanding of the mechanisms and signaling pathways involved in the instigation of the immediate pro-inflammatory response. RESULTS: Through a combination of transcription factor binding site enrichment and pathway analysis we identified key roles for a number of transcription factors in the instigation of cutaneous inflammation. In particular, defined roles were elucidated for the transcription factors NF-kB and AP-1 in the orchestration of the early pro-inflammatory response, with these factors being implicated in the activation of a suite of inflammatory mediators. CONCLUSIONS: Interrogation of the host temporal response to P. ovis infestation has enabled the further identification of the mechanisms underlying the development of the immediate host pro-inflammatory response. This response involves key regulatory roles for the transcription factors NF-kB and AP-1. Pathway analysis demonstrated that the activation of these transcription factors may be triggered following a host LPS-type response, potentially involving TLR4-signalling and also lead to the intriguing possibility that this could be triggered by a P. ovis allergen.

  6. Chaos M-ary modulation and demodulation method based on Hamilton oscillator and its application in communication.

    Science.gov (United States)

    Fu, Yongqing; Li, Xingyuan; Li, Yanan; Yang, Wei; Song, Hailiang

    2013-03-01

    Chaotic communication has aroused general interests in recent years, but its communication effect is not ideal with the restriction of chaos synchronization. In this paper a new chaos M-ary digital modulation and demodulation method is proposed. By using region controllable characteristics of spatiotemporal chaos Hamilton map in phase plane and chaos unique characteristic, which is sensitive to initial value, zone mapping method is proposed. It establishes the map relationship between M-ary digital information and the region of Hamilton map phase plane, thus the M-ary information chaos modulation is realized. In addition, zone partition demodulation method is proposed based on the structure characteristic of Hamilton modulated information, which separates M-ary information from phase trajectory of chaotic Hamilton map, and the theory analysis of zone partition demodulator's boundary range is given. Finally, the communication system based on the two methods is constructed on the personal computer. The simulation shows that in high speed transmission communications and with no chaos synchronization circumstance, the proposed chaotic M-ary modulation and demodulation method has outperformed some conventional M-ary modulation methods, such as quadrature phase shift keying and M-ary pulse amplitude modulation in bit error rate. Besides, it has performance improvement in bandwidth efficiency, transmission efficiency and anti-noise performance, and the system complexity is low and chaos signal is easy to generate.

  7. Efficacy of doramectin injectable against Oestrus ovis and gastrointestinal nematodes in sheep in the southwestern region of France.

    Science.gov (United States)

    Dorchies, P; Jacquiet, P; Bergeaud, J P; Duranton, C; Prévot, F; Alzieu, J P; Gossellin, J

    2001-03-20

    A study was conducted to evaluate the therapeutic efficacy of doramectin administered intramuscularly at a dose rate of 200 microg/kg to sheep harbouring naturally acquired infections of gastrointestinal nematodes and Oestrus ovis in the southwestern region of France. On day 0, 24 sheep were selected on the basis of positive faecal egg counts (>100 EPG) and positive assessment of O. ovis infection (including positive O. ovis antibody level and positive clinical score). The sheep were randomly allocated to a non-medicated control group (T1) or a doramectin-treated group (T2) of 12 animals each. On day 0, sheep in group T2 received a single intramuscular injection of doramectin (200 microg/kg), whereas those in group T1 received an intramuscular injection of saline solution (sodium chloride, 0.02ml/kg). Individual faecal egg counts were performed on days 0, 1, 2, 3, 4, 5, 6, 7, and 14. Between days 14 and 16, all sheep were slaughtered, and worm and O. ovis burdens were determined. In doramectin-treated sheep, faecal egg counts had decreased to zero by day 4 for all recovered types of nematode eggs: strongyles, Nematodirus sp., Trichuris sp., and Rhabditidae sp. For strongyles, Nematodirus sp., and Rhabditidae, the percentage reductions in faecal egg counts (geometric means) of doramectin-treated sheep, compared to the non-medicated control sheep were 100% from days 4-7. For Trichuris sp., they were 100, 99.7, 99.9, and 100% on days 4, 5, 6, and 7, respectively. On day 14, percentage reductions were 100% for Nematodirus sp. and Rhabditidae, and 99.8 and 99.1% for strongyles and Trichuris sp., respectively. At necropsy, only adult nematodes and mainly first-stage O. ovis larvae were recovered. Doramectin was highly efficacious against the adult stages of Teladorsagia circumcincta (100%), Nematodirus battus (100%), Nematodirus filicollis (99.9%), Oesophagostomum venulosum (99.8%), and Trichuris sp. (99.3%). It was also 100% efficacious against first-stage larvae of O

  8. First record of Taenia ovis krabbei muscle cysts in muskoxen from Greenland

    DEFF Research Database (Denmark)

    Raundrup, Katrine; Al-Sabi, Mohammad M; Kapel, Christian Moliin Outzen

    2012-01-01

    A first record of Taenia ovis krabbei muscle cysts in a muskoxen (Ovibos moschatus) from the Kangerlussuaq population in West Greenland suggests that introduced muskoxen now contributes to the transmission of this parasite in addition to previous observations from caribou (Rangtfer tarandus...

  9. Time-dependent Taylor–Aris dispersion of an initial point concentration

    DEFF Research Database (Denmark)

    Vedel, Søren; Hovad, Emil; Bruus, Henrik

    2014-01-01

    -specific theoretical results, and furthermore predict new phenomena. In particular, for the transient phase before the well-described steady Taylor–Aris limit is reached, we find anomalous diffusion with a dependence of the temporal scaling exponent on the initial release point, generalizing this finding in specific...... cases. During this transient we furthermore identify maxima in the values of the dispersion coefficient which exceed the Taylor–Aris value by amounts that depend on channel geometry, initial point release position, velocity profile and Péclet number. We show that these effects are caused by a difference...

  10. In-Depth Characterization of Sheep (Ovis aries) Milk Whey Proteome and Comparison with Cow (Bos taurus)

    Science.gov (United States)

    Ha, Minh; Sabherwal, Manya; Duncan, Elizabeth; Stevens, Stewart; Stockwell, Peter; McConnell, Michelle; Bekhit, Alaa El-Din; Carne, Alan

    2015-01-01

    An in-depth proteomic study of sheep milk whey is reported and compared to the data available in the literature for the cow whey proteome. A combinatorial peptide ligand library kit (ProteoMiner) was used to normalize protein abundance in the sheep whey proteome followed by an in-gel digest of a 1D-PAGE display and an in-solution digestion followed by OFFGEL isoelectric focusing fractionation. The peptide fractions obtained were then analyzed by LC-MS/MS. This enabled identification of 669 proteins in sheep whey that, to our knowledge, is the largest inventory of sheep whey proteins identified to date. A comprehensive list of cow whey proteins currently available in the literature (783 proteins from unique genes) was assembled and compared to the sheep whey proteome data obtained in this study (606 proteins from unique genes). This comparison revealed that while the 233 proteins shared by the two species were significantly enriched for immune and inflammatory responses in gene ontology analysis, proteins only found in sheep whey in this study were identified that take part in both cellular development and immune responses, whereas proteins only found in cow whey in this study were identified to be associated with metabolism and cellular growth. PMID:26447763

  11. In-Depth Characterization of Sheep (Ovis aries Milk Whey Proteome and Comparison with Cow (Bos taurus.

    Directory of Open Access Journals (Sweden)

    Minh Ha

    Full Text Available An in-depth proteomic study of sheep milk whey is reported and compared to the data available in the literature for the cow whey proteome. A combinatorial peptide ligand library kit (ProteoMiner was used to normalize protein abundance in the sheep whey proteome followed by an in-gel digest of a 1D-PAGE display and an in-solution digestion followed by OFFGEL isoelectric focusing fractionation. The peptide fractions obtained were then analyzed by LC-MS/MS. This enabled identification of 669 proteins in sheep whey that, to our knowledge, is the largest inventory of sheep whey proteins identified to date. A comprehensive list of cow whey proteins currently available in the literature (783 proteins from unique genes was assembled and compared to the sheep whey proteome data obtained in this study (606 proteins from unique genes. This comparison revealed that while the 233 proteins shared by the two species were significantly enriched for immune and inflammatory responses in gene ontology analysis, proteins only found in sheep whey in this study were identified that take part in both cellular development and immune responses, whereas proteins only found in cow whey in this study were identified to be associated with metabolism and cellular growth.

  12. Vegetative Valvular Endocarditis and Hepatitis Associated with Helcococcus ovis in a 7-year-old White Leghorn Rooster.

    Science.gov (United States)

    Crispo, Manuela; Stoute, Simone; Savaris, Thaiza; Bickford, Arthur; Santoro, Tiffany; Sentíes-Cué, C Gabriel

    2017-12-01

    Helcococcus ovis is a slow-growing, pyridoxal-dependent, Gram-positive coccus belonging to the Peptostreptococcaceae family. Bacteria belonging to the genus Helcococcus are considered normal inhabitants of keratinized epithelium in humans; however, several reports support their role as pathogens in humans and several animal species. This case report describes the identification of H. ovis in a white leghorn rooster with valvular vegetative endocarditis and hepatitis. In February 2017 one dead, 7-yr-old, white leghorn rooster was submitted to the California Animal Health and Food Safety Turlock laboratory for diagnostic testing. Postmortem and microscopic examination revealed vegetative endocarditis and aortic thrombosis associated with large numbers of Gram-positive cocci. Myocarditis and extensive necrotic hepatitis were also noticed. Helcococcus ovis was isolated in large numbers from the aortic endothelium and confirmed by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Bacterial colonies become evident 48 hr postincubation and exhibited a satellite growth around Escherichia coli on blood agar plates. A similar relationship has been described between Helcococcus spp. and Staphylococcus aureus. The primary site of infection in this chicken was not determined. To our understanding this is the first report of H. ovis infection in an avian species. The fastidious nature and nutritional requirements of Helcococcus spp. must be considered in order to allow proper identification and avoid misdiagnosis. Further studies are needed to define pathogenesis, virulence factors, and predisposing conditions associated with this microorganism.

  13. The ARIES-RS power core - recent development in Li/V designs

    International Nuclear Information System (INIS)

    Sze Dai-Kai; Billone, M.C.; Hua, T.Q.; Tillack, M.; Najmabadi, F.; Wang Xueren; Malang, S.; El-Guebaly, L.A.; Sviatoslavsky, I.N.; Blanchard, J.P.; Crowell, J.A.; Khater, H.Y.; Mogahed, E.A.; Waganer, L.M.; Lee, D.; Cole, D.

    1998-01-01

    The ARIES-RS fusion power plant design study is based on reversed-shear (RS) physics with a Li/V (lithium breeder and vanadium structure) blanket. The reversed-shear discharge has been documented in many large tokamak experiments. The plasma in the RS mode has a high beta, low current, and low current drive requirement. Therefore, it is an attractive physics regime for a fusion power plant. The blanket system based on Li/V has high temperature operating capability, good tritium breeding, excellent high heat flux removal capability, long structural life time, low activation, low after heat and good safety characteristics. For these reasons, the ARIES-RS reactor study selected Li/V as the reference blanket. The combination of attractive physics and attractive blanket engineering is expected to result in a superior power plant design. This paper summarizes the power core design of the ARIES-RS power plant study. (orig.)

  14. Determination of Prevalence and Risk Factors of Infection with Babesia ovis in Small Ruminants from West Azerbaijan Province, Iran by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Bijan Esmaeilnejad

    2015-10-01

    Full Text Available Background: Small ruminants’ babesiosis caused by Babesia ovis, is transmitted during blood feeding by infected ticks and is the most economically important tick-borne disease in tropical and subtropical areas. This study was carried out to to estimate the infection rate of B. ovis in sheep and goats by PCR. We have analysed risk factors that might influence infection of sheep and goats with B. ovis.Methods: A total 402 blood samples were examined microscopically for the presence of Babesia infection. All samples were tested by PCR. During sampling, whole body of each animal and farm dogs was examined for the presence of ticks.Results: Forty-two animals (10.4% were positive for Babesia spp. upon microscopic examination, whereas 67 animals (16.7% yielded the specific DNA for B. ovis of which 52 animals were sheep and 15 animals were goats.Twenty-nine farms (72.5% were found positive for B. ovis. The percentage of positive animals in each location varied from 13 % to 20 %. The relative risk of the presence of ticks in sheep and goats (P< 0.01 and farm dogs (P< 0.01 for PCRpositive results forB. ovis in sheep and goats was found 3.8 and 2.9, respectively. A total of 747 ticks identified as Rhipicephalus bursa, R. sanguineus and R. turanicus on the basis of morphological features.Conclusion: Other animal species besides dogs may also be risk factors for babesiosis in sheep and goats. Also, R. bursa may play an important role as a vector of the parasite in Iran.

  15. Y chromosome haplotype diversity of domestic sheep (Ovis aries) in northern Eurasia.

    Science.gov (United States)

    Zhang, Min; Peng, Wei-Feng; Yang, Guang-Li; Lv, Feng-Hua; Liu, Ming-Jun; Li, Wen-Rong; Liu, Yong-Gang; Li, Jin-Quan; Wang, Feng; Shen, Zhi-Qiang; Zhao, Sheng-Guo; Hehua, Eer; Marzanov, Nurbiy; Murawski, Maziek; Kantanen, Juha; Li, Meng-Hua

    2014-12-01

    Variation in two SNPs and one microsatellite on the Y chromosome was analyzed in a total of 663 rams representing 59 breeds from a large geographic range in northern Eurasia. SNPA-oY1 showed the highest allele frequency (91.55%) across the breeds, whereas SNPG-oY1 was present in only 56 samples. Combined genotypes established seven haplotypes (H4, H5, H6, H7, H8, H12 and H19). H6 dominated in northern Eurasia, and H8 showed the second-highest frequency. H4, which had been earlier reported to be absent in European breeds, was detected in one European breed (Swiniarka), whereas H7, which had been previously identified to be unique to European breeds, was present in two Chinese breeds (Ninglang Black and Large-tailed Han), one Buryatian (Transbaikal Finewool) and two Russian breeds (North Caucasus Mutton-Wool and Kuibyshev). H12, which had been detected only in Turkish breeds, was also found in Chinese breeds in this work. An overall low level of haplotype diversity (median h = 0.1288) was observed across the breeds with relatively higher median values in breeds from the regions neighboring the Near Eastern domestication center of sheep. H6 is the dominant haplotype in northwestern and eastern China, in which the haplotype distribution could be explained by the historical translocations of the H4 and H8 Y chromosomes to China via the Mongol invasions followed by expansions to northwestern and eastern China. Our findings extend previous results of sheep Y chromosomal genetic variability and indicate probably recent paternal gene flows between sheep breeds from distinct major geographic regions. © 2014 Stichting International Foundation for Animal Genetics.

  16. Advection and Taylor-Aris dispersion in rivulet flow

    Science.gov (United States)

    Al Mukahal, F. H. H.; Duffy, B. R.; Wilson, S. K.

    2017-11-01

    Motivated by the need for a better understanding of the transport of solutes in microfluidic flows with free surfaces, the advection and dispersion of a passive solute in steady unidirectional flow of a thin uniform rivulet on an inclined planar substrate driven by gravity and/or a uniform longitudinal surface shear stress are analysed. Firstly, we describe the short-time advection of both an initially semi-infinite and an initially finite slug of solute of uniform concentration. Secondly, we describe the long-time Taylor-Aris dispersion of an initially finite slug of solute. In particular, we obtain the general expression for the effective diffusivity for Taylor-Aris dispersion in such a rivulet, and discuss in detail its different interpretations in the special case of a rivulet on a vertical substrate.

  17. Calibration of ARI QC ionisation chambers using the Australian secondary standards for activity

    International Nuclear Information System (INIS)

    Mo, L.; Van Der Gaast, H.A.; Alexiev, D.; Butcher, K.S.A.; Davies, J.

    1999-01-01

    The Secondary Standard Activity Laboratory (SSAL) in ANSTO routinely provides standardised radioactive sources, traceable activity measurements and custom source preparation services to customers. The most important activity carried out is the calibration of ionisation chambers located in the Quality Control (QC) section of Australian Radioisotopes (ARI). This ensures that their activity measurements are traceable to the Australian primary methods of standardisation. ARI QC ionisation chambers are calibrated for 99m Tc, 67 Ga, 131 I, 201 Tl and 153 Sm. The SSAL has a TPA ionisation chamber, which has been directly calibrated against a primary standard for a variety of radioactive nuclides. Calibration factors for this chamber were determined specifically for the actual volumes (5ml for 99m Tc, 131 I, 2ml for 67 Ga, 201 Tl and 3 ml for 153 Sm) and types of vial (Wheaton) which are routinely used at ARI. These calibration factors can be used to accurately measure the activity of samples prepared by ARI. The samples can subsequently be used to calibrate the QC ionisation chambers. QC ionisation chambers are re-calibrated biannually

  18. The ARIES-I high-field-tokamak reactor: Design-point determination and parametric studies

    International Nuclear Information System (INIS)

    Miller, R.L.

    1989-01-01

    The multi-institutional ARIES study has examined the physics, technology, safety, and economic issues associated with the conceptual design of a tokamak magnetic-fusion reactor. The ARIES-I variant envisions a DT-fueled device based on advanced superconducting coil, blanket, and power-conversion technologies and a modest extrapolation of existing tokamak physics. A comprehensive systems and trade study has been conducted as an integral and ongoing part of the reactor assessment in order to identify an acceptable design point to be subjected to detailed analysis and integration as well as to characterize the ARIES-I operating space. Results of parametric studies leading to the identification of such a design point are presented. 15 refs., 6 figs., 2 tabs

  19. Neutronics design aspects of reference ARIES-I fusion blanket

    International Nuclear Information System (INIS)

    Cheng, E.T.

    1990-12-01

    A SiC composite blanket concept was recently conceived for a deuterium-tritium burning, 1000 MW(e) tokamak fusion reactor design, ARIES-I. SiC composite structural material was chosen due to its very low activation features. High blanket nuclear performance and thermal efficiency, adequate tritium breeding, and a low level of activation are important design requirements for the ARIES-I reactor. The major approaches, other than using SiC as structural material, in meeting these design requirements, are to employ beryllium, the only low activation neutron multiplying material, and isotopically tailored Li 2 ZrO 3 , a tritium breeding material stable at high temperature, as blanket materials. 5 refs., 4 figs., 2 tabs

  20. FIRE, A Test Bed for ARIES-RS/AT Advanced Physics and Plasma Technology

    International Nuclear Information System (INIS)

    Meade, Dale M.

    2004-01-01

    The overall vision for FIRE [Fusion Ignition Research Experiment] is to develop and test the fusion plasma physics and plasma technologies needed to realize capabilities of the ARIES-RS/AT power plant designs. The mission of FIRE is to attain, explore, understand and optimize a fusion dominated plasma which would be satisfied by producing D-T [deuterium-tritium] fusion plasmas with nominal fusion gains ∼10, self-driven currents of ∼80%, fusion power ∼150-300 MW, and pulse lengths up to 40 s. Achieving these goals will require the deployment of several key fusion technologies under conditions approaching those of ARIES-RS/AT. The FIRE plasma configuration with strong plasma shaping, a double null pumped divertor and all metal plasma-facing components is a 40% scale model of the ARIES-RS/AT plasma configuration. ''Steady-state'' advanced tokamak modes in FIRE with high beta, high bootstrap fraction, and 100% noninductive current drive are suitable for testing the physics of the ARIES-RS/A T operating modes. The development of techniques to handle power plant relevant exhaust power while maintaining low tritium inventory is a major objective for a burning plasma experiment. The FIRE high-confinement modes and AT-modes result in fusion power densities from 3-10 MWm -3 and neutron wall loading from 2-4 MWm -2 which are at the levels expected from the ARIES-RS/AT design studies

  1. Radiologic analysis of hindfoot alignment: Comparison of Méary, long axial, and hindfoot alignment views.

    Science.gov (United States)

    Neri, T; Barthelemy, R; Tourné, Y

    2017-12-01

    Among radiographic views available for assessing hindfoot alignment, the antero-posterior weight-bearing view with metal cerclage of the hindfoot (Méary view) is the most widely used in France. Internationally, the long axial view (LAV) and hindfoot alignment view (HAV) are used also. The objective of this study was to compare the reliability of these three views. The Méary view with cerclage of the hindfoot is as reliable as the LAV and HAV for assessing hindfoot alignment. All three views were obtained in each of 22 prospectively included patients. Intra-observer and inter-observer reliabilities were assessed by having two observers collect the radiographic measurements then computing the intra-class correlation coefficients (ICCs). The intra-observer and inter-observer ICCs were 0.956 and 0.988 with the Méary view, 0.990 and 0.765 with the HAV, and 0.997 and 0.991 with the LAV, respectively. Correlations were far stronger between the LAV and HAV than between each of these and the Méary view. Compared to the LAV and HAV, the Méary view indicated a greater degree of hindfoot valgus. Intra-observer reliability was excellent with both the LAV and HAV, whereas inter-observer reliability was better with the LAV. Excellent reliability was also obtained with the Méary view. Combining the Méary view to obtain a radiographic image of the clinical deformity with the LAV to measure the angular deviation of the hindfoot axis may be useful when assessing hindfoot malalignment. A comparison of the three views in a larger population is needed before clinical recommendations can be made. II, prospective study. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. From Monologue to Dialogue: Natural Language Generation in OVIS

    OpenAIRE

    Theune, Mariet; Freedman, R.; Callaway, C.

    2003-01-01

    This paper describes how a language generation system that was originally designed for monologue generation, has been adapted for use in the OVIS spoken dialogue system. To meet the requirement that in a dialogue, the system’s utterances should make up a single, coherent dialogue turn, several modifications had to be made to the system. The paper also discusses the influence of dialogue context on information status, and its consequences for the generation of referring expressions and accentu...

  3. Reappearance of Taenia ovis krabbei muscle cysts in a roe deer (Capreolus capreolus) in Denmark after 60+ years.

    Science.gov (United States)

    Al-Sabi, Mohammad Nafi Solaiman; Chriél, Mariann; Holm, Elisabeth; Jensen, Tim Kåre; Ståhl, Marie; Enemark, Heidi Larsen

    2013-09-01

    The present report describes the reappearance of Taenia ovis krabbei in a roe deer from Denmark after more than 60 years. The cysticerci were isolated from the thigh muscle of the deer, and the diagnosis was based on histostological analysis, morphology of the rostellar-hooks as well as molecular typing of the mitochondrial cytochrome c oxidase I (cox1) gene. The exact definitive host was not revealed in this report, but domestic dogs may play a role of the definitive host in the area. This finding is of concern to hunters and deer meat producers, since the infected meat is usually condemned due to esthetic reasons. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. ARIES-IV Nested Shell Blanket Design

    International Nuclear Information System (INIS)

    Wong, C.P.C.; Redler, K.; Reis, E.E.; Will, R.; Cheng, E.; Hasan, C.M.; Sharafat, S.

    1993-11-01

    The ARIES-IV Nested Shell Blanket (NSB) Design is an alternate blanket concept of the ARIES-IV low activation helium-cooled reactor design. The reference design has the coolant routed in the poloidal direction and the inlet and outlet plena are located at the top and bottom of the torus. The NSB design has the high velocity coolant routed in the toroidal direction and the plena are located behind the blanket. This is of significance since the selected structural material is SiC-composite. The NSB is designed to have key high performance components with characteristic dimensions of no larger than 2 m. These components can be brazed to form the blanket module. For the diverter design, we eliminated the use of W as the divertor coating material by relying on the successful development of the gaseous divertor concept. The neutronics and thermal-hydraulic performance of both blanket concepts are similar. The selected blanket and divertor configurations can also meet all the projected structural, neutronics and thermal-hydraulics design limits and requirements. With the selected blanket and divertor materials, the design has a level of safety assurance rate of I (LSA-1), which indicates an inherently safe design

  5. Fluorescence in situ hybridization mapping of six loci containing genes involved in the dioxin metabolism of domestic bovids.

    Science.gov (United States)

    Genualdo, Viviana; Spalenza, Veronica; Perucatti, Angela; Iannuzzi, Alessandra; Di Meo, Giulia Pia; Caputi-Jambrenghi, Annamaria; Vonghia, Gino; Rasero, Roberto; Nebbia, Carlo; Sacchi, Paola; Iannuzzi, Leopoldo

    2011-05-01

    Six loci containing genes involved in the dioxin metabolism (ARNT, AHR, CYP1A1, CYP1A2, CYP1B1 and AHRR) were assigned, for the first time, to cattle (Bos taurus, 2n = 60, BTA), river buffalo (Bubalus bubalis, 2n = 50, BBU), sheep (Ovis aries, 2n = 54, OAR) and goat (Capra hircus, 2n = 60, CHI) chromosomes by comparative FISH-mapping and R-banding using bovine BAC-clones. The following chromosome locations were found: ARNT to BTA3q21, BBU6q21, OAR1p21 and CHI3q21, AHR to BTA4q15, BBU8q15, OAR4q15 and CHI4q15; CYP1A1 and CYP1A2 to BTA21q17, BBU20q17, OAR18q17 and CHI21q17; CYP1B1 to BTA11q16, BBU12q22, OAR3p16 and CHI11q16, AHRR to BTA20q24, BBU19q24, OAR16q24 and CHI20q24. All loci were mapped at the same homoeologous chromosomes and chromosome bands of the four bovid species. Comparisons with corresponding human locations were also reported.

  6. Gastrointestinal parasites of sheep, municipality of Lajes, Rio Grande do Norte, Brazil Parasitos do trato gastrintestinal de ovinos, município de Lajes, Rio Grande do Norte, Brasil

    Directory of Open Access Journals (Sweden)

    Maria de Fátima de Souza

    2012-03-01

    Full Text Available This study investigated the gastrointestinal parasitism by helminths and protozoa in sheep (Ovis aries Santa Inês breed, municipality of Lajes, Rio Grande do Norte. Monthly, from April 2005 to August 2007, stool samples were collected from two tracer lambs in the first day of the experiment and performed a necropsy of these animals in 44th day. A total of 64 lambs were sampled, but only 62 lambs were slaughtered. The fecal samples were examined by sedimentation in water. The contents of the abomasum, small intestine and large intestine were examined for the recovery of helminths. The parasitological examination revealed eggs of the following groups of helminths: Strongyloidea, Strongyloides sp., Trichuris sp., and Moniezia sp. Also were found oocysts of Eimeria spp., cysts of Entamoeba ovis and Giardia duodenalis. The helminths identified from examining the contents were: Haemonchus contortus, Cooperia pectinata, Cooperia punctata, Trichostrongylus colubriformis, Moniezia expansa, Oesophagostomum sp. Skrjabinema ovis and Trichuris sp.O presente estudo investigou o parasitismo gastrintestinal por helmintos e protozoários em ovinos (Ovis aries da raça Santa Inês, no município de Lajes, Rio Grande do Norte. Mensalmente, entre abril de 2005 e agosto de 2007, foram coletadas amostras fecais de dois cordeiros traçadores no primeiro dia do experimento e realizada a necropsia desses animais no 44º dia. O total de cordeiros amostrados foi 64, mas apenas 62 foram necropsiados. As amostras fecais foram examinadas pela técnica de sedimentação espontânea em água. Os conteúdos do abomaso, intestino delgado e intestino grosso dos cordeiros necropsiados foram examinados para a recuperação dos helmintos. Os exames parasitológicos evidenciaram ovos dos seguintes grupos de helmintos: Strongyloidea, Strongyloides sp. , Trichuris sp., e Moniezia sp. Também foram encontrados oocistos de Eimeria spp., cistos de Entamoeba ovis e de Giardia duodenalis

  7. ARI-EL: een case-controle onderzoek naar Acute Respiratoire Infecties in de Eerste lijn. Tussenrapportage over okt. 2000 t/m sept. 2001

    NARCIS (Netherlands)

    van den Brandhof WE; Bartelds AIM; Peeters MF; Wilbrink B; Heijnen MLA; CIE; NIVEL; Streeklaboratorium voor de Volksgezondheid Tilburg; LIS

    2002-01-01

    Vanaf oktober 2000 is de Nederlandse influenza-surveillance tijdelijk uitgebreid tot een case-controle studie naar acute respiratoire infecties (ARI) bij huisartspatienten: de ARI-EL studie. Doel is inzicht verkrijgen in de incidentie en etiologie van ARI, risicofactoren voor ARI en in de zorgvraag

  8. Antigenic Cross-reactivity among Haemonchus contortus, Oesophagostomum columbianum and Trichuris ovis of Goat

    Directory of Open Access Journals (Sweden)

    Ruma JAS

    2016-12-01

    Full Text Available Background: Cross antigenicity is the major problem in developing a reliable tool for immunodiagnosis and immunoprophylaxis of parasitic diseases. Mixed infection due to different types of gastrointestinal parasites is more common than single species infection under field condition.Methods: The present study was undertaken to detect antigenic cross-reactivity among Haemonchus contortus, Oesophagostomum columbianum and Trichuris ovis of goats by SDS-PAGE and western blot analysis using hyperimmune sera (HIS rose in rabbit separately against the antigens of the three nematode species.Results: Thirteen, 16 and 14 polypeptides in crude somatic antigen (CSAg of H. contortus (CSAg-Hc, O. columbianum (CSAg-Oc and T. ovis (CSAg-To, respectively, were resolved in SDS PAGE analyses. It was revealed that 54 kDa peptide was shared by H.contortus and O. columbianum, whereas 47 kDa peptide was shared by O. columbianum and T. ovis. Western blot analyses revealed that three immunogenic polypeptides (MW 54, 49 and 42 kDa in CSAg-Hc, five in CSAg-Oc (54, 47, 44, 38 and 35.5 kDa and CSAg-To and five polypeptides (90, 51, 47, 39.5 and 31 kDa in CSAg-To cross-reacted with the heterologous HIS. Four species-specific immunoreactive polypeptides (92, 85, 65 and 39 kDa of H. contortus and two (72 & 26 kDa in O. columbianum were also identified in the study. Conclusion: The shared polypeptides and species-specific polypeptides might be evaluated as protective antigen and subsequently exploitation for developing immunodiagnostic and for immunoprophylactic tools of for these common nematode species. 

  9. Antigenic Cross-reactivity among Haemonchus contortus, Oesophagostomum columbianum and Trichuris ovis of Goat.

    Science.gov (United States)

    Jas, Ruma; Ghosh, Joydeb; DAS, Kinsuk

    2016-01-01

    Cross antigenicity is the major problem in developing a reliable tool for immunodiagnosis and immunoprophylaxis of parasitic diseases. Mixed infection due to different types of gastrointestinal parasites is more common than single species infection under field condition. The present study was undertaken to detect antigenic cross-reactivity among Haemonchus contortus, Oesophagostomum columbianum and Trichuris ovis of goats by SDS-PAGE and western blot analysis using hyperimmune sera (HIS) rose in rabbit separately against the antigens of the three nematode species. Thirteen, 16 and 14 polypeptides in crude somatic antigen (CSAg) of H. contortus (CSAg-Hc), O. columbianum (CSAg-Oc) and T. ovis (CSAg-To), respectively, were resolved in SDS PAGE analyses. It was revealed that 54 kDa peptide was shared by H.contortus and O. columbianum , whereas 47 kDa peptide was shared by O. columbianum and T. ovis . Western blot analyses revealed that three immunogenic polypeptides (MW 54, 49 and 42 kDa) in CSAg-Hc, five in CSAg-Oc (54, 47, 44, 38 and 35.5 kDa) and CSAg-To and five polypeptides (90, 51, 47, 39.5 and 31 kDa) in CSAg-To cross-reacted with the heterologous HIS. Four species-specific immunoreactive polypeptides (92, 85, 65 and 39 kDa) of H. contortus and two (72 & 26 kDa) in O. columbianum were also identified in the study. The shared polypeptides and species-specific polypeptides might be evaluated as protective antigen and subsequently exploitation for developing immunodiagnostic and for immunoprophylactic tools of for these common nematode species.

  10. ARIES Oxide Production Program Annual Report - FY14

    Energy Technology Data Exchange (ETDEWEB)

    Kelley, Evelyn A. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Dinehart, Steven Mark [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-02-01

    A summary of the major accomplishments (September), milestones, financial summary, project performance and issues facing the ARIES Oxide Production Program at the close of FY14 is presented in this Executive Summary. Annual accomplishments are summarized in the body of the report.

  11. ARIS: Acid Rain Information System. Final project report

    Energy Technology Data Exchange (ETDEWEB)

    McWilliams, P.; Musante, L.

    1982-04-20

    ARIS is to provide the technical, government, and business communities with abstracted information from the world's significant technical and business literature. The subject areas covered by this acid rain data base includes (1) the mechanism of the formation of acid rain; (2) its transport phenomena; (3) its effects on materials; (4) its effects on plants; (5) the health effects of acid rain; and (6) monitoring and analysis of acid rain. Data in ARIS comes from several government and commercial data base producers, and these include EDB DOE Energy Database, Environmental Science Index, Air Pollution Abstracts, National Technical Service (NTIS), and articles of regional interests from various newspapers. The types of publication source documents are: technical journals, conference proceedings, selected monographs, government reports, special studies, and newspapers. The file data is proposed to be updated quarterly and will cover selected references from 1970 with major focus on material after 1976.

  12. Safety in the ARIES Tokamak Design Study

    International Nuclear Information System (INIS)

    Herring, J.S.; Wong, C.P.-C.; Cheng, E.T.; Grotz, S.

    1989-01-01

    Safety is one of the primary goals of the ARIES Tokamak Design Study. Public safety goals are the achievement passive safety which is demonstrable in tests that could precede operation and the assurance that releases from accidents be passively limited such that no evacuation plan in necessary. Strategies for safety of the plant investment are factory fabrication, short construction times and a design such that no off-normal operational transient results in damage which could not be repaired in routine maintenance. ARIES-I, the first of three 'visions' of potential tokamak reactors, will use He at 5 MPa as a blanket coolant and SiC/composite ceramic for the first wall and blanket materials. Both the coolant and the structural material were chosen for their low activation, both in the short term after accidents and for long term waste management. The breeder, Li 4 SiO 4 , was also chosen for low activation. Contemporary plasma physics and aggressive technology are used in ARIES-I, which results in very high toroidal fields (24 T maximum at the coil). The stored TF energy will be about 130 GJ. A central concern is the safe discharge of this stored energy under electrical fault conditions and prevention of a failure in the magnet set from propagating into systems containing radioactive inventories. The TF coil system consists of 16 coils, each containing two separate windings powered by two independent power supplies. Arcs and shorts between the two power supply systems and across individual windings have been modeled. In addition, delay or failure in circuit breaker opening has been modeled. The safety impacts of LOCA, LOFA and disruptive events have also been evaluated. 8 refs., 4 figs., 7 tabs

  13. Non-dirt house floor and the stimulant of environmental health decreased the risk Acute Respiratory Infection (ARI

    Directory of Open Access Journals (Sweden)

    Putu Suriyasa

    2006-03-01

    Full Text Available The risk factors related to acute respiratory infection (ARI, among others, is house floor. The aim of this research was to identify the influence of the Family Health and Nutrition program (FHN and other risk factors related to ARI. Data was obtained from a survey conducted in 5 provinces in Indonesia, which received the project of Family Health and Nutrition (FHN in 2003. The number of subjects was 1,500 families, selected by stratified random sampling method. The questionnaire completion and the observation were done on the spot in the subject’s house by special trained interviewers. The use of non-dirt house floor built prior to the project of FHN decreased the risk of ARI cases of 51% than the use of dirt house floor [Odds Ratio (OR = 0.49; 95% Confidence Interval (CI = 0.25-0.96]. The risk of ARI decreased of 52% among those who received than those which never received the stimulant of environmental health Family Health and Nutrition program (OR = 0.48; 95% CI =0.33-0.70. To decrease the risks of ARI cases, the program of environmental health is necessarily continued. (Med J Indones 2006; 15:60-5Keywords: ARI, non-dirt house floor, and stimulant of environmental health

  14. ARIES pit disassembly-safeguards issues for transparency

    International Nuclear Information System (INIS)

    Fearey, B.L.; Cremers, T.L.

    1995-01-01

    Historic changes are now occurring in U.S. nonproliferation and arms control policy. The quantity of nuclear weapons required to provide a deterrence has decreased (especially with the end of the Cold War). Further, various bilateral and multilateral treaties now require the removal of numerous nuclear weapons from the U.S. stockpile. Although the removal of such weapons appears straightforward, the final disposition of the surplus weapons-grade nuclear material must be carefully considered. Domestically, several plutonium disposition plans are now under consideration concerning long-term safety, materials accounting, environmental impact, accessibility, and long-term containment. The Automated Retirement and Integrated Extraction System (ARIES) currently under development at Los Alamos National Laboratory is one such disposition method for the disassembly of plutonium weapons components (pits). The ARIES system integrates and automates several features: disassembly of pits, consolidation of the plutonium material, on-line measurement of final products, waste streams, and long-term packaging. Clearly, in any plutonium disposition plan, the safeguards aspects of materials control and accounting and the security aspects must be carefully considered and evaluated

  15. Being Irrationally Funny as a Cognitive Psychologist: Interview With Dan Ariely.

    Science.gov (United States)

    Ariely, Dan; Popescu, Beatrice

    2015-11-01

    The idea of interviewing Dan Ariely was somehow latent on my mind since I started being interested in cognitive psychology and cognitive behavior psychotherapy, but actually got more ardent ever since irrationality became a research topic for his team at Duke University. I picked him as an interviewee thinking not only at his exceptional skills as a researcher and as Kahnemann 'disciple', but mainly for his fantastic wit, true modesty and utmost interest in making people's lives easier and more comfortable, by creating awareness on a lot of topics otherwise neglected. Dan Ariely's very agreeable personality and humor would not let you think of him as a burnt casualty who, in his youth struggled to survive a personal drama, so well-documented in his paper "Painful lessons" posted on the MIT website (http://web.mit.edu/ariely/www/MIT/Papers/mypain.pdf). I think reading his paper and also this transcribed interview with him would be also comforting for people who found out about Bucharest fire incident that rocked our society and also for people who are personally related to this tragedy.

  16. Risk factors of Acute Respiratory Infection (ARI in under-fives in a rural hospital of Central India

    Directory of Open Access Journals (Sweden)

    Amar M. Taksande

    2015-11-01

    Full Text Available Introduction: Acute Respiratory Infection (ARI is a major cause of morbidity and mortality in developing countries in children especially in under-fives. Every year in the world, about 13 million under-5 children dies, 95% from developing countries; one third of total deaths are due to ARI. The aim of this study was to identify the significant risk factors for ARI in children less than five years of age living in rural areas of Central India.Methods: A hospital based case control study was undertaken to determine risk factors associated with respiratory tract infections in children. Children less than 5 years admitted in a pediatric ward with diagnosis of ARI were enrolled in the study as cases (n = 300 while the same number of controls (n = 300 were selected from neighborhood and were matched for age, sex and religion. Details of risk factors in cases and controls were recorded in pre-designed proforma. Results: A significant association was found between ARI and lack of breastfeeding, nutritional status, immunization status, delayed weaning, prelactal feeding, living in overcrowded conditions, mothers’ literacy status, low birth weight and prematurity. Among the environmental variables, inadequate ventilation, improper housing condition, exposure to indoor air pollution in form of combustion from fuel used for cooking were found as significant risk factors for ARI in under-fives.Conclusions: ARIs are affected by socio-demographic and socio-cultural risk factors, which can be modified with simple interventions. The various risk factors identified in this study were lack of breastfeeding, undernutrition, delayed weaning, overcrowding and prelactal feeding.

  17. Observations of TT Ari requested in support of MOST observations

    Science.gov (United States)

    Waagen, Elizabeth O.

    2012-08-01

    Dr. Nikolaus Vogt (Universidad de Valparaiso, Chile) requested simultaneous photometry and spectroscopy of the novalike (VY Scl subtype) cataclysmic variable TT Ari in support of upcoming observations with the Canadian Microvariability and Oscillations of Stars (MOST) satellite 2012 September 13 through October 20. The Departamento de Fisica y Astronomia of the Valparaiso University will carry out photometry with small telescopes in central Chile but the assistance of other observers, particularly in other latitudes and longitudes, is requested. The observations are being carried out to study superhump behavior, which is still not well understood despite the amount of research done in all classes of cataclysmic variables. TT Ari exibits superhumps - both positive (the superhump period is longer than the orbital period) and negative (the superhump period is shorter than the orbital period). While positive superhumps are thought probably to be the result of an eccentric configuration in the accretion disk, the mechanism for negative superhumps is not yet understood except that it may be related to the disk's being warped out of the orbital plane, leading to complex torque phenomena. TT Ari, one of the brightest cataclysmic variables, exhibits occasional fadings of several magnitudes, from its usual high-state (maximum) magnitude of ~10.5V to a low-state magnitude as faint as 16V. These fadings occur every 20-25 years, and last between 500 and 1000 days. According to observations in the AAVSO International Database, TT Ari is currently magnitude 10.5V. Finder charts with sequence may be created using the AAVSO Variable Star Plotter (http://www.aavso.org/vsp). Observations should be submitted to the AAVSO International Database. See full Alert Notice for more details, particularly regarding goals of the campaign, and observing instructions.

  18. Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence.

    Science.gov (United States)

    Oliveros, R; Cutillas, C; De Rojas, M; Arias, P

    2000-12-01

    Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).

  19. Transient Taylor-Aris dispersion for time-dependent flows in straight channels

    DEFF Research Database (Denmark)

    Vedel, Søren; Bruus, Henrik

    2012-01-01

    Taylor–Aris dispersion, the shear-induced enhancement of solute diffusion in the flow direction of the solvent, has been studied intensely in the past half century for the case of steady flow and single-frequency pulsating flows. Here, combining Aris’s method of moments with Dirac’s bra–ket forma......Taylor–Aris dispersion, the shear-induced enhancement of solute diffusion in the flow direction of the solvent, has been studied intensely in the past half century for the case of steady flow and single-frequency pulsating flows. Here, combining Aris’s method of moments with Dirac’s bra...

  20. The design and research of anti-color-noise chaos M-ary communication system

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Yongqing, E-mail: fuyongqing@hrbeu.edu.cn; Li, Xingyuan; Li, Yanan [College of information and Communication Engineering, Harbin Engineering University, Harbin 150001 (China); Zhang, Lin [College of Underwater Acoustic Engineering, Harbin Engineering University, Harbin 150001 (China)

    2016-03-15

    Previously a novel chaos M-ary digital communication method based on spatiotemporal chaos Hamilton oscillator has been proposed. Without chaos synchronization circumstance, it has performance improvement in bandwidth efficiency, transmission efficiency and anti-white-noise performance compared with traditional communication method. In this paper, the channel noise influence on chaotic modulation signals and the construction problem of anti-color-noise chaotic M-ary communication system are studied. The formula of zone partition demodulator’s boundary in additive white Gaussian noise is derived, besides, the problem about how to determine the boundary of zone partition demodulator in additive color noise is deeply studied; Then an approach on constructing anti-color-noise chaos M-ary communication system is proposed, in which a pre-distortion filter is added after the chaos baseband modulator in the transmitter and whitening filter is added before zone partition demodulator in the receiver. Finally, the chaos M-ary communication system based on Hamilton oscillator is constructed and simulated in different channel noise. The result shows that the proposed method in this paper can improve the anti-color-noise performance of the whole communication system compared with the former system, and it has better anti-fading and resisting disturbance performance than Quadrature Phase Shift Keying system.

  1. The design and research of anti-color-noise chaos M-ary communication system

    International Nuclear Information System (INIS)

    Fu, Yongqing; Li, Xingyuan; Li, Yanan; Zhang, Lin

    2016-01-01

    Previously a novel chaos M-ary digital communication method based on spatiotemporal chaos Hamilton oscillator has been proposed. Without chaos synchronization circumstance, it has performance improvement in bandwidth efficiency, transmission efficiency and anti-white-noise performance compared with traditional communication method. In this paper, the channel noise influence on chaotic modulation signals and the construction problem of anti-color-noise chaotic M-ary communication system are studied. The formula of zone partition demodulator’s boundary in additive white Gaussian noise is derived, besides, the problem about how to determine the boundary of zone partition demodulator in additive color noise is deeply studied; Then an approach on constructing anti-color-noise chaos M-ary communication system is proposed, in which a pre-distortion filter is added after the chaos baseband modulator in the transmitter and whitening filter is added before zone partition demodulator in the receiver. Finally, the chaos M-ary communication system based on Hamilton oscillator is constructed and simulated in different channel noise. The result shows that the proposed method in this paper can improve the anti-color-noise performance of the whole communication system compared with the former system, and it has better anti-fading and resisting disturbance performance than Quadrature Phase Shift Keying system.

  2. Authentication of meat from game and domestic species by SNaPshot minisequencing analysis.

    Science.gov (United States)

    La Neve, Fabio; Civera, Tiziana; Mucci, Nadia; Bottero, Maria Teresa

    2008-10-01

    The aim of the present study is to develop an assay for the specific identification of meat from Capreolus capreolus, Cervus elaphus, Capra ibex, Rupicapra rupicapra, targeting sequences of the cytochrome b (cyt b) gene of mitochondrial DNA. The assay is also intended to enable differentiation between meat from these wild species as well as Ovis aries, Capra hircus, Bubalus bubalis, Bos taurus and Sus scrofa domestic species. The primers used in the preliminary PCR were designed in well conserved regions upstream and downstream of the diagnosis sites. They successfully amplified a conserved 232bp region from the cyt b gene of all the species taken into consideration. The sites of diagnosis have been interrogated using a minisequencing reaction and capillary electrophoresis. All the results of the multiplex PER (primer extension reaction) test were confirmed by fragment sequencing. The assay offers the possibility of discriminating nine species at the same time.

  3. Studies on antigenic cross-reactivity of Trichuris ovis with host mucosal antigens in goat

    Directory of Open Access Journals (Sweden)

    Gautam Patra

    2015-12-01

    Full Text Available Objective: To ascertain whether immunodominant antigens of Trichuris ovis might share and cross react with host molecule. Methods: Two crude protein preparations from anterior and posterior parts of Trichuris ovis were characterized along with host mucosal antigen by double immunodiffusion, sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blotting technique. Conventional scanning electron microscopy was performed as per standard procedure. Results: Sharp and distinct bands of three antigens have been found in double immunodiffusion using hyperimmune serum raised in rabbit indicating the presence of specific antibody against each antigen. All three antigens have shown major and minor bands with molecular weight ranging from 15 to 110 kDa during sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Conclusions: The antigenic cross-reactivity was thought to result from shared antigens. The existence of paracloacal papillae found in the anterior part of the male was not a unique feature for species differentiation.

  4. Research Facilities for Solar Astronomy at ARIES P. Pant

    Indian Academy of Sciences (India)

    Aryabhatta Research Institute of Observational Sciences (ARIES), Manora Peak,. Nainital 263 129 .... station-20 computer, a GPS clock for accurate timing, etc. The various CCD ... circulation unit is used for cooling the camera head up to −25.

  5. Olematu olemine. Kulešovi efektist seoses Eisensteini juubeliga / Lauri Kärk ; tõlkinud Kaia Sisask

    Index Scriptorium Estoniae

    Kärk, Lauri, 1954-

    1998-01-01

    Kieli "Cinachea" festivali raames peetud filmiajaloo seminari (22. aprill 1998) teeside põhjal; lisa : Lev Kulešovi elulugu ja filmograafia, tõlge Ephraim Katzi raamatust "The Film Encyclopedia". New York, 1998

  6. Gastrointestinal parasites of sheep, municipality of Lajes, Rio Grande do Norte, Brazil.

    Science.gov (United States)

    de Souza, Maria de Fátima; Pimentel-Neto, Manoel; da Silva, Rízia Maria; Farias, Albeísa Cleyse Batista; Guimarães, Marcos Pezzi

    2012-01-01

    This study investigated the gastrointestinal parasitism by helminths and protozoa in sheep (Ovis aries) Santa Inês breed, municipality of Lajes, Rio Grande do Norte. Monthly, from April 2005 to August 2007, stool samples were collected from two tracer lambs in the first day of the experiment and performed a necropsy of these animals in 44th day. A total of 64 lambs were sampled, but only 62 lambs were slaughtered. The fecal samples were examined by sedimentation in water. The contents of the abomasum, small intestine and large intestine were examined for the recovery of helminths. The parasitological examination revealed eggs of the following groups of helminths: Strongyloidea, Strongyloides sp., Trichuris sp., and Moniezia sp. Also were found oocysts of Eimeria spp., cysts of Entamoeba ovis and Giardia duodenalis. The helminths identified from examining the contents were: Haemonchus contortus, Cooperia pectinata, Cooperia punctata, Trichostrongylus colubriformis, Moniezia expansa, Oesophagostomum sp. Skrjabinema ovis and Trichuris sp.

  7. On δ-derivations of n-ary algebras

    International Nuclear Information System (INIS)

    Kaygorodov, Ivan B

    2012-01-01

    We give a description of δ-derivations of (n+1)-dimensional n-ary Filippov algebras and, as a consequence, of simple finite-dimensional Filippov algebras over an algebraically closed field of characteristic zero. We also give new examples of non-trivial δ-derivations of Filippov algebras and show that there are no non-trivial δ-derivations of the simple ternary Mal'tsev algebra M 8 .

  8. n-ary algebras: a review with applications

    International Nuclear Information System (INIS)

    De Azcarraga, J A; Izquierdo, J M

    2010-01-01

    This paper reviews the properties and applications of certain n-ary generalizations of Lie algebras in a self-contained and unified way. These generalizations are algebraic structures in which the two-entry Lie bracket has been replaced by a bracket with n entries. Each type of n-ary bracket satisfies a specific characteristic identity which plays the role of the Jacobi identity for Lie algebras. Particular attention will be paid to generalized Lie algebras, which are defined by even multibrackets obtained by antisymmetrizing the associative products of its n components and that satisfy the generalized Jacobi identity, and to Filippov (or n-Lie) algebras, which are defined by fully antisymmetric n-brackets that satisfy the Filippov identity. 3-Lie algebras have surfaced recently in multi-brane theory in the context of the Bagger-Lambert-Gustavsson model. As a result, Filippov algebras will be discussed at length, including the cohomology complexes that govern their central extensions and their deformations (it turns out that Whitehead's lemma extends to all semisimple n-Lie algebras). When the skewsymmetry of the Lie or n-Lie algebra bracket is relaxed, one is led to a more general type of n-algebras, the n-Leibniz algebras. These will be discussed as well, since they underlie the cohomological properties of n-Lie algebras. The standard Poisson structure may also be extended to the n-ary case. We shall review here the even generalized Poisson structures, whose generalized Jacobi identity reproduces the pattern of the generalized Lie algebras, and the Nambu-Poisson structures, which satisfy the Filippov identity and determine Filippov algebras. Finally, the recent work of Bagger-Lambert and Gustavsson on superconformal Chern-Simons theory will be briefly discussed. Emphasis will be made on the appearance of the 3-Lie algebra structure and on why the A 4 model may be formulated in terms of an ordinary Lie algebra, and on its Nambu bracket generalization. (topical

  9. ARIES: A mobile robot inspector

    International Nuclear Information System (INIS)

    Byrd, J.S.

    1995-01-01

    ARIES (Autonomous Robotic Inspection Experimental System) is a mobile robot inspection system being developed for the Department of Energy (DOE) to survey and inspect drums containing mixed and low-level radioactive waste stored in warehouses at DOE facilities. The drums are typically stacked four high and arranged in rows with three-foot aisle widths. The robot will navigate through the aisles and perform an autonomous inspection operation, typically performed by a human operator. It will make real-time decisions about the condition of the drums, maintain a database of pertinent information about each drum, and generate reports

  10. Superoxide dismutase from Trichuris ovis, inhibiton by benzimidazoles and pyrimidine derivatives

    OpenAIRE

    Sanchez-Moreno, M.; Garcia-Rejon, L.; Salas, I.; Osuna, A.; Monteoliva, M.

    1992-01-01

    Three superoxide dismutase isoenzymes of different cellular location were detected in an homogenate of Thrichuris ovis. Each of these molecular forms was purified by differential centrifugation and precipitation with ammonium sulphate, followed by chromatography on DEAE-cellulose and Sephadex G-75 columns. The activity levels of the two molecular forms detected in the mitochondrial (one cyanide sensitive Cu-Zn-SOD and the other cyanide intensitive Mn-Sod were higher than that of the superoxid...

  11. Characterization of Trichuris skrjabini by isoenzyme gel electrophoresis: comparative study with Trichuris ovis.

    Science.gov (United States)

    Cutillas, C; German, P; Arias, P; Guevara, D

    1996-10-01

    Morphological and biometric studies were performed in Trichuris skrjabini (Baskakov, 1924) collected from the caecum of Capra hircus. The LDH (EC 1.1.1.27.), G6PD (EC 1.1.1.49.), GPI (EC 5.3.1.9.), MDH (EC 1.1.1.37) and malic enzyme (ME) (EC 1.1.1.40) isoenzymatic patterns of T. skrjabini were determined by starch gel electrophoresis. The G6PD and GPI isoenzymatic patterns of T. skrjabini displayed two anodic bands for both enzymes: one fast migration band and one band near the origin. This isoenzymatic pattern was interpreted as two gene loci encoding both enzymes. The LDH isoenzymatic pattern of T. skrjabini was characterized by the presence of a cathodically migrating band, while the MDH isoenzymatic pattern showed a very slow cathodic band. These two phenotypes were interpreted as the expression of a homozygous state of a gene locus for LDH and MDH in T. skrjabini. The ME isoenzymatic pattern was characterized by the presence of a single anodic band. Further, comparative isoenzymatic studies were carried out between T. skrjabini and T. ovis. The different G6PD, GPI, LDH, MDH and ME isoenzymatic patterns observed for both species allowed us to distinguish them and therefore to use isoenzymatic patterns as a diagnostic tool to differentiate species of Trichuris.

  12. Normal forms for characteristic functions on n-ary relations

    NARCIS (Netherlands)

    D.J.N. van Eijck (Jan)

    2004-01-01

    textabstractFunctions of type (n) are characteristic functions on n-ary relations. Keenan established their importance for natural language semantics, by showing that natural language has many examples of irreducible type (n) functions, i.e., functions of type (n) that cannot be represented as

  13. The Performance of a Mobile Phone Respiratory Rate Counter Compared to the WHO ARI Timer

    Directory of Open Access Journals (Sweden)

    Heng Gan

    2015-01-01

    Full Text Available OBJECTIVE: To compare the accuracy and efficiency of the respiratory rate (RR RRate mobile application to the WHO ARI Timer. METHODS: Volunteers used both devices to measure RR from reference videos of infants and children. Measurements were compared using correlation, Bland-Altman analysis, error metrics and time taken. RESULTS: Measurements with either device were highly correlated to the reference (r = 0.991 and r = 0.982, and to each other (r = 0.973. RRate had a larger bias than the ARI Timer (0.6 vs. 0.04 br/min, but tighter limits of agreement (−4.5 to 3.3 br/min vs. −5.5 to 5.5 br/min. RRate was more accurate than the ARI Timer (percentage error 10.6% vs. 14.8%, root mean square error 2.1 vs. 2.8 br/min and normalized root mean square error 5.6% vs. 7.5%. RRate measurements were 52.7 seconds (95% CI 50.4 s to 54.9 s faster. CONCLUSION: During video observations, RRate measured RR quicker with a similar accuracy compared to the ARI Timer.

  14. Caracterização epidemiológica e fatores de risco associados à infecção por Brucella ovis em ovinos deslanados do semiárido paraibano Epidemiological characterization and risk factors associated with Brucella ovis infection in sheep in the Brazilian semiarid

    Directory of Open Access Journals (Sweden)

    Fabrine A. Santos

    2013-04-01

    Full Text Available Este trabalho teve como objetivo determinar a prevalência de rebanhos ovinos positivos (focos e de animais soropositivos para Brucella ovis na mesorregião do Sertão, Estado da Paraíba, Nordeste do Brasil, bem como identificar fatores de risco. Foram colhidas amostras de sangue de 1.134 animais procedentes de 103 rebanhos em 17 municípios. Para o diagnóstico sorológico da infecção por B. ovis foi utilizado o teste de imunodifusão em gel de ágar (IDGA. Um rebanho foi considerado positivo quando apresentou pelo menos um animal soropositivo. Das 103 propriedades utilizadas 21 (20,39% apresentaram pelo menos um animal soropositivo e dos 1.134 animais, 59 (5,20% foram soropositivos. Realizar higiene nas instalações com periodicidade anual (odds ratio = 7,13; IC 95% = 1,56-32,47; p=0,011 e aquisição de animais (odds ratio = 6,06; IC 95% = 1,39-26,48; p=0,017 foram identificados como fatores de risco. Com base na análise de fatores de risco, recomenda-se a realização de diagnóstico da infecção por B. ovis previamente à aquisição de animais e realização periódica de higienização das instalações.The aim of this investigation was to determine the seroprevalence of Brucella ovis in sheep flocks and individual sheep in the Sertão mesorregion, Paraíba state, Northeastern Brazil, as well as to identify risk factors. Blood samples were collected from 1,134 sheep from 103 flocks in 17 counties. For the serological diagnosis of B. ovis infection the agar gel immunodiffusion test (AGID was carried out. A flock was considered positive when there was at least one seropositive animal. Of the 103 flocks used, 21 (20.39% presented at least one seropositive sheep, and of the 1,134 sheep examined 59 (5.20% seropositive animals were diagnosed. Cleaning of facilities (odds ratio = 7.13; 95% CI=1.56-32.47; p=0.011 and purchase of animals (odds ratio = 6.06; 95% CI=1.39-26.48; p=0.017 were identified as risk factors. Based on the risk factor

  15. A systems analysis of the ARIES tokamak reactors

    International Nuclear Information System (INIS)

    Bathke, C.G.

    1992-01-01

    The multi-institutional ARIES study has completed a series of cost-of-electricity optimized conceptual designs of commercial tokamak fusion reactors that vary the assumed advances in technology and physics. A comparison of these designs indicates the cost benefit of various design options. A parametric systems analysis suggests a possible means to obtain a marginally competitive fusion reactor

  16. ARI3SG: Aerosol retention in the secondary side of a steam generator. Part II: Model validation and uncertainty analysis

    International Nuclear Information System (INIS)

    Lopez, Claudia; Herranz, Luis E.

    2012-01-01

    Highlights: ► Validation of a model (ARI3SG) for the aerosol retention in the break stage of a steam generator under SGTR conditions. ► Interpretation of the experimental SGTR and CAAT data by using the ARI3SG model. ► Assessment of the epistemic and stochastic uncertainties effect on the ARI3SG results. - Abstract: A large body of data has been gathered in the last decade through the EU-SGTR, ARTIST and ARTIST 2 projects for aerosol retention in the steam generator during SGTR severe accident sequences. At the same time the attempt to extend the analytical capability has resulted in models that need to be validated. The ARI3SG is one of such developments and it has been built to estimate the aerosol retention in the break stage of a “dry” steam generator. This paper assesses the ARI3SG predictability by comparing its estimates to open data and by analyzing the effect of associated uncertainties. Datamodel comparison has been shown to be satisfactory and highlight the potential use of an ARI3SG-like formulation in system codes.

  17. A nonsense mutation in the beta-carotene oxygenase 2 (BCO2 gene is tightly associated with accumulation of carotenoids in adipose tissue in sheep (Ovis aries

    Directory of Open Access Journals (Sweden)

    Boman Inger A

    2010-02-01

    Full Text Available Abstract Background Sheep carcasses with yellow fat are sporadically observed at Norwegian slaughter houses. This phenomenon is known to be inherited as a recessive trait, and is caused by accumulation of carotenoids in adipose tissue. Two enzymes are known to be important in carotenoid degradation in mammals, and are therefore potential candidate genes for this trait. These are beta-carotene 15,15'-monooxygenase 1 (BCMO1 and the beta-carotene oxygenase 2 (BCO2. Results In the present study the coding region of the BCMO1 and the BCO2 gene were sequenced in yellow fat individuals and compared to the corresponding sequences from control animals with white fat. In the yellow fat individuals a nonsense mutation was found in BCO2 nucleotide position 196 (c.196C>T, introducing a stop codon in amino acid position 66. The full length protein consists of 575 amino acids. In spite of a very low frequency of this mutation in the Norwegian AI-ram population, 16 out of 18 yellow fat lambs were found to be homozygous for this mutation. Conclusion In the present study a nonsense mutation (c.196C>T in the beta-carotene oxygenase 2 (BCO2 gene is found to strongly associate with the yellow fat phenotype in sheep. The existence of individuals lacking this mutation, but still demonstrating yellow fat, suggests that additional mutations may cause a similar phenotype in this population. The results demonstrate a quantitatively important role for BCO2 in carotenoid degradation, which might indicate a broad enzyme specificity for carotenoids. Animals homozygous for the mutation are not reported to suffer from any negative health or development traits, pointing towards a minor role of BCO2 in vitamin A formation. Genotyping AI rams for c.196C>T can now be actively used in selection against the yellow fat trait.

  18. Closed Form Aliasing Probability For Q-ary Symmetric Errors

    Directory of Open Access Journals (Sweden)

    Geetani Edirisooriya

    1996-01-01

    Full Text Available In Built-In Self-Test (BIST techniques, test data reduction can be achieved using Linear Feedback Shift Registers (LFSRs. A faulty circuit may escape detection due to loss of information inherent to data compaction schemes. This is referred to as aliasing. The probability of aliasing in Multiple-Input Shift-Registers (MISRs has been studied under various bit error models. By modeling the signature analyzer as a Markov process we show that the closed form expression derived for aliasing probability previously, for MISRs with primitive polynomials under q-ary symmetric error model holds for all MISRs irrespective of their feedback polynomials and for group cellular automata signature analyzers as well. If the erroneous behaviour of a circuit can be modelled with q-ary symmetric errors, then the test circuit complexity and propagation delay associated with the signature analyzer can be minimized by using a set of m single bit LFSRs without increasing the probability of aliasing.

  19. ARIES-ST STUDIES REPORT FOR THE PERIOD JANUARY 1, 1998 THROUGH DECEMBER 31, 1998

    International Nuclear Information System (INIS)

    V.S. CHAN; L.L. LAO; Y.R. LIN-LIU; R.L. MILLER; T.W. PETRIE; P.A. POLITZER; R. PRATER; M.J. SCHAFFER; G.M. STAEBLER; R.D. STAMBAUGH; A.D. TURNBULL; W.P.WEST

    1999-01-01

    During 1998, the General Atomics (GA) ARIES-Spherical Torus (ST) team examined several critical issues related to the physics performance of the ARIES-ST design, and a number of suggestions were made concerning possible improvements in performance. These included specification of a reference plasma equilibrium, optimization about the reference equilibrium to achieve higher beta limits, examination of three possible schemes for plasma initiation, development of a detailed scenario for ramp-up of the plasma current and pressure to its full, final operating values, an assessment of the requirement for electron confinement, and several suggestions for divertor heat flux reduction. The reference equilibrium was generated using the TOQ code, with the specification of a 100%, self-consistent bootstrap current. The equilibrium has β = 51%, 10% below the stability limit (a margin specified by the ARIES-ST study). In addition, a series of intermediate equilibria were defined, corresponding to the ramp-up scenario discussed. A study of the influence of shaping on ARIES-ST performance indicates that significant improvement in both kink and ballooning stability can be obtained by modest changes in the squareness of the plasma. In test equilibria the ballooning beta limit is increased from 58% to 67%. Also the maximum allowable plasma-wall separation for kink stability can be increased by 30%. Three schemes were examined for noninductive plasma initiation. These are helicity injection (HICD), electron cyclotron heating (ECH)-assisted startup, and inductive startup using only the external equilibrium coils. HICD startup experiments have been done on the HIT and CDX devices. ECH-assisted startup has been demonstrated on CDX-U and DIII-D. External coil initiation is based on calculations for a proposed DIII-D experiment. In all cases, plasma initiation and preparation of an approximately 0.3 MA plasma for ARIES-ST appears entirely feasible

  20. ARIES NDA Robot operators' manual

    International Nuclear Information System (INIS)

    Scheer, N.L.; Nelson, D.C.

    1998-05-01

    The ARIES NDA Robot is an automation device for servicing the material movements for a suite of Non-destructive assay (NDA) instruments. This suite of instruments includes a calorimeter, a gamma isotopic system, a segmented gamma scanner (SGS), and a neutron coincidence counter (NCC). Objects moved by the robot include sample cans, standard cans, and instrument plugs. The robot computer has an RS-232 connection with the NDA Host computer, which coordinates robot movements and instrument measurements. The instruments are expected to perform measurements under the direction of the Host without operator intervention. This user's manual describes system startup, using the main menu, manual operation, and error recovery

  1. Evaluating methamphetamine use and risks of injection initiation among street youth: the ARYS study

    Directory of Open Access Journals (Sweden)

    Montaner Julio SG

    2006-05-01

    Full Text Available Abstract Many Canadian cities are experiencing ongoing infectious disease and overdose epidemics among injection drug users (IDU. These health concerns have recently been exacerbated by the increasing availability and use of methamphetamine. The challenges of reducing health-related harms among IDU have led to an increased recognition that strategies to prevent initiation into injection drug use must receive renewed focus. In an effort to better explore the factors that may protect against or facilitate entry into injection drug use, the At Risk Youth Study (ARYS has recently been initiated in Vancouver, Canada. The local setting is unique due to the significant infrastructure that has been put in place to reduce HIV transmission among active IDU. The ARYS study will seek to examine the impact of these programs, if any, on non-injection drug users. In addition, Vancouver has been the site of widespread use of methamphetamine in general and has seen a substantial increase in the use of crystal methamphetamine among street youth. Hence, the ARYS cohort is well positioned to examine the harms associated with methamphetamine use, including its potential role in facilitating initiation into injection drug use. This paper provides some background on the epidemiology of illicit drug use among street youth in North America and outlines the methodology of ARYS, a prospective cohort study of street youth in Vancouver, Canada.

  2. Consideraciones epidemiológicas en la prevalencia serológica de Brucella ovis en Zacatecas, México

    Directory of Open Access Journals (Sweden)

    José Maria Carrera Chávez

    2013-01-01

    Full Text Available La epididimitis causada por Brucella ovis es una enfermedad de importancia en los rebaños ovinos de México. En los sementales afectados ocasiona baja productividad por la disminución de la fertilidad. El objetivo del estudio fue determinar la relevancia de diferentes posibles factores de riesgo (sistema de producción, densidad de sementales, total de vientres, relación hembras:macho, sistema de empadre y raza del semental sobre la prevalencia de B. ovis en Zacatecas, México. Se muestrearon 544 sementales, en 153 rebaños, provenientes de cuatro sistemas de producción. La respuesta serológica se evaluó mediante inmunodifusión doble en gel. El 18.6 % (101/544 de los sementales muestreados resultaron positivos y el 10.5 % (16/153 de los rebaños presentó al menos un semental positivo. El sistema semi-intensivo presentó la mayor prevalencia (P<0.05, con 86.1 % (87/101 de sementales positivos, el extensivo 11.9 % (12/101, el traspatio 2.0 % (2/101, y el intensivo no registró positivos. La prevalencia de B. ovis fue más alta en los rebaños más grandes, con mayor número de vientres y sementales. Los sementales de raza Katahdin mostraron mayor prevalencia (30.8 % (24/78 que los Rambouillet (14.0 % (18/129, Dorper (13.8 % (31/224 y Suffolk (13.8 % (8/58 (P<0.05. La prevalencia se relacionó más con el sistema de producción utilizado que con la relación hembras:macho o el sistema de empadre. Los resultados obtenidos sugieren que la cantidad de sementales en el rebaño es el factor de mayor relevancia en la prevalencia serológica de B. ovis (OR = 17.38, 95 % IC 7.76 a 38.94, aunque pudiera estar supeditado al sistema de producción.

  3. A comparison of two agar gel immunodiffusion methods and a complement fixation test for serologic diagnosis of Brucella ovis infection in experimentally infected rams

    Directory of Open Access Journals (Sweden)

    M.N. Xavier

    2011-08-01

    Full Text Available A infecção por Brucella ovis é considerada uma das principais causas de epididimite e infertilidade em carneiros, resultando em falhas reprodutivas e perdas econômicas significativas em rebanhos ovinos ao redor do mundo. O estudo teve o objetivo de avaliar três testes sorológicos disponíveis para o diagnóstico da brucelose ovina por B. ovis, utilizando 181 soros ovinos. Amostras de soro provenientes de carneiros experimentalmente infectados foram coletadas ao longo de 192 dias pós-infecção (n=117 e durante o período pré-infecção (n=9. Adicionalmente, amostras de soro foram obtidas de ovinos provenientes de um rebanho livre para B. ovis (n=55. As técnicas de imunodifusão em gel de agar (IDGA, utilizando dois antígenos disponíveis comercialmente, e de fixação de complemento foram comparadas (FC. Foram obtidos resultados de sensibilidade especificidade semelhantes para ambos os métodos de IDGA e ainda, a técnica de IDGA foi mais eficiente do que a da FC para o diagnóstico sorológico da infecção por B. ovis.

  4. Reactor Configuration Development for ARIES-CS

    International Nuclear Information System (INIS)

    Ku LP

    2005-01-01

    New compact, quasi-axially symmetric stellarator configurations have been developed as part of the ARIES-CS reactor studies. These new configurations have good plasma confinement and transport properties, including low losses of α particles and good integrity of flux surfaces at high β. We summarize the recent progress by showcasing two attractive classes of configurations--configurations with judiciously chosen rotational transforms to avoid undesirable effects of low order resonances on the flux surface integrity and configurations with very small aspect ratios (∼2.5) that have excellent quasi-axisymmetry and low field ripples

  5. Exposure of bighorn sheep to domestic goats colonized with Mycoplasma ovipneumoniae induces sub-lethal pneumonia

    OpenAIRE

    Besser, Thomas E.; Cassirer, E. Frances; Potter, Kathleen A.; Foreyt, William J.

    2017-01-01

    Background Bronchopneumonia is a population limiting disease of bighorn sheep (Ovis canadensis) that has been associated with contact with domestic Caprinae. The disease is polymicrobial but is initiated by Mycoplasma ovipneumoniae, which is commonly carried by both domestic sheep (O. aries) and goats (Capra aegagrus hircus). However, while previous bighorn sheep comingling studies with domestic sheep have resulted in nearly 100% pneumonia mortality, only sporadic occurrence of fatal pneumoni...

  6. Exploration of Compact Stellarators as Power Plants: Initial Results from ARIES-CS Study

    International Nuclear Information System (INIS)

    Najmabadi, Farrokh

    2005-01-01

    A detailed and integrated study of compact stellarators as power plants, ARIES-CS, was initiated recently to advance our understanding of attractive compact stellarator configurations and to define key R and D areas. We have completed phase 1 of ARIES-CS study - our results are described in this paper. We have identified several promising stellarator configurations. High α particle loss of these configurations is a critical issue. It appears that devices with an overall size similar to those envisioned for tokamak power plants are possible. A novel approach was developed in ARIES-CS in which the blanket at the critical areas of minimum stand-off is replaced by a highly efficient WC-based shield. In this manner, we have been able to reduce the minimum stand-off by ∼20%-30% compared to a uniform radial build which was assumed in previous studies. Our examination of engineering options indicates that overall assembly and maintenance procedure plays a critical role in identifying acceptable engineering design and has a major impact on the optimization of a plasma/coil configuration

  7. Determination of Trichuris skrjabini by sequencing of the ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of trichurids.

    Science.gov (United States)

    Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C

    2004-06-01

    Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.

  8. ARIES-RS safety design and analysis

    International Nuclear Information System (INIS)

    Steiner, D.; El-Guebaly, L.; Herring, S.; Khater, H.; Mogahed, E.; Thayer, R.; Tillack, M.S.

    1997-01-01

    The ARIES-RS safety design and analysis focused on achieving two objectives: (1) The avoidance of sheltering or evacuation in the event of an accident; and (2) the generation of only low-level waste, no greater than Class C. The ARIES-RS baseline design employs V-4Cr-4Ti as the blanket structural material and a low activation ferritic steel in the reflector and shield. In the event of a LOCA, the baseline design first wall maximum temperature falls in the range of 1100-1200 C. For this temperature range, the hazard assessment indicates that the dose at the site boundary will be less than 1 rem per year. Thus, no sheltering or evacuation would be required in the event of a LOCA. Although the baseline design satisfies the first safety objective noted above, a first wall maximum temperature of ∝1100-1200 C would likely compromise the integrity of the vanadium blanket structure and would require blanket replacement following such a temperature excursion. To avoid this situation, a modified blanket design incorporating supplemental heat removal is also proposed. Preliminary analysis of this modified design suggests that the first wall maximum temperature can be kept below the temperature range of concern, ∝1000-1100 C, in the event of a LOCA. When the ferritic steel used in the reflector and shield is one reduced in Ir and Ag impurities, all in-vessel components qualify for near-surface shallow land burial as Class C low-level waste. (orig.)

  9. Bovicola ovis and Melophagus ovinus: Spatial distribution on Menz breed Sheep

    OpenAIRE

    Mersha Chanie

    2011-01-01

    This study was done from September 2006 to May 2007. A total of 105 Menz breed sheep from Yemenze Gera Midir district in the Amhara National Regional State, Ethiopia. The spatial distribution of sheep keds (Melophagus ovinus) and chewing lice (Bovicola ovis) on Menz breed sheep were examined which were naturally infested. The densities if sheep keds and lice were determined through counting after parting of the fleece/wool at five (5) points on a length of 10 cm areas of six (6) different reg...

  10. Epidemiological study of the intestinal helminths of wild boar (Sus scrofa) and mouflon (Ovis gmelini musimon) in central Italy.

    Science.gov (United States)

    Magi, M; Bertani, M; Dell'Omodarme, M; Prati, M C

    2002-12-01

    Since 1995 the population of wild ungulates increased significantly in the "Parco provinciale dei Monti Livornesi" (Livorno, Tuscany, Central Italy). We studied the intestinal macroparasites of two hosts, the wild boar (Sus scrofa) and the mouflon (Ovis gmelini musimon). In the case of wild boars we found a dominant parasite species, Globocephalus urosubulatus. For this parasite the frequency distribution of the number of parasites per host agrees with a negative binomial distribution. There is not a significant correlation between the age of the animals and the parasitosis. Furthermore the mean parasite burden of male and female wild boars does not differ significantly. In the case of mouflons we found a dominant parasite species Nematodirus filicollis with Trichuris ovis as codominant species.

  11. Role of carriers in the transmission of pneumonia in bighorn sheep (Ovis canadensis)

    OpenAIRE

    Raghavan, Bindu; Erickson, Kayla; Kugadas, Abirami; Batra, Sai A.; Call, Douglas R.; Davis, Margaret A.; Foreyt, William J.; Srikumaran, Subramaniam

    2016-01-01

    ABSTRACT In the absence of livestock contact, recurring lamb mortality in bighorn sheep (Ovis canadensis) populations previously exposed to pneumonia indicates the likely presence of carriers of pneumonia-causing pathogens, and possibly inadequate maternally derived immunity. To investigate this problem we commingled na?ve, pregnant ewes (n=3) with previously exposed rams (n=2). Post-commingling, all ewes and lambs born to them acquired pneumonia-causing pathogens (leukotoxin-producing Pasteu...

  12. Antigenic Cross-reactivity among Haemonchus contortus, Oesophagostomum columbianum and Trichuris ovis of Goat

    OpenAIRE

    JAS, Ruma; GHOSH, Joydeb; DAS, Kinsuk

    2016-01-01

    Background: Cross antigenicity is the major problem in developing a reliable tool for immunodiagnosis and immunoprophylaxis of parasitic diseases. Mixed infection due to different types of gastrointestinal parasites is more common than single species infection under field condition.Methods: The present study was undertaken to detect antigenic cross-reactivity among Haemonchus contortus, Oesophagostomum columbianum and Trichuris ovis of goats by SDS-PAGE and western blot analysis using hyperim...

  13. Feeding characteristics of sheep ( Ovis aries ) and Grant\\'s gazelles ...

    African Journals Online (AJOL)

    , neutral detergent fibre, acid detergent fibre, cellulose, lignin and in vitro dry matter digestibility. Sheep were predominantly grazers during both the dry and wet season while Grant's gazelles were mixed feeders, with a higher consumption of ...

  14. [Changes in the ECG telemetry of lambs infected with Cysticercus ovis].

    Science.gov (United States)

    Kostov, I; Georgieva, D

    1985-01-01

    Six lambs were experimentally infected with Cysticercus ovis. Some changes were followed up in the ECG by means of the radiotelemetric method. The infection process led to the following more important changes, such as sinus tachicardia and arhythmia, auricular fibrilation, sinoauricular block, atrial dissociation, the incidence of a pathologic Q deflection; lowering of the R deflection amplitude, and inversion of the T wave. It was found that the changes referred to persist for a longer period (in the case of infarction), and could be made use of in dispensary studies.

  15. External Ophthalmomyiasis Caused by Oestrus ovis: A Rare Case Report from India

    OpenAIRE

    Pandey, Anita; Madan, Molly; Asthana, Ashish K.; Das, Anupam; Kumar, Sandeep; Jain, Kirti

    2009-01-01

    Myiasis of different organs has been reported off and on from various regions in the world. We report a human case of external ophthalmomyiasis caused by the larvae of a sheep nasal botfly, Oestrus ovis, for the first time from Meerut city in Western Uttar Pradesh, India. A 25-year-old farmer presented with severe symptoms of conjunctivitis. The larvae, 3 in number, were observed in the bulbar conjunctiva, and following removal the symptoms of eye inflammation improved within a few hours.

  16. Summary of the PULSAR and ARIES studies

    International Nuclear Information System (INIS)

    Najmabadi, F.; Conn, R.W.

    1994-01-01

    The PULSAR research program is a multi-institutional effort to investigate the feasibility and potential features of fusion power plants based on pulsed, inductively driven tokamak operation. In order to provide a sensible assessment of pulsed tokamak operation, a comparison with the ARIES steady-state power plant designs has been made. Two PULSAR designs have been considered: PULSAR-I uses He coolant, a solid tritium-breeding material, and SiC composite structure; PULSAR-II uses liquid Li as the coolant and tritium breeder, and a V-alloy structure material. This paper focuses on the PULSAR design and the comparison with steady-state ARIES designs. The 1000-MWe PULSAR design has an aspect ratio of 4, a plasma major radius of 8.6m, a plasma minor radius of 2.2m, and a neutron wall loading of l.3MW/m 2 . The toroidal field on axis is 7T, plasma β is 2.8%, plasma current is 14MA, and the bootstrap fraction is 37%. Because of cyclic fatigue, the allowable stress in the TF coils is lower, and, therefore, for the same magnet technology, the maximum toroidal field on the coil is 12T in the PULSAR design (corresponding to 16T in a steady-state device). This decrease in the toroidal-field strength more than offsets the gains in plasma β values for a pulsed device, resulting in a lower fusion-power density and a larger tokamak relative to a steady-state design

  17. On The (honest) truth about dishonesty: How we lie to everyone: Especially ourselves by Dan Ariely

    OpenAIRE

    Hajdu, Csongor

    2016-01-01

    In this book Dan Ariely follows the topic he started to discuss in his prior book, the Predictably Irrational: stating that there is logic and consistency behind irrational human thinking and actions. Ariely goes into more details and leads the general topic of irrationality through a narrow-down approach to the topic of cheating, one of the fields we could observe to work irrationally in some cases, and even within that to cheating within organizational environment.

  18. New Insights into the Phylogeny and Gene Context Analysis of Binder of Sperm Proteins (BSPs.

    Directory of Open Access Journals (Sweden)

    Edith Serrano

    Full Text Available Seminal plasma (SP proteins support the survival of spermatozoa acting not only at the plasma membrane but also by inhibition of capacitation, resulting in higher fertilizing ability. Among SP proteins, BSP (binder of sperm proteins are the most studied, since they may be useful for the improvement of semen diluents, storage and subsequent fertilization results. However, an updated and detailed phylogenetic analysis of the BSP protein superfamily has not been carried out with all the sequences described in the main databases. The update view shows for the first time an equally distributed number of sequences between the three families: BSP, and their homologs 1 (BSPH1 and 2 (BSPH2. The BSP family is divided in four subfamilies, BSP1 subfamily being the predominant, followed by subfamilies BSP3, BSP5 and BSP2. BSPH proteins were found among placental mammals (Eutheria belonging to the orders Proboscidea, Primates, Lagomorpha, Rodentia, Chiroptera, Perissodactyla and Cetartiodactyla. However, BSPH2 proteins were also found in the Scandentia order and Metatheria clade. This phylogenetic analysis, when combined with a gene context analysis, showed a completely new evolutionary scenario for the BSP superfamily of proteins with three defined different gene patterns, one for BSPs, one for BSPH1/BSPH2/ELSPBP1 and another one for BSPH1/BSPH2 without ELSPBP1. In addition, the study has permitted to define concise conserved blocks for each family (BSP, BSPH1 and BSPH2, which could be used for a more reliable assignment for the incoming sequences, for data curation of current databases, and for cloning new BSPs, as the one described in this paper, ram seminal vesicle 20 kDa protein (RSVP20, Ovis aries BSP5b.

  19. External Ophthalmomyiasis Caused by Oestrus ovis: A Rare Case Report from India

    Science.gov (United States)

    Madan, Molly; Asthana, Ashish K.; Das, Anupam; Kumar, Sandeep; Jain, Kirti

    2009-01-01

    Myiasis of different organs has been reported off and on from various regions in the world. We report a human case of external ophthalmomyiasis caused by the larvae of a sheep nasal botfly, Oestrus ovis, for the first time from Meerut city in Western Uttar Pradesh, India. A 25-year-old farmer presented with severe symptoms of conjunctivitis. The larvae, 3 in number, were observed in the bulbar conjunctiva, and following removal the symptoms of eye inflammation improved within a few hours. PMID:19290093

  20. Receiver Architecture for 12.5 Gb/s 16-ary Pulse Position Modulation (PPM) Signaling

    Energy Technology Data Exchange (ETDEWEB)

    Mendez, A J; Gagliardi, R M; Hernandez, V J; Bennett, C V

    2008-07-11

    PPM is a signaling scheme that enables the transmission of multiple bits per symbol [1]. It has found favor in the regime of free space optical communications ('FSO' or 'Lasercom'); however, PPM has yet to be widely applied to fiber optic-based communications. Its limitation in fiber results from the exceedingly high bandwidth requirements needed to electronically process a directly detected pulse, especially as the symbol rate increases and the pulse width correspondingly decreases. As a solution, we introduced the concept of a virtual quadrant receiver for receiving 1.25 Gb/s 4-ary PPM, where photonic processing reduced the number of required electronic components [2]. In this paper, we extend these photonic process techniques to a 16-ary, 12.5 Gb/s (10 Gb/s plus 8B/10B line coding) PPM communications system for fiber optic avionics, wherein much of the receiver processing is enabled by techniques based on planar lightwave circuits (PLCs). The architecture is applicable to higher input data rates and M-ary PPM. In the following, we present the PPM encoding and decoding architectures and numerically simulated results.

  1. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations.

    Science.gov (United States)

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C

    2012-05-25

    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Host preference of the sheep scab mite, Psoroptes ovis : short communication

    Directory of Open Access Journals (Sweden)

    T. Meintjies

    2002-07-01

    Full Text Available Sheep scab mites, Psoroptes ovis, collected from a Merino donor sheep, were used to infest Merino and Dorper sheep, and Angora and Boer goats. Mites were placed on the sheep on 1 or 2 occasions and on 5 occasions on the goats. All the animals were examined at regular intervals for the presence of scab lesions and living mites. Both sheep breeds developed lesions, but those on the Merino sheep were always larger than those on the Dorper sheep at the same intervals after infestation. None of the goats developed lesions or showed signs of irritation, or harboured any mites.

  3. Health effects assessment of chemical exposures: ARIES methodology

    Energy Technology Data Exchange (ETDEWEB)

    Sierra, L; Montero, M.; Rabago, I.; Vidania, R.

    1995-07-01

    In this work, we present ARIES* update: a system designed in order to facilitate the human health effects assessment produced by accidental release of toxic chemicals. The first version of ARIES was developed in relation to 82/501/EEC Directive about mayor accidents in the chemical industry. So, the first aim was the support of the effects assessment derived for the chemicals included into this directive. From this establishment, it was considered acute exposures for high concentrations. In this report, we present the actual methodology for considering other type of exposures, such as environmental and occupational. Likewise other versions, the methodology comprises two approaches: quantitative and qualitative assessments. Quantitative assessment incorporates the mathematical algorithms useful to evaluate the effects produced by the most important routes of exposure: inhalation, ingestion, eye contact and skin absorption, in a short, medium and long term. It has been included models that realizes an accurate quantification of doses, effects,... and so on, such as simple approaches when the available information is not enough. Qualitative assessment, designed in order to complement or replace the previous one, is incorporated into an informatics system, developed in Clipper. It executes and displays outstanding and important toxicological information of about 100 chemicals. This information comes from ECDIN (Environmental Chemicals Data and Information Network) database through a collaboration with JRC-ISPRA working group. (Author) 24 refs.

  4. Health effects assessment of chemical exposures: ARIES methodology

    International Nuclear Information System (INIS)

    Sierra, L; Montero, M.; Rabago, I.; Vidania, R.

    1995-01-01

    In this work, we present ARIES* update: a system designed in order to facilitate the human health effects assessment produced by accidental release of toxic chemicals. The first version of ARIES was developed in relation to 82/501/EEC Directive about mayor accidents in the chemical industry. So, the first aim was the support of the effects assessment derived for the chemicals included into this directive. From this establishment, it was considered acute exposures for high concentrations. In this report, we present the actual methodology for considering other type of exposures, such as environmental and occupational. Likewise other versions, the methodology comprises two approaches: quantitative and qualitative assessments. Quantitative assessment incorporates the mathematical algorithms useful to evaluate the effects produced by the most important routes of exposure: inhalation, ingestion, eye contact and skin absorption, in a short, medium and long term. It has been included models that realizes an accurate quantification of doses, effects,... and so on, such as simple approaches when the available information is not enough. Qualitative assessment, designed in order to complement or replace the previous one, is incorporated into an informatics system, developed in Clipper. It executes and displays outstanding and important toxicological information of about 100 chemicals. This information comes from ECDIN (Environmental Chemicals Data and Information Network) database through a collaboration with JRC-ISPRA working group. (Author) 24 refs

  5. Configuration and engineering design of the ARIES-RS tokamak power plant

    International Nuclear Information System (INIS)

    Tillack, M.S.; Malang, S.; Waganer, L.; Wang, X.R.; Sze, D.K.; El-Guebaly, L.; Wong, C.P.C.; Crowell, J.A.; Mau, T.K.; Bromberg, L.

    1997-01-01

    ARIES-RS is a conceptual design study which has examined the potential of an advanced tokamak-based power plant to compete with future energy sources and play a significant role in the future energy market. The design is a 1000 MWe, DT-burning fusion power plant based on the reversed-shear tokamak mode of plasma operation, and using moderately advanced engineering concepts such as lithium-cooled vanadium-alloy plasma-facing components. A steady-state reversed shear tokamak currently appears to offer the best combination of good economic performance and physics credibility for a tokamak-based power plant. The ARIES-RS engineering design process emphasized the attainment of the top-level mission requirements developed in the early part of the study in a collaborative effort between the ARIES Team and representatives from U.S. electric utilities and industry. Major efforts were devoted to develop a credible configuration that allows rapid removal of full sectors followed by disassembly in the hot cells during plant operation. This was adopted as the only practical means to meet availability goals. Use of an electrically insulating coating for the self-cooled blanket and divertor provides a wide design window and simplified design. Optimization of the shield, which is one of the larger cost items, significantly reduced the power core cost by using ferritic steel where the power density and radiation levels are low. An additional saving is made by radial segmentation of the blanket, such that large segments can be reused. The overall tokamak configuration is described here, together with each of the major fusion power core components: the first-wall, blanket and shield; divertor; heating, current drive and fueling systems; and magnet systems. (orig.)

  6. Tunne Kelam - kolleeg ja sõber / Christopher Beazley, Elmar Bork, Ari Vatanen ...[jt.

    Index Scriptorium Estoniae

    2009-01-01

    Euroopa Parlamendi väliskomisjoni liikmed Christopher Beazley, Elmar Bork, Ari Vatanen, Leedu Vabariigi president Valdas Adamkus, Euroopa Parlamendi asepresident Alejo Vidal-Quadras ja Euroopa Parlamendi president Hans-Gert Pöttering Tunne Kelamist

  7. Rapid serum agglutination and agar gel immunodiffusion tests associated to clinical signs in rams experimentally infected with Brucella ovis Teste de soro aglutinação rápida e do teste de imunodifusão em gel de ágar associados aos sinais clínicos em carneiros infectados experimentalmente com Brucella ovis

    Directory of Open Access Journals (Sweden)

    Cristiane Nakada Nozaki

    2011-08-01

    Full Text Available The purpose of this study was to evaluate the agar gel immunodiffusion and the rapid serum agglutination tests associated to clinical signs in rams experimentally infected with Brucella ovis. The serological profile during the 12 months of infection showed a large fluctuation of antibodies that favors the failure in the diagnostic. The evaluation of tests after the experimental infection allowed to suggest that none of the tests were able to detect the infection throughout the period of study. The study reinforces the importance of considering the clinical signs to support the diagnosis of Brucella ovis infection in rams.O objetivo deste estudo foi avaliar o uso do teste de imunodifusão em gel de ágar e o teste sorológico de aglutinação rápida comparados aos sinais clínicos em carneiros infectados experimentalmente com Brucella ovis para o diagnóstico confirmatório da brucelose ovina. O perfil sorológico durante os 12 meses pós-infecção mostrou flutuação da resposta por anticorpos, que favorece a falha no diagnóstico. A avaliação dos testes indicou que nenhum dos testes foi capaz de detectar a infecção durante todo o período de estudo. O estudo ressalta a importância de considerar os sinais clínicos para apoiar o diagnóstico confirmatório da infecção por Brucella ovis em carneiros.

  8. The ARIES-ST study: Assessment of the spherical tokamak concept as fusion power plants

    International Nuclear Information System (INIS)

    Najmabadi, F.; Tillack, M.; Miller, R.; Mau, T.K.; Jardin, S.; Stambaugh, R.; Steiner, D.; Waganer, L.

    2001-01-01

    Recent experimental achievements and theoretical studies have generated substantial interest in the spherical tokamak concept. The ARIES-ST study was undertaken as a national U.S. effort to investigate the potential of the spherical tokamak concept as a fusion power plant and as a vehicle for fusion development. The 1000-MWe ARIES-ST power plant has an aspect ratio of 1.6, a major radius of 3.2 m, a plasma elongation (at 95% flux surface) of 3.4 and triangularity of 0.64. This configuration attains a β of 54% (which is 90% of the maximum theoretical β). While the plasma current is 31 MA, the almost perfect alignment of bootstrap and equilibrium current density profiles results in a current-drive power of only 31 MW. The on-axis toroidal field is 2.1 T and the peak field at the TF coil is 7.6 T, which leads to 288 MW of Joule losses in the normal-conducting TF system. The ARIES-ST study has highlighted many areas where tradeoffs among physics and engineering systems are critical in determining the optimum regime of operation for spherical tokamaks. Many critical issues also have been identified which must be resolved in R and D programs. (author)

  9. First molecular evidence of Anaplasma ovis and Rickettsia spp. in keds (Diptera: Hippoboscidae) of sheep and wild ruminants.

    Science.gov (United States)

    Hornok, Sándor; de la Fuente, José; Biró, Nóra; Fernández de Mera, Isabel G; Meli, Marina L; Elek, Vilmos; Gönczi, Eniko; Meili, Theres; Tánczos, Balázs; Farkas, Róbert; Lutz, Hans; Hofmann-Lehmann, Regina

    2011-10-01

    To evaluate the presence of rickettsial agents in hippoboscid flies with molecular methods, 81 sheep keds (Melophagus ovinus) were collected from 23 sheep, 144 deer keds (Lipoptena cervi) were caught in the environment, and a further 463 and 59 individuals of the latter species were obtained from fresh carcasses of 29 red deer and 17 roe deer, respectively. DNA was extracted individually or in pools. Anaplasma ovis was demonstrated in all examined sheep keds, and from one pool of free-living deer keds. Rickettsia helvetica or other, unidentified rickettsiae were also present in one pool of sheep keds, and in four pools of deer keds from both red deer and roe deer. This is the first account of polymerase chain reaction positivity of hippoboscid flies for A. ovis and rickettsiae. These results raise the possibility that-apart from cattle and roe deer as already reported-sheep and red deer might also play a reservoir role in the epidemiology of rickettsioses.

  10. Transmitter and Translating Receiver Design For 64-ary Pulse Position Modulation (PPM)

    Energy Technology Data Exchange (ETDEWEB)

    Mendez, A J; Hernandez, V J; Gagliardi, R M; Bennett, C V

    2010-01-20

    This paper explores the architecture and design of an optically-implemented 64-ary PPM transmitter and direct-translating receiver that effectively translates incoming electrically-generated bit streams into optical PPM symbols (and vice-versa) at > 1 Gb/s data rates. The PPM transmitter is a cascade of optical switches operating at the frame rate. A corresponding receiver design is more difficult to architect and implement, since increasing data rates lead to correspondingly shorter decision times (slot times and frame times). We describe a solution in the form of a time-to-space mapping arrayed receiver that performs a translating algorithm represented as a code map. The technique for generating the code map is described, and the implementation of the receiver as a planar lightwave circuit is given. The techniques for implementing the transmitter and receiver can be generalized for any case of M-ary PPM.

  11. Sarcocystis spp. in domestic sheep in Kunming City, China: prevalence, morphology, and molecular characteristics

    Directory of Open Access Journals (Sweden)

    Hu Jun-Jie

    2017-01-01

    Full Text Available Sheep (Ovis aries are intermediate hosts for at least six named species of Sarcocystis: S. tenella, S. arieticanis, S. gigantea, S. medusiformis, S. mihoensis, and S. microps. Here, only two species, S. tenella and S. arieticanis, were found in 79 of 86 sheep (91.9% in Kunming, China, based on their morphological characteristics. Four genetic markers, i.e., 18S rRNA gene, 28S rRNA gene, mitochondrial cox1 gene, and ITS-1 region, were sequenced and characterized for the two species of Sarcocystis. Sequences of the three former markers for S. tenella shared high identities with those of S. capracanis in goats, i.e., 99.0%, 98.3%, and 93.6%, respectively; the same three marker sequences of S. arieticanis shared high identities with those of S. hircicanis in goats, i.e., 98.5%, 96.5%, and 92.5%, respectively. No sequences in GenBank were found to significantly resemble the ITS-1 regions of S. tenella and S. arieticanis. Identities of the four genetic markers for S. tenella and S. arieticanis were 96.3%, 95.4%, 82.5%, and 66.2%, respectively.

  12. Sarcocystis spp. in domestic sheep in Kunming City, China: prevalence, morphology, and molecular characteristics.

    Science.gov (United States)

    Hu, Jun-Jie; Huang, Si; Wen, Tao; Esch, Gerald W; Liang, Yu; Li, Hong-Liang

    2017-01-01

    Sheep (Ovis aries) are intermediate hosts for at least six named species of Sarcocystis: S. tenella, S. arieticanis, S. gigantea, S. medusiformis, S. mihoensis, and S. microps. Here, only two species, S. tenella and S. arieticanis, were found in 79 of 86 sheep (91.9%) in Kunming, China, based on their morphological characteristics. Four genetic markers, i.e., 18S rRNA gene, 28S rRNA gene, mitochondrial cox1 gene, and ITS-1 region, were sequenced and characterized for the two species of Sarcocystis. Sequences of the three former markers for S. tenella shared high identities with those of S. capracanis in goats, i.e., 99.0%, 98.3%, and 93.6%, respectively; the same three marker sequences of S. arieticanis shared high identities with those of S. hircicanis in goats, i.e., 98.5%, 96.5%, and 92.5%, respectively. No sequences in GenBank were found to significantly resemble the ITS-1 regions of S. tenella and S. arieticanis. Identities of the four genetic markers for S. tenella and S. arieticanis were 96.3%, 95.4%, 82.5%, and 66.2%, respectively. © J.-J. Hu et al., published by EDP Sciences, 2017.

  13. Reappearance of Taenia ovis krabbei muscle cysts in a roe deer (Capreolus capreolus) in Denmark after 60+ years

    DEFF Research Database (Denmark)

    Al-Sabi, Mohammad Nafi Solaiman; Chriél, Mariann; Holm, Elisabeth

    2013-01-01

    The present report describes the reappearance of Taenia ovis krabbei in a roe deer from Denmark after more than 60 years. The cysticerci were isolated from the thigh muscle of the deer, and the diagnosis was based on histostological analysis, morphology of the rostellar-hooks as well as molecular...

  14. Evidence for a Common Origin of Blacksmiths and Cultivators in the Ethiopian Ari within the Last 4500 Years: Lessons for Clustering-Based Inference.

    Directory of Open Access Journals (Sweden)

    Lucy van Dorp

    2015-08-01

    Full Text Available The Ari peoples of Ethiopia are comprised of different occupational groups that can be distinguished genetically, with Ari Cultivators and the socially marginalised Ari Blacksmiths recently shown to have a similar level of genetic differentiation between them (FST ≈ 0.023 - 0.04 as that observed among multiple ethnic groups sampled throughout Ethiopia. Anthropologists have proposed two competing theories to explain the origins of the Ari Blacksmiths as (i remnants of a population that inhabited Ethiopia prior to the arrival of agriculturists (e.g. Cultivators, or (ii relatively recently related to the Cultivators but presently marginalized in the community due to their trade. Two recent studies by different groups analysed genome-wide DNA from samples of Ari Blacksmiths and Cultivators and suggested that genetic patterns between the two groups were more consistent with model (i and subsequent assimilation of the indigenous peoples into the expanding agriculturalist community. We analysed the same samples using approaches designed to attenuate signals of genetic differentiation that are attributable to allelic drift within a population. By doing so, we provide evidence that the genetic differences between Ari Blacksmiths and Cultivators can be entirely explained by bottleneck effects consistent with hypothesis (ii. This finding serves as both a cautionary tale about interpreting results from unsupervised clustering algorithms, and suggests that social constructions are contributing directly to genetic differentiation over a relatively short time period among previously genetically similar groups.

  15. Whale shark economics: a valuation of wildlife tourism in South Ari Atoll, Maldives

    KAUST Repository

    Cagua, Edgar F.; Collins, Neal; Hancock, James; Rees, Richard

    2014-01-01

    Whale sharks attract large numbers of tourists, divers and snorkelers each year to South Ari Atoll in the Republic of Maldives. Yet without information regarding the use and economic extent of the attraction, it is difficult to prioritize

  16. Studies on Aries River (Apuseni Mountains pollution using factorial analyses (in Romanian

    Directory of Open Access Journals (Sweden)

    Forray Ferenc La̒za̒r

    2001-04-01

    Full Text Available In the present study we try to use factor analysis in the characterisation of river water chemistry between the municipalities of Cheia and Muncel along a 54-km stretch of the Aries River (NW Romania. The results show that 4 factors can explain 88% of the water chemistry. The first factor explains 39% of the total data variance, and represents the water-rock interactions. This high percent indicates the importance of water rock interactions in defining the chemistry of surface waters. The second factor explains 23% of the data variation and represents the influence of mining effluents. The influence of the mine tailings on water chemistry is represented by the third factor. The sum of the second and the third factor can explain 40% of the total data variance, which confirms that the Arieş River is highly polluted by the mining industry. The last factor, which explains 8% of data variation represents the influence of the agricultural and domestic effluents.

  17. External ophthalmomyiasis presenting to an emergency department: corneal findings as a sign of Oestrus ovis.

    Science.gov (United States)

    Gholamhossein, Yaghoubi; Behrouz, Heydari

    2013-10-01

    This study aims to determine the frequency of opthalmyomyiasis externa and the ocular findings of disease in Southern Khorasan. All patients referred to the emergency department of Valiaser hospital during the year 2011 with external ophthalmomyiasis were enrolled in this study. The diagnosis of external ophthalmomyiasis was made according to clinical findings and the presence of Oestrus ovis larvae. There were 18 cases of external ophthalmomyiasis in the emergency department of Valiaser hospital in 2011. Most cases had the common signs and symptoms of allergic conjunctivitis, except for three males who were referred with respective complaints of red eye, foreign body sensation, and swelling around the eyelids after contact injury the previous day; corneal infiltration was present in three cases. The visual acuity among the three cases that had peripheral corneal involvement was 20 / 30 in both eyes. The bulbar conjunctiva showed chemosis in all cases and a ropy pattern discharge that was clinically compatible with external ophthalmomyiasis. However, in one case, microscopic slit lamp examination did not show Oestrus ovis larvae. The frequency of external ophthalmomyiasis was high in this region. Although external ophthalmomyiasis usually manifests as allergic conjunctivitis, coronary-like corneal infiltration may be considered in the differential diagnosis of external ophthalmomyiasis or toxic insult.

  18. Animal and plant remains in a tomb in test-pit 1/05, outside the fortified imperial palace Felix Romuliana

    Directory of Open Access Journals (Sweden)

    Dimitrijević Vesna

    2007-01-01

    Full Text Available During the excavations of a tomb located outside the defence walls of the imperial palace, Felix Romuliana, animal and plant remains were collected the analysis of which is the subject of the present study. The faunal remains include the bones and teeth of domestic animals - mule (Equus caballus x Equus asinus, domestic ox (Bos taurus, sheep (Ovis aries, sheep or goat (Ovis/Capra, pig (Sus domesticus and dog (Canis familiaris, a few remains of wild animals - red deer (Cervus elaphus and fox (Vulpes vulpes, and bone of a bird. Until now, no remains of mule have been discovered on sites originating from the classical period at the territory of Serbia. As for plant remains, pieces of carbonized oak wood (Quercus and maple wood (Acer were found, as well as a carbonized seed of a cultivated grapevine (Vitis vinifera vinifera and a tiny fruit of goosegrass (Galium aparine.

  19. Pharmacokinetics of a Transdermal Fentanyl Solution in Suffolk Sheep (Ovis aries).

    Science.gov (United States)

    Jen, Kimberly Y; Dyson, Melissa C; Lester, Patrick A; Nemzek, Jean A

    2017-09-01

    Sheep used as surgical models require appropriate pain management, and the commonly used transdermal fentanyl patches require a long predosing period to achieve adequate plasma concentrations. The aim of this study was to assess the pharmacokinetic parameters of an FDA-approved transdermal fentanyl solution (TFS) that has yet to be tested in sheep. In this study, we compared TFS at 2.7 mg/kg (n = 2), 1.7 mg/kg (n = 3), and 0.5 mg/kg (n = 3) with the control fentanyl patch at 2 μg/kg/h (n = 1); both products were applied topically to the intrascapular region. Plasma concentrations showed significant interanimal variability. Severe adverse effects occurred at both 2.7 and 1.7 mg/kg TFS and mild to moderate adverse effects were noted at 0.5 mg/kg. At all 3 doses, TFS had greater maximal concentration, clearance rate, and volume of distribution; shorter time to maximal concentration; and similar half-lives to those of the patch. In addition, we validated the use of a commercial human fentanyl ELISA kit, which positively correlated with the liquid chromatography-mass spectroscopy data, but absolute values did not match. Overall, at all 3 dosages tested (0.5, 1.7, and 2.7 mg/kg), TFS delivered fentanyl plasma concentrations that exceeded the minimal effective concentration; however, adverse effects were noted at all 3 dosages. Caution and further study are required before the use of TFS in sheep can be recommended fully.

  20. Ontogenesis of the oral vestibule in the sheep (Ovis aries, Ruminantia)

    Czech Academy of Sciences Publication Activity Database

    Pavlíková, H.; Witter, K.; Míšek, Ivan

    2001-01-01

    Roč. 248, č. 3 (2001), s. 270-270 ISSN 0362-2525 R&D Projects: GA AV ČR IAA7039901; GA AV ČR KSK6005114 Keywords : striated palatal muscle Subject RIV: EG - Zoology Impact factor: 0.959, year: 2001

  1. Liquid metal cooled divertor for ARIES

    International Nuclear Information System (INIS)

    Muraviev, E.

    1995-01-01

    A liquid metal, Ga-cooled divertor design was completed for the double null ARIES-II divertor design. The design analysis indicated a surface heat flux removal capability of up to 15 MW/m 2 , and its relative easy maintenance. Design issues of configuration, thermal hydraulics, thermal stresses, liquid metal loop and safety effects were evaluated. For coolant flow control, it was found that it is necessary to use some part of the blanket cooling ducts for the draining of liquid metal from the top divertor. In order to minimize the inventory of Ga, it was recommended that the liquid metal loop equipment should be located as close to the torus as possible. More detailed analysis of transient conditions especially under accident conditions was identified as an issue that will need to be addressed

  2. Gastrointestinal parasites of sheep, municipality of Lajes, Rio Grande do Norte, Brazil

    OpenAIRE

    Souza,Maria de Fátima de; Pimentel-Neto,Manoel; Silva,Rízia Maria da; Farias,Albeísa Cleyse Batista; Guimarães,Marcos Pezzi

    2012-01-01

    This study investigated the gastrointestinal parasitism by helminths and protozoa in sheep (Ovis aries) Santa Inês breed, municipality of Lajes, Rio Grande do Norte. Monthly, from April 2005 to August 2007, stool samples were collected from two tracer lambs in the first day of the experiment and performed a necropsy of these animals in 44th day. A total of 64 lambs were sampled, but only 62 lambs were slaughtered. The fecal samples were examined by sedimentation in water. The contents of the ...

  3. New q-ary quantum MDS codes with distances bigger than q/2

    Science.gov (United States)

    He, Xianmang; Xu, Liqing; Chen, Hao

    2016-07-01

    The construction of quantum MDS codes has been studied by many authors. We refer to the table in page 1482 of (IEEE Trans Inf Theory 61(3):1474-1484, 2015) for known constructions. However, there have been constructed only a few q-ary quantum MDS [[n,n-2d+2,d

  4. In live interaction, does familiarity promote attraction or contempt? Reply to Norton, Frost, and Ariely (2011).

    Science.gov (United States)

    Reis, Harry T; Maniaci, Michael R; Caprariello, Peter A; Eastwick, Paul W; Finkel, Eli J

    2011-09-01

    In this reply, we address and refute each of Norton, Frost, and Ariely's (see record 2011-18560-001) specific objections to the conclusion that, ceteris paribus, familiarity breeds liking in live interaction. In particular, we reiterate the importance of studying live interaction rather than decontextualized processes. These rebuttals notwithstanding, we concur with Norton et al.'s call for an integrative model that encompasses both Norton, Frost, and Ariely's (see record 2006-23056-008) results and ours (see record 2011-04644-001), and we point readers toward a description of a possible model presented in our original article. PsycINFO Database Record (c) 2011 APA, all rights reserved.

  5. Does Measles Vaccination Reduce the Risk of Acute Respiratory Infection (ARI and Diarrhea in Children: A Multi-Country Study?

    Directory of Open Access Journals (Sweden)

    Rahul Bawankule

    Full Text Available Pneumonia and diarrhea occur either as complications or secondary infections in measles affected children. So, the integrated Global Action Plan for Pneumonia and Diarrhea (GAPPD by WHO and UNICEF includes measles vaccination as preventive measure in children. The objective of the study is to examine the effect of measles vaccination on Acute Respiratory Infection (ARI and diarrhea in children in the Democratic Republic of Congo, Ethiopia, India, Nigeria, and Pakistan.We analyzed data from the most recent rounds of Demographic and Health Surveys (DHS in the selected countries. We included children age 12-59 months in the analysis. We used multivariable binary logistic regression to examine the effect of measles vaccination on ARI and diarrhea in children. We also estimated Vaccination Effectiveness (VE.More than 60 percent of the children age 12-59 months were given measles vaccine before the survey in the Democratic Republic of Congo, Ethiopia, India and Pakistan. Children who were given the measles vaccine were less likely to suffer from ARI than unvaccinated children in India and Pakistan. Children who were given the measles vaccine had a lower risk of diarrhea than those who did not receive it in all the selected countries except Ethiopia. Measles vaccination was associated with reduction in ARI cases by 15-30 percent in India and Pakistan, and diarrhea cases by 12-22 percent in the Democratic Republic of Congo, India, Nigeria and Pakistan.The receipt of the measles vaccine was associated with decrease in ARI and diarrhea in children. The immunization program must ensure that each child gets the recommended doses of measles vaccine at the appropriate age. The measles vaccination should be given more attention as a preventive intervention under the Global Action Plan for Pneumonia and Diarrhea (GAPPD in all low and middle-income countries.

  6. Does Measles Vaccination Reduce the Risk of Acute Respiratory Infection (ARI) and Diarrhea in Children: A Multi-Country Study?

    Science.gov (United States)

    Bawankule, Rahul; Singh, Abhishek; Kumar, Kaushalendra; Shetye, Sadanand

    2017-01-01

    Pneumonia and diarrhea occur either as complications or secondary infections in measles affected children. So, the integrated Global Action Plan for Pneumonia and Diarrhea (GAPPD) by WHO and UNICEF includes measles vaccination as preventive measure in children. The objective of the study is to examine the effect of measles vaccination on Acute Respiratory Infection (ARI) and diarrhea in children in the Democratic Republic of Congo, Ethiopia, India, Nigeria, and Pakistan. We analyzed data from the most recent rounds of Demographic and Health Surveys (DHS) in the selected countries. We included children age 12-59 months in the analysis. We used multivariable binary logistic regression to examine the effect of measles vaccination on ARI and diarrhea in children. We also estimated Vaccination Effectiveness (VE). More than 60 percent of the children age 12-59 months were given measles vaccine before the survey in the Democratic Republic of Congo, Ethiopia, India and Pakistan. Children who were given the measles vaccine were less likely to suffer from ARI than unvaccinated children in India and Pakistan. Children who were given the measles vaccine had a lower risk of diarrhea than those who did not receive it in all the selected countries except Ethiopia. Measles vaccination was associated with reduction in ARI cases by 15-30 percent in India and Pakistan, and diarrhea cases by 12-22 percent in the Democratic Republic of Congo, India, Nigeria and Pakistan. The receipt of the measles vaccine was associated with decrease in ARI and diarrhea in children. The immunization program must ensure that each child gets the recommended doses of measles vaccine at the appropriate age. The measles vaccination should be given more attention as a preventive intervention under the Global Action Plan for Pneumonia and Diarrhea (GAPPD) in all low and middle-income countries.

  7. Application of SADT and ARIS methodologies for modeling and management of business processes of information systems

    Directory of Open Access Journals (Sweden)

    O. V. Fedorova

    2018-01-01

    Full Text Available The article is devoted to application of SADT and ARIS methodologies for modeling and management of business processes of information systems. The relevance of this article is beyond doubt, because the design of the architecture of information systems, based on a thorough system analysis of the subject area, is of paramount importance for the development of information systems in general. The authors conducted a serious work on the analysis of the application of SADT and ARIS methodologies for modeling and managing business processes of information systems. The analysis was carried out both in terms of modeling business processes (notation and applying the CASE-tool, and in terms of business process management. The first point of view reflects the interaction of the business analyst and the programmer in the development of the information system. The second point of view is the interaction of the business analyst and the customer. The basis of many modern methodologies for modeling business processes is the SADT methodology. Using the methodology of the IDEF family, it is possible to efficiently display and analyze the activity models of a wide range of complex information systems in various aspects. CASE-tool ARIS is a complex of tools for analysis and modeling of the organization's activities. The methodical basis of ARIS is a set of different modeling methods that reflect different views on the system under study. The authors' conclusions are fully justified. The results of the work can be useful for specialists in the field of modeling business processes of information systems. In addition, the article has an oriented character when working on the constituent elements of curricula for students specializing in information specialties and management, provides an update of the content and structure of disciplines on modeling the architecture of information systems and organization management, using models.

  8. Updating ARI Educational Benefits Usage Data Bases for Army Regular, Reserve, and Guard: 2005 - 2006

    National Research Council Canada - National Science Library

    Young, Winnie

    2007-01-01

    This report describes the updating of ARI's educational benefits usage database with Montgomery GI Bill and Army College Fund data for Army Regular, Reserve, and Guard components over the 2005 and 2006 period...

  9. A comparison of steady-state ARIES and pulsed PULSAR tokamak power plants

    International Nuclear Information System (INIS)

    Bathke, C.G.

    1994-01-01

    The multi-institutional ARIES study has completed a series of three steady-state and two pulsed cost-optimized conceptual designs of commercial tokamak fusion power plants that vary the level of assumed advances in technology and physics. The cost benefits of various design options are compared quantitatively. Possible means to improve the economic competitiveness of fusion are suggested

  10. Vegetation map and plant checklist of Ol Ari Nyiro ranch and the ...

    African Journals Online (AJOL)

    Ol Ari Nyiro is a 360 km2 ranch of the Laikipia Plateau, in a semi-arid part of Kenya. The vegetation of the ranch and nearby Mukutan Gorge was mapped, and a preliminary check-list of fungi and vascular plants compiled. The vegetation was classified in 16 different types. A total of 708 species and subspecies were ...

  11. ABSI (A Body Shape Index) and ARI (Anthropometric Risk Indicator) in Bariatric Surgery. First Application on a Bariatric Cohort and Possible Clinical Use.

    Science.gov (United States)

    Consalvo, Vincenzo; Krakauer, Jesse C; Krakauer, Nir Y; Canero, Antonio; Romano, Mafalda; Salsano, Vincenzo

    2018-01-29

    BMI (body mass index) is used to identify candidates for bariatric surgery, with a criterion of BMI ≥ 40. For lesser degrees of obesity, BMI 35-39.9, comorbidities are also considered. A Body Shape Index (ABSI) was derived to correct WC (waist circumference) for BMI and height. ABSI has been shown to be a linear predictor of long-term mortality across the range of BMI. Anthropometric risk indicator (ARI) combines the complementary contributions of BMI and ABSI and further improves mortality hazard prediction. We report for the first time ABSI and ARI for a bariatric surgical cohort at baseline and with 3-year follow-up. ABSI and BMI were calculated for 101 subjects from our bariatric surgery center database at baseline and after 3 years of follow-up. Raw values for BMI and ABSI were converted to Z scores and ARI values based on sex- and age-specific normals and risk associations from the National Health and Nutrition Examination Survey (NHANES) III sample of the US general population. Baseline scores for the anthropometric variables BMI and ABSI and the corresponding ARI were all higher than for the NHANES population sample. At 3-year post surgery, all three measures decreased significantly. While baseline BMI did not predict the change in mortality risk by ARI, baseline ABSI did (r = - 0.73), as did baseline ARI (r = - 0.94). Sleeve gastrectomy lowers ABSI and the associated mortality risk estimated from population studies after 3 years of follow-up. Considering our results, bariatric surgical candidates with BMI in the range of 35 to 39.9 with an increased ABSI-related mortality risk may have considerable survival benefit from bariatric surgery, even in the absence of qualifying comorbidities. 2814.

  12. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    Science.gov (United States)

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  13. Major integration issues in evolving the configuration design space for the Aries-Cs compact stellarator power plant

    International Nuclear Information System (INIS)

    Raffray, A.R.; Malang, S.; El-Guebaly, L.; Ihli, T.; Najmabadi, F.; Wang, X.

    2006-01-01

    The Aries-Cs study has been launched with the goal of developing through physics and engineering optimization an attractive power plant concept based on a compact stellarator configuration. The first phase of the study involved scoping out different physics configurations including two and three field period options. The engineering effort during that phase aimed at scoping out maintenance schemes and power core designs best suited to a compact stellarator configuration. This led to a down selection of the most attractive blanket configurations and maintenance schemes for more detailed studies during the second phase of the study. This paper summarizes early results from the second phase of the Aries-Cs study with a particular emphasis on the engineering effort

  14. notebooks, looking for a very specific di- ary entry that he had made ...

    African Journals Online (AJOL)

    notebooks, looking for a very specific di- ary entry that he had made some years before. As he searches, the audience (or in this case, the reader) is shown glimpses from Fugard's actual diary entries since there is a significant overlap between dramatist and character. As Fugard (and. Fourie) confirms in the foreword to the.

  15. Evaluation of disposal, recycling and clearance scenarios for managing ARIES radwaste after plant decommissioning

    International Nuclear Information System (INIS)

    El-Guebaly, L.

    2007-01-01

    The wealth of experience accumulated over the past 30-40 years of fusion power plant studies must be forged into a new strategy to reshape all aspects of handling the continual stream of radioactive materials during operation and after power plant decommissioning. With tighter environmental controls and the political difficulty of building new repositories worldwide, the disposal option could be replaced with more environmentally attractive scenarios, such as recycling and clearance. We applied the three scenarios to the most recent ARIES compact stellarator power plant. All ARIES-CS components qualify as Class A or C low-level waste, according to the US guidelines, and can potentially be recycled using conventional and advanced remote handling equipment. Approximately 80% of the total waste can be cleared for reuse within the nuclear industry or, preferably, released to the commercial market. This paper documents the recent developments in radwaste management of nuclear facilities and highlights the benefits and challenges of disposal, recycling and clearance

  16. Whale shark economics: a valuation of wildlife tourism in South Ari Atoll, Maldives

    KAUST Repository

    Cagua, Edgar F.

    2014-08-12

    Whale sharks attract large numbers of tourists, divers and snorkelers each year to South Ari Atoll in the Republic of Maldives. Yet without information regarding the use and economic extent of the attraction, it is difficult to prioritize conservation or implement effective management plans. We used empirical recreational data and generalized mixed statistical models to conduct the first economic valuation (with direct spend as the primary proxy) of whale shark tourism in Maldives. We estimated that direct expenditures for whale shark focused tourism in the South Ari Marine Protected Area for 2012 and 2013 accounted for US$7.6 and $9.4 million respectively. These expenditures are based on an estimate of 72,000-78,000 tourists who are involved in whale shark excursions annually. That substantial amount of income to resort owners and operators, and tourism businesses in a relatively small area highlights the need to implement regulations and management that safeguard the sustainability of the industry through ensuring guest satisfaction and whale shark conservation. © 2014 Cagua et al.

  17. Design of the Advanced Rare Isotope Separator ARIS at FRIB

    Energy Technology Data Exchange (ETDEWEB)

    Hausmann, M., E-mail: hausmann@frib.msu.edu [Facility for Rare Isotope Beams, Michigan State University, East Lansing, MI 48824 (United States); Aaron, A.M. [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Amthor, A.M. [Dept. of Physics and Astronomy, Bucknell University, Lewisburg, PA 17837 (United States); Avilov, M.; Bandura, L.; Bennett, R.; Bollen, G.; Borden, T. [Facility for Rare Isotope Beams, Michigan State University, East Lansing, MI 48824 (United States); Burgess, T.W. [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Chouhan, S.S. [Facility for Rare Isotope Beams, Michigan State University, East Lansing, MI 48824 (United States); Graves, V.B. [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Mittig, W. [Facility for Rare Isotope Beams, Michigan State University, East Lansing, MI 48824 (United States); National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824 (United States); Morrissey, D.J. [National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824 (United States); Pellemoine, F.; Portillo, M.; Ronningen, R.M.; Schein, M. [Facility for Rare Isotope Beams, Michigan State University, East Lansing, MI 48824 (United States); Sherrill, B.M. [Facility for Rare Isotope Beams, Michigan State University, East Lansing, MI 48824 (United States); National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824 (United States); Zeller, A. [Facility for Rare Isotope Beams, Michigan State University, East Lansing, MI 48824 (United States)

    2013-12-15

    The Facility for Rare Isotopes Beams (FRIB) at Michigan State University will use projectile fragmentation and induced in-flight fission of heavy-ion primary beams at energies of 200 MeV/u and higher and at a beam power of 400 kW to generate rare isotope beams for experiments in nuclear physics, nuclear astrophysics, and fundamental symmetries, as well as for societal needs. The Advanced Rare Isotope Separator (ARIS) has been designed as a three-stage fragment separator for the efficient collection and purification of the rare isotope beams of interest. A vertically bending preseparator (first stage) with production target and beam dump is fully integrated into a production target facility hot cell with remote handling. The new separator compresses the accepted momentum width of up to ±5% of the beam by a factor of three in the standard operational mode. Provisions for alternate operational modes for specific cases are included in the design. This preseparator is followed by two, horizontally-bending separator stages (second and third stages) utilizing the magnets from the existing A1900 fragment separator at the National Superconducting Cyclotron Laboratory (NSCL). These stages can alternatively be coupled to a single high-resolution separator stage, resulting in the flexibility to optimize the operation for different experiments, including momentum tagging and in-flight particle identification of rare isotope beams. The design of ARIS will be presented with an emphasis on beam physics characteristics, and anticipated operational modes will be described.

  18. Probing the central engine and environment of AGN using ARIES 1.3-m and 3.6-m telescopes

    Science.gov (United States)

    Chand, Hum; Rakshit, Suvendu; Jalan, Priyanka; Ojha, Vineet; Srianand, Raghunathan; Vivek, Mariappan; Mishra, Sapna; Omar, Amitesh; Kumar, Parveen; Joshi, Ravi; Gopal-Krishna; Kumar, Rathna

    2018-04-01

    We discuss three long term observational programmes to probe the central engine and environment of active galactic nuclei (AGN) using the recently installed ARIES 1.3-m and 3.6-m telescopes. The first programme is on the photometric reverberation mapping of low luminosity AGN by mainly using the ARIES 1.3-m telescope. The major impact of this programme other than to estimate the black hole mass will be to extend the broad line region (BLR) radius-luminosity (RBLR-LAGN) relation to the unexplored low luminosity regime, and to constrain the AGN broad line region geometry. The second programme is to use long slit spectroscopy on the ARIES 3.6-m telescope to discover new high redshift quasar pairs with angular separation less than 1-arcmin. Here, the background QSOs sight-line will be used to probe the environment of the foreground QSOs at kpc-Mpc scales. The major impact of this programme will be on the discovery of new pairs which have been missed in the SDSS survey due to fiber collision below 1-arcmin separation, and use them to understand about any excess overdensity around the QSO, any anisotropic emission of QSOs, and/or any episodic activity of QSOs. The third programme is related to spectral variability studies of the C IV broad absorption line (BAL) QSOs, based on low resolution spectroscopy using the ARIES 3.6-m telescope. Here, those most interesting cases will be monitored, where the BAL flow emerges afresh or disappears completely in the C IV trough of BAL QSOs sample as seen in SDSS multi-epoch observations. Continuous monitoring of such a sample will be important for our understanding of the nature and origin of the flow, along with their stability and dynamical evolution.

  19. Pendidikan Karakter Menurut K.H. Hasyim Asy'ari Dalam Kitab Adâb Al-‘Âlim Wa Al-Muta‘Allim

    OpenAIRE

    Sholikah, Sholikah

    2015-01-01

    The article deals with K.H. Hasyim Asy'ari's thought of character education. The result of the study indicates that according to K.H. Hasyim Asy'ari the characters of teachers and students in his work Adab al-‘Âlim wa al-Muta'allim can be classified into three parts, are mentality or character, which should be possessed by teachers and learners: attempts to be done in order to become characterized teachers and learners, and: teaching strategies employed by educators and learning strategies us...

  20. Safety and environmental aspects of the HYLIFE-II and ARIES fusion reactor designs

    International Nuclear Information System (INIS)

    Dolan, T.J.; Longhurst, G.R.; Herring, J.S.

    1993-01-01

    The HYLIFE-II inertial confinement fusion reactor design uses jets of Flibe molten salt to protect the blast chamber walls and to breed tritium. It has a low tritium inventory and effective tritium removal. The issue with this design is not one of safety but of economics. The ARIES reactor designs have safety concerns associated with fires. These reactors designs are described

  1. The Aries Program with emphasis on the International Magnetospherics Studies /IMS/-Porcupine Project

    Science.gov (United States)

    Honecker, H. J.

    1976-01-01

    This paper will discuss the present state of the development of the Aries Sounding Rocket System with particular emphasis on the configuration and subsystems required to support the IMS Program. A brief history of the development program will be presented. The results of the first five flights, three successes and two failures, will be presented and the observed performance compared to theoretical performance.

  2. Isolation and characterization of fatty acid methyl ester (FAME)-producing Streptomyces sp. S161 from sheep (Ovis aries) faeces.

    Science.gov (United States)

    Lu, Y; Wang, J; Deng, Z; Wu, H; Deng, Q; Tan, H; Cao, L

    2013-09-01

    An actinomycete producing oil-like mixtures was isolated and characterized. The strain was isolated from sheep faeces and identified as Streptomyces sp. S161 based on 16S rRNA gene sequence analysis. The strain showed cellulase and xylanase activities. The (1) H nuclear magnetic resonance (NMR) spectra of the mixtures showed that the mixtures were composed of fatty acid methyl esters (52·5), triglycerides (13·7) and monoglycerides (9·1) (mol.%). Based on the gas chromatography-mass spectrometry (GC-MS) analysis, the fatty acid methyl esters were mainly composed of C14-C16 long-chain fatty acids. The results indicated that Streptomyces sp. S161 could produce fatty acid methyl esters (FAME) directly from starch. To our knowledge, this is the first isolated strain that can produce biodiesel (FAME) directly from starch. © 2013 The Society for Applied Microbiology.

  3. Test of the sheep ked Melophagus ovinus (L) as a vector of Anaplasma ovis Lestoquard.

    Science.gov (United States)

    Zaugg, J L; Coan, M E

    1986-05-01

    The sheep ked Melophagus ovinus was evaluated as a possible vector of Anaplasma ovis. In 4 tests, 45 to 293 keds were transferred from sheep with acute anaplasmosis, low level parasitemia, or carrier state of anaplasmosis to individual splenectomized ewes. Keds were confined in stockinette cages attached to the dorsal midline of the recipient hosts for 10 days. Throughout the 90-day observation periods after the keds were transferred, no clinical, serologic, or hematologic evidence of anaplasmosis was detected in any of the ked-recipient ewes. Results indicate that sheep keds probably are not mechanical or biological vectors of the ovine anaplasmosis organism.

  4. Limited sharing of tick-borne hemoparasites between sympatric wild and domestic ungulates.

    Science.gov (United States)

    Ghai, Ria R; Mutinda, Mathew; Ezenwa, Vanessa O

    2016-08-15

    Tick-borne hemoparasites (TBHs) are a group of pathogens of concern in animal management because they are associated with a diversity of hosts, including both wild and domestic species. However, little is known about how frequently TBHs are shared across the wildlife-livestock interface in natural settings. Here, we compared the TBHs of wild Grant's gazelle (Nanger granti) and domestic sheep (Ovis aries) in a region of Kenya where these species extensively overlap. Blood samples collected from each species were screened for piroplasm and rickettsial TBHs by PCR-based amplification of 18S/16S ribosomal DNA, respectively. Overall, 99% of gazelle and 66% of sheep were positive for Babesia/Theileria, and 32% of gazelle and 47% sheep were positive for Anaplasma/Ehrlichia. Sequencing a subset of positive samples revealed infections of Theileria and Anaplasma. Sequences sorted into seven phylogenetically distinct genotypes-two Theileria, and five Anaplasma. With the exception of a putatively novel Anaplasma lineage from Grant's gazelle, these genotypes appeared to be divergent forms of previously described species, including T. ovis, A. ovis, A. bovis, and A. platys. Only one genotype, which clustered within the A. platys clade, contained sequences from both gazelle and sheep. This suggests that despite niche, habitat, and phylogenetic overlap, the majority of circulating tick-borne diseases may not be shared between these two focal species. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Molecular characterization and classification of Trypanosoma spp. Venezuelan isolates based on microsatellite markers and kinetoplast maxicircle genes.

    Science.gov (United States)

    Sánchez, E; Perrone, T; Recchimuzzi, G; Cardozo, I; Biteau, N; Aso, P M; Mijares, A; Baltz, T; Berthier, D; Balzano-Nogueira, L; Gonzatti, M I

    2015-10-15

    Livestock trypanosomoses, caused by three species of the Trypanozoon subgenus, Trypanosoma brucei brucei, T. evansi and T. equiperdum is widely distributed throughout the world and constitutes an important limitation for the production of animal protein. T. evansi and T. equiperdum are morphologically indistinguishable parasites that evolved from a common ancestor but acquired important biological differences, including host range, mode of transmission, distribution, clinical symptoms and pathogenicity. At a molecular level, T. evansi is characterized by the complete loss of the maxicircles of the kinetoplastic DNA, while T. equiperdum has retained maxicircle fragments similar to those present in T. brucei. T. evansi causes the disease known as Surra, Derrengadera or "mal de cadeiras", while T. equiperdum is the etiological agent of dourine or "mal du coit", characterized by venereal transmission and white patches in the genitalia. Nine Venezuelan Trypanosoma spp. isolates, from horse, donkey or capybara were genotyped and classified using microsatellite analyses and maxicircle genes. The variables from the microsatellite data and the Procyclin PE repeats matrices were combined using the Hill-Smith method and compared to a group of T. evansi, T. equiperdum and T. brucei reference strains from South America, Asia and Africa using Coinertia analysis. Four maxicircle genes (cytb, cox1, a6 and nd8) were amplified by PCRfrom TeAp-N/D1 and TeGu-N/D1, the two Venezuelan isolates that grouped with the T. equiperdum STIB841/OVI strain. These maxicircle sequences were analyzed by nucleotide BLAST and aligned toorthologous genes from the Trypanozoon subgenus by MUSCLE tools. Phylogenetic trees were constructed using Maximum Parsimony (MP) and Maximum Likelihood (ML) with the MEGA5.1® software. We characterized microsatellite markers and Procyclin PE repeats of nine Venezuelan Trypanosoma spp. isolates with various degrees of virulence in a mouse model, and compared them to a

  6. Superoxide dismutase from Trichuris ovis--inhibition by benzimidazoles and pyrimidine derivatives.

    Science.gov (United States)

    Sanchez-Moreno, M; Garcia-Rejon, L; Salas, I; Osuna, A; Monteoliva, M

    1992-01-01

    Three superoxide dismutase isoenzymes of different cellular location were detected in an homogenate of Trichuris ovis. Each of these molecular forms was purified by differential centrifugation and precipitation with ammonium sulphate, followed by chromatography on DEAE-cellulose and Sephadex G-75 columns. The activity levels of the two molecular forms detected in the mitochondrial (one cyanide sensitive Cu-Zn-SOD and the other cyanide insensitive Mn-SOD) were higher than that of the superoxide dismutase detected in the cytoplasmic fraction (cyanide sensitive Cu-Zn-SOD). All molecular forms present evident differences to the SODs contained in the host liver. Molecular mass and some of the physical and chemical properties of the enzyme was determined for all three molecular forms. An inhibitory effect on the SOD of the parasite an the host was detected with a series of compounds, some of which markedly inhibited parasite enzyme but not host enzyme.

  7. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries).

    Science.gov (United States)

    Li, M-H; Tiirikka, T; Kantanen, J

    2014-02-01

    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10(-11) for all the colours; P=2.3 × 10(-11) for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding.

  8. Assessment of contamination and origin of metals in mining affected river sediments: A case study of the Aries catchment, Romania

    Directory of Open Access Journals (Sweden)

    Levei Erika

    2014-01-01

    Full Text Available The study presents the current status of contamination with metals (Cu, Cr, Cd, Pb, Ni, Zn, As and their anthropogenic or natural origin in the sediments of the Aries river basin, Romania, affected by mining activities. The results indicated an enrichment of metals in sediments. Different contamination levels were identified on the Aries river and its tributaries. According to sediment quality guidelines and contamination indices, sediments from the Aries river were found to be highly contaminated with Cd, Cu, As, considerably with Zn and moderately with Pb and Ni. The right-bank tributaries were found to be more contaminated than the left-bank affluents, where only a contamination with As of geogenic origin was identified. The Principal Component Analysis allowed to identify five latent factors (86 % total variability reflecting the anthropogenic and natural origins of metals. Arsenic, Cd and partially Pb were found to have a common anthropogenic origin, different from that of Cu. The statistical approach indicated also the geogenic origin of Pb due to its association with Ca, K, Na, Sr. Chromium and Ni were attributed to natural source following their association with Mn, Fe, Al and Mg, respectively.

  9. Caracterização epidemiológica e fatores de risco associados à infecção por Brucella ovis em ovinos deslanados do semiárido paraibano

    Directory of Open Access Journals (Sweden)

    Fabrine A. Santos

    2013-04-01

    Full Text Available Este trabalho teve como objetivo determinar a prevalência de rebanhos ovinos positivos (focos e de animais soropositivos para Brucella ovis na mesorregião do Sertão, Estado da Paraíba, Nordeste do Brasil, bem como identificar fatores de risco. Foram colhidas amostras de sangue de 1.134 animais procedentes de 103 rebanhos em 17 municípios. Para o diagnóstico sorológico da infecção por B. ovis foi utilizado o teste de imunodifusão em gel de ágar (IDGA. Um rebanho foi considerado positivo quando apresentou pelo menos um animal soropositivo. Das 103 propriedades utilizadas 21 (20,39% apresentaram pelo menos um animal soropositivo e dos 1.134 animais, 59 (5,20% foram soropositivos. Realizar higiene nas instalações com periodicidade anual (odds ratio = 7,13; IC 95% = 1,56-32,47; p=0,011 e aquisição de animais (odds ratio = 6,06; IC 95% = 1,39-26,48; p=0,017 foram identificados como fatores de risco. Com base na análise de fatores de risco, recomenda-se a realização de diagnóstico da infecção por B. ovis previamente à aquisição de animais e realização periódica de higienização das instalações.

  10. Differences in the antimicrobial susceptibility profiles of Moraxella bovis, M. bovoculi and M. ovis

    Directory of Open Access Journals (Sweden)

    Grazieli Maboni

    2015-06-01

    Full Text Available The aim of this study was to determine the differences in the antimicrobial susceptibility profiles of Moraxella bovis, M. bovoculi and M. ovis. Thirty-two strains of Moraxella spp. isolated from cattle and sheep with infectious keratoconjunctivitis were tested via broth microdilution method to determine their susceptibility to ampicillin, cefoperazone, ceftiofur, cloxacillin, enrofloxacin, florfenicol, gentamicin, neomycin, oxytetracycline and penicillin. The results demonstrated that Moraxella spp. strains could be considered sensitive for most of the antimicrobials tested in this study, but differences between the antimicrobial susceptibility profiles of these three Moraxella species were found. M. bovis might differ from other species due to the higher MIC and MBC values it presented.

  11. Differences in the antimicrobial susceptibility profiles of Moraxella bovis, M. bovoculi and M. ovis

    Science.gov (United States)

    Maboni, Grazieli; Gressler, Leticia T.; Espindola, Julia P.; Schwab, Marcelo; Tasca, Caiane; Potter, Luciana; de Vargas, Agueda Castagna

    2015-01-01

    The aim of this study was to determine the differences in the antimicrobial susceptibility profiles of Moraxella bovis, M. bovoculi and M. ovis. Thirty-two strains of Moraxella spp. isolated from cattle and sheep with infectious keratoconjunctivitis were tested via broth microdilution method to determine their susceptibility to ampicillin, cefoperazone, ceftiofur, cloxacillin, enrofloxacin, florfenicol, gentamicin, neomycin, oxytetracycline and penicillin. The results demonstrated that Moraxella spp. strains could be considered sensitive for most of the antimicrobials tested in this study, but differences between the antimicrobial susceptibility profiles of these three Moraxella species were found. M. bovis might differ from other species due to the higher MIC and MBC values it presented. PMID:26273272

  12. Genotype and Phenotype of Echinococcus granulosus Derived from Wild Sheep (Ovis orientalis) in Iran.

    Science.gov (United States)

    Eslami, Ali; Meshgi, Behnam; Jalousian, Fatemeh; Rahmani, Shima; Salari, Mohammad Ali

    2016-02-01

    The aim of the present study is to determine the characteristics of genotype and phenotype of Echinococcus granulosus derived from wild sheep and to compare them with the strains of E. granulosus sensu stricto (sheep-dog) and E. granulosus camel strain (camel-dog) in Iran. In Khojir National Park, near Tehran, Iran, a fertile hydatid cyst was recently found in the liver of a dead wild sheep (Ovis orientalis). The number of protoscolices (n=6,000) proved enough for an experimental infection in a dog. The characteristics of large and small hooks of metacestode were statistically determined as the sensu stricto strain but not the camel strain (P=0.5). To determine E. granulosus genotype, 20 adult worms of this type were collected from the infected dog. The second internal transcribed spacer (ITS2) of the nuclear ribosomal DNA (rDNA) and cytochrome c oxidase 1 subunit (COX1) of the mitochondrial DNA were amplified from individual adult worm by PCR. Subsequently, the PCR product was sequenced by Sanger method. The lengths of ITS2 and COX1 sequences were 378 and 857 bp, respectively, for all the sequenced samples. The amplified DNA sequences from both ribosomal and mitochondrial genes were highly similar (99% and 98%, respectively) to that of the ovine strain in the GenBank database. The results of the present study indicate that the morpho-molecular features and characteristics of E. granulosus in the Iranian wild sheep are the same as those of the sheep-dog E. granulosus sensu stricto strain.

  13. The Implementation of Acute Respiratory Infection (ARI Controlling Programme and the Coverage of Pneumonia among Under-Five Children

    Directory of Open Access Journals (Sweden)

    Ni'mal Baroya

    2018-01-01

    Full Text Available Abstract Pneumonia is an acute infection of lung tissue (alveoli. Pneumonia is one of the main focus ARI preventing and controlling program.  One of the ARI preventing and controlling program indicators was pneumonia coverage among under five years old. The coverage of pneumonia finding among under five years old in Banyuwangi Regency since 2014-2016 years have not reached the national target. Pneumonia toddler coverage in 2014 and 2015 shows 33,7% and 71,1%, while in 2016 shows 41,99%. This research aims to analyze the association between officer characteristics, logistics availability and ARI control activities with pneumonia toddler coverage in Banyuwangi Regency. The research uses cross sectional analytic desain with 31 respondents. The result of this research has significant relationship is age, work length and capacity buailding. Nevertheless, gender, education, knowladge, availability of diagnostic tools, guideline, KIE media, recording and reporting media, advocation and socialisation, pneumonia find and management, supervision, recording and reporting, partnership and network, monitoring and evaluation has not significant relationship. Banyuwangi Health Office is hoped to do conduct periodic training every year to ARI program officer on ARI control management, management of pneumonia toddler and promotion of pneumonia control in under fives to increase human resources capacity in primary health facility.                 Abstrak Pneumonia merupakan salah satu fokus utama Program Pencegahan dan Pengendalian ISPA. Salah satu indikator program P2 ISPA adalah cakupan penemuan pneumonia balita. Cakupan pneumonia pada balita di Kabupaten Banyuwangi dari tahun 2014-2016 belum mencapai target nasional. Pada tahun 2014 dan 2015 cakupan pneumonia pada balita sebesar 33,7% dan 71,1% sedangkan tahun 2016 sebesar 41,99%. Penelitian ini bertujuan menganalisis hubungan antara karakteristik petugas, ketersediaan  logistik dan kegiatan

  14. Superoxide dismutase from Trichuris ovis, inhibiton by benzimidazoles and pyrimidine derivatives

    Directory of Open Access Journals (Sweden)

    M. Sanchez-Moreno

    1992-01-01

    Full Text Available Three superoxide dismutase isoenzymes of different cellular location were detected in an homogenate of Thrichuris ovis. Each of these molecular forms was purified by differential centrifugation and precipitation with ammonium sulphate, followed by chromatography on DEAE-cellulose and Sephadex G-75 columns. The activity levels of the two molecular forms detected in the mitochondrial (one cyanide sensitive Cu-Zn-SOD and the other cyanide intensitive Mn-Sod were higher than that of the superoxide dismutase detected in the cytoplasmic fraction (cyanid sensitive Cu-Zn-SOD. All the mollecular forms present evident differences to the SODs contained in the host liver. Molecular mass and some of the physical and chemical aproperties of the enzyme was determined for all three molecular forms. An inhibitory effect on the SOD of the parasite an the host was detected with a series of compounds, some of wich markedly inhibited parasite ensyme but not host enzyme.

  15. Limiter discriminator detection of M-ary FSK signals

    Science.gov (United States)

    Fonseka, John P.

    1990-10-01

    The performance of limiter discriminator detection of M-ary FSK signals is analyzed at arbitrary modulation indices. It is shown that the error rate performance of limiter discriminator detection can be significantly improved by increasing the modulation index above 1/M. The optimum modulation index that minimizes the overall error probability is determined for the cases M = 2, 4 and 8. The analysis is carried out for wideband and bandlimited channels with Gaussian and second-order Butterworth filters. It is shown that the optimum modulation index depends on the signal/noise ratio (SNR), in a wideband channel, and on both SNR and time-bandwidth product in a bandlimited channel. Finally, it is shown that the optimum sampling instance in presence of a nonzero phase IF filter can be approximately determined by using only the worst case symbol pattern.

  16. Susceptibility of Dall sheep (Ovis dalli dalli) to pneumonia caused by Pasteurella haemolytica.

    Science.gov (United States)

    Foreyt, W J; Silflow, R M; Lagerquist, J E

    1996-10-01

    We evaluated susceptibility of Dall sheep (Ovis dalli dalli) to bacterial pneumonia induced by two strains of Pasteurella haemolytica of domestic sheep origin by evaluating the sensitivity of blood neutrophils of eight Dall sheep to lysis by cytotoxins of P. haemolytica, and by intratracheal inoculation of three Dall sheep, two bighorn sheep (Ovis canadensis), and two domestic sheep with 3.7 x 10(6) or 2.5 x 10(7) colony forming units of P. haemolytica. Neutrophils from the Dall sheep were more sensitive to lysis by cytotoxins from supernatants of a P. haemolytica, biotype A, serotype 2 (A2), of domestic sheep origin, than were neutrophils from six bighorn sheep. This cytotoxic bacterium was the same isolate that was used for intratracheal inoculation of two Dall sheep and two domestic sheep. Inoculation of this cytotoxic P. haemolytica A2 resulted in fatal fibrinopurulent pleuropneumonia in the first Dall sheep within 24 hr of inoculation, and pneumonic lesions in the second Dall sheep before it was euthanized 52 hr after inoculation. This strain of P. haemolytica A2 did not cause respiratory disease when inoculated into two domestic sheep. A noncytotoxic strain of P. haemolytica; biotype T, serotype 3,4,10 of domestic sheep origin did not result in pneumonia in the third Dall sheep or two bighorn sheep. Prior to inoculation, P. haemolytica, biotype T isolates were obtained from all three Dall sheep, but none of these isolates was cytotoxic. At necropsy, cytotoxic P. haemolytica A2 was isolated from lungs and other tissues of the two pneumonic Dall sheep. Based on these results, we conclude that Dall sheep appear to be at least as sensitive as bighorn sheep to pneumonia caused by P. haemolytica A2 of domestic sheep origin. Because in vitro and in vivo results appear closely correlated in this and other studies, we believe with additional evaluation and standardization, neutrophil cytotoxicity tests may serve as a substitute for live animal challenges in future

  17. Wild and semi-wild leafy vegetables used by the Maale and Ari ethnic communities in southern Ethiopia

    NARCIS (Netherlands)

    Kidane, Berhane; Maesen, van der L.J.G.; Asfaw, Zemede; Sosef, M.S.M.; Andel, van Tinde

    2015-01-01

    We studied wild and semi-wild leafy vegetables used by the Maale and Ari ethnic communities in southern Ethiopia. Quantitative and qualitative ethnobotanical methods, including individual and focus group (n = 18) discussions, field observations, and individual interviews (n = 144), were used in

  18. A cartography and GIS consultancy mission to the Agricultural Research Institute (ARI) in Mlingano, Tanzania, september 1999

    NARCIS (Netherlands)

    Schuiling, C.

    2000-01-01

    The Agricultural Research Institute (ARI) in Mlingano, Tanzania made a start with GIS activities at the end of 1998. After purchasing GIS hardware and software and basic training courses, Alterra was invited to carry out a consultancy mission to solvepractical problems with map projection, map

  19. Exclusion performance in dwarf goats (Capra aegagrus hircus and sheep (Ovis orientalis aries.

    Directory of Open Access Journals (Sweden)

    Christian Nawroth

    Full Text Available Using a comparative approach, we investigated the ability of dwarf goats and sheep to use direct and indirect information about the location of a food reward in an object-choice task. Subjects had to choose between two cups with only one covering a reward. Before making a choice, subjects received information about the baited (direct information or non-baited cup (indirect information. Both goats and sheep were able to use direct information (presence of food in the object choice task. After controlling for local enhancement, we found that goats rather than sheep were able to use indirect information (i.e., the absence of food to find a reward. The actual test setup could not clarify whether individual goats were able to inferentially reason about the content of the baited cup when only shown the content of the non-baited cup or if they simply avoided the empty cup in that situation. As browsing species, feral and wild goats exhibit highly selective feeding behaviour compared to the rather unselective grazing sheep. The potential influence of this species-specific foraging flexibility of goats and sheep for using direct and indirect information to find a food reward is discussed in relation to a higher aversion to losses in food acquisition in goats compared to sheep.

  20. The enteric nervous system in the ruminant stomach of the sheep (Ovis aries).

    NARCIS (Netherlands)

    A.A.L.M. Weyns

    1988-01-01

    textabstractNotwithstanding the enormous importance of the pathology of the ruminant stomach in veterinary medicine (and hence in economy) and the fact that adequate functioning of this gastrointestinal segment largely depends upon the integrity of the enteric nervous system, it is rather

  1. Exclusion Performance in Dwarf Goats (Capra aegagrus hircus) and Sheep (Ovis orientalis aries)

    Science.gov (United States)

    Nawroth, Christian; von Borell, Eberhard; Langbein, Jan

    2014-01-01

    Using a comparative approach, we investigated the ability of dwarf goats and sheep to use direct and indirect information about the location of a food reward in an object-choice task. Subjects had to choose between two cups with only one covering a reward. Before making a choice, subjects received information about the baited (direct information) or non-baited cup (indirect information). Both goats and sheep were able to use direct information (presence of food) in the object choice task. After controlling for local enhancement, we found that goats rather than sheep were able to use indirect information (i.e., the absence of food) to find a reward. The actual test setup could not clarify whether individual goats were able to inferentially reason about the content of the baited cup when only shown the content of the non-baited cup or if they simply avoided the empty cup in that situation. As browsing species, feral and wild goats exhibit highly selective feeding behaviour compared to the rather unselective grazing sheep. The potential influence of this species-specific foraging flexibility of goats and sheep for using direct and indirect information to find a food reward is discussed in relation to a higher aversion to losses in food acquisition in goats compared to sheep. PMID:24695781

  2. Individual gregariousness predicts behavioural synchronization in a foraging herbivore, the sheep (Ovis aries).

    Science.gov (United States)

    Hauschildt, Verena; Gerken, Martina

    2015-04-01

    Diversity of animal personalities has been proposed to arise from differences in social attraction, and to enhance behavioural flexibility of a population. The present study evaluated gregariousness as a personality trait in 14 ewes kept on pasture. Gregariousness was defined based on the frequency of having a close neighbour (behaviour was recorded individually every 15 min. Each session lasted 2.5h (08.30-11.00 h or 14.30-17.00 h, respectively). Behavioural synchronization was highest when the group consisted only of HG individuals (κHG=0.69, κLG=0.31; t=5.29; pbehavioural synchronization in sheep. Though sheep are generally recognized as a highly gregarious species, HG and LG individuals could be differentiated clearly and consistently. Research on animal personality might help explain social influences on behavioural synchronization. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Safety and Immunogenicity of a Mycoplasma ovipneumoniae bacterin for domestic sheep (Ovis aries).

    Science.gov (United States)

    Ziegler, Jessie C; Lahmers, Kevin K; Barrington, George M; Parish, Steven M; Kilzer, Katherine; Baker, Katherine; Besser, Thomas E

    2014-01-01

    Mortality from epizootic pneumonia is hindering re-establishment of bighorn sheep populations in western North America. Mycoplasma ovipneumoniae, a primary agent of this disease, is frequently carried asymptomatically by the domestic sheep and goats that constitute the reservoir of this agent for transmission to bighorn sheep. Our long-term objective is to reduce the risk of M. ovipneumoniae infection of bighorn sheep; one approach to this objective is to control the pathogen in its reservoir hosts. The safety and immunogenicity of M. ovipneumoniae for domestic sheep was evaluated in three experimental immunization protocols: 1) live M. ovipneumoniae (50 ug protein); 2) killed M. ovipneumoniae (50 ug whole cell protein) in oil adjuvant; and 3) killed M. ovipneumoniae (250 ug whole cell protein) in oil adjuvant. Immunogenicity was assessed by two serum antibody measures: competitive enzyme-linked immunosorbent assay (cELISA) (experiments 1-3) and serum growth inhibition (Experiment 3). Passive immunogenicity was also assessed in the third experiment using the same assays applied to blood samples obtained from the lambs of immunized ewes. Adverse reactions to immunization were generally minor, but local reactions were regularly observed at immunization sites with bacterins in oil adjuvants. No evidence of M. ovipneumoniae specific antibody responses were observed in the first or second experiments and no resistance to colonization was observed in the first experiment. However, the ewes in the third experiment developed strong cELISA serum antibody responses and significant serum M. ovipneumoniae inhibition activity, and these responses were passively transferred to their lambs. The results of these trials indicate that immunization with relatively large antigenic mass combined with an adjuvant is capable of inducing strong active antibody responses in ewes and passively immunizing lambs.

  4. Safety and Immunogenicity of a Mycoplasma ovipneumoniae bacterin for domestic sheep (Ovis aries.

    Directory of Open Access Journals (Sweden)

    Jessie C Ziegler

    Full Text Available BACKGROUND: Mortality from epizootic pneumonia is hindering re-establishment of bighorn sheep populations in western North America. Mycoplasma ovipneumoniae, a primary agent of this disease, is frequently carried asymptomatically by the domestic sheep and goats that constitute the reservoir of this agent for transmission to bighorn sheep. Our long-term objective is to reduce the risk of M. ovipneumoniae infection of bighorn sheep; one approach to this objective is to control the pathogen in its reservoir hosts. METHODS: The safety and immunogenicity of M. ovipneumoniae for domestic sheep was evaluated in three experimental immunization protocols: 1 live M. ovipneumoniae (50 ug protein; 2 killed M. ovipneumoniae (50 ug whole cell protein in oil adjuvant; and 3 killed M. ovipneumoniae (250 ug whole cell protein in oil adjuvant. Immunogenicity was assessed by two serum antibody measures: competitive enzyme-linked immunosorbent assay (cELISA (experiments 1-3 and serum growth inhibition (Experiment 3. Passive immunogenicity was also assessed in the third experiment using the same assays applied to blood samples obtained from the lambs of immunized ewes. RESULTS AND CONCLUSIONS: Adverse reactions to immunization were generally minor, but local reactions were regularly observed at immunization sites with bacterins in oil adjuvants. No evidence of M. ovipneumoniae specific antibody responses were observed in the first or second experiments and no resistance to colonization was observed in the first experiment. However, the ewes in the third experiment developed strong cELISA serum antibody responses and significant serum M. ovipneumoniae inhibition activity, and these responses were passively transferred to their lambs. The results of these trials indicate that immunization with relatively large antigenic mass combined with an adjuvant is capable of inducing strong active antibody responses in ewes and passively immunizing lambs.

  5. Unique features in the ARIES glovebox line

    International Nuclear Information System (INIS)

    Martinez, H.E.; Brown, W.G.; Flamm, B.; James, C.A.; Laskie, R.; Nelson, T.O.; Wedman, D.E.

    1998-01-01

    A series of unique features have been incorporated into the Advanced Recovery and Integrated Extraction System (ARIES) at the Los Alamos National Laboratory, TA-55 Plutonium Facility. The features enhance the material handling in the process of the dismantlement of nuclear weapon primaries in the glovebox line. Incorporated into these features are the various plutonium process module's different ventilation zone requirements that the material handling systems must meet. These features include a conveyor system that consists of a remotely controlled cart that transverses the length of the conveyor glovebox, can be operated from a remote location and can deliver process components to the entrance of any selected module glovebox. Within the modules there exists linear motion material handling systems with lifting hoist, which are controlled via an Allen Bradley control panel or local control panels. To remove the packaged products from the hot process line, the package is processed through an air lock/electrolytic decontamination process that removes the radioactive contamination from the outside of the package container and allows the package to be removed from the process line

  6. Field evaluation of the efficacy of fenbendazole in captive wild ruminants.

    Science.gov (United States)

    Goossens, E; Dorny, P; Vercammen, F; Vercruysse, J

    2005-11-05

    The efficacy of in-feed fenbendazole at a dose rate of 7.5 mg/kg bodyweight for three consecutive days was assessed in five Arabian oryx (Oryx leucoryx), six scimitar-horned oryx (Oryx dammah), 14 slender-horned gazelles (Gazella leptoceros), eight Soay sheep (Ovis aries aries soay), 13 alpine ibex (Capra ibex ibex), six red deer (Cervus elaphus hippelaphus) and 11 Nelson's elk (Cervus elaphus nelsoni) kept in five herds in a zoo. The efficacy was assessed by means of repeated faecal egg count reduction (fecr) tests and in vitro egg hatch assays. Fenbendazole was highly effective against nematodes in five of the seven species, consistently reducing egg shedding by more than 90 per cent. In the egg hatch assays of the five herds, 50 per cent inhibition of hatching (ld50) was observed at a concentration of thiabendazole below 0.1 microg/ml. In the Arabian oryx and alpine ibex the efficacy of fenbendazole was less than 90 per cent, and the ld50 in the egg hatch assays was between 0.1 and 0.2 microg/ml thiabendazole.

  7. Using visuo-kinetic virtual reality to induce illusory spinal movement: the MoOVi Illusion.

    Science.gov (United States)

    Harvie, Daniel S; Smith, Ross T; Hunter, Estin V; Davis, Miles G; Sterling, Michele; Moseley, G Lorimer

    2017-01-01

    Illusions that alter perception of the body provide novel opportunities to target brain-based contributions to problems such as persistent pain. One example of this, mirror therapy, uses vision to augment perceived movement of a painful limb to treat pain. Since mirrors can't be used to induce augmented neck or other spinal movement, we aimed to test whether such an illusion could be achieved using virtual reality, in advance of testing its potential therapeutic benefit. We hypothesised that perceived head rotation would depend on visually suggested movement. In a within-subjects repeated measures experiment, 24 healthy volunteers performed neck movements to 50 o of rotation, while a virtual reality system delivered corresponding visual feedback that was offset by a factor of 50%-200%-the Motor Offset Visual Illusion (MoOVi)-thus simulating more or less movement than that actually occurring. At 50 o of real-world head rotation, participants pointed in the direction that they perceived they were facing. The discrepancy between actual and perceived direction was measured and compared between conditions. The impact of including multisensory (auditory and visual) feedback, the presence of a virtual body reference, and the use of 360 o immersive virtual reality with and without three-dimensional properties, was also investigated. Perception of head movement was dependent on visual-kinaesthetic feedback ( p  = 0.001, partial eta squared = 0.17). That is, altered visual feedback caused a kinaesthetic drift in the direction of the visually suggested movement. The magnitude of the drift was not moderated by secondary variables such as the addition of illusory auditory feedback, the presence of a virtual body reference, or three-dimensionality of the scene. Virtual reality can be used to augment perceived movement and body position, such that one can perform a small movement, yet perceive a large one. The MoOVi technique tested here has clear potential for assessment and

  8. Differences in leukocyte differentiation molecule abundances on domestic sheep (Ovis aries) and bighorn sheep (Ovis canadensis) neutrophils identified by flow cytometry.

    Science.gov (United States)

    Highland, Margaret A; Schneider, David A; White, Stephen N; Madsen-Bouterse, Sally A; Knowles, Donald P; Davis, William C

    2016-06-01

    Although both domestic sheep (DS) and bighorn sheep (BHS) are affected by similar respiratory bacterial pathogens, experimental and field data indicate BHS are more susceptible to pneumonia. Cross-reactive monoclonal antibodies (mAbs) for use in flow cytometry (FC) are valuable reagents for interspecies comparative immune system analyses. This study describes cross-reactive mAbs that recognize leukocyte differentiation molecules (LDMs) and major histocompatibility complex antigens on DS and BHS leukocytes. Characterization of multichannel eosinophil autofluorescence in this study permitted cell-type specific gating of granulocytes for evaluating LDMs, specifically on neutrophils, by single-label FC. Evaluation of relative abundances of LDMs by flow cytometry revealed greater CD11a, CD11b, CD18 (β2 integrins) and CD 172a (SIRPα) on DS neutrophils and greater CD14 (lipopolysaccharide receptor) on BHS neutrophils. Greater CD25 (IL-2) was identified on BHS lymphocytes following Concavalin A stimulation. While DS and BHS have similar total peripheral blood leukocyte counts, BHS have proportionately more neutrophils. Published by Elsevier Ltd.

  9. Redescripción de Trichuris ovis (Nematoda) (Abildgaard, 1795) parásito de Ovis aries (Linné, 1758) y Capra hircus...

    OpenAIRE

    Oliveros, R; Cutillas Barrios, Cristina

    2003-01-01

    Los estudios taxonómicos previos llevados a cabo en el género Trichuris. confirman la sinon imia de Trichuris avis (Abildgaard, 1795) y Trichuris glabulasa (Von Linstow, 1901), aceptándose como única especie válida a Trichuris avis (Abildgaard, 1795). Es por ello que hemos querido realizar una redescripción de esta especie parásita de ovinos, teniendo en cuenta las características morfológicas y biométricas citadas hasta el momento en la bibliografía consultada, incluyendo aquellos d...

  10. High-resolution melting analysis (HRM) for differentiation of four major Taeniidae species in dogs Taenia hydatigena, Taenia multiceps, Taenia ovis, and Echinococcus granulosus sensu stricto.

    Science.gov (United States)

    Dehghani, Mansoureh; Mohammadi, Mohammad Ali; Rostami, Sima; Shamsaddini, Saeedeh; Mirbadie, Seyed Reza; Harandi, Majid Fasihi

    2016-07-01

    Tapeworms of the genus Taenia include several species of important parasites with considerable medical and veterinary significance. Accurate identification of these species in dogs is the prerequisite of any prevention and control program. Here, we have applied an efficient method for differentiating four major Taeniid species in dogs, i.e., Taenia hydatigena, T. multiceps, T. ovis, and Echinococcus granulosus sensu stricto. High-resolution melting (HRM) analysis is simpler, less expensive, and faster technique than conventional DNA-based assays and enables us to detect PCR amplicons in a closed system. Metacestode samples were collected from local abattoirs from sheep. All the isolates had already been identified by PCR-sequencing, and their sequence data were deposited in the GenBank. Real-time PCR coupled with HRM analysis targeting mitochondrial cox1 and ITS1 genes was used to differentiate taeniid species. Distinct melting curves were obtained from ITS1 region enabling accurate differentiation of three Taenia species and E. granulosus in dogs. The HRM curves of Taenia species and E .granulosus were clearly separated at Tm of 85 to 87 °C. In addition, double-pick melting curves were produced in mixed infections. Cox1 melting curves were not decisive enough to distinguish four taeniids. In this work, the efficiency of HRM analysis to differentiate four major taeniid species in dogs has been demonstrated using ITS1 gene.

  11. Low-sampling-rate M-ary multiple access UWB communications in multipath channels

    KAUST Repository

    Alkhodary, Mohammad T.

    2015-08-31

    The desirable characteristics of ultra-wideband (UWB) technology are challenged by formidable sampling frequency, performance degradation in the presence of multi-user interference, and complexity of the receiver due to the channel estimation process. In this paper, a low-rate-sampling technique is used to implement M-ary multiple access UWB communications, in both the detection and channel estimation stages. A novel approach is used for multiple-access-interference (MAI) cancelation for the purpose of channel estimation. Results show reasonable performance of the proposed receiver for different number of users operating many times below Nyquist rate.

  12. Low-sampling-rate M-ary multiple access UWB communications in multipath channels

    KAUST Repository

    Alkhodary, Mohammad T.; Ballal, Tarig; Al-Naffouri, Tareq Y.; Muqaibel, Ali H.

    2015-01-01

    The desirable characteristics of ultra-wideband (UWB) technology are challenged by formidable sampling frequency, performance degradation in the presence of multi-user interference, and complexity of the receiver due to the channel estimation process. In this paper, a low-rate-sampling technique is used to implement M-ary multiple access UWB communications, in both the detection and channel estimation stages. A novel approach is used for multiple-access-interference (MAI) cancelation for the purpose of channel estimation. Results show reasonable performance of the proposed receiver for different number of users operating many times below Nyquist rate.

  13. A Review of Hypothesized Determinants Associated with Bighorn Sheep (Ovis canadensis Die-Offs

    Directory of Open Access Journals (Sweden)

    David S. Miller

    2012-01-01

    Full Text Available Multiple determinants have been hypothesized to cause or favor disease outbreaks among free-ranging bighorn sheep (Ovis canadensis populations. This paper considered direct and indirect causes of mortality, as well as potential interactions among proposed environmental, host, and agent determinants of disease. A clear, invariant relationship between a single agent and field outbreaks has not yet been documented, in part due to methodological limitations and practical challenges associated with developing rigorous study designs. Therefore, although there is a need to develop predictive models for outbreaks and validated mitigation strategies, uncertainty remains as to whether outbreaks are due to endemic or recently introduced agents. Consequently, absence of established and universal explanations for outbreaks contributes to conflict among wildlife and livestock stakeholders over land use and management practices. This example illustrates the challenge of developing comprehensive models for understanding and managing wildlife diseases in complex biological and sociological environments.

  14. Validation of an improved anaplasma antibody cELISA kit for detection of anaplasma ovis antibody in domestic sheep at the U.S. Sheep Experiment Station in Dubois, ID

    Science.gov (United States)

    An accurate and simple-to-perform new version of a competitive ELISA (cELISA) kit that became commercially available in 2015 for testing of cattle for antibody to Anaplasma marginale was validated for detection of Anaplasma ovis antibody in domestic sheep. True positives and negatives were identifie...

  15. Raillietia caprae (Acari: Raillietidae and Psoroptes ovis (Acari: Psoroptidae in the ears of goats in the state of Rio de Janeiro, Southeast Brazil Raillietia caprae (Acari: Raillietidae e Psoroptes ovis (Acari: Psoroptidae nos condutos auditivos de caprinos no Estado do Rio de Janeiro, Brasil

    Directory of Open Access Journals (Sweden)

    João Luiz H. Faccini

    2008-03-01

    Full Text Available Ear cannals of 145 domestic goats including the breeds Saanen, Toggenburg, Anglobian, Alpine, Moxoto (native and crossbred goats from 10 smallholder farms were examined by flushing for the presence of ear mites. Prevalence of Raillietia caprae Quintero, Bassols and Acevedo, 1980 was much more higher than Psoroptes ovis (Hering, 1838 in the studied area, respectively 62% ( 90/145 and 4% ( 6/145. The youngest animal parasitized was eight months old and the oldest was 10 years old. Subclinical otitis is a common feature of infestation by both species but increase of wax and the presence of pus were detected in the flushed material in approximately 10% of the goats examined.Os condutos auditivos de 145 caprinos das raças Saanen, Toggenburg, Anglobian, Alpine, Moxoto (native e mestiços provenientes de 10 pequenos criadores foram examinados pela técnica de lavagem para diagnosticar a infestação por ácaros. A prevalência de Raillietia caprae Quintero, Bassols and Acevedo, 1980 foi muito mais alta do que Psoroptes ovis (Hering, 1838 - 62% (90/145 e 4% (6/145, respectivamente. O animal parasitado mais jovem tinha oito meses de idade e o mais velho 10 anos. Otite subclínica é comum nas infestações por ambas espécies mas aumento de cerume e presença de pus foram diagnosticados no material da lavagem em aproximadamente 10% dos caprinos examinados.

  16. Sketsa Karya Ari Nur Utami: Arsitektur Urban dalam Perspektif Ekokritisisme

    Directory of Open Access Journals (Sweden)

    Usma Nur Dian Rosyidah

    2013-12-01

    Full Text Available Kota adalah ruang kompleks bagi siapa pun yang berada di dalamnya. Saat ini, penghuni ruang kota terancam oleh menurunnya kualitas ekologis kota akibat pembangunan gedung, berbagai fasilitas. dan infrastruktur kota yang masif. Salah satu novel yang memotret eksploitasi ekologi kota tersebut adalah Sketsa karya Ari Nur Utami. Sebagai novel berlatar belakang arsitektur, Sketsa menceritakan pembangunan gedung di Jakarta oleh pengembang bernama PT Semesta Sentosa. Menggunakan teori ekokritisisme, fokus diskusi dalam artikel ini adalah cara penulis memasukkan nilai dan asumsi ekokritik dalam arsitektur urban di novel Sketsa. Tulisan ini bertujuan untuk menguraikan dominasi pandangan antroposentris individu terhadap alam. Melalui metode kualitatif­deskriptif dengan melakukan close­reading, hasil pembahasan menunjukkan bahwa pembangunan di Jakarta dengan berbagai proyek arsitektur urbannya masih mengabaikan kelestarian lingkungan. Ketidakpedulian terhadap lingkungan ini dapat dilihat dari orientasi etis dan linguistik antroposentris yang dipilih demi mendapatkan keuntungan besar dalam bisnis properti di Jakarta. Abstract: City is a space that contains complexities for anyone being part of it. Nowadays, people are threatened by the ecologically degrading city as the result of the massive development of buildings and other city’s facilities and infrastructures. A novel portraying the issues of ecological exploitation is Ari Nur Utami’s Sketsa. Being claimed as an architectural background novel, Sketsa portrays the development of buildings in Jakarta by a property developer named PT Semesta Sentosa. By applying ecocriticism theory, one point discussed in this article is how the author imputes certain ecocritical values and assumptions in presenting the urban architecture in Sketsa. The objective of this research is to elaborate the domination of anthropocentric perspective over nature. Through the qualitative­descriptive method, it is found that

  17. PESANTREN DAN POLITIK (Sinergi Pendidikan Pesantren dan Kepemimpinan dalam Pandangan KH. M. Hasyim Asy’ari

    Directory of Open Access Journals (Sweden)

    Zaini Tamin Abd Rohim

    2015-11-01

    Full Text Available Pesantren and politics are two different terms which may have a synergy in a social reality and a history of archipelago. This study refers to the thought of Hasyim Asy’ari about Islamic education, pesantren, and its role in a national life. Historically, the existence of pesantren aims to preserve Islamic values especially on education and to educate students to be well-knowledged people who are capable of using their knowledge in society and have a noble character. Some studies by Hasyim Asy’ari explain that the goal of Islamic education does not merely bring out education outcome on the cognitive level, but also on the practice level where students can make use of knowledge they have learned or so-called useful knowledge (‘ilm na>fi’. These aforesaid goal becomes the pesantren’s priority which combines intellectual, emotional, and spiritual skills to build a students’ character. Character is a prominent factor in leadership, an ability to step out of the existing culture and make an evolutionary change which is far adaptive. Hence, since Pesantren is valued as a hub of character education, it plays a role to build students’ character either intellectual and social abilities or leadership skills.

  18. ARIES API/industry communication network now spans the U.S

    International Nuclear Information System (INIS)

    Anon.

    1996-01-01

    The ATM Research and Industrial Enterprise Study (ARIES) is a joint development project of API member companies. It involves the cooperation of the vendor community, several DOE labs and NASA's Advanced Communications Technology Satellite (ACTS) Program to explore the ability of Asynchronous Transfer Mode (ATM) networking technology to revolutionize the process of energy exploration and production. One of the goals of this partnership is to implement real-time seismic exploration by providing high-data-rate communications from ships to data processing centers on land, all integrally coupled with interactive analysis by expert geoscientists. This paper reviews a demonstration project of this system transmitting seismic data from a ship in the Gulf of Mexico to the Houston offices of Amoco, Shell and the Institute of Biosciences and Technology in the Texas Medical Center

  19. Comments concerning the real risk of sexual adverse events secondary to the use of 5-ARIs

    Directory of Open Access Journals (Sweden)

    Furio Pirozzi Farina

    2016-01-01

    Full Text Available Treatment-induced sexual dysfunctions (SD are a recurrent and controversial topic in recent literature on the adverse events related to the use of 5-alpha-reductase inhibitors (5ARIs (1, 2. In order to deal adequately with the various aspects of this topic, it is necessary to first cover some of the steps that allow a better definition and understanding of the subject.

  20. Sarmatian Attributes in Archaeological Complexes of Catacombs Burials in Arys Culture of Southern Kazakhstan (1st Century B.C. - 3rd Century A.D.

    Directory of Open Access Journals (Sweden)

    Podushkin Aleksandr Nikolaevich

    2015-12-01

    Full Text Available The publication is devoted to archaeological research of monuments of the catacomb of Arys culture of Southern Kazakhstan (1st Century B.C. - 3rd Century A.D.. Now scientists have a complete understanding of the range and typology, periodization and chronology of monuments of this culture. There are three stages: Karaultobe (4th century B.C. - 1st century A.D.; Karatobe (1st Century B.C. - 4th century A.D.; Altintobe (4th-6th centuries A.D.. These stages are characterized by specific clusters of signs in the form of artifacts. The author also carried out the ethnic attribution of the Arys culture in association with the ancient state Kangiuj. As a result of this work, the ethnicity of the state Kangiuj was revealed: in particular, late Saka’s, Sarmatian, Huns and Kangiuj ethnic components which are relevant to archaeological complexes, were identified. In the Arys monuments of culture the author discovered complexes of findings which associated with the Sarmatian world of Eurasia by their ethno-cultural parameters. They include typical for the Sarmatians list of ritual action and the funerary equipment, including weapons, bronze mirrors, ritual and religious objects, signs-tamgas, jewelry (including Egyptian faience, articles in “animal”, gold-turquoise and polychrome style. The characteristics of the burial complexes of catacombs of the Arys culture discussed in the publication and corresponding to chronological calculations and ethno-cultural interpretations, allow to speak about presence in the territory of South Kazakhstan of the Asian Sarmatians or any local branch of the Union of the Sarmatian tribes in the 1st century B.C. - 3rd century A.D.

  1. Dicty_cDB: Contig-U13391-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 587_82( CP000587 |pid:none) Ostreococcus lucimarinus CCE9901 ... 43 0.004 AY092033_1( AY092033 |pid:none) Homo sapiens NALP3 interm...3015498109 Global-Ocean-Sampling_GS-35-01-01-1... 46 0.91 1 ( DU327579 ) 1098473610927 CHORI-243 Ovis aries ...018 2 ( AC188370 ) Glycine max clone gmp1-120k16, complete sequence. 50 0.058 1 ( ER548246 ) 1093016198016 Global-Ocean-Sampli... DKEY-258P11 in ... 38 0.97 3 ( EJ508572 ) 1095407031867 Global-Ocean-Sampling_GS-28-01-01-1... 40 1.0 2 ( E...R418890 ) 1092963689437 Global-Ocean-Sampling_GS-35-01-01-1... 36 1.1 3 ( CR450742 ) Zebrafish DNA sequence

  2. Mutations in Ovis aries TMEM154 are associated with lower small ruminant lentivirus proviral concentration in one sheep flock.

    Science.gov (United States)

    Alshanbari, F A; Mousel, M R; Reynolds, J O; Herrmann-Hoesing, L M; Highland, M A; Lewis, G S; White, S N

    2014-08-01

    Small ruminant lentivirus (SRLV), also called ovine progressive pneumonia virus or maedi-visna, is present in 24% of US sheep. Like human immunodeficiency virus, SRLV is a macrophage-tropic lentivirus that causes lifelong infection. The production impacts from SRLV are due to a range of disease symptoms, including pneumonia, arthritis, mastitis, body condition wasting and encephalitis. There is no cure and no effective vaccine for preventing SRLV infection. However, breed differences in prevalence and proviral concentration indicate a genetic basis for susceptibility to SRLV. Animals with high blood proviral concentration show increased tissue lesion severity, so proviral concentration represents a live animal test for control post-infection in terms of proviral replication and disease severity. Recently, it was found that sheep with two copies of TMEM154 haplotype 1 (encoding lysine at position 35) had lower odds of SRLV infection. In this study, we examined the relationship between SRLV control post-infection and variants in two genes, TMEM154 and CCR5, in four flocks containing 1403 SRLV-positive sheep. We found two copies of TMEM154 haplotype 1 were associated with lower SRLV proviral concentration in one flock (P < 0.02). This identified the same favorable diplotype for SRLV control post-infection as for odds of infection. However, frequencies of haplotypes 2 and 3 were too low in the other three flocks to test. The CCR5 promoter deletion did not have consistent association with SRLV proviral concentration. Future work in flocks with more balanced allele frequencies is needed to confirm or refute TMEM154 association with control of SRLV post-infection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA. Animal Genetics published by John Wiley & Sons Ltd on behalf of Stichting International Foundation for Animal Genetics.

  3. Functional Role of Cyclin-Dependent Kinase 5 in the Regulation of Melanogenesis and Epidermal Structure.

    Science.gov (United States)

    Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren

    2017-10-23

    The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report for the first time that cyclin-dependent kinase 5 (Cdk5) is an essential regulator of MITF and PAX3. Cdk5 knockdown in mice causes a lightened coat color, a polarized distribution of melanin and hyperproliferation of basal keratinocytes. Reduced expression of Keratin 10 (K10) resulting from Cdk5 knockdown may be responsible for an abnormal epidermal structure. In contrast, overexpression of Cdk5 in sheep (Ovis aries) only produces brown patches on a white background, with no other observable abnormalities. Collectively, our findings show that Cdk5 has an important functional role in the regulation of melanin production and transportation and in normal development of the integumentary system.

  4. Cloning, identification, and functional analysis of bone marrow stromal cell antigen-2 from sika deer (Cervus nippon).

    Science.gov (United States)

    Wang, Jiawen; Bian, Shuai; Liu, Meichun; Zhang, Xin; Wang, Siming; Bai, Xueyuan; Zhao, Daqing; Zhao, Yu

    2018-06-30

    BST-2(tetherin/CD317/HM1.24) has been identified as a cellular antiviral factor that inhibits the release of a wide range of enveloped viruses from infected cells. Orthologs of BST-2 have been identified in several species including humans, monkeys, cows, sheep, pigs, and mice. In this study, we cloned the gene and characterized the protein of the BST-2 homolog from sika deer (Cervus nippon). cnBST-2 shares 37.8% and 74.2% identity with the BST-2 homologs from Homo sapiens and Ovis aries, respectively. The extracellular domain of cnBST-2 has two putative N-linked glycosylation sites and three potential dimerization sites. cnBST-2 was shown to be expressed on the cell surface, like human BST-2. Exogenous expression of cnBST-2 resulted in potent inhibition of HIV-1 particle release in 293T cells; however, this activity resisted antagonism by HIV-1 Vpu. Moreover, cnBST-2 was not able to activate nuclear factor-κB, in contrast to human BST-2. This study is the first report of the isolation and characterization of BST-2 from C. nippon. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. A study on in vitro culture of Trichuris ovis in different physiological solutions at constant temperature, 37°C.

    Science.gov (United States)

    Singh, Tikam; Lal, S S

    2011-06-01

    The primary aim of in vitro culture of whipworms (Trichuris ovis) is to provide artificial conditions under which the life cycle of the parasites completed outside the host under controlled conditions. The physiological solutions used for the present study were sodium chloride (0.64%), Ringer's solution, Tyrode's solution, and Lock-Lewis solution. Parasites were collected from freshly slaughtered intestine of the host. The recovered parasites were washed with running tap water after that with normal saline. After washing parasites were put in four petridishes containing different physiological solutions. Observations were recorded after interval of every 8 h. The hundred percent survival of Trichuris ovis was observed at 32, 40, and 48 h in NaCl (0.64%), Ringer's, Tyrode's, and Lock-Lewis solution, respectively in case of both male and female parasites. In sodium chloride solution (0.64%) cent percent mortality was observed after 64 h of incubation in males and in case of females it was observed 72 h. In Ringer's solution cent percent mortality was observed after 72 in males and in females it was observed 80 h. In Tyrode's solution cent percent mortality was observed after 88 h in males and 96 h in females. In Lock-Lewis solution cent percent mortality was observed after 96 h in case of both the male and female parasites. Present study could be used to understand the effects of various drugs on the above parasites and also other intra-intestinal parasites.

  6. Natural infection by gastrointestinal and bronchopulmonary nematodes in mouflons (Ovis musimon) and their response to netobimin treatment.

    Science.gov (United States)

    Meana, A; Luzón-Peña, M; Santiago-Moreno, J; De Bulnes, A; Gómez-Bautista, M

    1996-01-01

    Gastrointestinal and bronchopulmonary nematode infections and the efficacy of netobimin (Hapasil) were analyzed by way of fecal examination in 10 female mouflons (Ovis musimon), in central Spain, February 1993. Before treatment all 10 mouflons had Trichostrongylus axei, Teladorsagia circumcincta and Marshallagia spp.; sic had Nematodirus spp., two had Trichuris sp., one had Capillaria sp., seven had bronchopulmonary Dictyocaulus filaria and 10 mouflons had protostrongylid lungworms (Muellerius capillaris, Protostrongylus rufescens, Cystocaulus ocreatus or Neostrongylus linearis). Netobimin (7.5 mg/kg) was 100% effective against T. axei, T. circumcincta, Marshallagia spp., and D. filaria infections whereas one animal continued eliminating Nematodirus spp. eggs. The drug also was effective against Capillaria spp. but not against Trichuris spp. or protostrongylid infections.

  7. Fuzzy control of optical PPM CDMA with M-ary orthogonal signaling

    Science.gov (United States)

    Cui, K.; Leeson, M. S.; Hines, E. L.

    2008-06-01

    This paper introduces an incorporated spectral-amplitude coding (SAC) optical code-division multiple-access (OCDMA) scheme. One novel class of optical signature codes based on combinatorial designs is employed with M-ary pulse-position modulation (PPM) signaling to improve the system performance beyond the interference limit. A union upper bound on the bit error rate (BER) is derived and the performance characteristics are then discussed with a variety of system parameters. Furthermore, fuzzy logic (FL) control is proposed to provide tolerance of different degrees of reliability in multirate transmission and to achieve distinct service differentiation for multimedia applications. It is shown that the proposed system can effectively suppress noise effects and offer improved adaptation capabilities for multi-quality network requirements in comparison with systems without optimization.

  8. Use of system code to estimate equilibrium tritium inventory in fusion DT machines, such as ARIES-AT and components testing facilities

    International Nuclear Information System (INIS)

    Wong, C.P.C.; Merrill, B.

    2014-01-01

    Highlights: • With the use of a system code, tritium burn-up fraction (f burn ) can be determined. • Initial tritium inventory for steady state DT machines can be estimated. • f burn of ARIES-AT, CFETR and FNSF-AT are in the range of 1–2.8%. • Respective total tritium inventories of are 7.6 kg, 6.1 kg, and 5.2 kg. - Abstract: ITER is under construction and will begin operation in 2020. This is the first 500 MW fusion class DT device, and since it is not going to breed tritium, it will consume most of the limited supply of tritium resources in the world. Yet, in parallel, DT fusion nuclear component testing machines will be needed to provide technical data for the design of DEMO. It becomes necessary to estimate the tritium burn-up fraction and corresponding initial tritium inventory and the doubling time of these machines for the planning of future supply and utilization of tritium. With the use of a system code, tritium burn-up fraction and initial tritium inventory for steady state DT machines can be estimated. Estimated tritium burn-up fractions of FNSF-AT, CFETR-R and ARIES-AT are in the range of 1–2.8%. Corresponding total equilibrium tritium inventories of the plasma flow and tritium processing system, and with the DCLL blanket option are 7.6 kg, 6.1 kg, and 5.2 kg for ARIES-AT, CFETR-R and FNSF-AT, respectively

  9. ARIES Oxide Production Program Assessment of Risk to Long-term Sustainable Production Rate

    Energy Technology Data Exchange (ETDEWEB)

    Whitworth, Julia [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Lloyd, Jane Alexandria [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Majors, Harry W. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-04

    This report describes an assessment of risks and the development of a risk watch list for the ARIES Oxide Production Program conducted in the Plutonium Facility at LANL. The watch list is an active list of potential risks and opportunities that the management team periodically considers to maximize the likelihood of program success. The initial assessments were made in FY 16. The initial watch list was reviewed in September 2016. The initial report was not issued. Revision 1 has been developed based on management review of the original watch list and includes changes that occurred during FY-16.

  10. Cloning, expression, purification and crystallographic studies of galectin-11 from domestic sheep (Ovis aries).

    Science.gov (United States)

    Sakthivel, Dhanasekaran; Littler, Dene; Shahine, Adam; Troy, Sally; Johnson, Matthew; Rossjohn, Jamie; Piedrafita, David; Beddoe, Travis

    2015-08-01

    Galectins are an evolutionarily conserved family of proteins that translate glycan recognition into cellular effects. Galectin-11 is a unique member of the galectin family that is only expressed in ruminants such as sheep, goat and cattle and that plays a critical role in several important biological processes, such as reproduction and parasite-mediated innate immune responses. Currently, these two areas are of major importance for the sustainability of ruminant livestock production. Despite the emerging biological significance of galectin-11, no structural information is available. It is expected that structural studies will unravel the functional mechanisms of galectin-11 activity. Here, the expression, purification and crystallization of the ruminant-specific galectin-11 from domestic sheep and the collection of X-ray data to 2.0 Å resolution are reported.

  11. Reindeer (Rangifer tarandus response to feces and urine from sheep (Ovis aries and reindeer

    Directory of Open Access Journals (Sweden)

    Stein R. Moe

    1999-04-01

    Full Text Available In many Norwegian alpine and tundra areas sheep and reindeer graze sympatrically. Areas covered with dung or urine may have consequences for reindeer pasture utilization. Experiments were conducted on 5 stall fed male reindeer calves where animals were individually presenred with two troughs (experimental and control containing 200 g of concentrate. Fresh and dry sheep and reindeer pellets (50 g wet weight were mixed with the concentrate in the experimental trough and the aversive response was tested against the control. Both fresh sheep (P < 0.0001 and reindeer (P < 0.0001 pellets were associated with aversive response by reindeer. A similar response was found for dry sheep (P = 0.006 and dry reindeer (P = 0.0009 pellets. Similar trials were conducted using sheep and reindeer urine (20 g sprayed evenly on the food and the aversive response by reindeer was tested against the control (sprayed with 20 g of water. Both sheep and reindeer urine stimulated an aversive response by reindeer {P = 0.03 for both tests. The differences in the aversive response of reindeer ro fresh sheep and reindeer pellets, dry sheep and reindeer pellets and sheep and reindeer urine were also tested. No differences by reindeer were found between sheep and reindeer pellets, either for fresh (P = 0.28 or dry (P = 0.07, or between food treated with sheep and reindeer urine (P = 0.28. Possible habituation to sheep and reindeer pellets was tested using 8 consecutive trials with dry pellets, followed by 2 additional trials when dry pellets were soaked in water. This was done to simulate natural dry periods followed by rain showers. Habituation effects were found in trials with dry sheep and reindeer pellets. Subsequent trials with fecal pellets soaked in water significantly reduced food intake when compared with the last habituation trial with dry pellets (P < 0.05.

  12. Aspects of Toxoplasma Infection on the Reproductive System of Experimentally Infected Rams (Ovis Aries

    Directory of Open Access Journals (Sweden)

    Welber Daniel Zanetti Lopes

    2009-01-01

    Full Text Available Eight reproductive rams with no prior reproductive disease were distributed into three groups of infection with T. gondii: GI, 3 rams, 2.0×105 P strain oocysts; GII, 3 rams, 1.0×106 RH strain tachyzoites; GIII, 2 control rams. Clinical parameters were measured and serological evaluations (IIF were performed. Presence of the parasite in the semen was investigated by PCR and bioassay techniques. The rams presented clinical alterations (hyperthermia and apathy related to toxoplasmosis in both groups infected with Toxoplasma gondii. All the inoculated rams responded to antigenic stimulus, producing antibodies against T. gondii from postinoculation day 5 onwards. In ovine groups I and II, the greatest titers observed were 1 : 4096 and 1 : 8192, respectively. In semen samples collected from these two groups, the presence of T. gondii was detected by bioassay and PCR. This coccidian was isolated (bioassay and PCR in tissue pools (testicles, epididymis, seminal vesicle, and prostrate from two rams infected presenting oocysts and in one presenting tachyzoites.

  13. First wall/blanket/shield design and power conversion for the ARIES-IV tokamak fusion reactor

    International Nuclear Information System (INIS)

    Hasan, M.Z.; Conn, R.W.; Najmabadi, F.

    1994-01-01

    ARIES-IV is a conceptual, D-T burning, steady-state tokamak fusion reactor producing 1000 MWe net. It operates in the second plasma stability regime. The structural material is SiC composite and the primary coolant is helium at 10 MPa base pressure. The coolant flows poloidally in two loops, one inboard and one outboard. The coolant channels are circular tubes that form shells and are placed between two purge plates; the space between two adjacent tubes and the plate is purge gas flow area. The solid breeder is Li 2 O, and Be is used as neutron multiplier to ensure adequate TBR. Beryllium and Li 2 O are placed in between the adjacent tube shells. A computer code was developed to perform and optimize thermal-hydraulic design. Minimization of blanket thickness and the amount of Be, and the maximization of breeder zone thickness were done by iteration with neutronics. The gross thermal efficiency is 49%. The cost of electricity is 68 mills/kWh. The use of low activation SiC composite as the structural material, Li 2 O as the solid breeder, and avoidance of tungsten in the divertor has resulted in a good safety performance, and LSA rating of 1. Overall, SiC/He/Li 2 O ARIES-IV design is expected to have attractive economic and safety advantages

  14. The Impact of Combination Therapy with a-Blockers and 5ARIs on the Progression of BPH.

    Science.gov (United States)

    Sountoulides, Petros; Gravas, Stavros

    2015-01-01

    Benign prostatic hyperplasia (BPH) can be a progressive disease for some men with significant impact on their quality of life due to worsening of symptoms, risk of acute urinary retention (AUR) and surgery. Certain clinical parameters such as age, prostate volume and PSA are able to predict those patients with BPH-associated LUTS that are at risk of disease progression. These patients will likely benefit most from medical therapy that provides symptom relief while at the same time may prevent disease progression. Studies have shown that a-blockers, although able to rapidly alleviate symptoms, have no effect on prostate volume, risk for AUR and BPH-related surgery. On the other hand 5ARIs have proven their efficacy in reducing prostate size, the risk of AUR and prostate surgery. Therefore combination therapy with an a-blocker and a 5ARI can be the mainstay of treatment for those patients at risk of BPH progression. Patients' perspective and their needs and expectations from treatment are other crucial parameters to consider in order selecting the optimal management of BPH. Therefore physicians should take into consideration the drug properties and also the patients' preferences before deciding on the optimal pharmacological treatment for BPH-associated LUTS.

  15. ARIES: Enabling Visual Exploration and Organization of Art Image Collections.

    Science.gov (United States)

    Crissaff, Lhaylla; Wood Ruby, Louisa; Deutch, Samantha; DuBois, R Luke; Fekete, Jean-Daniel; Freire, Juliana; Silva, Claudio

    2018-01-01

    Art historians have traditionally used physical light boxes to prepare exhibits or curate collections. On a light box, they can place slides or printed images, move the images around at will, group them as desired, and visual-ly compare them. The transition to digital images has rendered this workflow obsolete. Now, art historians lack well-designed, unified interactive software tools that effectively support the operations they perform with physi-cal light boxes. To address this problem, we designed ARIES (ARt Image Exploration Space), an interactive image manipulation system that enables the exploration and organization of fine digital art. The system allows images to be compared in multiple ways, offering dynamic overlays analogous to a physical light box, and sup-porting advanced image comparisons and feature-matching functions, available through computational image processing. We demonstrate the effectiveness of our system to support art historians tasks through real use cases.

  16. Cellular distribution, purification and electrophoretic properties of malate dehydrogenase in Trichuris ovis and inhibition by benzimidazoles and pyrimidine derivatives.

    Science.gov (United States)

    Sanchez-Moreno, M; Ortega, J E; Valero, A

    1989-12-01

    High levels of malate dehydrogenase were found in Trichuris ovis. Two molecular forms of the enzyme, of different cellular location and electrophoretic pattern, were isolated and purified. The activity of soluble malate dehydrogenase was greater than that of mitochondrial malate dehydrogenase. Both forms also displayed different electrophoretic profiles in comparison with purified extracts from goat (Capra hircus) liver. Substrate concentration directly affected enzyme activity. Host and parasite malate dehydrogenase activity were both inhibited by a series of benzimidazoles and pyrimidine-derived compounds, some of which markedly reduced parasite enzyme activity, but not host enzyme activity. Percentage inhibition by some pyrimidine derivatives was greater than that produced by benzimidazoles.

  17. Use of system code to estimate equilibrium tritium inventory in fusion DT machines, such as ARIES-AT and components testing facilities

    Energy Technology Data Exchange (ETDEWEB)

    Wong, C.P.C., E-mail: wongc@fusion.gat.com [General Atomics, San Diego, CA (United States); Merrill, B. [Idaho National Laboratory, Idaho Falls, ID (United States)

    2014-10-15

    Highlights: • With the use of a system code, tritium burn-up fraction (f{sub burn}) can be determined. • Initial tritium inventory for steady state DT machines can be estimated. • f{sub burn} of ARIES-AT, CFETR and FNSF-AT are in the range of 1–2.8%. • Respective total tritium inventories of are 7.6 kg, 6.1 kg, and 5.2 kg. - Abstract: ITER is under construction and will begin operation in 2020. This is the first 500 MW{sub fusion} class DT device, and since it is not going to breed tritium, it will consume most of the limited supply of tritium resources in the world. Yet, in parallel, DT fusion nuclear component testing machines will be needed to provide technical data for the design of DEMO. It becomes necessary to estimate the tritium burn-up fraction and corresponding initial tritium inventory and the doubling time of these machines for the planning of future supply and utilization of tritium. With the use of a system code, tritium burn-up fraction and initial tritium inventory for steady state DT machines can be estimated. Estimated tritium burn-up fractions of FNSF-AT, CFETR-R and ARIES-AT are in the range of 1–2.8%. Corresponding total equilibrium tritium inventories of the plasma flow and tritium processing system, and with the DCLL blanket option are 7.6 kg, 6.1 kg, and 5.2 kg for ARIES-AT, CFETR-R and FNSF-AT, respectively.

  18. Incidence of Old World screw-worm fly, Chrysomya bezziana in Iraq

    International Nuclear Information System (INIS)

    Al-Taweel, Ayad A.; Al-Izzi, Mohammed A.J.; Jassim, Fadhil A.

    2000-01-01

    The Old World screw-worm fly (OWSWF), Chrysomya bezziana Villenuve, is a member of the insect family Calliphoridae and is an obligate parasite of warm-blooded animals in the tropics and sub-tropics (Norris and Murray 1964). Flies lay their eggs on the edge of wounds or body orifices; the resulting larvae invade the host tissues and produce lesions and infertility if the genitals become infested (Humphrey et al. 1980). Recorded hosts include cattle (Bos indicus), sheep (Ovis aries), goats (Caprus hircus), dogs (Canis familiaris), cats (Felis domesticus) and man (Homo sapiens) (Patton 1920, 1922, Stoddar and Peck 1962, Norris and Murray 1964). This investigation describes the incidence of myiasis caused by C. bezziana in Iraq from September 1996 to March 1998

  19. Dicty_cDB: Contig-U05453-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 4_N20_R IASMA L1 HindIII BAC library Vitis v... 44 1.6 1 ( DU234107 ) 1098574026029 CHORI-243 Ovis aries genomic... clone ... 44 1.6 1 ( CW007337 ) ZMMBLa0008O17.f ZMMBLa Zea mays genomic clone ZMM... 44 1.6 1 ( CU838323 ) A BAC library... EST Darmstadt I Hydra magnipapi... 44 1.6 1 ( BM439300 ) GIT0000114 Root-induced cDNA library from Glomus .... mays chromosome 8 clone CH201-12I21; ZMMBBc00... 44 1.6 1 ( AZ319107 ) 1M0038L02R Mouse 10kb plasmid UUGC1M library... has been constructed from PN40024 g... 44 1.6 1 ( CT525490 ) A BAC library

  20. The reindeer abomasal nematode (Ostertagia gruehneri) is naturally transmitted to sheep when sharing pastures

    DEFF Research Database (Denmark)

    Manninen, Saana-Maaria; Thamsborg, Stig Milan; Laaksonen, Sauli

    2014-01-01

    The increasing number of sheep (Ovis aries) in northern Finland, often alternately corralled with winter-fed reindeer (Rangifer tarandus tarandus), creates potential for cross-infection of gastrointestinal nematodes. The aim of this study was to elucidate this possibility with 43 animals. Eleven...... reindeer and 8 sheep had shared a corral by turns, reindeer during winters, and sheep in summers. Another 12 reindeer had no known contact with sheep. Twelve sheep had no close contact to other ruminants. Both reindeer groups were free-ranging during summers. During slaughter in September to November, 2003......, abomasa and parts of intestines were collected. Gastrointestinal nematodes were counted and identified. The species found were the following: in reindeer, Ostertagia gruehneri/Ostertagia arctica, Mazamastrongylus dagestanica, Nematodirus tarandi, Nematodirella longissimespiculata and Bunostomum...

  1. Mechanical deployment system on aries an autonomous mobile robot

    International Nuclear Information System (INIS)

    Rocheleau, D.N.

    1995-01-01

    ARIES (Autonomous Robotic Inspection Experimental System) is under development for the Department of Energy (DOE) to survey and inspect drums containing low-level radioactive waste stored in warehouses at DOE facilities. This paper focuses on the mechanical deployment system-referred to as the camera positioning system (CPS)-used in the project. The CPS is used for positioning four identical but separate camera packages consisting of vision cameras and other required sensors such as bar-code readers and light stripe projectors. The CPS is attached to the top of a mobile robot and consists of two mechanisms. The first is a lift mechanism composed of 5 interlocking rail-elements which starts from a retracted position and extends upward to simultaneously position 3 separate camera packages to inspect the top three drums of a column of four drums. The second is a parallelogram special case Grashof four-bar mechanism which is used for positioning a camera package on drums on the floor. Both mechanisms are the subject of this paper, where the lift mechanism is discussed in detail

  2. Lessons learned from the tokamak Advanced Reactor Innovation and Evaluation Study (ARIES)

    International Nuclear Information System (INIS)

    Krakowski, R.A.; Bathke, C.G.; Miller, R.L.; Werley, K.A.

    1994-01-01

    Lessons from the four-year ARIES (Advanced Reactor Innovation and Evaluation Study) investigation of a number of commercial magnetic-fusion-energy (MFE) power-plant embodiments of the tokamak are summarized. These lessons apply to physics, engineering and technology, and environmental, safety, and health (ES ampersand H) characteristics of projected tokamak power plants. Summarized herein are the composite conclusions and lessons developed in the course of four conceptual tokamak power-plant designs. A general conclusion from this extensive investigation of the commercial potential of tokamak power plants is the need for combined, symbiotic advances in both physics, engineering, and materials before economic competitiveness with developing advanced energy sources can be realized. Advances in materials are also needed for the exploitation of environmental advantages otherwise inherent in fusion power

  3. Lessons learned from the Tokamak Advanced Reactor Innovation and Evaluation Study (ARIES)

    International Nuclear Information System (INIS)

    Krakowski, R.A.; Bathke, C.G.; Miller, R.L.; Werley, K.A.

    1994-01-01

    Lessons from the four-year ARIES (Advanced Reactor Innovation and Evaluation Study) investigation of a number of commercial magnetic-fusion-energy (MFE) power-plant embodiments of the tokamak are summarized. These lessons apply to physics, engineering and technology, and environmental, safety and health (ES ampersand H) characteristics of projected tokamak power plants. A general conclusion from this extensive investigation of the commercial potential of tokamak power plants is the need for combined, symbiotic advances relative to present understanding in physics, engineering, and materials before economic competitiveness with developing advanced energy sources can be realized. Advanced tokamak plasmas configured in the second-stability regime that achieve both high β and bootstrap fractions near unity through strong profile control offer high promise in this regard

  4. Experimental system to measure excitation cross-sections by electron impact. Measurements for ArI and ArII

    International Nuclear Information System (INIS)

    Blanco, F.; Sanchez, J.A.; Aguilera, J.A.; Campos, J.

    1989-01-01

    An experimental set-up to measure excitation cross-section of atomic and molecular levels by electron impact based on the optical method is reported. We also present some measurements on the excitation cross-section for ArI 5p'(1/2)0 level, and for simultaneous ionization and excitation of Ar leading to ArII levels belonging to the 3p 4 4p and 3p 4 4d configurations. (Author)

  5. Antimicrobial susceptibility of Eschericia coli isolates from Arieş river (Romania

    Directory of Open Access Journals (Sweden)

    Andreea BODOCZI FLOREA

    2011-05-01

    Full Text Available We studied the prevalence of antimicrobial resistance (AR and multiple antimicrobial resistances (MAR among the faecal bacteria found in the Arieş river (Romania affected by strong anthropogenic pressures. Isolation and identification of E. coli were done by using enrichment media, selective media, and biochemical tests. Antimicrobial susceptibility testing by the disk diffusion method was conducted for 12 antimicrobial agents: ciprofloxacin, gentamicin, streptomycin, ceftazidin, ofloxacin, sulfamethoxazole, ticarcycline, ampicillin, nalidixic acid, nitrofurantoin, erythromycin, and norfloxacin. The data of the antimicrobial susceptibility reviled that all the studied E. coli strains were resistant to most of the tested antibiotics. The analysis of antibiotic resistance frequencies has showed an incidence of 46.66% strains resistant to more than 4 different antibiotics. Moreover, a high incidence of multiple antibiotic resistances was detected in each of the studied samples.

  6. Fusobacterium necrophorum in North American Bighorn Sheep ( Ovis canadensis ) Pneumonia.

    Science.gov (United States)

    Shanthalingam, Sudarvili; Narayanan, Sanjeevkumar; Batra, Sai Arun; Jegarubee, Bavananthasivam; Srikumaran, Subramaniam

    2016-07-01

    Fusobacterium necrophorum has been detected in pneumonic bighorn sheep (BHS; Ovis canadensis ) lungs, in addition to the aerobic respiratory pathogens Mannheimia haemolytica , Bibersteinia trehalosi , Pasteurella multocida , and Mycoplasma ovipneumoniae . Similar to M. haemolytica , F. necrophorum produces a leukotoxin. Leukotoxin-induced lysis and degranulation of polymorphonuclear leukocytes (PMNs) and macrophages are responsible for acute inflammation and lung tissue damage characteristic of M. haemolytica -caused pneumonia. As one approach in elucidating the role of F. necrophorum in BHS pneumonia, we determined the frequency of the presence of F. necrophorum in archived pneumonic BHS lung tissues, and susceptibility of BHS leukocytes to F. necrophorum leukotoxin. A species-specific PCR assay detected F. necrophorum in 37% of pneumonic BHS lung tissues (total tested n=70). Sequences of PCR amplicons were similar to the less virulent F. necrophorum subsp. funduliforme. Fusobacterium necrophorum leukotoxin exhibited cytotoxicity to BHS PMNs and peripheral blood mononuclear cells. As with the M. haemolytica leukotoxin, F. necrophorum leukotoxin was more toxic to BHS PMNs than domestic sheep PMNs. It is likely that F. necrophorum enters the lungs after M. haemolytica and other aerobic respiratory pathogens enter the lungs and initiate tissue damage, thereby creating a microenvironment that is conducive for anaerobic bacterial growth. In summary, Fusobacterium leukotoxin is highly toxic for BHS leukocytes; however, based on the PCR findings, it is unlikely to play a direct role in the development of BHS pneumonia.

  7. Optical monitoring of Active Galactic Nuclei from ARIES

    Science.gov (United States)

    Gopal-Krishna; Wiita, Paul Joseph

    2018-04-01

    This overview provides a historical perspective highlighting the pioneering role which the fairly modest observational facilities of ARIES have played since the 1990s in systematically characterizing the optical variability on hour-like time scale (intra-night optical variability, or INOV) of several major types of high-luminosity Active Galactic Nuclei (AGN). Such information was previously available only for blazars. Similar studies have since been initiated in at least a dozen countries, giving a boost to AGN variability research. Our work has, in particular, provided strong indication that mild INOV occurs in radio-quiet QSOs (amplitude up to 3 – 5 % and duty cycle 10%) and, moreover, has demonstrated that similarly mild INOV is exhibited even by the vast majority of radio-loud quasars which possess powerful relativistic jets (even including many that are beamed towards us). The solitary outliers are blazars, the tiny strongly polarized subset of powerful AGN, which frequently exhibit a pronounced INOV. Among the blazars, BL Lac objects often show a bluer-when-brighter chromatic behavior, while the flat spectrum radio quasars seem not to. Quantifying any differences of INOV among the major subclasses of non-blazar type AGNs will require dedicated monitoring programs using 2 - 3 metre class telescopes.

  8. Trusses Of Tensegrity Type In A Concept Of Train Station Renovation In Żary

    Directory of Open Access Journals (Sweden)

    Lechocka Paulina

    2015-09-01

    Full Text Available The first railway station in Żary was built in 1843 in Germany. After the Second World War and years of socialism in Poland the meaning of railway decreased and its technical condition deteriorated. Now the building needs renovation and change of function. Tensegrity structures may be useful in renovation of platforms shelter. They are strut and tie construction, in which there is self-stabilization between compressed and tensioned elements. Conception of new platform shelter is based on exemplary tensegrity module consist of three struts and nine cables (called „Simplex”. Tensegrity would make railway station more modern, but not cover its original elevation.

  9. Error Probability of Binary and -ary Signals with Spatial Diversity in Nakagami- (Hoyt Fading Channels

    Directory of Open Access Journals (Sweden)

    Duong Trung Q

    2007-01-01

    Full Text Available We analyze the exact average symbol error probability (SEP of binary and -ary signals with spatial diversity in Nakagami- (Hoyt fading channels. The maximal-ratio combining and orthogonal space-time block coding are considered as diversity techniques for single-input multiple-output and multiple-input multiple-output systems, respectively. We obtain the average SEP in terms of the Lauricella multivariate hypergeometric function . The analysis is verified by comparing with Monte Carlo simulations and we further show that our general SEP expressions particularize to the previously known results for Rayleigh ( = 1 and single-input single-output (SISO Nakagami- cases.

  10. HISTOPATOLOGIA DE LA INFECCIÓN EXPERIMENTAL DE OVEJAS SIN LANA Ovis aries POR Neospora caninum

    Directory of Open Access Journals (Sweden)

    Teresa Oviedo

    2003-01-01

    Full Text Available Ovejas sin lana en diferentes estados reproductivos fueron inoculadas por vía intravenosa con taquizoítos deN. caninum muestra «NC-beef» con el fin de estudiar la patofisiología de la enfermedad en estos animales yverificar la posibilidad de ser usados como modelo experimental de neosporosis bovina. Se utilizaron cincoovejas gestantes (una con 15 días, dos con 30 días, dos con 90 días, tres no gestantes y dos con 10 díasposparto. Los animales eran serologicamente negativos para N.caninum y T. gondii. Dos ovejas gestantes, noinoculadas, fueron utilizadas como control negativo. Los corderos necropsiados, nacidos de ovejas inoculadasantes o durante la gestación presentaron alteraciones histopatológicas en diferentes tejidos, siendo las masseveras observadas en el sistema nervioso central, caracterizadas por la presencia de formas quísticas delparásito asociadas con infiltrado inflamatorio predominantemente mononuclear, áreas de necrosis y en algunoscasos presencia de calcificación. Los corderos nacidos de ovejas inoculadas 10 días después del parto nopresentaron signos clínicos de la enfermedad ni anticuerpos contra o parásito y a la necropsia no presentaronlesiones en ninguno de los tejidos analizados. Un cordero nacido de oveja no inoculada no presentó alteracionesmicroscópicas en ninguno de los tejidos analizados

  11. Primary cell culture of LHRH neurones from embryonic olfactory placode in the sheep (Ovis aries).

    Science.gov (United States)

    Duittoz, A H; Batailler, M; Caldani, M

    1997-09-01

    The aim of this study was to establish an in vitro model of ovine luteinizing hormone-releasing hormone (LHRH) neurones. Olfactory placodes from 26 day-old sheep embryos (E26) were used for explant culture. Cultures were maintained successfully up to 35 days, but were usually used at 17 days for immunocytochemistry. LHRH and neuronal markers such as neurofilament (NF) were detected by immunocytochemistry within and/or outside the explant. Three main types of LHRH positive cells are described: (1) neuroblastic LHRH and NF immunoreactive cells with round cell body and very short neurites found mainly within the explant, (2) migrating LHRH bipolar neurones with an fusiform cell body, found outside the explant, (3) network LHRH neuron, bipolar or multipolar with long neurites connecting other LHRH neurons. Cell morphology was very similar to that which has been described in the adult sheep brain. These results strongly suggest that LHRH neurones in the sheep originate from the olfactory placode. This mode may represent a useful tool to study LHRH neurones directly in the sheep.

  12. Effect of pasture size on behavioural synchronization and spacing in German Blackface ewes (Ovis aries).

    Science.gov (United States)

    Hauschildt, Verena; Gerken, Martina

    2016-03-01

    This study aims to assess plot size related changes in spacing and behavioural synchronization in a herd of 14 German Blackface ewes kept on three different pasture sizes: S (126m(2)), M (1100m(2)), and L (11,200m(2)). In direct field observations, behaviour and nearest neighbour distance were recorded individually. Additionally, interindividual and nearest neighbour distances were derived from aerial photographs of the herd taken on plot sizes S and M. Nearest neighbour distances behaviour as intraindividual repeatability of the derived distances was highly significant (Kendall's W between 0.32 and 0.58; pbehavioural synchronization might be mainly attributed to the motivation for close proximity to any conspecific. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Rumen ciliate protozoa of domestic sheep (Ovis aries) and goat (Capra aegagrus hircus) in Kyrgyzstan.

    Science.gov (United States)

    Gürelli, Gözde; Canbulat, Savaş; Aldayarov, Nurbek; Dehority, Burk A

    2016-03-01

    Species composition and concentration of rumen ciliate protozoa were investigated in the rumen contents of 14 domestic sheep and 1 goat living in Bishkek, Kyrgyzstan. This is the first report on rumen ciliates from ruminants living in Kyrgyzstan. In sheep 12 genera, 28 species and 12 morphotypes were detected, whereas in goat 8 genera, 12 species and 4 morphotypes were detected. The density of ciliates in sheep was (28.1 ± 20.0) × 10(4) cells mL(-1) and in goat was 37.0 × 10(4) cells mL(-1). Dasytricha ruminantium, Isotricha prostoma, Entodinium simulans and Ophryoscolex caudatus were major species (100%) in sheep, and for the first time, Diplodinium rangiferi was detected in a domestic goat. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Genome-Wide Association Analyses Highlight the Potential for Different Genetic Mechanisms for Litter Size Among Sheep Breeds

    Science.gov (United States)

    Xu, Song-Song; Gao, Lei; Xie, Xing-Long; Ren, Yan-Ling; Shen, Zhi-Qiang; Wang, Feng; Shen, Min; Eyϸórsdóttir, Emma; Hallsson, Jón H.; Kiseleva, Tatyana; Kantanen, Juha; Li, Meng-Hua

    2018-01-01

    Reproduction is an important trait in sheep breeding as well as in other livestock. However, despite its importance the genetic mechanisms of litter size in domestic sheep (Ovis aries) are still poorly understood. To explore genetic mechanisms underlying the variation in litter size, we conducted multiple independent genome-wide association studies in five sheep breeds of high prolificacy (Wadi, Hu, Icelandic, Finnsheep, and Romanov) and one low prolificacy (Texel) using the Ovine Infinium HD BeadChip, respectively. We identified different sets of candidate genes associated with litter size in different breeds: BMPR1B, FBN1, and MMP2 in Wadi; GRIA2, SMAD1, and CTNNB1 in Hu; NCOA1 in Icelandic; INHBB, NF1, FLT1, PTGS2, and PLCB3 in Finnsheep; ESR2 in Romanov and ESR1, GHR, ETS1, MMP15, FLI1, and SPP1 in Texel. Further annotation of genes and bioinformatics analyses revealed that different biological pathways could be involved in the variation in litter size of females: hormone secretion (FSH and LH) in Wadi and Hu, placenta and embryonic lethality in Icelandic, folliculogenesis and LH signaling in Finnsheep, ovulation and preovulatory follicle maturation in Romanov, and estrogen and follicular growth in Texel. Taken together, our results provide new insights into the genetic mechanisms underlying the prolificacy trait in sheep and other mammals, suggesting targets for selection where the aim is to increase prolificacy in breeding projects.

  15. A rice chloroplast transit peptide sequence does not alter the cytoplasmic localization of sheep serotonin N-acetyltransferase expressed in transgenic rice plants.

    Science.gov (United States)

    Byeon, Yeong; Lee, Hyoung Yool; Lee, Kyungjin; Back, Kyoungwhan

    2014-09-01

    Ectopic overexpression of melatonin biosynthetic genes of animal origin has been used to generate melatonin-rich transgenic plants to examine the functional roles of melatonin in plants. However, the subcellular localization of these proteins expressed in the transgenic plants remains unknown. We studied the localization of sheep (Ovis aries) serotonin N-acetyltransferase (OaSNAT) and a translational fusion of a rice SNAT transit peptide to OaSNAT (TS:OaSNAT) in plants. Laser confocal microscopy analysis revealed that both OaSNAT and TS:OaSNAT proteins were localized to the cytoplasm even with the addition of the transit sequence to OaSNAT. Transgenic rice plants overexpressing the TS:OaSNAT fusion transgene exhibited high SNAT enzyme activity relative to untransformed wild-type plants, but lower activity than transgenic rice plants expressing the wild-type OaSNAT gene. Melatonin levels in both types of transgenic rice plant corresponded well with SNAT enzyme activity levels. The TS:OaSNAT transgenic lines exhibited increased seminal root growth relative to wild-type plants, but less than in the OaSNAT transgenic lines, confirming that melatonin promotes root growth. Seed-specific OaSNAT expression under the control of a rice prolamin promoter did not confer high levels of melatonin production in transgenic rice seeds compared with seeds from transgenic plants expressing OaSNAT under the control of the constitutive maize ubiquitin promoter. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Meat and Livestock Association Plenary Lecture 2005. Oocyte signalling molecules and their effects on reproduction in ruminants.

    Science.gov (United States)

    McNatty, Kenneth P; Lawrence, Stephen; Groome, Nigel P; Meerasahib, Mohammed F; Hudson, Norma L; Whiting, Lynda; Heath, Derek A; Juengel, Jennifer L

    2006-01-01

    Sheep (Ovis aries) are a highly diverse species, with more than 900 different breeds that vary significantly in their physiological characteristics, including ovulation rate and fecundity. From examination of inherited patterns of ovulation rate, several breeds have been identified with point mutations in two growth factor genes that are expressed in oocytes. Currently, five different point mutations have been identified in the BMP15 (GDF9b) gene and one in GDF9. Animals heterozygous for the GDF9 and/or the BMP15 mutations have higher ovulation rates than their wild-type counterparts. In contrast, those homozygous for any of the aforementioned BMP15 or GDF9 mutations are sterile owing to arrested follicular development. In bovine and ovine ovaries, GDF9 was expressed exclusively in oocytes throughout follicular growth from the primordial stage of development, whereas in sheep BMP15 was expressed exclusively in oocytes from the primary stage: no data for the ontogeny of BMP15 expression are currently available for cattle. In vitro, ovine growth differentiation factor 9 (oGDF9) has no effect on (3)H-thymidine incorporation by either bovine or ovine granulosa cells, whereas ovine bone morphogenetic protein 15 (oBMP15) has modest (1.2- to 1.6-fold; P reproduction in mammals, including rodents, humans and ruminants. Moreover, in vivo manipulation of these oocyte signalling molecules provides new opportunities for the management of the fertility of ruminants.

  17. Parâmetros cinéticos da degradação in vitro de alimentos incubados com inóculo microbiano de diferentes espécies de ruminantes Kinetic parameters of the ruminal in vitro degradation of feedstuffs given to different ruminant species

    Directory of Open Access Journals (Sweden)

    A.R.G.F. Bezerra

    2005-08-01

    Full Text Available Parâmetros cinéticos da degradação ruminal de alguns alimentos utilizados para ruminantes de zoológicos foram estimados mediante incubação in vitro com líquido ruminal de audade (Ammotragus lervia, cervo sambar (Cervus unicolor, elande (Taurotragus oryx, bovino (Bos taurus, bubalino (Bubalus bubalis, caprino (Capra hircus e ovino (Ovis aries. Os parâmetros cinéticos foram estimados pela técnica da produção de gás, cujos dados foram ajustados pelos modelos de um e de duplo compartimento. Não foram detectadas diferenças nos parâmetros cinéticos que permitissem agrupar os alimentos (fibrosos × não fibrosos e os animais (domésticos × silvestres. O modelo de duplo compartimento foi o mais adequado para a estimação dos parâmetros cinéticos da degradação ruminal. Inóculo microbiano oriundo de ruminantes domésticos não é recomendado para estimar parâmetros cinéticos da degradação ruminal de alimentos utilizados para ruminantes silvestres de zoológicos.The estimation of the ruminal kinetic parameters of pumpkin, potato-sweet, beet, broccoli, carrot, alfalfa hay, alfalfa pellet and bean, currently used for feeding wild and domestic ruminants raised in the Rio de Janeiro Zoo, was made through in vitro incubation of the feedstuffs together with ruminal fluid obtained from aoudad (Ammotragus lervia, sambar deer (Cervus unicolor, eland (Taurotragus oryx, cattle (Bos taurus, buffalo (Bubalus bubalis, goat (Capra hircus and sheep (Ovis aries. The gas production technique was used to obtain gas profiles, and the data were fitted by the mono or double compartmental model. The kinetic parameters were discrepant among both, animals and feedstuffs, and the double compartmental model gave the best estimation. Ruminal inocula from domestic ruminants can not be used to estimate the kinetic parameters of ruminal degradation of feedstuffs for wild ruminants.

  18. Use of RAPD and PCR double amplification in the study of ancient DNA

    Directory of Open Access Journals (Sweden)

    F. Balzano

    2011-01-01

    Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.

  19. The mammary gland in small ruminants: major morphological and functional events underlying milk production – a review

    DEFF Research Database (Denmark)

    Lérias, Joana R; Hernandez Castellano, Lorenzo E; Suárez-Trujillo, Aridany

    2014-01-01

    the modifications occurring in the mammary gland through the lactation period in production animals, particularly in the small ruminants, sheep (Ovis aries) and goat (Capra hircus). Nevertheless, understanding the different mammary gland patterns throughout lactation is essential to improve dairy production......, as well as a reduction of stroma, corresponding macroscopically to the increase in mammary gland volume. Throughout late lactation, the mammary gland volume decreases owing to the regression of the secretory structure. In general, common mammary gland patterns have been shown for both goats and sheep...... throughout the several lactation stages, although the number of studies is limited. The main objective of this manuscript is to review the colostrogenesis and lactogenesis processes as well as to highlight the mammary gland morphological patterns underlying milk production during the lactation cycle...

  20. PENDIDIKAN KARAKTER MENURUT K.H. HASYIM ASY’ARI DALAM KITAB ADÂB AL-‘ÂLIM WA AL-MUTA‘ALLIM

    Directory of Open Access Journals (Sweden)

    Sholikah Sholikah

    2015-09-01

    Full Text Available The article deals with K.H. Hasyim Asy’ari’s thought of character education. The result of the study indicates that according to K.H. Hasyim Asy’ari the characters of teachers and students in his work Adab al-‘Âlim wa al-Muta’allim can be classified into three parts, are mentality or character, which should be possessed by teachers and learners: attempts to be done in order to become characterized teachers and learners, and: teaching strategies employed by educators and learning strategies used by learners. These three parts have compatible indicators with the competence of educators stated in UU Sisdiknas (The Legislation of National Educational System year 2003 along with 18 values of character promulgated by Pusat Kurikulum Pengembangan dan Pendidikan Budaya dan Karakter Bangsa. Moreover, according to K.H. Hasyim Asy’ari, the relevance of character education with the context of character education in Indonesia consists of a number of character education elements, namely the meaning and goal of character education, the values of character for both teachers and students, the rationale of character education, the method of character education, the media of character education, and the evaluation of character education

  1. On the Symbol Error Rate of M-ary MPSK over Generalized Fading Channels with Additive Laplacian Noise

    KAUST Repository

    Soury, Hamza

    2015-01-07

    This work considers the symbol error rate of M-ary phase shift keying (MPSK) constellations over extended Generalized-K fading with Laplacian noise and using a minimum distance detector. A generic closed form expression of the conditional and the average probability of error is obtained and simplified in terms of the Fox’s H function. More simplifications to well known functions for some special cases of fading are also presented. Finally, the mathematical formalism is validated with some numerical results examples done by computer based simulations [1].

  2. On the Symbol Error Rate of M-ary MPSK over Generalized Fading Channels with Additive Laplacian Noise

    KAUST Repository

    Soury, Hamza; Alouini, Mohamed-Slim

    2015-01-01

    This work considers the symbol error rate of M-ary phase shift keying (MPSK) constellations over extended Generalized-K fading with Laplacian noise and using a minimum distance detector. A generic closed form expression of the conditional and the average probability of error is obtained and simplified in terms of the Fox’s H function. More simplifications to well known functions for some special cases of fading are also presented. Finally, the mathematical formalism is validated with some numerical results examples done by computer based simulations [1].

  3. Seroprevalence of Toxoplasma gondii in free-living European mouflon (Ovis orientalis musimon hunted in central Germany

    Directory of Open Access Journals (Sweden)

    Heddergott Mike

    2018-01-01

    Full Text Available Despite increasing consumption of mouflon (Ovis orientalis musimon meat in Germany, there is currently no surveillance of Toxoplasma gondii infection in populations of these animals and generally little knowledge about the prevalence of this protozoan in German wild ungulates. Between 2011 and 2015, we collected 138 blood samples from a free-living mouflon population in central German and tested sera for the presence of T. gondii antibodies using a modified agglutination test (MAT, cut-off 1:20. Antibodies were detected in 31 of the 138 samples (22.46%. There was a significant difference in seroprevalence between the different age classes, with antibodies to T. gondii more frequent in adults. In contrast, there was no significant difference in seroprevalence depending on sex and year of sample collection. Game meat is frequently consumed as raw or undercooked meat and may therefore represent a potential source of human infection with T. gondii.

  4. An ecologic study comparing distribution of Pasteurella trehalosi and Mannheimia haemolytica between Sierra Nevada bighorn sheep, White Mountain bighorn sheep, and domestic sheep.

    Science.gov (United States)

    Tomassini, Letizia; Gonzales, Ben; Weiser, Glen C; Sischo, William

    2009-10-01

    The prevalence and phenotypic variability of Pasteurella and Mannheimia isolates from Sierra Nevada bighorn sheep (Ovis canadensis sierrae), White Mountain bighorn sheep (Ovis canadensis nelsoni), and domestic sheep (Ovis aries) from California, USA, were compared. The White Mountain bighorn sheep population had a recent history of pneumonia-associated mortality, whereas the Sierra Nevada bighorn sheep population had no recent history of pneumonia-associated mortality. The domestic sheep flocks were pastured in areas geographically near both populations but were not known to have direct contact with either bighorn sheep population. Oropharyngeal swab samples were collected from healthy domestic and bighorn sheep and cultured to characterize bacterial species, hemolysis, biogroups, and biovariants. Pasteurella trehalosi and Mannheimia haemolytica were detected in all of the study populations, but the relative proportion of each bacterial species differed among sheep populations. Pasteurella trehalosi was more common than M. haemolytica in the bighorn sheep populations, whereas the opposite was true in domestic sheep. Mannheimia haemolytica was separated into 11 biogroups, and P. trehalosi was characterized into two biogroups. Biogroup distributions for M. haemolytica and P. trehalosi differed among the three populations; however, no difference was detected for the distribution of P. trehalosi biogroups between the Sierra Nevada bighorn sheep and domestic sheep. The prevalence odds ratios (pOR) for the distribution of M. haemolytica biogroups suggested little difference between White Mountain bighorn sheep and domestic sheep compared with Sierra Nevada bighorn sheep and domestic sheep, although these comparisons had relatively large confidence intervals for the point estimates. Hemolytic activity of the isolates was not different among the sheep populations for M. haemolytica but was different for P. trehalosi. No clear evidence of association was found in the

  5. On the symbol error rate of M-ary MPSK over generalized fading channels with additive Laplacian noise

    KAUST Repository

    Soury, Hamza

    2014-06-01

    This paper considers the symbol error rate of M-ary phase shift keying (MPSK) constellations over extended Generalized-K fading with Laplacian noise and using a minimum distance detector. A generic closed form expression of the conditional and the average probability of error is obtained and simplified in terms of the Fox\\'s H function. More simplifications to well known functions for some special cases of fading are also presented. Finally, the mathematical formalism is validated with some numerical results examples done by computer based simulations. © 2014 IEEE.

  6. On the symbol error rate of M-ary MPSK over generalized fading channels with additive Laplacian noise

    KAUST Repository

    Soury, Hamza; Alouini, Mohamed-Slim

    2014-01-01

    This paper considers the symbol error rate of M-ary phase shift keying (MPSK) constellations over extended Generalized-K fading with Laplacian noise and using a minimum distance detector. A generic closed form expression of the conditional and the average probability of error is obtained and simplified in terms of the Fox's H function. More simplifications to well known functions for some special cases of fading are also presented. Finally, the mathematical formalism is validated with some numerical results examples done by computer based simulations. © 2014 IEEE.

  7. Inactivated Orf virus (Parapoxvirus ovis) elicits antifibrotic activity in models of liver fibrosis.

    Science.gov (United States)

    Nowatzky, Janina; Knorr, Andreas; Hirth-Dietrich, Claudia; Siegling, Angela; Volk, Hans-Dieter; Limmer, Andreas; Knolle, Percy; Weber, Olaf

    2013-05-01

    Inactivated Orf virus (ORFV, Parapoxvirus ovis) demonstrates strong antiviral activity in animal models including a human hepatitis B virus (HBV)-transgenic mouse. In addition, expression of interferon (IFN)-γ and interleukin-10 (IL-10) was induced after administration of inactivated ORFV in these mice. IFN-γ and IL-10 are known to elicit antifibrotic activity. We therefore aimed to study antifibrotic activity of inactivated ORFV in models of liver fibrosis. We characterized ORFV-induced hepatic cytokine expression in rats. We then studied ORFV in two models of liver fibrosis in rats, pig serum-induced liver fibrosis and carbon tetrachloride (CCL4 )-induced liver fibrosis. ORFV induced hepatic expression of IFN-γ and IL-10 in rats. ORFV mediated antifibrotic activity when administrated concomitantly with the fibrosis-inducing agents in both models of liver fibrosis. Importantly, when CCL4 -induced liver fibrosis was already established, ORFV application still showed significant antifibrotic activity. In addition, we were able to demonstrate a direct antifibrotic effect of ORFV on stellate cells. These results establish a potential novel antifibrotic therapeutic approach that not only prevents but also resolves established liver fibrosis. Further studies are required to unravel the details of the mechanisms involved. © 2012 The Japan Society of Hepatology.

  8. Simplified Soft-output Demapper Based on a Linear Transformation Technique for M-ary PSK

    Directory of Open Access Journals (Sweden)

    Jianping Li

    2014-10-01

    Full Text Available Combining channel coding with high-order modulation schemes, namely coded modulation (CM, is an efficient digital transmission technology. CM requires the demapper to provide a soft decision bit metric as a part of the inputs to the decoder. This paper proposes an efficient soft- output demapper for M-ary PSK. This novel demodulation algorithm continues to evolve the conventional MAX-Log-MAP algorithm and summarizes the final derivation into a form of matrix multiplication. The Computational complexity for getting one bit soft value of a signal by employing the proposed algorithm remains a constant with the increase of modulation order. Meanwhile, the theoretical analysis and simulation results prove that the novel simplified soft-output demapper can obtain the same performance as MAX-Log-MAP.

  9. Utiliza????o do mapa pedol??gico na caracteriza????o geot??cnica da Aris Mestre D`Armas em Planaltina ??? DF

    OpenAIRE

    Paranhos, Haroldo; Farias, Rideci; Silva, Joyce Maria Lucas; Pereira, Paulo Sergio

    2016-01-01

    O presente trabalho apresenta os resultados dos estudos geot??cnicos realizados na ARIS Metre D???Armas em Planaltina ??? DF, com vistas ?? caracteriza????o geot??cnica dos solos e risco geot??cnico, por meio de levantamento de campo, sondagens SPT, sondagens com penetr??metro de anel e sondagens ?? trado, com coleta de amostras, ensaios de permeabilidade em furos de sondagens e ensaios de caracteriza????o dos solos em laborat??rio. Como ferramenta auxiliar na espacializa????o e defi...

  10. Mitigation of environmental impacts: a study of the companies that compose the Camaçari Industrial Center (PIC

    Directory of Open Access Journals (Sweden)

    Sonia Maria da Silva Gomes

    2016-09-01

    Full Text Available The purpose of this research was to map the environmental impacts of mitigation actions demonstrated in the sustainability reporting and financial statements of companies that compose the Camaçari Industrial Center (PIC from 2007 to 2013. Data from the Industrial Development Committee of Camaçari was used to survey the companies. The final sample consisted of 14 companies. Content analysis was used to identify the information contained in these reports, based on the model proposed by Nossa (2002 for measuring environmental impacts. The results showed that the subcategory most mentioned in the sustainability reports was wastefulness. It was found in 430 instances, followed by Recycling (157, CO² (129, Contamination and Land Restoration (122, and Conservation of Natural Resources (108. The wastefulness subcategory was also more present in the financial statements, with 77 instances, followed by Contamination and Land Restoration (49 and Recycling (29. There was also a growing trend of disclosure of environmental liabilities. The evidence indicates that the companies are concerned primarily with the treatment and disposal of their waste (solid, liquid and gaseous. The results are restricted to the period and sample investigated. Further research is suggested to broaden the sample and investigate the relationship between disclosure of environmental mitigation actions related to environmental impacts and the financial performance of companies. Additionally, studies could investigate which factors influence the adoption and dissemination of these actions, in the perception of managers of Brazilian companies.

  11. Target activation and radiological response of ARIES-IFE dry wall chamber

    International Nuclear Information System (INIS)

    El-Guebaly, L.A.; Henderson, D.L.; Wilson, P.P.H.; Abdou, A.E.

    2002-01-01

    The choice of target coating and hohlraum wall materials is among the most critical decisions to be made for inertial fusion energy (IFE) designs. Gold and gold/gadolinium have long been considered to be the coating and hohlraum wall materials of choice for direct drive (DD) and indirect drive (ID) targets, respectively, offering high target performance and low beam energy losses. More recently, a variety of other materials have been considered, including W, Pb, Pt, Pd, and Ag for the DD target coating and Au, W, Pb, Hg, Ta, Cs, and Hf for the hohlraum wall of the ID target. The choice of the coating/hohlraum material is a tradeoff between the target design elements such as safety, target physics, economics, etc. We identified the key safety issues and have investigated the neutron-induced irradiation effects of the candidate coating/hohlraum materials using the radiation chamber conditions of the ARIES-IFE dry wall concept. The safety requirements have specific impacts in terms of the coating/hohlraum materials choice

  12. Bartonella melophagi in blood of domestic sheep (Ovis aries) and sheep keds (Melophagus ovinus) from the southwestern US: Cultures, genetic characterization, and ecological connections.

    Science.gov (United States)

    Kosoy, Michael; Bai, Ying; Enscore, Russell; Rizzo, Maria Rosales; Bender, Scott; Popov, Vsevolod; Albayrak, Levent; Fofanov, Yuriy; Chomel, Bruno

    2016-07-15

    Bartonella melophagi sp. nov. was isolated from domestic sheep blood and from sheep keds (Melophagus ovinus) from the southwestern United States. The sequence analyses of the reference strain performed by six molecular markers consistently demonstrated that B. melophagi relates to but differ from other Bartonella species isolated from domestic and wild ruminants. Presence of 183 genes specific for B. melophagi, being absent in genomes of other Bartonella species associated with ruminants also supports the separation of this bacterial species from species of other ruminants. Bartonella DNA was detected in all investigated sheep keds; however, culturing of these bacteria from sheep blood rejects a speculation that B. melophagi is an obligatory endosymbiont. Instead, the results support the hypothesis that the domestic sheep is a natural host reservoir for B. melophagi and the sheep ked its main vector. This bacterium was not isolated from the blood of bighorn sheep and domestic goats belonging to the same subfamily Caprinae. B. melophagi has also been shown to be zoonotic and needs to be investigated further. Published by Elsevier B.V.

  13. Proyecto de mejora y acondicionamiento como apeadero multimodal de la parcela ARI-T03 y de varios viales en el municipio de San Fernando (Cádiz)

    OpenAIRE

    Díaz Ramos, Jesús

    2014-01-01

    El objeto del presente Proyecto es definir las obras necesarias para la correcta ejecución de las obras de mejora y acondicionamiento como apeadero multimodal de la parcela ARI-T03 y de varios viales, en el municipio de San Fernando (Cádiz).

  14. Clinical Survival of Rebonded Brackets with Different ARI Scores

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Ahangar Atashi

    2016-01-01

    Full Text Available Introduction: Bracket debonding is one of the most common events in orthodontics. The aim of the present study was to quantitatively compare clinical survival of rebonded brackets with different ARI scores with new brackets rebonding. Materials and Methods: The subjects in the present study consisted of 74 patients with 76 debonded brackets on maxillary first and second premolars. After refreshing the bracket base of the debonded brackets, they were assigned in two groups: group A with 27 brackets of ARI≥4 and group B with 28 brackets of ARI≤2. In 21 cases, new brackets were used (group C. The frequency of the debonding in each rebonded group during treatment was calculated in intervals of 6,12,18 mounths after onset of bracket rebonding . Chi-squared test was used to compare the frequency of debonded brackets. Results: The frequency of debonded brackets was significantly higher in group B (ARI≤2 than those of groups A (ARI≥4 and C (new brackets. The number of debonded brackets were not significantly different between groups A (ARI≥4 and C (new brackets. Conclusion: Rebonding strength of debonded brackets in those that the failure is presented between adhesive and enamel (ARI≥4 could be clinically acceptable with no need to use new brackets.    Key words: dental bonding; orthodontic brackets; prevalence

  15. An AANAT/ASMT transgenic animal model constructed with CRISPR/Cas9 system serving as the mammary gland bioreactor to produce melatonin-enriched milk in sheep.

    Science.gov (United States)

    Ma, Teng; Tao, Jingli; Yang, Minghui; He, Changjiu; Tian, Xiuzhi; Zhang, Xiaosheng; Zhang, Jinlong; Deng, Shoulong; Feng, Jianzhong; Zhang, Zhenzhen; Wang, Jing; Ji, Pengyun; Song, Yukun; He, Pingli; Han, Hongbing; Fu, Juncai; Lian, Zhengxing; Liu, Guoshi

    2017-08-01

    Melatonin as a potent antioxidant exhibits important nutritional and medicinal values. To produce melatonin-enriched milk will benefit the consumers. In this study, a sheep bioreactor which generates melatonin-enriched milk has been successfully developed by the technology that combined CRISPR/Cas9 system and microinjection. The AANAT and ASMT were cloned from pineal gland of Dorper sheep (Ovis aries). The in vitro studies found that AANAT and ASMT were successfully transferred to the mammary epithelial cell lines and significantly increased melatonin production in the culture medium compared to the nontransgenic cell lines. In addition, the Cas9 mRNA, sgRNA, and the linearized vectors pBC1-AANAT and pBC1-ASMT were co-injected into the cytoplasm of pronuclear embryos which were implanted into ewes by oviducts transferring. Thirty-four transgenic sheep were generated with the transgenic positive rate being roughly 35% which were identified by Southern blot and sequencing. Seven carried transgenic AANAT, two carried ASMT, and 25 carried both of AANAT and ASMT genes. RT-PCR and Western blot demonstrated that the lambs expressed these genes in their mammary epithelial cells and these animals produced melatonin-enriched milk. This is the first report to show a functional AANAT and ASMT transgenic animal model which produce significantly high levels of melatonin milk compared to their wild-type counterparts. The advanced technologies used in the study laid a foundation for generating large transgenic livestock, for example, the cows, which can produce high level of melatonin milk. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Role of carriers in the transmission of pneumonia in bighorn sheep (Ovis canadensis

    Directory of Open Access Journals (Sweden)

    Bindu Raghavan

    2016-06-01

    Full Text Available In the absence of livestock contact, recurring lamb mortality in bighorn sheep (Ovis canadensis populations previously exposed to pneumonia indicates the likely presence of carriers of pneumonia-causing pathogens, and possibly inadequate maternally derived immunity. To investigate this problem we commingled naïve, pregnant ewes (n=3 with previously exposed rams (n=2. Post-commingling, all ewes and lambs born to them acquired pneumonia-causing pathogens (leukotoxin-producing Pasteurellaceae and Mycoplasma ovipneumoniae, with subsequent lamb mortality between 4-9 weeks of age. Infected ewes became carriers for two subsequent years and lambs born to them succumbed to pneumonia. In another experiment, we attempted to suppress the carriage of leukotoxin-producing Pasteurellaceae by administering an antibiotic to carrier ewes, and evaluated lamb survival. Lambs born to both treatment and control ewes (n=4 each acquired pneumonia and died. Antibody titers against leukotoxin-producing Pasteurellaceae in all eight ewes were ‘protective’ (>1:800 and no apparent respiratory disease; however their lambs were either born with comparatively low titers, or with high (but non-protective titers that declined rapidly within 2-8 weeks of age, rendering them susceptible to fatal disease. Thus, exposure to pneumonia-causing pathogens from carrier ewes, and inadequate titers of maternally derived protective antibodies, are likely to render bighorn lambs susceptible to fatal pneumonia.

  17. Role of carriers in the transmission of pneumonia in bighorn sheep (Ovis canadensis).

    Science.gov (United States)

    Raghavan, Bindu; Erickson, Kayla; Kugadas, Abirami; Batra, Sai A; Call, Douglas R; Davis, Margaret A; Foreyt, William J; Srikumaran, Subramaniam

    2016-06-15

    In the absence of livestock contact, recurring lamb mortality in bighorn sheep (Ovis canadensis) populations previously exposed to pneumonia indicates the likely presence of carriers of pneumonia-causing pathogens, and possibly inadequate maternally derived immunity. To investigate this problem we commingled naïve, pregnant ewes (n=3) with previously exposed rams (n=2). Post-commingling, all ewes and lambs born to them acquired pneumonia-causing pathogens (leukotoxin-producing Pasteurellaceae and Mycoplasma ovipneumoniae), with subsequent lamb mortality between 4-9 weeks of age. Infected ewes became carriers for two subsequent years and lambs born to them succumbed to pneumonia. In another experiment, we attempted to suppress the carriage of leukotoxin-producing Pasteurellaceae by administering an antibiotic to carrier ewes, and evaluated lamb survival. Lambs born to both treatment and control ewes (n=4 each) acquired pneumonia and died. Antibody titers against leukotoxin-producing Pasteurellaceae in all eight ewes were 'protective' (>1:800 and no apparent respiratory disease); however their lambs were either born with comparatively low titers, or with high (but non-protective) titers that declined rapidly within 2-8 weeks of age, rendering them susceptible to fatal disease. Thus, exposure to pneumonia-causing pathogens from carrier ewes, and inadequate titers of maternally derived protective antibodies, are likely to render bighorn lambs susceptible to fatal pneumonia. © 2016. Published by The Company of Biologists Ltd.

  18. Melhor isso do que nada! Participação e responsabilização na gestão dos riscos do Pólo Petroquímico de Camaçari (BA Better this than nothing! Participation and accountability on risk management of Camaçari Petrochemical Complex, in Bahia State

    Directory of Open Access Journals (Sweden)

    Ana Licks Almeida Silva

    2009-12-01

    Full Text Available O objetivo da pesquisa foi analisar o modelo adotado na construção dos conselhos comunitários consultivos. O recorte empírico trata do Conselho Comunitário de Camaçari (BA, primeiro no país e referência para a implantação de outros. Observação participante e dezessete entrevistas foram as principais fontes de dados. O conselho se constitui num sofisticado mecanismo de docilização e responsabilização pela disseminação de uma ideologia organizacional hegemônica e de modos de governança neoliberais.This research intends to analyze the model adopted in the construction of community advisory committees. The empirical object is the Community Advisory Committee of Camaçari Complex (BA, the first one to be set up in the country and that has been used as a reference for the implementation of others. Participant observation and seventeen interviews were the main sources of data. The advisory committee constitutes itself in a sophisticated mechanism of docilization and responsabilization for the spread of an organizational hegemonic ideology and neoliberal modes of governance.

  19. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  20. LDPC-coded MIMO optical communication over the atmospheric turbulence channel using Q-ary pulse-position modulation.

    Science.gov (United States)

    Djordjevic, Ivan B

    2007-08-06

    We describe a coded power-efficient transmission scheme based on repetition MIMO principle suitable for communication over the atmospheric turbulence channel, and determine its channel capacity. The proposed scheme employs the Q-ary pulse-position modulation. We further study how to approach the channel capacity limits using low-density parity-check (LDPC) codes. Component LDPC codes are designed using the concept of pairwise-balanced designs. Contrary to the several recent publications, bit-error rates and channel capacities are reported assuming non-ideal photodetection. The atmospheric turbulence channel is modeled using the Gamma-Gamma distribution function due to Al-Habash et al. Excellent bit-error rate performance improvement, over uncoded case, is found.

  1. Strategic Management of People in Organizations of Petrochemical Camaçari – Bahia: Reflections on its Strategies for Attracting, Retaining and Professional Development

    Directory of Open Access Journals (Sweden)

    Nildes Pitombo Leite

    2012-12-01

    Full Text Available The investigation object of this research, the primary objectives was to identify and analyze what changes made in people management by the petrochemical organizations, from the trajectory of diversification in the Industrial Complex of Camaçari and their reflections into strategies for attraction, retention and professional development, much in line with the justifications, as with the question asked. The subjects involved were directors, managers and / or coordinators HR, minimum 10 and maximum of 32 years, two respondents per organization, totaling twenty-one organizations. This investigation was answered in each category and gradually increased at the junction of them all. The results show that the changes made in managing people in the petrochemical investigated are not, necessarily, computed from the trajectory of diversification: Petrochemical Pole / Industrial Complex of Camaçari. These results suggest that mergers are among the main responsible. However, there is the record that this change in context was beneficial to these organizations promote the output of the comfort zone that were since deploying Pole. It reinforces the premise that such an investigation ends innovative and contributory aspect for: the area of people management, petrochemical industry and the country.

  2. Performance analysis of MIMO wireless optical communication system with Q-ary PPM over correlated log-normal fading channel

    Science.gov (United States)

    Wang, Huiqin; Wang, Xue; Lynette, Kibe; Cao, Minghua

    2018-06-01

    The performance of multiple-input multiple-output wireless optical communication systems that adopt Q-ary pulse position modulation over spatial correlated log-normal fading channel is analyzed in terms of its un-coded bit error rate and ergodic channel capacity. The analysis is based on the Wilkinson's method which approximates the distribution of a sum of correlated log-normal random variables to a log-normal random variable. The analytical and simulation results corroborate the increment of correlation coefficients among sub-channels lead to system performance degradation. Moreover, the receiver diversity has better performance in resistance of spatial correlation caused channel fading.

  3. "ON ALGEBRAIC DECODING OF Q-ARY REED-MULLER AND PRODUCT REED-SOLOMON CODES"

    Energy Technology Data Exchange (ETDEWEB)

    SANTHI, NANDAKISHORE [Los Alamos National Laboratory

    2007-01-22

    We consider a list decoding algorithm recently proposed by Pellikaan-Wu for q-ary Reed-Muller codes RM{sub q}({ell}, m, n) of length n {le} q{sup m} when {ell} {le} q. A simple and easily accessible correctness proof is given which shows that this algorithm achieves a relative error-correction radius of {tau} {le} (1-{radical}{ell}q{sup m-1}/n). This is an improvement over the proof using one-point Algebraic-Geometric decoding method given in. The described algorithm can be adapted to decode product Reed-Solomon codes. We then propose a new low complexity recursive aJgebraic decoding algorithm for product Reed-Solomon codes and Reed-Muller codes. This algorithm achieves a relative error correction radius of {tau} {le} {Pi}{sub i=1}{sup m} (1 - {radical}k{sub i}/q). This algorithm is then proved to outperform the Pellikaan-Wu algorithm in both complexity and error correction radius over a wide range of code rates.

  4. TSKT-ORAM: A Two-Server k-ary Tree Oblivious RAM without Homomorphic Encryption

    Directory of Open Access Journals (Sweden)

    Jinsheng Zhang

    2017-09-01

    Full Text Available This paper proposes TSKT-oblivious RAM (ORAM, an efficient multi-server ORAM construction, to protect a client’s access pattern to outsourced data. TSKT-ORAM organizes each of the server storages as a k-ary tree and adopts XOR-based private information retrieval (PIR and a novel delayed eviction technique to optimize both the data query and data eviction process. TSKT-ORAM is proven to protect the data access pattern privacy with a failure probability of 2 - 80 when system parameter k ≥ 128 . Meanwhile, given a constant-size local storage, when N (i.e., the total number of outsourced data blocks ranges from 2 16 – 2 34 , the communication cost of TSKT-ORAM is only 22–46 data blocks. Asymptotic analysis and practical comparisons are conducted to show that TSKT-ORAM incurs lower communication cost, storage cost and access delay in practical scenarios than the compared state-of-the-art ORAM schemes.

  5. GASNet-EX Performance Improvements Due to Specialization for the Cray Aries Network

    Energy Technology Data Exchange (ETDEWEB)

    Hargrove, Paul H.; Bonachea, Dan

    2018-03-27

    This document is a deliverable for milestone STPM17-6 of the Exascale Computing Project, delivered by WBS 2.3.1.14. It reports on the improvements in performance observed on Cray XC-series systems due to enhancements made to the GASNet-EX software. These enhancements, known as “specializations”, primarily consist of replacing network-independent implementations of several recently added features with implementations tailored to the Cray Aries network. Performance gains from specialization include (1) Negotiated-Payload Active Messages improve bandwidth of a ping-pong test by up to 14%, (2) Immediate Operations reduce running time of a synthetic benchmark by up to 93%, (3) non-bulk RMA Put bandwidth is increased by up to 32%, (4) Remote Atomic performance is 70% faster than the reference on a point-to-point test and allows a hot-spot test to scale robustly, and (5) non-contiguous RMA interfaces see up to 8.6x speedups for an intra-node benchmark and 26% for inter-node. These improvements are available in the GASNet-EX 2018.3.0 release.

  6. Phylogenetic study of Theileria lestoquardi based on 18SrRNA gene Isolated from sheep in the middle region of Iraq

    Directory of Open Access Journals (Sweden)

    M.J.A. Alkhaled

    2016-12-01

    Full Text Available Theileriosis is parasitic infection causes by obligate intracellular protozoa of the genus Theileria. T. lestoquardi is the most virulent species in sheep and goats which causes a severe disease with a high morbidity and mortality rate. In this study the phylogenetic relationships between two local isolate of T. lestoquardi and nine T. lestoquardi global isolates as well as Babesia ovis out-group isolate were analyzed using the 18S rRNA gene sequence. The multiple sequence alignment analysis and neighbor joining phylogenetic tree analysis were performed by using ClustalW multiple sequence alignment online based analysis of 1098bp 18S rRNA gene was amplified by polymerase chain reaction. Phylogenetic analysis results of these gene sequences revealed that T. lestoquardi local isolates were closely related to T. lestoquardi Iran isolate (JQ917458.1 and two Iraq Kurdistan isolates (KC778786.1 and KC778785.1 more than other countries. This study represents the first report on the use of molecular phylogeny to classify T. lestoquardi obtained in Middle Region of Iraq.

  7. PENDIDIKAN KARAKTER MENURUT K.H. HASYIM ASY’ARI DALAM KITAB ADÂB AL-‘ÂLIM WA AL-MUTA‘ALLIM

    OpenAIRE

    Sholikah Sholikah

    2015-01-01

    The article deals with K.H. Hasyim Asy’ari’s thought of character education. The result of the study indicates that according to K.H. Hasyim Asy’ari the characters of teachers and students in his work Adab al-‘Âlim wa al-Muta’allim can be classified into three parts, are mentality or character, which should be possessed by teachers and learners: attempts to be done in order to become characterized teachers and learners, and: teaching strategies employed by educators and learning strategies us...

  8. Protostrongylid parasites and pneumonia in captive and wild thinhorn sheep (Ovis dalli).

    Science.gov (United States)

    Jenkins, E J; Veitch, A M; Kutz, S J; Bollinger, T K; Chirino-Trejo, J M; Elkin, B T; West, K H; Hoberg, E P; Polley, L

    2007-04-01

    We describe health significance of protostrongylid parasites (Parelaphostrongylus odocoilei and Protostrongylus stilesi) and other respiratory pathogens in more than 50 naturally infected Dall's sheep (Ovis dalli dalli) from the Mackenzie Mountains, Northwest Territories (1998-2002) as well as in three Stone's sheep (O. d. stonei) experimentally infected with P. odocoilei (2000-2002). Histological lesions in the brain and distribution of P. odocoilei in the muscles of experimentally and naturally infected sheep were consistent with a previously hypothesized "central nervous system to muscle" pattern of migration for P. odocoilei. Dimensions of granulomas associated with eggs of P. odocoilei and density of protostrongylid eggs and larvae in the cranial lung correlated with intensity of larvae in feces, and all varied with season of collection. Prevalence of P. stilesi based on the presence of larvae in feces underestimated true prevalence (based on examination of lungs) in wild Dall's sheep collected in summer and fall. Similarly, counts of both types of protostrongylid larvae in feces were unreliable indicators of parasitic infection in wild Dall's sheep with concomitant bacterial pneumonia associated with Arcanobacterium pyogenes, Pasteurella sp., and Mannheimia sp. Diffuse, interstitial pneumonia due to P. odocoilei led to fatal pulmonary hemorrhage and edema after exertion in one experimentally infected Stone's sheep and one naturally infected Dall's sheep. Bacterial and verminous pneumonia associated with pathogens endemic in wild Dall's sheep in the Mackenzie Mountains caused sporadic mortalities. There was no evidence of respiratory viruses or bacterial strains associated with domestic ruminants, from which this population of wild sheep has been historically isolated.

  9. In vitro prion protein conversion suggests risk of bighorn sheep (Ovis canadensis) to transmissible spongiform encephalopathies

    Science.gov (United States)

    Johnson, Christopher J.; Morawski, A.R.; Carlson, C.M.; Chang, H.

    2013-01-01

    Background: Transmissible spongiform encephalopathies (TSEs) affect both domestic sheep (scrapie) and captive and free-ranging cervids (chronic wasting disease; CWD). The geographical range of bighorn sheep (Ovis canadensis; BHS) overlaps with states or provinces that have contained scrapie-positive sheep or goats and areas with present epizootics of CWD in cervids. No TSEs have been documented in BHS, but the susceptibility of this species to TSEs remains unknown. Results: We acquired a library of BHS tissues and found no evidence of preexisting TSEs in these animals. The prion protein gene (Prnp) in all BHS in our library was identical to scrapie-susceptible domestic sheep (A136R 154Q171). Using an in vitro prion protein conversion assay, which has been previously used to assess TSE species barriers and, in our study appears to recollect known species barriers in mice, we assessed the potential transmissibility of TSEs to BHS. As expected based upon Prnp genotype, we observed BHS prion protein conversion by classical scrapie agent and evidence for a species barrier between transmissible mink encephalopathy (TME) and BHS. Interestingly, our data suggest that the species barrier of BHS to white-tailed deer or wapiti CWD agents is likely low. We also used protein misfolding cyclic amplification to confirm that CWD, but not TME, can template prion protein misfolding in A136R 154Q171genotype sheep. Conclusions: Our results indicate the in vitro conversion assay used in our study does mimic the species barrier of mice to the TSE agents that we tested. Based on Prnp genotype and results from conversion assays, BHS are likely to be susceptible to infection by classical scrapie. Despite mismatches in amino acids thought to modulate prion protein conversion, our data indicate that A136R154Q171 genotype sheep prion protein is misfolded by CWD agent, suggesting that these animals could be susceptible to CWD. Further investigation of TSE transmissibility to BHS, including

  10. How Respiratory Pathogens Contribute to Lamb Mortality in a Poorly Performing Bighorn Sheep ( Ovis canadensis ) Herd.

    Science.gov (United States)

    Wood, Mary E; Fox, Karen A; Jennings-Gaines, Jessica; Killion, Halcyon J; Amundson, Sierra; Miller, Michael W; Edwards, William H

    2017-01-01

    We evaluated bighorn sheep ( Ovis canadensis ) ewes and their lambs in captivity to examine the sources and roles of respiratory pathogens causing lamb mortality in a poorly performing herd. After seven consecutive years of observed December recruitments of sheep from the remnant Gribbles Park herd in Colorado, US were captured and transported to the Thorne-Williams Wildlife Research Center in Wyoming in March 2013. Ewes were sampled repeatedly over 16 mo. In April 2014, ewes were separated into individual pens prior to lambing. Upon death, lambs were necropsied and tested for respiratory pathogens. Six lambs developed clinical respiratory disease and one lamb was abandoned. Pathology from an additional six lambs born in 2013 was also evaluated. Mycoplasma ovipneumoniae , leukotoxigenic Mannheimia spp., leukotoxigenic Bibersteinia trehalosi , and Pasteurella multocida all contributed to lamb pneumonia. Histopathology suggested a continuum of disease, with lesions typical of pasteurellosis predominating in younger lambs and lesions typical of mycoplasmosis predominating in older lambs. Mixed pathology was observed in lambs dying between these timeframes. We suspected that all the ewes in our study were persistently infected and chronically shedding the bacteria that contributed to summer lamb mortality.

  11. Fluorescent in-situ hybridization of cattle and sheep chromosomes with cloned human fragile-X DNA

    DEFF Research Database (Denmark)

    Ali, Ahmd; Thomsen, Preben Dybdahl; Babar, M.E.

    2009-01-01

    An extensive study on spontaneous and 5-Fluorodeoxyuridine induced fragile sites identified Xq31 in cattle (Bos taurus) and (Xq24, Xq26) in sheep (Ovis aries) in addition to several autosomal fragile sites (under publication). A ZOO-FISH study using three cloned human fragile-X probes with CCG....../CGG(n) trinucleotide repeat sequence was carried out to determine homology between human and bovine fragile-X. The hybridisation results showed only a weak signal on a human chromosome that was not an X with all three fragile site probes. No signals were detected in sheep chromosomes. The signal of all three human...... fragile-X probes on cattle chromosomes was however, medium-prominent sub-centromeric signal on two homologues. BrdU administration in 12 h before harvesting identified these homologues to be chromosome number 5. In addition retrospective slides of cattle and sheep chromosomes used for fragile site studies...

  12. Effect of ionizing radiation on the virulence and the immunogenic properties of Babesia ovis

    International Nuclear Information System (INIS)

    Khalacheva, M.; Kararizova, L.

    1977-01-01

    The effect was followed up of ionizing radiation of 20, 25, 30, 32, 35, 40 and 50 krad on the virulence and the immunigenic properties of B.ovis. The experiments were carried out with 22 sheep (20 test and 2 donor) according to the rate of treatment into 7 test groups with a total of 17 animals, and 1 control with 3 sheep. One month after infection with irradiated blood reinfection was carried out of 8 animals (of different groups) that had recovered, using virulent untrated blood. The titer of the antibodies in the remaining sheep was followed up by means of the complement fixation test. It was found that irradiation at 20 - 25 krad lowered the virulence of the Babesia organisms, but these could provoke the disease in an acute form and cause death. The animals that survived after being infected with the indicated doses developed a comparatively good immunity. It is considered that the most appropriate dose of irradiation is 30 krad. 32 and 35 krad do not kill Babesiae; the parasites thus irradiated, however, cannot protect the animals ar reinfection. It has been found that Babesiae irradiated at the rates of 40 and 450 krad do not cause an infection process, and at reinfection the animals respond almost in the same way as the controls. (author)

  13. A study on ovine tick-borne hemoprotozoan parasites (Theileria and Babesia) in the East Black Sea Region of Turkey.

    Science.gov (United States)

    Altay, Kursat; Dumanli, Nazir; Aktas, Munir

    2012-07-01

    In this study, the frequency of Theileria and Babesia species was assessed via reverse line blotting and blood smear-based diagnostic methods in small ruminants. A total of 201 apparently healthy animals from 26 randomly selected herds located in 4 locations (Artvin, Giresun, Gumushane, and Tokat) of East Black Sea Region of Turkey were investigated for the blood protozoans. In a polymerase chain reaction (PCR), the hypervariable V4 region of the 18S ribosomal RNA gene was amplified with a set of general primers specific for all Theileria and Babesia species. The PCR products were hybridized against catchall and species-specific (Theileria spp., Theileria lestoquardi, Theileria ovis, Theileria sp. OT1, Theileria sp., OT3, Theileria sp., MK, Theileria luwenshuni, Theileria uilenbergi, Babesia spp., Babesia ovis, Babesia motasi, and Babesia crassa) probes. Theileria piroplasms were identified in nine (4.47%) samples by microscopic examination. Reverse line blotting (RLB) detected the infection in 19.90% of the samples. The infection rate of sheep (28.90%) was higher than goats (4.10%). T. ovis, Theileria sp., MK, and Theileria sp. OT3 were detected by RLB. The most prevalent Theileria species was T. ovis (18.90%) followed by Theileria sp. MK (0.99%). Theileria sp. OT3 was detected in one sample (0.43%). A single animal was infected as mix with T. ovis and Theileria sp. MK. The other Theileria (T. lestoquardi, Theileria sp. OT1, T. luwenshuni, and T. uilenbergi) and Babesia (B. ovis, B. motasi, and B. crassa) species were not detected. This study is the first molecular survey on ovine tick-borne protozoans in East Black Sea Region of Turkey.

  14. Characterization of Two Multidrug-Resistant IncA/C Plasmids from the 1960s by Using the MinION Sequencer Device.

    Science.gov (United States)

    Szabó, Mónika; Nagy, Tibor; Wilk, Tímea; Farkas, Tibor; Hegyi, Anna; Olasz, Ferenc; Kiss, János

    2016-11-01

    Two A/C incompatibility group (IncA/C family) plasmids from the 1960s have been sequenced and classified into the A/C 2 type 1 group. R16a and IP40a contain novel antibiotic resistance islands and a complete GIsul2 genomic island not previously found in the family. In the 173.1-kb R16a, the 29.9-kb antibiotic resistance island (ARI) is located in a unique backbone position not utilized by ARIs. ARI R16a consists of Tn1, Tn6020, and Tn6333, harboring the resistance genes bla TEM-1D and aphA1b and a mer module, respectively; a truncated Tn5393 copy; and a gene cluster with unknown function. Plasmid IP40a is 170.4 kb in size and contains a 5.6-kb ARI inserted into the kfrA gene. ARI IP40a carrying bla TEM-1D and aphA1b genes is composed of Tn1 with a Tn6023 insertion. Additionally, IP40a harbors single IS2, IS186, and Tn1000 insertions scattered in the backbone; an IS150 copy in GIsul2; and a complete Tn6333 carrying a mer module at the position of ARI R16a Loss of resistance markers in R16a, IP40a, and R55 was observed during stability tests. Every phenotypic change proved to be the result of recombination events involving mobile elements. Intramolecular transposition of IS copies that generated IP40a derivatives lacking large parts of the backbone could account for the formation of other family members, too. The MinION platform proved to be a valuable tool in bacterial genome sequencing since it generates long reads that span repetitive elements and facilitates full-length plasmid or chromosome assembly. Nanopore technology enables rapid characterization of large, low-copy-number plasmids and their rearrangement products. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. Safety in the ARIES-III D-3He tokamak reactor design

    International Nuclear Information System (INIS)

    Herring, J.S.; Dolan, T.J.

    1992-01-01

    This paper reports on the ARIES-III reactor study, an extensive examination of the viability of a D- 3 He-fueled commercial tokamak powder reactor. Because neutrons are produced only through side reactions (D+D- 3 HE+N; and D+D-T+p followed by D+T- 4 He+n), the reactor has the significant advantages of reduced activation of the first wall and shield, low afterheat and Class A or C low level waste disposal. Since no tritium is required for operation, no lithium-containing breeding blanket is necessary. A ferritic steel shield behind the first wall protects the magnets from gamma and neutron heating and from radiation damage. The authors explored the potential for isotopically tailoring the 4 mm tungsten layer on the divertor in order to reduce the offsite doses should a tungsten aerosol be released from the reactor after an accident. The authors also modeled a loss-of-cooling accident (LOCA) in which the organic coolant was burning in order to estimate the amount of radionuclides released from the first wall. Because the maximum temperature is low, degree C, release fractions are small. The authors analyzed the disposition of the 20 g/day of tritium that is produced by D-D reactions and removed by the vacuum pumps

  16. Description of Diploplastron dehorityi sp. nov. (Entodiniomorphida, Ophryoscolecidae), a new rumen ciliate from Brazilian sheep (Ovis aries).

    Science.gov (United States)

    Cedrola, Franciane; Dias, Roberto Júnio Pedroso; Martinele, Isabel; D'Agosto, Marta

    2017-05-03

    To date the genus Diploplastron comprised only one species of ophryoscolecid ciliate, Diploplastron affine, which is characterized by having two retractable ciliary zones in the anterior end of the body, two slender and juxtaposed skeletal plates on the right side, a rod shape macronucleus, and two contractile vacuoles. During study on the characterization of rumen ciliate community composition in Brazilian domestic sheep, we observed ciliates with atypical morphology but with diagnostic features of genus Diploplastron. This study describes Diploplastron dehorityi, a new species of ophryoscolecid ciliate, that differs from D. affine, primarily, in the morphology of skeletal plates, morphology of nuclear apparatus and body shape. In addition to the similarities between the new species and congener species, D. dehorityi has some morphological similarities to species of genus Eremoplastron.

  17. Aspectos anatômicos da macro e microvascularização da placenta em ovinos (Ovis aries

    Directory of Open Access Journals (Sweden)

    Luciana Silveira Flores Schoenau

    2005-12-01

    Full Text Available Placenta possesses various essential independent vascular systems and intimately associated vascular systems, the effectiveness of which are related to the type of blood stream between the maternal and fetal circulation and, therefore, the morphology of the vascularization. The aim of this research was to study the anatomical aspects of gross and microscopic vascularization of the sheep placenta (Corriedale cross breeds and Ideal breeds, living at sea level and the systematization of the fetal vessels from umbilical funiculus until the capillary bed. The cotyledons were demonstrated to be mostly spheroids and to possess between one to four vascular in the majority and receive from one to four vascular branches in their central concavity. Anastomoses of the umbilical funiculus vessels occur only between arteries and anastomoses between the chorionic vessel branches are more frequent in veins than in the arteries.Were found 187 types of different cotyledonary-artery arrays were found. The chorionic artery leading to pregnant horn is shorter in lenght and emits fewer cotyledonary branches than the non pregnant horn. The chorionic vein is formed by the confluence of two branches and receives collateral tributary vessels that frequently are anastomosed between themselves. The microvascularization of the fetal cotyledon was studied by scanning electron microscopy and is demonstrated to possess of cylindrical villous trees with vessels and with parallel vessels and with capilarization in the villous extremities. Capillary fan-like handles and conical villous trees are also observed. The macrocospic features of the cotyledons and microscopy of the villous trees reflect the altitude in which the animals live (the 95 m above sea level.

  18. In vitro ovicidal and larvicidal activity of condensed tannins on gastrointestinal nematode infestations in sheep (Ovis aries

    Directory of Open Access Journals (Sweden)

    Eidi Yoshihara

    2014-12-01

    Full Text Available Infestations of gastrointestinal parasitic nematodes in sheep result in significant costs to farmers. These infestations are controlled using synthetic anthelmintic treatments, which can result in the development of anthelmintic resistance in nematodes. The use of plants rich in condensed tannins (CTs is a promising alternative for controlling infestations of harmful parasites in sheep, and could allow reduction of the chemical products used. This study investigated the in vitro effect of CTs from Acacia mearnsii extract (AE on egg hatching and motility of third-stage larvae. Egg-hatching rate was measured after incubation with extracts for 48 h at 27 °C. The egg hatch test was performed with dilutions of 0.09, 0.19, 0.39, 0.78, 1.56, 3.12, 6.25, 12.5, 25, 50, and 100 mg mL-1. Distilled water was used as the negative control. The corresponding egg hatching inhibition percentages were 22.3, 32.3, 39.2, 49.1, 56.7, 59.0, 62.3, 77.3, 92.7, 98.3, and 100%. The concentration required to inhibit egg hatching in 50% of eggs (LC50 was 2.85 mg mL-1. The inhibition achieved with the negative control was 7.06%. A larval migration inhibition test was carried out after incubation with the extracts for 48 h at 27 oC, with AE and distilled water used in dilutions of 3.12, 6.25, 12.5, 25, 50, and 100 mg mL-1. The corresponding percentages of migration inhibition were 16.5, 37.0, 56.3, 79.4, 91.8, and 97.1%. The concentration required to inhibit migration of 50% of larvae (LC50 was 12.45 mg mL-1. The inhibition achieved with the negative control was 8.53%. The in vitro ovicidal and larvicidal activity of CTs from AE indicate the anthelmintic effect of AE, suggesting the potential of CT extracts to be used as alternatives for controlling gastrointestinal nematode infestations in small ruminants.

  19. Molecular characterization of HOXC8 gene and methylation status analysis of its exon 1 associated with the length of cashmere fiber in Liaoning cashmere goat.

    Science.gov (United States)

    Bai, Wen L; Wang, Jiao J; Yin, Rong H; Dang, Yun L; Wang, Ze Y; Zhu, Yu B; Cong, Yu Y; Deng, Liang; Guo, Dan; Wang, Shi Q; Yang, Shu H; Xue, Hui L

    2017-02-01

    Homeobox protein Hox-C8 (HOXC8) is a member of Hox family. It is expressed in the dermal papilla of the skin and is thought to be associated with the hair inductive capacity of dermal papilla cells. In the present study, we isolated and characterized a full-length open reading frame of HOXC8 cDNA from the skin tissue of Liaoning cashmere goat, as well as, established a phylogenetic relationship of goat HOXC8 with that of other species. Also, we investigated the effect of methylation status of HOXC8 exon 1 at anagen secondary hair follicle on the cashmere fiber traits in Liaoning cashmere goat. The sequence analysis indicated that the obtained cDNA was 1134-bp in length containing a complete ORF of 729-bp. It encoded a peptide of 242 amino acid residues in length. The structural analysis indicated that goat HOXC8 contained a typical homeobox domain. The phylogenetic analysis revealed that Capra hircus HOXC8 had a closer genetic relationship with that of Ovis aries, followed by Bos Taurus and Bubalus bubalis. The methylation analysis suggested that the methylation degree of HOXC8 exon 1 in anagen secondary hair follicle might be involved in regulating the growth of cashmere fiber in Liaoning cashmere goat. Our results provide new evidence for understanding the molecular structural and evolutionary characteristics of HOXC8 in Liaoning cashmere goat, as well as, for further insight into the role of methylation degree of HOXC8 exon 1 regulates the growth of cashmere fiber in goat.

  20. Helminthes and Coccidia Infection of Wild Sheep (Ovis Ammon Orintalis in Kabodan Island of National Park of Urmia Lake, Iran

    Directory of Open Access Journals (Sweden)

    Habib Khoshvaghti

    2010-06-01

    Full Text Available Forty-one wild sheep (Ovis ammon orintalis from Kabodan Island of National Park of UrmiaLake (North-West of Iran, were examined during a period of six months from October 2002 toMarch 2003, for helminthes and coccidian infection. The numbers of oocyst and eggs per gram offaeces (OPG & EPG were determined by the centrifuge flotation technique using saturated sugarsolution. The rate of infection for Strongylid form, Marshalagia, Trichuris eggs, and lung wormlarvae were 8 (19.5%, 12 (29.5%, 17 (41.5% and 14 (34.1%, respectively. Thirty-three(80.48% of the examined wild animals were infected to one or more Eimeria species including E.parva, E. ahsata, E. ovinoidalis and E. faurei. This study suggested that the rate of parasiticinfection in wild sheep were very low but it would seem that in unsuitable condition such asdrought and starvation, parasitic infection can be cause a serious problem in wild sheep population.

  1. Benefit Analysis of Implementation of Alternative SO2 Quality Standards on Acute Respiratory Syndrome (ARI Incidence Reduction in Indonesia

    Directory of Open Access Journals (Sweden)

    Muhamad Nizar

    2014-12-01

    Full Text Available Indonesia Quality Standard (QS for ambient SO2 for 1 hour time average i.e. 900 μg/m3(equivalent to 360μg/m3in24 hour time average regulated in the Government Regulation No. 41 of 1999 is the most loose compared to the ambient SO2 standards of other countries in the world including WHO QS guideline. This QS is not expected to guarantee the protection of public health in Indonesia. Therefore more stringent QS alternative for ambient SO2 is required. This research examines benefit values in public health aspect if Indonesia tightens its ambient SO2 QS. Two alternative QS for SO2 are used i.e196 μg/m3(equivalent to 78μg/m3in24 hour time average referring to U.S. EPA and 750μg/m3(equivalent to 360μg/m3in24 hour time average referring to PUSARPEDAL. First step is to map distribution of SO2 ambient concentrations in Indonesia. The result indicates that Provinces of Jakarta and Banten have exceeded both alternative QS while Provinces of Yogyakarta, West Java, Central Java, East Java, Bali, and North Sumatra only exceed the alternative QS of 196μg/m3. From the public health aspect, by attaining to the alternative QS of 750μg/m3, Jakarta and Banten will reduce incidence of ARI by 95% and 98%. By attaining to the alternative QS of 196μg/m3, East Java, Bali and North Sumatra will reduce the incidence of ARI by 59%, 51%, and 5%.

  2. A divergent Artiodactyl MYADM-like repeat is associated with erythrocyte traits and weight of lamb weaned in domestic sheep.

    Science.gov (United States)

    Gonzalez, Michael V; Mousel, Michelle R; Herndon, David R; Jiang, Yu; Dalrymple, Brian P; Reynolds, James O; Johnson, Wendell C; Herrmann-Hoesing, Lynn M; White, Stephen N

    2013-01-01

    A genome-wide association study (GWAS) was performed to investigate seven red blood cell (RBC) phenotypes in over 500 domestic sheep (Ovis aries) from three breeds (Columbia, Polypay, and Rambouillet). A single nucleotide polymorphism (SNP) showed genome-wide significant association with increased mean corpuscular hemoglobin concentration (MCHC, P = 6.2×10(-14)) and genome-wide suggestive association with decreased mean corpuscular volume (MCV, P = 2.5×10(-6)). The ovine HapMap project found the same genomic region and the same peak SNP has been under extreme historical selective pressure, demonstrating the importance of this region for survival, reproduction, and/or artificially selected traits. We observed a large (>50 kb) variant haplotype sequence containing a full-length divergent artiodactyl MYADM-like repeat in strong linkage disequilibrium with the associated SNP. MYADM gene family members play roles in membrane organization and formation in myeloid cells. However, to our knowledge, no member of the MYADM gene family has been identified in development of morphologically variant RBCs. The specific RBC differences may be indicative of alterations in morphology. Additionally, erythrocytes with altered morphological structure often exhibit increased structural fragility, leading to increased RBC turnover and energy expenditure. The divergent artiodactyl MYADM-like repeat was also associated with increased ewe lifetime kilograms of lamb weaned (P = 2×10(-4)). This suggests selection for normal RBCs might increase lamb weights, although further validation is required before implementation in marker-assisted selection. These results provide clues to explain the strong selection on the artiodactyl MYADM-like repeat locus in sheep, and suggest MYADM family members may be important for RBC morphology in other mammals.

  3. A divergent Artiodactyl MYADM-like repeat is associated with erythrocyte traits and weight of lamb weaned in domestic sheep.

    Directory of Open Access Journals (Sweden)

    Michael V Gonzalez

    Full Text Available A genome-wide association study (GWAS was performed to investigate seven red blood cell (RBC phenotypes in over 500 domestic sheep (Ovis aries from three breeds (Columbia, Polypay, and Rambouillet. A single nucleotide polymorphism (SNP showed genome-wide significant association with increased mean corpuscular hemoglobin concentration (MCHC, P = 6.2×10(-14 and genome-wide suggestive association with decreased mean corpuscular volume (MCV, P = 2.5×10(-6. The ovine HapMap project found the same genomic region and the same peak SNP has been under extreme historical selective pressure, demonstrating the importance of this region for survival, reproduction, and/or artificially selected traits. We observed a large (>50 kb variant haplotype sequence containing a full-length divergent artiodactyl MYADM-like repeat in strong linkage disequilibrium with the associated SNP. MYADM gene family members play roles in membrane organization and formation in myeloid cells. However, to our knowledge, no member of the MYADM gene family has been identified in development of morphologically variant RBCs. The specific RBC differences may be indicative of alterations in morphology. Additionally, erythrocytes with altered morphological structure often exhibit increased structural fragility, leading to increased RBC turnover and energy expenditure. The divergent artiodactyl MYADM-like repeat was also associated with increased ewe lifetime kilograms of lamb weaned (P = 2×10(-4. This suggests selection for normal RBCs might increase lamb weights, although further validation is required before implementation in marker-assisted selection. These results provide clues to explain the strong selection on the artiodactyl MYADM-like repeat locus in sheep, and suggest MYADM family members may be important for RBC morphology in other mammals.

  4. Bighorn sheep (Ovis canadensis) sinus tumors are associated with coinfections by potentially pathogenic bacteria in the upper respiratory tract.

    Science.gov (United States)

    Fox, Karen A; Rouse, Natalie M; Huyvaert, Kathryn P; Griffin, Karen A; Killion, Halcyon J; Jennings-Gaines, Jessica; Edwards, William H; Quackenbush, Sandra L; Miller, Michael W

    2015-01-01

    Bighorn sheep (Ovis canadensis) sinus tumors are hyperplastic to neoplastic, predominantly stromal masses of the paranasal sinuses that expand the sinus lining and obstruct the sinus cavities. Obstruction of the sinus cavities and disruption of normal sinus lining anatomy may interfere with clearance of bacterial pathogens from the upper respiratory tract. To examine this possibility, we explored whether the presence of sinus tumor features (tumor score) affected the likelihood of detecting potentially pathogenic bacteria from upper respiratory sinus lining tissues in bighorn sheep. We developed or used existing PCR assays for the detection of leukotoxigenic Pasteurellaceae and Mycoplasma ovipneumoniae in sinus lining tissues collected from 97 bighorn sheep in Colorado, US from 2009 to 2012. With the use of logistic regression analyses we found that tumor score was a good predictor of the probability of detecting potentially pathogenic bacteria in sinus lining tissues; we were more likely to detect potentially pathogenic bacteria from samples with high tumor scores. These findings add to our understanding of possible mechanisms for the maintenance and shedding of bacterial agents from the upper respiratory tracts of bighorn sheep.

  5. Comparison of Passively Transferred Antibodies in Bighorn and Domestic Lambs Reveals One Factor in Differential Susceptibility of These Species to Mannheimia haemolytica-Induced Pneumonia ▿

    Science.gov (United States)

    Herndon, Caroline N.; Shanthalingam, Sudarvili; Knowles, Donald P.; Call, Douglas R.; Srikumaran, Subramaniam

    2011-01-01

    Mannheimia haemolytica consistently causes fatal bronchopneumonia in bighorn sheep (BHS; Ovis canadensis) under natural and experimental conditions. Leukotoxin is the primary virulence factor of this organism. BHS are more susceptible to developing fatal pneumonia than the related species Ovis aries (domestic sheep [DS]). In BHS herds affected by pneumonia, lamb recruitment is severely impaired for years subsequent to an outbreak. We hypothesized that a lack of maternally derived antibodies (Abs) against M. haemolytica provides an immunologic basis for enhanced susceptibility of BH lambs to population-limiting pneumonia. Therefore, the objective of this study was to determine the titers of Abs directed against M. haemolytica in the sera of BH and domestic lambs at birth through 12 weeks of age. Results revealed that BH lambs had approximately 18-fold lower titers of Ab against surface antigens of M. haemolytica and approximately 20-fold lower titers of leukotoxin-neutralizing Abs than domestic lambs. The titers of leukotoxin-neutralizing Abs in the serum and colostrum samples of BH ewes were approximately 157- and 50-fold lower than those for domestic ewes, respectively. Comparatively, the higher titers of parainfluenza 3 virus-neutralizing Abs in the BH lambs ruled out the possibility that these BHS had an impaired ability to passively transfer Abs to their lambs. These results suggest that lower levels of leukotoxin-neutralizing Abs in the sera of BH ewes, and resultant low Ab titers in their lambs, may be a critical factor in the poor lamb recruitment in herds affected by pneumonia. PMID:21613459

  6. Comparison of passively transferred antibodies in bighorn and domestic lambs reveals one factor in differential susceptibility of these species to Mannheimia haemolytica-induced pneumonia.

    Science.gov (United States)

    Herndon, Caroline N; Shanthalingam, Sudarvili; Knowles, Donald P; Call, Douglas R; Srikumaran, Subramaniam

    2011-07-01

    Mannheimia haemolytica consistently causes fatal bronchopneumonia in bighorn sheep (BHS; Ovis canadensis) under natural and experimental conditions. Leukotoxin is the primary virulence factor of this organism. BHS are more susceptible to developing fatal pneumonia than the related species Ovis aries (domestic sheep [DS]). In BHS herds affected by pneumonia, lamb recruitment is severely impaired for years subsequent to an outbreak. We hypothesized that a lack of maternally derived antibodies (Abs) against M. haemolytica provides an immunologic basis for enhanced susceptibility of BH lambs to population-limiting pneumonia. Therefore, the objective of this study was to determine the titers of Abs directed against M. haemolytica in the sera of BH and domestic lambs at birth through 12 weeks of age. Results revealed that BH lambs had approximately 18-fold lower titers of Ab against surface antigens of M. haemolytica and approximately 20-fold lower titers of leukotoxin-neutralizing Abs than domestic lambs. The titers of leukotoxin-neutralizing Abs in the serum and colostrum samples of BH ewes were approximately 157- and 50-fold lower than those for domestic ewes, respectively. Comparatively, the higher titers of parainfluenza 3 virus-neutralizing Abs in the BH lambs ruled out the possibility that these BHS had an impaired ability to passively transfer Abs to their lambs. These results suggest that lower levels of leukotoxin-neutralizing Abs in the sera of BH ewes, and resultant low Ab titers in their lambs, may be a critical factor in the poor lamb recruitment in herds affected by pneumonia.

  7. Anaplasma phagocytophilum and Babesia spp. in roe deer (Capreolus capreolus), fallow deer (Dama dama) and mouflon (Ovis musimon) in Germany.

    Science.gov (United States)

    Kauffmann, Melanie; Rehbein, Steffen; Hamel, Dietmar; Lutz, Walburga; Heddergott, Mike; Pfister, Kurt; Silaghi, Cornelia

    2017-02-01

    Infections with the tick-borne pathogens Anaplasma phagocytophilum and Babesia spp. can cause febrile disease in several mammalian species, including humans. Wild ruminants in Europe are suggested to serve as reservoir hosts for particular strains or species of these pathogens. The aims of this study were to investigate the occurrence of A. phagocytophilum and Babesia spp. in roe deer (Capreolus capreolus), fallow deer (Dama dama) and mouflon (Ovis musimon orientalis) in Germany, and the diversity and host association of genetic variants of A. phagocytophilum and Babesia species. From 2009 to 2010, 364 spleen samples from 153 roe deer, 43 fallow deer and 168 mouflon from 13 locations in Germany were tested for DNA of A. phagocytophilum and Babesia spp. by real-time PCR or conventional PCR, respectively. Variants of A. phagocytophilum were investigated with a nested PCR targeting the partial 16S rRNA gene, and species of piroplasms were identified by sequencing. DNA of A. phagocytophilum was detected in 303 (83.2%) samples: roe deer, 96.1% (147/153); fallow deer, 72.1% (31/43); and mouflon, 74.4% (125/168). Sequence analysis of 16S rRNA-PCR products revealed the presence of nine different genetic variants. DNA of Babesia spp. was found in 113 (31.0%) samples: roe deer, 62.8% (96/153); fallow deer, 16.3% (6/43); and mouflon, 6.5% (11/168). Babesia capreoli, Babesia sp. EU1 (referred to also as B. venatorum), B. odocoilei-like and a Theileria species were identified. Co-infections with A. phagocytophilum and Babesia spp. were detected in 30.0% of the animals which were tested positive for A. phagocytophilum and/or Babesia spp. Roe deer had a significantly higher percentage of co-infections (60.8%), followed by fallow deer (14.0%) and mouflon (6.5%). Thus, the results suggest that roe deer plays a key role in the endemic cycles of the pathogens investigated. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. CHORDAE TENDINEAE FREQUENCY IN THE MITRAL VALVE OF SANTA INÊS SHEEP (Ovis Aries, Linnaeus 1758 FREQUÊNCIA DE CORDAS TENDÍNEAS DA VALVA MITRAL DO CORAÇÃO DE OVINOS (Ovis aries, LINNAEUS 1758 DA RAÇA SANTA INÊS

    Directory of Open Access Journals (Sweden)

    Fábio Ferreira de Queiroz

    2009-12-01

    Full Text Available

    The aim of this work is to investigate the frequency of tendinous cords in the left atrioventricular valve complex (LAVC of the heart of sheeps of the Santa Inês breed. The experiments involved 40 hearts prepared in 10% formalin solution and dissected for the retreat of LVC. The LAVC was analyzed for tendinous cords counting and the total of these cords in each heart varied from 10 to 27 and the total oriented to the commissure of valve varied from two to five cords, all coming from papilar sub-auricular and papilar sub-atrial muscles. Higher frequency was observed in hearts with three cords that were oriented to commissure. The results suggest no anatomic standardization in the amount of tendinous cords in the heart of the sheep of the Santa Inês.

    Keywords:  Frequency, heart, morphology, sheep, tendinous cords.
    Este trabalho teve como objetivo investigar a frequência de cordas tendíneas no complexo valvar atrioventricular esquerdo (CVAE do coração de ovinos da raça Santa Inês. Os ensaios foram realizados em quarenta órgãos preparados com a utilização de solução de formol a 10% e dissecados para a retirada do CVAE, classificando-se e quantificando-se as cordas tendíneas, cujo número variou de 10 a 27, bem como as que se orientavam à comissura entre as válvulas, variando em número de duas a cinco cordas, saindo dos músculos papilares subauricular e subatrial. Corações com três cordas que se orientavam à comissura apresentaram maior frequência. Os resultados sugerem a inexistência de uma padronização anatômica na quantidade de cordas tendíneas no coração do ovino da raça Santa Inês.

    Palavra-chaveS: Cordas tendíneas, coração, frequência, morfologia, ovino.

  9. Expansion of the known distribution of Asiatic mouflon (Ovis orientalis) in the Late Pleistocene of the Southern Levant

    Science.gov (United States)

    Yeomans, Lisa; Martin, Louise; Richter, Tobias

    2017-08-01

    Wild sheep (Ovis orientalis) bones recovered from the Natufian site of Shubayqa 1 demonstrate a wider distribution of mouflon in the Late Pleistocene of the Southern Levant than previously known. Early Epipalaeolithic sites are common in the limestone steppe region of eastern Jordan but have yielded only a handful of caprine bones that cannot be identified to species level and few faunal remains from excavated Late Epipalaeolithic sites have been reported. Analysis of animal bone from Shubayqa 1 suggests a significant population of wild sheep could be found concentrated in the basalt desert environment of eastern Jordan during the Late Pleistocene, especially where higher rainfall over the Jebel Druze provided more water. A population of wild sheep was still present in the Pre-Pottery Neolithic A when the nearby site of Shubayqa 6 was occupied. Hunting of diverse, locally available resources including wild sheep at the end of the Pleistocene illustrates the flexible and adaptive exploitation strategies that hunter-forager groups engaged in. This provides further evidence to the increasing body of data showing the creative and opportunistic approach of terminal Pleistocene groups allowing continued occupation even in more marginal environments in a period of environmental change.

  10. The Krásná Hora, Milešov, and Příčovy Sb-Au ore deposits, Bohemian Massif: mineralogy, fluid inclusions, and stable isotope constraints on the deposit formation

    Science.gov (United States)

    Němec, Matěj; Zachariáš, Jiří

    2018-02-01

    The Krásná Hora-Milešov and Příčovy districts (Czech Republic) are the unique examples of Sb-Au subtype orogenic gold deposits in the Bohemian Massif. They are represented by quartz-stibnite veins and massive stibnite lenses grading into low-grade, disseminated ores in altered host rocks. Gold postdates the stibnite and is often replaced by aurostibite. The ore zones are hosted by hydrothermally altered dikes of lamprophyres (Krásná Hora-Milešov) or are associated with local strike-slip faults (Příčovy). Formation of Sb-Au deposits probably occurred shortly after the main gold-bearing event (348-338 Ma; Au-only deposits) in the central part of the Bohemian Massif. Fluid inclusion analyses suggest that stibnite precipitated at 250 to 130 °C and gold at 200 to 130 °C from low-salinity aqueous fluids. The main quartz gangue hosting the ore precipitated from the same type of fluid at about 300 °C. Early quartz-arsenopyrite veins are not associated with the Sb-Au deposition and formed from low-salinity, aqueous-carbonic fluid at higher pressure and temperature ( 250 MPa, 400 °C). The estimated oxygen isotope composition of the ore-bearing fluid (4 ± 1‰ SMOW; based on post-ore calcite) suggests its metamorphic or mixed magmatic-metamorphic origin and excludes the involvement of meteoric water. Rapid cooling of warm hydrothermal fluids reacting with "cold" host rock was probably the most important factor in the formation of both stibnite and gold.

  11. Design and performance of axes controller for the 50/80 cm ARIES Schmidt telescope

    Science.gov (United States)

    Kumar, T. S.; Banwar, R. N.

    We describe here the details of R.A. and Dec axes controller for the 50/80 cm Schmidt telescope at Aryabhatta Research Institute of observational sciencES (ARIES). Each axis is driven by a set of two motors for backlash-free motion and is coupled to on-shaft encoder for absolute position measurements. Additional incremental encoders are provided though a backlash-free reduction for velocity feedback. A pulse width modulation (PWM) based proportional and integral (PI) controller is designed to drive the twin-motor drive of each axis. The overall telescope control architecture features a distributed network of simple low cost PIC microcontrollers interfaced via CAN bus and RS232 ports. Using this controller it has been observed that the rms velocity errors at slew, set, guide, fine and tracking speeds are negligible. Excessive preload on the gearbox bearings results in a highly nonlinear behavior at fine speeds owing to dynamics of friction. We found that the peak errors in the tracking performance and fine speeds can be improved by properly adjusting the preloads on the gearbox bearings.

  12. Use and management of traditional medicinal plants by Maale and Ari ethnic communities in southern Ethiopia

    Science.gov (United States)

    2014-01-01

    Background Around 80% of the people of Ethiopia are estimated to be relying on medicinal plants for the treatment of different types of human health problems. The purpose of this study was to describe and analyse the use and management of medicinal plants used for the treatment of human health problems by the Maale and Ari communities in southern Ethiopia. Methods Quantitative and qualitative ethnobotanical field inquiries and analytical methods including individual and focus group discussions (18), observations, individual interviews (n = 74), preference ranking and paired comparison were used. Data were collected in three study sites and from two markets; the latter surveyed every 15 days from February 2011 to February 2012. Results A total of 128 medicinal plant species, belonging to 111 genera and 49 families, used as herbal medicine by Maale and Ari communities were documented. Predominantly harvested plant parts were leaves, which are known to have relatively low impact on medicinal plant resources. Species with high familiarity indices included Solanum dasyphyllum, Indigofera spicata, Ruta chalepensis, Plumbago zeylanica and Meyna tetraphylla. Low Jaccards similarity indices (≤ 0.33) indicated little correspondence in medicinal plant use among sites and between ethnic communities. The dominant ways of medicinal plant knowledge acquisition and transfer is vertical: from parents to children through oral means. Gender and site significantly influenced the number of human medicinal plants known currently in the study sites. Age was only a factor of significance in Maale. Marketing of medicinal plants harvested from wild and semi-wild stands is not common. Expansion of agricultural land and lack of cultivation efforts by local communities are mentioned by locals to affect the availability of medicinal plant resources. Conclusion S. dasyphyllum, I. spicata, P. zeylanica, M. tetraphylla, and Oxalis radicosa need to be considered for phytochemical and

  13. A point scale in the study of excavated osseus remains of the domestic sheep (Ovis ammon f. aries).

    Science.gov (United States)

    Przespolewska, Helena; Kobryń, Henryk

    2003-01-01

    On the basis of the standard measurements of 1277 long appendicular bones of the domestic sheep, a universal point scale has been elaborated. The bones examined were obtained from European, Asian and African archaeological sites dating from 4500 BC to 1500 AD. A comparative analysis of the metapodial bones of the domestic sheep from Central Europe (Poland, Germany and Hungary) has been undertaken, using this scale.

  14. ANALYSIS OF MORPHOMETRIC PARAMETERS OF THE ROE DEER MANDIBLE (Capreolus capreolus AND MANDIBLE OF THE SHEEP (Ovis aries

    Directory of Open Access Journals (Sweden)

    Rizah Avdić

    2013-08-01

    Full Text Available Morphology and morphometry of the bones are the methods often used for identification of species, estimation of animals' age, and genetic and forensic investigation. The mandible as the largest bone of the head is perhaps the most representative sample for this research. The aim of this study was to determine the basic morphometric parameters of the mandible of roe deer and sheep in order to identify the species. All samples were described by linear measure morphometric analysis of 12 specific anatomical points on the mandibles of roe deer and sheep. The results obtained are presented in the Table as mean and standard deviation.Key words: morphology, morphometry, mandible, roe deer, shee

  15. Hint2, the mitochondrial nucleoside 5'-phosphoramidate hydrolase; properties of the homogeneous protein from sheep (Ovis aries) liver.

    Science.gov (United States)

    Bretes, Ewa; Wojdyła-Mamoń, Anna M; Kowalska, Joanna; Jemielity, Jacek; Kaczmarek, Renata; Baraniak, Janina; Guranowski, Andrzej

    2013-01-01

    Adenosine 5'-phosphoramidate (NH2-pA) is a rare natural nucleotide and its biochemistry and biological functions are poorly recognized. All organisms have proteins that may be involved in the catabolism of NH2-pA. They are members of the HIT protein family and catalyze hydrolytic splitting of NH2-pA to 5'-AMP and ammonia. At least five HIT proteins have been identified in mammals; however, the enzymatic and molecular properties of only Fhit and Hint1 have been comprehensively studied. Our study focuses on the Hint2 protein purified by a simple procedure to homogeneity from sheep liver mitochondrial fraction (OaHint2). Hint1 protein was also prepared from sheep liver (OaHint1) and the molecular and kinetic properties of the two proteins compared. Both function as homodimers and behave as nucleoside 5'-phosphoramidate hydrolases. The molecular mass of the OaHint2 monomer is 16 kDa and that of the OaHint1 monomer 14.9 kDa. Among potential substrates studied, NH2-pA appeared to be the best; the Km and kcat values estimated for this compound are 6.6 μM and 68.3 s⁻¹, and 1.5 μM and 11.0 s⁻¹ per natively functioning dimer of OaHint2 and OaHint1, respectively. Studies of the rates of hydrolysis of different NH2-pA derivatives show that Hint2 is more specific towards compounds with a P-N bond than Hint1. The thermostability of these two proteins is also compared.

  16. Physics Basis for the Advanced Tokamak Fusion Power Plant ARIES-AT

    Energy Technology Data Exchange (ETDEWEB)

    S.C. Jardin; C.E. Kessel; T.K. Mau; R.L. Miller; F. Najmabadi; V.S. Chan; M.S. Chu; R. LaHaye; L.L. Lao; T.W. Petrie; P. Politzer; H.E. St. John; P. Snyder; G.M. Staebler; A.D. Turnbull; W.P. West

    2003-10-07

    The advanced tokamak is considered as the basis for a fusion power plant. The ARIES-AT design has an aspect ratio of A always equal to R/a = 4.0, an elongation and triangularity of kappa = 2.20, delta = 0.90 (evaluated at the separatrix surface), a toroidal beta of beta = 9.1% (normalized to the vacuum toroidal field at the plasma center), which corresponds to a normalized beta of bN * 100 x b/(I(sub)P(MA)/a(m)B(T)) = 5.4. These beta values are chosen to be 10% below the ideal-MHD stability limit. The bootstrap-current fraction is fBS * I(sub)BS/I(sub)P = 0.91. This leads to a design with total plasma current I(sub)P = 12.8 MA, and toroidal field of 11.1 T (at the coil edge) and 5.8 T (at the plasma center). The major and minor radii are 5.2 and 1.3 m, respectively. The effects of H-mode edge gradients and the stability of this configuration to non-ideal modes is analyzed. The current-drive system consists of ICRF/FW for on-axis current drive and a lower-hybrid system for off-axis. Tran sport projections are presented using the drift-wave based GLF23 model. The approach to power and particle exhaust using both plasma core and scrape-off-layer radiation is presented.

  17. Physics Basis for the Advanced Tokamak Fusion Power Plant ARIES-AT

    International Nuclear Information System (INIS)

    Jardin, S.C.; Kessel, C.E.; Mau, T.K.; Miller, R.L.; Najmabadi, F.; Chan, V.S.; Chu, M.S.; LaHaye, R.; Lao, L.L.; Petrie, T.W.; Politzer, P.; John, St. H.E.; Snyder, P.; Staebler, G.M.; Turnbull, A.D.; West, W.P.

    2003-01-01

    The advanced tokamak is considered as the basis for a fusion power plant. The ARIES-AT design has an aspect ratio of A always equal to R/a = 4.0, an elongation and triangularity of kappa = 2.20, delta = 0.90 (evaluated at the separatrix surface), a toroidal beta of beta = 9.1% (normalized to the vacuum toroidal field at the plasma center), which corresponds to a normalized beta of bN * 100 x b/(I(sub)P(MA)/a(m)B(T)) = 5.4. These beta values are chosen to be 10% below the ideal-MHD stability limit. The bootstrap-current fraction is fBS * I(sub)BS/I(sub)P = 0.91. This leads to a design with total plasma current I(sub)P = 12.8 MA, and toroidal field of 11.1 T (at the coil edge) and 5.8 T (at the plasma center). The major and minor radii are 5.2 and 1.3 m, respectively. The effects of H-mode edge gradients and the stability of this configuration to non-ideal modes is analyzed. The current-drive system consists of ICRF/FW for on-axis current drive and a lower-hybrid system for off-axis. Tran sport projections are presented using the drift-wave based GLF23 model. The approach to power and particle exhaust using both plasma core and scrape-off-layer radiation is presented

  18. Temperature, salinity, pressure, and other data from current meter and CTD casts in the NE Atlantic Ocean as part of the Subduction Accelerated Research Initiative (ARI) project, from 1991-05-18 to 1993-06-14 (NODC Accession 9700245)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The overall objective of the Subduction Accelerated Research Initiative (ARI) was to bring together several techniques to address the formation and evolution of...

  19. Florística em um hectare de cerrado stricto sensu na ARIE - cerrado Pé-de-Gigante, Santa Rita do Passa Quatro, SP

    OpenAIRE

    Weiser, Veridiana de Lara; Godoy, Silvana Aparecida Pires de

    2001-01-01

    Foi realizado um levantamento florístico em um ha de cerrado stricto sensu, na parte norte da ARIE - Cerrado Pé-de-Gigante, Santa Rita do Passa Quatro, São Paulo. Foram coletados 428 espécimes em fase reprodutiva, em vinte e cinco excursões de coleta, durante o período de novembro de 1996 a abril de 1998. A listagem florística obtida apresenta 141 espécies, distribuídas em 109 gêneros e 49 famílias. As famílias mais representativas foram: Leguminosae, Asteraceae, Malpighiaceae e Myrtaceae. A ...

  20. Analysis of different sub-carrier allocation of M-ary QAM-OFDM downlink in RoF system

    Science.gov (United States)

    Shao, Yu-feng; Chen, Luo; Wang, An-rong; Zhao, Yun-jie; Long, Ying; Ji, Xing-ping

    2018-01-01

    In this paper, the performance of a 60 GHz radio over fiber (RoF) system with 4/16/64 quadrature amplitude modulation (QAM) orthogonal frequency division multiplexing (OFDM) downstream signals is studied. Delivery of 10 Gbit/s M-ary QAM (MQAM) OFDM signals through the 20-km-long single-mode fiber (SMF) is complicated in terms of intensity modulation and direct detection (IM/DD). Using self-homodyne method, the beating of two independent light waves generating the millimeter-wave at the photodetector can be down-converted to baseband in the electrical domain. Meanwhile, three kinds of sub-carrier arrangement schemes are compared and discussed, and the simulation results show that lower peak-to-average power ratio ( PAPR) can be obtained adopting the adjacent scheme. At bit error rate ( BER) of 10-3, the receiver sensitivity using 4QAM-OFDM sub-carrier signal is almost enhanced by 4 dB and 9 dB compared with those of 16QAM-OFDM signal and 64QAM-OFDM signal.

  1. Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

    Science.gov (United States)

    Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

    2016-01-01

    Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

  2. Gene expression patterns induced at different stages of rhinovirus infection in human alveolar epithelial cells.

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Etemadi

    Full Text Available Human rhinovirus (HRV is the common virus that causes acute respiratory infection (ARI and is frequently associated with lower respiratory tract infections (LRTIs. We aimed to investigate whether HRV infection induces a specific gene expression pattern in airway epithelial cells. Alveolar epithelial cell monolayers were infected with HRV species B (HRV-B. RNA was extracted from both supernatants and infected monolayer cells at 6, 12, 24 and 48 hours post infection (hpi and transcriptional profile was analyzed using Affymetrix GeneChip and the results were subsequently validated using quantitative Real-time PCR method. HRV-B infects alveolar epithelial cells which supports implication of the virus with LRTIs. In total 991 genes were found differentially expressed during the course of infection. Of these, 459 genes were up-regulated whereas 532 genes were down-regulated. Differential gene expression at 6 hpi (187 genes up-regulated vs. 156 down-regulated were significantly represented by gene ontologies related to the chemokines and inflammatory molecules indicating characteristic of viral infection. The 75 up-regulated genes surpassed the down-regulated genes (35 at 12 hpi and their enriched ontologies fell into discrete functional entities such as regulation of apoptosis, anti-apoptosis, and wound healing. At later time points of 24 and 48 hpi, predominated down-regulated genes were enriched for extracellular matrix proteins and airway remodeling events. Our data provides a comprehensive image of host response to HRV infection. The study suggests the underlying molecular regulatory networks genes which might be involved in pathogenicity of the HRV-B and potential targets for further validations and development of effective treatment.

  3. Costs and benefits of group living with disease: a case study of pneumonia in bighorn lambs (Ovis canadensis).

    Science.gov (United States)

    Manlove, Kezia R; Cassirer, E Frances; Cross, Paul C; Plowright, Raina K; Hudson, Peter J

    2014-12-22

    Group living facilitates pathogen transmission among social hosts, yet temporally stable host social organizations can actually limit transmission of some pathogens. When there are few between-subpopulation contacts for the duration of a disease event, transmission becomes localized to subpopulations. The number of per capita infectious contacts approaches the subpopulation size as pathogen infectiousness increases. Here, we illustrate that this is the case during epidemics of highly infectious pneumonia in bighorn lambs (Ovis canadensis). We classified individually marked bighorn ewes into disjoint seasonal subpopulations, and decomposed the variance in lamb survival to weaning into components associated with individual ewes, subpopulations, populations and years. During epidemics, lamb survival varied substantially more between ewe-subpopulations than across populations or years, suggesting localized pathogen transmission. This pattern of lamb survival was not observed during years when disease was absent. Additionally, group sizes in ewe-subpopulations were independent of population size, but the number of ewe-subpopulations increased with population size. Consequently, although one might reasonably assume that force of infection for this highly communicable disease scales with population size, in fact, host social behaviour modulates transmission such that disease is frequency-dependent within populations, and some groups remain protected during epidemic events. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  4. Costs and benefits of group living with disease: a case study of pneumonia in bighorn lambs (Ovis canadensis)

    Science.gov (United States)

    Manlove, Kezia R.; Cassirer, E. Frances; Cross, Paul C.; Plowright, Raina K.; Hudson, Peter J.

    2014-01-01

    Group living facilitates pathogen transmission among social hosts, yet temporally stable host social organizations can actually limit transmission of some pathogens. When there are few between-subpopulation contacts for the duration of a disease event, transmission becomes localized to subpopulations. The number of per capita infectious contacts approaches the subpopulation size as pathogen infectiousness increases. Here, we illustrate that this is the case during epidemics of highly infectious pneumonia in bighorn lambs (Ovis canadensis). We classified individually marked bighorn ewes into disjoint seasonal subpopulations, and decomposed the variance in lamb survival to weaning into components associated with individual ewes, subpopulations, populations and years. During epidemics, lamb survival varied substantially more between ewe-subpopulations than across populations or years, suggesting localized pathogen transmission. This pattern of lamb survival was not observed during years when disease was absent. Additionally, group sizes in ewe-subpopulations were independent of population size, but the number of ewe-subpopulations increased with population size. Consequently, although one might reasonably assume that force of infection for this highly communicable disease scales with population size, in fact, host social behaviour modulates transmission such that disease is frequency-dependent within populations, and some groups remain protected during epidemic events.

  5. Transmission of the allergy reaction of a delayed type against Salmonella abortus ovis through blood plasma of gamma-irradiated guinea pigs

    International Nuclear Information System (INIS)

    Kostov, G.

    1977-01-01

    Use is made of blood plasma taken from guinea pigs (sensibilized with a live culture of Salmonella abortus ovis and then irradiated with 800 rad gamma-rays) to transmit the skin allergy reaction to normal, nonsensibilized guinea pigs. The allergy reaction has been demonstrated in the recipients of plasma as early as the 3-4th hour following the injection of the allergen into the skin. It reaches its peak at the 12-24th hour and later on strongly diminishes, remaining in few of the animals only up to the 48th hour. The infiltrate at the site of injection in the skin of positively reacting animals contains at the 24th hour cells of the polymorphonuclear type, which predominate, while the cells of the mononuclear type are few in number. There are no precipitins in the plasma of the donors, and the titer of the agglutinins and the cytophile antibodies is very low. Regardless of these findings it is concluded that the transmitted allergy reaction is of the fast type (after Arthuss), and not of the delayed one. (author)

  6. Bighorn sheep × domestic sheep hybrids survive Mannheimia haemolytica challenge in the absence of vaccination.

    Science.gov (United States)

    Subramaniam, R; Shanthalingam, S; Bavananthasivam, J; Kugadas, A; Raghavan, B; Batra, S A; Herndon, C N; Rodriguez, J; Tibary, A; Nelson, D; Potter, K A; Foreyt, W J; Srikumaran, S

    2014-06-04

    Bighorn sheep (BHS, Ovis canadensis) are much more susceptible than domestic sheep (DS, Ovis aries) to pneumonia caused by leukotoxin (Lkt)-producing members of the Family Pasteurellaceae, particularly Mannheimia haemolytica and Bibersteinia trehalosi. Leukotoxin is widely accepted as the critical virulence factor of these bacteria since Lkt-negative mutants do not cause death of BHS. Typically, DS carry Lkt-positive M. haemolytica and/or B. trehalosi as commensal bacteria in their nasopharynx. In contrast, most BHS do not carry Lkt-positive M. haemolytica or B. trehalosi, or carry Lkt-negative strains in their nasopharynx. In previous studies, we demonstrated that unimmunized DS resist M. haemolytica challenge while BHS succumb to it. We hypothesized that Lkt-neutralizing antibodies, induced by Lkt-positive M. haemolytica and/or B. trehalosi innately carried by DS in their nasopharynx, render them less susceptible to infection by these bacteria. In this study we developed BHS×DS F1 hybrids by artificial insemination of domestic ewes with BHS semen. F1 hybrids were fertile, and produced F2 hybrids and back-crosses. The F1, F2, and back-crosses were raised together with domestic ewes. All these animals acquired Lkt-positive M. haemolytica and/or B. trehalosi, and developed high titers of Lkt-neutralizing antibodies in the absence of vaccination. Furthermore, all of these animals resisted challenge with lethal dose of M. haemolytica. These results suggest that lack of previous exposure to Lkt is at least partially responsible for fatal pneumonia in BHS when they acquire Lkt-positive M. haemolytica and/or B. trehalosi from DS when the two species commingle. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Defective bacterial clearance is responsible for the enhanced lung pathology characteristic of Mannheimia haemolytica pneumonia in bighorn sheep.

    Science.gov (United States)

    Subramaniam, Renuka; Herndon, Caroline N; Shanthalingam, Sudarvili; Dassanayake, Rohana P; Bavananthasivam, Jegarubee; Potter, Kathleen A; Knowles, Donald P; Foreyt, William J; Srikumaran, Subramaniam

    2011-12-15

    The molecular and cellular basis for the enhanced lung pathology and mortality caused by Mannheimia haemolytica in bighorn sheep (BHS, Ovis canadenesis), in comparison to domestic sheep (DS, Ovis aries), is not clear. Polymorphonuclear leukocytes (PMNs) of BHS are four- to eight-fold more susceptible to M. haemolytica leukotoxin-induced cytolysis, which is likely to reduce the number of functional phagocytes in the lung. We hypothesized that enhanced lung pathology is due to defective clearance of M. haemolytica from the lungs of BHS. To test this hypothesis, M. haemolytica (1 × 10(7) colony forming units [cfu]) were inoculated intra-tracheally into three groups each of BHS and DS, which were euthanized and necropsied at 4, 12, and 18 h post-inoculation (hpi). Bacterial and leukocyte counts were performed on broncho-alveolar lavage fluid (BALF) collected at necropsy. BALF from BHS euthanized at 4 and 12 hpi contained a significantly higher number of M. haemolytica than that from DS. More importantly, DS did not have any bacteria in BALF at 18 hpi, while the BHS still had significant numbers. As expected, the BHS did exhibit more extensive lung lesions at 12 and 18 hpi when compared to DS. At 18 hpi, necrotic PMNs were observed in the lesional lung tissues of BHS, but not DS. Furthermore, BALF from BHS had significantly lower titers of antibodies to Lkt and surface antigens of M. haemolytica, than that of DS. These findings suggest that the enhanced pathology in BHS lungs is due to defective clearance of M. haemolytica from the lungs. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Use of exposure history to identify patterns of immunity to pneumonia in bighorn sheep (Ovis canadensis).

    Science.gov (United States)

    Plowright, Raina K; Manlove, Kezia; Cassirer, E Frances; Cross, Paul C; Besser, Thomas E; Hudson, Peter J

    2013-01-01

    Individual host immune responses to infectious agents drive epidemic behavior and are therefore central to understanding and controlling infectious diseases. However, important features of individual immune responses, such as the strength and longevity of immunity, can be challenging to characterize, particularly if they cannot be replicated or controlled in captive environments. Our research on bighorn sheep pneumonia elucidates how individual bighorn sheep respond to infection with pneumonia pathogens by examining the relationship between exposure history and survival in situ. Pneumonia is a poorly understood disease that has impeded the recovery of bighorn sheep (Ovis canadensis) following their widespread extirpation in the 1900s. We analyzed the effects of pneumonia-exposure history on survival of 388 radio-collared adults and 753 ewe-lamb pairs. Results from Cox proportional hazards models suggested that surviving ewes develop protective immunity after exposure, but previous exposure in ewes does not protect their lambs during pneumonia outbreaks. Paradoxically, multiple exposures of ewes to pneumonia were associated with diminished survival of their offspring during pneumonia outbreaks. Although there was support for waning and boosting immunity in ewes, models with consistent immunizing exposure were similarly supported. Translocated animals that had not previously been exposed were more likely to die of pneumonia than residents. These results suggest that pneumonia in bighorn sheep can lead to aging populations of immune adults with limited recruitment. Recovery is unlikely to be enhanced by translocating naïve healthy animals into or near populations infected with pneumonia pathogens.

  9. Phylogeographic and population genetic structure of bighorn sheep ( Ovis canadensis ) in North American deserts.

    Science.gov (United States)

    Buchalski, Michael R; Sacks, Benjamin N; Gille, Daphne A; Penedo, Maria Cecilia T; Ernest, Holly B; Morrison, Scott A; Boyce, Walter M

    2016-06-09

    Fossil data are ambiguous regarding the evolutionary origin of contemporary desert bighorn sheep ( Ovis canadensis subspecies). To address this uncertainty, we conducted phylogeographic and population genetic analyses on bighorn sheep subspecies found in southwestern North America. We analyzed 515 base pairs of mtDNA control region sequence and 39 microsatellites in 804 individuals from 58 locations. Phylogenetic analyses revealed 2 highly divergent clades concordant with Sierra Nevada ( O. c. sierrae ) and Rocky Mountain ( O. c. canadensis ) bighorn and showed that these 2 subspecies both diverged from desert bighorn prior to or during the Illinoian glaciation (~315-94 thousand years ago [kya]). Desert bighorn comprised several more recently diverged haplogroups concordant with the putative Nelson ( O. c. nelsoni ), Mexican ( O. c. mexicana ), and Peninsular ( O. c. cremnobates ) subspecies. Corresponding estimates of effective splitting times (~17-3 kya), and haplogroup ages (~85-72 kya) placed the most likely timeframe for divergence among desert bighorn subspecies somewhere within the last glacial maximum. Median-joining haplotype network and Bayesian skyline analyses both indicated that desert bighorn collectively comprised a historically large and haplotype-diverse population, which subsequently lost much of its diversity through demographic decline. Using microsatellite data, discriminant analysis of principle components (DAPC) and Bayesian clustering analyses both indicated genetic structure concordant with the geographic distribution of 3 desert subspecies. Likewise, microsatellite and mitochondrial-based F ST comparisons revealed significant fixation indices among the desert bighorn genetic clusters. We conclude these desert subspecies represent ancient lineages likely descended from separate Pleistocene refugial populations and should therefore be managed as distinct taxa to preserve maximal biodiversity. Los datos de fósiles sobre el origen evolutivo

  10. Severe Streptococcus infection in spotted hyenas in the Ngorongoro Crater, Tanzania.

    Science.gov (United States)

    Höner, Oliver P; Wachter, Bettina; Speck, Stephanie; Wibbelt, Gudrun; Ludwig, Arne; Fyumagwa, Robert D; Wohlsein, Peter; Lieckfeldt, Dietmar; Hofer, Heribert; East, Marion L

    2006-06-15

    In a population of spotted hyenas (Crocuta crocuta) monitored between 1996 and 2005 in the Ngorongoro Crater, Tanzania, 16 individuals from five of eight social groups displayed clinical signs of an infection, including severe unilateral swelling of the head followed by abscess formation at the mandibular angle, respiratory distress, mild ataxia, and lethargy. Two (12.5%) of these 16 individuals died within days of developing signs. Clinical signs in hyenas were first noted in 2001, and most cases occurred between September 2002 and February 2003, suggesting an outbreak of infection during this period. Histopathological examination of internal organs from one hyena that died with signs revealed morphological changes consistent with severe bacterial infection. Phenotypic examination and phylogenetic analysis of the 16S rRNA gene of the causative agent of infection revealed a Lancefield group C Streptococcus with a high level of homology to S. equi subsp. ruminatorum, a subspecies of S. equi recently described in domestic sheep (Ovis aries) and goats (Capra hircus) with mastitis in Spain. Strains similar to this bacterium were also isolated from two hyenas without obvious clinical signs, suggesting that hyenas may be 'carriers' of this bacterium, and from a sympatric Burchell's zebra (Equus burchelli), a herbivore species often consumed by hyenas. To our knowledge this is the first report of a Streptococcus infection in these two wildlife species. The high genetic similarity between the hyena and zebra isolates indicates that inter-specific transmission may occur, possibly when hyenas consume infected zebra carcasses.

  11. Local Extinction and Unintentional Rewilding of Bighorn Sheep (Ovis canadensis) on a Desert Island

    Science.gov (United States)

    Wilder, Benjamin T.; Betancourt, Julio L.; Epps, Clinton W.; Crowhurst, Rachel S.; Mead, Jim I.; Ezcurra, Exequiel

    2014-01-01

    Bighorn sheep (Ovis canadensis) were not known to live on Tiburón Island, the largest island in the Gulf of California and Mexico, prior to the surprisingly successful introduction of 20 individuals as a conservation measure in 1975. Today, a stable island population of ∼500 sheep supports limited big game hunting and restocking of depleted areas on the Mexican mainland. We discovered fossil dung morphologically similar to that of bighorn sheep in a dung mat deposit from Mojet Cave, in the mountains of Tiburón Island. To determine the origin of this cave deposit we compared pellet shape to fecal pellets of other large mammals, and extracted DNA to sequence mitochondrial DNA fragments at the 12S ribosomal RNA and control regions. The fossil dung was 14C-dated to 1476–1632 calendar years before present and was confirmed as bighorn sheep by morphological and ancient DNA (aDNA) analysis. 12S sequences closely or exactly matched known bighorn sheep sequences; control region sequences exactly matched a haplotype described in desert bighorn sheep populations in southwest Arizona and southern California and showed subtle differentiation from the extant Tiburón population. Native desert bighorn sheep previously colonized this land-bridge island, most likely during the Pleistocene, when lower sea levels connected Tiburón to the mainland. They were extirpated sometime in the last ∼1500 years, probably due to inherent dynamics of isolated populations, prolonged drought, and (or) human overkill. The reintroduced population is vulnerable to similar extinction risks. The discovery presented here refutes conventional wisdom that bighorn sheep are not native to Tiburón Island, and establishes its recent introduction as an example of unintentional rewilding, defined here as the introduction of a species without knowledge that it was once native and has since gone locally extinct. PMID:24646515

  12. Local extinction and unintentional rewilding of bighorn sheep (Ovis canadensis on a desert island.

    Directory of Open Access Journals (Sweden)

    Benjamin T Wilder

    Full Text Available Bighorn sheep (Ovis canadensis were not known to live on Tiburón Island, the largest island in the Gulf of California and Mexico, prior to the surprisingly successful introduction of 20 individuals as a conservation measure in 1975. Today, a stable island population of ∼500 sheep supports limited big game hunting and restocking of depleted areas on the Mexican mainland. We discovered fossil dung morphologically similar to that of bighorn sheep in a dung mat deposit from Mojet Cave, in the mountains of Tiburón Island. To determine the origin of this cave deposit we compared pellet shape to fecal pellets of other large mammals, and extracted DNA to sequence mitochondrial DNA fragments at the 12S ribosomal RNA and control regions. The fossil dung was 14C-dated to 1476-1632 calendar years before present and was confirmed as bighorn sheep by morphological and ancient DNA (aDNA analysis. 12S sequences closely or exactly matched known bighorn sheep sequences; control region sequences exactly matched a haplotype described in desert bighorn sheep populations in southwest Arizona and southern California and showed subtle differentiation from the extant Tiburón population. Native desert bighorn sheep previously colonized this land-bridge island, most likely during the Pleistocene, when lower sea levels connected Tiburón to the mainland. They were extirpated sometime in the last ∼1500 years, probably due to inherent dynamics of isolated populations, prolonged drought, and (or human overkill. The reintroduced population is vulnerable to similar extinction risks. The discovery presented here refutes conventional wisdom that bighorn sheep are not native to Tiburón Island, and establishes its recent introduction as an example of unintentional rewilding, defined here as the introduction of a species without knowledge that it was once native and has since gone locally extinct.

  13. Local extinction and unintentional rewilding of bighorn sheep (Ovis canadensis) on a desert island

    Science.gov (United States)

    Wilder, Benjamin T.; Betancourt, Julio L.; Epps, Clinton W.; Crowhurst, Rachel S.; Mead, Jim I.; Ezcurra, Exequiel

    2014-01-01

    Bighorn sheep (Ovis canadensis) were not known to live on Tiburón Island, the largest island in the Gulf of California and Mexico, prior to the surprisingly successful introduction of 20 individuals as a conservation measure in 1975. Today, a stable island population of ~500 sheep supports limited big game hunting and restocking of depleted areas on the Mexican mainland. We discovered fossil dung morphologically similar to that of bighorn sheep in a dung mat deposit from Mojet Cave, in the mountains of Tiburón Island. To determine the origin of this cave deposit we compared pellet shape to fecal pellets of other large mammals, and extracted DNA to sequence mitochondrial DNA fragments at the 12S ribosomal RNA and control regions. The fossil dung was 14C-dated to 1476–1632 calendar years before present and was confirmed as bighorn sheep by morphological and ancient DNA (aDNA) analysis. 12S sequences closely or exactly matched known bighorn sheep sequences; control region sequences exactly matched a haplotype described in desert bighorn sheep populations in southwest Arizona and southern California and showed subtle differentiation from the extant Tiburón population. Native desert bighorn sheep previously colonized this land-bridge island, most likely during the Pleistocene, when lower sea levels connected Tiburón to the mainland. They were extirpated sometime in the last ~1500 years, probably due to inherent dynamics of isolated populations, prolonged drought, and (or) human overkill. The reintroduced population is vulnerable to similar extinction risks. The discovery presented here refutes conventional wisdom that bighorn sheep are not native to Tiburón Island, and establishes its recent introduction as an example of unintentional rewilding, defined here as the introduction of a species without knowledge that it was once native and has since gone locally extinct.

  14. PROFILE SOCIAL CLASS OF INDIVIDUALS ASSISTED IN A SOCIAL ORGANIZATION IN THE CAMAÇARI-BA CITY

    Directory of Open Access Journals (Sweden)

    Milene de Andrade Carvalho

    2012-04-01

    Full Text Available The city of Camaçari-Ba in the Bahia is considered the biggest territory of the region metropolitan area of Salvador-B. This population has presented considerable growth in the Human Development Index (HDI, with magnifying of the life expectancy and industrial cycle. The biggest social organization situated in the city and considered satate reference of social inclusion are develops entailed diverse actions to the participation of the city departments, except on actions to the healt secretariat. This study one is about a research of transverse whose objective was to identify the profile of 227 individuals assisted by social organization Prof. Raimundo Pinheiro, located in the mentioned city. The results had indicated the presence of a predominant age range next to 60 years, the relation between income and scholarity, the high frequency of chronic pain and relation enters the chronic use of drugs, activities of daily life and occupational activities. It is necessary that the activities of the social organization contemplate the logic of the intersectoral and include secretariat of health in its organizational politics.

  15. Anatomical study of animal remains from Phoenician-Punic amphorae found in the Santa Giusta Pond, Sardinia (Italy

    Directory of Open Access Journals (Sweden)

    Laura Portas

    2015-12-01

    Full Text Available During the underwater excavations carried out in the Santa Giusta Pond, near Oristano, Sardinia, a significant amount of Phoenician- Punic materials was brought to light including amphorae (dating back to 7th-2nd century BC and vegetal and animal remains. All of these archaeological finds may come from Othoca, an important Phoenician- Punic city on the eastern shore of the pond, geographically corresponding with the modern-day town of Santa Giusta. Animal materials consist of more than 3000 very well-preserved remains, belonging to sheep (Ovis aries, goat (Capra hircus and cattle (Bos taurus. Bone analyses allowed reconstructing the slaughtering methods, as well as manipulation procedures carried out to preserve meat in order to be exported overseas. Although pig (Sus scrofa played an important economical role in other Sardinian Phoenician-Punic settlements, in this archaeological context this species is absent, suggesting that the meat contained in the amphorae was probably destined to other areas of the Mediterranean basin, where people did not eat pork.

  16. Scanning Electron Microscopy-Energy-Dispersive X-Ray (SEM/EDX): A Rapid Diagnostic Tool to Aid the Identification of Burnt Bone and Contested Cremains.

    Science.gov (United States)

    Ellingham, Sarah T D; Thompson, Tim J U; Islam, Meez

    2018-03-01

    This study investigates the use of Scanning electron microscopy-energy-dispersive X-ray (SEM-EDX) as a diagnostic tool for the determination of the osseous origin of samples subjected to different temperatures. Sheep (Ovis aries) ribs of two experimental groups (fleshed and defleshed) were burned at temperatures of between 100°C and 1100°C in 100°C increments and subsequently analyzed with the SEM-EDX to determine the atomic percentage of present elements. Three-factor ANOVA analysis showed that neither the exposure temperature, nor whether the burning occurred with or without soft tissue present had any significant influence on the bone's overall elemental makeup (p > 0.05). The Ca/P ratio remained in the osseous typical range of between 1.6 and 2.58 in all analyzed samples. This demonstrates that even faced with high temperatures, the overall gross elemental content and atomic percentage of elements in bone remain stable, creating a unique "fingerprint" for osseous material, even after exposure to extreme conditions. © 2017 American Academy of Forensic Sciences.

  17. Equalizer Complexity for 6-LP Mode 112 Gbit/s m-ary DP-QAM Space Division Multiplexed Transmission in Strongly Coupled Few-Mode-Fibers

    DEFF Research Database (Denmark)

    Asif, Rameez; Ye, Feihong; Morioka, Toshio

    2015-01-01

    12×12 multiple-input multiple-output (MIMO) adaptive digital signal processing (DSP). Time domain equalization (TDE) is realized to implement the linear adaptive MIMO module that is implemented in blind mode using conventional constant-modulusalgorithm (CMA) for finite impulse response (FIR) adaptive......We have quantified equalizer complexity for transmitting dual-polarized 6-LP modes (LP01, LP11a, LP11b, LP21a, LP21b and LP02) of 112 Gbit/s m-ary QAM (m=4, 16, 32, 64, 256) single carrier signals over 20 km step-index few-mode fiber. The transmitted signals are strongly coupled and recovered using...

  18. Anatomic and craniometric factors in differentiating roe deer (Capreolus capreolus from sheep (Ovis aries and goat (Capra hircus skulls

    Directory of Open Access Journals (Sweden)

    Onuk Burcu

    2013-01-01

    Full Text Available This study was carried out to investigate the bony structures relevant to skull of roe deer, sheep and goat. The skull of five sheep weighing 45-50 kg, three goat weighing 50-60 kg and five roe deer weighing 20-25 kg were used in this study. Macerations of the cranium were performed by the boiling method. The skull of the roe deer was notably similar to that of sheep with the presence of external lacrimal fossa, and to the goat with due to the presence of two points (lateral and medial on the septal process and a significant fissure formed between the nasal, lacrimal, frontal and maxillary bones. In addition to these similarities, the formations which were specific to the roe deer were structures such as the number and position of the lacrimal foramen and presence of an uncertain muscular tubercle in the basilar portion of the occipital bone. In addition, the craniometric parameters specific to the roe deer’s skull were determined as the zygomatic, interorbital, neurocranium and nasal lengths.

  19. Impact of two myostatin (MSTN mutations on weight gain and lamb carcass classification in Norwegian White Sheep (Ovis aries

    Directory of Open Access Journals (Sweden)

    Blichfeldt Thor

    2010-01-01

    Full Text Available Abstract Background Our aim was to estimate the effect of two myostatin (MSTN mutations in Norwegian White Sheep, one of which is close to fixation in the Texel breed. Methods The impact of two known MSTN mutations was examined in a field experiment with Norwegian White Sheep. The joint effect of the two MSTN mutations on live weight gain and weaning weight was studied on 644 lambs. Carcass weight gain from birth to slaughter, carcass weight, carcass conformation and carcass fat classes were calculated in a subset of 508 lambs. All analyses were carried out with a univariate linear animal model. Results The most significant impact of both mutations was on conformation and fat classes. The largest difference between the genotype groups was between the wild type for both mutations and the homozygotes for the c.960delG mutation. Compared to the wild types, these mutants obtained a conformation score 5.1 classes higher and a fat score 3.0 classes lower, both on a 15-point scale. Conclusions Both mutations reduced fatness and increased muscle mass, although the effect of the frameshift mutation (c.960delG was more important as compared to the 3'-UTR mutation (c.2360G>A. Lambs homozygous for the c.960delG mutation grew more slowly than those with other MSTN genotypes, but had the least fat and the largest muscle mass. Only c.960delG showed dominance effects.

  20. Quantitative trait loci (QTL) mapping of resistance to strongyles and coccidia in the free-living Soay sheep (Ovis aries).

    Science.gov (United States)

    Beraldi, Dario; McRae, Allan F; Gratten, Jacob; Pilkington, Jill G; Slate, Jon; Visscher, Peter M; Pemberton, Josephine M

    2007-01-01

    A genome-wide scan was performed to detect quantitative trait loci (QTL) for resistance to gastrointestinal parasites and ectoparasitic keds segregating in the free-living Soay sheep population on St. Kilda (UK). The mapping panel consisted of a single pedigree of 882 individuals of which 588 were genotyped. The Soay linkage map used for the scans comprised 251 markers covering the whole genome at average spacing of 15cM. The traits here investigated were the strongyle faecal egg count (FEC), the coccidia faecal oocyst count (FOC) and a count of keds (Melophagus ovinus). QTL mapping was performed by means of variance component analysis so that the genetic parameters of the study traits were also estimated and compared with previous studies in Soay and domestic sheep. Strongyle FEC and coccidia FOC showed moderate heritability (h(2)=0.26 and 0.22, respectively) in lambs but low heritability in adults (h(2)<0.10). Ked count appeared to have very low h(2) in both lambs and adults. Genome scans were performed for the traits with moderate heritability and two genomic regions reached the level of suggestive linkage for coccidia FOC in lambs (logarithm of the odds=2.68 and 2.21 on chromosomes 3 and X, respectively). We believe this is the first study to report a QTL search for parasite resistance in a free-living animal population and therefore may represent a useful reference for similar studies aimed at understanding the genetics of host-parasite co-evolution in the wild.

  1. Use of exposure history to identify patterns of immunity to pneumonia in bighorn sheep (Ovis canadensis.

    Directory of Open Access Journals (Sweden)

    Raina K Plowright

    Full Text Available Individual host immune responses to infectious agents drive epidemic behavior and are therefore central to understanding and controlling infectious diseases. However, important features of individual immune responses, such as the strength and longevity of immunity, can be challenging to characterize, particularly if they cannot be replicated or controlled in captive environments. Our research on bighorn sheep pneumonia elucidates how individual bighorn sheep respond to infection with pneumonia pathogens by examining the relationship between exposure history and survival in situ. Pneumonia is a poorly understood disease that has impeded the recovery of bighorn sheep (Ovis canadensis following their widespread extirpation in the 1900s. We analyzed the effects of pneumonia-exposure history on survival of 388 radio-collared adults and 753 ewe-lamb pairs. Results from Cox proportional hazards models suggested that surviving ewes develop protective immunity after exposure, but previous exposure in ewes does not protect their lambs during pneumonia outbreaks. Paradoxically, multiple exposures of ewes to pneumonia were associated with diminished survival of their offspring during pneumonia outbreaks. Although there was support for waning and boosting immunity in ewes, models with consistent immunizing exposure were similarly supported. Translocated animals that had not previously been exposed were more likely to die of pneumonia than residents. These results suggest that pneumonia in bighorn sheep can lead to aging populations of immune adults with limited recruitment. Recovery is unlikely to be enhanced by translocating naïve healthy animals into or near populations infected with pneumonia pathogens.

  2. Disease and predation: sorting out causes of a bighorn sheep (Ovis canadensis decline.

    Directory of Open Access Journals (Sweden)

    Joshua B Smith

    Full Text Available Estimating survival and documenting causes and timing of mortality events in neonate bighorn sheep (Ovis canadensis improves understanding of population ecology and factors influencing recruitment. During 2010-2012, we captured and radiocollared 74 neonates in the Black Hills, South Dakota, of which 95% (70 died before 52 weeks of age. Pneumonia (36% was the leading cause of mortality followed by predation (30%. We used known fate analysis in Program MARK to estimate weekly survival rates and investigate the influence of intrinsic variables on 52-week survival. Model {S1 wk, 2-8 wks, >8 wks} had the lowest AIC c (Akaike's Information Criterion corrected for small sample size value, indicating that age (3-stage age-interval: 1 week, 2-8 weeks, and >8 weeks best explained survival. Weekly survival estimates for 1 week, 2-8 weeks, and >8 weeks were 0.81 (95% CI = 0.70-0.88, 0.86 (95% CI = 0.81-0.90, and 0.94 (95% CI = 0.91-0.96, respectively. Overall probability of surviving 52 weeks was 0.02 (95% CI = 0.01-0.07. Of 70 documented mortalities, 21% occurred during the first week, 55% during weeks 2-8, and 23% occurred >8 weeks of age. We found pneumonia and predation were temporally heterogeneous with lambs most susceptible to predation during the first 2-3 weeks of life, while the greatest risk from pneumonia occurred from weeks 4-8. Our results indicated pneumonia was the major factor limiting recruitment followed by predation. Mortality from predation may have been partly compensatory to pneumonia and its effects were less pronounced as alternative prey became available. Given the high rates of pneumonia-caused mortality we observed, and the apparent lack of pneumonia-causing pathogens in bighorn populations in the western Black Hills, management activities should be geared towards eliminating contact between diseased and healthy populations.

  3. Disease and predation: Sorting out causes of a bighorn sheep (Ovis canadensis) decline

    Science.gov (United States)

    Smith, Joshua B.; Jenks, Jonathan A.; Grovenburg, Troy W.; Klaver, Robert W.

    2014-01-01

    Estimating survival and documenting causes and timing of mortality events in neonate bighorn sheep (Ovis canadensis) improves understanding of population ecology and factors influencing recruitment. During 2010–2012, we captured and radiocollared 74 neonates in the Black Hills, South Dakota, of which 95% (70) died before 52 weeks of age. Pneumonia (36%) was the leading cause of mortality followed by predation (30%). We used known fate analysis in Program MARK to estimate weekly survival rates and investigate the influence of intrinsic variables on 52-week survival. Model {S1 wk, 2–8 wks, >8 wks} had the lowest AICc (Akaike’s Information Criterion corrected for small sample size) value, indicating that age (3-stage age-interval: 1 week, 2–8 weeks, and >8 weeks) best explained survival. Weekly survival estimates for 1 week, 2–8 weeks, and >8 weeks were 0.81 (95% CI = 0.70–0.88), 0.86 (95% CI = 0.81–0.90), and 0.94 (95% CI = 0.91–0.96), respectively. Overall probability of surviving 52 weeks was 0.02 (95% CI = 0.01–0.07). Of 70 documented mortalities, 21% occurred during the first week, 55% during weeks 2–8, and 23% occurred >8 weeks of age. We found pneumonia and predation were temporally heterogeneous with lambs most susceptible to predation during the first 2–3 weeks of life, while the greatest risk from pneumonia occurred from weeks 4–8. Our results indicated pneumonia was the major factor limiting recruitment followed by predation. Mortality from predation may have been partly compensatory to pneumonia and its effects were less pronounced as alternative prey became available. Given the high rates of pneumonia-caused mortality we observed, and the apparent lack of pneumonia-causing pathogens in bighorn populations in the western Black Hills, management activities should be geared towards eliminating contact between diseased and healthy populations.

  4. Persistent efficacy of a long acting injectable formulation of moxidectin against natural infestations of the sheep nasal bot (Oestrus ovis) in Spain.

    Science.gov (United States)

    Rugg, Douglas; Ferrer, Luis Miguel; Sarasola, Patxi; Figueras, Luis; Lacasta, Delia; Liu, Bo; Bartram, David

    2012-09-10

    Cydectin(®) 2% LA Solution for Injection for Sheep (Pfizer Animal Health) is a long-acting (LA) formulation of moxidectin for the treatment and prevention of mixed infections of gastro-intestinal nematodes, respiratory nematodes and certain arthropod parasites in sheep. To evaluate the duration of persistent efficacy against nasal bots (Oestrus ovis), a natural exposure study was conducted in Spain during the summer of 2011. One hundred and twenty nasal bot-free, Rasa Aragonesa sheep were randomly allocated to eight groups of 15 animals each. On Day 0, four groups were treated at the recommended dose rate of 1 mg moxidectin/kg bodyweight. Four groups remained untreated as negative controls. All animals were held in nasal bot-proof housing except for exposure to natural challenge when one group of treated sheep and one of group of control animals were transferred to a local pasture at either 0-20, 20-40, 40-60, or 60-80 days after treatment. Following challenge, sheep were scored for clinical signs of bot infestation, necropsied and the heads sectioned for larval recovery. Nasal bot larvae were retrieved from 7 to 11 control sheep following each exposure period indicating that adult bots were active throughout the study. In the first challenge up to 20 days after treatment, when sheep were slaughtered immediately after exposure, the majority of larvae were first instar (L1) and only 3 of the 15 control sheep were infested with second instars (L2). There was 100% efficacy against L2 and 38.1% reduction in the number of live L1 in the treated sheep but mean counts were not significantly different between treatment and control groups (P ≥ 0.05). For the subsequent exposure periods 20-80 days after treatment (necropsies 7-9 days after challenge), 6-10 sheep were infested with L1 and 9-11 control sheep were infested with L2 and third instars (L3). There was negligible efficacy against L1, but treatment with moxidectin resulted in 100% control of L2 and L3. These

  5. Plasma profile and shape optimization for the advanced tokamak power plant, ARIES-AT

    International Nuclear Information System (INIS)

    Kessel, C.E.; Mau, T.K.; Jardin, S.C.; Najmabadi, F.

    2006-01-01

    An advanced tokamak plasma configuration is developed based on equilibrium, ideal MHD stability, bootstrap current analysis, vertical stability and control, and poloidal field coil analysis. The plasma boundaries used in the analysis are forced to coincide with the 99% flux surface from the free-boundary equilibrium. Using an accurate bootstrap current model and external current drive profiles from ray tracing calculations in combination with optimized pressure profiles, β N values above 7.0 have been obtained. The minimum current drive requirement is found to lie at a lower β N of 6.0. The external kink mode is stabilized by a tungsten shell located at 0.33 times the minor radius and a feedback system. Plasma shape optimization has led to an elongation of 2.2 and triangularity of 0.9 at the separatrix. Vertical stability could be achieved by a combination of tungsten shells located at 0.33 times the minor radius and feedback control coils located behind the shield. The poloidal field coils were optimized in location and current, providing a maximum coil current of 8.6 MA. These developments have led to a simultaneous reduction in the power plant major radius and toroidal field from those found in a previous study [S.C. Jardin, C.E. Kessel, C.G. Bathke, D.A. Ehst, T.K. Mau, F. Najmabadi, T.W. Petrie, the ARIES Team, Physics basis for a reversed shear tokamak power plant, Fusion Eng. Design 38 (1997) 27

  6. Effect of vaccination against pneumonia on the survival of bighorn sheep (Ovis canadensis) commingled with carrier animals.

    Science.gov (United States)

    Raghavan, Bindu; Bavananthasivam, Jegarubee; Kugadas, Abirami; Haldorson, Gary J; Srikumaran, Subramaniam

    2017-05-01

    Leukotoxin producing (lkt+) members of Pasteurellaceae, particularly Mannheimia haemolytica and Bibersteinia trehalosi are important pathogens of pneumonia in bighorn sheep (BHS; Ovis canadensis), causing fatal disease. Predisposing or concurrent infection with Mycoplasma ovipneumoniae enhances the severity of the disease, resulting in increased morbidity and mortality. Several studies have investigated the effectiveness of vaccines against lkt+ members of Pasteurellaceae in preventing fatal pneumonia in BHS. In all of these studies, however, vaccinated animals were challenged experimentally, by direct inoculation of the pathogens, rather than by natural challenge. Moreover, none has investigated the efficacy of the vaccines under conditions of concurrent infection with M. ovipneumoniae. We immunized three bighorn rams and one pregnant ewe with an experimental multivalent vaccine along with a commercial vaccine. The immunized animals were then commingled with two bighorn ewes known to be carriers of lkt+ members of Pasteurellaceae, to simulate natural infection or disease transmission. All vaccinated animals remained healthy. We then inoculated the two carrier ewes with nasal washings from domestic sheep containing M. ovipneumoniae. Within a week, all animals developed mild to moderate signs of pneumonia. While the rams died within two-three months post-inoculation (p.i.), the vaccinated ewe and her lamb died five and eight months p.i., respectively. Taken together, these results suggest that vaccination of BHS against lkt+ members of Pasteurellaceae alone can protect them from natural challenge by these pathogens. However, it may not be adequate to protect them against pneumonia compounded by concurrent infection with M. ovipneumoniae. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Characterisation of IncA/C2 plasmids carrying an In416-like integron with the blaVIM-19 gene from Klebsiella pneumoniae ST383 of Greek origin.

    Science.gov (United States)

    Papagiannitsis, Costas C; Dolejska, Monika; Izdebski, Radosław; Giakkoupi, Panagiota; Skálová, Anna; Chudějová, Kateřina; Dobiasova, Hana; Vatopoulos, Alkiviadis C; Derde, Lennie P G; Bonten, Marc J M; Gniadkowski, Marek; Hrabák, Jaroslav

    2016-02-01

    The complete nucleotide sequences of three multidrug resistance (MDR) IncA/C-like plasmids from Enterobacteriaceae isolates carrying the VIM-type carbapenemase-encoding integrons In4863 (blaVIM-19-aacA7-dfrA1-ΔaadA1-smr2) or In4873 (blaVIM-1-aacA7-dfrA1-ΔaadA1-smr2) were determined, which are the first In416-like elements identified in Greece. Plasmids pKP-Gr642 and pKP-Gr8143 were from Klebsiella pneumoniae ST383 isolates, whereas plasmid pEcl-Gr4873 was from an Enterobacter cloacae ST88 isolate. Sequencing showed that pKP-Gr642 (162787bp) and pKP-Gr8143 (154395bp) consisted of the type 1 IncA/C2 conserved backbone, the blaCMY-2-like gene-containing region, and the ARI-B (with the sul2 gene) and ARI-A (with a class 1 integron) resistance islands, like the plasmid pUMNK88_161 from the USA. The third plasmid, pEcl-Gr4873 (153958bp), exhibited extensive similarity with the type 2 IncA/C2 plasmid pR55 from France. pEcl-Gr4873 carried only one resistance island of a hybrid transposon structure inserted in a different location to ARI-A in type 1 A/C2 plasmids. In all three plasmids, the In416-like integrons In4863 or In4873 were identified within non-identical class II transposon structures. All three In416-like-carrying regions presented significant similarities with the MDR region of the IncA/C2 plasmid pCC416 from Italy, carrying the prototype In416 integron (blaVIM-4-aacA7-dfrA1-ΔaadA1-smr2). These findings provided the basis for speculations regarding the evolution of IncA/C2 plasmids with In416-like integrons, and confirmed the rapid evolution of some IncA/C2 plasmid lineages. Considering the broad host range of IncA/C2 molecules, it seems that pKP-Gr642, pKP-Gr8143 and pEcl-Gr4873 plasmids might support the diffusion of In416-like integrons among Enterobacteriaceae. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  8. Using visuo-kinetic virtual reality to induce illusory spinal movement: the MoOVi Illusion

    Directory of Open Access Journals (Sweden)

    Daniel S. Harvie

    2017-02-01

    Full Text Available Background Illusions that alter perception of the body provide novel opportunities to target brain-based contributions to problems such as persistent pain. One example of this, mirror therapy, uses vision to augment perceived movement of a painful limb to treat pain. Since mirrors can’t be used to induce augmented neck or other spinal movement, we aimed to test whether such an illusion could be achieved using virtual reality, in advance of testing its potential therapeutic benefit. We hypothesised that perceived head rotation would depend on visually suggested movement. Method In a within-subjects repeated measures experiment, 24 healthy volunteers performed neck movements to 50o of rotation, while a virtual reality system delivered corresponding visual feedback that was offset by a factor of 50%–200%—the Motor Offset Visual Illusion (MoOVi—thus simulating more or less movement than that actually occurring. At 50o of real-world head rotation, participants pointed in the direction that they perceived they were facing. The discrepancy between actual and perceived direction was measured and compared between conditions. The impact of including multisensory (auditory and visual feedback, the presence of a virtual body reference, and the use of 360o immersive virtual reality with and without three-dimensional properties, was also investigated. Results Perception of head movement was dependent on visual-kinaesthetic feedback (p = 0.001, partial eta squared = 0.17. That is, altered visual feedback caused a kinaesthetic drift in the direction of the visually suggested movement. The magnitude of the drift was not moderated by secondary variables such as the addition of illusory auditory feedback, the presence of a virtual body reference, or three-dimensionality of the scene. Discussion Virtual reality can be used to augment perceived movement and body position, such that one can perform a small movement, yet perceive a large one. The MoOVi

  9. Njv Magazine 3 final

    African Journals Online (AJOL)

    En-Joy

    Mixed infections (1.7%) due to A.ovis and T.ovis were also detected. A.ovis was the most predominant blood parasite ... smear method in the goats. ... infection based on the diagnostic methods used. ..... Volta: A model for the integration of.

  10. The path from ITER to a power plant - initial results from the ARIES ''Pathways'' program

    International Nuclear Information System (INIS)

    Najmabadi, F.

    2007-01-01

    The US national power plant studies program, ARIES, has initiated a 3-year integrated study, called the ''Pathways Program'' to investigate what the fusion program needs to do, in addition to successful operation of the ITER, in order to transform fusion into a commercial reality. The US power industry and regulatory agencies view the demonstration power plant, DEMO, as a device which is build and operated by industry, possibly with government participation, to demonstrate the commercial readiness of fusion power. As such, the ''Pathways'' programs will investigate what is needed, in addition to successful operation of ITER, to convince industry to move forward with a fusion DEMO. While many reports exists that provide a strategic view of the needs for fusion development; in the ITER era, a much more detailed view is needed to provide the necessary information for program planning. By comparing the anticipated results from ITER and existing facilities with the requirements for a power plant in the first phase of the Pathways study, we will develop a comprehensive list of remaining R and D items for developing fusion, will identify metrics for distributing resources among R and D issues, and will identify which of those items can/should be done in existing or simulation facilities. In the second phase of the study, we will develop potential embodiments for the fusion test facility (ies) and explore their cost/performance parametrically. An important by-product of this study is the identification of key R and D issues that can be performed and resolved in existing facilities to make the fusion facility cheaper and/or a higher performance device. This paper summarizes the results from the first phase of our study. We have adopted a ''holistic'' or integrated approach with the focus on the needs of the customer. In such an approach, the remaining R and D should generate all of the information needed by industry to move forward with the DEMO, i.e., data needed to

  11. [Detection and Analysis of Human Parainfluenza Virus Infection in Hospitalized Adults with Acute Respiratory Tract Infections].

    Science.gov (United States)

    Li, Xing-Qiao; Liu, Xue-Wei; Zhou, Tao; Pei, Xiao-Fang

    2017-11-01

    To investigate the prevalence and gene characteristics of different groups of human parainfluenza virus (HPIV) infection in hospitalized adults with acute respiratory tract infections (ARI). RT-PCR was used to detect HPIV hemagglutinin (HA) DNA,which was extracted from sputum samples of 1 039 adult patients with ARI from March,2014 to June,2016. The HA gene amplified from randomly selected positive samples were sequenced to analyze the homology and variation. 10.6% (110/1 039) of these samples were positive for HPIV,including 8 cases of HPIV-1,22 cases of HPIV-2,46 cases of HPIV-3 and 34 cases of HPIV-4. Detectable rate varied among different groups of HPIV according to seasons of the year and ages of patients. No significant differences were found between the positive samples and the reference sequences. Compared with different reference strains of different regions,the genetic distance of nucleotide is the smallest between the strains tested in this study and the reference strains of other provinces and cities in China. In Chengdu region,HPIV virus is highly detected in ARI,all subtypes were detected with HPIV-3 being the main subtype.

  12. Genome-wide association mapping identifies the genetic basis of discrete and quantitative variation in sexual weaponry in a wild sheep population.

    Science.gov (United States)

    Johnston, Susan E; McEwan, John C; Pickering, Natalie K; Kijas, James W; Beraldi, Dario; Pilkington, Jill G; Pemberton, Josephine M; Slate, Jon

    2011-06-01

    Understanding the genetic architecture of phenotypic variation in natural populations is a fundamental goal of evolutionary genetics. Wild Soay sheep (Ovis aries) have an inherited polymorphism for horn morphology in both sexes, controlled by a single autosomal locus, Horns. The majority of males have large normal horns, but a small number have vestigial, deformed horns, known as scurs; females have either normal horns, scurs or no horns (polled). Given that scurred males and polled females have reduced fitness within each sex, it is counterintuitive that the polymorphism persists within the population. Therefore, identifying the genetic basis of horn type will provide a vital foundation for understanding why the different morphs are maintained in the face of natural selection. We conducted a genome-wide association study using ∼36000 single nucleotide polymorphisms (SNPs) and determined the main candidate for Horns as RXFP2, an autosomal gene with a known involvement in determining primary sex characters in humans and mice. Evidence from additional SNPs in and around RXFP2 supports a new model of horn-type inheritance in Soay sheep, and for the first time, sheep with the same horn phenotype but different underlying genotypes can be identified. In addition, RXFP2 was shown to be an additive quantitative trait locus (QTL) for horn size in normal-horned males, accounting for up to 76% of additive genetic variation in this trait. This finding contrasts markedly from genome-wide association studies of quantitative traits in humans and some model species, where it is often observed that mapped loci only explain a modest proportion of the overall genetic variation. © 2011 Blackwell Publishing Ltd.

  13. Ari Folman’s Waltz With Bashir and the Limits of Abstract Tragedy

    Directory of Open Access Journals (Sweden)

    Nicholas Hetrick

    2010-06-01

    Full Text Available

    Abstract (E: Drawing on scholarship on film cognition, the essay argues that Ari Folman's animated documentary Waltz with Bashir effectively recreates the process of recovering memories by capitalizing on the way our brains process films, and by thematizing memory. However, the film's limited contextualization of the 1982 Lebanon War and the lives of the soldiers involved and depicted limits Waltz's ability to make an effective antiwar statement. While the film's impact is not limited to viewers with knowledge of the particular politico-military conflict the film represents, it is limited by the nature and extent of its involvement with its subjects' lives before and after the war.

     

  14. Occurrence of Capillaria sp. in the liver of sheep (Ovis aries in a slaughterhouse in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Paulo Eduardo Ferlini Teixeira

    2018-06-01

    Full Text Available Abstract Although sheep farming has grown in the state of Acre over the past four decades, little is known about occurrences of helminthiases in the herds of this region. The objective of the study was to assess the occurrences of non-intestinal helminthiasis among sheep slaughtered in Rio Branco. A total of 110 sheep livers were inspected from two slaughter batches (july 2014 and march 2015 in a slaughterhouse in Rio Branco. Livers with macroscopic lesions were photographed and were then subjected to histopathological analysis under an optical microscope. The macroscopic lesions showed small nodes with inflammatory characteristics and areas of fibrosis, which appeared to be calcified, thus suggesting a granulomatous reaction. Of the 110 evaluated livers, we noticed 110 nodules in total; these nodules have an average size of 0.5 cm. The histopathological analysis showed alterations to the architecture of the hepatic lobe, with multiple foci of necrosis and polymorphonuclear cells. Two samples revealed the presence of helminths from Nematode class and Capillaria sp. eggs identified by the typical morphology and morphometry. This seems to be the first report of Capillaria sp. in sheep livers in Brazil, and it serves as an important alert regarding animal health surveillance and control and regarding the Capillaria sp. zoonotic role in humans.

  15. Artérias e veias placentárias em ovinos deslanados sem raça definida (Ovis aries, L. 1758

    Directory of Open Access Journals (Sweden)

    Janicleide Maria de Almeida

    2000-01-01

    Full Text Available O suprimento sangüíneo da placenta de 30 ovelhas deslanadas sem raça definida foi estudado mediante análise de peças obtidas através de injeção vascular com Látex Neoprene 650 corado. Constataram-se no material casos de gestações únicas (53,3%, gemelares (46,7% e trigemelares (3,3%. Em todos os casos analisados, observaram-se 4 vasos umbilicais (2 artérias e 2 veias além do ducto alantóide, na constituição do funículo umbilical. Em apenas 1 caso (gestação trigemelar, as duas artérias umbilicais de um dos fetos fundiram-se na porção média do funículo umbilical, e neste caso integrava apenas uma veia umbilical. A área placentária hilar variava de 2,0 a 6,0 centímetros dependendo da fase de gestação. O número médio de placentônios por gestação foi igual a 96, com tamanhos e formas bastante diversificados, sendo que aqueles maiores que 1,5 centímetro eram predominantes, assim como aqueles de formato ovóide. Os placentônios eram irrigados e drenados por uma série diversificada de artérias e veias, constituindo arranjos arteriocotiledonários e venocotiledonários, perfazendo um total de 299 e 314 arranjos respectivamente.

  16. Expression of adenosine 5'-monophosphate-Activated protein kinase (AMPK) in ovine testis (Ovis aries): In vivo regulation by nutritional state.

    Science.gov (United States)

    Taibi, N; Dupont, J; Bouguermouh, Z; Froment, P; Ramé, C; Anane, A; Amirat, Z; Khammar, F

    2017-03-01

    In the present study, we identified AMPK and investigated its potential role in steroidogenesis in vivo in the ovine testis in response to variation in nutritional status (fed control vs. restricted). We performed immunoblotting to show that both active and non-active forms of AMPK exist in ovine testis and liver. In testis, we confirmed these results by immunohistochemistry. We found a correlation between ATP (Adenosine-Triphosphate) levels and the expression of AMPK in liver. Also, low and high caloric diets induce isoform-dependent AMPK expression, with an increase in α2, ß1ß2 and γ1 activity levels. Although the restricted group exhibited an increase in lipid balance, only the triglyceride and HC-VLDL (Cholesterol-Very low density lipoprotein) fractions showed significant differences between groups, suggesting an adaptive mechanism. Moreover, the relatively low rate of non-esterified fatty acid released into the circulation implies re-esterification to compensate for the physiological need. In the fed control group, AMPK activates the production of testosterone in Leydig cells; this is, in turn, associated with an increase in the expression of 3ß-HSD (3 beta hydroxy steroid deshydrogenase), p450scc (Cholesterol side-chain cleavage enzyme) and StAR (Steroidogenic acute regulatory protein) proteins induced by decreased MAPK ERK½ (Extracellular signal-regulated kinase -Mitogen-activated protein kinase) phosphorylation. In contrast, in the restricted group, testosterone secretion was reduced but intracellular cholesterol concentration was not. Furthermore, the combination of high levels of lipoproteins and emergence of the p38 MAP kinase pathway suggest the involvement of pro-inflammatory cytokines, as confirmed by transcriptional repression of the StAR protein. Taken together, these results suggest that AMPK expression is tissue dependent. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Choosing sheep (Ovis aries) as animal model for temporomandibular joint research: Morphological, histological and biomechanical characterization of the joint disc.

    Science.gov (United States)

    Angelo, D F; Morouço, P; Alves, N; Viana, T; Santos, F; González, R; Monje, F; Macias, D; Carrapiço, B; Sousa, R; Cavaco-Gonçalves, S; Salvado, F; Peleteiro, C; Pinho, M

    2016-12-01

    Preclinical trials are essential to the development of scientific technologies. Remarkable molecular and cellular research has been done using small animal models. However, significant differences exist regarding the articular behavior between these models and humans. Thus, large animal models may be more appropriate to perform trials involving the temporomandibular joint (TMJ). The aim of this work was to make a morphological (anatomic dissection and white light 3D scanning system), histological (TMJ in bloc was removed for histologic analysis) and biomechanical characterization (tension and compression tests) of sheep TMJ comparing the obtained results with human data. Results showed that sheep processus condylaris and fossa mandibularis are anatomically similar to the same human structures. TMJ disc has an elliptical perimeter, thinner in the center than in periphery. Peripheral area acts as a ring structure supporting the central zone. The disc cells display both fibroblast and chondrocyte-like morphology. Marginal area is formed by loose connective tissue, with some chondrocyte-like cells and collagen fibers in diverse orientations. Discs obtained a tensile modulus of 3.97±0.73MPa and 9.39±1.67MPa, for anteroposterior and mediolateral assessment. The TMJ discs presented a compressive modulus (E) of 446.41±5.16MPa and their maximum stress value (σmax) was 18.87±1.33MPa. Obtained results suggest that these animals should be considered as a prime model for TMJ research and procedural training. Further investigations in the field of oromaxillofacial surgery involving TMJ should consider sheep as a good animal model due to its resemblance of the same joint in humans. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  18. Energy conversion options for ARIES-III - A conceptual D-3He tokamak reactor

    International Nuclear Information System (INIS)

    Santarius, J.F.; Blanchard, J.P.; Emmert, G.A.; Sviatoslavsky, I.N.; Wittenberg, L.J.; Ghoneim, N.M.; Hasan, M.Z.; Mau, T.K.; Greenspan, E.; Herring, J.S.; Kernbichler, W.; Klein, A.C.; Miley, G.H.; Miller, R.L.; Peng, Y.K.M.

    1989-01-01

    The potential for highly efficient conversion of fusion power to electricity provides one motivation for investigating D- 3 He fusion reactors. This stems from: (1) the large fraction of D- 3 He power produced in the forms of charged particles and synchrotron radiation which are amenable to direct conversion, and (2) the low neutron fluence and lack of tritium breeding constraints, which increase design flexibility. The design team for a conceptual D- 3 He tokamak reactor, ARIES-III, has investigated numerous energy conversion options at a scoping level in attempting to realize high efficiency. The energy conversion systems have been studied in the context of their use on one or more of three versions of a D- 3 He tokamak: a first stability regime device, a second stability regime device, and a spherical torus. The set of energy conversion options investigated includes bootstrap current conversion, compression-expansion cycles, direct electrodynamic conversion, electrostatic direct conversion, internal electric generator, liquid metal heat engine blanket, liquid metal MHD, plasma MHD, radiation boiler, scrape-off layer thermoelectric, synchrotron radiation conversion by rectennas, synchrotron radiation conversion by thermal cycles, thermionic/AMTEC/thermal systems, and traveling wave conversion. The original set of options is briefly discussed, and those selected for further study are described in more detail. The four selected are liquid metal MHD, plasma MHD, rectenna conversion, and direct electrodynamic conversion. Thermionic energy conversion is being considered, and some options may require a thermal cycle in parallel or series. 17 refs., 3 figs., 1 tab

  19. Construction of 3.6m ARIES telescope enclosure with eccentric pier at Devasthal, Nainital

    Science.gov (United States)

    Bangia, Tarun

    Space optimized enclosure with eccentric pier for 3.6m ARIES telescope presents construction challenges at the unique observing site of Devasthal, Nainital, India. Enclosure comprises of about 16.5m diameter and 14m high insulated steel framed cylindrical dome rotating on a 14m high stationery dome supporting structure and a 24m × 12m extension structure building for accommodating aluminizing plant and ventilation system etc. Great deal of manual and mechanical excavation was carried out at the rocky site using rock breaking and JCB machines. Foundation bolts for columns of dome supporting structure and extension structure building were grouted after alignment with total station. A 7m diameter hollow cylindrical pier isolated from other structures and 1.85m eccentric with dome center designed due to space limitation at site is being casted for mounting 150 MT mass of the largest 3.6m telescope in the country. A 7m diameter template was fabricated for 3.6m pier top. Most of enclosure components are manufactured and tested in works before assembly/erection at site. Dome drive was tested with dummy loads using VVVF drive with 6 drive and 12 idler wheel assemblies at works to simulate dome weight and smooth operation before erection at site. A 4.2m wide motorized windscreen is being manufactured with a special grade synthetic fabric to withstand wind speed up to 15m/s.

  20. Direct enzyme assay evidence confirms aldehyde reductase function of Ydr541cp and Ygl039wp from Saccharomyces cerevisiae.

    Science.gov (United States)

    Moon, Jaewoong; Liu, Z Lewis

    2015-04-01

    The aldehyde reductase gene ARI1 is a recently characterized member of an intermediate subfamily within the short-chain dehydrogenase/reductase (SDR) superfamily that clarified mechanisms of in situ detoxification of 2-furaldehyde and 5-hydroxymethyl-2-furaldehyde by Saccharomyces cerevisiae. Uncharacterized open reading frames (ORFs) are common among tolerant candidate genes identified for lignocellulose-to-advanced biofuels conversion. This study presents partially purified proteins of two ORFs, YDR541C and YGL039W, and direct enzyme assay evidence against aldehyde-inhibitory compounds commonly encountered during lignocellulosic biomass fermentation processes. Each of the partially purified proteins encoded by these ORFs showed a molecular mass of approximately 38 kDa, similar to Ari1p, a protein encoded by aldehyde reductase gene. Both proteins demonstrated strong aldehyde reduction activities toward 14 aldehyde substrates, with high levels of reduction activity for Ydr541cp toward both aromatic and aliphatic aldehydes. While Ydr541cp was observed to have a significantly higher specific enzyme activity at 20 U/mg using co-factor NADPH, Ygl039wp displayed a NADH preference at 25 U/mg in reduction of butylaldehyde. Amino acid sequence analysis identified a characteristic catalytic triad, Ser, Tyr and Lys; a conserved catalytic motif of Tyr-X-X-X-Lys; and a cofactor-binding sequence motif, Gly-X-X-Gly-X-X-Ala, near the N-terminus that are shared by Ydr541cp, Ygl039wp, Yol151wp/GRE2 and Ari1p. Findings of aldehyde reductase genes contribute to the yeast gene annotation and aids development of the next-generation biocatalyst for advanced biofuels production. Copyright © 2015 John Wiley & Sons, Ltd.

  1. Capacitação Técnica e Competitividade na Petroquímica Brasileira nos anos 1990: O Caso de Camaçari - BA

    Directory of Open Access Journals (Sweden)

    José Manoel Carvalho de Mello

    2003-01-01

    Full Text Available O artigo enfoca e avalia a importância da capacitação tecnológica na estratégia de empresas petroquímicas selecionadas do pólo de Camaçari, na Bahia. Para tanto analisa as variáveis P&D e qualificação profissional na estratégia para a competitividade dessas empresas nos anos 1990, após a abertura comercial e a reestruturação patrimonial, através de dados secundários e de uma pesquisa de campo com entrevistas abertas. Concluiu-se que os investimentos feitos em P&D e na qualificação profissional apresentam-se tímidos, destinando-se principalmente para inovações incrementais. No entanto, é possível inferir que há um certo esforço em capacitação tecnológica por parte da maioria das empresas pesquisadas, principalmente as empresas produtoras de petroquímicos finais, embora seja necessário vencer muitos desafios em relação à eficiência produtiva, rentabilidade e competitividade no mercado interno e externo.This paper focuses and evaluates the role of technological learning in the strategy of petrochemical firms operating in Brazil at the Petrochemical Pole of Camaçari, Bahia. In such attempt this paper analizes the role of R&D activities and professional qualification investments in the overall strategy of those firms in the 1990s. The data analyzed in the paper results from a research of secondary data bases and from interviews accomplished in 2002 with a selected number of firms. In short, R&D as well as professional qualification investments by those firms are quite low and are oriented mainly to minor modifications. Last, although the role of the efforts in technological capabilities observed in the interviewed firms cannot be underestimated, there are still many challenges in relation to efficiency, profitability and competitiveness at the national and international markets.

  2. LOOP CALCULUS AND BELIEF PROPAGATION FOR Q-ARY ALPHABET: LOOP TOWER

    Energy Technology Data Exchange (ETDEWEB)

    CHERTKOV, MICHAEL [Los Alamos National Laboratory; CHERNYAK, VLADIMIR [Los Alamos National Laboratory

    2007-01-10

    Loop calculus introduced in [1], [2] constitutes a new theoretical tool that explicitly expresses symbol Maximum-A-Posteriori (MAP) solution of a general statistical inference problem via a solution of the Belief Propagation (BP) equations. This finding brought a new significance to the BP concept, which in the past was thought of as just a loop-free approximation. In this paper they continue a discussion of the Loop Calculus, partitioning the results into three Sections. In Section 1 they introduce a new formulation of the Loop Calculus in terms of a set of transformations (gauges) that keeping the partition function of the problem invariant. The full expression contains two terms referred to as the 'ground state' and 'excited states' contributions. The BP equations are interpreted as a special (BP) gauge fixing condition that emerges as a special orthogonality constraint between the ground state and excited states, which also selects loop contributions as the only surviving ones among the excited states. In Section 2 they demonstrate how the invariant interpretation of the Loop Calculus, introduced in Section 1, allows a natural extension to the case of a general q-ary alphabet, this is achieved via a loop tower sequential construction. The ground level in the tower is exactly equivalent to assigning one color (out of q available) to the 'ground state' and considering all 'excited' states colored in the remaining (q-1) colors, according to the loop calculus rule. Sequentially, the second level in the tower corresponds to selecting a loop from the previous step, colored in (q-1) colors, and repeating the same ground vs excited states splitting procedure into one and (q-2) colors respectively. The construction proceeds till the full (q-1)-levels deep loop tower (and the corresponding contributions to the partition function) are established. In Section 3 they discuss an ultimate relation between the loop calculus and the Bethe

  3. Physical mapping of 20 unmapped fragments of the btau_4.0 genome assembly in cattle, sheep and river buffalo.

    Science.gov (United States)

    De Lorenzi, L; Genualdo, V; Perucatti, A; Iannuzzi, A; Iannuzzi, L; Parma, P

    2013-01-01

    The recent advances in sequencing technology and bioinformatics have revolutionized genomic research, making the decoding of the genome an easier task. Genome sequences are currently available for many species, including cattle, sheep and river buffalo. The available reference genomes are very accurate, and they represent the best possible order of loci at this time. In cattle, despite the great accuracy achieved, a part of the genome has been sequenced but not yet assembled: these genome fragments are called unmapped fragments. In the present study, 20 unmapped fragments belonging to the Btau_4.0 reference genome have been mapped by FISH in cattle (Bos taurus, 2n = 60), sheep (Ovis aries, 2n = 54) and river buffalo (Bubalus bubalis, 2n = 50). Our results confirm the accuracy of the available reference genome, though there are some discrepancies between the expected localization and the observed localization. Moreover, the available data in the literature regarding genomic homologies between cattle, sheep and river buffalo are confirmed. Finally, the results presented here suggest that FISH was, and still is, a useful technology to validate the data produced by genome sequencing programs. Copyright © 2013 S. Karger AG, Basel.

  4. Diet, dietary selectivity and density of South American grey fox, Lycalopex griseus, in Central Chile.

    Science.gov (United States)

    Muñoz-Pedreros, Andrés; Yáñez, José; Norambuena, Heraldo V; Zúñiga, Alfredo

    2018-01-01

    The South American grey fox Lycalopex griseus is a canid widely distributed in southern South America; however, some aspects of its biology are still poorly known. We studied the diet and density of L. griseus in the Lago Peñuelas Biosphere Reserve, in Central Chile. The trophic niche breadth was B = 6.16 (B sta = 0.47) and prey diversity was H' = 2.46 (H max ' = 3.17, J' = 0.78). The highest proportions of prey consumed in the diet were Oryctolagus cuniculus (52.21%) and other mammals (32.78%). We compared these results with a latitudinal gradient of diet results for this species in Chile. L. griseus eats mostly mammals (>90% of total prey), consuming the rodent Phyllotis darwini and reptiles in the northern zone; Oryctolagus cuniculus, Octodon degus and Abrocoma bennetti in the central zone; Abrothrix spp. and lagomorphs in the southern zone; and Lepus capensis and Ovis aries in the austral zone. The estimated density of L. griseus in Lago Peñuelas NR was 1.3 foxes/km 2 . © 2017 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

  5. Mapping whole genome shotgun sequence and variant calling in mammalian species without their reference genomes [v2; ref status: indexed, http://f1000r.es/2x3

    Directory of Open Access Journals (Sweden)

    Ted Kalbfleisch

    2014-02-01

    Full Text Available Genomics research in mammals has produced reference genome sequences that are essential for identifying variation associated with disease.  High quality reference genome sequences are now available for humans, model species, and economically important agricultural animals.  Comparisons between these species have provided unique insights into mammalian gene function.  However, the number of species with reference genomes is small compared to those needed for studying molecular evolutionary relationships in the tree of life.  For example, among the even-toed ungulates there are approximately 300 species whose phylogenetic relationships have been calculated in the 10k trees project.  Only six of these have reference genomes:  cattle, swine, sheep, goat, water buffalo, and bison.  Although reference sequences will eventually be developed for additional hoof stock, the resources in terms of time, money, infrastructure and expertise required to develop a quality reference genome may be unattainable for most species for at least another decade.  In this work we mapped 35 Gb of next generation sequence data of a Katahdin sheep to its own species’ reference genome (Ovis aries Oar3.1 and to that of a species that diverged 15 to 30 million years ago (Bos taurus UMD3.1.  In total, 56% of reads covered 76% of UMD3.1 to an average depth of 6.8 reads per site, 83 million variants were identified, of which 78 million were homozygous and likely represent interspecies nucleotide differences. Excluding repeat regions and sex chromosomes, nearly 3.7 million heterozygous sites were identified in this animal vs. bovine UMD3.1, representing polymorphisms occurring in sheep.  Of these, 41% could be readily mapped to orthologous positions in ovine Oar3.1 with 80% corroborated as heterozygous.  These variant sites, identified via interspecies mapping could be used for comparative genomics, disease association studies, and ultimately to understand

  6. An examination of melanogenic traits and TYRP1 polymorphism in Nanping and Romney Marsh sheep breeds

    Directory of Open Access Journals (Sweden)

    G. Li

    2018-03-01

    Full Text Available The effects of mutations of the gene for tyrosinase-related protein 1 (TYRP1 on the black muscles and coat color in Nanping black-boned sheep were investigated. Tyrosinase activity and melanin content in plasma were measured and compared in three random groups of sheep: Nanping black-boned (101 heads, Nanping normal (106 heads and Romney Marsh sheep (82 heads, Ovis aries. Eight exons and their partial flanking regions of the TYRP1 gene were amplified. Six intronic mutations and six exonic polymorphisms including two non-synonymous mutations [c.203C  >  T (p.A68V and c.1202T  >  C (p.V401A] were identified. Using a bi-directional polymerase chain reaction allele-specific amplification (bi-PASA of the mutation c.203C  >  T it was shown that the frequencies of allele C in the Nanping black-boned, Nanping normal and Romney Marsh sheep were respectively 0.955, 0.967 and 0.744. For the mutation c.1202T  >  C, the frequencies of allele T in the three populations of sheep were respectively 0.777, 0.745 and 0.793 as measured using the single-strand conformation polymorphism. When the data from sheep of all three populations with the CC genotype of SNP c.203C  >  T were pooled, it was found that there was significantly higher (P  <  0.05 tyrosinase activity, content of alkali-soluble melanin and ratio of eumelanin : total melanin than in the plasma of sheep with the CT and TT genotypes. This was not so within each of the three groups of sheep. No significant effect of the TRYP1 genotype on coat color was found. Further studies will be necessary to determine the cause of the black traits in Nanping black-boned sheep.

  7. Molecular and phylogenetic analysis of Anaplasma spp. in sheep and goats from six provinces of China.

    Science.gov (United States)

    Zhang, Yan; Lv, Yali; Zhang, Feifei; Zhang, Wenjing; Wang, Jinhong; Cui, Yanyan; Wang, Rongjun; Jian, Fuchun; Zhang, Longxian; Ning, Changshen

    2016-12-30

    Members of the genus Anaplasma are important emerging tick-borne pathogens in both humans and animals in tropical and subtropical areas. Here, we investigated the presence of Anaplasma spp. in 621 sheep and 710 goats from six provinces of China. Polymerase chain reaction (PCR) and DNA sequencing were conducted to determine the prevalence of Anaplasma (A.) phagocytophilum, A. ovis and A. bovis targeting the 16S ribosomal RNA or the major surface protein 4 gene. PCR revealed Anaplasma in 39.0% (240/621) of sheep and 45.5% (323/710) of goats. The most frequently detected species was A. ovis (88/621, 14.2% for sheep; 129/710, 18.2% for goats), followed by A. bovis (60/621, 9.7% for sheep; 74/710, 10.4% for goats) and A. phagocytophilum (33/621, 5.3% for sheep; 15/710, 2.1% for goats). Additionally, eight sheep and 20 goats were found to be infected with three pathogens simultaneously. DNA sequencing confirmed the presence of these three Anaplasma species in the investigated areas, and phylogenetic analysis indicated that there was geographic segregation to a certain extent, as well as a relationship between the host and cluster of A. ovis. The results of the present study provide valuable data that helps understand the epidemiology of anaplasmosis in ruminants from China.

  8. Molecular identification of Theileria and Babesia in sheep and goats in the Black Sea Region in Turkey.

    Science.gov (United States)

    Aydin, Mehmet Fatih; Aktas, Munir; Dumanli, Nazir

    2013-08-01

    This study was carried out to investigate presence and distribution of Theileria and Babesia species via microscopic examination and reverse line blotting (RLB) techniques in sheep and goats in the Black Sea region of Turkey. For this purpose, 1,128 blood samples (869 sheep and 259 goats) were collected by active surveillance from sheep and goats in different provinces of various cities in the region in the years 2010 and 2011. Smears were prepared from the blood samples, stained with Giemsa, and examined under the light microscope for Theileria and Babesia piroplasms. The genomic DNAs were extracted from blood samples. The length of 360-430-bp fragment in the variable V4 region of 18S SSU rRNA gene of Theileria and Babesia species was amplified using the gDNAs. The polymerase chain reaction products were hybridized to the membrane-connected species-specific probes. A total of 38 animals (3.37%) including 34 sheep (3.91%) and 4 goats (1.54%) were found to be positive for Theileria spp. piroplasms in microscopic examination of smears while Babesia spp. piroplasm could not detected. Infection rates were 34.64% in sheep, 10.04% in goats, and totally 28.99% for Theileria ovis while 0.58% in sheep and totally 0.44% for Babesia ovis. However, Theileria sp. OT3 was detected in 2.65% of sheep and 2.04% of all animals; besides Theileria sp., MK had 0.58% prevalence in sheep and 0.77% in goats, with a total 0.62% with RLB. Although T. ovis and Theileria sp. MK were determined in both sheep and goats, B. ovis and Theileria sp. OT3 were observed only in the sheep. These results provide the first detailed molecular data for sheep and goat theileriosis and babesiosis in the region.

  9. Darwinian pluralism and the multilevel selection debate

    Indian Academy of Sciences (India)

    2014-03-15

    Mar 15, 2014 ... replicate like genes and do not reproduce like organisms. But. (2) is not the point ... ary 'unit' remains the whole genetic code of the individual, the ..... ciality) and then converted for other functions in modified. 'social niches' ...

  10. Direct enzyme assay evidence confirms aldehyde reductase function of Ydr541cp and Ygl039wp from Saccharomyces cerevisiae

    Science.gov (United States)

    Aldehyde reductase gene ARI1 is a recently characterized member of intermediate subfamily under SDR (short-chain dehydrogenase/reductase) superfamily that revealed mechanisms of in situ detoxification of furfural and HMF for tolerance of Saccharomyces cerevisiae. Uncharacterized open reading frames ...

  11. TAFONOMÍA DE RESTOS ÓSEOS PROVENIENTES DE EGAGRÓPILAS DE CORAGYPS ATRATUS (JOTE DE CABEZA NEGRA EN EL NOROESTE DE LA PATAGONIA ARGENTINA/Taphonomy of bones remains from pellets of Coragyps Atratus (black vulture in the northwest of the argentinian Patag

    Directory of Open Access Journals (Sweden)

    Fernando Ballejo

    2012-11-01

    Full Text Available Existen diversos estudios actualísticos en tafonomía sobre restos de presas de diferentes especies de aves raptoras. Sin embargo, este tipo de trabajos en aves carroñeras ha sido escasamente considerado hasta el momento en Argentina, a pesar que ellas cumplen un papel fundamental en la alteración y transporte de cadáveres. Coragyps atratus (jote de cabeza negra tiene la particularidad de formar posaderos comunales cercanos a áreas de actividades humanas y de alimentarse de animales de todos los tamaños, por lo que pueden interferir en la formación de sitios arqueológicos. El objetivo de este trabajo es realizar un análisis tafonómico sobre los restos óseos recuperados de egagrópilas de C. atratus en el Noroeste patagónico, con el fin de generar herramientas que permitan identificar a estas aves como posibles agentes acumuladores. Se recolectaron 469 egagrópilas distribuidas en tres posaderos del Noroeste patagónico. Se identificaron los elementos recuperados y se evaluaron los grados de alteraciones por ácidos gástricos. Lepus europaeus y Ovis aries dominaron las muestras. Los elementos más representativos pertenecen al autopodio, principalmente falanges. Todos ellos muestran signos de digestión, que van desde porosidades superficiales, perforaciones y fracturas, con la desaparición de la médula en el caso de varias falanges; denotando diferencias en relación al tamaño de la presa consumida. Abstract There are several actualistic taphonomic studies regarding different species of birds of prey. However, the studies focus on scavenger birds have been scarcely considered in Argentina, despite the fact that they play a fundamental role in the alteration and transportation of carcasses. A peculiar characteristic of Coragyps atratus (black vulture is that it builds communal roosts near places where human activities are developed and it feeds on animals of varying size, which may interfere with the formation of archaeological

  12. Energy, water and space use by free-living red kangaroos Macropus rufus and domestic sheep Ovis aries in an Australian rangeland.

    Science.gov (United States)

    Munn, A J; Dawson, T J; McLeod, S R; Dennis, T; Maloney, S K

    2013-08-01

    We used doubly labelled water to measure field metabolic rates (FMR) and water turnover rates (WTR) in one of Australia's largest native herbivores, the red kangaroo (Macropus rufus) and one of Australia's dominant livestock species, the wool-breed Merino sheep, under free-living conditions in a typical Australian rangeland. Also, we used GPS technology to examine animal space use, along with the comparisons of urine concentration, diet, diet digestibility, and subsequent grazing pressures. We found smaller space-use patterns than previously reported for kangaroos, which were between 14 and 25 % those of sheep. The FMR of a 25-kg kangaroo was 30 % that of a 45-kg sheep, while WTR was 15 % and both were associated with smaller travel distances, lower salt intakes, and higher urine concentration in kangaroos than sheep. After accounting for differences in dry matter digestibility of food eaten by kangaroos (51 %) and sheep (58 %), the relative grazing pressure of a standard (mature, non-reproductive) 25-kg kangaroo was 35 % that of a 45-kg sheep. Even for animals of the same body mass (35 kg), the relative grazing pressure of the kangaroo was estimated to be only 44 % that of the sheep. After accounting for the energetic costs of wool growth by sheep, the FMRs of our sheep and kangaroos were 2-3 times their expected BMRs, which is typical for mammalian FMR:BMRs generally. Notably, data collected from our free-living animals were practically identical to those from animals confined to a semi-natural enclosure (collected in an earlier study under comparable environmental conditions), supporting the idea that FMRs are relatively constrained within species.

  13. Assessing Timing and Causes of Neonatal Lamb Losses in a Bighorn Sheep ( Ovis canadensis canadensis ) Herd via Use of Vaginal Implant Transmitters.

    Science.gov (United States)

    Grigg, Jamin L; Wolfe, Lisa L; Fox, Karen A; Killion, Halcyon J; Jennings-Gaines, Jessica; Miller, Michael W; P Dreher, Brian

    2017-07-01

    We evaluated the use of vaginal implant transmitters (VITs) as a means of detecting, capturing, and radio collaring Rocky Mountain bighorn sheep ( Ovis canadensis canadensis) lambs to estimate survival and to facilitate carcass recovery to assess causes of mortality. We focused on one of several bighorn herds in Colorado, US, suffering from depressed recruitment that was not preceded by a classic all-age die-off. We captured, radio-collared, diagnosed pregnancy by ultrasound examination, and inserted VITs into 15 pregnant ewes from a herd residing near Granite, Colorado. We were subsequently able to collar a lamb from each of 13 VITs, and two additional lambs opportunistically from ewes without transmitters. As lambs died, we recovered and submitted carcasses for necropsy and laboratory assessment. All lambs captured and one additional lamb (carcass found opportunistically) were dead by about 130 d of age: 11 died of apparent pneumonia (all within 8-10 wk of age), one died from trauma after being kicked or trampled, one was killed by a mountain lion ( Puma concolor ), and three died of starvation likely caused by abandonment after capture. Pneumonic lambs had involvement of Mycoplasma ovipneumoniae and leukotoxigenic Bibersteinia trehalosi . The use of VITs and lamb collars enabled us to efficiently identify pneumonia as the predominant cause of depressed lamb recruitment in this herd; however, we urge care in neonatal lamb handling to minimize abandonment.

  14. Evidence of Zika Virus RNA Fragments in Aedes albopictus (Diptera: Culicidae) Field-Collected Eggs From Camaçari, Bahia, Brazil.

    Science.gov (United States)

    Smartt, Chelsea T; Stenn, Tanise M S; Chen, Tse-Yu; Teixeira, Maria Gloria; Queiroz, Erivaldo P; Souza Dos Santos, Luciano; Queiroz, Gabriel A N; Ribeiro Souza, Kathleen; Kalabric Silva, Luciano; Shin, Dongyoung; Tabachnick, Walter J

    2017-07-01

    A major mosquito-borne viral disease outbreak caused by Zika virus (ZIKV) occurred in Bahia, Brazil, in 2015, largely due to transmission by the mosquito, Aedes aegypti (L.). Detecting ZIKV in field samples of Ae. aegypti has proven problematic in some locations, suggesting other mosquito species might be contributing to the spread of ZIKV. In this study, several (five) adult Aedes albopictus (Skuse) mosquitoes that emerged from a 2015 field collection of eggs from Camaçari, Bahia, Brazil, were positive for ZIKV RNA; however, attempts to isolate live virus were not successful. Results from this study suggest that field-collected Ae. albopictus eggs may contain ZIKV RNA that require further tests for infectious ZIKV. There is a need to investigate the role of Ae. albopictus in the ZIKV infection process in Brazil and to study the potential presence of vertical and sexual transmission of ZIKV in this species. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Mechanisms Involved in Acquisition of blaNDM Genes by IncA/C2 and IncFIIY Plasmids.

    Science.gov (United States)

    Wailan, Alexander M; Sidjabat, Hanna E; Yam, Wan Keat; Alikhan, Nabil-Fareed; Petty, Nicola K; Sartor, Anna L; Williamson, Deborah A; Forde, Brian M; Schembri, Mark A; Beatson, Scott A; Paterson, David L; Walsh, Timothy R; Partridge, Sally R

    2016-07-01

    blaNDM genes confer carbapenem resistance and have been identified on transferable plasmids belonging to different incompatibility (Inc) groups. Here we present the complete sequences of four plasmids carrying a blaNDM gene, pKP1-NDM-1, pEC2-NDM-3, pECL3-NDM-1, and pEC4-NDM-6, from four clinical samples originating from four different patients. Different plasmids carry segments that align to different parts of the blaNDM region found on Acinetobacter plasmids. pKP1-NDM-1 and pEC2-NDM-3, from Klebsiella pneumoniae and Escherichia coli, respectively, were identified as type 1 IncA/C2 plasmids with almost identical backbones. Different regions carrying blaNDM are inserted in different locations in the antibiotic resistance island known as ARI-A, and ISCR1 may have been involved in the acquisition of blaNDM-3 by pEC2-NDM-3. pECL3-NDM-1 and pEC4-NDM-6, from Enterobacter cloacae and E. coli, respectively, have similar IncFIIY backbones, but different regions carrying blaNDM are found in different locations. Tn3-derived inverted-repeat transposable elements (TIME) appear to have been involved in the acquisition of blaNDM-6 by pEC4-NDM-6 and the rmtC 16S rRNA methylase gene by IncFIIY plasmids. Characterization of these plasmids further demonstrates that even very closely related plasmids may have acquired blaNDM genes by different mechanisms. These findings also illustrate the complex relationships between antimicrobial resistance genes, transposable elements, and plasmids and provide insights into the possible routes for transmission of blaNDM genes among species of the Enterobacteriaceae family. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  16. Identification and disruption of bacteria associated with sheep scab mites-novel means of control?

    Science.gov (United States)

    Hall, S A; Mack, K; Blackwell, A; Evans, K A

    2015-10-01

    Psoroptes ovis mites, which cause psoroptic mange (sheep scab), were investigated to identify potential bacterial targets for endosymbiont control of sheep scab. In addition, transmission of bacteria to the sheep skin was investigated through the characterisation of bacteria present in P. ovis faecal trails and on the fleece environment by internal transcribed spacer (ITS) sequencing. A diverse range of bacteria was identified in addition to a potential endosymbiont candidate, Comamonas sp, which was detected in P. ovis by both ITS PCR and endosymbiont-specific PCR. Disruption of these bacteria within P. ovis, through the use of antibiotics, was explored; with significant reduction in mean mite survival when administered antibiotic diets compared with controls (LR4 = 23.12, P bacteria associated with P. ovis should be further investigated for novel control. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Infusion of Trx-1-overexpressing hucMSC prolongs the survival of acutely irradiated NOD/SCID mice by decreasing excessive inflammatory injury.

    Science.gov (United States)

    Hu, JiangWei; Yang, ZaiLiang; Wang, Jun; Tang, YongYong; Liu, Hao; Zhang, Bin; Chen, Hu

    2013-01-01

    A protective reagent for ARI should have the ability to repair injured tissue caused by radiation and prevent continuous damage from secondary risk factors. Trx-1 was explored as a candidate therapy for ARI, as it scavenges reactive oxygen species, regulates cell growth and differentiation, participates in immune reactions, and inhibits apoptosis by acting inside and/or outside cells. Trx-1 can also decrease excessive inflammation in ARI by regulating the creation of inflamed media, by inhibiting the activation of complement, and by reducing the chemotaxis, adhesion, and migration of inflammatory cells. As effectively and stably expressing exogenous genes in the long term and regulating immune inflammation and tissue repair, MSC are a good choice for Trx-1 gene therapy. In this study, Trx-1-overexpressing hucMSC-Trx-1 were obtained by adenoviral vector-mediated infection. We first measured the redox capacity of hucMSC-Trx-1 with an antioxidant capacity (T-AOC) assay, a hydrogen peroxide (H2O2) content determination assay in vivo, a H2O2-induced oxidation hemolysis assay, and a lipid peroxidation assay in vitro. Then, we measured survival time, the protection of the hematopoietic system, and the regulation of inflammation in important organs in three treatment groups of NOD/SCID mice (treated with hucMSC-Trx-1, with hucMSC, and with saline) that were exposed to 4.5 Gy (60)Co-γ-ray radiation. The hucMSC-Trx-1 group achieved superior antioxidation results, protecting bone marrow hematopoietic stem cells (Lin(-)CD117(+): hucMSC-Trx-1 vs. hucMSC, PTrx-1 vs. NS, PTrx-1 vs. hucMSC or NS, PTrx-1 vs. NS, PTrx-1 vs. hucMSC, PTrx-1 vs. NS, PTrx-1 vs. hucMSC, PTrx-1 vs. hucMSC or NS, PTrx-1 combines the merits of gene and cell therapy as a multifunctional radioprotector for ARI.

  18. Florística em um hectare de cerrado stricto sensu na ARIE - cerrado Pé-de-Gigante, Santa Rita do Passa Quatro, SP

    Directory of Open Access Journals (Sweden)

    Weiser Veridiana de Lara

    2001-01-01

    Full Text Available Foi realizado um levantamento florístico em um ha de cerrado stricto sensu, na parte norte da ARIE - Cerrado Pé-de-Gigante, Santa Rita do Passa Quatro, São Paulo. Foram coletados 428 espécimes em fase reprodutiva, em vinte e cinco excursões de coleta, durante o período de novembro de 1996 a abril de 1998. A listagem florística obtida apresenta 141 espécies, distribuídas em 109 gêneros e 49 famílias. As famílias mais representativas foram: Leguminosae, Asteraceae, Malpighiaceae e Myrtaceae. A floração e frutificação das espécies foram maiores no período chuvoso. Espécies zoocóricas (61 predominaram, seguidas pelas anemocóricas (46 e autocóricas (34. Analisou-se a flora como um todo e seus componentes herbáceo-subarbustivo e arbustivo-arbóreo, separadamente.

  19. The use of a Psoroptes ovis serodiagnostic test for the analysis of a natural outbreak of sheep scab

    Directory of Open Access Journals (Sweden)

    Burgess Stewart TG

    2012-01-01

    Full Text Available Abstract Background Sheep scab is a highly contagious disease of sheep caused by the ectoparasitic mite Psoroptes ovis. The disease is endemic in the UK and has significant economic impact through its effects on performance and welfare. Diagnosis of sheep scab is achieved through observation of clinical signs e.g. itching, pruritis and wool loss and ultimately through the detection of mites in skin scrapings. Early stages of infestation are often difficult to diagnose and sub-clinical animals can be a major factor in disease spread. The development of a diagnostic assay would enable farmers and veterinarians to detect disease at an early stage, reducing the risk of developing clinical disease and limiting spread. Methods Serum samples were obtained from an outbreak of sheep scab within an experimental flock (n = 480 (3 samples each from 160 sheep allowing the assessment, by ELISA of sheep scab specific antibody prior to infestation, mid-outbreak (combined with clinical assessment and post-treatment. Results Analysis of pre-infestation samples demonstrated low levels of potential false positives (3.8%. Of the 27 animals with clinical or behavioural signs of disease 25 tested positive at the mid-outbreak sampling period, however, the remaining 2 sheep tested positive at the subsequent sampling period. Clinical assessment revealed the absence of clinical or behavioural signs of disease in 132 sheep, whilst analysis of mid-outbreak samples showed that 105 of these clinically negative animals were serologically positive, representing potential sub-clinical infestations. Conclusions This study demonstrates that this ELISA test can effectively diagnose sheep scab in a natural outbreak of disease, and more importantly, highlights its ability to detect sub-clinically infested animals. This ELISA, employing a single recombinant antigen, represents a major step forward in the diagnosis of sheep scab and may prove to be critical in any future control

  20. Efficacy of a Parapoxvirus ovis-based immunomodulator against equine herpesvirus type 1 and Streptococcus equi equi infections in horses.

    Science.gov (United States)

    Ons, Ellen; Van Brussel, Leen; Lane, Stephen; King, Vickie; Cullinane, Ann; Kenna, Rachel; Lyons, Pamela; Hammond, Toni-Ann; Salt, Jeremy; Raue, Rudiger

    2014-10-10

    The efficacy of Zylexis®, an immunomodulator in horses based on inactivated Parapoxvirus ovis (iPPVO), was assessed using an equine herpesvirus type 1 (EHV-1) challenge model in the presence of a natural infection with Streptococcus equi equi (S. equi). Eleven horses were treated with iPPVO and twelve were kept as controls. Six horses were challenged with EHV-1 and commingled with the horses on study. Animals were dosed on Days -2, 0 (just before commingling) and Day 7. On Day 11 significantly less nasal discharge, enlarged lymph nodes, EHV-1 shedding and lower rectal temperatures were observed in the iPPVO-treated group. In addition, iPPVO-treated horses showed significantly fewer enlarged lymph nodes on Days 17 and 19, significantly less lower jaw swelling on Day 3 and significantly lower rectal temperatures on Days 12 and 13. Dyspnoea, depression and anorexia were only recorded for the control group. Following challenge seven out of 11 horses in the iPPVO treated group shed EHV-1 but on Days 11, 12, 13, 14, 15 and 16 quantitative virus detection in this group was significantly lower as compared to the controls. All animals shed S. equi but the percentage of animals with positive bacterial detection was lower in the iPPVO group than in the control group from Day 14 through Day 28. This difference was significant on Day 24. No injection site reactions or adverse events were observed. In conclusion, Zylexis administration is safe and reduced clinical signs and shedding related to both EHV-1 and S. equi infections. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Toward the ultimate goal of tritium self-sufficiency: Technical issues and requirements imposed on ARIES advanced power plants

    International Nuclear Information System (INIS)

    El-Guebaly, Laila A.; Malang, Siegfried

    2009-01-01

    Due to the lack of external tritium sources, all fusion power plants must demonstrate a closed tritium fuel cycle. The tritium breeding ratio (TBR) must exceed unity by a certain margin. The key question is: how large is this margin and how high should the calculated TBR be? The TBR requirement is design and breeder-dependent and evolves with time. At present, the ARIES requirement is 1.1 for the calculated overall TBR of LiPb systems. The Net TBR during plant operation could be around 1.01. The difference accounts for deficiencies in the design elements (nuclear data evaluation, neutronics code validation, and 3D modeling tools). Such a low Net TBR of 1.01 is potentially achievable in advanced designs employing advanced physics and technology. A dedicated R and D effort will reduce the difference between the calculated TBR and Net TBR. A generic breeding issue encountered in all fusion designs is whether any fusion design will over-breed or under-breed during plant operation. To achieve the required Net TBR with sufficient precision, an online control of tritium breeding is highly recommended for all fusion designs. This can easily be achieved for liquid breeders through online adjustment of Li enrichment.

  2. An individual-based modelling approach to estimate landscape connectivity for bighorn sheep (Ovis canadensis

    Directory of Open Access Journals (Sweden)

    Corrie H. Allen

    2016-05-01

    Full Text Available Background. Preserving connectivity, or the ability of a landscape to support species movement, is among the most commonly recommended strategies to reduce the negative effects of climate change and human land use development on species. Connectivity analyses have traditionally used a corridor-based approach and rely heavily on least cost path modeling and circuit theory to delineate corridors. Individual-based models are gaining popularity as a potentially more ecologically realistic method of estimating landscape connectivity. However, this remains a relatively unexplored approach. We sought to explore the utility of a simple, individual-based model as a land-use management support tool in identifying and implementing landscape connectivity. Methods. We created an individual-based model of bighorn sheep (Ovis canadensis that simulates a bighorn sheep traversing a landscape by following simple movement rules. The model was calibrated for bighorn sheep in the Okanagan Valley, British Columbia, Canada, a region containing isolated herds that are vital to conservation of the species in its northern range. Simulations were run to determine baseline connectivity between subpopulations in the study area. We then applied the model to explore two land management scenarios on simulated connectivity: restoring natural fire regimes and identifying appropriate sites for interventions that would increase road permeability for bighorn sheep. Results. This model suggests there are no continuous areas of good habitat between current subpopulations of sheep in the study area; however, a series of stepping-stones or circuitous routes could facilitate movement between subpopulations and into currently unoccupied, yet suitable, bighorn habitat. Restoring natural fire regimes or mimicking fire with prescribed burns and tree removal could considerably increase bighorn connectivity in this area. Moreover, several key road crossing sites that could benefit from

  3. Molecular evidence of a new Babesia sp. in goats.

    Science.gov (United States)

    Ozubek, Sezayi; Aktas, Munir

    2017-01-15

    In this study, a novel Babesia sp. infecting goats was detected and its phylogenetic relationship to related species was determined. A total of 200 blood samples collected from sheep (n=78) and goats (n=122) were examined in the study. The V4 hypervariable region of the 18S rRNA gene of the novel Babesia sp. was amplified by PCR and analysed using a reverse line blot hybridization assay adapted for small ruminants. Samples from seven goats hybridized to Theileria/Babesia catch-all and Babesia catch-all probes and did not hybridize to any species-specific probe tested, suggesting the presence of an unrecognized Babesia species or genotype. Sequencing results showed the isolate to clearly differ from ovine Babesia species and genotypes currently available in the GenBank database. The isolate showed 90.9%, 93.5%, and 93.4% identity to B. ovis, B. motasi, and B. crassa, respectively and 91-93% similarity to Babesia genotypes recently described in small ruminants. The highest homology (∼96-97%) observed was with Babesia odocoilei, Babesia sp. EU1, and Babesia divergens. The new isolate was provisionally designated Babesia sp. The study contributes to better insight into the distribution and phylogenetic diversity of piroplasms in small ruminants. The survey indicated a high prevalence of piroplasms in small ruminants (21.5%). Of those detected, T. ovis was the most prevalent (17%), followed by Babesia sp. (3.5%), and B. ovis (2%). Copyright © 2016 Elsevier B.V. All rights reserved.

  4. ORIGIN, HISTORY AND CURRENT SITUATION OF PELIBUEY SHEEP IN MEXICO

    Directory of Open Access Journals (Sweden)

    Cecilio Ubaldo Aguilar Martínez

    2017-12-01

    Full Text Available Domestic sheep (Ovis aries is descendant from Asian mouflon and was domesticated in the Near East. Later, sheep began its dissemination to West Africa, where it is believed that the ancestry of Pelibuey sheep came from. Pelibuey sheep were brought to America by the Spaniards to feed the crew of the boats. It is unclear whether these animals came directly from West Africa or from the Canary Islands. It is considered that Pelibuey sheep entered to Mexico between 1930 and 1940, although some authors think that this breed already existed in the country in the late nineteenth century. Since 1963, Pelibuey sheep has been the most studied breed in Mexico, due to its ability to produce in tropics, as well as its high adaptability to most agro-ecological zones of the country. A brief review about productive and reproductive traits in current Pelibuey herds, allowed to conclude that they are very similar to those of the first sheep studied almost 50 years ago. Currently, the breed has been subjected to  non-planned crosses with other breeds to increase productivity, which puts in risk this important genetic resource. Therefore, there is a need to realize the conservation of the breed.

  5. A rule of thumb in mammalian herbivores?

    Science.gov (United States)

    Augner; Provenza; Villalba

    1998-08-01

    In two experiments on appetitive learning we conditioned lambs, Ovis aries, to particular concentrations of a flavour by mixing the flavour with an energy-rich food that complemented their energy-poor diet. The lambs were subsequently offered energy-rich food with five different concentrations of the flavour (the concentration to which they were conditioned, two higher concentrations, and two lower concentrations). At these tests, the lambs consistently preferred the weaker flavours. This finding stands in contrast to earlier results on generalization gradients. In a third experiment, similarly designed to the other two, we tested for effects of a strong flavour on the behaviour of lambs when they were offered a novel nutritious food. Half of the lambs were offered unadulterated wheat, and the others strongly flavoured wheat. We found that the flavour in itself was initially aversive. We propose that the lambs' avoidance of foods with strong flavours may be an expression of a rule of thumb of the type 'given a choice, avoid food with strong flavours'. Such a rule could be part of a risk-averse foraging strategy displayed by mammalian herbivores, and which could be of particular importance when they encounter unfamiliar foods. Copyright 1998 The Association for the Study of Animal Behaviour

  6. Production of sheep anti triiodothyronine T3 antisera for development of T3 RIA kit

    International Nuclear Information System (INIS)

    Elsadig, M. G.; Abdalla, O. M.; Eltayed, E. A.

    2009-01-01

    This study was a trial to produce antisera against triiodothyronine T 3 . Small amounts of antibodies were detected due to a poor response of sheep to immunization. Consequently the amount of T 3 tracer bound by antibodies was found to be less than 10% with weak discrimination between zero and high standard doses in all bleeds which dose not satisfy radioimmunoassay (RIA) technique requirements. In this study, two local male Sudanese sheep (ovis aries) were immunized with T 3 -immuno gen intramuscularly and subcutaneously in different sites along their backs. Sheep (I) was immunized with 25μg of antigen per kg body weight in first and boosting injections, while the dose was only 10μg per kg body weight for sheep (II). T 3 -immunogen was emulsified in FCA for the first injection and in FIA for the boosting injections. The sera obtained from both sheep after each injection were subjected to evaluation for the levels of circulating anti T 3 antibodies through both qualitative and quantitative tests. The tests were performed for both purified and non-purified forms of antibodies with different separation techniques. Theses me methods include, precipitation by second antibody assisted by polyethylene glycol (PEG), polystyrene beads, and liquid phase separation techniques.(Author)

  7. Mitochondrial DNA analysis of medieval sheep (Ovis aries) in central Italy reveals the predominance of haplogroup B already in the Middle Ages.

    Science.gov (United States)

    Gabbianelli, F; Gargani, M; Pariset, L; Mariotti, M; Alhaique, F; De Minicis, E; Barelli, L; Ciammetti, E; Redi, F; Valentini, A

    2015-06-01

    We retrieved 34 medieval ovicaprine remains, from three archaeological sites of central Italy dating to about 1000 years old, and analyzed them using mitochondrial DNA. We compared the reconstructed haplogroups with modern sheep samples from Europe and the Middle East and sequences from the literature. In modern sheep, haplogroup HA is present in countries with access to the Mediterranean and close to the domestication center, whereas it is very rare or absent in the rest of Europe. The haplogroup HB was predominant in ancient samples (90%), whereas haplogroup HA was found at 10%. Ancient haplogroups match the present distribution in modern sheep in Italy, indicating that the current proportion of HA/HB was already established in the Middle Ages and is not the result of subsequent events such as selective breeding practices. © 2015 Stichting International Foundation for Animal Genetics.

  8. Estudo morfológico do funículo espermático em ovinos da raça Corriedale (Ovis aries, L. 1758

    Directory of Open Access Journals (Sweden)

    Roberto Carvalhal

    2000-01-01

    Full Text Available Estudamos em 40 ovinos adultos da raça Corriedale os aspectos histológicos do funículo espermático. Observamos que este se acha envolvido por uma cápsula de tecido conjuntivo fibroelástico denso, de espessura variável, pregueada em alguns pontos, e revestida por mesotélio que circunda todo o conjunto vásculo-nervoso, e projeta-se para formar o mesoducto deferente. Em posição subcapsular, verifica-se uma camada de tecido conjuntivo fibroelástico frouxo, de espessura variável, que circunda parcialmente o funículo espermático, isolando nas regiões deferencial e abdeferencial conjuntos vásculo-nervosos, responsáveis pela nutrição do epidídimo. Na região do mesoducto deferente, o tecido subcapsular acompanhado de tecido adiposo constitui a camada interna deste meso, formando a sua adventícia e abrigando vasos e nervos deferenciais. Na região abdeferencial, pequenos acúmulos de tecido adiposo são vistos de permeio aos vasos e nervos desta região. Entre as artérias, veias e nervos testiculares, bem como entre os vasos das regiões deferencial e abdeferencial, observa-se o tecido conjuntivo denso, intervascular, rico em fibras elásticas, que constitui as adventícias contínuas destes vasos. O arranjo vascular mostra que o segmento da artéria testicular, contido no funículo espermático, apresenta trajeto sinuoso. Estando envolvido pelo plexo venoso pampiniforme, formado por veias testiculares desprovidas de válvulas de calibres variados, apresentando amplas comunicações entre si. As veias responsáveis pela drenagem do epidídimo e ducto deferente estão localizadas em posição subcapsular deferencial e abdeferencial e mostram-se providas de válvulas. O trato das artérias testiculares no funículo espermático apresenta como comprimento médio, máximo e mínimo, respectivamente, 150,4 cm, 198,0 cm e 73,3 cm, à direita, e 149,6 cm, 189,2 cm e 90,0 cm, à esquerda, não existindo diferenças estatisticamente significantes ao nível de 5%, quando comparamos a média do segmento da artéria testicular contida no funículo espermático direito em relação ao esquerdo.

  9. Three-dimensional reconstruction studies and morphometric analysis of rudimental tooth primordia in the upper incisor region of the sheep (Ovis aries, Ruminantia)

    Czech Academy of Sciences Publication Activity Database

    Witter, Kirsti; Matulová, Petra; Míšek, Ivan

    2003-01-01

    Roč. 48, - (2003), s. 15-24 ISSN 0003-9969 R&D Projects: GA ČR GA304/02/0448; GA ČR GP304/01/P021 Institutional research plan: CEZ:AV0Z5045916 Keywords : tooth development * odontogenesis * dentition Subject RIV: ED - Physiology Impact factor: 1.098, year: 2003

  10. Error Probability of Binary and -ary Signals with Spatial Diversity in Nakagami- (Hoyt) Fading Channels

    OpenAIRE

    Duong Trung Q; Shin Hyundong; Hong Een-Kee

    2007-01-01

    We analyze the exact average symbol error probability (SEP) of binary and -ary signals with spatial diversity in Nakagami- (Hoyt) fading channels. The maximal-ratio combining and orthogonal space-time block coding are considered as diversity techniques for single-input multiple-output and multiple-input multiple-output systems, respectively. We obtain the average SEP in terms of the Lauricella multivariate hypergeometric function . The analysis is verified by comparing with Monte Carlo simu...

  11. The social marketing of project ARIES: overcoming challenges in recruiting gay and bisexual males for HIV prevention counseling.

    Science.gov (United States)

    Fisher, D S; Ryan, R; Esacove, A W; Bishofsky, S; Wallis, J M; Roffman, R A

    1996-01-01

    This paper reports on the development, implementation, and evaluation of a social marketing campaign designed to recruit clients Project ARIES, and AIDS prevention study funded by the National Institute of Mental Health. Marketing channels employed for the campaign included advertising in the gay press, generating coverage in the mainstream press, distributing materials to HIV testing centers and other health and social service providers, and displaying posters in gay bars and baths. While these approaches all succeeded in eliciting inquiries from individuals engaging in high risk sexual behaviors, they differed in several respects, including their ability to reach specific subgroups that are often underserved by more traditional programs, such as men of color, younger men, and men who self-report as being closeted. Promotional materials displayed in gay bars and baths resulted in the highest percentage of callers who, after inquiring about the program, decided to participate in the counseling. Coverage in the mainstream press was the most successful in reaching closeted men, men who were less active in the gay community, and individuals who did not self-identify as gay. Display and classified ads in the gay press produced the highest number of initial inquiries. Finally, recruitment of participants via materials distributed to HIV test sites and other service providers was the most effective in reaching men who were HIV-positive.

  12. Oestrus ovis (Diptera: Oestridae an important ectoparasite in sheep of four cantons of the municipality of Sorata province Larecaja, department of La Paz

    Directory of Open Access Journals (Sweden)

    Choque-Fernández Graciela Cristina

    2017-04-01

    Full Text Available The study of Oestrosis in sheep was carried out in the cantons of Sorata, Obispo Bosque, Laripata and Ilabaya, belonging to the Municipality of Sorata, under the agreement made with the institution Departmental Agricultural and Livestock Service (SEDAG between August and September 2002, with 164 heads of sheep out of which 151 heads were Oestrus ovis, 13 were negative, taking into account the factors canton, sex, age and number of larvae per animal. The prevalence of Oestrosis in Sorata was 39% and by corner Obispo Bosque 28%, Ilabaya and Laripata 18% and 15% respectively. The analysis of variance to quantify the number of larvae per canton did not present significant differences (P> 0.005 as well as for the sex and age factor, which means that the canton Sorata, Obispo Bosque, Laripata and Ilabaya have equal % of Oestrosis for The age factor is not significant difference between females and males nor groups of age 1 and 2. Analysis of variance to determine the differences in the number of larvae per canton, sex, age and larval stage also does not exist significant differences, however, considering (P <0.005 because there are more larvae in the L-1 stage than L-2 and L-3. In this sense, Oestrosis affects all the cantons under study without distinction of age groups, sex, however varying in the presence of different larval stages, where L-1 predominates.

  13. Molecular Identification and Epidemiological Features of Human Adenoviruses Associated with Acute Respiratory Infections in Hospitalized Children in Southern China, 2012-2013.

    Science.gov (United States)

    Chen, Yi; Liu, Fanghua; Wang, Changbing; Zhao, Mingqi; Deng, Li; Zhong, Jiayu; Zhang, Yingying; Ye, Jun; Jing, Shuping; Cheng, Zetao; Guan, Yongxin; Ma, Yi; Sun, Yuanyuan; Zhu, Bing; Zhang, Qiwei

    2016-01-01

    Acute respiratory infections (ARI) are the major worldwide health problem associated with high morbidity and mortality rates. Human adenovirus (HAdV) is one of the most common pathogens associated with viral ARI, and thus calls for specific diagnosis and better understanding of the epidemiology and clinical characteristics. Total 4,130 children with ARI requiring hospitalization from 2012 to 2013 were retrospectively studied. Throat swab specimens were collected from each patient. Fluorescence Quantitative PCR was performed to detect adenovirus as well as other common ARI-related pathogens. The seven HAdV hypervariable regions (HVRs) of the hexon gene from fifty-seven HAdVs-positive samples collected in the seasonal peaks were sequenced. Phylogenetic analysis of HVRs was also conducted to confirm the molecular types and genetic variation. In addition, epidemiological features and co-infection with other human respiratory pathogens were investigated and analyzed. Of 4,130 hospitalized pediatric patients tested, the positive rates of respiratory syncytial virus (RSV), Mycoplasma pneumoniae (MP), and HAdV were 13.7%, 13.2%, and 12.0%, respectively. The HAdV positive patients accounted for 7.9%, 17.2%, 17.5% and 10.7% in age groups infected with other respiratory pathogens (84/495, 17.0%). The most common co-infection pathogens with HAdV were MP (57.1%) and Human Bocavirus (HBoV) (16.7%). The majority of HAdV infected patients were totally recovered (96.9%, 480/495); However, four (0.8%) patients, who were previously healthy and at the age of 2 years or younger died of pneumonia. Seasonal peaks of HAdV infection occurred in the summer season of 2012 and 2013; the predominant HAdV type was HAdV-3 (70%), followed by HAdV-7 (28%). These epidemiological features were different from those in Northern China. The HAdV-55 was identified and reported for the first time in Guangzhou metropolitan area. Phylogenetic analysis indicated that all the HVR sequences of the hexon gene

  14. Laser Induced Fluorescence (LIF) Measurements of Neutral (ArI) and singly-ionized (ArII) Argon in a LargeScale Helicon Plasma

    Science.gov (United States)

    Kelly, R. F.; Fisher, D. M.; Hatch, M. W.; Gilmore, M.; Dwyer, R. H.; Meany, K.; Zhang, Y.; Desjardins, T. R.

    2017-10-01

    In order to investigate the role of neutral dynamics in helicon discharges in the HelCat (Helicon-Cathode) plasma device at U. New Mexico, a Laser Induced Fluorescence (LIF) system has been developed. The LIF system is based on a >250 mW, tunable diode laser with a tuning range between 680 and 700nm. For neutral Argon, the laser pumps the metastable (2P3/20) 4s level to the (2P1/20) 4p level using 696. 7352 nm light. The fluorescence radiation from decay to the (2P1/20) 4s level at 772. 6333 nm is observed. For singly ionized Argon, the laser pumps the 3s23p4(3 P)3d level to the 3s23p4(3 P)4p level using 686.3162nm light. The fluorescence radiation from the decay to the 3s23p4(3 P)4s level is observed. The system design, and velocity measurements in the axial, azimuthal and radial directions for ArI, and in the axial direction for ArII will be presented. Supported by U.S. National Science Foundation Award 1500423.

  15. Circulation au moyen âge des matériaux ferreux issus des Pyrénées ariégeoises et de la Lombardie. Apport du couplage des analyses en éléments traces et multivariées

    OpenAIRE

    Leroy , Stéphanie

    2010-01-01

    This provenance study concerns the trade understanding in the Middle Ages of iron objects originally from specific ironmaking processes linked to the use of manganese rich ores. We were particularly interested in the case studies of the Ariège (French Pyrenees) and the Lombardy (Italian Alps) areas, two separate geographic areas that held a major place in the medieval economy of their region. This work deals with three specific historical questions. The first part is to clarify the trade rout...

  16. Evaluating potential overlap between pack stock and Sierra Nevada bighorn sheep (Ovis canadensis sierrae) in Sequoia and Kings Canyon National Parks, California

    Science.gov (United States)

    Klinger, Robert C.; Few, Alexandra P.; Knox, Kathleen A.; Hatfield, Brian E.; Clark, Jonathan; German, David W.; Stephenson, Thomas R.

    2015-01-01

    Pack stock (horses, mules, burros, llamas, and goats) are frequently assumed to have negative effects on public lands, but there is a general lack of data to be able to quantify the degree to which this is actually the case. Sequoia and Kings Canyon National Parks have received complaints that pack stock may affect Sierra Nevada bighorn sheep (Ovis canadensis sierrae; SNBS), a federally endangered subspecies that occurs in largely disjunct herds in the Sierra Nevada Range of California. The potential effects are thought to be displacement of SNBS from meadows on their summer range (altered habitat use) or, more indirectly, through changes in SNBS habitat or forage quality. Our goals were to conduct an association analysis to quantify the degree of potential spatial overlap in meadow use between SNBS and pack stock and to compare differences in vegetation community composition, structure, and diversity among meadows with different levels of use by bighorn sheep and pack stock. For the association analysis, we used two approaches: (1) we quantified the proportion of meadows that were within the herd home ranges of bighorn sheep and were potentially open to pack stock, and, (2) we used Monte Carlo simulations and use-availability analyses to compare the proportion of meadows used by bighorn sheep relative to the proportional occurrence or area of meadows available to bighorn sheep that were used by pack stock. To evaluate potential effects of pack stock on meadow plant communities and SNBS forage, we sampled vegetation in 2011 and 2012 at 100 plots to generate data that allowed us to compare:

  17. [Different species of human rhinovirus infection in children with acute respiratory tract infections in Beijing].

    Science.gov (United States)

    Song, Ming-hui; Zhao, Lin-qing; Qian, Yuan; Zhu, Ru-nan; Deng, Jie; Wang, Fang; Sun, Yu; Tian, Run

    2013-12-01

    To understand the clinical characteristics of different groups human rhinovirus (HRV)-A, B and C infection in children with acute respiratory tract infections (ARI) in Beijing. Respiratory tract specimens (n = 1412) collected from children with ARI during Jan. 2011 to Dec. 2012 were tested for HRV by using semi-nested PCR. Gene fragments of VP4/VP2 capsid protein amplified from HRV positive specimens were sequenced for HRV genotype confirmation. Then epidemiological characteristics of these HRV-positive cases were analyzed. Among these 1412 specimens tested, 103 (7.3%) were HRV positive, including 54 (52.4%) positive for HRV-A, 14 (13.6%) for HRV-B, 35 (34.0%) for HRV-C determined by sequence analysis. The positive rates of HRV-A, B and C (2.5%, 16/638; 0.3%, 2/638 and 1.3%, 8/638) in children with acute upper respiratory tract infections (URI) were lower than those (5.8%, 36/623; 1.8%, 11/623 and 3.9%, 24/623) in children with acute lower respiratory tract infections (LRI) (P = 0.003, 0.011, 0.003). In children with LRI, the positive rates of HRV-A, C were similar to each other (P = 0.112), and both were higher than that of HRV-B (P = 0.000, P = 0.026). The severity of ARI among children positive for different groups HRV showed no significant difference evaluated by Kruskal-Wallis H test (Hc = 0.044, P > 0.05), as well as that between children co-infected with HRV and other viruses and those infected with HRV only evaluated by Wilcoxon rank sum test (Zc = 0.872, P > 0.05). HRV is one of important pathogens for children with ARI, especially LRI in Beijing. The positive rates of HRV-A and HRV-C are similar to each other, and both are higher than that of HRV-B. No significant difference was shown among children with different HRV genotypes by evaluation of the severity of ARI, and co-infections of HRV with other viruses do not significantly increase the severity of ARI.

  18. Inactivated Parapoxvirus ovis induces a transient increase in the expression of proinflammatory, Th1-related, and autoregulatory cytokines in mice

    International Nuclear Information System (INIS)

    Anziliero, D.; Weiblen, R.; Kreutz, L.C.; Spilki, F.; Flores, E.F.

    2014-01-01

    The immunostimulatory properties of inactivated Parapoxvirus ovis (iPPVO) have long been investigated in different animal species and experimental settings. In this study, we investigated the effects of iPPVO on cytokine expression in mice after intraperitoneal inoculation. Spleen and sera collected from iPPVO-treated mice at intervals after inoculation were submitted to cytokine mRNA determination by real-time PCR (qPCR), serum protein concentration by ELISA, and interferon (IFN)-α/β activity by bioassay. The spleen of iPPVO-treated animals showed a significant increase in mRNA expression of all cytokines assayed, with different kinetics and magnitude. Proinflammatory cytokines interleukin (IL)-1β, tumor necrosis factor-alpha (TNF-α), and IL-8 mRNA peaked at 24 hours postinoculation (hpi; 5.4-fold increase) and 48 hpi (3- and 10-fold increases), respectively. A 15-fold increase in IFN-γ and 6-fold IL-12 mRNA increase were detected at 48 and 24 hpi, respectively. Increased expression of autoregulatory cytokines (Th2), mainly IL-10 and IL-4, could be detected at later times (72 and 96 hpi) with peaks of 4.7- and 4.9-fold increases, respectively. IFN-I antiviral activity against encephalomyocarditis virus was demonstrated in sera of treated animals between 6 and 12 hpi, with a >90% reduction in the number of plaques. Measurement of serum proteins by ELISA revealed increased levels of IL-1, TNF-α, IL-12, IFN-γ, and IL-10, with kinetics similar to those observed by qPCR, especially for IL-12 and IFN-γ. These data demonstrate that iPPVO induced a transient and complex cytokine response, initially represented by Th1-related cytokines followed by autoregulatory and Th2 cytokines

  19. Inactivated Parapoxvirus ovis induces a transient increase in the expression of proinflammatory, Th1-related, and autoregulatory cytokines in mice

    Energy Technology Data Exchange (ETDEWEB)

    Anziliero, D.; Weiblen, R. [Setor de Virologia, Departamento de Medicina Veterinária Preventiva, Universidade Federal de Santa Maria, Santa Maria, RS, Brasil, Setor de Virologia, Departamento de Medicina Veterinária Preventiva, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Kreutz, L.C. [Programa de Pós-Graduação em Bioexperimentação, Faculdade de Agronomia e Medicina Veterinária, Universidade de Passo Fundo, Passo Fundo, RS, Brasil, Programa de Pós-Graduação em Bioexperimentação, Faculdade de Agronomia e Medicina Veterinária, Universidade de Passo Fundo, Passo Fundo, RS (Brazil); Spilki, F. [Laboratório de Microbiologia Molecular, Instituto de Ciências da Saúde, Universidade Feevale, Novo Hamburgo, RS, Brasil, Laboratório de Microbiologia Molecular, Instituto de Ciências da Saúde, Universidade Feevale, Novo Hamburgo, RS (Brazil); Flores, E.F. [Setor de Virologia, Departamento de Medicina Veterinária Preventiva, Universidade Federal de Santa Maria, Santa Maria, RS, Brasil, Setor de Virologia, Departamento de Medicina Veterinária Preventiva, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil)

    2014-02-17

    The immunostimulatory properties of inactivated Parapoxvirus ovis (iPPVO) have long been investigated in different animal species and experimental settings. In this study, we investigated the effects of iPPVO on cytokine expression in mice after intraperitoneal inoculation. Spleen and sera collected from iPPVO-treated mice at intervals after inoculation were submitted to cytokine mRNA determination by real-time PCR (qPCR), serum protein concentration by ELISA, and interferon (IFN)-α/β activity by bioassay. The spleen of iPPVO-treated animals showed a significant increase in mRNA expression of all cytokines assayed, with different kinetics and magnitude. Proinflammatory cytokines interleukin (IL)-1β, tumor necrosis factor-alpha (TNF-α), and IL-8 mRNA peaked at 24 hours postinoculation (hpi; 5.4-fold increase) and 48 hpi (3- and 10-fold increases), respectively. A 15-fold increase in IFN-γ and 6-fold IL-12 mRNA increase were detected at 48 and 24 hpi, respectively. Increased expression of autoregulatory cytokines (Th2), mainly IL-10 and IL-4, could be detected at later times (72 and 96 hpi) with peaks of 4.7- and 4.9-fold increases, respectively. IFN-I antiviral activity against encephalomyocarditis virus was demonstrated in sera of treated animals between 6 and 12 hpi, with a >90% reduction in the number of plaques. Measurement of serum proteins by ELISA revealed increased levels of IL-1, TNF-α, IL-12, IFN-γ, and IL-10, with kinetics similar to those observed by qPCR, especially for IL-12 and IFN-γ. These data demonstrate that iPPVO induced a transient and complex cytokine response, initially represented by Th1-related cytokines followed by autoregulatory and Th2 cytokines.

  20. Molecular detection of Theileria, Babesia, and Hepatozoon spp. in ixodid ticks from Palestine.

    Science.gov (United States)

    Azmi, Kifaya; Ereqat, Suheir; Nasereddin, Abedelmajeed; Al-Jawabreh, Amer; Baneth, Gad; Abdeen, Ziad

    2016-07-01

    Ixodid ticks transmit various infectious agents that cause disease in humans and livestock worldwide. A cross-sectional survey on the presence of protozoan pathogens in ticks was carried out to assess the impact of tick-borne protozoa on domestic animals in Palestine. Ticks were collected from herds with sheep, goats and dogs in different geographic districts and their species were determined using morphological keys. The presence of piroplasms and Hepatozoon spp. was determined by PCR amplification of a 460-540bp fragment of the 18S rRNA gene followed by RFLP or DNA sequencing. A PCR-RFLP method based on the 18S rRNA was used in order to detect and to identify Hepatozoon, Babesia and Theileria spp. A total of 516 ticks were collected from animals in six Palestinian localities. Five tick species were found: Rhipicephalus sanguineus sensu lato, Rhipicephalus turanicus, Rhipicephalus bursa, Haemaphysalis parva and Haemaphysalis adleri. PCR-based analyses of the ticks revealed Theileria ovis (5.4%), Hepatozoon canis (4.3%), Babesia ovis (0.6%), and Babesia vogeli (0.4%). Theileria ovis was significantly associated with ticks from sheep and with R. turanicus ticks (p<0.01). H. canis was detected only in R. sanguineus s.l. and was significantly associated with ticks from dogs (p<0.01). To our knowledge, this is the first report describing the presence of these pathogens in ticks collected from Palestine. Communicating these findings with health and veterinary professionals will increase their awareness, and contribute to improved diagnosis and treatment of tick-borne diseases. Copyright © 2016. Published by Elsevier GmbH.

  1. Resistencia química del hormigón. XXVII. Contribución al estudio del sistema: cemento P-550-ARI hidratado-agua desionizada

    Directory of Open Access Journals (Sweden)

    Bermejo-Muñoz, M. Francisca

    1987-03-01

    Full Text Available In this work, which is the following of others, the performance of a portland cement of a high initial resistance (P-550-ARI —with a calculated content (Bogue of 39,2% of C3S, of 25,7% of C2S, of 9,9% of C3A, of 12,0% of C4AF and of 6,9% of CaSO4 — is studied when it is submitted to the action of deionized water running across the beds of granulated cement, made with this hydrated cement cured during 7 or 28 days, determining: a the evolution of the content on ions Ca (II and SO4 (II on the taken diverse fractions of deionized water which have ran across those beds, so as this of the pH and of the conductivity, b the variation in the amount of these ions that are forming the correspondent compounds, in the hydrated cement from the beds that have been submitted before and after to the action of the deionized water, and c the structural modification undergone by the crystalline compounds of the hydrated cement from the beds submitted to the action of the deionized water.

    En el trabajo presente, continuación de otros, se estudia el comportamiento de un cemento portland de alta resistencia inicial (P-550-ARI —con un contenido calculado (Bogue del 39,2% de C3S, del 25,7% de C2S, del 9,9% de C3A del 12,0 de C4AF y del 6,9 % de CaS04— cuando se somete a la acción del agua desionizada que atraviesa los lechos de cemento granulados, fabricados con dicho cemento hidratado y curado durante 7 y 28 días, determinando: a La evolución del contenido de los iones Ca (II y SO4 (II de las diversas fracciones recogidas de agua desionizada, que han atravesado los lechos mencionados, así como la del pH y de la conductividad, b la variación de las cantidades de dichos iones, que se encuentran formando los compuestos correspondientes en el cemento hidratado de los lechos antes y después de someterlos a la acci

  2. Effect of Disease Definition on Perceived Burden of Acute Respiratory Infections in Children: A Prospective Cohort Study Based on Symptom Diaries.

    Science.gov (United States)

    Zoch, Beate; Günther, Annette; Karch, André; Mikolajczyk, Rafael

    2017-10-01

    Acute respiratory infections (ARIs) are among the most frequent childhood diseases in Western countries. Assessment of ARI episodes for research purposes is usually based on parent-administered retrospective questionnaires or prospective symptom diaries. The aim of our analysis was to compare the effect of ARI definitions on the corresponding disease burden in a prospective cohort study using symptom diaries. A literature search was performed to identify definitions of ARI used in research studies. The definitions were applied to a symptom diary dataset from a cohort study of 1-3-year-old children conducted in the winter season 2013/2014. We compared the total number of ARI episodes, the total number of days with ARI and the median and mean duration of ARI episodes resulting from the use of the different definitions. Six ARI definitions were identified in the literature. Depending on ARI definition, the total number of ARI episodes and the total number of days with ARI in our dataset varied by a factor of 1.69 and 1.53, respectively, between the lowest and the highest. The median duration of the episodes ranged from 7 to 10 days. Different definitions led to considerable differences in the number and duration of ARI episodes, making direct comparisons of studies with different methods questionable. We propose the use of a standardized ARI definition in upcoming cohort studies working with diary data. This process could be conducted using a Delphi survey with experts in this study field.

  3. ATP-Binding Cassette Systems of Brucella

    Directory of Open Access Journals (Sweden)

    Dominic C. Jenner

    2009-01-01

    Full Text Available Brucellosis is a prevalent zoonotic disease and is endemic in the Middle East, South America, and other areas of the world. In this study, complete inventories of putative functional ABC systems of five Brucella species have been compiled and compared. ABC systems of Brucella melitensis 16M, Brucella abortus 9-941, Brucella canis RM6/66, Brucella suis 1330, and Brucella ovis 63/290 were identified and aligned. High numbers of ABC systems, particularly nutrient importers, were found in all Brucella species. However, differences in the total numbers of ABC systems were identified (B. melitensis, 79; B. suis, 72; B. abortus 64; B. canis, 74; B. ovis, 59 as well as specific differences in the functional ABC systems of the Brucella species. Since B. ovis is not known to cause human brucellosis, functional ABC systems absent in the B. ovis genome may represent virulence factors in human brucellosis.

  4. Forensic analysis of bone in Regio antebrachii of deer (Capreolus capreolus and sheep (Ovis aries in order to determine origin of animal species

    Directory of Open Access Journals (Sweden)

    Blagojević Miloš

    2012-01-01

    Full Text Available There are frequent cases of poaching in which it is necessary to determine to which animal species the prey belonged on the basis of morphological characteristics of the bone. In this case, the Department of Forensic Medicine received material for giving an expert opinion on the left and right forearm (radius and ulna and twelve pieces of the ribs. The ribs were completely broken, so in order to identify the bones as belonging to a particular animal species, only the radius and ulna were used. Forensic analysis was perfomed by comparing the osteological features of the delivered bones with those of museum specimens of deer and sheep bones. The forearm (ossa antebrachii of the deer is slender and thin, and it is massive and heavier in sheep. There are two interosseus spaces (spatium interosseum antebrachii of the forearm in the deer and only one in the sheep. The olecranon tuber (tuber olecrani of the sheep is triangular in shape, and in deer it is divided into cranial and caudal prominences. The radial tuberosity (tuberositas radii of the sheep is better defined. Based on morphological characteristics of the disputed bones we found that the submitted material originated from a doe.

  5. EFEITO DO DIÂMETRO FOLICULAR SOBRE A QUALIDADE DOS OÓCITOS OBTIDOS DE OVÁRIOS DE OVELHAS (Ovis aries E CABRAS (Capra hircus

    Directory of Open Access Journals (Sweden)

    Ricardo de Macêdo Chaves

    2010-10-01

    Full Text Available This study aimed to evaluate the influence of follicular diameter on the quality of oocytes from ovaries of female sheep and goats. The ovaries of sheep (156 units and goats (105 units from slaughterhouse were used. The follicles were measured, aspirated and divided into three classes of follicular diameter: class 1 (CI – 2 to 3 mm, class 2 (CII – 4 to 5 mm and class 3 (CIII – 6 mm. The recovered oocytes were evaluated and classified according to morphological aspect in 5 quality groups: grade 1 (GI, grade 2 (GII, grade 3 (GIII, naked (N and atresia (A. Of the 468 follicles aspirated from sheep, 327 CI, 84 CII, CIII 57 and 83 GI, 78 GII, GIII 95, 119 N, 93 A were found, and from the 422 follicles aspirated from goats 197 CI, 132 CII, 92 CIII and 64 GI, 70 GII, 91 GIII, 123 N, 74 A were found. The data did not show significant correlation between quality of oocytes and diameter of follicles (P > 0.05. Under the conditions observed in this study it was concluded that the follicular diameter has no influence on the quality of cumulus-oocyte complex (COC recovered from the ovaries of female sheep and goats.

  6. Influence of citric acid as setting retarder in CPV portland cement pastes and mortars; Influencia do acido citrico como retardador de pega em pastas e argamassas de cimento portland CPV ARI

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.C.; Lopes, M.M.S.; Alvarenga, R.C.S.S.; Fassoni, D.P.; Pedroti, L.G. [Universidade Federal de Vicosa (UFV), MG (Brazil); Azevedo, A.R.G. de, E-mail: afonso.garcez91@gmail.com [Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacazes, RJ (Brazil)

    2016-07-01

    This work aims to study the availability of using and the influence of citric acid in the properties of pastes and mortars made with Portland cement CPV ARI both in fresh and hardened form. The citric acid dosages were 0, 0.4%, and 0.8% relative to the cement mass. The produced cement pastes were tested to determine normal consistency water and initial and final setting times. Mortars were tested to determine the consistency index, specific gravity, air entrained content in the fresh stage, hardened bulk density, compressive strength at ages 7, 14, and 28 days, and analysis by XRD technique. The results show that citric acid, besides improve the mortar workability, contribute to an increase in mechanical strength in older than 14 days. (author)

  7. The Physics Basis For An Advanced Physics And Advanced Technology Tokamak Power Plant Configuration, ARIES-ACT1

    Energy Technology Data Exchange (ETDEWEB)

    Charles Kessel, et al

    2014-03-05

    The advanced physics and advanced technology tokamak power plant ARIES-ACT1 has a major radius of 6.25 m at aspect ratio of 4.0, toroidal field of 6.0 T, strong shaping with elongation of 2.2 and triangularity of 0.63. The broadest pressure cases reached wall stabilized βN ~ 5.75, limited by n=3 external kink mode requiring a conducting shell at b/a = 0.3, and requiring plasma rotation, feedback, and or kinetic stabilization. The medium pressure peaking case reached βN = 5.28 with BT = 6.75, while the peaked pressure case reaches βN < 5.15. Fast particle MHD stability shows that the alpha particles are unstable, but this leads to redistribution to larger minor radius rather than loss from the plasma. Edge and divertor plasma modeling show that about 75% of the power to the divertor can be radiated with an ITER-like divertor geometry, while over 95% can be radiated in a stable detached mode with an orthogonal target and wide slot geometry. The bootstrap current fraction is 91% with a q95 of 4.5, requiring about ~ 1.1 MA of external current drive. This current is supplied with 5 MW of ICRF/FW and 40 MW of LHCD. EC was examined and is most effective for safety factor control over ρ ~ 0.2-0.6 with 20 MW. The pedestal density is ~ 0.9x1020 /m3 and the temperature is ~ 4.4 keV. The H98 factor is 1.65, n/nGr = 1.0, and the net power to LH threshold power is 2.8- 3.0 in the flattop.

  8. Differentiating human versus non-human bone by exploring the nutrient foramen: implications for forensic anthropology.

    Science.gov (United States)

    Johnson, Vail; Beckett, Sophie; Márquez-Grant, Nicholas

    2017-11-01

    One of the roles of a forensic anthropologist is to assist medico-legal investigations in the identification of human skeletal remains. In some instances, only small fragments of bone may be present. In this study, a non-destructive novel technique is presented to distinguish between human and non-human long bones. This technique is based on the macroscopic and computed tomography (CT) analysis of nutrient foramina. The nutrient foramen of long bone diaphyses transmits the nutrient artery which provides much of the oxygen and nutrients to the bone. The nutrient foramen and its canal were analysed in six femora and humeri of human, sheep (Ovies aries) and pig (Sus scrofa) species. The location, position and direction of the nutrient foramina were measured macroscopically. The length of the canal, angle of the canal, circumference and area of the entrance of the foramen were measured from CT images. Macroscopic analysis revealed the femora nutrient foramina are more proximal, whereas humeri foramina are more distal. The human bones and sheep humerus conform to the perceived directionality, but the pig bones and sheep femur do not. Amongst the parameters measured in the CT analysis, the angle of the canal had a discriminatory power. This study shows the potential of this technique to be used independently or complementary to other methods in distinguishing between human and non-human bone in forensic anthropology.

  9. Epidemiological factors related to the transmission risk of Trypanosoma cruzi in a Quilombola community, State of Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Marlon Cezar Cominetti

    2011-10-01

    Full Text Available INTRODUCTION: This work was an epidemiological investigation of the risk of Trypanosoma cruzi transmission in the rural Quilombola community of Furnas do Dionízio, State of Mato Grosso do Sul, Brazil. METHODS: Of the 71 animals examined, seven were captured (two opossums, Didelphis albiventris; four rats, Rattus rattus; and one nine-banded armadillo, Dasypus novemcinctus and 64 were domestic (one canine, Canis familiaris; five pigs, Sus scrofa; two bovines, Bos taurus; five caprines, Capra sp.; and 51 ovines, Ovis aries. Parasitological tests were performed to detect parasites in the blood and to identify the morphology of flagellates. These methods included fresh examinations, buffy coat tests and blood cultures. Molecular analysis of DNA for identification of trypanosomatids was performed by polymerase chain reaction (PCR with primers S35 and S36. RESULTS: The parasitological tests showed flagellates in an opossum and two cattle. The molecular tests showed DNA from T. cruzi in an opossum and a pig. Triatoma sordida was the only triatomine species found in the community, and it colonized households (four specimens and the surrounding areas (124 specimens. Twenty-three specimens tested positive for flagellates, which were subsequently identified as T. cruzi by PCR. CONCLUSIONS: Data analysis demonstrated that T. cruzi has a peridomestic life cycle that involves both domestic and wild mammals.

  10. In-gel and OFFGEL-based proteomic approach for authentication of meat species from minced meat and meat products.

    Science.gov (United States)

    Naveena, Basappa M; Jagadeesh, Deepak S; Kamuni, Veeranna; Muthukumar, Muthupalani; Kulkarni, Vinayak V; Kiran, Mohan; Rapole, Srikanth

    2018-02-01

    Fraudulent mislabelling of processed meat products on a global scale that cannot be detected using conventional techniques necessitates sensitive, robust and accurate methods of meat authentication to ensure food safety and public health. In the present study, we developed an in-gel (two-dimensional gel electrophoresis, 2DE) and OFFGEL-based proteomic method for authenticating raw and cooked water buffalo (Bubalus bubalis), sheep (Ovis aries) and goat (Caprus hircus) meat and their mixes. The matrix-assisted liquid desorption/ionization time-of-flight mass spectrometric analysis of proteins separated using 2DE or OFFGEL electrophoresis delineated species-specific peptide biomarkers derived from myosin light chain 1 and 2 (MLC1 and MLC2) of buffalo-sheep-goat meat mix in definite proportions at 98:1:1, 99:0.5:0.5 and 99.8:0.1:0.1 that were found stable to resist thermal processing. In-gel and OFFGEL-based proteomic approaches are efficient in authenticating meat mixes spiked at minimum 1.0% and 0.1% levels, respectively, in triple meat mix for both raw and cooked samples. The study demonstrated that authentication of meat from a complex mix of three closely related species requires identification of more than one species-specific peptide due to close similarity between their amino acid sequences. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  11. The Use of a Mechanical Non-Penetrating Captive Bolt Device for the Euthanasia of Neonate Lambs.

    Science.gov (United States)

    Grist, Andrew; Lines, Jeff A; Knowles, Toby G; Mason, Charles W; Wotton, Stephen B

    2018-04-02

    A non-penetrating captive bolt device, powered by a 1-grain 0.22″ cartridge delivering a calculated kinetic energy of 47 Joules was tested as a euthanasia method on 200 neonate lambs (Ovis aries) of 4.464 kg (SD (Standard deviation) ± 1.056) mean dead weight, to assess effectiveness and shot position. Every lamb (n = 200) was effectively stunned when the weapon was applied powered by a brown, 1-grain cartridge but 10/200 (5%) of the lambs displayed rhythmic or agonal breathing and were subsequently euthanased using euthatal (Merial, UK, GTIN: 03661103015550). Evaluation of the method was conducted using behavioural indicators of brain dysfunction followed by post-mortem examination of the heads. A second trial was conducted using a higher velocity 1.25-grain cartridge and a specific shot position on 48 lambs (mean dead weight = 6.21 kg, SD ± 1.24) averaging 5 days old. One hundred percent of the lambs in the second trial were immediately stun-killed. Given this complete kill rate and the sample size of the study, the study provides a statistical 95% confidence interval of 92.6% to 100%. The use of the Accles & Shelvoke “CASH” Small Animal Tool (Birmingham, UK) can therefore be recommended for the euthanasia of neonate lambs with a 1.25-grain cartridge and a specific shooting position.

  12. The Use of a Mechanical Non-Penetrating Captive Bolt Device for the Euthanasia of Neonate Lambs

    Directory of Open Access Journals (Sweden)

    Andrew Grist

    2018-04-01

    Full Text Available A non-penetrating captive bolt device, powered by a 1-grain 0.22″ cartridge delivering a calculated kinetic energy of 47 Joules was tested as a euthanasia method on 200 neonate lambs (Ovis aries of 4.464 kg (SD (Standard deviation ± 1.056 mean dead weight, to assess effectiveness and shot position. Every lamb (n = 200 was effectively stunned when the weapon was applied powered by a brown, 1-grain cartridge but 10/200 (5% of the lambs displayed rhythmic or agonal breathing and were subsequently euthanased using euthatal (Merial, UK, GTIN: 03661103015550. Evaluation of the method was conducted using behavioural indicators of brain dysfunction followed by post-mortem examination of the heads. A second trial was conducted using a higher velocity 1.25-grain cartridge and a specific shot position on 48 lambs (mean dead weight = 6.21 kg, SD ± 1.24 averaging 5 days old. One hundred percent of the lambs in the second trial were immediately stun-killed. Given this complete kill rate and the sample size of the study, the study provides a statistical 95% confidence interval of 92.6% to 100%. The use of the Accles & Shelvoke “CASH” Small Animal Tool (Birmingham, UK can therefore be recommended for the euthanasia of neonate lambs with a 1.25-grain cartridge and a specific shooting position.

  13. Traditional uses of medicinal animals in the semi-arid region of northeastern Brazil

    Directory of Open Access Journals (Sweden)

    Alves Rômulo Romeu Nóbrega

    2012-10-01

    Full Text Available Abstract The present work presents an inventory of the traditional medicinal uses of animals in the municipality of Bom Sucesso in Paraíba State (PB in the semiarid northeastern region of Brazil. Information was obtained through the use of semi-structured interviews with 50 people who use zootherapeutic products. A total of 25 animal species used for medicinal purposes were identified (18 vertebrates and seven invertebrates distributed among five taxonomic categories; the groups with the largest numbers of citations were: mammals (8 citations, insects (7, and reptiles (5. The most cited animal species were: Tubinambis merianae “teju” lizards (44 citations; Apis mellifera Italian honeybees (318 citations; Gallus gallus chickens (31 citations; Ovis aries sheep (31 citations; Crotalus durissus rattlesnakes (14 citations; Boa constrictor (12 citations; and Bos taurus cattle (12 citations. A significant number of illnesses and conditions treated with animal-based medicines were cited, and the category with the greatest number of citations was “problems affecting the respiratory system”. Our results suggest that the use of zootherapeutics in the region is persistent, and that knowledge about these curative practices is an integral part of the regional culture. As such, studies concerning the uses of zootherapeutics are important windows to understanding human/environmental/cultural interactions and a pathway to conciliating regional cultures with efforts to conserve the native fauna.

  14. Isolation, culture and characterisation of somatic cells derived from semen and milk of endangered sheep and eland antelope.

    Science.gov (United States)

    Nel-Themaat, L; Gómez, M C; Damiani, P; Wirtu, G; Dresser, B L; Bondioli, K R; Lyons, L A; Pope, C E; Godke, R A

    2007-01-01

    Semen and milk are potential sources of somatic cells for genome banks. In the present study, we cultured and characterised cells from: (1) cooled sheep milk; (2) fresh, cooled and frozen-thawed semen from Gulf Coast native (GCN) sheep (Ovis aries); and (3) fresh eland (Taurotragus oryx) semen. Cells attached to the culture surface from fresh (29%), cooled (43%) and slow-frozen (1 degrees C/min; 14%) ram semen, whereas no attachment occurred in the fast-frozen (10 degrees C/min) group. Proliferation occurred in fresh (50%) and cooled (100%) groups, but no cells proliferated after passage 1 (P1). Eland semen yielded cell lines (100%) that were cryopreserved at P1. In samples from GCN and cross-bred milk, cell attachment (83% and 95%, respectively) and proliferation (60% and 37%, respectively) were observed. Immunocytochemical detection of cytokeratin indicated an epithelial origin of semen-derived cells, whereas milk yielded either fibroblasts, epithelial or a mixture of cell types. Deoxyribonucleic acid microsatellite analysis using cattle-derived markers confirmed that eland cells were from the semen donor. Eland epithelial cells were transferred into eland oocytes and 12 (71%), six (35%) and two (12%) embryos cleaved and developed to morulae or blastocyst stages, respectively. In conclusion, we have developed a technique for obtaining somatic cells from semen. We have also demonstrated that semen-derived cells can serve as karyoplast donors for nuclear transfer.

  15. Interstellar Deuterium, Nitrogen and Oxygen Towards HZ43A: Results from the Far Ultraviolet Spectroscopic Explorer (FUSE) Mission

    Science.gov (United States)

    Kruk, J. W.; Howk, J. C.; Andre, M.; Moos, H. W.; Oegerle, William R.; Oliveira, C.; Sembach, K. R.; Chayer, P.; Linsky, J. L.; Wood, B. E.

    2002-01-01

    We present an analysis of interstellar absorption along the line of sight to the nearby white dwarf star HZ43A. The distance to this star is 68+/-13 pc, and the line of sight extends toward the north Galactic pole. Column densities of O(I), N(I), and N(II) were derived from spectra obtained by the Far Ultraviolet Spectroscopic Explorer (FUSE), the column density of D(I) was derived from a combination of our FUSE spectra and an archival HST GARDENS spectrum, and the column density of H(I) was derived from a combination of the GARDENS spectrum and values derived from EUVE data obtained from the literature. We find the following abundance ratios (with 2 sigma uncertainties): D(I)/H(I)=(1.66+/-0.28)x10(exp -5), O(I)/H(I)=(3.63+/-0.84)x10(exp -4), and N(I)/H(I)=(3.80+/-0.74)x10(exp -5). The N(II) column density was slightly greater than that of N(I), indicating that ionization corrections are important when deriving nitrogen abundances. Other interstellar species detected along the line of sight were C(II), C(III), O(VI), Si(II), Ar(I), Mg(II) and Fe(II); an upper limit was determined for N(III). No elements other than H(I) were detected in the stellar photosphere.

  16. Animal-based medicines used in ethnoveterinary practices in the semi-arid region of Northeastern Brazil.

    Science.gov (United States)

    Souto, Wedson M S; Barboza, Raynner R D; Rocha, Michelle S P; Alves, Rômulo R N; Mourão, José S

    2012-09-01

    This work documents the zootherapeutic practices in Ethnoveterinary medicine (EVM) of Pedra Lavrada (6°45'S, 36°28'W), Northeastern Brazil. We interviewed 23 people (22 men and 1 woman), who provided information on animal species used as remedies, body parts used to prepare the remedies, and illnesses for which the remedies were prescribed. We calculated the use-value to determine the most important species. Interviewees cited 11 animal taxa. The main species mentioned were ram - Ovis aries (UV=0.89), crab-eating fox - Cerdocyon thous (UV=0.79), common green iguana - Iguana iguana (UV=0.79), and South American rattlesnake - Caudisona durissa (Linnaeus, 1758) (UV=0.74). The most frequently cited treatments concerned to inflammatory and dermatological ailments or conditions, as well as to obstetric disorders. Similar to other studies, local ethnoveterinary establishes connections with human ethnomedicine. The results suggest that similarities in the repertoire of medicinal resources chosen by local residents reflect the local accessibility/availability of the resources. Our results help to preserve ethnoveterinary knowledge, which is important in enhancing our understanding on the relationship among humans, society and nature, and also to elaborate more effective strategies for conserving natural resources. Other studies for scientific validation of the effects and side effects of these zootherapeutic products are needed before they can be recommended or not for use.

  17. Molecular Identification and Epidemiological Features of Human Adenoviruses Associated with Acute Respiratory Infections in Hospitalized Children in Southern China, 2012-2013.

    Directory of Open Access Journals (Sweden)

    Yi Chen

    Full Text Available Acute respiratory infections (ARI are the major worldwide health problem associated with high morbidity and mortality rates. Human adenovirus (HAdV is one of the most common pathogens associated with viral ARI, and thus calls for specific diagnosis and better understanding of the epidemiology and clinical characteristics.Total 4,130 children with ARI requiring hospitalization from 2012 to 2013 were retrospectively studied. Throat swab specimens were collected from each patient. Fluorescence Quantitative PCR was performed to detect adenovirus as well as other common ARI-related pathogens. The seven HAdV hypervariable regions (HVRs of the hexon gene from fifty-seven HAdVs-positive samples collected in the seasonal peaks were sequenced. Phylogenetic analysis of HVRs was also conducted to confirm the molecular types and genetic variation. In addition, epidemiological features and co-infection with other human respiratory pathogens were investigated and analyzed.Of 4,130 hospitalized pediatric patients tested, the positive rates of respiratory syncytial virus (RSV, Mycoplasma pneumoniae (MP, and HAdV were 13.7%, 13.2%, and 12.0%, respectively. The HAdV positive patients accounted for 7.9%, 17.2%, 17.5% and 10.7% in age groups <1, 1-3, 3-6 and 6-14 years, respectively. Eighty-four HAdV positive children were co-infected with other respiratory pathogens (84/495, 17.0%. The most common co-infection pathogens with HAdV were MP (57.1% and Human Bocavirus (HBoV (16.7%. The majority of HAdV infected patients were totally recovered (96.9%, 480/495; However, four (0.8% patients, who were previously healthy and at the age of 2 years or younger died of pneumonia. Seasonal peaks of HAdV infection occurred in the summer season of 2012 and 2013; the predominant HAdV type was HAdV-3 (70%, followed by HAdV-7 (28%. These epidemiological features were different from those in Northern China. The HAdV-55 was identified and reported for the first time in Guangzhou

  18. Transfer of Trypanosoma ELISA technology to Onderstepoort Veterinary Institute, South Africa

    International Nuclear Information System (INIS)

    Waal, D.T. de

    2000-01-01

    Following a brief historical overview of trypanosomosis in South Africa, the present day role is explained of the Onderstepoort Veterinary Institute (OVI) in assisting disease diagnosis and surveillance. Production and distribution of ELISA kits will be initiated at OVI, initially for brucellosis and at a later stage for trypanosomosis. (author)

  19. <