WorldWideScience

Sample records for oryzias latipes haplotype-specific

  1. RELATIONSHIP BETWEEN ETHINYLESTRADIOL-MEDIATED CHANGES IN ENDOCRINE FUNCTION AND REPRODUCTION IMPAIRMENT IN JAPANESE MEDAKA (ORYZIAS LATIPES)

    Many biochemical endpoints currently are used to describe endocrine function in fish; however, the sensitivity of these parameters as biomarkers of impaired reproduction or sexual development is not well understood. In the present study, adult Japanese medaka (Oryzias latipes) we...

  2. USE OF THE JAPANESE MEDAKA (ORYZIAS LATIPES) AND GUPPY (POECILIA RETICULATA) IN CARCINOGENESIS TESTING UNDER NATIONAL TOXICOLOGY PROGRAM PROTOCOLS

    that are economical, sensitive, and scientifically acceptable. Among small fish models, the Japanese medaka (Oryzias latipes) is preeminent for investigating effects of carcinogenic and/or toxic waterborne hazards to humans. The guppy (Poecilia reticulata), although less widely u...

  3. Specification of primordial germ cells in medaka (Oryzias latipes

    Raz Erez

    2007-01-01

    Full Text Available Abstract Background Primordial germ cells (PGCs give rise to gametes that are responsible for the development of a new organism in the next generation. Two modes of germ line specification have been described: the inheritance of asymmetrically-localized maternally provided cytoplasmic determinants and the induction of the PGC fate by other cell types. PGCs specification in zebrafish appears to depend on inheritance of germ plasm in which several RNA molecules such as vasa and nanos reside. Whether the specification mode of PGCs found in zebrafish is general for other fish species was brought into question upon analysis of olvas expression – the vasa homologue in another teleost, medaka (Oryzias latipes. Here, in contrast to the findings in zebrafish, the PGCs are found in a predictable position relative to a somatic structure, the embryonic shield. This finding, coupled with the fact that vasa mRNA, which is localized to the germ plasm of zebrafish but does not label a similar structure in medaka opened the possibility of fundamentally different mechanisms governing PGC specification in these two fish species. Results In this study we addressed the question concerning the mode of PGC specification in medaka using embryological experiments, analysis of RNA stability in the PGCs and electron microscopy observations. Dramatic alterations in the somatic environment, i.e. induction of a secondary axis or mesoderm formation alteration, did not affect the PGC number. Furthermore, the PGCs of medaka are capable of protecting specific RNA molecules from degradation and could therefore exhibit a specific mRNA expression pattern controlled by posttrancriptional mechanisms. Subsequent analysis of 4-cell stage medaka embryos using electron microscopy revealed germ plasm-like structures located at a region corresponding to that of zebrafish germ plasm. Conclusion Taken together, these results are consistent with the idea that in medaka the inheritance of

  4. Past seawater experience enhances seawater adaptability in medaka, Oryzias latipes.

    Miyanishi, Hiroshi; Inokuchi, Mayu; Nobata, Shigenori; Kaneko, Toyoji

    2016-01-01

    During the course of evolution, fishes have acquired adaptability to various salinity environments, and acquirement of seawater (SW) adaptability has played important roles in fish evolution and diversity. However, little is known about how saline environments influence the acquirement of SW adaptability. The Japanese medaka Oryzias latipes is a euryhaline species that usually inhabits freshwater (FW), but is also adaptable to full-strength SW when transferred through diluted SW. In the present study, we examined how past SW experience affects hyposmoregulatory ability in Japanese medaka. For the preparation of SW-experienced fish, FW medaka were acclimated to SW after pre-acclimation to 1/2 SW, and the SW-acclimated fish were transferred back to FW. The SW-experienced fish and control FW fish (SW-inexperienced fish) were transferred directly to SW. Whereas control FW fish did not survive direct transfer to SW, 1/4 of SW-experienced fish adapted successfully to SW. Although there were no significant differences in blood osmolality and plasma Na(+) and Cl(-) concentrations between SW-experienced and control FW medaka in FW, increments in these parameters following SW transfer were lower in SW-experienced fish than in control FW fish. The gene expression of SW-type Na(+), K(+)-ATPase (NKA) in the gills of SW-experienced medaka increased more quickly after direct SW transfer compared with the expression in control FW fish. Prior to SW transfer, the density of NKA-immunoreactive ionocytes in the gills was higher in SW-experienced fish than in control FW fish. Ionocytes expressing CFTR Cl(-) channel at the apical membrane and those forming multicellular complexes, both of which were characteristic of SW-type ionocytes, were also increased in SW-experienced fish. These results indicate that past SW experience enhances the capacity of Na(+) and Cl(-) secretion in ionocytes and thus hypoosmoregulatory ability of Japanese medaka, suggesting the presence of epigenetic

  5. Assessing developmental toxicity of caffeine and sweeteners in medaka (Oryzias latipes)

    Lee, Wenjau; Wang, Yun-Chi

    2015-01-01

    The use of artificial sweeteners (ASWs) has increased and become more widespread, and consequently ASWs have appeared in aquatic environments around the world. However, their safety to the health of humans and wildlife remains inconclusive. In this study, using medaka embryos (Oryzias latipes), we investigated developmental toxicity of aspartame (ASP) and saccharin (SAC). Since ASWs are often consumed with caffeine (CAF) and CAF with sucrose (SUC), we tested biological activities of these fou...

  6. Adverse effects of tributyltin on reproduction of Japanese medaka, Oryzias latipes

    NAKAYAMA, Kei; OSHIMA, Yuji

    2008-01-01

    Tributyltin (TBT) is a typical endocrine disruptor that can induce imposex in mollusks and interfere with the reproduction in bivalves and fish. Our group has been studied the toxic effects of TBT using Japanese medaka (Oryzias latipes) as a model organism, and evaluated the effects on reproduction and behavior of medaka exposed to TBT. A series of our studies has demonstrated that TBT suppresses mating behavior in male and depresses fertility. We also observed that TBT exposure causes abnorm...

  7. An Adaptive Modeling Technique for Instream Fish Habitat Preference of Japanese Medaka (Oryzias Latipes)

    Fukuda, Shinji; Hiramatsu, Kazuaki; Mori, Makito; Shikasyo, Shiomi

    2005-01-01

    It is widely known that habitat selections of riverine fish differ within and between rivers. In our past study, the preference intensity of Japanese Medaka (Oryzias latipes) to three environmental factors of water depth, current velocity and cover ratio was quantified on laboratory open-channel experiments for developing a general habitat preference model. A simplified fuzzy reasoning method was introduced in consideration of essential vagueness of fish behaviors. The fuzzy preference inten...

  8. Identifcation of Novel Retroid Agents in Danio rerio, Oryzias latipes, Gasterosteus aculeatus and Tetraodon nigroviridis

    Holly A. Basta

    2007-01-01

    Full Text Available Retroid agents are genomes that encode a reverse transcriptase (RT and replicate or transpose by way of an RNA intermediate. The Genome Parsing Suite (GPS is software created to identify and characterize Retroid agents in any genome database (McClure et al. 2005. The detailed analysis of all Retroid agents found by the GPS in Danio rerio (zebrafsh, Oryzias latipes (medaka, Gasterosteus aculeatus (stickleback and Tetraodon nigroviridis (spotted green pufferfish reveals extensive Retroid agent diversity in the compact genomes of all four fish. Novel Retroid agents were identified by the GPS software: the telomerase reverse transcriptase (TERT in O. latipes, G. aculeatus and T. nigroviridis and a potential TERT in D. rerio, a retrotransposon in D. rerio, and multiple lineages of endogenous retroviruses (ERVs in D. rerio, O. latipes and G. aculeatus.

  9. Bioaccumulation of 14C-hexachlorobenzene in eggs and fry of Japanese medaka (Oryzias latipes)

    Huang, Y.; Biddinger, G.R.; Gloss, S.P.

    1986-01-01

    Hexachlorobenzene (HCB) is a widespread pollutant that is persistent once it enters the ecosphere. It bioaccumulates in both terrestrial and aquatic animals and is not readily metabolized. Although HCB bioaccumulation in fresh water fish has been reported, few data are available on bioaccumulation of this or other chemicals during early developmental stages of fish. The authors used the Japanese medaka (Oryzias latipes) to examine the rates of HCB bioaccumulation during early life stages subjected to both short term (24 h) and long term (14 day) aqueous exposure. The relatively rapid development and ease of laboratory maintenance made the medaka an ideal organism for this purpose

  10. Developmental regulation of neuroligin genes in Japanese rice fish (oryzias latipes) embryogenesis maintains the rhythym during ethanol-in

    Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese rice fish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively ge...

  11. ALTERED GENE EXPRESSION AND DEVELOPMENT OF POTENTIAL BIOMARKERS IN MEDAKA (ORYZIAS LATIPES) BRAIN, LIVER AND TESTIS FOLLOWING EXPOSURE TO FIBRATE PHARMACEUTICALS

    To help address the consequences of increasing levels of environmental contaminants and to identify potentially novel markers of toxicity, we examined gene expression profiles from medaka (Oryzias latipes) exposed to a prototypical fibrate pharmaceutical. Changes in gene express...

  12. Alteration of General Behavior of Male Medaka,oryzias latipes,Exposed to Tributyltin and /or Polychlorinated Biphenyls

    Nakayama, Kei; Oshima, Yuji; Hiramatsu, Kazuaki; Honjo, Tsuneo

    2004-01-01

    We examined the general behavior of male Japanese medaka, Oryzias latipes, after exposed to tributyltin (TBT), polychlorinated biphenyls (PCBs), or a mixture of these chamicals at a concentration of 1μg/g body weight daily for 3 weeks. We analyzed swimming velocity as an indicator of acute toxicity and counted the frequencies of straight swimming and swimming in circles. We also calclated the entropy of the positions of the fish within the experimental chamber. Neither TBT nor PCBs nor their ...

  13. Differential maturation of rhythmic clock gene expression during early development in medaka (Oryzias latipes).

    Cuesta, Ines H; Lahiri, Kajori; Lopez-Olmeda, Jose Fernando; Loosli, Felix; Foulkes, Nicholas S; Vallone, Daniela

    2014-05-01

    One key challenge for the field of chronobiology is to identify how circadian clock function emerges during early embryonic development. Teleosts such as the zebrafish are ideal models for studying circadian clock ontogeny since the entire process of development occurs ex utero in an optically transparent chorion. Medaka (Oryzias latipes) represents another powerful fish model for exploring early clock function with, like the zebrafish, many tools available for detailed genetic analysis. However, to date there have been no reports documenting circadian clock gene expression during medaka development. Here we have characterized the expression of key clock genes in various developmental stages and in adult tissues of medaka. As previously reported for other fish, light dark cycles are required for the emergence of clock gene expression rhythms in this species. While rhythmic expression of per and cry genes is detected very early during development and seems to be light driven, rhythmic clock and bmal expression appears much later around hatching time. Furthermore, the maturation of clock function seems to correlate with the appearance of rhythmic expression of these positive elements of the clock feedback loop. By accelerating development through elevated temperatures or by artificially removing the chorion, we show an earlier onset of rhythmicity in clock and bmal expression. Thus, differential maturation of key elements of the medaka clock mechanism depends on the developmental stage and the presence of the chorion.

  14. Chromosomal studies on radiation-induced gynogenesis and diploid gynogenesis in the fish Oryzias latipes

    Ijiri, Kenichi

    1983-01-01

    When sperm of the fish Oryzias latipes exposed to radiation fertilize normal eggs, the 'Hertwig effect' occurs, namely a high mortality of embryos at low doses but a better survival at high doses. This phenomenon induced by ultraviolet light (UV) or gamma-rays was previously studied quantitatively using the survival frequencies of embryos at various stages during their development. From the genetic analysis of both UV and gamma-ray effects, using the wild-type sperm of this species and then checking the appearance of melanophores on the yolk sacs of embryos, it was suggested that sperm chromosomes do not participate in embryonic development at high doses. The number of chromosomes in cells of the embryos which survive till stage 26 were counted, finding haploid embryos in the dose region of the Hertwig phenomenon. The analysis of chromosome number was mostly in agreement with the genetic studies, but there existed a few cases in which these two methods of analysis did show the opposite results. From these data, the validity of the genetic studies based on the appearance of melanophores on the yolk sac is discussed. Attempts to produce diploid gynogenesis through the cold temperature treatment are also reported. (author)

  15. Chronic fluoxetine treatment induces anxiolytic responses and altered social behaviors in medaka, Oryzias latipes.

    Ansai, Satoshi; Hosokawa, Hiroshi; Maegawa, Shingo; Kinoshita, Masato

    2016-04-15

    Medaka (Oryzias latipes) is a small freshwater teleost that is an emerging model system for neurobehavioral research and toxicological testing. The selective serotonin reuptake inhibitor class of antidepressants such as fluoxetine is one of the widely prescribed drugs, but little is known about the effects of these drugs on medaka behaviors. To assess the behavioral effects of fluoxetine, we chronically administrated fluoxetine to medaka adult fish and analyzed the anxiety-related and social behaviors using five behavioral paradigms (diving, open-field, light-dark transition, mirror-biting, and social interaction) with an automated behavioral testing system. Fish chronically treated with fluoxetine exhibited anxiolytic responses such as an overall increased time spent in the top area in the diving test and an increased time spent in center area in the open-field test. Analysis of socially evoked behavior showed that chronic fluoxetine administration decreased the number of mirror biting times in the mirror-biting test and increased latency to first contact in the social interaction test. Additionally, chronic fluoxetine administration reduced the horizontal locomotor activity in the open-field test but not the vertical activity in the diving test. These investigations are mostly consistent with previous reports in the other teleost species and rodent models. These results indicate that behavioral assessment in medaka adult fish will become useful for screening of effects of pharmaceutical and toxicological compounds in animal behaviors. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Developmental toxicity from exposure to various forms of mercury compounds in medaka fish (Oryzias latipes embryos

    Wu Dong

    2016-08-01

    Full Text Available This study examined developmental toxicity of different mercury compounds, including some used in traditional medicines. Medaka (Oryzias latipes embryos were exposed to 0.001–10 µM concentrations of MeHg, HgCl2, α-HgS (Zhu Sha, and β-HgS (Zuotai from stage 10 (6–7 hpf to 10 days post fertilization (dpf. Of the forms of mercury in this study, the organic form (MeHg proved the most toxic followed by inorganic mercury (HgCl2, both producing embryo developmental toxicity. Altered phenotypes included pericardial edema with elongated or tube heart, reduction of eye pigmentation, and failure of swim bladder inflation. Both α-HgS and β-HgS were less toxic than MeHg and HgCl2. Total RNA was extracted from survivors three days after exposure to MeHg (0.1 µM, HgCl2 (1 µM, α-HgS (10 µM, or β-HgS (10 µM to examine toxicity-related gene expression. MeHg and HgCl2 markedly induced metallothionein (MT and heme oxygenase-1 (Ho-1, while α-HgS and β-HgS failed to induce either gene. Chemical forms of mercury compounds proved to be a major determinant in their developmental toxicity.

  17. Effects of methyl testosterone exposure on sexual differentiation in medaka, Oryzias latipes

    Papoulias, D.M.; Noltie, Douglas B.; Tillitt, D.E.

    2000-01-01

    Studies were conducted to characterize effects of a known androgen on sexual differentiation and development of medaka, Oryzias latipes (d-rR strain), at two life stages. Embryos were injected with graded doses of methyl testosterone (MT) prior to epiboly. The occurrence of sex-reversal, and the gonadosomatic index (GSI) were evaluated in adults. Primary germ cells were counted and gonad volumes calculated for larvae to determine if sex-reversal could be detected at an early life stage. Sex-reversal of genetic females to phenotypic males was observed at both life stages. The GSI for phenotypic females was greater than for phenotypic males, while the GSI in XX males was similar to XY males. MT appeared to reduce the GSI of XX females exposed to MT but not sex-reversed. Our results indicate that embryonic exposure to androgens influences sexual development in medaka. Utilizing the d-rR strain of medaka allows detection of an effect as early as 2 weeks after chemical exposure making this a useful tool to screen chemicals for effects on sexual differentiation. Copyright (C) 2000.

  18. A genetic screen for mutations affecting embryonic development in medaka fish (Oryzias latipes).

    Loosli, F; Köster, R W; Carl, M; Kühnlein, R; Henrich, T; Mücke, M; Krone, A; Wittbrodt, J

    2000-10-01

    In a pilot screen, we assayed the efficiency of ethylnitrosourea (ENU) as a chemical mutagen to induce mutations that lead to early embryonic and larval lethal phenotypes in the Japanese medaka fish, Oryzias latipes. ENU acts as a very efficient mutagen inducing mutations at high rates in germ cells. Three repeated treatments of male fish in 3 mM ENU for 1 h results in locus specific mutation rates of 1.1-1.95 x10(-3). Mutagenized males were outcrossed to wild type females and the F1 offspring was used to establish F2 families. F2 siblings were intercrossed and the F3 progeny was scored 24, 48 and 72 h after fertilization for morphological alterations affecting eye development. The presented mutant phenotypes were identified using morphological criteria and occur during early developmental stages of medaka. They are stably inherited in a Mendelian fashion. The high efficiency of ENU to induce mutations in this pilot screen indicates that chemical mutagenesis and screening for morphologically visible phenotypes in medaka fish allows the genetic analysis of specific aspects of vertebrate development complementing the screens performed in other vertebrate model systems.

  19. Evaluation of 2,4-dichlorophenol exposure of Japanese medaka, Oryzias latipes, using a metabolomics approach.

    Kokushi, Emiko; Shintoyo, Aoi; Koyama, Jiro; Uno, Seiichi

    2017-12-01

    In this study, the metabolic effects of waterborne exposure of medaka (Oryzias latipes) to nominal concentrations of 20 (L group) and 2000 μg/L (H group) 2,4-dichlorophenol (DCP) were examined using a gas chromatography/mass spectroscopy (GC/MS) metabolomics approach. A principal component analysis (PCA) separated the L, H, and control groups along PC1 to explain the toxic effects of DCP at 24 h of exposure. Furthermore, the L and H groups were separated along PC1 at 96 h on the PCA score plots. These results suggest that the effects of DCP depended on exposure concentration and time. Changes in tricarboxylic cycle metabolites suggested that fish exposed to 2,4-DCP require more energy to metabolize and eliminate DCP, particularly at 96 h of exposure. A time-dependent response in the fish exposed to DCP was observed in the GC/MS data, suggesting that the higher DCP concentration had greater effects at 24 h than those observed in response to the lower concentration. In addition, several essential amino acids (arginine, histidine, lysine, isoleucine, leucine, methionine, phenylalanine, threonine, tryptophan, and valine) decreased after DCP exposure in the H group, and starvation condition and high concentration exposure of DCP could consume excess energy from amino acids.

  20. The notochord curvature in medaka (Oryzias latipes) embryos as a response to ultraviolet A irradiation.

    Sayed, Alaa El-Din Hamid; Mitani, Hiroshi

    2016-11-01

    In the present work, the destructive effects of ultraviolet A (UVA; 366nm) irradiation on the developmental stages of Japanese medaka (Oryzias latipes) are revealed in terms of hatching success, mortality rate, and morphological malformations (yolk sac edema, body curvature, fin blistering, and dwarfism). Fertilized eggs in stage 4 were exposed to 15, 30, and 60min/day UVA for 3days in replicates. Fish were staged and aged following the stages established by Iwamatsu [1]. We observed and recorded the hatching time and deformed and dead embryos continuously. The hatching time was prolonged and the deformed and dead embryos numbers were increased by UVA dose increase. At stage 40, samples from each group were fixed to investigate their morphology and histopathology. Some morphological malformations were recorded after UVA exposure in both strains. Histopathological changes were represented as different shapes of curvature in notochord with collapse. The degree of collapsation was depended on the dose and time of UVA exposure. Our findings show that exposure to UVA irradiation caused less vertebral column curvature in medaka fry. Moreover, p53-deficient embryos were more tolerant than those of wild-type (Hd-rR) Japanese medaka. This study indicated the dangerous effects of the UVA on medaka. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Habituation of medaka (Oryzias latipes) demonstrated by open-field testing.

    Matsunaga, Wataru; Watanabe, Eiji

    2010-10-01

    Habituation to novel environments is frequently studied to analyze cognitive phenotypes in animals, and an open-field test is generally conducted to investigate the changes that occur in animals during habituation. The test has not been used in behavioral studies of medaka (Oryzias latipes), which is recently being used in behavioral research. Therefore, we examined the open-field behavior of medaka on the basis of temporal changes in 2 conventional indexes of locomotion and position. The findings of our study clearly showed that medaka changed its behavior through multiple temporal phases as it became more familiar with new surroundings; this finding is consistent with those of other ethological studies in animals. During repeated open-field testing on 2 consecutive days, we observed that horizontal locomotion on the second day was less than that on the first day, which suggested that habituation is retained in fish for days. This temporal habituation was critically affected by water factors or visual cues of the tank, thereby suggesting that fish have spatial memory of their surroundings. Thus, the data from this study will afford useful fundamental information for behavioral phenotyping of medaka and for elucidating cognitive phenotypes in animals. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  2. On the manganese content of the egg of Oryzias latipes and its change during the early development

    Hori, R.; Iwasaki, S.I.

    1976-01-01

    The content of manganese of the egg of Oryzias latipes was determined by atomic absorption spectrophotometry and activation analysis. The amount of manganese in the unfertilized egg was 0.51 mμg and increased remarkably in one hour after fertilization. Although the increasing rate became gradually lower in further stages, the content of manganese amounted to 2.61 mμg in the embryo after gastrulation. Tracer-experiments showed that the egg accumulated manganese positively from the surrounding medium during the short time after fertilization. (author)

  3. Effects of gamma-rays on the taste buds of embryos and adults of the fish Oryzias latipes

    Ghoneum, M.M.H.; Ijiri, K.; Egami, N.; Hamed, M.S.; Gabr, O.M.

    1983-01-01

    The present study was performed in order to evaluate the state of activity of the taste bud cells of the fish Oryzias latipes. Two types of taste bud cells, namely pale cells and dark cells were distinguished and scored separately. From the irradiation experiment on adult fish, it was found that pale cells were more radiosensitive than are dark cells. At 10 days after irradiation with 1000 R, repopulation of the pale cells was observed and their number returned almost to the control value. In the experiments using various stages of embryos, the formation of the taste bud cells was highly radiosensitive at their early embryonic stages. (author)

  4. GONADAL DEVELOPMENT AND ENDOCRINE RESPONSES IN JAPANESE MEDAKA (ORYZIAS LATIPES) EXPOSED TO O,P'-DDT IN WATER OR THROUGH MATERNAL TRANSFER

    Various isomers and metabolites of DDT disrupt endocrine systems and gonadal development in fish andxwildlife and o,p'-DDT has been shown to be a relatively potent estrogen agonist. In this study, we exposed Japanese medaka (Oryzias latipes) to o,p'-DDT using two exposure protoco...

  5. Fish short-term reproduction assay with atrazine and the Japanese medaka (Oryzias latipes).

    Hosmer, Alan J; Schneider, Suzanne Z; Anderson, Julie C; Knopper, Loren D; Brain, Richard A

    2017-09-01

    Breeding groups of Japanese medaka (Oryzias latipes) were exposed to atrazine at measured concentrations of 0.6, 5.5, and 53 μg/L for 35 d. Evaluated endpoints included survival, fecundity, fertility, growth (weight and length), behavior, secondary sex characteristics (anal fin papillae), gonad histopathology, and hepatic vitellogenin. No statistically significant effects of atrazine exposure on survival and growth of medaka were noted during the test, and mean survival was ≥97.5% in all treatment groups on day 35. No significant effects of atrazine exposure on reproduction were observed. The number of mean cumulative eggs produced in the negative control and the 0.6, 5.5, and 53 μg/L treatment groups was 7158, 6691, 6883, and 6856, respectively. The mean number of eggs per female reproductive day was 40.9, 38.2, 40.2, and 39.2, respectively. There were also no dose-dependent effects on mean anal fin papillae counts among male fish or expression of vtg-II in males or females. In addition, atrazine exposure was not related to the developmental stage of test fish, with testes stages ranging from 2 to 3 in all groups and ovaries ranging from stage 2 to 2.5. Overall, exposure to atrazine up to 53 µg/L for 35 d did not result in significant, treatment-related effects on measured endpoints related to survival, growth, or reproduction in Japanese medaka. Environ Toxicol Chem 2017;36:2327-2334. © 2017 SETAC. © 2017 SETAC.

  6. Quantifiable biomarkers of normal aging in the Japanese medaka fish (Oryzias latipes.

    Lingling Ding

    2010-10-01

    Full Text Available Small laboratory fish share many anatomical and histological characteristics with other vertebrates, yet can be maintained in large numbers at low cost for lifetime studies. Here we characterize biomarkers associated with normal aging in the Japanese medaka (Oryzias latipes, a species that has been widely used in toxicology studies and has potential utility as a model organism for experimental aging research.The median lifespan of medaka was approximately 22 months under laboratory conditions. We performed quantitative histological analysis of tissues from age-grouped individuals representing young adults (6 months old, mature adults (16 months old, and adults that had survived beyond the median lifespan (24 months. Livers of 24-month old individuals showed extensive morphologic changes, including spongiosis hepatis, steatosis, ballooning degeneration, inflammation, and nuclear pyknosis. There were also phagolysosomes, vacuoles, and residual bodies in parenchymal cells and congestion of sinusoidal vessels. Livers of aged individuals were characterized by increases in lipofuscin deposits and in the number of TUNEL-positive apoptotic cells. Some of these degenerative characteristics were seen, to a lesser extent, in the livers of 16-month old individuals, but not in 6-month old individuals. The basal layer of the dermis showed an age-dependent decline in the number of dividing cells and an increase in senescence-associated β-galactosidase. The hearts of aged individuals were characterized by fibrosis and lipofuscin deposition. There was also a loss of pigmented cells from the retinal epithelium. By contrast, age-associated changes were not apparent in skeletal muscle, the ocular lens, or the brain.The results provide a set of markers that can be used to trace the process of normal tissue aging in medaka and to evaluate the effect of environmental stressors.

  7. Effects of triphenyltin on reproduction in Japanese medaka (Oryzias latipes) across two generations.

    Horie, Yoshifumi; Watanabe, Haruna; Takanobu, Hitomi; Shigemoto, Yoshiko; Yamagishi, Takahiro; Iguchi, Taisen; Tatarazako, Norihisa

    2017-11-01

    Triphenyltin (TPT) is an organotin compound used in marine anti-fouling coatings to prevent the attachment and growth of marine organisms, and it has negative effects on aquatic organisms. TPT is still detected at low concentrations, although its use has been prohibited at least in the European Community and is restricted in Japan as well. Studies using Japanese medaka (Oryzias latipes) indicate that TPT has the potential to inhibit reproduction. Although TPT is detected in many aquatic ecosystems, the multi-generational impact of TPT remains unknown. We investigated the two-generational effects of TPT on Japanese medaka and examined the relationships of several such effects between the F0 and F1 generations. Suppression of fecundity was observed in both generations, and fertility and growth were inhibited in the F1 generation. Moreover, delayed hatching and lower hatchability were observed in F1 embryos. Importantly, the value of the lowest observed effect concentration (LOEC) for these influences in F1 was lower than that in F0: that is, the LOEC values of fecundity and mortality were 3.2μg/L in the F0 generation and 1.0μg/L in the F1 generation. Fertility was not affected by TPT in F0, whereas it was significantly suppressed in the 1.0μg/L-exposure group of the F1 generation. Our results provide the first evidence of the effects of TPT on reproduction in a teleost fish across two generations, highlighting the concern that TPT could affect reproduction and mortality at decreasing concentrations in temporally overlapping generations. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Toxicity implications for early life stage Japanese medaka (Oryzias latipes) exposed to oxyfluorfen.

    Powe, Doris K; Dasmahapatra, Asok K; Russell, Joseph L; Tchounwou, Paul B

    2018-05-01

    We investigated the potential toxic effects of Oxyfluorfen (OXY), an herbicide used in agriculture, on the embryo-larval development of Japanese medaka fish (Oryzias latipes). Embryos (1-day postfertilization) and larvae (2-day posthatch) were exposed to OXY (0.5-8 mg/L) for 96 h and evaluated for mortality and hatching on embryos, and the mortality and growth on larvae during depuration. It was observed that the embryo-mortality was inconsistently altered by OXY; only the 2 mg/L group showed significant reduction on embryo survivability. However, larval-mortality was concentration-dependent and OXY exposure induced scoliosis-like phenotypic features in the surviving larvae; the calculated LC 50 was 5.238 mg/L. Our data further indicated that larval skeleton, both axial and appendicular, was the potential target site of OXY. Skeletal growth in larvae exposed to 2 mg/L was inhibited significantly until 1 week of depuration with regard to the linear lengths of neurocranium, Meckel's cartilage, caudal vertebrae (first 10) in the axial skeletons, and pectoral fin and urostyle in the appendicular skeletons. Moreover, the total protein content remained unaltered by OXY after 96 h exposure; while the RNA concentration was reduced significantly in larvae exposed to 2 mg/L. Expression analysis of several genes by quantitative real-time RT-PCR (RT-qPCR) showed significant upregulation of zic5, a zinc-finger type transcription regulator, at the transcription level. This study indicated that the scoliosis induced by OXY in Japanese medaka larvae was the result of stunted skeletal growth, probably because of deregulation of zinc-finger type transcription regulators, at the genomic level. © 2018 Wiley Periodicals, Inc.

  9. Aquatic toxicity of cartap and cypermethrin to different life stages of Daphnia magna and Oryzias latipes.

    Kim, Younghee; Jung, Jinyong; Oh, Sorin; Choi, Kyungho

    2008-01-01

    Cartap and cypermethrin, which are among the most widely used pesticides in many countries, are considered safe because of their low mammalian toxicity and their low persistence in the environment. However, recent findings of endocrine-disrupting effects and developmental neurotoxicity have raised concerns about the potential ecological impacts of these pesticides. We evaluated the aquatic toxicity of cartap [S,S'-(2-dimethylaminotrimethylene) bis(thiocarbamate), unspecified hydrochloride] and cypermethrin [(RS)-alpha-cyano-3-phenoxybenzyl-(1RS,3RS,1RS,3SR)-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane carboxylate], both individually and combined, on different life stages of the freshwater cladoceran Daphnia magna and a freshwater teleost, Japanese medaka (Oryzias latipes). The 96-hr Daphnia median effective concentrations (EC50s) for cartap and cypermethrin were 91.0 microg/L and 0.00061 microg/L, respectively. Rapid recovery of Daphnia was observed after short-term pulsed exposure to cartap and cypermethrin; there were no adverse effects on reproduction or survival 20 d after a 24 hr exposure to cartap up to 1240 microg/L and cypermethrin up to 1.9 microg/L. Chronic continuous exposure (for 21 d) of 7-d-old Daphnia to cypermethrin significantly reduced the intrinsic population growth rate in a concentration-dependent manner. However, because the intrinsic population growth rates were all above zero, populations did not decrease even at the highest experimental concentration of 200 ng/L. Exposure of Daphnia neonates (cartap or 40 microg/L of cypermethrin. The mixture of both compounds showed no synergistic toxicity. The extremely high acute-to-chronic ratio suggests that the standard acute lethal toxicity assessment might not reflect the true environmental hazards of these frequently used pesticides. Ecological hazard assessments of long-term low dose or pulsed exposures to cartap and cypermethrin may reveal more realistic consequences of these compounds in

  10. Change in the radiation responses of oogonia in the embryos and fry of the fish Oryzias latipes

    Hamaguchi, S.

    1976-01-01

    Embryos of the fish Oryzias latipes were irradiated with 1000 R of X-rays 1 day before hatching, and the post-irradiation change in the female germ-cell population was observed. Scarcely any reduction in the number of oogonia was observed, but their proliferation was inhibited. Repopulation occurred between 12 and 20 days after hatching. These responses were quite different from those of germ cells in the irradiated fry. Embryos and/or fry were also exposed to 1000 R of X-rays 1 day before hatching and 0, 1, 2, and 3 days after hatching. A comparison of their responses suggested that the change in the radiation responses of oogonia is correlated with the initiation of meiosis. (author)

  11. Effects of gamma-rays on morphology of the thymus of the adult fish of Oryzias latipes

    Ghoneum, M.M.H.; Ijiri, Ken-ichi; Egami, Nobuo

    1982-01-01

    The effects of gamma-rays on the thymus in the adult fish of Oryzias latipes were studied. Fish were subjected to a single whole-body irradiation of the dose ranging from 0 to 8 kR. Through the histological sections, the quantitative treatment was performed on the changes in thymus volume and mitotic activity of thymocytes after irradiation. The thymus in the irradiated fish exhibited a sudden drop in its volume on day 1-3 post-irradiation, subsequently followed by its regeneration. The change in mitotic index of thymocytes, especially in the regeneration phase, showed a dose-dependent behavior (same level as the control for 10 and 25 R; and overshoot for 100 and 200 R; a gradual recovery for 1 and 2 kR; no mitosis for 4 and 8 kR). (author)

  12. The utility of the guppy (Poecilia reticulata) and medaka (Oryzias latipes) in evaluation of chemicals for carcinogenicity.

    Kissling, Grace E; Bernheim, Naomi J; Hawkins, William E; Wolfe, Marilyn J; Jokinen, Micheal P; Smith, Cynthia S; Herbert, Ronald A; Boorman, Gary A

    2006-07-01

    There has been considerable interest in the use of small fish models for detecting potential environmental carcinogens. In this study, both guppies (Poecilia reticulata) and medaka (Oryzias latipes) were exposed in the aquaria water to three known rodent carcinogens for up to 16 months. Nitromethane, which caused mammary gland tumors by inhalation exposure in female rats, harderian gland and lung tumors in male and female mice, and liver tumors in female mice by inhalation, failed to increase tumors in either guppies or medaka. Propanediol, which when given in the feed was a multisite carcinogen in both sexes of rats and mice, caused increased liver tumors in male guppies and male medaka. There was reduced survival in female guppies and no increased tumors in female medaka. 1,2,3-Trichloropropane, which when administered by oral gavage was a multisite carcinogen in both sexes of rats and mice, caused an increased incidence of tumors in the liver of both male and female guppies and medaka and in the gallbladder of male and female medaka. The results of this study demonstrate that for these three chemicals, under these specific exposure conditions, the fish appear less sensitive and have a narrower spectrum of tissues affected than rodents. These results suggest that fish models are of limited utility in screening unknown chemicals for potential carcinogenicity.

  13. Evaluation of potential mechanisms of atrazine-induced reproductive impairment in fathead minnow (Pimephales promelas) and Japanese medaka (Oryzias latipes)

    Richter, Cathy; Papoulias, Diana M.; Whyte, Jeffrey J.; Tillitt, Donald E.

    2016-01-01

    Atrazine has been implicated in reproductive dysfunction of exposed organisms, and previous studies documented decreased egg production in Japanese medaka (Oryzias latipes) and fathead minnows (Pimephales promelas) during 30-d to 38-d exposures to 0.5 µg/L, 5 µg/L, and 50 µg/L atrazine. The authors evaluated possible mechanisms underlying the reduction in egg production. Gene expression in steroidogenesis pathways and the hypothalamus–pituitary–gonad axis of male and female fish was measured. Atrazine did not significantly induce gonad aromatase (cyp19a1a) expression. An atrazine-induced shift in the number of females in an active reproductive state was observed. Expression of the egg maturation genes vitellogenin 1 (vtg1) and zona pellucida glycoprotein 3.1 (zp3.1) in medaka females was correlated and had a bimodal distribution. In both species, females with low vtg1 or zp3.1 expression also had low expression of steroidogenesis genes in the gonad, estrogen receptor in the liver, and gonadotropins in the brain. In the medaka, the number of females per tank that had high expression of zp3.1 was significantly correlated with egg production per tank. The number of medaka females with low expression of zp3.1 increased significantly with atrazine exposure. Thus, the decline in egg production observed in response to atrazine exposure may be the result of a coordinated downregulation of genes required for reproduction in a subset of females.

  14. Effects of tributyltin on early life-stage, reproduction, and gonadal sex differentiation in Japanese medaka (Oryzias latipes).

    Horie, Yoshifumi; Yamagishi, Takahiro; Shintaku, Yoko; Iguchi, Taisen; Tatarazako, Norihisa

    2018-07-01

    Tributyltin, an organotin compound, was used worldwide as an antifouling agent in aquatic environments and there has been much concern about the toxicological and ecotoxicological properties of organotin compounds. Even though it has been prohibited worldwide, tributyltin is still detected at low concentrations in aquatic environments. Here we investigated the effects of tributyltin on the early life-stage, reproduction, and gonadal sex differentiation in Japanese medaka (Oryzias latipes). In adults, exposure to tributyltin at 3.82 μg/L suppressed fecundity and fertility and increased mortality. At 10.48 μg/L all medaka died by the sixth day of exposure. Exposure to tributyltin during early life-stages induced no significant differences in mortality or embryonic development, but growth was suppressed in groups exposed to 0.13 and 0.68 μg/L. Furthermore, there was no abnormal gonadal development in Japanese medaka exposed to tributyltin. These results provide evidence of the negative effects of tributyltin on reproduction in a teleost fish. Tributyltin did not affect gonadal sex differentiation in Japanese medaka, but fecundity and fertility were suppressed, although it is not clear whether this suppression resulted from the endocrine-disrupting action of tributyltin or its toxicity. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Radioecological studies of 137Cs in limnological ecosystems. Biochemical states of 137Cs accumulated in killifish (Medaka, Oryzias latipes) meat

    Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki; Izumo, Yoshiro; Nakamura, Fumio.

    1997-01-01

    Biochemical states of 137 Cs accumulated in killifish's (Medaka, Oryzias latipes) meat were investigated in order to elucidate the accumulation mechanism of the radionuclide in goldfish, Carassius auratus auratus, examined in our preceding report. Most of 137 Cs radioactivity in the killifish's raw meat accumulated this radionuclide in the radioactive freshwater, were found in the non-protein nitrogenous compound (NPNC) fraction (>92%), also in the killifish's control raw meat mixed with 137 Cs, the difference between both meat samples was not clear. As the results of gel filtration profiles on Sephadex G-25 for the NPNC fraction of these meats, each only one radioactive peak was shown, also similar to 137 CsCl solution. Moreover, these peaks appeared at the same position. On the other hand, the peak positions absorbed at OD 280nm in the samples were different from those of each radioactive peak. It was so suggested that 137 Cs accumulated in the killifish's meat was shown not to be binding to protein's composition. Furthermore, as the results on thin-layer chromatography, ion-exchange resin chromatography and reaction with 137 Cs in samples and ammonium phosphomolybdate, 137 Cs in the NPNC fraction of the killifish's meat was not almost different from those of each control and 137 CsCl solution. (author)

  16. Expression of c-fos gene in central nervous system of adult medaka (Oryzias latipes) after hypergravity stimulation

    Shimomura, S.; Ijiri, K.

    The immediate-early genes serve as useful neurobiological tools for mapping brain activity induced by a sensory stimulation. In this study, we have examined brain activity related to gravity perception of medaka (Oryzias latipes) by use of c-fos. The gene, which is homologous to the c-fos genes of other vertebrates, was identified in medaka. Functionally important domains are highly conserved among all the vertebrate species analyzed. Intraperitoneal administration of kainic acid transiently induced the c-fos mRNAs in medaka brain. The results indicate that the expression of c-fos can be utilized as a suitable anatomical marker for the increased neural activities in the central nervous system of medaka. Fish were continuously exposed to 3G hypergravity by centrifugation. Investigation of c-fos mRNA expression showed that c-fos mRNA significantly increased 30 minutes after a start of 3G exposure. The distribution of its transcripts within brains was analyzed by an in situ hybridization method. The 3G-treated medakas displayed c-fos positive cells in their brainstem regions, which are related to vestibular function, such as torus semicircularis, posterior octavu nucleus, nucleus tangentialis and inferior olive. Our results established the method to trace the activated area in the fish brain following gravity stimulation. The method will be a useful tool for understanding gravity perception in the brain.

  17. Impacts of low dose rate irradiation on the fertility, fecundity and hatchling survival of Japanese rice fish (medaka, Oryzias latipes)

    Hinton, T.G.; Coughlin, D.P.; Marsh, L.C.; Yi, Yi; Winn, R.

    2004-01-01

    A renewed international interest in the effects on biota from low dose rate irradiation has recently occurred. Much of that interest is centered on the relevance of previously accepted dose rate guidelines (e.g. 10 mGy d -1 for aquatic biota) suggested by the ICRP and IAEA. All parties concerned seem to agree that additional data are needed on population level impacts from chronic low-level exposures to radionuclides. Using a Low Dose Rate Irradiation Facility (LoDIF), we conducted an experiment on the fecundity, fertility and hatchling survival of Japanese Rice Fish (medaka, Oryzias latipes). Fish were exposed externally to 137 Cs from juvenile through adulthood at mean dose rates of 3.5, 35 and 350 mGy d -1 . Fish were bred at maturity and the following endpoints were examined: 1) the number of eggs produced; 2) the percent of eggs that hatched; and 3) the survival of hatchlings 20-days post hatch. The influence of gender was examined by breeding irradiated males with control females; control males with irradiated females; irradiated males with irradiated females; and control males with control females. The data contribute to our understanding the impacts of low dose rate irradiation. (author)

  18. Evaluation on potential for assessing indoor formaldehyde using biosensor system based on swimming behavior of Japanese medaka (oryzias latipes)

    Kim, Jonghun [Department of Architecture, The University of Tokyo, 4-6-1 Komaba, Meguro-Ku, Tokyo, 153-8505 (Japan); Kato, Shinsuke; Tatsuma, Tetsu [Institute of Industrial Science, The University of Tokyo, 4-6-1 Komaba, Meguro-Ku, Tokyo, 153-8505 (Japan); Takeuchi, Kenichiro [Sumitomo Forestry Co., Ltd. (Japan); Kang, Ik Joon [Aquatic Biomonitoring and Environmental Laboratory, Department of Bioscience and Biotechnology, Faculty of Agriculture, Kyushu University, Fukuoka, 812-8581 (Japan)

    2011-04-15

    In order to develop an early-warning biosensor system for predicting the impact on health of long-term and low-level exposure to indoor chemical compounds, e.g. volatile organic compounds (VOCs), we evaluated the potential for assessing indoor air quality using the biosensor system based on the swimming behavior of Japanese medaka (oryzias latipes) as an indicator of indoor air quality in the beginning. As a technology to dissolve chemical compounds into water efficiently, a micro bubble generator was introduced. The test chemical was formaldehyde which is a representative of chemical compounds existing indoors. The result of the measuring solubility of formaldehyde was that formaldehyde concentration in water was raised to 0.12 mg/L when 1.0 mg/m{sup 3} of formaldehyde in air was bubbled for approximately 44 h. The correlation between the 0.1 mg/L of formaldehyde in water, which is roughly equivalent to 0.83 mg/m{sup 3} of formaldehyde in air, and the swimming activities of medaka was investigated. The fish showed abnormal behavior compared to one under a control treatment, e.g. the body movement distance decreased and the duration time near the upper water column increased significantly. It was verified that it is possible to detect concentrations of formaldehyde of 0.83 mg/m{sup 3} in indoor air using this proposed biosensor system. (author)

  19. Verification of responses of Japanese medaka (Oryzias latipes) to anti-androgens, vinclozolin and flutamide, in short-term assays.

    Nakamura, Ataru; Takanobu, Hitomi; Tamura, Ikumi; Yamamuro, Masumi; Iguchi, Taisen; Tatarazako, Norihisa

    2014-05-01

    Various testing methods for the detection of the endocrine disruptive activities of chemicals have been developed in freshwater fish species. However, a few relatively easier specific methods for detecting anti-androgenic activities are available for fish. The aim of this study was to verify the papillary process in Japanese medaka (Oryzias latipes) as an indicator of the anti-androgenic activity of chemicals. Japanese medaka were exposed to two types of anti-androgenic compounds, vinclozolin and flutamide, using two short-term assays; one was conformed to the existing short-term reproduction assay using adult fish (adult test) and the other was a test based on the same methods but using juvenile fish at the beginning of exposure (juvenile test). Significant decreases in male papillary processes were observed in the juvenile test treated with the highest concentration of both antiandrogens (640 µg l(-1) vinclozolin and 1000 µg l(-1) flutamide); however, no significant effects were observed in the adult test. Consequently, our results indicate that papillary processes in Japanese medaka can be used as the end-point for screening the anti-androgenic activity of chemicals using juvenile fish for a specific period based on the existing short-term reproduction assay. Copyright © 2013 John Wiley & Sons, Ltd.

  20. Effects of the antiandrogens, vinclozolin and cyproterone acetate on gonadal development in the Japanese medaka (Oryzias latipes).

    Kiparissis, Yiannis; Metcalfe, Tracy L; Balch, Gordon C; Metcalfe, Chris D

    2003-05-29

    This study was focused on determining the effects of exposure to antiandrogens on the gonadal development of Japanese medaka (Oryzias latipes). Test compounds included the fungicide, vinclozolin and the clinical antiandrogen, cyproterone acetate. Newly hatched medaka were exposed to aqueous solutions of vinclozolin (2500 microg/l) and the vinclozolin fungicide formulation, Ronilan (1000 and 5000 microg/l) and cyproterone acetate (1 and 10 microg/l), for 3 months. Histological evaluation of the gonadal tissues of exposed fish indicated that the 5000 microg/l concentration of the vinclozolin formulation (Ronilan) induced a low incidence of intersex (i.e. testis-ova) and the 2500 microg/l concentration of vinclozolin-affected spermatogenesis in males. Also, the vinclozolin treatments induced moderate ovarian atresia. Cyproterone acetate also induced a low incidence of testis-ova, but in contrast to the vinclozolin treatment the amount of ovarian tissue in the testis-ova was equal to or greater than the amount of testicular tissue. In the cyproterone acetate treatments, both oogenesis and spermatogenesis were moderately inhibited at all test concentrations. The results of this study indicate that antiandrogens have the potential to alter testicular development and gametogenesis in fish. However, research is needed to determine the mechanisms by which antiandrogens affect fish.

  1. Effects of alachlor on the early development and induction of estrogen-responsive genes in Medaka, Oryzias latipes

    Lee, C.; Ryu, J.; Park, S.Y.; Choi, K.; Jeon, S.H.; Na, J.G.; Rhee, D.G. [National Inst. of Environmental Research, Incheon (Korea)

    2004-09-15

    Alachlor is an acetanilide herbicide used to control annual grasses and weeds in field corn, soybeans, and peanuts. It is a selective systemic herbicide, absorbed by germinating shoots and by roots. Although the specific pathways are not exactly understood, the acetanilide herbicides apparently interfere with several physiological processes including biosynthesis of lipids, proteins and flavonoids. These herbicides are widely used in agriculture and are commonly detected in surface water and groundwater. Alachlor has a relatively low acute toxicity, however, repeated exposure has been reported to cause hepatotoxicity, irreversible uveal degeneration and tumour formation in some animals. Besides alachlor is one of the herbicides reported to have endocrine disrupting effects. 2,4-D, 2,4,5-T, amitrole and atrazine also belong to these types of herbicides. Alachlor is a strongly suspected endocrine disruptor in that it is listed by EPA and the World Wildlife Fund [WWF] as a potential endocrine disrupting chemical. Many mammalian and aquatic toxicological studies with alachlor were performed under the conditions of acute, subacute and chronic experiment. However, not many studies using fish have been carried out with the purpose of screening and testing of endocrine disrupting effects of alachlor. The purpose of this study was to determine the effects of alachlor on the early morphological development of medaka (Oryzias latipes). Embryonic growth, deformation and hatching success were determined to see the effects of this chemical. Also, we tried to measure the estrogenic activity of alachlor using the ELISA and RT-PCR methods. By using these techniques, we evaluated the induction of the estrogen-responsive genes, vitellogenin (precursor of yolk protein) and choriogenin (precursor of egg envelope protein) in male medaka exposed to alachlor.

  2. Fluorescence in situ hybridization techniques (FISH) to detect changes in CYP19a gene expression of Japanese medaka (Oryzias latipes)

    Park, June-Woo; Tompsett, Amber; Zhang, Xiaowei; Newsted, John L.; Jones, Paul D.; Au, Doris; Kong, Richard; Wu, Rudolf S.S.; Giesy, John P.; Hecker, Markus

    2008-01-01

    The aim of this study was to develop a sensitive in situ hybridization methodology using fluorescence-labeled riboprobes (FISH) that allows for the evaluation of gene expression profiles simultaneously in multiple target tissues of whole fish sections of Japanese medaka (Oryzias latipes). To date FISH methods have been limited in their application due to autofluorescence of tissues, fixatives or other components of the hybridization procedure. An optimized FISH method, based on confocal fluorescence microscopy was developed to reduce the autofluorescence signal. Because of its tissue- and gender-specific expression and relevance in studies of endocrine disruption, gonadal aromatase (CYP19a) was used as a model gene. The in situ hybridization (ISH) system was validated in a test exposure with the aromatase inhibitor fadrozole. The optimized FISH method revealed tissue-specific expression of the CYP19a gene. Furthermore, the assay could differentiate the abundance of CYP19a mRNA among cell types. Expression of CYP19a was primarily associated with early stage oocytes, and expression gradually decreased with increasing maturation. No expression of CYP19a mRNA was observed in other tissues such as brain, liver, or testes. Fadrozole (100 μg/L) caused up-regulation of CYP19a expression, a trend that was confirmed by RT-PCR analysis on excised tissues. In a combination approach with gonad histology, it could be shown that the increase in CYP19a expression as measured by RT-PCR on a whole tissue basis was due to a combination of both increases in numbers of CYP19a-containing cells and an increase in the amount of CYP19a mRNA present in the cells

  3. Sound production in Japanese medaka (Oryzias latipes) and its alteration by exposure to aldicarb and copper sulfate.

    Kang, Ik Joon; Qiu, Xuchun; Moroishi, Junya; Oshima, Yuji

    2017-08-01

    This study is the first to report sound production in Japanese medaka (Oryzias latipes). Sound production was affected by exposure to the carbamate insecticide (aldicarb) and heavy-metal compound (copper sulfate). Medaka were exposed at four concentrations (aldicarb: 0, 0.25, 0.5, and 1 mg L -1 ; copper sulfate: 0, 0.5, 1, and 2 mg L -1 ), and sound characteristics were monitored for 5 h after exposure. We observed constant average interpulse intervals (approx 0.2 s) in all test groups before exposure, and in the control groups throughout the experiment. The average interpulse interval became significantly longer during the recording periods after 50 min of exposure to aldicarb, and reached a length of more than 0.3 s during the recording periods after 120 min exposure. Most medaka fish stopped to produce sound after 50 min of exposure to copper sulfate at 1 and 2 mg L -1 , resulting in significantly declined number of sound pulses and pulse groups. Relative shortened interpulse intervals of sound were occasionally observed in medaka fish exposed to 0.5 mg L -1 copper sulfate. These alternations in sound characteristics due to toxicants exposure suggested that they might impair acoustic communication of medaka fish, which may be important for their reproduction and survival. Our results suggested that using acoustic changes of medaka has potential to monitor precipitate water pollutions, such as intentional poisoning or accidental leakage of industrial waste. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Recovery from reproductive and morphological abnormalities in medaka (Oryzias latipes) following a 14-day exposure to diclofenac.

    Yokota, Hirofumi; Higashi, Kaho; Hanada, Erina; Matsuzaki, Ei; Tsuruda, Yukinari; Suzuki, Tomoko; Nakano, Eiko; Eguchi, Sayaka

    2017-12-01

    Mating pairs of medaka (Oryzias latipes) were exposed to diclofenac at measured concentrations of 0 (control), 7.1, 37, and 78 μg/L for 14 d under static-renewal conditions. Effects on reproductive success, as well as morphological abnormalities, of the fish were assessed. During the exposure period, both fecundity and fertility were significantly decreased in the 37- and 78-μg/L treatment groups, and swollen abdomens in females were observed in all exposure groups. Notably, a defect of the lower jaw was also observed in 4 male fish: 2 at 37 μg/L and 2 at 78 μg/L of diclofenac. Subsequently, we investigated whether the reproductive and morphological abnormalities induced by diclofenac would be permanent or reversible once the medaka were returned to clean water. The reproductive ability of paired medaka was gradually restored to fish that were cultured in clean water for 14 d. After this period in clean water, we also observed a noticeable decrease in swollen abdomens in females; however, mandibular defects in the males remained, even after the 14-d recovery period. Radiographic and histochemical examinations revealed that diclofenac might affect bone remodeling in the lower jaw of male medaka because of a disruption in osteoclast function. These results suggest that reproductive impairments in pairs of medaka exposed to diclofenac may be reversible but that skeletal deformities (i.e., mandibular defect) in males may be persistent. Environ Toxicol Chem 2017;36:3277-3283. © 2017 SETAC. © 2017 SETAC.

  5. Analysis of the Ush2a gene in medaka fish (Oryzias latipes.

    Elena Aller

    Full Text Available Patients suffering from Usher syndrome (USH exhibit sensorineural hearing loss, retinitis pigmentosa (RP and, in some cases, vestibular dysfunction. USH is the most common genetic disorder affecting hearing and vision and is included in a group of hereditary pathologies associated with defects in ciliary function known as ciliopathies. This syndrome is clinically classified into three types: USH1, USH2 and USH3. USH2 accounts for well over one-half of all Usher cases and mutations in the USH2A gene are responsible for the majority of USH2 cases, but also for atypical Usher syndrome and recessive non-syndromic RP. Because medaka fish (Oryzias latypes is an attractive model organism for genetic-based studies in biomedical research, we investigated the expression and function of the USH2A ortholog in this teleost species. Ol-Ush2a encodes a protein of 5.445 aa codons, containing the same motif arrangement as the human USH2A. Ol-Ush2a is expressed during early stages of medaka fish development and persists into adulthood. Temporal Ol-Ush2a expression analysis using whole mount in situ hybridization (WMISH on embryos at different embryonic stages showed restricted expression to otoliths and retina, suggesting that Ol-Ush2a might play a conserved role in the development and/or maintenance of retinal photoreceptors and cochlear hair cells. Knockdown of Ol-Ush2a in medaka fish caused embryonic developmental defects (small eyes and heads, otolith malformations and shortened bodies with curved tails resulting in late embryo lethality. These embryonic defects, observed in our study and in other ciliary disorders, are associated with defective cell movement specifically implicated in left-right (LR axis determination and planar cell polarity (PCP.

  6. Analysis of the Ush2a gene in medaka fish (Oryzias latipes).

    Aller, Elena; Sánchez-Sánchez, Ana V; Chicote, Javier U; García-García, Gema; Udaondo, Patricia; Cavallé, Laura; Piquer-Gil, Marina; García-España, Antonio; Díaz-Llopis, Manuel; Millán, José M; Mullor, José L

    2013-01-01

    Patients suffering from Usher syndrome (USH) exhibit sensorineural hearing loss, retinitis pigmentosa (RP) and, in some cases, vestibular dysfunction. USH is the most common genetic disorder affecting hearing and vision and is included in a group of hereditary pathologies associated with defects in ciliary function known as ciliopathies. This syndrome is clinically classified into three types: USH1, USH2 and USH3. USH2 accounts for well over one-half of all Usher cases and mutations in the USH2A gene are responsible for the majority of USH2 cases, but also for atypical Usher syndrome and recessive non-syndromic RP. Because medaka fish (Oryzias latypes) is an attractive model organism for genetic-based studies in biomedical research, we investigated the expression and function of the USH2A ortholog in this teleost species. Ol-Ush2a encodes a protein of 5.445 aa codons, containing the same motif arrangement as the human USH2A. Ol-Ush2a is expressed during early stages of medaka fish development and persists into adulthood. Temporal Ol-Ush2a expression analysis using whole mount in situ hybridization (WMISH) on embryos at different embryonic stages showed restricted expression to otoliths and retina, suggesting that Ol-Ush2a might play a conserved role in the development and/or maintenance of retinal photoreceptors and cochlear hair cells. Knockdown of Ol-Ush2a in medaka fish caused embryonic developmental defects (small eyes and heads, otolith malformations and shortened bodies with curved tails) resulting in late embryo lethality. These embryonic defects, observed in our study and in other ciliary disorders, are associated with defective cell movement specifically implicated in left-right (LR) axis determination and planar cell polarity (PCP).

  7. Benzo(a)pyrene-induced cytochrome p4501A expression of four freshwater fishes (Oryzias latipes, Danio rerio, Cyprinus carpio, and Zacco platypus).

    Lee, Jin Wuk; Yoon, Hong-Gil; Lee, Sung Kyu

    2015-05-01

    Oryzias latipes, Danio rerio, Cyprinus carpio, and Zacco platypus are useful indicator species for CYP1A biomarker studies; however, comparative studies have not been performed. To compare susceptibility, dose- and time-dependent CYP1A induction at the mRNA and protein levels in response to benzo(a)pyrene (BaP) exposure was analyzed. At the mRNA level, a statistically significant difference was found among the four species; however, such was not observed at the protein level. C. carpio showed the highest CYP1A induction level and the steepest slope in the dose-response curve. To assess susceptibility, the difference in CYP1A mRNA induction among species must be considered, and C. carpio was the most sensitive species of the four evaluated in terms of CYP1A expression. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Using CRISPR/Cas9-mediated gene editing to further explore growth and trade-off effects in myostatin-mutated F4 medaka (Oryzias latipes).

    Yeh, Ying-Chun; Kinoshita, Masato; Ng, Tze Hann; Chang, Yu-Hsuan; Maekawa, Shun; Chiang, Yi-An; Aoki, Takashi; Wang, Han-Ching

    2017-09-12

    Myostatin (MSTN) suppresses skeletal muscle development and growth in mammals, but its role in fish is less well understood. Here we used CRISPR/Cas9 to mutate the MSTN gene in medaka (Oryzias latipes) and evaluate subsequent growth performance. We produced mutant F0 fish that carried different frameshifts in the OlMSTN coding sequence and confirmed the heritability of the mutant genotypes to the F1 generation. Two F1 fish with the same heterozygous frame-shifted genomic mutations (a 22 bp insertion in one allele; a 32 bp insertion in the other) were then crossbred to produce subsequent generations (F2~F5). Body length and weight of the MSTN -/- F4 medaka were significantly higher than in the wild type fish, and muscle fiber density in the inner and outer compartments of the epaxial muscles was decreased, suggesting that MSTN null mutation induces muscle hypertrophy. From 3~4 weeks post hatching (wph), the expression of three major myogenic related factors (MRFs), MyoD, Myf5 and Myogenin, was also significantly upregulated. Some medaka had a spinal deformity, and we also observed a trade-off between growth and immunity in MSTN -/- F4 medaka. Reproduction was unimpaired in the fast-growth phenotypes.

  9. Distribution of the orphan nuclear receptor Nurr1 in medaka (Oryzias latipes): cues to the definition of homologous cell groups in the vertebrate brain.

    Kapsimali, M; Bourrat, F; Vernier, P

    2001-03-12

    The orphan nuclear receptor Nurr1 has been extensively studied in mammals and shown to contribute to the differentiation of several cell phenotypes in the nervous and endocrine systems. In this study, the gene homologous to the mammalian Nurr1 (NR4A2) was isolated in the teleost fish medaka (Oryzias latipes), and the distribution of its transcripts was analyzed within brains of embryos and adults. Nurr1 has a widespread distribution in the medaka brain. Large amounts of Nurr1 transcripts were found in the intermediate nucleus of the ventral telencephalon, preoptic magnocellular nucleus, ventral habenula, nucleus of the periventricular posterior tuberculum, and nuclei of glossopharyngeal and vagus nerves. To search for homologous cell groups between teleost fish and tetrapods brains, the co-localization of Nurr1 and tyrosine hydroxylase (TH) transcripts was analyzed. Neither Nurr1 nor TH expression was detected in the ventral midbrain, but both transcripts were present in the periventricular nucleus of the posterior tuberculum. This observation supports the hypothesis that this nucleus is homologous to dopaminergic mesencephalic nuclei of mammals. The presence of Nurr1 in the preoptic magnocellular nucleus of medaka and paraventricular hypothalamic nucleus of mammals reinforces the hypothesis of homology between these areas. TH and Nurr1 transcripts are also co-localized, among others, in the nucleus of the paraventricular organ and nucleus of the vagus nerve. This work suggests that the differentiating role of Nurr1 in the central nervous system is conserved in gnathostomes. Copyright 2001 Wiley-Liss, Inc.

  10. Nanosecond pulsed electric field suppresses development of eyes and germ cells through blocking synthesis of retinoic acid in Medaka (Oryzias latipes.

    Eri Shiraishi

    Full Text Available Application of nanosecond pulsed electric fields (nsPEFs has attracted rising attention in various scientific fields including medical, pharmacological, and biological sciences, although its effects and molecular mechanisms leading to the effects remain poorly understood. Here, we show that a single, high-intensity (10-30 kV/cm, 60-ns PEF exposure affects gene expression and impairs development of eyes and germ cells in medaka (Oryzias latipes. Exposure of early blastula stage embryos to nsPEF down-regulated the expression of several transcription factors which are essential for eye development, causing abnormal eye formation. Moreover, the majority of the exposed genetic female embryos showed a fewer number of germ cells similar to that of the control (unexposed genetic male at 9 days post-fertilization (dpf. However, all-trans retinoic acid (atRA treatment following the exposure rescued proliferation of germ cells and resumption of normal eye development, suggesting that the phenotypes induced by nsPEF are caused by a decrease of retinoic acid levels. These results confirm that nsPEFs induce novel effects during embryogenesis in medaka.

  11. The vasa-like gene, olvas, identifies the migration path of primordial germ cells during embryonic body formation stage in the medaka, Oryzias latipes.

    Shinomiya, A; Tanaka, M; Kobayashi, T; Nagahama, Y; Hamaguchi, S

    2000-08-01

    The medaka homolog of the Drosophila vasa gene, olvas (Oryzias latipes vas) was obtained using polymerase chain reaction of medaka cDNA from the testis and ovary. The spatio-temporal expression pattern of olvas transcripts was observed by in situ hybridization on gonads and embryos. The transcripts for olvas were exclusively detected in the cytoplasm of germ cells in the testis and ovary, not in gonadal somatic cells. In the early developmental stages, each blastomere possessed the maternal transcripts of olvas, which disappeared during gastrula stages. At the late gastrula stage, specific expression of olvas was observed only in germline cells located at the posterior shield. Embryos after the hybridization were examined histologically, and the distribution and migration path of primordial germ cells (PGC) during early stages of embryonic-body formation were revealed using the olvas gene as a germline cell marker. The PGC were translocated from the posterior shield to both sides of the embryonic body via the inner embryonic body in the medaka.

  12. Irradiation-injured brain tissues can self-renew in the absence of the pivotal tumor suppressor p53 in the medaka (Oryzias latipes) embryo

    Yasuda, Takako; Nagata, Kento; Igarashi, Kento; Watanabe-Asaka, Tomomi; Oda, Shoji; Mitani, Hiroshi; Kimori, Yoshitaka

    2016-01-01

    The tumor suppressor protein, p53, plays pivotal roles in regulating apoptosis and proliferation in the embryonic and adult central nervous system (CNS) following neuronal injuries such as those induced by ionizing radiation. There is increasing evidence that p53 negatively regulates the self-renewal of neural stem cells in the adult murine brain; however, it is still unknown whether p53 is essential for self-renewal in the injured developing CNS. Previously, we demonstrated that the numbers of apoptotic cells in medaka (Oryzias latipes) embryos decreased in the absence of p53 at 12-24 h after irradiation with 10-Gy gamma rays. Here, we used histology to examine the later morphological development of the irradiated medaka brain. In p53-deficient larvae, the embryonic brain possessed similar vacuoles in the brain and retina, although the vacuoles were much smaller and fewer than those found in wild-type embryos. At the time of hatching (6 days after irradiation), no brain abnormality was observed. In contrast, severe disorganized neuronal arrangements were still present in the brain of irradiated wild-type embryos. Our present results demonstrated that self-renewal of the brain tissue completed faster in the absence of p53 than wild type at the time of hatching because p53 reduces the acute severe neural apoptosis induced by irradiation, suggesting that p53 is not essential for tissue self-renewal in developing brain. (author)

  13. A protocol for adult somatic cell nuclear transfer in medaka fish (Oryzias latipes) with a high rate of viable clone formation.

    Bubenshchikova, Ekaterina; Kaftanovskaya, Elena; Adachi, Tomoko; Hashimoto, Hisashi; Kinoshita, Masato; Wakamatsu, Yuko

    2013-12-01

    Previously, we successfully generated fully grown, cloned medaka (the Japanese rice fish, Oryzias latipes) using donor nuclei from primary culture cells of adult caudal fin tissue and nonenucleated recipient eggs that were heat shock-treated to induce diploidization of the nuclei. However, the mechanism of clone formation using this method is unknown, and the rate of adult clone formation is not high enough for studies in basic and applied sciences. To gain insight into the mechanism and increase the success rate of this method of clone formation, we tested two distinct nuclear transfer protocols. In one protocol, the timing of transfer of donor nuclei was changed, and in the other, the size of the donor cells was changed; each protocol was based on our original methodology. Ultimately, we obtained an unexpectedly high rate of adult clone formation using the protocol that differed with respect to the timing of donor nuclei transfer. Specifically, 17% of the transplants that developed to the blastula stage ultimately developed into adult clones. The success rate with this method was 13 times higher than that obtained using the original method. Analyses focusing on the reasons for this high success rate of clone formation will help to elucidate the mechanism of clone formation that occurs with this method.

  14. Radioecological studies of {sup 137}Cs in limnological ecosystems. Biochemical states of {sup 137}Cs accumulated in killifish (Medaka, Oryzias latipes) meat

    Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki [Saitama Institute of Public Health, Urawa (Japan); Izumo, Yoshiro; Nakamura, Fumio

    1997-07-01

    Biochemical states of {sup 137}Cs accumulated in killifish`s (Medaka, Oryzias latipes) meat were investigated in order to elucidate the accumulation mechanism of the radionuclide in goldfish, Carassius auratus auratus, examined in our preceding report. Most of {sup 137}Cs radioactivity in the killifish`s raw meat accumulated this radionuclide in the radioactive freshwater, were found in the non-protein nitrogenous compound (NPNC) fraction (>92%), also in the killifish`s control raw meat mixed with {sup 137}Cs, the difference between both meat samples was not clear. As the results of gel filtration profiles on Sephadex G-25 for the NPNC fraction of these meats, each only one radioactive peak was shown, also similar to {sup 137}CsCl solution. Moreover, these peaks appeared at the same position. On the other hand, the peak positions absorbed at OD{sub 280nm} in the samples were different from those of each radioactive peak. It was so suggested that {sup 137}Cs accumulated in the killifish`s meat was shown not to be binding to protein`s composition. Furthermore, as the results on thin-layer chromatography, ion-exchange resin chromatography and reaction with {sup 137}Cs in samples and ammonium phosphomolybdate, {sup 137}Cs in the NPNC fraction of the killifish`s meat was not almost different from those of each control and {sup 137}CsCl solution. (author)

  15. Effects of silver nanoparticles on the development and histopathology biomarkers of Japanese medaka (Oryzias latipes) using the partial-life test.

    Wu, Yuan; Zhou, Qunfang; Li, Hongcheng; Liu, Wei; Wang, Thanh; Jiang, Guibin

    2010-10-15

    Silver nanoparticles (AgNPs) have emerged as an important class of nanomaterials and are currently used in a wide range of industrial and commercial applications. This has caused increasing concern about their effects on the environment and to human health. Using Japanese medaka (Oryzias latipes) at early-life stages as experimental models, the developmental toxicity of silver nanoparticles was investigated following exposure to 100-1000 μg/L homogeneously dispersed AgNPs for 70 days, and developmental endpoints were evaluated by microscopy during embryonic, larval and juvenile stages of development in medaka. Meanwhile, histopathological changes in the larval eye were evaluated. Retarded development and reduced pigmentation were observed in the treated embryos by AgNPs at high concentrations (≥ 400 μg/L). Maximum width of the optic tectum, as an indicator of midbrain development, decreased significantly in a dose-related manner. Furthermore, silver nanoparticles exposure at all concentrations induced a variety of morphological malformations such as edema, spinal abnormalities, finfold abnormalities, heart malformations and eye defects. Histopathological observations also confirmed the occurrence of abnormal eye development induced by AgNPs. The data showed non-linear or U-shaped dose-response patterns for growth retardation at 5 days of postfertilization, as well as the incidence of abnormalities. Preliminary results suggested that the developmental process of medaka may be affected by exposure to silver nanoparticles. Morphological abnormalities in early-life stages of medaka showed the potential developmental toxicities of silver nanoparticles. Further research should be focused on the mechanisms of developmental toxicity in fish exposed to silver nanoparticles. Crown Copyright 2009. Published by Elsevier B.V. All rights reserved.

  16. p,p'-DDE Induces Gonadal Intersex in Japanese Medaka (Oryzias latipes) at Environmentally Relevant Concentrations: Comparison with o,p'-DDT.

    Sun, Jianxian; Wang, Chen; Peng, Hui; Zheng, Guomao; Zhang, Shiyi; Hu, Jianying

    2016-01-05

    Previous studies have reported high body burdens of dichlorodiphenyltrichloroethane (DDT) and its metabolites in wild fishes worldwide. This study evaluated the adverse effects of 1,1-dichloro-2,2-bis (p-chlorophenyl)-ethylene (p,p'-DDE) and o,p'-DDT on gonadal development and reproduction by exposing transgenic Japanese medaka (Oryzias latipes) from hatch for 100 days. While both p,p'-DDE and o,p'-DDT induced intersex in male medaka, the lowest observable effective concentration (LOEC) of o,p'-DDT was 57.7 ng/g ww, about 5-fold lower than that (272 ng/g ww) of p,p'-DDE. Since LOECs of both chemicals were comparable to the body concentrations in wild fish, DDT contamination would likely contribute to the occurrence of intersex observed in wild fish. Exposure to o,p'-DDT resulted in much higher expression of vitellogenin in liver of males than p,p'-DDE, accordant with the higher potency of o,p'-DDT than p,p'-DDE to induce intersex. This phenomenon could be partly explained by the significantly elevated levels of 17β-estradiol in plasma of males exposed to o,p'-DDT, in addition to its estrogenic activity via the estrogen receptor. Significantly lower fertilization (p = 0.006) and hatchability (p = 0.019) were observed in the 13 intersex males. This study for the first time demonstrated the induction of intersex and reproductive effects of p,p'-DDE and o,p'-DDT at environmentally relevant concentrations.

  17. Development of a possible nonmammalian test system for radiation-induced germ-cell mutagenesis using a fish, the Japanese medaka (Oryzias latipes)

    Shima, A.; Shimada, A.

    1991-01-01

    To develop a specific-locus test (SLT) system for environmental mutagenesis using vertebrate species other than the mouse, we first established a tester stock of the fish medaka (Oryzias latipes) that is homozygous recessive at three loci. The phenotypic expression of these loci can be easily recognized early in embryonic development by observation through the transparent egg membrane. We irradiated wild-type males with 137Cs gamma-rays to determine the dose-response relationships for dominant lethal and specific-locus mutations induced in sperm, spermatids, and spermatogonia. Through observation of 322,666 loci in control offspring and 374,026 loci in offspring obtained from 0.64-, 4.75-, or 9.50-Gy-irradiated gametes, specific-locus mutations were phenotypically detected during early development. These putative mutations, designated total mutation, can be recognized only in embryos of oviparous animals. The developmental fate of these mutant embryos was precisely followed. During subsequent embryonic development, a large fraction died and thus was unavailable for test-crossing, which was used to identify viable mutations. Our medaka SLT system demonstrates that the vast majority of total mutations is associated with dominant lethal mutations. Thus far only one spontaneous viable mutation has been observed, so that all doubling calculations involving this endpoint carry a large error. With these reservations, however, we conclude that the quantitative data so far obtained from the medaka SLT are quite comparable to those from the mouse SLT and, hence, indicate the validity of the medaka SLT as a possible nonmammalian test system

  18. Quantitative structure-activity relationships for chronic toxicity of alkyl-chrysenes and alkyl-benz[a]anthracenes to Japanese medaka embryos (Oryzias latipes).

    Lin, Hongkang; Morandi, Garrett D; Brown, R Stephen; Snieckus, Victor; Rantanen, Toni; Jørgensen, Kåre B; Hodson, Peter V

    2015-02-01

    Alkylated polycyclic aromatic hydrocarbons (alkyl-PAHs) are a class of compounds found at significant concentrations in crude oils, and likely the main constituents responsible for the chronic toxicity of oil to fish. Alkyl substituents at different locations on the aromatic rings change the size and shape of PAH molecules, which results in different interactions with tissue receptors and different severities of toxicity. The present study is the first to report the toxicity of several alkylated derivatives of chrysene and benz[a]anthracene to the embryos of Japanese medaka (Oryzias latipes) using the partition controlled delivery (PCD) method of exposure. The PCD method maintained the desired exposure concentrations by equilibrium partitioning of hydrophobic test compounds from polydimethylsiloxane (PDMS) films. Test concentrations declined by only 13% over a period of 17 days. Based on the prevalence of signs of blue sac disease (BSD), as expressed by median effective concentrations (EC50s), benz[a]anthracene (B[a]A) was more toxic than chrysene. Alkylation generally increased toxicity, except at position 2 of B[a]A. Alkyl-PAHs substituted in the middle region had a lower EC50 than those substituted at the distal region. Except for B[a]A and 7-methylbenz[a]anthracene (7-MB), estimated EC50 values were higher than their solubility limits, which resulted in limited toxicity within the range of test concentrations. The regression between log EC50s and logKow values provided a rough estimation of structure-activity relationships for alkyl-PAHs, but Kow alone did not provide a complete explanation of the chronic toxicity of alkyl PAHs. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Ontogenetic improvement of visual function in the medaka Oryzias latipes based on an optomotor testing system for larval and adult fish

    Carvalho, Paulo S. M.; Noltie, Douglas B.; Tillitt, D.E.

    2002-01-01

    We developed a system for evaluation of visual function in larval and adult fish. Both optomotor (swimming) and optokinetic (eye movement) responses were monitored and recorded using a system of rotating stripes. The system allowed manipulation of factors such as width of the stripes used, rotation speed of the striped drum, and light illuminance levels within both the scotopic and photopic ranges. Precise control of these factors allowed quantitative measurements of visual acuity and motion detection. Using this apparatus, we tested the hypothesis that significant posthatch ontogenetic improvements in visual function occur in the medaka Oryzias latipes, and also that this species shows significant in ovo neuronal development. Significant improvements in the acuity angle alpha (ability to discriminate detail) were observed from approximately 5 degrees at hatch to 1 degree in the oldest adult stages. In addition, we measured a significant improvement in flicker fusion thresholds (motion detection skills) between larval and adult life stages within both the scotopic and photopic ranges of light illuminance. Ranges of flicker fusion thresholds (X±SD) at log I=1.96 (photopic) varied from 37.2±1.6 cycles/s in young adults to 18.6±1.6 cycles/s in young larvae 10 days posthatch. At log I=−2.54 (scotopic), flicker fusion thresholds varied from 5.8±0.7 cycles/s in young adults to 1.7±0.4 cycles/s in young larvae 10 days posthatch. Light sensitivity increased approximately 2.9 log units from early hatched larval stages to adults. The demonstrated ontogenetic improvements in visual function probably enable the fish to explore new resources, thereby enlarging their fundamental niche.

  20. Alteration of development and gene expression induced by in ovo-nanoinjection of 3-hydroxybenzo[c]phenanthrene into Japanese medaka (Oryzias latipes) embryos.

    Chen, Kun; Tsutsumi, Yuki; Yoshitake, Shuhei; Qiu, Xuchun; Xu, Hai; Hashiguchi, Yasuyuki; Honda, Masato; Tashiro, Kosuke; Nakayama, Kei; Hano, Takeshi; Suzuki, Nobuo; Hayakawa, Kazuichi; Shimasaki, Yohei; Oshima, Yuji

    2017-01-01

    Benzo[c]phenanthrene (BcP) is a highly toxic polycyclic aromatic hydrocarbon (PAHs) found throughout the environment. In fish, it is metabolized to 3-hydroxybenzo[c]phenanthrene (3-OHBcP). In the present study, we observed the effects of 1nM 3-OHBcP on the development and gene expression of Japanese medaka (Oryzias latipes) embryos. Embryos were nanoinjected with the chemical after fertilization. Survival, developmental stage, and heart rate of the embryos were observed, and gene expression differences were quantified by messenger RNA sequencing (mRNA-Seq). The exposure to 1nM 3-OHBcP accelerated the development of medaka embryos on the 1st, 4th, and 6th days post fertilization (dpf), and increased heart rates significantly on the 5th dpf. Physical development differences of exposed medaka embryos were consistent with the gene expression profiles of the mRNA-Seq results for the 3rd dpf, which show that the expression of 780 genes differed significantly between the solvent control and 1nM 3-OHBcP exposure groups. The obvious expression changes in the exposure group were found for genes involved in organ formation (eye, muscle, heart), energy supply (ATPase and ATP synthase), and stress-response (heat shock protein genes). The acceleration of development and increased heart rate, which were consistent with the changes in mRNA expression, suggested that 3-OHBcP affects the development of medaka embryos. The observation on the developmental stages and heart beat, in ovo-nanoinjection and mRNA-Seq may be efficient tools to evaluate the effects of chemicals on embryos. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Carbonic anhydrase 2-like and Na⁺-K⁺-ATPase α gene expression in medaka (Oryzias latipes) under carbonate alkalinity stress.

    Yao, Zongli; Lai, Qifang; Hao, Zhuoran; Chen, Ling; Lin, Tingting; Zhou, Kai; Wang, Hui

    2015-12-01

    High carbonate alkalinity is one of the major stress factors for living organisms in saline-alkaline water areas. Acute and chronic effects of carbonate alkalinity on expression of two genes, carbonic anhydrase 2-like (CA2-like) and Na(+)-K(+)-ATPase α subunit (NKA-α) mRNA in medaka (Oryzias latipes) were evaluated to better understand the responses important for coping with a carbonate alkalinity stress. In the acute exposure experiment, the expression of CA2-like and NKA-α mRNA in the gill and kidney of medaka were examined from 0 h to 7 days exposed to 30.4 mM carbonate alkalinity water. Exposure to high carbonate alkalinity resulted in a transitory alkalosis, followed by a transient increase in gill and kidney CA2-like and NKA-α mRNA expression. In the chronic exposure experiment, the expression of these two genes was examined in the gill and kidney at 50 days post-exposure to six different carbonate alkalinity concentrations ranging from 1.5 to 30.4 mM. Gill and kidney CA2-like mRNA levels in 30.4 mM were approximately 10 and 30 times higher than that of the control (1.5 mM), respectively. Less differences were found in NKA-α expression in the 50-days exposure. The results indicate that when transferred to high carbonate alkalinity water, a transitory alkalosis may occur in medaka, followed by compensatory acid-base and ion regulatory responses. Thus, CA2-like and NKA-α are at least two of the important factors that contribute to the regulation of alkalinity stress.

  2. Benzo[a]pyrene-induced immunotoxicity in Japanese medaka (Oryzias latipes): relationship between lymphoid CYP1A activity and humoral immune suppression

    Carlson, E.A.; Li, Y.; Zelikoff, J.T.

    2004-01-01

    Exposure to the environmental contaminant benzo[a]pyrene (BaP) results in suppression of immune function in both mammalian and fish species. This laboratory has previously demonstrated that a single intraperitoneal (IP) injection of BaP reduced lymphocyte proliferation, phagocyte-mediated superoxide generation, and antibody-forming cell (AFC) numbers in Japanese medaka (Oryzias latipes). The objective of the current study was to determine the role of BaP metabolism in the observed immunosuppression. Results from rodent studies have suggested that BaP elicits its immunotoxic effects via upregulation of cytochrome P4501A1 (CYP1A1) and the subsequent production of immunosuppressive BaP metabolites. In this study, exposure of medaka to 200 μg BaP/g BW significantly induced CYP1A expression or activity within lymphoid tissue 48 h post-IP injection; induction was observed specifically within distinct subpopulations of kidney mononuclear cells. Concurrent injection of fish with BaP and the CYP1A1 inhibitors α-naphthoflavone (ANF) or dehydroepiandrosterone (DHEA) resulted in inhibition of renal EROD activity and amelioration of BaP-induced suppression of medaka AFC numbers. Results of this study suggest that (1) BaP-induced suppression of medaka humoral immunity relies upon the CYP1A-catalyzed production of immunotoxic BaP metabolites and (2) BaP metabolites may be created in situ, directly by specific cells within kidney lymphoid tissue. Thus, apparently, mechanisms involved in BaP-induced immunosuppression have been phylogenetically conserved from fish to mammals

  3. Effects of benzophenone-3 exposure on endocrine disruption and reproduction of Japanese medaka (Oryzias latipes)—A two generation exposure study

    Kim, Sujin; Jung, Dawoon; Kho, Younglim; Choi, Kyungho

    2014-01-01

    Highlights: • Exposure to BP-3 led to adverse reproduction effects on Japanese medaka at 26 μg/L. • Changes in sex hormones and steroidogenic gene transcription were observed. • Parental exposure to BP-3 influenced on the growth of second generation fish. - Abstract: Benzophenone-3 (BP-3) has been widely used in sunscreens and cosmetics to protect human skin from the harmful effects of UV irradiation. While BP-3 has been frequently detected in surface waters, sediments and biota, only limited information is available on its in vivo toxicity, particularly in fish. In the present study the endocrine disrupting capacity of BP-3 and its underlying mechanisms were investigated using Japanese medaka (Oryzias latipes). Adult Japanese medaka pairs (F0) were exposed to 0, 4.7, 8.4, 26, or 90 μg/L (or 0, 15, 50, 150, or 500 μg/L of BP-3 based on nominal concentration) for 14 d and its effects on sex steroid hormones, and transcription of various associated genes were determined. Following additional 14 d of exposure, the F1 eggs reproduced were counted and were further exposed to 0, 5.4, 12, or 30 μg/L of BP-3 (or 0, 15, 50, or 150 μg/L based on nominal concentrations) until 30 d after hatching. Chemical analysis of the exposed media confirmed transformation of BP-3 to benzophenone-1 (BP-1), a more potent estrogen agonist. After 14 d of the adult fish exposure, plasma concentrations of testosterone (T) significantly increased in male fish. The 17β-estradiol (E2) to T (E2/T) ratio showed significant decreases in both male and female fish. Overall down-regulation of gonadal steroidogenic genes such as star, cyp11a, cyp17, hsd3b, hsd17b3, and cyp19a was also observed. After 28 d of exposure, the daily average egg reproduction per female was significantly reduced at 26 μg/L of BP-3. However, hatchability of F1 eggs was not affected by continuous exposure. After continued exposure until 30 dph, juvenile fish showed concentration-dependent decrease of condition factor

  4. Quantitative structure–activity relationships for chronic toxicity of alkyl-chrysenes and alkyl-benz[a]anthracenes to Japanese medaka embryos (Oryzias latipes)

    Lin, Hongkang [Department of Biology, Queen' s University, Kingston, Ontario K7L3N6 (Canada); Morandi, Garrett D. [School of Environmental Studies, Queen' s University, Kingston, Ontario K7L3N6 (Canada); Brown, R. Stephen [School of Environmental Studies, Queen' s University, Kingston, Ontario K7L3N6 (Canada); Department of Chemistry, Queen' s University, Kingston, Ontario K7L3N6 (Canada); Snieckus, Victor; Rantanen, Toni [Department of Chemistry, Queen' s University, Kingston, Ontario K7L3N6 (Canada); Jørgensen, Kåre B. [Department of Mathematics and Natural Sciences, University of Stavanger, 4036 Stavanger (Norway); Hodson, Peter V., E-mail: peter.hodson@queensu.ca [Department of Biology, Queen' s University, Kingston, Ontario K7L3N6 (Canada); School of Environmental Studies, Queen' s University, Kingston, Ontario K7L3N6 (Canada)

    2015-02-15

    Highlights: • Medaka embryos were exposed to alkyl chrysenes and benzo[a]anthracenes (BAA). • Concentrations were kept constant by partition controlled delivery. • Chrysene was not toxic within solubility limits, in contrast to BAA. • Alkylation increased the toxicity of chrysene and BAA. • Toxicity was related to hydrophobicity and to specific modes of action. - Abstract: Alkylated polycyclic aromatic hydrocarbons (alkyl-PAHs) are a class of compounds found at significant concentrations in crude oils, and likely the main constituents responsible for the chronic toxicity of oil to fish. Alkyl substituents at different locations on the aromatic rings change the size and shape of PAH molecules, which results in different interactions with tissue receptors and different severities of toxicity. The present study is the first to report the toxicity of several alkylated derivatives of chrysene and benz[a]anthracene to the embryos of Japanese medaka (Oryzias latipes) using the partition controlled delivery (PCD) method of exposure. The PCD method maintained the desired exposure concentrations by equilibrium partitioning of hydrophobic test compounds from polydimethylsiloxane (PDMS) films. Test concentrations declined by only 13% over a period of 17 days. Based on the prevalence of signs of blue sac disease (BSD), as expressed by median effective concentrations (EC50s), benz[a]anthracene (B[a]A) was more toxic than chrysene. Alkylation generally increased toxicity, except at position 2 of B[a]A. Alkyl-PAHs substituted in the middle region had a lower EC50 than those substituted at the distal region. Except for B[a]A and 7-methylbenz[a]anthracene (7-MB), estimated EC50 values were higher than their solubility limits, which resulted in limited toxicity within the range of test concentrations. The regression between log EC50s and log K{sub ow} values provided a rough estimation of structure–activity relationships for alkyl-PAHs, but K{sub ow} alone did not provide

  5. Toxic actions of dinoseb in medaka (Oryzias latipes) embryos as determined by in vivo 31P NMR, HPLC-UV and 1H NMR metabolomics.

    Viant, Mark R; Pincetich, Christopher A; Hinton, David E; Tjeerdema, Ronald S

    2006-03-10

    Changes in metabolism of Japanese medaka (Oryzias latipes) embryos exposed to dinoseb (2-sec-butyl-4,6-dinitrophenol), a substituted dinitrophenol herbicide, were determined by in vivo (31)P NMR, high-pressure liquid chromatography (HPLC)-UV, and (1)H NMR metabolomics. ATP and phosphocreatine (PCr) metabolism were characterized within intact embryos by in vivo (31)P NMR; concentrations of ATP, GTP, ADP, GDP, AMP and PCr were determined by HPLC-UV; and changes in numerous polar metabolites were characterized by (1)H NMR-based metabolomics. Rangefinding exposures determined two sublethal doses of dinoseb, 50 and 75 ppb, in which embryos survived from 1-day post fertilization (DPF) through the duration of embryogenesis. In vivo (31)P NMR data were acquired from 900 embryos in 0, 50, and 75 ppb dinoseb at 14, 62, and 110 h (n = 6 groups) after initiation of exposure. After 110 h, embryos were observed for normal development and hatching success, then either preserved in 10% formalin for growth analysis or flash frozen and extracted for HPLC-UV and (1)H NMR analysis. Dinoseb exposure at both concentrations resulted in significant declines in [ATP] and [PCr] at 110 h as measured by in vivo (31)P NMR (p fashion. Metabolic effects measured by in vivo (31)P NMR showed a significant increase in orthophosphate levels (P(i); p < 0.05), and significant decreases in [ATP], [PCr] and the PCr/P(i) ratio (p < 0.05). Metabolomics revealed a dose-response relationship between dinoseb and endogenous metabolite changes, with both dinoseb concentrations producing significantly different metabolic profiles from controls (p < 0.05). Metabolic changes included decreased concentrations of ATP, PCr, alanine and tyrosine, and increased concentrations of lactate with medaka embryotoxicity. This study demonstrated that medaka embryos respond to dinoseb with significant changes in metabolism, reduced growth and heart rates, and increased abnormal development and post-exposure mortality. All

  6. Effects of benzophenone-3 exposure on endocrine disruption and reproduction of Japanese medaka (Oryzias latipes)—A two generation exposure study

    Kim, Sujin; Jung, Dawoon [School of Public Health, Seoul National University, Seoul 151-742 (Korea, Republic of); Kho, Younglim [Department of Health, Environment and Safety, Eulji University, Seongnam 461-713 (Korea, Republic of); Choi, Kyungho, E-mail: kyungho@snu.ac.kr [School of Public Health, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Highlights: • Exposure to BP-3 led to adverse reproduction effects on Japanese medaka at 26 μg/L. • Changes in sex hormones and steroidogenic gene transcription were observed. • Parental exposure to BP-3 influenced on the growth of second generation fish. - Abstract: Benzophenone-3 (BP-3) has been widely used in sunscreens and cosmetics to protect human skin from the harmful effects of UV irradiation. While BP-3 has been frequently detected in surface waters, sediments and biota, only limited information is available on its in vivo toxicity, particularly in fish. In the present study the endocrine disrupting capacity of BP-3 and its underlying mechanisms were investigated using Japanese medaka (Oryzias latipes). Adult Japanese medaka pairs (F0) were exposed to 0, 4.7, 8.4, 26, or 90 μg/L (or 0, 15, 50, 150, or 500 μg/L of BP-3 based on nominal concentration) for 14 d and its effects on sex steroid hormones, and transcription of various associated genes were determined. Following additional 14 d of exposure, the F1 eggs reproduced were counted and were further exposed to 0, 5.4, 12, or 30 μg/L of BP-3 (or 0, 15, 50, or 150 μg/L based on nominal concentrations) until 30 d after hatching. Chemical analysis of the exposed media confirmed transformation of BP-3 to benzophenone-1 (BP-1), a more potent estrogen agonist. After 14 d of the adult fish exposure, plasma concentrations of testosterone (T) significantly increased in male fish. The 17β-estradiol (E2) to T (E2/T) ratio showed significant decreases in both male and female fish. Overall down-regulation of gonadal steroidogenic genes such as star, cyp11a, cyp17, hsd3b, hsd17b3, and cyp19a was also observed. After 28 d of exposure, the daily average egg reproduction per female was significantly reduced at 26 μg/L of BP-3. However, hatchability of F1 eggs was not affected by continuous exposure. After continued exposure until 30 dph, juvenile fish showed concentration-dependent decrease of condition factor

  7. DNA-PK inhibition causes a low level of H2AX phosphorylation and homologous recombination repair in Medaka (Oryzias latipes) cells

    Urushihara, Yusuke; Kobayashi, Junya; Matsumoto, Yoshihisa; Komatsu, Kenshi; Oda, Shoji; Mitani, Hiroshi

    2012-01-01

    Highlights: ► We investigated the effect of DNA-PK inhibition on DSB repair using fish cells. ► A radiation sensitive mutant RIC1 strain showed a low level of DNA-PK activity. ► DNA-PK dysfunction leads defects in HR repair and DNA-PKcs autophosphorylation. ► DNA-PK dysfunction leads a slight increase in the number of 53BP1 foci after DSBs. ► DNA-PK dysfunction leads an alternative NHEJ that depends on 53BP1. -- Abstract: Nonhomologous end joining (NHEJ) and homologous recombination (HR) are known as DNA double-strand break (DSB) repair pathways. It has been reported that DNA-PK, a member of PI3 kinase family, promotes NHEJ and aberrant DNA-PK causes NHEJ deficiency. However, in this study, we demonstrate that a wild-type cell line treated with DNA-PK inhibitor and a mutant cell line with dysfunctional DNA-PK showed decreased HR efficiency in fish cells (Medaka, Oryzias latipes). Previously, we reported that the radiation-sensitive mutant RIC1 strain has a defect in the Histone H2AX phosphorylation after γ-irradiation. Here, we showed that a DNA-PK inhibitor, NU7026, treatment resulted in significant reduction in the number of γH2AX foci after γ-irradiation in wild-type cells, but had no significant effect in RIC1 cells. In addition, RIC1 cells showed significantly lower levels of DNA-PK kinase activity compared with wild-type cells. We investigated NHEJ and HR efficiency after induction of DSBs. Wild-type cells treated with NU7026 and RIC1 cells showed decreased HR efficiency. These results indicated that aberrant DNA-PK causes the reduction in the number of γH2AX foci and HR efficiency in RIC1 cells. We performed phosphorylated DNA-PKcs (Thr2609) and 53BP1 focus assay after γ-irradiation. RIC1 cells showed significant reduction in the number of phosphorylated DNA-PKcs foci and no deference in the number of 53BP1 foci compared with wild-type cells. These results suggest that low level of DNA-PK activity causes aberrant DNA-PKcs autophosphorylation

  8. Evaluation of the effects of ethinylestradiol on sexual differentiation in the olvas-GFP/STII-YI medaka (transgenic Oryzias latipes) strain as estimated by proliferative activity of germ cells

    Hano, Takeshi; Oshima, Yuji; Kinoshita, Masato; Tanaka, Minoru; Mishima, Noriko; Wakamatsu, Yuko; Ozato, Kenjiro; Shimasaki, Yohei; Honjo, Tsuneo

    2011-01-01

    We evaluated the effects of 17(-ethinylestradiol (EE 2 ) on sexual differentiation in transgenic olvas-GFP/STII-YI medaka (Oryzias latipes) in terms of the proliferative activity of germ cells. This strain contains the green fluorescent protein (GFP) gene fused to the regulatory region of the medaka vasa gene, and germ cell-specific expression of GFP can be visualized in living (transparent) individuals. From 0 days post-hatch (0 dph) onwards, juveniles were exposed to graded concentrations of EE 2 (25.2-1710 ng/L) for 35 days. The gonads of live specimens were monitored by measuring their size and calculating their GFP-fluorescence area. GFP-fluorescent area in control females was about 10 times that in control males at 10 days posthatch (dph) whereas the gonadal size of 10 dph males that had been exposed to 158 ng/L of EE 2 significantly increased up to twice the size of control males, indicating that abnormal sexual differentiation towards female might occur in these individuals. Histological examination and identification of the sex-linked marker SL1 indicated that male to female sex reversal occurred at EE 2 exposure ≥45.1 ng/L at 35 dph. These results suggest that observation of proliferative activity of germ cells in the olvas-GFP/STII-YI strain could be applied to facilitated screening fish model to detect adverse effects on sexual differentiation as early as 10 dph juveniles.

  9. Taxonomy Icon Data: Oryzias javanicus [Taxonomy Icon

    Full Text Available Oryzias javanicus Oryzias javanicus Chordata/Vertebrata/Pisciformes Oryzias_javanicus_L.png Oryzias_java...nicus_NL.png Oryzias_javanicus_S.png Oryzias_javanicus_NS.png http://biosciencedbc.jp/t...axonomy_icon/icon.cgi?i=Oryzias+javanicus&t=L http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Oryzias+javan...icus&t=NL http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Oryzias+javanicus&t=S ...http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Oryzias+javanicus&t=NS http://togodb.biosciencedbc.jp/togodb/view/taxonomy_icon_comment_en?species_id=77 ...

  10. Radiation effects on lifespan of the fish Oryzias latipes

    Egami, N.

    1979-01-01

    The mortality rate of adult fish exposed to continuous γ-ray irradiation was examined and the results summarized. Initial results into the effects of low-dose γ-irradiation during early developmental stages (one day embryo - 3 month old young) on lifespan, indicate that in this fish the life-shortening effects of radiation are marked at high doses but not at low doses. Age-related histological changes in various tissues have been observed in both irradiated and non-irradiated fish. (Auth.)

  11. NTP carcinogenesis studies of 2,2-bis(bromomethyl)-1,3-propanediol, nitromethane, and 1,2,3-trichloropropane (cas nos. 3296-90-0, 75-52-5, and 96-18-4) in guppies (Poecilia reticulata) and medaka (Oryzias latipes) (Waterborne Studies).

    2005-10-01

    The NTP chose to initiate studies in fish as an exploration of alternate or additional models for examining chemical toxicity and carcinogenicity. The use of small fish species in carcinogenicity testing offered potential advantages as a bioassay test system, including significant savings in cost and time over rodent studies. Large numbers of small fish could be easily maintained in a limited area. The two species chosen for study were guppy (Poecilia reticulata) and medaka (Oryzias latipes), both of which are hardy, easily maintained, and have a low occurrence of background lesions. The three chemicals chosen for study in fish had already been studied by the NTP in rodents, permitting a comparison of results between the two models. Two of the chemicals used (2,2-bis(bromomethyl)-1,3-propanediol and 1,2,3-trichloropropane) were mutagenic and multisite carcinogens in rats and mice. The third chemical, nitromethane, was nonmutagenic with a more modest carcinogenic response in rodents. Male and female guppies and medaka were exposed to 2,2-bis(bromomethyl)- 1,3-propanediol (greater than 99% pure), nitromethane, (greater than 99% pure), or 1,2,3-trichloropropane (99% pure) in aquaria water for up to 16 months. OVERALL STUDY DESIGN: Groups of approximately 220 guppies (two replicates of 110) were maintained in aquaria water containing nominal concentrations of 0, 24, 60, or 150 mg/L 2,2-bis(bromomethyl)-1,3-propanediol; 0, 10, 30, or 70 mg/L nitromethane; or 0, 4.5, 9.0, or 18.0 mg/L 1,2,3-trichloropropane. Groups of approximately 340 medaka (two replicates of 170) were maintained in aquaria water containing 0, 24, 60, or 150 mg/L 2,2-bis(bromomethyl)-1,3-propanediol; 0, 10, 20, or 40 mg/L nitromethane; or 0, 4.5, 9.0, or 18.0 mg/L 1,2,3-trichloropropane. The overall study durations were 16 months for all guppy studies, 14 months for 2,2-bis(bromomethyl)-1,3-propanediol-exposed medaka, and 13 months for nitromethane- and 1,2,3-trichloropropane-exposed medaka. Ten

  12. Haplotype specific alteration of diabetes MHC risk by olfactory receptor gene polymorphism.

    Jahromi, Mohamed M

    2012-12-01

    Evidence for genes associated with risk for Type 1 diabetes (T1D) in the extended region of the major histocompatibility complex (MHC) genes is accumulating. The aim of this study was to investigate the association pattern of the extended MHC region with T1D susceptibility to identify effects independent of well established DR/DQ genes. A total of 394 Europid families with T1D were genotyped for the single nucleotide polymorphism (SNP) in the olfactory receptor family 14, subfamily J, member 1 (OR14J1) gene, rs9257691, in the MHC telomeric region. The OR provides "an internal depiction of our external world" through the capture of odorant molecules in the main OR system by several large families of G-protein coupled receptors (GPCR). These receptors transduce and chemosignals into the central nervous system (CNS). This SNP was chosen to identify its association with T1D. Interestingly, OR14J1C allele was significantly associated with T1D that seems to go with DRB1*0401, Χ(2)=10.9, p=0.0003. However, by fixing both genes of DR*0401-DQB1*0302, high risk, the association of T1D with OR14J1C still existed, Χ(2)=7.4, p=0.005. The occurrence of association of the OR14J1C allele with T1D patients with DRB1*401/DQB1*0302 is an independent risk for T1D. As an accumulative report suggests the role of OR in the pathogenesis of diabetic microvascular and other diabetic complications, undoubtedly, this haplotype specific alteration of T1D risk is an independent risk for the disease and can address the promising MHC-linked gene other than DR/DQ. Moreover, there is nothing to hinder for that this might be a signal that identifies the role of OR gene in the pathogenesis of T1D in patients who are prone to diabetic complications. Copyright © 2012. Published by Elsevier B.V.

  13. Artificial fertilization by intracytoplasmic sperm injection in a teleost fish, the medaka (Oryzias latipes).

    Otani, Satoshi; Iwai, Toshiharu; Nakahata, Shingo; Sakai, Chiharu; Yamashita, Masakane

    2009-01-01

    Intracytoplasmic sperm injection (ICSI) is a technique that has been successfully used for assisting reproduction in mammals. However, this method is still not reliable in nonmammalian species, including teleosts. We succeeded in producing medaka individuals by ICSI with a rate of 13.4% (28 hatched embryos out of 209 eggs fertilized by ICSI), the best value reported so far in teleosts, including zebrafish and Nile tilapia. Although the technique was based on that developed for mammalian eggs, some critical modifications were made to adjust it to the medaka egg, which has a thick and hard envelope (the chorion) and a single sperm entry site (the micropyle). Medaka ICSI was performed by injecting a demembranated spermatozoon into an egg cytoplasm through the micropyle 10-15 sec after egg activation induced by a piezo-actuated vibration, the site and timing of sperm penetration being consistent with those in normal fertilization in medaka. To increase the efficiency of ICSI in medaka, we found that the fertilization by ICSI should precisely mimic the fertilization by insemination with intact sperm, both spatially and temporally. The success rate of ICSI was highly variable in batches of eggs (ranging from 0% to 56%), suggesting that the conditions of eggs are important factors in stabilizing the production of individuals by ICSI. The success in medaka ICSI provides a basis for future research to understand the basic mechanisms in gamete biology of teleosts as well as for development of new technology that can yield valuable applications in fisheries science.

  14. Establishment and characterization of Roberts syndrome and SC phocomelia model medaka (Oryzias latipes).

    Morita, Akihiro; Nakahira, Kumiko; Hasegawa, Taeko; Uchida, Kaoru; Taniguchi, Yoshihito; Takeda, Shunichi; Toyoda, Atsushi; Sakaki, Yoshiyuki; Shimada, Atsuko; Takeda, Hiroyuki; Yanagihara, Itaru

    2012-06-01

    Roberts syndrome and SC phocomelia (RBS/SC) are genetic autosomal recessive syndromes caused by establishment of cohesion 1 homolog 2 ( ESCO 2) mutation. RBS/SC appear to have a variety of clinical features, even with the same mutation of the ESCO2 gene. Here, we established and genetically characterized a medaka model of RBS/SC by reverse genetics. The RBS/SC model was screened from a mutant medaka library produced by the Targeting Induced Local Lesions in Genomes method. The medaka mutant carrying the homozygous mutation at R80S in the conserved region of ESCO2 exhibited clinical variety (i.e. developmental arrest with craniofacial and chromosomal abnormalities and embryonic lethality) as characterized in RBS/SC. Moreover, widespread apoptosis and downregulation of some gene expression, including notch1a, were detected in the R80S mutant. The R80S mutant is the animal model for RBS/SC and a valuable resource that provides the opportunity to extend knowledge of ESCO2. Downregulation of some gene expression in the R80S mutant is an important clue explaining non-correlation between genotype and phenotype in RBS/SC. © 2012 The Authors Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

  15. The Japanese Medakafish (Oryzias latipes) as Animal Model for Space-related Bone Research

    Renn, J.; Schaedel, M.; Elmasri, H.; Wagner, T.; Goerlich, R.; Furutani-Seiki, M.; Kondoh, H.; Schartl, M.; Winkler, C.

    Long-term space flight leads to bone loss due to reduced mechanical load. Animal models are needed to support the analysis of the underlying mechanisms at the molecular and cellular level that are presently largely unclear. For this, small laboratory fish offer many experimental advantages as in vivo models to study disease related processes. They produce large numbers of completely transparent embryos, are easy to keep under laboratory and space conditions and have relatively compact genomes. We are using the Japanese Medaka to characterize the genetic networks regulating bone formation and to study bone formation and remodeling under microgravity. We showed that despite the large evolutionary distance many known factors regulating bone formation are conserved between fish and humans. This includes osteoprotegerin (opg), a key regulator of bone resorption that is altered at the transcriptional level by simulated microgravity in mammals in vitro (Kanematsu et al., Bone 30, 2002). To monitor, how opg is regulated by altered gravity in vivo in fish and how fish react to microgravity, we isolated the Medaka opg regulatory region and produced transgenic fish that carry the green fluorescent protein reporter under the control of the Medaka opg promoter. This model will be useful to monitor gravity-induced changes at the molecular level in vivo. Fish also provide the opportunity to identify novel genes involved in bone formation by using large-scale mutagenesis screens. We have characterized several lines of mutant fish subjected to ENU mutagenesis that show morphological defects in the formation of the bone precursor cell compartment of the axial skeleton, the sclerotome. Using this genetic approach, the identification of the mutated genes is expected to reveal novel components of the genetic cascades that regulate bone formation. In an attempt to identify genes specifically expressed in the sclerotome in Medaka, we identified and characterized dmrt2, a gene that so far was not known to be involved in bone formation in mammals. Taken together, the Medaka offers excellent experimental approaches to isolate novel bone genes and to analyze the effects of altered gravity on the expression of skeletal factors in a whole-animal model system, with relevance to human diseases. Acknowledgement: This work is supported by the German Aerospace Center (DLR) (50 WB 0152) and the European Space Agency (AO-LS-99-MAP-LSS-003).

  16. Chronic Mycobacterium marinum Infection Acts as a Tumor Promoter in Japanese Medaka (Oryzias latipes)

    An accumulating body of research indicates there is an increased cancer risk associated with chronic infections. The genus Mycobacterium contains a number of species, including M tuberculosis, which mount chronic infections and have been implicated in higher cancer risk. Several ...

  17. Trichioroethylene and Chioral Hydrate Metabolism in the Japanese Medaka Minnow (Oryzias Latipes) In Vitro

    Lipscomb, John

    1996-01-01

    ...: the species is small enough to be reared in large numbers under relatively simple environmental conditions, the gestation period is short so that many generations can be tested in a short period...

  18. Targeted Inactivation of DNA Photolyase Genes in Medaka Fish (Oryzias latipes).

    Ishikawa-Fujiwara, Tomoko; Shiraishi, Eri; Fujikawa, Yoshihiro; Mori, Toshio; Tsujimura, Tohru; Todo, Takeshi

    2017-01-01

    Proteins of the cryptochrome/photolyase family (CPF) exhibit sequence and structural conservation, but their functions are divergent. Photolyase is a DNA repair enzyme that catalyzes the light-dependent repair of ultraviolet (UV)-induced photoproducts, whereas cryptochrome acts as a photoreceptor or circadian clock protein. Two types of DNA photolyase exist: CPD photolyase, which repairs cyclobutane pyrimidine dimers (CPDs), and 6-4 photolyase, which repairs 6-4 pyrimidine-pyrimidone photoproducts (6-4PPs). Although the Cry-DASH protein is classified as a cryptochrome, it also has light-dependent DNA repair activity. To determine the significance of the three light-dependent repair enzymes in recovering from solar UV-induced DNA damage at the organismal level, we generated mutants in each gene in medaka using the CRISPR genome editing technique. The light-dependent repair activity of the mutants was examined in vitro in cultured cells and in vivo in skin tissue. Light-dependent repair of CPD was lost in the CPD photolyase-deficient mutant, whereas weak repair activity against 6-4PPs persisted in the 6-4 photolyase-deficient mutant. These results suggest the existence of a heretofore unknown 6-4PP repair pathway and thus improve our understanding of the mechanisms of defense against solar UV in vertebrates. © 2016 The Authors. Photochemistry and Photobiology published by Wiley Periodicals, Inc. on behalf of American Society for Photobiology.

  19. Bioconcentration and distribution of silver nanoparticles in Japanese medaka (Oryzias latipes)

    Jung, Youn-Joo [Department of Environmental Science and Engineering, Gwangju Institute of Science and Technology (GIST) , 261 Cheom-dan Gwagi-ro, Buk-gu, Gwangju 500-712 (Korea, Republic of); Kim, Ki-Tae [Department of Environmental Engineering, Seoul National University of Science and Technology, Seoul 139-743 (Korea, Republic of); Kim, Jun. Y. [Department of Environmental Science and Engineering, Gwangju Institute of Science and Technology (GIST) , 261 Cheom-dan Gwagi-ro, Buk-gu, Gwangju 500-712 (Korea, Republic of); Yang, Song-Yi; Lee, Byeong-Gweon [Department of Oceanography, Chonnam National University, Gwangju 500-755 (Korea, Republic of); Kim, Sang D., E-mail: sdkim@gist.ac.kr [Department of Environmental Science and Engineering, Gwangju Institute of Science and Technology (GIST) , 261 Cheom-dan Gwagi-ro, Buk-gu, Gwangju 500-712 (Korea, Republic of)

    2014-02-01

    Highlights: • The bioconcentration and biodistribution of AgNPs were measured by the silver isotope {sup 110m}Ag. • BCF values were 39.8 ± 7.4, 42.5 ± 5.1 and 116.4 ± 6.1 L kg{sup −1} for AgNPs-CIT, AgNPs-PVP and AgNO{sub 3}, respectively. • The extent of silver ion release from AgNPs affected the uptake kinetic pattern. • AgNPs were mainly concentrated in the liver of Japanese medaka. - Abstract: The study of the bioconcentration of silver nanoparticles (AgNPs) is important to fully understand their hazard potential in the aquatic environment. We synthesized AgNPs radiolabeled with silver isotopes ({sup 110m}Ag) to quantify the bioconcentration of AgNPs coated with citrate (AgNPs-CIT) and polyvinylpyrrolidone (AgNPs-PVP) in Japanese medaka, and to investigate the biodistribution of silver in organs, which were compared with {sup 110m}AgNO{sub 3}. BCF values were determined to be 39.8 ± 7.4, 42.5 ± 5.1 and 116.4 ± 6.1 L kg{sup −1} for AgNPs-CIT, AgNPs-PVP and AgNO{sub 3}, respectively. The release of more silver ions in AgNPs-PVP contributed to a different kinetic uptake pattern with AgNPs-CIT, which was similar to that of AgNO{sub 3}. Bioconcentrated AgNPs in medaka were not observed to be eliminated, independent of surface coating differences, similarly to AgNO{sub 3}. There was no difference in biodistribution in each organ before and after depuration in two types of AgNPs and AgNO{sub 3}, all of which were mainly concentrated in the liver. This study quantified the bioconcentration and distribution of AgNPs and AgNO{sub 3} more precisely by utilizing a silver isotope, which is helpful in monitoring the toxicity of AgNPs to Japanese medaka.

  20. PRDM9 drives evolutionary erosion of hotspots in Mus musculus through haplotype-specific initiation of meiotic recombination.

    Baker, Christopher L; Kajita, Shimpei; Walker, Michael; Saxl, Ruth L; Raghupathy, Narayanan; Choi, Kwangbom; Petkov, Petko M; Paigen, Kenneth

    2015-01-01

    Meiotic recombination generates new genetic variation and assures the proper segregation of chromosomes in gametes. PRDM9, a zinc finger protein with histone methyltransferase activity, initiates meiotic recombination by binding DNA at recombination hotspots and directing the position of DNA double-strand breaks (DSB). The DSB repair mechanism suggests that hotspots should eventually self-destruct, yet genome-wide recombination levels remain constant, a conundrum known as the hotspot paradox. To test if PRDM9 drives this evolutionary erosion, we measured activity of the Prdm9Cst allele in two Mus musculus subspecies, M.m. castaneus, in which Prdm9Cst arose, and M.m. domesticus, into which Prdm9Cst was introduced experimentally. Comparing these two strains, we find that haplotype differences at hotspots lead to qualitative and quantitative changes in PRDM9 binding and activity. Using Mus spretus as an outlier, we found most variants affecting PRDM9Cst binding arose and were fixed in M.m. castaneus, suppressing hotspot activity. Furthermore, M.m. castaneus×M.m. domesticus F1 hybrids exhibit novel hotspots, with large haplotype biases in both PRDM9 binding and chromatin modification. These novel hotspots represent sites of historic evolutionary erosion that become activated in hybrids due to crosstalk between one parent's Prdm9 allele and the opposite parent's chromosome. Together these data support a model where haplotype-specific PRDM9 binding directs biased gene conversion at hotspots, ultimately leading to hotspot erosion.

  1. Integrated genetic and epigenetic analysis identifies haplotype-specific methylation in the FTO type 2 diabetes and obesity susceptibility locus.

    Christopher G Bell

    2010-11-01

    Full Text Available Recent multi-dimensional approaches to the study of complex disease have revealed powerful insights into how genetic and epigenetic factors may underlie their aetiopathogenesis. We examined genotype-epigenotype interactions in the context of Type 2 Diabetes (T2D, focussing on known regions of genomic susceptibility. We assayed DNA methylation in 60 females, stratified according to disease susceptibility haplotype using previously identified association loci. CpG methylation was assessed using methylated DNA immunoprecipitation on a targeted array (MeDIP-chip and absolute methylation values were estimated using a Bayesian algorithm (BATMAN. Absolute methylation levels were quantified across LD blocks, and we identified increased DNA methylation on the FTO obesity susceptibility haplotype, tagged by the rs8050136 risk allele A (p = 9.40×10(-4, permutation p = 1.0×10(-3. Further analysis across the 46 kb LD block using sliding windows localised the most significant difference to be within a 7.7 kb region (p = 1.13×10(-7. Sequence level analysis, followed by pyrosequencing validation, revealed that the methylation difference was driven by the co-ordinated phase of CpG-creating SNPs across the risk haplotype. This 7.7 kb region of haplotype-specific methylation (HSM, encapsulates a Highly Conserved Non-Coding Element (HCNE that has previously been validated as a long-range enhancer, supported by the histone H3K4me1 enhancer signature. This study demonstrates that integration of Genome-Wide Association (GWA SNP and epigenomic DNA methylation data can identify potential novel genotype-epigenotype interactions within disease-associated loci, thus providing a novel route to aid unravelling common complex diseases.

  2. Effects of dietary 2,2', 4,4'-tetrabromodiphenyl ether (BDE-47) exposure on medaka (Oryzias latipes) swimming behavior.

    Sastre, Salvador; Fernández Torija, Carlos; Carbonell, Gregoria; Rodríguez Martín, José Antonio; Beltrán, Eulalia María; González-Doncel, Miguel

    2018-02-01

    A diet fortified with 2,2', 4,4'-tetrabromodiphenyl ether (BDE-47: 0, 10, 100, and 1000 ng/g) was dosed to 4-7-day-old post-hatch medaka fish for 40 days to evaluate the effects on the swimming activity of fish using a miniaturized swimming flume. Chlorpyrifos (CF)-exposed fish were selected as the positive control to assess the validity and sensitivity of the behavioral findings. After 20 and 40 days of exposure, the locomotor activity was analyzed for 6 min in a flume section (arena). The CF positive control for each time point were fish exposed to 50 ng CF/ml for 48 h. Swimming patterns, presented as two-dimensional heat maps of fish movement and positioning, were obtained by geostatistical analyses. The heat maps of the control groups at time point 20 revealed visually comparable swimming patterns to those of the BDE-47-treated groups. For the comparative fish positioning analysis, both the arenas were divided into 15 proportional areas. No statistical differences were found between residence times in the areas from the control groups and those from the BDE-47-treated groups. At time point 40, the heat map overall patterns of the control groups differed visually from that of the 100-ng BDE-47/g-treated group, but a comparative analysis of the residence times in the corresponding 15 areas did not reveal consistent differences. The relative distances traveled by the control and treated groups at time points 20 and 40 were also comparable. The heat maps of CF-treated fish at both time points showed contrasting swim patterns with respect to those of the controls. These differential patterns were statistically supported with differences in the residence times for different areas. The relative distances traveled by the CF-treated fish were also significantly shorter. These results confirm the validity of the experimental design and indicate that a dietary BDE-47 exposure does not affect forced swimming in medaka at growing stages. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Aquaporin expression in the Japanese medaka (Oryzias latipes) in freshwater and seawater: challenging the paradigm of intestinal water transport?

    Madsen, Steffen; Bujak, Joanna; Tipsmark, Christian

    2014-01-01

    response to salinity, suggesting that water transport is not regulated at this level. In contrast, mRNA of the Na+,K+,2Cl–-cotransporter type-2 strongly increased in the intestine in SW compared with FW fish. Using custom-made antibodies, Aqp1a, Aqp8ab and Aqp10a were localized in the apical region...... in the intestine of SW fish is surprising, and challenges the paradigm for transepithelial intestinal water absorption in SW fishes....

  4. Evaluation of the carcinogenic, reproductive, and developmental effects of mixtures of contaminants on the Medaka Fish (Oryzias latipes)

    Hartley, W.; Roy, C.

    1993-01-01

    This paper details the initial results of a study to evaluate the effects of mixtures. The study, when completed, will include cadmium in combination with other chemicals. The primary mechanism of cadmium toxicity in adult fishes is gill tissue necrosis, but this was observed at very high laboratory concentrations or special circumstances. There is a lack of aquatic toxicological research involving specific developmental effects of cadmium in the medaka embryo. There is a need to investigate the sublethal effects of cadmium in low concentration where mortality of the exposed biological organism is not the endpoint of toxicity. The toxicity of cadmium for embryonic, juvenile, and adult fish is variable according to species and stage of life. The object of the following experiments was to observe the various physiological, morphological, and limited behavioral effects of cadmium on the medaka embryo

  5. DNA methyltransferase expressions in Japanese rice fish (Oryzias latipes) embryogenesis is developmentally regulated and modulated by ethanol and 5-azacytidine

    We aimed to investigate the impact of the epigenome in inducting fetal alcohol spectrum disorder (FASD) phenotypes in Japanese rice fish embryogenesis. One of the significant events in epigenome is DNA methylation which is catalyzed by DNA methyl transferase (DNMT) enzymes. We analyzed DNMT enzyme m...

  6. Modulation of DNA methylation machineries in japanese rice fish (Oryzias latipes) embryogenesis by ethanol and 5-azacytidine

    As a sequel of our investigations on the impact of epigenome in inducing fetal alcohol spectrum disorder (FASD) phenotypes in Japanese rice fish, we investigated on several DNA methylation machinery genes including DNA methyl transferase 3ba (dnmt3ba) and methyl binding proteins (MBPs), namely, mbdl...

  7. In Vivo Anti-estrogenic Effects of Menadione on Hepatic Estrogen-responsive Gene Expression in Male Medaka (Oryzias latipes)

    Yamaguchi, Akemi; Kohra, Shinya; Ishibashi, Hiroshi; Arizono, Koji; Tominaga, Nobuaki

    2008-01-01

    Menadione, a synthetic vitamin K3, exhibits anti-estrogenic activity on in vitro assay. However, the in vivo anti-estrogenic effects of menadione have not been determined, while correlations between biological effects and structural changes are unclear. Thus, we investigated the in vivo anti-estrogenic activity of menadione under fluorescent light and dark conditions. Suppression of the hepatic estrogen response genes vitellogenin1 (VTG1), VTG2 and estrogen receptor-α (ER-α) was used as an in...

  8. PROMOTION BY 17BETA-ESTRADIOL AND BETA-HEXACHLOROCYCLOHEXANE OF HEPATOCELLULAR TUMORS IN MEDAKA, ORYZIAS LATIPES. (R825298)

    AbstractA feature common to many laboratory and field studies with various fish species is a higher prevalence of hepatocellular neoplasia in females than in males. During female sexual maturation, endogenous estrogens stimulate substantial increases in synthetic acti...

  9. EFFECTS OF O,P'-DDT ON GONADAL DEVELOPMENT AND ENDOCRINE RESPONSES IN JAPANESE MEDAKA (ORYZIAS LATIPES). (R827098)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  10. Development of an Aquatic Bioassay using the Medaka (Oryzias latipes) to Assess Human Health Risk: Tumor Immunodiagnosis.

    1995-01-10

    tumors, melanoma Actin Skeletal muscle Chromogranin Neuroendocrine cells Myelin associated protein Neurons ULEX europaeus agglutinin I Endothelial...Actin BioGenex + Ulex europaeus agglutinin I Vector Endothelial cell antigen BioGenex ND Lysozyme BioGenex ND S-100 protein BioGenex + MAP-2

  11. In ovo exposure to o,p -DDE affects sexual development but not sexual differentiation in Japanese medaka (Oryzias latipes).

    Papoulias, D.M.; Villalobos, Sergio A.; Meadows, J.; Noltie, Douglas B.; Giesy, J.P.; Tillitt, D.E.

    2003-01-01

    Despite being banned in many countries, dichlorodiphenyltrichloroethane (DDT) and its metabolites dichlorodiphenyldichloroethylene (DDE) and dichlorodiphenyldichloroethane (DDD) continue to be found in fish tissues at concentrations of concern. Like o,p -DDT, o,p -DDE is estrogenic and is believed to exert its effects through binding to the estrogen receptor. The limited toxicologic data for o,p -DDE suggest that it decreases fecundity and fertility of fishes. We conducted an egg injection study using the d-rR strain of medaka and environmentally relevant concentrations of o,p -DDE to examine its effects on sexual differentiation and development. The gonads of exposed fish showed no evidence of sex reversal or intersex. However, other gonad abnormalities occurred in exposed individuals. Females exhibited few vitellogenic oocytes and increased atresia. Male testes appeared morphologically normal but were very small. Gonadosomatic index values for both sexes were lower for exposed fish. Our observations of abnormal female and very small male gonads after in ovo o,p -DDE exposure may be indicative of effects on early endocrine processes important for normal ovarian and testicular development.

  12. Modulation of DNA methylation machineries in Japanese rice fish (Oryzias latipes) embryogenesis by ethanol and 5-azacytidine.

    Dasmahapatra, Asok K; Khan, Ikhlas A

    2016-01-01

    As a sequel of our investigations on the impact of epigenome in inducing fetal alcohol spectrum disorder (FASD) phenotypes in Japanese rice fish, we have investigated on several DNA methylation machinery genes including DNA methyl transferase 3ba (dnmt3ba) and methyl binding proteins (MBPs), namely, mbd1b, mbd3a, mbd3b, and mecp2 at the transcription level. Studies were made during normal development, from 0day post fertilization (dpf) to hatching, and also exposing the fertilized eggs to ethanol or a DNMT inhibitor, 5-azacytidine (5-azaC). We observed that during development, all these genes followed distinct expression patterns, generally high mRNA copies in early phases (0-1dpf) and significantly low mRNA copies prior to or after hatching. Ethanol (100-500mM, 0-2dpf) was unable to alter any of these mRNAs in 2dpf; additional four day (2-6dpf) maintenance of these embryos in ethanol-free environment, on 6dpf, was also unable to establish any significant difference in these mRNA levels in comparison with the corresponding controls. However, continuous exposure of fertilized eggs in 300mM ethanol, 0-6dpf, showed significantly high mRNA copies only in MBPs (mbd1b, mbd3a, mbd3b, mecp2). 5-azaC (2mM) on 2dpf was able to enhance only mbd3b mRNA. Removal of 5-azaC and maintenance of these embryos in clean medium, 2-6dpf, showed significantly enhanced mbd3b and mecp2 mRNAs compared to corresponding controls on 6dpf. Our studies showed that in Japanese rice fish embryogenesis both ethanol and 5-azaC have the potential to specifically modulate the developmental rhythm of DNA methylation machineries. Published by Elsevier Inc.

  13. Transgenerational effects from early developmental exposures to bisphenol A or 17α-ethinylestradiol in medaka, Oryzias latipes

    Bhandari, Ramji K.; vom Saal, Frederick S.; Tillitt, Donald E.

    2015-01-01

    The transgenerational consequences of environmental contaminant exposures of aquatic vertebrates have the potential for broad ecological impacts, yet are largely uninvestigated. Bisphenol A (BPA) and 17α-ethinylestradiol (EE2) are two ubiquitous estrogenic chemicals present in aquatic environments throughout the United States and many other countries. Aquatic organisms, including fish, are exposed to varying concentrations of these chemicals at various stages of their life history. Here, we tested the ability of embryonic exposure to BPA or EE2 to cause adverse health outcomes at later life stages and transgenerational abnormalities in medaka fish. Exposures of F0 medaka to either BPA (100 μg/L) or EE2 (0.05 μg/L) during the first 7 days of embryonic development, when germ cells are differentiating, did not cause any apparent phenotypic abnormalities in F0 or F1 generations, but led to a significant reduction in the fertilization rate in offspring two generations later (F2) as well as a reduction of embryo survival in offspring three generations later (F3). Our present observations suggest that BPA or EE2 exposure during development induces transgenerational phenotypes of reproductive impairment and compromised embryonic survival in fish of subsequent generations. These adverse outcomes may have negative impacts on populations of fish inhabiting contaminated aquatic environments.

  14. Embryonic exposure of medaka (Oryzias latipes) to propylparaben: Effects on early development and post-hatching growth

    González-Doncel, Miguel; García-Mauriño, José Enrique; San Segundo, Laura; Beltrán, Eulalia M.; Sastre, Salvador; Fernández Torija, Carlos

    2014-01-01

    Here we proposed a battery of non-invasive biomarkers and a histological survey to examine physiological/anatomical features in embryos, eleutheroembryos (13 days post-fertilization, dpf), and larvae (28–42 dpf) of medaka to investigate the effects of embryonic exposure to propylparaben (PrP). Concentrations <1000 μg PrP/L didn't exert early or late toxic effects. However, survivorship was affected at 4000 μg/L in eleutheroembryos and at ≥1000 μg/L in larvae. Histological alterations were found in 37.5% of eleutheroembryos exposed to 4000 μg PrP/L. Morphometric analysis of the gallbladder revealed significant dilation at ≥400 μg/L throughout embryo development. Ethoxyresorufin-O-deethylase (EROD), as indicator of cytochrome P4501A activity, didn't reveal induction/inhibition although its combination with a P4501A agonist (i.e. β-naphthoflavone) resulted in a synergic EROD response. Results suggest a low toxicity of PrP for fish and support the use of fish embryos and eleutheroembryos as alternatives of in vivo biomarkers indicative of exposure/toxicity. -- Highlights: • Addressing pre- and post-hatch effects from medaka embryo exposure to propylparaben. • Macroscopical effects (length, mortality) seen primarily after hatch at ≥400 μg/L. • Synergic EROD embryonic response when propylparaben combined with a CYP1A agonist. • Significant gallbladder dilation seen at ≥400 μg PrP/L and as soon as discernible. • Histological harm to eleutheroembryos in peritoneal cavity, liver, kidney and brain. -- PrP resulted in low toxicity based on non-invasive biomarkers and histological tools to analyze pre- and post-hatch effects after medaka embryo exposure

  15. Modeling and E-M estimation of haplotype-specific relative risks from genotype data for a case-control study of unrelated individuals.

    Stram, Daniel O; Leigh Pearce, Celeste; Bretsky, Phillip; Freedman, Matthew; Hirschhorn, Joel N; Altshuler, David; Kolonel, Laurence N; Henderson, Brian E; Thomas, Duncan C

    2003-01-01

    The US National Cancer Institute has recently sponsored the formation of a Cohort Consortium (http://2002.cancer.gov/scpgenes.htm) to facilitate the pooling of data on very large numbers of people, concerning the effects of genes and environment on cancer incidence. One likely goal of these efforts will be generate a large population-based case-control series for which a number of candidate genes will be investigated using SNP haplotype as well as genotype analysis. The goal of this paper is to outline the issues involved in choosing a method of estimating haplotype-specific risk estimates for such data that is technically appropriate and yet attractive to epidemiologists who are already comfortable with odds ratios and logistic regression. Our interest is to develop and evaluate extensions of methods, based on haplotype imputation, that have been recently described (Schaid et al., Am J Hum Genet, 2002, and Zaykin et al., Hum Hered, 2002) as providing score tests of the null hypothesis of no effect of SNP haplotypes upon risk, which may be used for more complex tasks, such as providing confidence intervals, and tests of equivalence of haplotype-specific risks in two or more separate populations. In order to do so we (1) develop a cohort approach towards odds ratio analysis by expanding the E-M algorithm to provide maximum likelihood estimates of haplotype-specific odds ratios as well as genotype frequencies; (2) show how to correct the cohort approach, to give essentially unbiased estimates for population-based or nested case-control studies by incorporating the probability of selection as a case or control into the likelihood, based on a simplified model of case and control selection, and (3) finally, in an example data set (CYP17 and breast cancer, from the Multiethnic Cohort Study) we compare likelihood-based confidence interval estimates from the two methods with each other, and with the use of the single-imputation approach of Zaykin et al. applied under both

  16. Expression Profiles of Branchial FXYD Proteins in the Brackish Medaka Oryzias dancena: A Potential Saltwater Fish Model for Studies of Osmoregulation

    Yang, Wen-Kai; Kang, Chao-Kai; Chang, Chia-Hao; Hsu, An-Di; Lee, Tsung-Han; Hwang, Pung-Pung

    2013-01-01

    FXYD proteins are novel regulators of Na+-K+-ATPase (NKA). In fish subjected to salinity challenges, NKA activity in osmoregulatory organs (e.g., gills) is a primary driving force for the many ion transport systems that act in concert to maintain a stable internal environment. Although teleostean FXYD proteins have been identified and investigated, previous studies focused on only a limited group of species. The purposes of the present study were to establish the brackish medaka (Oryzias dancena) as a potential saltwater fish model for osmoregulatory studies and to investigate the diversity of teleostean FXYD expression profiles by comparing two closely related euryhaline model teleosts, brackish medaka and Japanese medaka (O. latipes), upon exposure to salinity changes. Seven members of the FXYD protein family were identified in each medaka species, and the expression of most branchial fxyd genes was salinity-dependent. Among the cloned genes, fxyd11 was expressed specifically in the gills and at a significantly higher level than the other fxyd genes. In the brackish medaka, branchial fxyd11 expression was localized to the NKA-immunoreactive cells in gill epithelia. Furthermore, the FXYD11 protein interacted with the NKA α-subunit and was expressed at a higher level in freshwater-acclimated individuals relative to fish in other salinity groups. The protein sequences and tissue distributions of the FXYD proteins were very similar between the two medaka species, but different expression profiles were observed upon salinity challenge for most branchial fxyd genes. Salinity changes produced different effects on the FXYD11 and NKA α-subunit expression patterns in the gills of the brackish medaka. To our knowledge, this report is the first to focus on FXYD expression in the gills of closely related euryhaline teleosts. Given the advantages conferred by the well-developed Japanese medaka system, we propose the brackish medaka as a saltwater fish model for

  17. IDENTIFICATION AND CHARACTERIZATION OF CDNA ENCODING CYTOCHROME P450 3A FROM THE FRESH WATER TELEOST MEDAKA (ORYZIAS LATIPES). (R825298)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  18. EXPRESSION OF BRANCHIAL FLAVIN-CONTAINING MONOOXYGENASE IS DIRECTLY CORRELATED WITH SALINITY-INDUCED ALDICARB TOXICITY IN THE EURYHALINE FISH (ORYZIAS LATIPES). (R826109)

    AbstractEarlier studies in our laboratory have demonstrated a reduction of flavin-containing monooxygenase (FMO) activity when salt-water adapted euryhaline fish were transferred to water of less salinity. Since FMOs have been shown to be responsible for the bioact...

  19. Comparison of TiO2 nanoparticle and graphene-TiO2 nanoparticle composite phototoxicity to Daphnia magna and Oryzias latipes

    With a dramatic rise in complexity, needs of nanotoxicology research go beyond simple forms of nanomaterials. This study compared the phototoxicity of nano-TiO2and graphene-TiO2 nanocomposite (GNP). GNP was synthesized based on a hydrothermal method, which simultaneously performe...

  20. TRANSGENERATIONAL AND DEVELOPMENTAL EXPOSURE OF JAPANESE MEDAKA (ORYZIAS LATIPES) TO ETHINYLESTRADIOL RESULTS IN ENDOCRINE AND REPRODUCTIVE DIFFERENCES IN THE RESPONSE TO ETHINYLESTRADIOL AS ADULTS. (R827098)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  1. TRANSGENERATIONAL AND DEVELOPMENTAL EXPOSURE OF JAPANESE MEDAKA (ORYZIAS LATIPES) TO ETHINYLESTRADIOL RESULTS IN ENDOCRINE AND REPRODUCTIVE DIFFERENCES IN THE RESPONSE TO ETHINYLESTRADIOL AS ADULTS

    17a-Ethinylestradiol (EE), a synthetic estrogen found in birth control pills, has been detected in the effluent of municipal wastewater treatment plants in several countries. Because EE was designed to be extremely potent at the estrogen receptor (ER), environmental exposure to l...

  2. CORRELATION OF FLAVIN-CONTAINING MONOOXYGENASE ACTIVITY, ALDICARB TOXICITY AND SALINITY IN THE EURYHALINE FISH, JAPANESE MEDAKA (ORYZIAS LATIPES). (R826109)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  3. Detection of γ-ray-induced DNA damages in malformed dominant lethal embryos of the Japanese medaka (Oryzias latipes) using AP-PCR fingerprinting

    Kubota, Yoshiko; Shimada, Atsuko; Shima, Akihiro

    1992-01-01

    Adult male fish of the medaka HNI strain exposed to 9.5 Gy or 19 Gy (0.95 Gy/min) of γ-rays were mated with non-irradiated female fish of the Hd-rR strain. Genomic DNA was prepared from malformed individual embryos which were expected to be dominant lethal and used for AP-PCR fingerprinting. By the use of a part of the T3 promoter sequence (20 mer), which is not found in the medaka genome as an arbitrary primer, polymorphisms were found in genomic fingerprints which could distinguish the parental strains. On the other hand, fingerprints of F1 hybrids were found to be the sum of those of their parents. Based on these findings, the fingerprints of genomic DNA of each severely malformed embryo were analyzed, because it was expected that radiation-induced genomic damages resulting in severe malformation and eventually in dominant lethals should be detected as changes in paternal fingerprints of F1 hybrids. Indeed, changes were found in genomic DNA as loss of some paternal bands in fingerprints of malformed embryos. One of 10 malformed embryos obtained from 9.5 Gy γ-irradiated males had lost 5 bands. These results indicated a possibility that quantitative as well as qualitative estimation of γ-ray-induced DNA damages can be made by this method which does not require the functional selection based on a specific target gene. (author). 16 refs., 3 figs., 1 tab

  4. PROMOTION BY 17&BETA;-ESTRADIOL AND &BETA;-HEXACHLOROCYCLOHEXANE OF HEPATOCELLULAR TUMORS IN MEDAKA, ORYZIAS LATIPES. AQUAT. (R828676C002)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  5. Photorepair and excision repair removal of UV-induced pyrimidine dimers and (6-4) photoproducts in the tail fin of the Medaka, Oryzias latipes

    Funayama, Tomoo; Mitani, Hiroshi; Shima, Akihiro; Ishigaki, Yasuhito; Matsunaga, Tsukasa; Nikaido, Osamu.

    1994-01-01

    Induction and repair of UV-B induced DNA damage in the tail fin of the Medaka, were examined immunohistochemically and by the enzyme-linked immunosorbent assay (ELISA). UV-induced DNA damage was detected only in the outermost layer of epithelial cells and did not differ in fishes having different degree of melanization. Both pyrimidine dimers and (6-4) photoproducts in the fin cells were removed by excision repair in the dark, the excision of (6-4) photoproducts being about twice as efficient as that of pyrimidine dimers. The rate of excision repair of UV-induced lesions in fin tissue was three to four times that in cultured Medaka cells, OL32.. In the fin cells, reductions in the numbers of pyrimidine dimers and (6-4) photoproducts were seen after treatment with fluorescent light, whereas less reductions of pyrimidine dimers and no reductions of (6-4) photoproducts were observed in OL32 cells. (author)

  6. Effects of kisspeptin1 on electrical activity of an extrahypothalamic population of gonadotropin-releasing hormone neurons in medaka (Oryzias latipes).

    Zhao, Yali; Wayne, Nancy L

    2012-01-01

    Kisspeptin (product of the kiss1 gene) is the most potent known activator of the hypothalamo-pituitary-gonadal axis. Both kiss1 and the kisspeptin receptor are highly expressed in the hypothalamus of vertebrates, and low doses of kisspeptin have a robust and long-lasting stimulatory effect on the rate of action potential firing of hypophysiotropic gonadotropin releasing hormone-1 (GnRH1) neurons in mice. Fish have multiple populations of GnRH neurons distinguished by their location in the brain and the GnRH gene that they express. GnRH3 neurons located in the terminal nerve (TN) associated with the olfactory bulb are neuromodulatory and do not play a direct role in regulating pituitary-gonadal function. In medaka fish, the electrical activity of TN-GnRH3 neurons is modulated by visual cues from conspecifics, and is thought to act as a transmitter of information from the external environment to the central nervous system. TN-GnRH3 neurons also play a role in sexual motivation and arousal states, making them an important population of neurons to study for understanding coordination of complex behaviors. We investigated the role of kisspeptin in regulating electrical activity of TN-GnRH3 neurons in adult medaka. Using electrophysiology in an intact brain preparation, we show that a relatively brief treatment with 100 nM of kisspeptin had a long-lasting stimulatory effect on the electrical activity of an extrahypothalamic population of GnRH neurons. Dose-response analysis suggests a relatively narrow activational range of this neuropeptide. Further, blocking action potential firing with tetrodotoxin and blocking synaptic transmission with a low Ca(2+)/high Mg(2+) solution inhibited the stimulatory action of kisspeptin on electrical activity, indicating that kisspeptin is acting indirectly through synaptic regulation to excite TN-GnRH3 neurons. Our findings provide a new perspective on kisspeptin's broader functions within the central nervous system, through its regulation of an extrahypothalamic population of GnRH neurons involved in multiple neuromodulatory functions.

  7. Establishment of estrogen receptor 1 (ESR1)-knockout medaka: ESR1 is dispensable for sexual development and reproduction in medaka, Oryzias latipes.

    Tohyama, Saki; Ogino, Yukiko; Lange, Anke; Myosho, Taijun; Kobayashi, Tohru; Hirano, Yu; Yamada, Gen; Sato, Tomomi; Tatarazako, Norihisa; Tyler, Charles R; Iguchi, Taisen; Miyagawa, Shinichi

    2017-08-01

    Estrogens play fundamental roles in regulating reproductive activities and they act through estrogen receptor (ESR) in all vertebrates. Most vertebrates have two ESR subtypes (ESR1 and ESR2), whereas teleost fish have at least three (Esr1, Esr2a and Esr2b). Intricate functionalization has been suggested among the Esr subtypes, but to date, distinct roles of Esr have been characterized in only a limited number of species. Study of loss-of-function in animal models is a powerful tool for application to understanding vertebrate reproductive biology. In the current study, we established esr1 knockout (KO) medaka using a TALEN approach and examined the effects of Esr1 ablation. Unexpectedly, esr1 KO medaka did not show any significant defects in their gonadal development or in their sexual characteristics. Neither male or female esr1 KO medaka exhibited any significant changes in sexual differentiation or reproductive activity compared with wild type controls. Interestingly, however, estrogen-induced vitellogenin gene expression, an estrogen-responsive biomarker in fish, was limited in the liver of esr1 KO males. Our findings, in contrast to mammals, indicate that Esr1 is dispensable for normal development and reproduction in medaka. We thus provide an evidence for estrogen receptor functionalization between mammals and fish. Our findings will also benefit interpretation of studies into the toxicological effects of estrogenic chemicals in fish. © 2017 Japanese Society of Developmental Biologists.

  8. Polycystic kidney disease in the medaka (Oryzias latipes pc mutant caused by a mutation in the Gli-Similar3 (glis3 gene.

    Hisashi Hashimoto

    Full Text Available Polycystic kidney disease (PKD is a common hereditary disease in humans. Recent studies have shown an increasing number of ciliary genes that are involved in the pathogenesis of PKD. In this study, the Gli-similar3 (glis3 gene was identified as the causal gene of the medaka pc mutant, a model of PKD. In the pc mutant, a transposon was found to be inserted into the fourth intron of the pc/glis3 gene, causing aberrant splicing of the pc/glis3 mRNA and thus a putatively truncated protein with a defective zinc finger domain. pc/glis3 mRNA is expressed in the epithelial cells of the renal tubules and ducts of the pronephros and mesonephros, and also in the pancreas. Antisense oligonucleotide-mediated knockdown of pc/glis3 resulted in cyst formation in the pronephric tubules of medaka fry. Although three other glis family members, glis1a, glis1b and glis2, were found in the medaka genome, none were expressed in the embryonic or larval kidney. In the pc mutant, the urine flow rate in the pronephros was significantly reduced, which was considered to be a direct cause of renal cyst formation. The cilia on the surface of the renal tubular epithelium were significantly shorter in the pc mutant than in wild-type, suggesting that shortened cilia resulted in a decrease in driving force and, in turn, a reduction in urine flow rate. Most importantly, EGFP-tagged pc/glis3 protein localized in primary cilia as well as in the nucleus when expressed in mouse renal epithelial cells, indicating a strong connection between pc/glis3 and ciliary function. Unlike human patients with GLIS3 mutations, the medaka pc mutant shows none of the symptoms of a pancreatic phenotype, such as impaired insulin expression and/or diabetes, suggesting that the pc mutant may be suitable for use as a kidney-specific model for human GLIS3 patients.

  9. A new data-mining method to search for behavioral properties that induce alignment and their involvement in social learning in medaka fish (Oryzias latipes.

    Takashi Ochiai

    Full Text Available BACKGROUND: Coordinated movement in social animal groups via social learning facilitates foraging activity. Few studies have examined the behavioral cause-and-effect between group members that mediates this social learning. METHODOLOGY/PRINCIPAL FINDINGS: We first established a behavioral paradigm for visual food learning using medaka fish and demonstrated that a single fish can learn to associate a visual cue with a food reward. Grouped medaka fish (6 fish learn to respond to the visual cue more rapidly than a single fish, indicating that medaka fish undergo social learning. We then established a data-mining method based on Kullback-Leibler divergence (KLD to search for candidate behaviors that induce alignment and found that high-speed movement of a focal fish tended to induce alignment of the other members locally and transiently under free-swimming conditions without presentation of a visual cue. The high-speed movement of the informed and trained fish during visual cue presentation appeared to facilitate the alignment of naïve fish in response to some visual cues, thereby mediating social learning. Compared with naïve fish, the informed fish had a higher tendency to induce alignment of other naïve fish under free-swimming conditions without visual cue presentation, suggesting the involvement of individual recognition in social learning. CONCLUSIONS/SIGNIFICANCE: Behavioral cause-and-effect studies of the high-speed movement between fish group members will contribute to our understanding of the dynamics of social behaviors. The data-mining method used in the present study is a powerful method to search for candidates factors associated with inter-individual interactions using a dataset for time-series coordinate data of individuals.

  10. Gender-related effects of 17-{beta}-estradiol and B-hexachlorocyclohexane on liver tumor formation in medaka (Oryzias latipes)

    Cooke, J.B.; Hinton, D.E. [Univ. of California, Davis, CA (United States)

    1994-12-31

    When medaka were acutely exposed to diethylnitrosamine (DEN), greater incidence of hepatocarcinoma was seen in female versus male fish. This is possibly related to elevated female endogenous estrogens, which increase liver weight and production of vitellogenin. To examine roles of estrogens in tumor modulation, 21-day old medaka were exposed to DEN (200 ppm for 24 hr.), then fed purified diets containing the estrogenic compound {beta}-hexachlorocyclohexane ({beta}-HCH) or 17-{beta}estradiol (E2) for 6 months. Incidences of basophilic preneoplastic foci of cellular alteration in females receiving DEN and 0.01, 0.1, or 1.0 ppm E2 were three times the incidences in similarly-treated males. Also, incidences of basophilic foci in DEN + 0.1 ppm E2 males were significantly increased over DEN-only males and were equal to incidences in DEN-only females. Liver weights and hepatosomatic indices of males given 0.1 ppm E2 were not significantly different than females fed control diet. Females fed 0.01-10.0 ppm {beta}-HCH after DEN had 4--5 times greater incidences of basophilic foci as males. Gender-related effects on kinetics of growth rates and volumes of foci are being examined.

  11. CYTOCHROME P450 1A1 AND STRESS PROTEIN INDUCTION IN EARLY LIFE STAGES OF MEDAKA (ORYZIAS LATIPES) EXPOSED TO TRICHLOROETHYLENE (TCE) SOOT AND DIFFERENT FRACTIONS. (R825433)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  12. Aerial release of Rhinoncomimus latipes (Coleoptera: Curculionidae) to control Persicaria perfoliata (Polygonaceae) using an unmanned aerial system.

    Park, Yong-Lak; Gururajan, Srikanth; Thistle, Harold; Chandran, Rakesh; Reardon, Richard

    2018-01-01

    Rhinoncomimus latipes (Coleoptera: Curculionidae) is a major biological control agent against the invasive plant Persicaria perfoliata. Release of R. latipes is challenging with the current visit-and-hand release approach because P. perfoliata shows a high degree of patchiness in the landscape, possesses recurved barbs on its stems, and often spreads into hard-to-access areas. This 3-year study developed and evaluated unmanned aerial systems (UAS) for precise aerial release of R. latipes to control P. perfoliata. We have developed two UAS (i.e. quad-rotor and tri-rotor) and an aerial release system to disseminate R. latipes. These include pods containing R. latipes and a dispenser to accommodate eight pods. Results of field tests to evaluate the systems showed no significant (P > 0.05) effects on survivorship and feeding ability of R. latipes after aerial release. Our study demonstrates the potential of UAS for precision aerial release of biological control agents to control invasive plants. The aerial deployment systems we have developed, including both pods and a dispenser, are low cost, logistically practical, and effective with no negative effects on aerially released R. latipes. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  13. Preferential edge habitat colonization by a specialist weevil, Rhinoncomimus latipes (Coleoptera: Curculionidae)

    J.A. Hough-Goldstein; E. Lake; V. D' Amico; S.H. Berg

    2012-01-01

    Understanding the behavioral basis of dispersal and colonization is critical in biological control systems, where success of a natural enemy depends in part on its ability to find and move to new host patches. We studied behavior of the specialist weevil Rhinoncomimus latipes Korotyaev, a biological control agent of mile-a-minute weed, ...

  14. Preferential Edge Habitat Colonization by a Specialist Weevil, Rhinoncomimus latipes (Coleoptera: Curculionidae)

    Understanding the behavioral basis of dispersal and colonization is critical in biological control systems, where success of a natural enemy depends in part on its ability to find and move to new host patches. We studied behavior of the specialist weevil Rhinoncomimus latipes Korotyaev, a biological...

  15. Preliminary Study on Testicular Germ Cell Transplantation of Endemic Species Oryzias celebensis

    Andriani, I.; Agustiani, F.; Hassan, M.; Parenrengi, A.; Inoue, K.

    2018-03-01

    The research has been conducted to study some technical steps for male germ-plasm from endemic fish species such as some species of Oryzias fish in Indonesia to preserve and propagate through germ cell transplantation technology. For preliminary research, the study was started with germ cell characterization of testes, cryopreservation of TGC and the transplantation of Oryzias celebensis as candidates for surrogate broodstock of Oryzias fish male germ plasm. The data analized included the potential number of TGC as donor, the viability of cryopreserved TGC in two types of cryoprotectans and the survival rate of O.celebensis larvae as recipient after transplantation. The result showed that the average amount of TGC yielded after dissociation was 131000 ± 31349 with 74.2 % viability of TGC each. Cryoprotectan10% DMSO +glucose yielded higher viable of TGC. More than 80 % of O.celebensis larvae survived after transplantation. In conclusion, these preliminary data of O.celebensis as surrogate broodstock candidate will support the application of TGC transplantation technology in Oryzias endemic species.

  16. Desert springs: deep phylogeographic structure in an ancient endemic crustacean (Phreatomerus latipes.

    Michelle T Guzik

    Full Text Available Desert mound springs of the Great Artesian Basin in central Australia maintain an endemic fauna that have historically been considered ubiquitous throughout all of the springs. Recent studies, however, have shown that several endemic invertebrate species are genetically highly structured and contain previously unrecognised species, suggesting that individuals may be geographically 'stranded in desert islands'. Here we further tested the generality of this hypothesis by conducting genetic analyses of the obligate aquatic phreatoicid isopod Phreatomerus latipes. Phylogenetic and phylogeographic relationships amongst P. latipes individuals were examined using a multilocus approach comprising allozymes and mtDNA sequence data. From the Lake Eyre region in South Australia we collected data for 476 individuals from 69 springs for the mtDNA gene COI; in addition, allozyme electrophoresis was conducted on 331 individuals from 19 sites for 25 putative loci. Phylogenetic and population genetic analyses showed three major clades in both allozyme and mtDNA data, with a further nine mtDNA sub-clades, largely supported by the allozymes. Generally, each of these sub-clades was concordant with a traditional geographic grouping known as spring complexes. We observed a coalescent time between ∼2-15 million years ago for haplotypes within each of the nine mtDNA sub-clades, whilst an older total time to coalescence (>15 mya was observed for the three major clades. Overall we observed that multiple layers of phylogeographic history are exemplified by Phreatomerus, suggesting that major climate events and their impact on the landscape have shaped the observed high levels of diversity and endemism. Our results show that this genus reflects a diverse fauna that existed during the early Miocene and appears to have been regionally restricted. Subsequent aridification events have led to substantial contraction of the original habitat, possibly over repeated Pleistocene

  17. Using energy budget data to assess the most damaging life-stage of an agricultural pest Mocis latipes (Guenèe, 1982) (Lepidoptera - Noctuidae)

    Assunção-Albuquerque, MJT.; Peso-Aguiar, MC.; Albuquerque, FS.

    2010-01-01

    There is much evidence to support that Mocis latipes larvae (Guenèe, 1852) are the most dangerous pasture pest and usually cause large environmental losses. However, no studies have been carried out to identify the instars during which this moth causes the most damage to the environment. Here we calculate M. latipes larval energy budget to assess its consumption across all instars and estimate the consumption/amount of plant biomass required to complete its larval development. Assimilation, r...

  18. Using energy budget data to assess the most damaging life-stage of an agricultural pest Mocis latipes (Guenèe, 1982) (Lepidoptera--Noctuidae).

    Assunção-Albuquerque, M J T; Peso-Aguiar, M C; Albuquerque, F S

    2010-08-01

    There is much evidence to support that Mocis latipes larvae (Guenèe, 1852) are the most dangerous pasture pest and usually cause large environmental losses. However, no studies have been carried out to identify the instars during which this moth causes the most damage to the environment. Here we calculate M. latipes larval energy budget to assess its consumption across all instars and estimate the consumption/amount of plant biomass required to complete its larval development. Assimilation, respiration, consumption, excretion, gross growth efficiency and net growth efficiency were calculated. Pearson correlations were used to identify the best predictors that influenced larval growth and weight. Across all instars consumption increased exponentially, especially during the last phase. M. latipes larvae consumed ca 13.8% of total food from the first to the fifth instar, whereas during the sixth instars these larvae consumed ca 72.6%. Results also show that the best gross growth and net growth efficiency were obtained when larvae reached the fifth instar. The results also show that one larva of Mocis latipes consumes 1.02 g (dry weight) of Paspalum maritimum (Trin) in 19 days. Overall, our results indentified the sixth instar as the most destructive instar of this insect. Thus, once we know the most destructive instars of this pest, measures can be taken to disable M. latipes larval development and consequently stop their increase in plant consumption, reducing ecological and economic damage. This knowledge may eventually lead to reduced agricultural damage and contribute to sustainable farming strategies.

  19. Oryzias melastigma - an effective substitute for exotic larvicidal fishes: enhancement of its reproductive potential by supplementary feeding.

    Dutta, Abir Lal; Dey, Sajal Kumar; Chakraborty, Debargha; Manna, Asim Kumar; Manna, Pankaj Kumar

    2013-12-01

    A preliminary study was conducted on the efficacy of Oryzias melastigma in consuming mosquito larva so as to control mosquito and mosquito borne diseases, and enhancing its reproductive success using supplementary feed. Oryzias melastigma is a larvivore fish and widely distributed in the shallow water, wetlands of Gangetic plains and peninsular India. These studies indicate that O. melastigma is a prolific breeder and gregarious feeder of mosquito larvae. Increased reproduction by providing different supplementary feed, of which Ulothrix acted remarkably, may aid in wide spread use of this fish as a biological control measure against mosquitoes. One adult fish of any sex can consume 87.1% first instars mosquito larvae/day. So, early stages of mosquito larvae are effectively controlled, as compared to other successive stages. Ulothrix has considerable effect on egg production, successful hatching and regaining reproductive maturity of female in surprisingly quicker interval.

  20. Using energy budget data to assess the most damaging life-stage of an agricultural pest Mocis latipes (Guenèe, 1982) (Lepidoptera - Noctuidae)

    Albuquerque, M. J. T. Assunção; Aguiar, M. C. Peso; Albuquerque, F. S.

    2010-01-01

    p.459-463 There is much evidence to support that Mocis latipes larvae (Guenèe, 1852) are the most dangerous pasture pest and usually cause large environmental losses. However, no studies have been carried out to identify the instars during which this moth causes the most damage to the environment. Here we calculate M. latipes larval energy budget to assess its consumption across all instars and estimate the consumption/amount of plant biomass required to complete its larval development. As...

  1. Detection of Metallothionein in Javanese Medaka (Oryzias javanicus, Using a scFv-Immobilized Protein Chip

    Euiyeon Lee

    2018-04-01

    Full Text Available Environmental pollution by various industrial chemicals and biological agents poses serious risks to human health. Especially, marine contamination by potentially toxic elements (PTEs has become a global concern in recent years. Many efforts have been undertaken to monitor the PTE contamination of the aquatic environment. However, there are few approaches available to assess the PTE exposure of aquatic organisms. In this research, we developed a strategy to evaluate the heavy metal exposure of marine organisms, by measuring the expression levels of metallothionein protein derived from Oryzias javanicus (OjaMT. OjaMT is a biomarker of heavy metal exposure because the expression level increases upon heavy metal exposure. The developed assay is based on a real-time, label-free surface plasmon resonance (SPR measurement. Anti-OjaMT antibody and anti-OjaMT single-chain fragment of variable region (scFv were used as detection probes. Two types of SPR sensor chips were fabricated, by immobilizing antibody or Cys3-tagged scFv (scFv-Cys3 in a controlled orientation and were tested for in situ label-free OjaMT detection. Compared to the antibody-presenting sensor chips, the scFv-presenting sensor chips showed improved performance, displaying enhanced sensitivity and enabling semi-quantitative detection. The portable SPR system combined with scFv-immobilized sensor chips is expected to provide an excellent point-of-care testing system that can monitor target biomarkers in real time.

  2. Comparative Toxicity of Different Crude Oils on the Cardiac Function of Marine Medaka (Oryzias melastigma Embryo

    Zhendong Zhang

    2014-12-01

    Full Text Available The acute toxic effect of different crude oils (heavy crude oil and bonny light crude oil on embryos of marine medaka Oryzias melastigma was measured and evaluated by exposure to the water-accommodated fraction (WAF in the present study. The cardiac function of medaka embryos was used as target organ of ecotoxicological effect induced by oil exposure. Results showed that the developing marine medaka heart was a sensitive target organ to crude oil exposure the heavy crude oil WAF was more toxic to cardiac function of medaka embryos than bonny light cured oil one. Cardiac function of medaka embryos was clearly affected by exposure to heavy crude oil WAF after 24 hours exposure and showed a dose-dependent slowing of heart rate. Furthermore, swelled and enlarged heart morphology, lowered blood circulation and accumulation of blood cells around the heart area were found. However, the toxic effect of bonny light crude oil on cardiac function of medaka embryos was comparatively low. Statistical results showed that the cardiac function was only affected by highest bonny light crude oil WAF (9.8 mg/L exposure treatment. These findings indicated that cardiac function of marine medaka embryo was a good toxicity model for oil pollution and could be used to compare and evaluate the toxicity of different crude oils. The heart rate was an appropriate endpoint in the acute toxicity test.

  3. Using energy budget data to assess the most damaging life-stage of an agricultural pest Mocis latipes (Guenèe, 1982 (Lepidoptera - Noctuidae

    MJT. Assunção-Albuquerque

    Full Text Available There is much evidence to support that Mocis latipes larvae (Guenèe, 1852 are the most dangerous pasture pest and usually cause large environmental losses. However, no studies have been carried out to identify the instars during which this moth causes the most damage to the environment. Here we calculate M. latipes larval energy budget to assess its consumption across all instars and estimate the consumption/amount of plant biomass required to complete its larval development. Assimilation, respiration, consumption, excretion, gross growth efficiency and net growth efficiency were calculated. Pearson correlations were used to identify the best predictors that influenced larval growth and weight. Across all instars consumption increased exponentially, especially during the last phase. M. latipes larvae consumed ca 13.8% of total food from the first to the fifth instar, whereas during the sixth instars these larvae consumed ca 72.6%. Results also show that the best gross growth and net growth efficiency were obtained when larvae reached the fifth instar. The results also show that one larva of Mocis latipes consumes 1.02 g (dry weight of Paspalum maritimum (Trin in 19 days. Overall, our results indentified the sixth instar as the most destructive instar of this insect. Thus, once we know the most destructive instars of this pest, measures can be taken to disable M. latipes larval development and consequently stop their increase in plant consumption, reducing ecological and economic damage. This knowledge may eventually lead to reduced agricultural damage and contribute to sustainable farming strategies.

  4. Reproductive and transgenerational toxicities of phenanthrene on female marine medaka (Oryzias melastigma).

    Sun, Lingbin; Zuo, Zhenghong; Chen, Meng; Chen, Yixin; Wang, Chonggang

    2015-05-01

    Phenanthrene (PHE) is one of the most abundant polycyclic aromatic hydrocarbons in the aquatic environment and often results from oil spills. To assess the effects of PHE on fish, marine medaka (Oryzias melastigma) was exposed to PHE at 0.06, 0.6, 6 and 60 μg/L. The reproductive functions and transgenerational effects were investigated. After 80 days exposure, the percentage of previtellogenic and vitellogenic oocytes in the ovary showed a significant decrease in the 0.06 and 60 μg/L groups. The mRNA levels of salmon-type gonadotropin releasing hormone, the follicle-stimulating hormone FSHβ, and the luteinizing hormone LHβ in the brain; the cytochrome P450 aromatase gene CYP19A and the estrogen receptor α (ERα) in the ovary; and ERα and vitellogenin VTG1 and 2 in the liver all exhibited significant down-regulation in the 0.06 and 60 μg/L groups, but did not significantly change in the 6 μg/L group compared to the control, which was quite consistent with development of the oocytes. A significant elevation of PHE accumulation in the brain in the 0.06 and 60 μg/L groups gave a reasonable explanation for the nonmonotonic dose-response and also elucidated the action pathway via the brain-pituitary-gonadal axis. The reduction of the time to hatch and the increased cardiac rhythm of embryos were in accord with the PHE accumulative levels in the eggs. The results demonstrated that exposure to PHE at both low and high concentrations can inhibit ovary development. In addition, PHE can be maternally transferred to embryos and influence the health and sustainability of the next generation. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Impact of ocean acidification on the early development and escape behavior of marine medaka (Oryzias melastigma).

    Wang, Xiaojie; Song, Lulu; Chen, Yi; Ran, Haoyu; Song, Jiakun

    2017-10-01

    Ocean acidification is predicted to affect a wide diversity of marine organisms. However, no studies have reported the effects of ocean acidification on Indian Ocean fish. We have used the Indian Ocean medaka (Oryzias melastigma) as a model species for a marine fish that lives in coastal waters. We investigated the impact of ocean acidification on the embryonic development and the stereotyped escape behavior (mediated by the Mauthner cell) in newly hatched larvae. Newly fertilized eggs of medaka were reared in seawater at three different partial pressures of carbon dioxide (pCO 2 ): control at 450 μatm, moderate at 1160 μatm, and high at 1783 μatm. Hatch rates, embryonic duration, and larval malformation rates were compared and were not significantly different between the treatments and the control. In the high pCO 2 group, however, the yolks of larvae were significantly smaller than in the control group, and the newly hatched larvae were significantly longer than the larvae in the control. In the moderate pCO 2 group, the eye distance decreased significantly. No significantly negative growth effects were observed in the larvae when exposed to pCO 2 levels that are predicted as a result of ocean acidification in the next 100-200 years. Larvae reared under control conditions readily produced C-start escape behavior to mechanosensory stimuli; however, in the moderate and high pCO 2 experimental groups, the probabilities of C-start were significantly lower than those of the control group. Therefore, the sensory integration needed for the C-start escape behavior appears to be vulnerable to ocean acidification. Altered behavior in marine larval fish, particularly behaviors involved in escape from predation, could have potentially negative implications to fish populations, and, further, to the marine ecosystems at the levels of CO 2 projected for the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. A haplotype specific to North European wheat (Triticum aestivum L.)

    Tsombalova, J.; Karafiátová, Miroslava; Vrána, Jan; Kubaláková, Marie; Peusa, H.; Jakobson, I.; Jarve, M.; Valárik, Miroslav; Doležel, Jaroslav; Jarve, K.

    2017-01-01

    Roč. 64, č. 4 (2017), s. 653-664 ISSN 0925-9864 R&D Projects: GA MŠk(CZ) LO1204; GA ČR(CZ) GA14-07164S Institutional support: RVO:61389030 Keywords : bread wheat * genetic diversity * polyploid wheat * introgression lines * molecular analysis * tetraploid wheat * hexaploid wheat * powdery mildew * spelta l. * map * Common wheat * Triticum aestivum L * Spelt * Triticum spelta L * Chromosome 4A * Zero alleles * Haplotype * Linkage disequilibrium Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany Impact factor: 1.294, year: 2016

  7. Effects of chronic ammonia exposure on ammonia metabolism and excretion in marine medaka Oryzias melastigma.

    Gao, Na; Zhu, Limei; Guo, Zhiqiang; Yi, Meisheng; Zhang, Li

    2017-06-01

    Ammonia is highly toxic to aquatic organisms, but whether ammonia excretion or ammonia metabolism to less toxic compounds is the major strategy for detoxification in marine fish against chronic ammonia exposure is unclear to date. In this study, we investigated the metabolism and excretion of ammonia in marine medaka Oryzias melastigma during chronic ammonia exposure. The fish were exposed to 0, 0.1, 0.3, 0.6, and 1.1 mmol l -1  NH 4 Cl spiked seawater for 8 weeks. Exposure of 0.3-1.1 mmol l -1  NH 4 Cl had deleterious effects on the fish, including significant reductions in growth, feed intake, and total protein content. However, the fish could take strategies to detoxify ammonia. The tissue ammonia (T Amm ) in the 0.3-1.1 mmol l -1  NH 4 Cl treatments was significantly higher than those in the 0 and 0.1 mmol l -1  NH 4 Cl treatments after 2 weeks of exposure, but it recovered with prolonged exposure time, ultimately reaching the control level after 8 weeks. The amino acid catabolic rate decreased to reduce the gross ammonia production with the increasing ambient ammonia concentration. The concentrations of most metabolites remained constant in the 0-0.6 mmol l -1  NH 4 Cl treatments, whereas 5 amino acids and 3 energy metabolism-related metabolites decreased in the 1.1 mmol l -1  NH 4 Cl treatment. J Amm steadily increased in ambient ammonia from 0 to 0.6 mmol l -1 and slightly decreased when the ambient ammonia concentration increased to 1.1 mmol l -1 . Overall, marine medaka cope with sublethal ammonia environment by regulating the tissue T Amm via reducing the ammonia production and increasing ammonia excretion. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Comment: 219 [Taxonomy Icon

    Full Text Available Japanese medaka Oryzias latipes Oryzias_latipes_L.png 219.png Taxonomy icon (c) Database Center for Life Sci...ence licensed under CC Attribution2.1 Japan アイコン:メダカ HNI-Ⅱ系統バージョン bando 2010/02/15 15:31:07 2010/02/16 09:53:27 ...

  9. Evaluation of mutagenicity and metabolism-mediated cytotoxicity of the naphthoquinone 5-methoxy-3,4-dehydroxanthomegnin from Paepalanthus latipes

    Rodrigo R. Kitagawa

    Full Text Available A large number of quinones have been associated with antitumor, antibacterial, antimalarial, and antifungal activities. Results of previous studies of 5-methoxy-3,4-dehydroxanthomegnin, a naphthoquinone isolated from Paepalanthus latipes Silveira, Eriocaulaceae, revealed antitumor, antibacterial, immunomodulatory, and antioxidant activities. In this study, we assessed the mutagenicity and metabolism-mediated cytotoxicity of 5-methoxy-3,4-dehydroxanthomegnin by using the Ames test and a microculture neutral red assay incorporating an S9 fraction (hepatic microsomal fraction and cofactors, respectively. We also evaluated the mutagenic activity in Salmonella typhimurium strains TA100, TA98, TA102, and TA97a, as well as the cytotoxic effect on McCoy cells with and without metabolic activation in both tests. Results indicated that naphthoquinone does not cause mutations by substitution or by addition and deletion of bases in the deoxyribonucleic acid sequence with and without metabolic activation. As previously demonstrated, the in vitro cytotoxicity of 5-methoxy-3,4-dehydroxanthomegnin to McCoy cells showed a significant cytotoxic index (CI50 of 11.9 μg/ml. This index was not altered by addition of the S9 fraction, indicating that the S9 mixture failed to metabolically modify the compound. Our results, allied with more specific biological assays in the future, would contribute to the safe use of 5-methoxy-3,4-dehydroxanthomegnin, compound that has showed in previous studies beneficial properties as a potential anticancer drug.

  10. Labeling fish with an activable element through their diet. [samarium

    Michibata, Hitoshi (Toyama Univ. (Japan). Faculty of Science)

    1981-10-01

    Stable samarium, one of the rare earth elements, was fed to medaka (Oryzias latipes) and goldfish (Carassius auratus). The concentration of samarium in the labeled fish was determined by neutron activation analysis. In O. latipes, samarium was detectable even 1 yr after the labeled diet was eaten. In C. auratus, samarium was retained in the fifth brachial arch, scales, and gills.

  11. Effect of mercury and cadmium on early life stages of Java medaka (Oryzias javanicus): A potential tropical test fish

    Ismail, Ahmad; Yusof, Shahrizad

    2011-01-01

    Research highlights: → Early life stages of Java medaka show high sensitivity to Cd and Hg. → Exposure of the early life stages caused several developmental impairments. → Java medaka is suitable to be established as test organism for ecotoxicology. → Results of testing using this fish reflect the environment of the tropical region. - Abstract: Several organisms have been used as indicators, bio-monitoring agents or test organisms in ecotoxicological studies. A close relative of the well established Japanese medaka, the Java medaka (Oryzias javanicus), has the potential to be a test organism. The fish is native to the estuaries of the Malaysian Peninsula, Thailand, Indonesia and Singapore. In this study, newly fertilised eggs were exposed to different concentrations of Cd and Hg. Observations were done on the development of the embryos. Exposure to low levels of Cd and Hg (0.01-0.05 ppm) resulted in several developmental disorders that led to death. Exposure to ≥1.0 ppm Cd resulted in immediate developmental arrest. The embryos of Java medaka showed tolerance to a certain extent when exposed to ≥1.0 ppm Hg compared to Cd. Based on the sensitivity of the embryos, Java medaka is a suitable test organism for ecotoxicology in the tropical region.

  12. Developmental toxicity and molecular responses of marine medaka (Oryzias melastigma) embryos to ciguatoxin P-CTX-1 exposure.

    Yan, Meng; Leung, Priscilla T Y; Ip, Jack C H; Cheng, Jin-Ping; Wu, Jia-Jun; Gu, Jia-Rui; Lam, Paul K S

    2017-04-01

    Ciguatoxins are produced by toxic benthic dinoflagellates and cause ciguatera fish poisoning worldwide, but the toxic effects on developing marine fish have not been well investigated. The Pacific ciguatoxin (P-CTX-1), is a potent sodium channel agonist, which is one of the most toxic members among all CTXs. This study evaluated the toxic effects of microinjecting purified Pacific ciguatoxin-1 (P-CTX-1) on embryonic development of marine medaka Oryzias melastigma. A lower 96h-LD 50 value was estimated for eleuthero-embryos (1.32ngg -1 ) than that for embryos (1.71ngg -1 ), indicating that P-CTX-1 is more lethal to newly hatched medaka larvae. P-CTX-1 induced detrimental effects during embryonic development, including hatching failure, abnormalities in physical development (caudal fin malformation and spinal deformities), internal damage (green coloration of the gall bladder and hemorrhaging), immune dysfunction, and altered muscle physiology (bradycardia and hyperkinetic twitching). The results of a transcriptional expression analysis of genes related to the stress/immune responses, cardiac and bone development, and apoptosis supported the observed developmental abnormalities. This study advanced the understanding of P-CTX-1 mediated toxic mechanisms in the development of early life stages of a fish, and thus contributed to the toxicity assessment of CTXs in marine ecosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Hepatic Proteomic Responses in Marine Medaka ( Oryzias melastigma ) Chronically Exposed to Antifouling Compound Butenolide [5-octylfuran-2(5H)-one] or 4,5-Dichloro-2- N -Octyl-4-Isothiazolin-3-One (DCOIT)

    Chen, Lianguo; Sun, Jin; Zhang, Huoming; Au, Doris W. T.; Lam, Paul K. S.; Zhang, Weipeng; Bajic, Vladimir B.; Qiu, Jian-Wen; Qian, Pei-Yuan

    2015-01-01

    function in marine organisms. In the present study, we investigated the hepatic protein expression profiles of both male and female marine medaka (Oryzias melastigma) exposed to low concentrations of DCOIT at 2.55 mu g/L (0.009 mu M) or butenolide, a

  14. The effects of fish gender on susceptibility to acute Streptococcus agalactiae infection in Javanese medaka Oryzias javanicus.

    Amal, M N A; Zarif, S T; Suhaiba, M S; Aidil, M R M; Shaqinah, N N; Zamri-Saad, M; Ismail, A

    2017-12-05

    This study describes the susceptibility of different fish gender following acute Streptococcus agalactiae infection by using Javanese medaka Oryzias javanicus as test fish. The fish were grouped into four groups, which were: (1) all-male; (2) all-female; (3) mixed-gender (1 male: 1 female ratio); and (4) control non-infected (1 male: 1 female ratio). The fish in group 1, 2 and 3 were intraperitoneally exposed to 5.4 × 10 8  CFU/mL of S. agalactiae, while for group 4, the fish were exposed using sterile broth. The main clinical signs and histopathological changes of infected Javanese medaka were commonly observed in S. agalactiae infected fishes. However, no difference on clinical signs and histopathological changes of fish in group 1, 2 and 3 were noticed. The Javanese medaka mortality in group 1, 2 and 3 were observed from 4 h post infection (hpi) to 6 hpi, with the cumulative mortality from 3% to 30%. Then, the mortality increased at 12 hpi, with the range from 53% to 80%. However, 100% of the infected fish dead at 24 hpi. No clinical sign, histopathological change and fish mortality recorded in group 4. Generally, the clinical signs, mortality patterns, cumulative mortality and histopathological changes of Javanese medaka infected by S. agalactiae did not show any difference between the all-male, all-female and mixed-gender groups. This indicates that the susceptibility of fish to S. agalactiae infection is not influenced by their gender. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. The effect of fish gender on susceptibility to acute Streptococcus agalactiae infection in Javanese medaka Oryzias javanicus.

    Amal, M N A; Zarif, S T; Suhaiba, M; Aidil, M R M; Shaqinah, N N; Zamri-Saad, M; Ismail, A

    2017-12-04

    This study describes the susceptibility of different fish gender following acute Streptococcus agalactiae infection by using Javanese medaka Oryzias javanicus as test fish. The fish were grouped into four groups, which were: (1) all-male; (2) all-female; (3) mixed-gender (1 male: 1 female ratio); and (4) control non-infected (1 male: 1 female ratio). The fish in group 1, 2 and 3 were intraperitoneally exposed to 5.4 × 10 8  CFU/ml of S. agalactiae, while for group 4, the fish were exposed using sterile broth. The main clinical signs and histopathological changes of infected Javanese medaka were commonly observed in S. agalactiae infected fishes. However, no difference on clinical signs and histopathological changes of fish in group 1, 2 and 3 were noticed. The Javanese medaka mortality in group 1, 2 and 3 were observed from 4 h post infection (hpi) to 6 hpi, with the cumulative mortality from 3% to 30%. Then, the mortality increased at 12 hpi, with the range from 53% to 80%. However, 100% of the infected fish dead at 24 hpi. No clinical signs, histopathological changes and fish mortality recorded in group 4. Generally, the clinical signs, mortality patterns, cumulative mortality and histopathological changes of Javanese medaka infected by S. agalactiae did not show any difference between the all-male, all-female and mixed-gender groups. This indicates that the susceptibility of fish to S. agalactiae infection is not influenced by their gender. Copyright © 2017. Published by Elsevier Ltd.

  16. Hypoxia induces miR-210, leading to anti-apoptosis in ovarian follicular cells of marine medaka Oryzias melastigma

    Tse, Anna Chung-Kwan; Li, Jing-Woei; Chan, Ting-Fung; Wu, Rudolf Shiu-Sun; Lai, Keng-Po

    2015-01-01

    Highlights: • We demonstrate hypoxia induced miR-210 in ovarian follicular cells. • We show anti-apoptotic roles of miR-210 in ovarian follicular cells under hypoxia. • Apoptotic genes (DLC1, SLK, TNFRSF10B, RBM25, and USP7) are target of miR-210. • MiR-210 is vital for ovarian follicular cells proliferation in response to hypoxia. - Abstract: Hypoxia is a major global problem that impairs reproductive functions and reduces the quality and quantity of gametes and the fertilization success of marine fish. Nevertheless, the detailed molecular mechanism underlying hypoxia-induced female reproductive impairment remains largely unknown. There is increasing evidence that miRNA is vital in regulating ovarian functions and is closely associated with female fertility in humans. Certain miRNAs that regulate apoptotic genes can be induced by hypoxia, resulting in cell apoptosis. Using primary ovarian follicular cells of the marine medaka, Oryzias melastigma, as a model, we investigated the response of miR-210 to hypoxic stress in ovarian tissues to see if it would interrupt reproductive functions. A significant induction of miR-210 was found in primary ovarian follicular cells exposed to hypoxia, and gene ontology analysis further highlighted the potential roles of miR-210 in cell proliferation, cell differentiation, and cell apoptosis. A number of miR-210 target apoptotic genes, including Deleted in liver cancer 1 protein (DLC1), STE20-like serine/threonine-protein kinase (SLK), tumor necrosis factor receptor superfamily member 10b (TNFRSF10B), RNA binding motif protein 25 (RBM25), and Ubiquitin-specific-processing protease 7 (USP7), were identified. We further showed that ectopic expression of miR-210 would result in down-regulation of these apoptotic genes. On the other hand, the inhibition of miR-210 promoted apoptotic cell death and the expression of apoptotic marker – caspase 3 in follicular cells under hypoxic treatment, supporting the regulatory role of mi

  17. Hypoxia induces miR-210, leading to anti-apoptosis in ovarian follicular cells of marine medaka Oryzias melastigma

    Tse, Anna Chung-Kwan [School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong SAR (China); State Key Laboratory in Marine Pollution, Hong Kong SAR (China); Li, Jing-Woei; Chan, Ting-Fung [School of Life Sciences, Hong Kong Bioinformatics Centre, The Chinese University of Hong Kong, Hong Kong SAR (China); Wu, Rudolf Shiu-Sun [School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong SAR (China); State Key Laboratory in Marine Pollution, Hong Kong SAR (China); Lai, Keng-Po, E-mail: balllai@hku.hk [School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong SAR (China); State Key Laboratory in Marine Pollution, Hong Kong SAR (China)

    2015-08-15

    Highlights: • We demonstrate hypoxia induced miR-210 in ovarian follicular cells. • We show anti-apoptotic roles of miR-210 in ovarian follicular cells under hypoxia. • Apoptotic genes (DLC1, SLK, TNFRSF10B, RBM25, and USP7) are target of miR-210. • MiR-210 is vital for ovarian follicular cells proliferation in response to hypoxia. - Abstract: Hypoxia is a major global problem that impairs reproductive functions and reduces the quality and quantity of gametes and the fertilization success of marine fish. Nevertheless, the detailed molecular mechanism underlying hypoxia-induced female reproductive impairment remains largely unknown. There is increasing evidence that miRNA is vital in regulating ovarian functions and is closely associated with female fertility in humans. Certain miRNAs that regulate apoptotic genes can be induced by hypoxia, resulting in cell apoptosis. Using primary ovarian follicular cells of the marine medaka, Oryzias melastigma, as a model, we investigated the response of miR-210 to hypoxic stress in ovarian tissues to see if it would interrupt reproductive functions. A significant induction of miR-210 was found in primary ovarian follicular cells exposed to hypoxia, and gene ontology analysis further highlighted the potential roles of miR-210 in cell proliferation, cell differentiation, and cell apoptosis. A number of miR-210 target apoptotic genes, including Deleted in liver cancer 1 protein (DLC1), STE20-like serine/threonine-protein kinase (SLK), tumor necrosis factor receptor superfamily member 10b (TNFRSF10B), RNA binding motif protein 25 (RBM25), and Ubiquitin-specific-processing protease 7 (USP7), were identified. We further showed that ectopic expression of miR-210 would result in down-regulation of these apoptotic genes. On the other hand, the inhibition of miR-210 promoted apoptotic cell death and the expression of apoptotic marker – caspase 3 in follicular cells under hypoxic treatment, supporting the regulatory role of mi

  18. Linking genomic responses of gonads with reproductive impairment in marine medaka (Oryzias melastigma) exposed chronically to the chemopreventive and antifouling agent, 3,3′-diindolylmethane (DIM)

    Chen, Lianguo [Division of Life Science, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong SAR (China); Au, Doris W.T. [State Key Laboratory in Marine Pollution, Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong SAR (China); Hu, Chenyan [School of Chemistry and Environmental Engineering, Wuhan Institute of Technology, Wuhan 430072 (China); Zhang, Weipeng [Division of Life Science, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong SAR (China); Zhou, Bingsheng [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Cai, Lin [Division of Life Science, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong SAR (China); Giesy, John P. [Department of Veterinary Biomedical Sciences and Toxicology Centre, University of Saskatchewan, 44 Campus Drive, Saskatoon, SK S7N 5B3 (Canada); Department of Zoology, and Center for Integrative Toxicology, Michigan State University, East Lansing, MI (United States); Qian, Pei-Yuan, E-mail: boqianpy@ust.hk [Division of Life Science, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong SAR (China)

    2017-02-15

    Highlights: • Marine medaka were exposed chronically to low-doses of DIM. • Toxicogenomic responses of gonads were profiled at transcript and protein levels. • Molecular initiating events were linked to adverse apical outcomes. • VTG mobilization was blocked by lower abundance of cathepsin enzyme in ovary. • Eggshell proteins were more indicative of reproductive failure than VTG. - Abstract: 3,3′-Diindolylmethane (DIM) has been promoted as an effective chemopreventive and antifouling additive. However, the concurrent risks or side effects of DIM are not fully understood, especially on tissues responsive to estrogen. Therefore, this study employed marine medaka (Oryzias melastigma) as a test model to evaluate relative safety and explore mechanisms of toxic action of DIM on development and function of gonad after chronic (28 days) aqueous exposure to relatively low doses (0 μg/L or 8.5 μg/L). Integration of comprehensive toxicogenomic analysis at the transcriptome and proteome levels with apical endpoints, such as production of eggs and swimming performance of larvae, elucidated the molecular linkage in gonad from bottom up along the reproductive adverse outcome pathway. A series of sequential changes at the transcript and protein levels were linked to lesser fecundity and viability of larvae exposed to DIM. Anomalous production of vitellogenin (VTG) and eggshell proteins in testis confirmed the estrogenic potency of DIM. In the ovary, although storage of VTG was greater, lesser expressions of cathepsin enzymes blocked cleavage and incorporation of VTG into oocytes as yolk, which acted together with lower eggshell proteins to inhibit maturation of primary oocyte and thus contributed to impairment of fecundity. Overall, this study demonstrated that exposure to DIM impaired reproductive fitness. Diverse molecular initiating changes in gonads were linked to apical endpoints that could be used in assessment of risks posed by DIM on gametogenesis. In

  19. Linking genomic responses of gonads with reproductive impairment in marine medaka (Oryzias melastigma) exposed chronically to the chemopreventive and antifouling agent, 3,3′-diindolylmethane (DIM)

    Chen, Lianguo; Au, Doris W.T.; Hu, Chenyan; Zhang, Weipeng; Zhou, Bingsheng; Cai, Lin; Giesy, John P.; Qian, Pei-Yuan

    2017-01-01

    Highlights: • Marine medaka were exposed chronically to low-doses of DIM. • Toxicogenomic responses of gonads were profiled at transcript and protein levels. • Molecular initiating events were linked to adverse apical outcomes. • VTG mobilization was blocked by lower abundance of cathepsin enzyme in ovary. • Eggshell proteins were more indicative of reproductive failure than VTG. - Abstract: 3,3′-Diindolylmethane (DIM) has been promoted as an effective chemopreventive and antifouling additive. However, the concurrent risks or side effects of DIM are not fully understood, especially on tissues responsive to estrogen. Therefore, this study employed marine medaka (Oryzias melastigma) as a test model to evaluate relative safety and explore mechanisms of toxic action of DIM on development and function of gonad after chronic (28 days) aqueous exposure to relatively low doses (0 μg/L or 8.5 μg/L). Integration of comprehensive toxicogenomic analysis at the transcriptome and proteome levels with apical endpoints, such as production of eggs and swimming performance of larvae, elucidated the molecular linkage in gonad from bottom up along the reproductive adverse outcome pathway. A series of sequential changes at the transcript and protein levels were linked to lesser fecundity and viability of larvae exposed to DIM. Anomalous production of vitellogenin (VTG) and eggshell proteins in testis confirmed the estrogenic potency of DIM. In the ovary, although storage of VTG was greater, lesser expressions of cathepsin enzymes blocked cleavage and incorporation of VTG into oocytes as yolk, which acted together with lower eggshell proteins to inhibit maturation of primary oocyte and thus contributed to impairment of fecundity. Overall, this study demonstrated that exposure to DIM impaired reproductive fitness. Diverse molecular initiating changes in gonads were linked to apical endpoints that could be used in assessment of risks posed by DIM on gametogenesis. In

  20. Development of haplotype-specific molecular markers for the low-molecular-weight glutenin subunits

    Low-molecular-weight glutenin subunits (LMW-GSs) are one of the major components of gluten and their allelic variation has been widely associated with numerous wheat end-use quality parameters. These proteins are encoded by multigene families located at the orthologous Glu-3 loci (Glu-A3, Glu-B3 and...

  1. Effects of Di-butyl Phthalate (DBP) on Developing Medaka Embryos

    Tang, Sherry

    2012-01-01

    Plasticizers are chemical additives that enhance plastic flexibility. They are ubiquitous environmental contaminants and are commonly found in river and lake waters (Fromme et al 2002). The present study aimed to investigate the effects of a water-soluble plasticizer, dibutyl phthalate (DBP) on developing Medaka ("Oryzias latipes") embryos. Three…

  2. Influences of humic acid on the bioavailability of phenanthrene and alkyl phenanthrenes to early life stages of marine medaka (Oryzias melastigma)

    Liu, Yangzhi; Yang, Chenghu; Cheng, Pakkin; He, Xiaojing; Zhu, Yaxian; Zhang, Yong

    2016-01-01

    The influences of humic acid (HA) on the environmental behavior and bioavailability of parent polycyclic aromatic hydrocarbons (PAHs) and alkyl PAHs were investigated and compared using the early life stages of marine medaka (Oryzias melastigma, O. melastigma). It was demonstrated that the binding affinity of parent phenanthrene (PHE) with HA was smaller than that of 3-methyl phenanthrene (3-MP) and 9-ethyl phenanthrene (9-EP). Furthermore, the bioaccumulation of the three PAHs and the levels of lipid peroxidation (LPO) were calculated to study the changes in bioavailability of PAHs in presence of HA. The results indicated that the addition of HA significantly decreased the bioaccumulation and toxicity of PAHs by decreasing free PAHs concentrations. The bioavailable fractions of HA-bound PAHs in bioaccumulation (α) and toxicity (β) were evaluated, indicating that the HA-bound 3-MP and 9-EP show higher bioavailability in bioaccumulation and lower bioavailability in toxicity relative to those of PHE. The β/α values were less than 1 for all PAH treatment groups containing HA, suggesting that the fraction of HA-bound PAHs contributing to bioaccumulation was higher than that of HA-bound PAHs inducing toxic effect. In addition, we proposed that the free PAHs generated by desorption from HA in the cell were toxic by showing that the β/α ratio values are correlated with the log K_O_W values (p = 0.007 and R"2 = 0.8355). Thus, oil spill risk assessments should consider both alkyl PAHs and the factors that influence the bioavailability and toxicity of PAHs in the natural aquatic environments. - Highlights: • Effects of HA on bioavailability of parent and alkyl PAHs were firstly compared. • Changes in the bioavailability due to HA depended on the alkylation of PAHs. • The bioavailable fractions of the HA-bound parent and alkyl PAHs were calculated. • The toxicity of HA-bound PAHs was related to the physicochemical properties of PAHs. - This study is the

  3. Hypoxia induces telomerase reverse transcriptase (TERT gene expression in non-tumor fish tissues in vivo: the marine medaka (Oryzias melastigma model

    Mok Helen OL

    2006-09-01

    Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This

  4. Comparative safety of the antifouling compound butenolide and 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) to the marine medaka (Oryzias melastigma)

    Chen, Lianguo [Division of Life Science, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong Special Administrative Region (Hong Kong); Ye, Rui [State Key Laboratory in Marine Pollution, Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong Special Administrative Region (Hong Kong); Xu, Ying; Gao, Zhaoming [Division of Life Science, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong Special Administrative Region (Hong Kong); Au, Doris W.T. [State Key Laboratory in Marine Pollution, Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong Special Administrative Region (Hong Kong); Qian, Pei-Yuan, E-mail: boqianpy@ust.hk [Division of Life Science, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong Special Administrative Region (Hong Kong)

    2014-04-01

    Highlights: • Adverse effects of antifouling compound butenolide were studied using marine medaka. • The active ingredient in SeaNine 211, DCOIT, was employed as positive control. • Butenolide induced transient, reversible biological effects on marine medaka. • Lower toxicity of butenolide on marine biota highlights its promising application. • The increased sensitivity of male medaka addresses the gender difference. - Abstract: This study evaluated the potential adverse effects of butenolide, a promising antifouling compound, using the marine medaka (Oryzias melastigma), a model fish for marine ecotoxicology. The active ingredient used in the commercial antifoulant SeaNine 211, 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) was employed as the positive control. Adult marine medaka (4-month-old) were exposed to various concentrations of butenolide or DCOIT for 28 days and then depurated in clean seawater for 14 days (recovery). A suite of sensitive biomarkers, including hepatic oxidative stress, neuronal signal transmission, endocrine disruption, and reproductive function, was used to measure significant biological effects induced by the chemicals. Compared to DCOIT, chronic exposure to butenolide induced a lower extent of oxidative stress in the liver of male and female medaka. Furthermore, butenolide-exposed fish could recover faster from oxidative stress than fish exposed to DCOIT. Regarding neurotransmission, DCOIT significantly inhibited acetylcholinesterase (AChE) activity in the brain of both male and female medaka, whereas this was not significant for butenolide. In addition, plasma estradiol (E{sub 2}) level was elevated and testosterone (T) level was decreased in male medaka exposed to DCOIT. This greatly imbalanced sex hormones ratio (E{sub 2}/T) in exposed males, indicating that DCOIT is a potent endocrine disruptive chemical. In contrast, butenolide induced only moderate effects on sex hormone levels in exposed males, which could be

  5. Comparative safety of the antifouling compound butenolide and 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) to the marine medaka (Oryzias melastigma)

    Chen, Lianguo

    2014-04-01

    This study evaluated the potential adverse effects of butenolide, a promising antifouling compound, using the marine medaka (Oryzias melastigma), a model fish for marine ecotoxicology. The active ingredient used in the commercial antifoulant SeaNine 211, 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) was employed as the positive control. Adult marine medaka (4-month-old) were exposed to various concentrations of butenolide or DCOIT for 28 days and then depurated in clean seawater for 14 days (recovery). A suite of sensitive biomarkers, including hepatic oxidative stress, neuronal signal transmission, endocrine disruption, and reproductive function, was used to measure significant biological effects induced by the chemicals. Compared to DCOIT, chronic exposure to butenolide induced a lower extent of oxidative stress in the liver of male and female medaka. Furthermore, butenolide-exposed fish could recover faster from oxidative stress than fish exposed to DCOIT. Regarding neurotransmission, DCOIT significantly inhibited acetylcholinesterase (AChE) activity in the brain of both male and female medaka, whereas this was not significant for butenolide. In addition, plasma estradiol (E2) level was elevated and testosterone (T) level was decreased in male medaka exposed to DCOIT. This greatly imbalanced sex hormones ratio (E2/T) in exposed males, indicating that DCOIT is a potent endocrine disruptive chemical. In contrast, butenolide induced only moderate effects on sex hormone levels in exposed males, which could be gradually recovered during depuration. Moreover, the endocrine disruptive effect induced by butenolide did not affect normal development of offspring. In contrast, DCOIT-exposed fish exhibited a decrease of egg production and impaired reproductive success. Overall, the above findings demonstrated that chronic exposure to butenolide induced transient, reversible biological effect on marine medaka, while DCOIT could impair reproductive success of fish, as

  6. Comparative safety of the antifouling compound butenolide and 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) to the marine medaka (Oryzias melastigma)

    Chen, Lianguo; Ye, Rui; Xu, Ying; Gao, Zhaoming; Au, Doris W.T.; Qian, Pei-Yuan

    2014-01-01

    Highlights: • Adverse effects of antifouling compound butenolide were studied using marine medaka. • The active ingredient in SeaNine 211, DCOIT, was employed as positive control. • Butenolide induced transient, reversible biological effects on marine medaka. • Lower toxicity of butenolide on marine biota highlights its promising application. • The increased sensitivity of male medaka addresses the gender difference. - Abstract: This study evaluated the potential adverse effects of butenolide, a promising antifouling compound, using the marine medaka (Oryzias melastigma), a model fish for marine ecotoxicology. The active ingredient used in the commercial antifoulant SeaNine 211, 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) was employed as the positive control. Adult marine medaka (4-month-old) were exposed to various concentrations of butenolide or DCOIT for 28 days and then depurated in clean seawater for 14 days (recovery). A suite of sensitive biomarkers, including hepatic oxidative stress, neuronal signal transmission, endocrine disruption, and reproductive function, was used to measure significant biological effects induced by the chemicals. Compared to DCOIT, chronic exposure to butenolide induced a lower extent of oxidative stress in the liver of male and female medaka. Furthermore, butenolide-exposed fish could recover faster from oxidative stress than fish exposed to DCOIT. Regarding neurotransmission, DCOIT significantly inhibited acetylcholinesterase (AChE) activity in the brain of both male and female medaka, whereas this was not significant for butenolide. In addition, plasma estradiol (E 2 ) level was elevated and testosterone (T) level was decreased in male medaka exposed to DCOIT. This greatly imbalanced sex hormones ratio (E 2 /T) in exposed males, indicating that DCOIT is a potent endocrine disruptive chemical. In contrast, butenolide induced only moderate effects on sex hormone levels in exposed males, which could be gradually

  7. Comparative safety of the antifouling compound butenolide and 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) to the marine medaka (Oryzias melastigma).

    Chen, Lianguo; Ye, Rui; Xu, Ying; Gao, Zhaoming; Au, Doris W T; Qian, Pei-Yuan

    2014-04-01

    This study evaluated the potential adverse effects of butenolide, a promising antifouling compound, using the marine medaka (Oryzias melastigma), a model fish for marine ecotoxicology. The active ingredient used in the commercial antifoulant SeaNine 211, 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) was employed as the positive control. Adult marine medaka (4-month-old) were exposed to various concentrations of butenolide or DCOIT for 28 days and then depurated in clean seawater for 14 days (recovery). A suite of sensitive biomarkers, including hepatic oxidative stress, neuronal signal transmission, endocrine disruption, and reproductive function, was used to measure significant biological effects induced by the chemicals. Compared to DCOIT, chronic exposure to butenolide induced a lower extent of oxidative stress in the liver of male and female medaka. Furthermore, butenolide-exposed fish could recover faster from oxidative stress than fish exposed to DCOIT. Regarding neurotransmission, DCOIT significantly inhibited acetylcholinesterase (AChE) activity in the brain of both male and female medaka, whereas this was not significant for butenolide. In addition, plasma estradiol (E2) level was elevated and testosterone (T) level was decreased in male medaka exposed to DCOIT. This greatly imbalanced sex hormones ratio (E2/T) in exposed males, indicating that DCOIT is a potent endocrine disruptive chemical. In contrast, butenolide induced only moderate effects on sex hormone levels in exposed males, which could be gradually recovered during depuration. Moreover, the endocrine disruptive effect induced by butenolide did not affect normal development of offspring. In contrast, DCOIT-exposed fish exhibited a decrease of egg production and impaired reproductive success. Overall, the above findings demonstrated that chronic exposure to butenolide induced transient, reversible biological effect on marine medaka, while DCOIT could impair reproductive success of fish, as

  8. Hepatic Proteomic Responses in Marine Medaka ( Oryzias melastigma ) Chronically Exposed to Antifouling Compound Butenolide [5-octylfuran-2(5H)-one] or 4,5-Dichloro-2- N -Octyl-4-Isothiazolin-3-One (DCOIT)

    Chen, Lianguo

    2015-02-03

    The pollution of antifoulant SeaNine 211, with 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) as active ingredient, in coastal environment raises concerns on its adverse effects, including endocrine disruption and impairment of reproductive function in marine organisms. In the present study, we investigated the hepatic protein expression profiles of both male and female marine medaka (Oryzias melastigma) exposed to low concentrations of DCOIT at 2.55 mu g/L (0.009 mu M) or butenolide, a promising antifouling agent, at 2.31 mu g/L (0.012 mu M) for 28 days. The results showed that proteins involved in phase I (CYP450 enzyme) metabolism, phase II (UDPGT and GST) conjugation as well as mobilization of retinoid storage, an effective nonenzymatic antioxidant, were consistently up-regulated, possibly facilitating the accelerated detoxification of butenolide. Increased synthesis of bile acid would promote the immediate excretion of butenolide metabolites. Activation of fatty acid beta-oxidation and ATP synthesis were consistent with elevated energy consumption for butenolide degradation and excretion. However, DCOIT did not significantly affect the detoxification system of male medaka, but induced a marked increase of vitellogenin (VTG) by 2.3-fold in the liver of male medaka, suggesting that there is estrogenic activity of DCOIT in endocrine disruption. Overall, this study identified the molecular mechanisms and provided sensitive biomarkers characteristic of butenolide and DCOIT in the liver of marine medaka. The low concentrations of butenolide and DCOIT used in the exposure regimes highlight the needs for systematic evaluation of their environmental risk. In addition, the potent estrogenic activity of DCOIT should be considered in the continued applications of SeaNine 211.

  9. Proteomic changes in brain tissues of marine medaka (Oryzias melastigma) after chronic exposure to two antifouling compounds: Butenolide and 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT)

    Chen, Lianguo

    2014-12-01

    SeaNine 211 with active ingredient of 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) has been used as a "green" antifouling agent worldwide but has raised serious biosafety concerns in coastal environments. DCOIT has the potential to disrupt the neurotransmission in nervous system, but the underlying mechanism has not been clarified. In the present study, we used TMT six-plex labeling coupled with two-dimensional LC-MS/MS analysis to investigate the protein expression profiles in brain tissues of the marine medaka (Oryzias melastigma) after a 28-day exposure to environmentally-realistic concentration of DCOIT at 2.55. μg/L (0.009. μM) or butenolide, one promising antifouling compound, at 2.31. μg/L (0.012. μM). DCOIT and butenolide induced differential expression of 26 and 18 proteins in male brains and of 27 and 23 proteins in female brains, respectively. Distinct mechanisms of toxicity were initiated by DCOIT and butenolide in males, whereas the protein expression profiles were largely similar in females treated by these two compounds. In males, DCOIT exposure mainly led to disruption of mitogen-activated protein kinase (MAPK) signaling pathway, while butenolide affected proteins related to the cytoskeletal disorganization that is considered as a general response to toxicant stress. Furthermore, a sex-dependent protein expression profile was also noted between male and female fish, as evident by the inverse changes in the expressions of common proteins (5 proteins for butenolide- and 2 proteins for DCOIT-exposed fish). Overall, this study provided insight into the molecular mechanisms underlying the toxicity of DCOIT and butenolide. The extremely low concentrations used in this study highlighted the ecological relevance, arguing for thorough assessments of their ecological risks before the commercialization of any new antifouling compound.

  10. Comment: 198 [Taxonomy Icon

    Full Text Available ゲノム比較解析のためにゲノム解読が行われた。 撮影:成瀬清(基礎生物学研究所) Photo: Kiyoshi Naruse (National Institute for Basic Biology) bando 2009/10/01 14:48:45 2010/01/14 20:09:26 ... ...nal Institute for Basic Biology) licensed under CC Attribution2.1 Japan メダカ近交系 HNI-Ⅱ系統 北日本集団由来の純系。 Hd-rR系統との...Japanese medaka Oryzias latipes Oryzias_latipes_L.png 198.png Kiyoshi Naruse (Natio

  11. Comment: 199 [Taxonomy Icon

    Full Text Available nal Institute for Basic Biology) licensed under CC Attribution2.1 Japan メダカ近交系 Hd-rR系統 南日本集団由来の純系。 メダカで最初にゲノム解読が行われた系統。 撮影:成瀬清(基礎生物学...研究所) Photo: Kiyoshi Naruse (National Institute for Basic Biology) bando 2009/09/30 11:23:24 2010/01/14 20:09:43 ... ...Japanese medaka Oryzias latipes Oryzias_latipes_L.png 199.png Kiyoshi Naruse (Natio

  12. Evaluation of fish models of soluble epoxide hydrolase inhibition.

    Newman, J W; Denton, D L; Morisseau, C; Koger, C S; Wheelock, C E; Hinton, D E; Hammock, B D

    2001-01-01

    Substituted ureas and carbamates are mechanistic inhibitors of the soluble epoxide hydrolase (sEH). We screened a set of chemicals containing these functionalities in larval fathead minnow (Pimphales promelas) and embryo/larval golden medaka (Oryzias latipes) models to evaluate the utility of these systems for investigating sEH inhibition in vivo. Both fathead minnow and medaka sEHs were functionally similar to the tested mammalian orthologs (murine and human) with respect to substrate hydrol...

  13. Down-regulation of MHC class I by the Marek's disease virus (MDV) UL49.5 gene product mildly affects virulence in a haplotype-specific fashion.

    Jarosinski, Keith W; Hunt, Henry D; Osterrieder, Nikolaus

    2010-09-30

    Marek's disease is a devastating neoplastic disease of chickens caused by Marek's disease virus (MDV). MDV down-regulates surface expression of MHC class I molecules, although the mechanism has remained elusive. MDV harbors a UL49.5 homolog that has been shown to down-regulate MHC class I expression in other Varicelloviruses. Using in vitro assays, we showed that MDV pUL49.5 down-regulates MHC class I directly and identified its cytoplasmic tail as essential for this function. In vivo, viruses lacking the cytoplasmic tail of pUL49.5 showed no differences in MD pathogenesis compared to revertant viruses in highly susceptible chickens of the B(19)B(19) MHC class I haplotype, while there was a mild reduction in pathogenic potential of the deletion viruses in chickens more resistant to MD pathogenesis (MHC:B(21)B(21)). We concluded that the pathogenic effect of MHC class I down-regulation mediated by pUL49.5 is small because virus immune evasion possibly requires more than one viral protein. Copyright 2010 Elsevier Inc. All rights reserved.

  14. Down-regulation of MHC Class I by the Marek's Disease Virus (MDV) UL49.5 Gene Product Mildly Affects Virulence in a Haplotype-specific Fashion

    Marek’s disease is a devastating neoplastic disease of chickens caused by gallid herpesvirus 2 or Marek’s disease virus (MDV), which is characterized by massive visceral tumors, immune suppression, neurologic syndromes, and peracute deaths. It has been reported that MDV down-regulates surface expre...

  15. A Short History of the Hatching Enzyme Studies in Medaka(Development of Medaka Biology in Japan-Part II)

    Yamagami, Kenjiro

    1997-01-01

    The studies on the hatching enzyme of the medaka, Oryzias latipes, have a history of about 50 years, which is only a half of whole history of the studies on the hatching enzyme in animals since the first conjecture of it in a lung fish in 1900. Medaka, however, has served as the material most intensively studied for the enzyme, and the studies have given invaluable information to establish some significant concepts in the field of developmental and cell biology as well as the hatching biology...

  16. Japanese medaka: a non-mammalian vertebrate model for studying sex and age-related bone metabolism in vivo.

    Admane H Shanthanagouda

    Full Text Available BACKGROUND: In human, a reduction in estrogen has been proposed as one of the key contributing factors for postmenopausal osteoporosis. Rodents are conventional models for studying postmenopausal osteoporosis, but the major limitation is that ovariectomy is needed to mimic the estrogen decline after menopause. Interestingly, in medaka fish (Oryzias latipes, we observed a natural drop in plasma estrogen profile in females during aging and abnormal spinal curvature was apparent in old fish, which are similar to postmenopausal women. It is hypothesized that estrogen associated disorders in bone metabolism might be predicted and prevented by estrogen supplement in aging O. latipes, which could be corresponding to postmenopausal osteoporosis in women. PRINCIPAL FINDINGS: In O. latipes, plasma estrogen was peaked at 8 months old and significantly declined after 10, 11 and 22 months in females. Spinal bone mineral density (BMD and micro-architecture by microCT measurement progressively decreased and deteriorated from 8 to 10, 12 and 14 months old, which was more apparent in females than the male counterparts. After 10 months old, O. latipes were supplemented with 17α-ethinylestradiol (EE2, a potent estrogen mimic at 6 and 60 ng/mg fish weight/day for 4 weeks, both reduction in spinal BMD and deterioration in bone micro-architecture were significantly prevented. The estrogenic effect of EE2 in O. latipes was confirmed by significant up-regulation of four key estrogen responsive genes in the liver. In general, bone histomorphometric analyses indicated significantly lowered osteoblasts and osteoclasts numbers and surfaces on vertebrae of EE2-fed medaka. SIGNIFICANCE: We demonstrate osteoporosis development associated with natural drop in estrogen level during aging in female medaka, which could be attenuated by estrogen treatment. This small size fish is a unique alternative non-mammalian vertebrate model for studying estrogen-related molecular

  17. FY 1982 report on the results of the verification test on the methanol conversion for oil-fired power plant. Part 2. Verification test on the environmental safety; 1982 nendo sekiyu karyoku hatsudensho metanoru tenkan tou jissho shiken seika hokokusho. Kankyo anzensei jissho shiken (Sono 2)

    NONE

    1983-03-01

    For the purpose of contributing to the promotion of methanol introduction and establishment of conversion technology, testing research on environmental safety of methanol was conducted, and the FY 1982 results were reported. In this fiscal year, construction was completed of testing facilities for breeding monkey/aquatic animal in the methanol environment, and test was started. In the test on the rapid exposure of macaca to high concentration (10,000ppm), effects were recognized on the blood physiochemistry, urine analysis, cardiac function, cerebral basal nuclei and cinerea part, as a result of various inspections/analyses made after 7-day exposure. Further, for the macaca exposed to a concentration of 3,000ppm, no remarkable changes were observed in urine analysis, pH value, etc. As to the effect of toxicity of methanol on oryzias latipes, toxicity is considerably lower than that of other chemicals. At about 3% concentration, half the number of oryzias latipes was fatal in 96 hours. Further, when diatom is exposed to methanol of concentration of 100ppm or more at the time of starting culture, the diatom continues to be hindered by methanol even after methanol fades away. At the same time, methanol also seems to have effects on the shape and metabolism of diatom. (NEDO)

  18. Dnd Is a Critical Specifier of Primordial Germ Cells in the Medaka Fish

    Ni Hong

    2016-03-01

    Full Text Available Primordial germ cell (PGC specification occurs early in development. PGC specifiers have been identified in Drosophila, mouse, and human but remained elusive in most animals. Here we identify the RNA-binding protein Dnd as a critical PGC specifier in the medaka fish (Oryzias latipes. Dnd depletion specifically abolished PGCs, and its overexpression boosted PGCs. We established a single-cell culture procedure enabling lineage tracing in vitro. We show that individual blastomeres from cleavage embryos at the 32- and 64-cell stages are capable of PGC production in culture. Importantly, Dnd overexpression increases PGCs via increasing PGC precursors. Strikingly, dnd RNA forms prominent particles that segregate asymmetrically. Dnd concentrates in germ plasm and stabilizes germ plasm RNA. Therefore, Dnd is a critical specifier of fish PGCs and utilizes particle partition as a previously unidentified mechanism for asymmetric segregation. These findings offer insights into PGC specification and manipulation in medaka as a lower vertebrate model.

  19. Draft genome of the medaka fish: a comprehensive resource for medaka developmental genetics and vertebrate evolutionary biology.

    Takeda, Hiroyuki

    2008-06-01

    The medaka Oryzias latipes is a small egg-laying freshwater teleost, and has become an excellent model system for developmental genetics and evolutionary biology. The medaka genome is relatively small in size, approximately 800 Mb, and the genome sequencing project was recently completed by Japanese research groups, providing a high-quality draft genome sequence of the inbred Hd-rR strain of medaka. In this review, I present an overview of the medaka genome project including genome resources, followed by specific findings obtained with the medaka draft genome. In particular, I focus on the analysis that was done by taking advantage of the medaka system, such as the sex chromosome differentiation and the regional history of medaka species using single nucleotide polymorphisms as genomic markers.

  20. Oxidative degradation of alkylphenols by horseradish peroxidase.

    Sakuyama, Hisae; Endo, Yasushi; Fujimoto, Kenshiro; Hatana, Yasuhiko

    2003-01-01

    Alkylphenols such as bisphenol A (2,2-bis(4-hydroxyphenyl)propane; BPA), p-nonylphenol (p-NP), and p-octylphenol (p-OP) that are known as endocrine disrupters were oxidized by horseradish (Armoracia rusticana) peroxidase (HRP) with H2O2. The optimal pHs for BPA, p-NP, and p-OP were 8.0, 7.0, and 5.0, respectively. The optimal temperature for BPA was 20 degrees C. Although BPA was rapidly degraded by HRP, its degradation depended on the concentration of HRP. Most of the oxidation products of BPA were polymers, although some 4-isopropenylphenol was produced. When male Japanese medaka (Oryzias latipes) were exposed to BPA, vitellogenin in the blood increased. However, no increased vitellogenin was observed in medaka exposed to HRP-oxidized BPA. The enzymatic oxidation of BPA using HRP was able to eliminate its estrogen-like activity.

  1. Dicty_cDB: Contig-U06086-1 [Dicty_cDB

    Full Text Available 34 1.9 2 ( CT531391 ) A BAC library has been constructed from cultivar ... 34 1.9 3 ( CT536760 ) A BAC lib...u... 36 2.9 2 ( CT504385 ) A BAC library has been constructed from cultivar ... 38 3.0 2 ( BX005275 ) ...1 ( DH327531 ) Oryzias latipes Fosmid clone:GOLWFno690_k15, forw... 46 3.2 1 ( CT562554 ) A BAC library has been constructed from cul...9 ) 16372 Swollen Stolon Solanum tuberosum cDNA, mRNA... 48 0.81 1 ( CK277118 ) EST723196 potato abiotic stress cDNA library... Sola... 48 0.81 1 ( CK277117 ) EST723195 potato abiotic stress cDNA library Sola... 48 0.81

  2. The fish sexual development test: an OECD test guideline proposal with possible relevance for environmental risk assessment. Results from the validation programme

    Holbech, Henrik; Brande-Lavridsen, Nanna; Kinnberg, Karin Lund

    2010-01-01

    The Fish Sexual Development Test (FSDT) has gone through two validations as an OECD test guideline for the detection of endocrine active chemicals with different modes of action. The validation has been finalized on four species: Zebrafish (Danio rerio), Japanese medaka (Oryzias latipes), three s...... as a population relevant endpoint and the results of the two validation rounds will be discussed in relation to environmental risk assessment and species selection....... for histology. For all three methods, the fish parts were numbered and histology could therefore be linked to the vitellogenin concentration in individual fish. The two core endocrine relevant endpoints were vitellogenin concentrations and phenotypic sex ratio. Change in the sex ratio is presented...

  3. Use of medaka as a tool in studies of radiation effects and chemical carcinogenesis

    Hyodo-Taguchi, Y.; Aoki, K.; Matsudaira, H.

    1982-01-01

    The medaka, Oryzias latipes, a small freshwater oviparous fish, is common in Japan and found in some parts of Asia. Adult fish are 3.0-3.5 cm long and weigh 0.5-0.7 g. The small fish have been used extensively in this laboratory for analysis of radiation effects and for study of chemical carcinogenesis. These fish are relatively easy to rear and their reproductive biology is well known. Recently, inbred strains of the fish have been established by full sister-brother mating. In this report, we will review experimental results using medaka in studies of : 1) radiation effects on spermatogenesis, and 2) induction of hepatic tumors by MAM acetate, we will also review use of medaka in related studies of radiation effects and chemical carcinogenesis. (author)

  4. Links between persistent DNA damage, genome instability, and aging

    Dynan, William S. [Emory Univ., Atlanta, GA (United States). Dept. of Radiation Oncology

    2016-11-14

    The goal of this study was to examine long-term effects of low-dose radiation exposure. One of the hypotheses was that radiation exposure would accelerate the normal aging process. The study was jointly funded by NASA and examined both low-LET radiation (γ-rays) and high-LET radiation (1000 MeV/nucleon 56Fe ions) at doses of 0.1 Gy and up. The work used the Japanese medaka fish (Oryzias latipes), as a vertebrate model organism that can be maintained in large numbers at low cost for lifetime studies. Like other small laboratory fish, Japanese medaka share many anatomical and histological characteristics with other vertebrates, and a variety of genetic and genomic resources are available. Some work also used the zebrafish (Danio rerio), another widely used laboratory model organism.

  5. Biological (molecular and cellular) markers of toxicity

    Shugart, L.R.; D'Surney, S.J.; Gettys-Hull, C.; Greeley, M.S. Jr.

    1991-01-01

    Several molecular and cellular markers of genotoxicity were adapted for measurement in the Medaka (Oryzias latipes), and were used to describe the effects of treatment of the organism with diethylnitrosamine (DEN). NO 6 -ethyl guanine adducts were detected, and a slight statistically significant, increase in DNA strand breaks was observed. These results are consistent with the hypothesis that prolonged exposure to high levels of DEN induced alkyltransferase activity which enzymatically removes any O 6 -ethyl guanine adducts but does not result in strand breaks or hypomethylation of the DNA such as might be expected from excision repair of chemically modified DNA. Following a five week continuous DEN exposure with 100 percent renewal of DEN-water every third day, the F values (DNA double strandedness) increased considerably and to similar extent in fish exposed to 25, 50, and 100 ppM DEN. This has been observed also in medaka exposed to BaP

  6. Instrumental neutron activation analysis of river habitants by the k(0)-standardization method

    Momoshima, N.; Toyoshima, T.; Matsushita, R.; Fukuda, A.; Hibino, K.

    2005-01-01

    Analysis of metal concentrations in samples use reference materials for determination, which means elements out of the references are not possible to be determined. The instrumental neutron activation analysis (INAA) with k(O)-standardization method makes possible to determine metals without use of reference materials, which is very attractive for environmental sample analysis, River habitants would be available as a bio-indicator from which river water quality or metal contamination level could be evaluated. We analyzed river fishes and river insects by INAA with k(O)-standardization to examine the possibility of these habitants as a bio-indicator of water system. Small fishes, Oryzias latipes and Gambusia affinis were collected at 3 different rivers every month and river insects, families of Heptageniidae, Baetidae, Perlidae, Hydropsychidae, Psephenidae were collected at a fixed point of the river. The dried samples were irradiated at the research reactor, JRR-4 (3.5MW), JAERI for 10 min and 3 h. 17 elements (Na, K, Ca, Sc, Cr, Mn, Fe, Co, Zn, As, Se, Br, Rb, Sr, Ba, Ce and Sm) were determined by the NAA-k(0) method, showing effectiveness of the present method for environmental sample analysis. The metals observed in the fishes were the highest in Ca and the lowest in Sc, ranging from 10 5 mg/kg-dry weigh in Ca to 10 -2 mg/kg-dry weight in Sc. The differences in metal concentrations were examined by statistical analysis with t-test. Ca, Na and Br concentrations differ between species, Oryzias latipes and Gambusia, and Fe, Sc, Co, Zn and Se concentrations differ among rivers. No difference was observed on K, Rb and Sr concentrations.

  7. In vivo imaging of the morphology and changes in pH along the gastrointestinal tract of Japanese medaka by photonic band-gap hydrogel microspheres

    Du, Xuemin; Lei, Ngai-Yu; Hu, Peng; Lei, Zhang; Ong, Daniel Hock-Chun; Ge, Xuewu; Zhang, Zhicheng; Lam, Michael Hon-Wah

    2013-01-01

    Graphical abstract: -- Highlights: •Fabrication of pH-responsive photonic colloidal crystalline microspheres. •Specific photonic band-gap responses occurred in the pH range of 4–5. •Remarkably low in vivo toxicity to Japanese medaka (Oryzia latipes). •In vivo imaging of the morphology and pH along GI tract of Japanese medaka. •Demonstrates bio-imaging potentials of stimuli-responsive photonic materials. -- Abstract: Colloidal crystalline microspheres with photonic band-gap properties responsive to media pH have been developed for in vivo imaging purposes. These colloidal crystalline microspheres were constructed from monodispersed core–shell nano-size particles with poly(styrene-co-acrylic acid) (PS-co-PAA) cores and poly(acrylic acid-co-N-isopropylacrylamide) (PAA-co-PNIPAM) hydrogel shells cross-linked by N,N′-methylenebisacrylamide. A significant shift in the photonic band-gap properties of these colloidal crystalline microspheres was observed in the pH range of 4–5. This was caused by the discontinuous volume phase transition of the hydrogel coating, due to the protonation/deprotonation of its acrylic acid moieties, on the core–shell nano-sized particles within the microspheres. The in vivo imaging capability of these pH-responsive photonic microspheres was demonstrated on a test organism – Japanese medaka, Oryzia latipes – in which the morphology and change in pH along their gastrointestinal (GI) tracts were revealed under an ordinary optical microscope. This work illustrates the potential of stimuli-responsive photonic band-gap materials in tissue-/organ-level in vivo bio-imaging

  8. Acute Toxicity Comparison of Single-Walled Carbon Nanotubes in Various Freshwater Organisms

    Eun Kyung Sohn

    2015-01-01

    Full Text Available While the commercialization of single-walled carbon nanotubes (SWCNTs is rapidly expanding, the environmental impact of this nanomaterial is not well understood. Therefore, the present study evaluates the acute aquatic toxicity of SWCNTs towards two freshwater microalgae (Raphidocelis subcapitata and Chlorella vulgaris, a microcrustacean (Daphnia magna, and a fish (Oryzias latipes based on OECD test guidelines (201, 202, and 203. According to the results, the SWCNTs inhibited the growth of the algae R. subcapitata and C. vulgaris with a median effective concentration (EC50 of 29.99 and 30.96 mg/L, respectively, representing “acute category 3” in the Globally Harmonized System (GHS of classification and labeling of chemicals. Meanwhile, the acute toxicity test using O. latipes and D. magna did not show any mortality/immobilizing effects up to a concentration of 100.00 mg/L SWCNTs, indicating no hazard category in the GHS classification. In conclusion, SWCNTs were found to induce acute ecotoxicity in freshwater microalgae, yet not in D. magna and medaka fish.

  9. Genetic similarity of the Hainan medaka populations collected from hyper- and hypo-osmotic environments in northern Vietnam

    Hayakawa, Hideki; Le, Quang Dung; Kinoshita, Masato; Takehana, Yusuke; Sakuma, Kei; Takeshima, Hirohiko; Kojima, Shigeaki; Naruse, Kiyoshi; Inoue, Koji

    2015-06-01

    Ricefishes of the genus Oryzias, including Japanese medaka ( O. latipes), are known as excellent model organisms for studies in various fields of science. Some species of the genus inhabit brackish water, and such species are recognized to be useful to investigate physiological phenomena in seawater. However, only a limited number of species have been recorded from brackish waters. In addition, there is no information about the genetic relationship among populations inhabiting sites with different salinities. Here we report the discovery of Oryzias fish in two locations near Haiphong, northern Vietnam, a brackish mangrove planting area and a freshwater pond. A phylogenetic analysis using mitochondrial 12S and 16S ribosomal RNA (rRNA) gene sequences indicated that the fish from the two localities are the same species, Hainan medaka, O. curvinotus. Population genetic analysis using the mitochondrial 12S and 16S rRNA gene sequences revealed a close genetic relationship between the two populations. These results suggest that O. curvinotus is adaptable to both hyperosmotic and hypoosmotic environments. Due to its osmotic adaptability and ease of rearing in the laboratory, this species is expected to become a model for marine environmental and toxicological studies, as well as for studies of osmotic adaptation mechanisms.

  10. Novel insights into iron regulation and requirement in marine medaka Oryzias melastigma.

    Wang, Jian; Wang, Wen-Xiong

    2016-05-24

    Iron (Fe) is an essential trace element for marine fish. However, our knowledge of Fe requirements at different development stages of marine fish is still limited. Here, we reported the efficient Fe absorption strategies adopted by larval fish under different dietary Fe supplementary levels (i.e., 0-640 mg/kg). Biokinetically, the larval fish controlled their dietary Fe assimilation efficiency (AE, 1.6-18.5%), and enhanced their waterborne Fe uptake (ca. 2.5 fold change of uptake rate constant) once the dietary Fe was deficient (i.e., 27.4 mg Fe/kg feed). Transcriptionally, the expression of hepcidin1 (hep1; Fe regulator; i.e., 2.3-15.7 fold change) in larval fish was positively correlated with the Fe supplementary levels. Comparatively, the female adult fish were poor in assimilating the added Fe source (i.e., ferric form) with similar life-sustainable levels of Fe (i.e., 0.046-0.12 μg/g/d assimilated for Fe supplementary levels of 27.4, 162 and 657 mg Fe/kg feed). The overall feeding experiments suggested that dietary net Fe flux sufficient for the normal growth of larval medaka was 0.71-1.75 μg/g/d (i.e., 83.9 mg Fe/kg feed), consistent with the modeled value (i.e., 1.09-2.16 μg/g/d). In female adults, the estimated essential net Fe flux was 0.88-0.90 μg/g/d.

  11. Different phylogenomic approaches to resolve the evolutionary relationships among model fish species.

    Negrisolo, Enrico; Kuhl, Heiner; Forcato, Claudio; Vitulo, Nicola; Reinhardt, Richard; Patarnello, Tomaso; Bargelloni, Luca

    2010-12-01

    Comparative genomics holds the promise to magnify the information obtained from individual genome sequencing projects, revealing common features conserved across genomes and identifying lineage-specific characteristics. To implement such a comparative approach, a robust phylogenetic framework is required to accurately reconstruct evolution at the genome level. Among vertebrate taxa, teleosts represent the second best characterized group, with high-quality draft genome sequences for five model species (Danio rerio, Gasterosteus aculeatus, Oryzias latipes, Takifugu rubripes, and Tetraodon nigroviridis), and several others are in the finishing lane. However, the relationships among the acanthomorph teleost model fishes remain an unresolved taxonomic issue. Here, a genomic region spanning over 1.2 million base pairs was sequenced in the teleost fish Dicentrarchus labrax. Together with genomic data available for the above fish models, the new sequence was used to identify unique orthologous genomic regions shared across all target taxa. Different strategies were applied to produce robust multiple gene and genomic alignments spanning from 11,802 to 186,474 amino acid/nucleotide positions. Ten data sets were analyzed according to Bayesian inference, maximum likelihood, maximum parsimony, and neighbor joining methods. Extensive analyses were performed to explore the influence of several factors (e.g., alignment methodology, substitution model, data set partitions, and long-branch attraction) on the tree topology. Although a general consensus was observed for a closer relationship between G. aculeatus (Gasterosteidae) and Di. labrax (Moronidae) with the atherinomorph O. latipes (Beloniformes) sister taxon of this clade, with the tetraodontiform group Ta. rubripes and Te. nigroviridis (Tetraodontiformes) representing a more distantly related taxon among acanthomorph model fish species, conflicting results were obtained between data sets and methods, especially with respect

  12. Natriuretic peptides in developing medaka embryos: implications in cardiac development by loss-of-function studies.

    Miyanishi, Hiroshi; Okubo, Kataaki; Nobata, Shigenori; Takei, Yoshio

    2013-01-01

    Cardiac natriuretic peptides (NPs), atrial NP (ANP) and B-type NP (BNP), and their receptor, guanylyl cyclase (GC)-A have attracted attention of many basic and clinical researchers because of their potent renal and cardiovascular actions. In this study, we used medaka, Oryzias latipes, as a model species to pursue the physiological functions of NPs because it is a suitable model for developmental analyses. Medaka has two ligands, BNP and C-type NP3 (CNP3) (but not ANP), that have greater affinity for the two O. latipes GC-A receptors (OLGC), OLGC7 and OLGC2, respectively. CNP3 is the ancestral molecule of cardiac NPs. Initially, we examined developmental expression of cardiac NP/receptor combinations, BNP/OLGC7 and CNP3/OLGC2, using quantitative real-time PCR and in situ hybridization. BNP and CNP3 mRNA increased at stages 25 (onset of ventricular formation) and 22 (appearance of heart anlage), respectively, whereas both receptor mRNAs increased at as early as stage 12. BNP/OLGC7 transcripts were found in arterial/ventricular tissues and CNP3/OLGC2 transcripts in venous/atrial tissues by in situ hybridization. Thus, BNP and CNP3 can act locally on cardiac myocytes in a paracrine/autocrine fashion. Double knockdown of BNP/OLGC7 genes impaired ventricular development by causing hypoplasia of ventricular myocytes as evidenced by reduced bromodeoxyuridine incorporation. CNP3 knockdown induced hypertrophy of atria and activated the renin-angiotensin system. Collectively, it appears that BNP is important for normal ventricular, whereas CNP3 is important for normal atrial development and performance, a role usually taken by ANP in other vertebrates. The current study provides new insights into the role of cardiac NPs in cardiac development in vertebrates.

  13. Species specific anaesthetics for fish anaesthesia and euthanasia.

    Readman, Gareth D; Owen, Stewart F; Knowles, Toby G; Murrell, Joanna C

    2017-08-02

    There is a need to ensure that the care and welfare for fish maintained in the laboratory are to the highest standards. This extends to the use of anaesthetics for both scientific study, humane killing and euthanasia at end of life. An anaesthetic should not induce negative behaviours and fish should not seek to avoid the anaesthetic. Surprisingly little information is available to facilitate a humane choice of anaesthetic agent for fish despite over 100 years of use and the millions of fish currently held in thousands of laboratories worldwide. Using a chemotaxic choice chamber we found different species specific behavioural responses among four closely related fish species commonly held in the laboratory, exposed to three widely used anaesthetic agents. As previously found for zebrafish (Danio rerio), the use of MS-222 and benzocaine also appears to induce avoidance behaviours in medaka (Oryzias latipes); but etomidate could provide an alternative choice. Carp (Cyprinus carpio), although closely related to zebrafish showed avoidance behaviours to etomidate, but not benzocaine or MS-222; and rainbow trout (Oncorhynchus mykiss) showed no avoidance to the three agents tested. We were unable to ascertain avoidance responses in fathead minnows (Pimephales promelas) and suggest different test paradigms are required for that species.

  14. Genetic Architecture of the Variation in Male-Specific Ossified Processes on the Anal Fins of Japanese Medaka.

    Kawajiri, Maiko; Fujimoto, Shingo; Yoshida, Kohta; Yamahira, Kazunori; Kitano, Jun

    2015-10-28

    Traits involved in reproduction evolve rapidly and show great diversity among closely related species. However, the genetic mechanisms that underlie the diversification of courtship traits are mostly unknown. Japanese medaka fishes (Oryzias latipes) use anal fins to attract females and to grasp females during courtship; the males have longer anal fins with male-specific ossified papillary processes on the fin rays. However, anal fin morphology varies between populations: the southern populations tend to have longer anal fins and more processes than the northern populations. In the present study, we conducted quantitative trait locus (QTL) mapping to investigate the genetic architecture underlying the variation in the number of papillary processes of Japanese medaka fish and compared the QTL with previously identified QTL controlling anal fin length. First, we found that only a few QTL were shared between anal fin length and papillary process number. Second, we found that the numbers of papillary processes on different fin rays often were controlled by different QTL. Finally, we produced another independent cross and found that some QTL were repeatable between the two crosses, whereas others were specific to only one cross. These results suggest that variation in the number of papillary processes is polygenic and controlled by QTL that are distinct from those controlling anal fin length. Thus, different courtship traits in Japanese medaka share a small number of QTL and have the potential for independent evolution. Copyright © 2015 Kawajiri et al.

  15. Residue analyses on 2-amino-4-phenylthiazole, a piscine anesthetic, in fishes, 3

    Suzuki, Akira; Shimura, Masaru; Kikuchi, Takahiko; Sekizawa, Yasuharu

    1977-01-01

    The major biotransformation product of 2-amino-phenylthiazole in rainbow trout (Salmo gairdneri irideus) was isolated from water following exposure of fish to the anesthetic. The isolated crystalline metabolite was shown by means of ultraviolet, infrared and optical rotatory dispersion spectroscopy and gas chromatography to be identical to 2-amino-4-phenylthiazole-2-N-β-mono-D-glucopyranosiduronic acid, the major biotransformation product previously found in medaka (killifish, Oryzias latipes). The major biotransformation product in carp (Cyprinus carpio) was also identified as 2-amino-4-phenylthiazole-2-N-β-mono-D-glucopyranosiduronic acid by molecular sieve, thin layer and gas chromatography. Conversion of 2-amino-4-phenylthiazole to the N-glycuronyl conjugate was 8 and 12%, respectively, in rainbow trout and carp as shown by thin layer chromatography of extracts from fish treated with 3 H-labeled anesthetic. In addition, a minor metabolite of the anesthetic in rainbow trout was isolated as a yellowish-white crystalline powder and identified as 2-acetamino-4-(4'-hydroxyphenyl)-thiazole by means of ultraviolet and infrared spectroscopy, NMR and mass spectrometry. Chromatography suggested that this same metabolite was also formed in carp but in concentrations too low for isolation and definitive identification. (auth.)

  16. Neurological effects on startle response and escape from predation by medaka exposed to organic chemicals

    Carlson, R.; Drummond, R.; Hammermeister, D.; Bradbury, S. [Environmental Protection Agency, Duluth, MN (United States). Environmental Research Lab.

    1995-12-31

    Simultaneous electrophysiological and behavioral studies were performed on juvenile Japanese medaka (Oryzias latipes) exposed to representative neurotoxic organic chemicals at sublethal concentrations. Non-invasive recordings were made of the electrical impulses generated within giant neuronal Mauthner cells, associated interneurons or motoneurons, and musculature, all of which initiate the startle or escape response in fish. Timing in milliseconds between these electrical sequelae was measured for each fish before and at 24 and 48 hours exposure to a chemical. Also noted was the number of startle responses to number of stimuli ratio (R/S). Other groups of medaka were fed to bluegills and consumption times recorded to assess their ability to escape predation. These results were compared to neurophysiological effect levels. Phenol, 2,4-dinitrophenol, chlorpyrifos, fenvalerate, and 1-octanol impaired the ability of medaka to escape predation at all concentrations. Medaka were more susceptible to predation in high concentrations of carbaryl and strychnine, but less susceptible at low concentrations, whereas the reverse was true for endosulfan. The variety of neurological effects detected at these concentrations suggest that different mechanisms may be responsible. Phenol and strychnine affected Mauthner cell to motoneuron transmission, chlorpyrifos and carbaryl showed neuromuscular effects, and R/S was affected by most chemicals. Although a variety of neurotoxic mechanisms were examined, the exposure threshold for significant effects for each specific compound was found to be consistent for both the neurophysiological and behavioral endpoints.

  17. Fish from Head to Tail: The 9th European Zebrafish Meeting in Oslo.

    Griffiths, Gareth; Müller, Ferenc; Ledin, Johan; Patton, E Elizabeth; Gjøen, Tor; Lobert, Viola Hélène; Winther-Larsen, Hanne Cecilie; Mullins, Mary; Joly, Jean-Stephane; Weltzien, Finn-Arne; Press, Charles McLean; Aleström, Peter

    2016-04-01

    The 9th European Zebrafish Meeting took place recently in Oslo (June 28-July 2, 2015). A total of 650 participants came to hear the latest research news focused on the zebrafish, Danio rerio, and to its distant evolutionary relative medaka, Oryzias latipes. The packed program included keynote and plenary talks, short oral presentations and poster sessions, workshops, and strategic discussions. The meeting was a great success and revealed dramatically how important the zebrafish in particular has become as a model system for topics, such as developmental biology, functional genomics, biomedicine, toxicology, and drug development. A new emphasis was given to its potential as a model for aquaculture, a topic of great economic interest to the host country Norway and for the future global food supply in general. Zebrafish husbandry as well as its use in teaching were also covered in separate workshops. As has become a tradition in these meetings, there was a well-attended Wellcome Trust Sanger Institute and ZFIN workshop focused on Zebrafish Genome Resources on the first day. The full EZM 2015 program with abstracts can be read and downloaded from the EZM 2015 Web site zebrafish2015.org .

  18. Construction of the High-Density Genetic Linkage Map and Chromosome Map of Large Yellow Croaker (Larimichthys crocea

    Jingqun Ao

    2015-11-01

    Full Text Available High-density genetic maps are essential for genome assembly, comparative genomic analysis and fine mapping of complex traits. In this study, 31,191 single nucleotide polymorphisms (SNPs evenly distributed across the large yellow croaker (Larimichthys crocea genome were identified using restriction-site associated DNA sequencing (RAD-seq. Among them, 10,150 high-confidence SNPs were assigned to 24 consensus linkage groups (LGs. The total length of the genetic linkage map was 5451.3 cM with an average distance of 0.54 cM between loci. This represents the densest genetic map currently reported for large yellow croaker. Using 2889 SNPs to target specific scaffolds, we assigned 533 scaffolds, comprising 421.44 Mb (62.04% of the large yellow croaker assembled sequence, to the 24 linkage groups. The mapped assembly scaffolds in large yellow croaker were used for genome synteny analyses against the stickleback (Gasterosteus aculeatus and medaka (Oryzias latipes. Greater synteny was observed between large yellow croaker and stickleback. This supports the hypothesis that large yellow croaker is more closely related to stickleback than to medaka. Moreover, 1274 immunity-related genes and 195 hypoxia-related genes were mapped to the 24 chromosomes of large yellow croaker. The integration of the high-resolution genetic map and the assembled sequence provides a valuable resource for fine mapping and positional cloning of quantitative trait loci associated with economically important traits in large yellow croaker.

  19. Evaluation of wastewater reclamation technologies based on in vitro and in vivo bioassays

    Cao Nan; Yang Min; Zhang Yu; Hu Jianying; Ike, Michihiko; Hirotsuji, Junji; Matsui, Hisae; Inoue, Daisuke; Sei, Kazunari

    2009-01-01

    When municipal secondary effluent is used as the main supplementation water source for surface water bodies, its potential adverse ecological effects should not be neglected. The objective of this work was to investigate the effectiveness of several technologies, i.e. combination of coagulation and sand filtration (CSF), ultraviolet (UV) irradiation, chlorination, ozonation, ultrafiltration (UF) and reverse osmosis filtration (RO), on the removal of acute ecotoxicity, genotoxicity and retinoic acid receptor (RAR) agonist activity from the municipal secondary effluent. The effects of treated effluents on the development of Japanese medaka (Oryzias latipes) embryos were also evaluated. The secondary effluent exhibited a mutagenic effect on Salmonella typhimurium strain TA 1535/pSK1002, acute invertebrate toxicity to Daphnia magna, and weak RAR α activity. RO and ozonation demonstrated remarkable removals of the genotoxic effect, acute toxicity and RAR activity from secondary effluent, while chlorination could elevate both genotoxicity and acute toxicity. CSF, UV, UF, chlorination as well as RO could decrease the 4-day mortality of medaka embryos and accordingly increase the hatching success rate, comparing with the secondary effluent. Ozonation at 4 mg/l and higher doses, however, elicited significantly higher 4-day mortality, leading to the reduction of the hatching success rate

  20. Inherited XX sex reversal originating from wild medaka populations.

    Shinomiya, A; Otake, H; Hamaguchi, S; Sakaizumi, M

    2010-11-01

    The teleost fish, medaka (Oryzias latipes), has an XX/XY sex-determining mechanism. A Y-linked DM domain gene, DMY, has been isolated by positional cloning as the sex-determining gene in this species. Previously, we conducted a field survey of genotypic sex and found that approximately 1% of wild medaka are sex-reversed (XX males and XY females). Here, we performed genetic analyses of nine spontaneous XX sex-reversed males to elucidate its genetic basis. In all cases, the F(1) progeny were all females, whereas XX males reappeared in the backcross (BC) progeny, suggesting that XX sex reversal is a recessive trait. Although the incidences of sex reversal in the BC progeny were mostly low, 40% were males derived from one XX male. We performed linkage analysis using 55 BC males and located a single major factor, sda-1 (sex-determining autosomal factor-1), controlling sex reversal in an autosomal linkage group. Thus, genes involved in the sex-determining pathway can be isolated from spontaneous mutants in wild populations.

  1. Toxicity of tetramethylammonium hydroxide to aquatic organisms and its synergistic action with potassium iodide.

    Mori, Izumi C; Arias-Barreiro, Carlos R; Koutsaftis, Apostolos; Ogo, Atsushi; Kawano, Tomonori; Yoshizuka, Kazuharu; Inayat-Hussain, Salmaan H; Aoyama, Isao

    2015-02-01

    The aquatic ecotoxicity of chemicals involved in the manufacturing process of thin film transistor liquid crystal displays was assessed with a battery of four selected acute toxicity bioassays. We focused on tetramethylammonium hydroxide (TMAH, CAS No. 75-59-2), a widely utilized etchant. The toxicity of TMAH was low when tested in the 72 h-algal growth inhibition test (Pseudokirchneriellia subcapitata, EC50=360 mg L(-1)) and the Microtox® test (Vibrio fischeri, IC50=6.4 g L(-1)). In contrast, the 24h-microcrustacean immobilization and the 96 h-fish mortality tests showed relatively higher toxicity (Daphnia magna, EC50=32 mg L(-1) and Oryzias latipes, LC50=154 mg L(-1)). Isobologram and mixture toxicity index analyses revealed apparent synergism of the mixture of TMAH and potassium iodide when examined with the D. magna immobilization test. The synergistic action was unique to iodide over other halide salts i.e. fluoride, chloride and bromide. Quaternary ammonium ions with longer alkyl chains such as tetraethylammonium and tetrabutylammonium were more toxic than TMAH in the D. magna immobilization test. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. FY 1983 report on the results of the verification test on the methanol conversion for oil-fired power plant. Part 1. Verification test on the environmental safety; 1983 nendo sekiyu karyoku hatsudensho metanoru tenkan tou jissho shiken seika hokokusho. Kankyo anzensei jissho shiken (Sono 1)

    NONE

    1984-03-01

    As to the verification test on the environmental safety in the use of methanol as power generation use fuel, the following were summed up: review of the verification test and the interim evaluation, state of implementation of the FY 1983 verification test, study/evaluation of the results of the FY 1983 test, survey of research trends, plan of the FY 1984 verification test, record of the committee, etc. Concerning the interim evaluation, high evaluation was obtained as described below: Testing facilities were constructed as planned at first to make the implementation of various tests possible; Tests were smoothly conducted, and among the acute test using monkey, test on mock flue gas using monkey/rat, test on mutagenicity and test on the effect on aquatic animals, tests using oryzias latipes and abalone on the fatal concentration, avoidance behavior and chronic effect were finished by the end of FY 1983 almost as planned; The long-term inhalation test using monkey and rat/mouse has been smoothly in progress. In the survey of research trends, the paper introduced the outlined literature on the methanol metabolism of monkey, changes in the methanol concentration in blood/urine in the case of drinking methanol by mistake. (NEDO)

  3. Acquisition of glial cells missing 2 enhancers contributes to a diversity of ionocytes in zebrafish.

    Takanori Shono

    Full Text Available Glial cells missing 2 (gcm2 encoding a GCM-motif transcription factor is expressed in the parathyroid in amniotes. In contrast, gcm2 is expressed in pharyngeal pouches (a homologous site of the parathyroid, gills, and H(+-ATPase-rich cells (HRCs, a subset of ionocytes on the skin surface of the teleost fish zebrafish. Ionocytes are specialized cells that are involved in osmotic homeostasis in aquatic vertebrates. Here, we showed that gcm2 is essential for the development of HRCs and Na(+-Cl(- co-transporter-rich cells (NCCCs, another subset of ionocytes in zebrafish. We also identified gcm2 enhancer regions that control gcm2 expression in ionocytes of zebrafish. Comparisons of the gcm2 locus with its neighboring regions revealed no conserved elements between zebrafish and tetrapods. Furthermore, We observed gcm2 expression patterns in embryos of the teleost fishes Medaka (Oryzias latipes and fugu (Fugu niphobles, the extant primitive ray-finned fishes Polypterus (Polypterus senegalus and sturgeon (a hybrid of Huso huso × Acipenser ruhenus, and the amphibian Xenopus (Xenopus laevis. Although gcm2-expressing cells were observed on the skin surface of Medaka and fugu, they were not found in Polypterus, sturgeon, or Xenopus. Our results suggest that an acquisition of enhancers for the expression of gcm2 contributes to a diversity of ionocytes in zebrafish during evolution.

  4. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  5. An in vivo model fish system to test chemical effects on sexual differentiation and development: exposure to ethinyl estradiol

    Papoulias, Diana M.; Noltie, Douglas B.; Tillitt, Donald E.

    2000-01-01

    A model system was characterized which may be used as an in vivo screen for effects of chemicals or environmental mixtures on sexual differentiation and development of reproductive organs and gametes. We evaluated the effects of a model environmental estrogen, ethinyl estradiol (EE2), on the d-rR strain of medaka, Oryzias latipes, using a nano-injection exposure. Gonad histopathology indicated that a single injection of 0.5–2.5 ng EE2/egg can cause phenotypic sex-reversal of genetic males to females. Sex-reversals could be detected as early as 7 days post-hatch. Sex-reversed males had female-typical duct development and the secondary sex characteristics we measured were generally consistent with phenotype, with the exception of a few EE2-exposed XX and XY females which possessed ambiguous anal fins. Using discriminant analysis, we determined that the presence or absence of the secondary sex characteristic, a dorsal fin notch, was a very reliable indicator of gonadal sex. No instances of gonadal intersexes were observed. Ethinyl estradiol also appeared to reduce growth but not condition (weight-at-length) and exposed XX females appeared to have a higher incidence of atretic follicles relative to controls. Our results suggest that estrogenic chemicals may influence sexual differentiation and development and that the medaka model is well suited to assessing these effects.

  6. Predicting bioavailability and accumulation of organochlorine pesticides by Japanese medaka in the presence of humic acid and natural organic matter using passive sampling membranes.

    Ke, Runhui; Luo, Jianping; Sun, Liwei; Wang, Zijian; Spear, Philip A

    2007-10-01

    Adsorption to dissolved organic matter (DOM) may significantly decrease the freely dissolved concentration of many hydrophobic organic compounds and, hence, result in reduced bioavailability to aquatic organisms. Here, the suitability of using triolein-embedded cellulose acetate membrane (TECAM) as a biomimetic surrogate to assess the bioavailability of organochlorine pesticides (OCPs) in water in the presence of DOM was explored. The accumulation of OCPs was measured in TECAM and pelagic Japanese medaka (Oryzias latipes) in the laboratory after 12 h exposure to water containing different levels of Aldrich humic acid. Further, OCP uptake by TECAM and medaka in real aqueous environments was evaluated after 30 d exposures in two sites. Laboratory results showed that OCP uptake by medaka consistently decreased with increasing levels of humic acid in the range of 0-15 mg C/L in sample solutions. This tendency was closely mimicked by OCP accumulation in TECAM under the same conditions. Field results showed that TECAM accumulated similar OCP patterns as medaka (r2 = 0.92 for site 1 and r2 = 0.94 for site 2), although comparison of the in-field eight OCP concentrations in TECAM to those in medaka yielded approximately a factor of 3 (on a wet weight basis). These results suggest that the TECAM method can be used as a simple and useful tool to predict the bioavailability and bioaccumulation potential of poorly biotransformed organic compounds in pelagic fish in aqueous environment.

  7. Accumulation of tritium in aquatic organisms through a food chain with three trophic levels

    Komatsu, Kenshi; Higuchi, Masataka; Sakka, Masatoshi

    1981-01-01

    Accumulation of tritium in aquatic organisms was estimated through a model food chain such as; tritiated water (THO) → diatoms → brine shrimps → Japanese killifish. Tritium accumulations in each organism as organic bound form are expressed as the R value which is defined as the ratio of tritium specific activity in lyophilized organisms (μCi/gH) to that in water (μCi/gH). The maximum R values were 0.5 in diatoms, Chaetoceros gracilis, 0.5 in brine shrimps, Artamia salina, and 0.32 in Japanese killifish, Oryzias latipes under the growing condition where tritium accumulation took place from tritiated water without tritiated diets. Brine shrimps and Japanese killifish, which grew from larvae to adult in tritiated sea water with feeding on tritiated diets (model food chain), had the R value at 0.70 and 0.67 respectively, indicating that more tritium accumulation in consumer populations with tritiated diets than those without tritiated diets. In addition, the R values of each organ of Japanese killifish, of DNA and the nucleotides purified from brine shrimps growing under the condition with or without our model food chain were measured to estimate the tritium distribution in the body or various components of the organism. These results did not indicate the seeking characteristic of tritium to some specific organs of compounds. (author)

  8. Accumulation of tritium in aquatic organisms through a food chain with three trophic levels

    Komatsu, K.; Higuchi, M.; Sakka, M. (Tohoku Univ., Sendai (Japan). School of Medicine)

    1981-06-01

    Accumulation of tritium in aquatic organisms was estimated through a model food chain such as; tritiated water (THO) ..-->.. diatoms ..-->.. brine shrimps ..-->.. Japanese killifish. Tritium accumulations in each organism as organic bound form are expressed as the R value which is defined as the ratio of tritium specific activity in lyophilized organisms (..mu..Ci/gH) to that in water (..mu..Ci/gH). The maximum R values were 0.5 in diatoms, Chaetoceros gracilis, 0.5 in brine shrimps, Artamia salina, and 0.32 in Japanese killifish, Oryzias latipes under the growing condition where tritium accumulation took place from tritiated water without tritiated diets. Brine shrimps and Japanese killifish, which grew from larvae to adult in tritiated sea water with feeding on tritiated diets (model food chain), had the R value at 0.70 and 0.67 respectively, indicating that more tritium accumulation in consumer populations with tritiated diets than those without tritiated diets. In addition, the R values of each organ of Japanese killifish, of DNA and the nucleotides purified from brine shrimps growing under the condition with or without our model food chain were measured to estimate the tritium distribution in the body or various components of the organism. These results did not indicate the seeking characteristic of tritium to some specific organs of compounds.

  9. Use of multi-photon laser-scanning microscopy to describe the distribution of xenobiotic chemicals in fish early life stages

    Hornung, Michael W.; Cook, Philip M.; Flynn, Kevin M.; Lothenbach, Doug B.; Johnson, Rodney D.; Nichols, John W.

    2004-01-01

    To better understand the mechanisms by which persistent bioaccumulative toxicants (PBTs) produce toxicity during fish early life stages (ELS), dose-response relationships need to be understood in relation to the dynamic distribution of chemicals in sensitive tissues. In this study, a multi-photon laser scanning microscope (MPLSM) was used to determine the multi-photon excitation spectra of several polyaromatic hydrocarbons (PAHs) and to describe chemical distribution among tissues during fish ELS. The multi-photon excitation spectra revealed intense fluorescent signal from the model fluorophore, pentamethyl-difluoro-boro-indacene (BODIPY[reg], less signal from benzo[a]pyrene and fluoranthene, and no detectable signal from pyrene. The imaging method was tested by exposing newly fertilized medaka (Oryzias latipes) eggs to BODIPY[reg] or fluoranthene for 6 h, followed by transfer to clean media. Embryos and larvae were then imaged through 5 days post-hatch. The two test chemicals partitioned similarly throughout development and differences in fluorescence intensity among tissues were evident to a depth of several hundred microns. Initially, the most intense signal was observed in the oil droplet within the yolk, while a moderate signal was seen in the portion of the yolk containing the yolk-platelets. As embryonic development progressed, the liver biliary system, gall bladder, and intestinal tract accumulated strong fluorescent signal. After hatch, once the gastrointestinal tract was completely developed, most of the fluorescent signal was cleared. The MPLSM is a useful tool to describe the tissue distribution of fluorescent PBTs during fish ELS

  10. A conserved non-reproductive GnRH system in chordates.

    Takehiro G Kusakabe

    Full Text Available Gonadotropin-releasing hormone (GnRH is a neuroendocrine peptide that plays a central role in the vertebrate hypothalamo-pituitary axis. The roles of GnRH in the control of vertebrate reproductive functions have been established, while its non-reproductive function has been suggested but less well understood. Here we show that the tunicate Ciona intestinalis has in its non-reproductive larval stage a prominent GnRH system spanning the entire length of the nervous system. Tunicate GnRH receptors are phylogenetically closest to vertebrate GnRH receptors, yet functional analysis of the receptors revealed that these simple chordates have evolved a unique GnRH system with multiple ligands and receptor heterodimerization enabling complex regulation. One of the gnrh genes is conspicuously expressed in the motor ganglion and nerve cord, which are homologous structures to the hindbrain and spinal cord of vertebrates. Correspondingly, GnRH receptor genes were found to be expressed in the tail muscle and notochord of embryos, both of which are phylotypic axial structures along the nerve cord. Our findings suggest a novel non-reproductive role of GnRH in tunicates. Furthermore, we present evidence that GnRH-producing cells are present in the hindbrain and spinal cord of the medaka, Oryzias latipes, thereby suggesting the deep evolutionary origin of a non-reproductive GnRH system in chordates.

  11. Diversity of Active States in TMT Opsins.

    Kazumi Sakai

    Full Text Available Opn3/TMT opsins belong to one of the opsin groups with vertebrate visual and non-visual opsins, and are widely distributed in eyes, brains and other internal organs in various vertebrates and invertebrates. Vertebrate Opn3/TMT opsins are further classified into four groups on the basis of their amino acid identities. However, there is limited information about molecular properties of these groups, due to the difficulty in preparing the recombinant proteins. Here, we successfully expressed recombinant proteins of TMT1 and TMT2 opsins of medaka fish (Oryzias latipes in cultured cells and characterized their molecular properties. Spectroscopic and biochemical studies demonstrated that TMT1 and TMT2 opsins functioned as blue light-sensitive Gi/Go-coupled receptors, but exhibited spectral properties and photo-convertibility of the active state different from each other. TMT1 opsin forms a visible light-absorbing active state containing all-trans-retinal, which can be photo-converted to 7-cis- and 9-cis-retinal states in addition to the original 11-cis-retinal state. In contrast, the active state of TMT2 opsin is a UV light-absorbing state having all-trans-retinal and does not photo-convert to any other state, including the original 11-cis-retinal state. Thus, TMT opsins are diversified so as to form a different type of active state, which may be responsible for their different functions.

  12. Ichthyofauna of the Kubo, Tochikura, and Ichinono river systems (Kitakami River drainage, northern Japan), with a comparison of predicted and surveyed species richness

    Nakae, Masanori; Senou, Hiroshi

    2014-01-01

    Abstract The potential fish species pool of the Kubo, Tochikura, and Ichinono river systems (tributaries of the Iwai River, Kitakami River drainage), Iwate Prefecture, northern Japan, was compared with the observed ichthyofauna by using historical records and new field surveys. Based on the literature survey, the potential species pool comprised 24 species/subspecies but only 20, including 7 non-native taxa, were recorded during the fieldwork. The absence during the survey of 11 species/subspecies from the potential species pool suggested either that sampling effort was insufficient, or that accurate determination of the potential species pool was hindered by lack of biogeographic data and ecological data related to the habitat use of the species. With respect to freshwater fish conservation in the area, Lethenteron reissneri, Carassius auratus buergeri, Pseudorasbora pumila, Tachysurus tokiensis, Oryzias latipes, and Cottus nozawae are regarded as priority species, and Cyprinus rubrofuscus, Pseudorasbora parva, and Micropterus salmoides as targets for removal. PMID:25425932

  13. Species comparison of inflammatory cell reactivity

    Boncavage-Hennessey, E.M.; Twerdok, L.E. [Geo-Centers, Inc., Frederick, MD (United States); Finch, R.A.; Gardner, H.S. [Army Biomedical Research and Development Lab., Frederick, MD (United States)

    1994-12-31

    In comparison to the use of rodent models, the use of fish as a potential model to predict immune dysfunction in response to environmental contaminants is a relatively new concept. The development of a fish model for immunotoxicity is possible due to the phylogenetic conservation of many immune functions. The authors have compared mononuclear cell reactivity following in vitro stimulation among five species; Japanese medaka (Oryzias latipes), rainbow trout (Oncorhynchus mykiss), DBA/2 mice, Sprague-Dawley rats and human ML-1 cells. Mononuclear cells were isolated from the rodent bone marrow and from the teleost anterior kidney (the cell population which most closely resembles mammalian hematopoietic tissue). ML-1 cells are a myeloblastic cell line that were differentiated in vitro to monocytes/macrophages. Cell populations were characterized by myeloperoxidase and nonspecific esterase staining characteristic. Reactive oxidant production following in vitro stimulation by phorbol ester was measured using the following methods: reduction of cytochrome c (detection of extracellular superoxide), reduction of nitroblue tetrazolium (detection of intracellular superoxide) and oxidation of phenol red in the presence of horseradish peroxidase (hydrogen peroxide production). In general, teleost cells demonstrated higher superoxide anion production and mammalian cells produced higher quantities of hydrogen peroxide.

  14. hebp3, a novel member of the heme-binding protein gene family, is expressed in the medaka meninges with higher abundance in females due to a direct stimulating action of ovarian estrogens.

    Nakasone, Kiyoshi; Nagahama, Yoshitaka; Okubo, Kataaki

    2013-02-01

    The brains of teleost fish exhibit remarkable sexual plasticity throughout their life span. To dissect the molecular basis for the development and reversal of sex differences in the teleost brain, we screened for genes differentially expressed between sexes in the brain of medaka (Oryzias latipes). One of the genes identified in the screen as being preferentially expressed in females was found to be a new member of the heme-binding protein gene family that includes hebp1 and hebp2 and was designated here as hebp3. The medaka hebp3 is expressed in the meninges with higher abundance in females, whereas there is no expression within the brain parenchyma. This female-biased expression of hebp3 is not attributable to the direct action of sex chromosome genes but results from the transient and reversible action of estrogens derived from the ovary. Moreover, estrogens directly activate the transcription of hebp3 via a palindromic estrogen-responsive element in the hebp3 promoter. Taken together, our findings demonstrate that hebp3 is a novel transcriptional target of estrogens, with female-biased expression in the meninges. The definite but reversible sexual dimorphism of the meningeal hebp3 expression may contribute to the development and reversal of sex differences in the teleost brain.

  15. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.

    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko

    2014-04-01

    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  16. A simple osmium post-fixation paraffin-embedment technique to identify lipid accumulation in fish liver using medaka (Oryziaslatipes) eggs and eleutheroembryos as lipid rich models

    Mondon, J.A.; Howitt, J.; Tosiano, M.; Kwok, K.W.H.; Hinton, D.E.

    2011-01-01

    Highlights: → Hepatic lipidosis in fish liver is often misdiagnosed or overlooked. → Specific histological fat stains and cryostat sections are not commonly used. → Standard paraffin processing removes lipid leaving vacuoles of unknown origin. → Osmium post-fixed paraffin-embedment is a cost effective alternative. → Medaka trials show suitability for lipid visualization in tissues from egg to adult. - Abstract: Hepatic lipidosis is a non-specific biomarker of effect from pollution exposure in fish. Fatty liver is often misdiagnosed or overlooked in histological assessments due to the decreasing application of specific fat procedures and stains. For example, ethanol dehydration in standard paraffin processing removes lipids, leaving vacuoles of which the precise nature is unknown. Lipids can be identified using osmium post-fixation in semi-thin resin sections or transmission electron microscopy. However, both are expensive and technically demanding procedures, often not available for routine environmental risk assessment and monitoring programs. The current emphasis to reduce and refine animal toxicity testing, requires refinement of the suite of histopathological techniques currently available to maximize information gained from using fish for toxicity testing and as bio-indicators of environmental quality. This investigation has successfully modified an osmium post-fixation technique to conserve lipids in paraffin-embedded tissues using medaka (Oryzias latipes) eleutheroembryos and eggs (embryos) as lipid rich models.

  17. Comment: 212 [Taxonomy Icon

    Full Text Available Oryzias javanicus Oryzias javanicus Oryzias_javanicus_L.png 212.png Kiyoshi Naruse ...(National Institute for Basic Biology) licensed under CC Attribution2.1 Japan ジャワメダカ (Oryzias javanicus) インド

  18. Physiological and behavioural impacts of Pacific ciguatoxin-1 (P-CTX-1) on marine medaka (Oryzias melastigma).

    Mak, Yim Ling; Li, Jing; Liu, Chih-Ning; Cheng, Shuk Han; Lam, Paul K S; Cheng, Jinping; Chan, Leo L

    2017-01-05

    Ciguatoxins (CTXs) are natural biotoxins produced by benthic dinoflagellates of the genus Gambierdiscus, which are bioaccumulated and biotransformed along food chains in coral ecosystems. They are neurotoxins that activate voltage-gated sodium channels and disrupt ion conductance in the excitable tissues. Pacific ciguatoxin-1 (P-CTX-1) is the most prevalent and potent CTX congener present in fishes from the Pacific Ocean. In this study, P-CTX-1 was administrated to larval marine medaka (2h post-hatch) via microinjection. Exposure to P-CTX-1 at sub-ppb levels led to adverse behavioural changes, altered physiological performances and reduced survivability of the larval marine medaka as early as 24h after exposure. P-CTX-1 decreased the rate of heartbeat and locomotion of the exposed larvae, probably owing to a series of physiological processes and morphological changes such as pericardial oedema, failure of swim bladder inflation and spinal curvature. The exposed larval marine medaka also demonstrated reduced, delayed and paralyzed responses to external stimulations. This may render them more susceptible to predation. P-CTX-1 could be effectively distributed from the yolk sac to all parts of the fish body, including head and trunk, 24h after exposure. Repeated low-dose P-CTX-1 exposure resulted in larval mortality comparable to that of a single high-dose exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. How many fish in a tank? Constructing an automated fish counting system by using PTV analysis

    Abe, S.; Takagi, T.; Takehara, K.; Kimura, N.; Hiraishi, T.; Komeyama, K.; Torisawa, S.; Asaumi, S.

    2017-02-01

    Because escape from a net cage and mortality are constant problems in fish farming, health control and management of facilities are important in aquaculture. In particular, the development of an accurate fish counting system has been strongly desired for the Pacific Bluefin tuna farming industry owing to the high market value of these fish. The current fish counting method, which involves human counting, results in poor accuracy; moreover, the method is cumbersome because the aquaculture net cage is so large that fish can only be counted when they move to another net cage. Therefore, we have developed an automated fish counting system by applying particle tracking velocimetry (PTV) analysis to a shoal of swimming fish inside a net cage. In essence, we treated the swimming fish as tracer particles and estimated the number of fish by analyzing the corresponding motion vectors. The proposed fish counting system comprises two main components: image processing and motion analysis, where the image-processing component abstracts the foreground and the motion analysis component traces the individual's motion. In this study, we developed a Region Extraction and Centroid Computation (RECC) method and a Kalman filter and Chi-square (KC) test for the two main components. To evaluate the efficiency of our method, we constructed a closed system, placed an underwater video camera with a spherical curved lens at the bottom of the tank, and recorded a 360° view of a swimming school of Japanese rice fish (Oryzias latipes). Our study showed that almost all fish could be abstracted by the RECC method and the motion vectors could be calculated by the KC test. The recognition rate was approximately 90% when more than 180 individuals were observed within the frame of the video camera. These results suggest that the presented method has potential application as a fish counting system for industrial aquaculture.

  20. Final report- Links between persistent DNA damage, genome instability, and aging

    Dynan, William S. [Emory Univ., Atlanta, GA (United States)

    2016-11-30

    The goal of the project was to determine whether high linear energy transfer (LET) space radiation produces the same or different effects as low doses of terrestrial (low-LET) radiation. The work used the Japanese medaka fish (Oryzias latipes) as a vertebrate model organism that can be maintained in large numbers at low cost for lifetime studies. To determine whether simulated space radiation produced the same or different effects as low doses of low-LET radiation, medaka embryos were irradiated at doses ranging from 0.1 to 9 Gray (Gy) of high-LET charged particle radiation (1000 MeV/nucleon 56-Fe ions) or 0.1 Gy to 27 Gy of low-LET gamma-rays. To examine the effect of irradiation on potential biomarkers, the population was sampled at intervals from 8 to 28 months post-irradiation and liver tissue was subjected to histological and molecular analysis. Charged particle radiation and aging contributed synergistically to accumulation of lipid oxidation products, which are a marker of chronic oxidative stress. This was mirrored by a decline in mRNA encoding the transcriptional activator PPARGC1A, which is required for mitochondrial maintenance and for defense against oxidative stress. Additionally, mitochondria had an elongated and enlarged ultrastructure. Depending on the endpoint, effects of gamma-rays in the same dose range were either lesser or not detected. Together, results indicate that a single exposure to high-LET, but not low-LET radiation, early in life, leads to increased oxidative stress throughout the normal lifespan of the individual.

  1. Assessing the toxicity of sediments using the medaka embryo-larval assay and 2 other bioassays.

    Barhoumi, Badreddine; Clérandeau, Christelle; Landi, Laure; Pichon, Anaïk; Le Bihanic, Florane; Poirier, Dominique; Anschutz, Pierre; Budzinski, Hélène; Driss, Mohamed Ridha; Cachot, Jérôme

    2016-09-01

    Sediments are sinks for aquatic pollutants, and analyzing toxicity in such complex matrices is still challenging. To evaluate the toxicity of bioavailable pollutants accumulated in sediments from the Bizerte lagoon (Tunisia), a novel assay, the medaka embryo-larval assay by sediment contact, was applied. Japanese medaka (Oryzias latipes) embryos were incubated in direct contact with sediment samples up to hatching. Lethal and sublethal adverse effects were recorded in embryos and larvae up to 20 d postfertilization. Results from medaka embryo-larval assay were compared with cytotoxicity (Microtox®), genotoxicity (SOS chromotest), and pollutant content of sediments. The results highlight differences in the contamination profile and toxicity pattern between the different studied sediments. A significant correlation was shown between medaka embryo-larval assay by sediment contact and SOS chromotest responses and concentrations of most organic pollutants studied. No correlation was shown between pollutant levels and Microtox. According to the number of sediment samples detected as toxic, medaka embryo-larval assay by sediment contact was more sensitive than Microtox, which in turn was more sensitive than the SOS chromotest; and medaka embryo-larval assay by sediment contact allowed sediment toxicity assessment of moderately polluted sediments without pollutant extraction and using an ecologically realistic exposure scenario. Although medaka embryo-larval assay by sediment contact should be tested on a larger sample set, the results show that it is sensitive and convenient enough to monitor the toxicity of natural sediments. Environ Toxicol Chem 2016;35:2270-2280. © 2016 SETAC. © 2016 SETAC.

  2. Rapid and simple method for quantitative evaluation of neurocytotoxic effects of radiation on developing medaka brain

    Yasuda, Takako; Maeda, Keiko; Matsumoto, Atsuko; Maruyama, Kouichi; Ishikawa, Yuji; Yoshimoto, Masami

    2008-01-01

    We describe a novel method for rapid and quantitative evaluation of the degree of radiation-induced apoptosis in the developing brain of medaka (Oryzias latipes). Embryos at stage 28 were irradiated with 1, 2, 3.5, and 5 Gy x-ray. Living embryos were stained with a vital dye, acridine orange (AO), for 1-2 h, and whole-mount brains were examined under an epifluorescence microscope. From 7 to 10 h after irradiation with 5 Gy x-ray, we found two morphologically different types of AO-stained structures, namely, small single nuclei and rosette-shaped nuclear clusters. Electron microscopy revealed that these two distinct types of structures were single apoptotic cells with condensed nuclei and aggregates of apoptotic cells, respectively. From 10 to 30 h after irradiation, a similar AO-staining pattern was observed. The numbers of AO-stained rosette-shaped nuclear clusters and AO-stained single nuclei increased in a dose-dependent manner in the optic tectum. We used the number of AO-stained rosette-shaped nuclear clusters/optic tectum as an index of the degree of radiation-induced brain cell death at 20-24 h after irradiation. The results showed that the number of rosette-shaped nuclear clusters/optic tectum in irradiated embryos exposed to 2 Gy or higher doses was highly significant compared to the number in nonirradiated control embryos, whereas no difference was detected at 1 Gy. Thus, the threshold dose for brain cell death in medaka embryos was taken as being between 1-2 Gy, which may not be so extraordinarily large compared to those for rodents and humans. The results show that medaka embryos are useful for quantitative evaluation of developmental neurocytotoxic effects of radiation. (author)

  3. Evaluation of fish models of soluble epoxide hydrolase inhibition.

    Newman, J W; Denton, D L; Morisseau, C; Koger, C S; Wheelock, C E; Hinton, D E; Hammock, B D

    2001-01-01

    Substituted ureas and carbamates are mechanistic inhibitors of the soluble epoxide hydrolase (sEH). We screened a set of chemicals containing these functionalities in larval fathead minnow (Pimphales promelas) and embryo/larval golden medaka (Oryzias latipes) models to evaluate the utility of these systems for investigating sEH inhibition in vivo. Both fathead minnow and medaka sEHs were functionally similar to the tested mammalian orthologs (murine and human) with respect to substrate hydrolysis and inhibitor susceptibility. Low lethality was observed in either larval or embryonic fish exposed to diuron [N-(3,4-dichlorophenyl), N'-dimethyl urea], desmethyl diuron [N-(3,4-dichlorophenyl), N'-methyl urea], or siduron [N-(1-methylcyclohexyl), N'-phenyl urea]. Dose-dependent inhibition of sEH was a sublethal effect of substituted urea exposure with the potency of siduron diuron = diuron, differing from the observed in vitro sEH inhibition potency of siduron > desmethyl diuron > diuron. Further, siduron exposure synergized the toxicity of trans-stilbene oxide in fathead minnows. Medaka embryos exposed to diuron, desmethyl diuron, or siduron displayed dose-dependent delays in hatch, and elevated concentrations of diuron and desmethyl diuron produced developmental toxicity. The dose-dependent toxicity and in vivo sEH inhibition correlated, suggesting a potential, albeit undefined, relationship between these factors. Additionally, the observed inversion of in vitro to in vivo potency suggests that these fish models may provide tools for investigating the in vivo stability of in vitro inhibitors while screening for untoward effects. PMID:11171526

  4. Estradiol-induced promotion of hepatocarcinogenesis in medaka: Relationship of foci of cellular alteration to neoplasia

    Cooke, J.B.; Hinton, D.E. [Univ. of California, Davis, CA (United States)

    1995-12-31

    In some laboratory and field studies, female fish have higher prevalences of liver tumors than do males. The authors hypothesize gender and site-specific differences in prevalence are due to variable exposures of previously initiated fish to tumor modulating compounds. Estradiol, a growth promoter, increases incidences of hepatic tumors in carcinogen-treated rainbow trout and medaka (Oryzias latipes). Estradiol also increases incidences of hepatic foci of cellular alteration (FCA) in medaka. FCA are found in subadults of tumor-bearing feral populations. Lack of knowledge about the relationship of various phenotypes of FCA to eventual tumors, however, has prevented use of FCA as a biomarker. The authors examined fate and growth of liver FCA using a 2-step, initiation-promotion protocol. Three week old medaka were exposed to 200 ppm diethylnitrosamine (DEN) for 24 hr. and then fed 0.1 ppm 17-{beta}-estradiol (E2) continuously through sampling at weeks 4--26. Percent volume of FCA and morphometric characteristics of normal and focal hepatocytes, including numerical density and average hepatocyte volume were quantified using computer-assisted stereology. E2 increased percentage of liver occupied by DEN-initiated amphophilic, basophilic and eosinophilic FCA in both sexes. Focal parameters of young, DEN-initiated and estradiol-treated medaka were not reached until much later in fish given only DEN. Non-focal hepatocytes in estradiol-treated medaka were smaller and more numerous than in DEN-only counterparts. Morphometric analysis is quantitatively tracking the fate of specific phenotypes of FCA to determine their role in progression to cancer.

  5. p53-Dependent suppression of genome instability in germ cells

    Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2014-02-15

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.

  6. A genetic linkage map of sole (Solea solea: a tool for evolutionary and comparative analyses of exploited (flatfishes.

    Eveline Diopere

    Full Text Available Linkage maps based on markers derived from genes are essential evolutionary tools for commercial marine fish to help identify genomic regions associated with complex traits and subject to selective forces at play during exploitation or selective breeding. Additionally, they allow the use of genomic information from other related species for which more detailed information is available. Sole (solea solea L. is a commercially important flatfish species in the North Sea, subject to overexploitation and showing evidence of fisheries-induced evolutionary changes in growth- and maturation-related traits. Sole would definitely benefit from a linkage map to better understand how evolution has shaped its genome structure. This study presents a linkage map of sole based on 423 single nucleotide polymorphisms derived from expressed sequence tags and 8 neutral microsatellite markers. The total map length is 1233.8 cM and consists of 38 linkage groups with a size varying between 0 to 92.1 cM. Being derived from expressed sequence tags allowed us to align the map with the genome of four model fish species, namely medaka (Oryzias latipes, Nile tilapia (Oreochromis niloticus, three-spined stickleback (Gasterosteus aculeatus and green spotted pufferfish (Tetraodon nigroviridis. This comparison revealed multiple conserved syntenic regions with all four species, and suggested that the linkage groups represent 21 putative sole chromosomes. The map was also compared to the linkage map of turbot (Scophthalmus maximus, another commercially important flatfish species and closely related to sole. For all putative sole chromosomes (except one a turbot homolog was detected, confirming the even higher degree of synteny between these two flatfish species.

  7. Light and electron microscopic analyses of Vasa expression in adult germ cells of the fish medaka.

    Yuan, Yongming; Li, Mingyou; Hong, Yunhan

    2014-07-15

    Germ cells of diverse animal species have a unique membrane-less organelle called germ plasm (GP). GP is usually associated with mitochondria and contains RNA binding proteins and mRNAs of germ genes such as vasa. GP has been described as the mitochondrial cloud (MC), intermitochondrial cement (IC) and chromatoid body (CB). The mechanism underlying varying GP structures has remained incompletely understood. Here we report the analysis of GP through light and electron microscopy by using Vasa as a marker in adult male germ cells of the fish medaka (Oryzias latipes). Immunofluorescence light microscopy revealed germ cell-specific Vasa expression. Vasa is the most abundant in mitotic germ cells (oogonia and spermatogonia) and reduced in meiotic germ cells. Vasa in round spermatids exist as a spherical structure reminiscent of CB. Nanogold immunoelectron microscopy revealed subcellular Vasa redistribution in male germ cells. Vasa in spermatogonia concentrates in small areas of the cytoplasm and is surrounded by mitochondria, which is reminiscent of MC. Vasa is intermixed with mitochondria to form IC in primary spermatocytes, appears as the free cement (FC) via separation from mitochondria in secondary spermatocyte and becomes condensed in CB at the caudal pole of round spermatids. During spermatid morphogenesis, Vasa redistributes and forms a second CB that is a ring-like structure surrounding the dense fiber of the flagellum in the midpiece. These structures resemble those described for GP in various species. Thus, Vasa identifies GP and adopts varying structures via dynamic reorganization at different stages of germ cell development. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Ethanol disrupts chondrification of the neurocranial cartilages in medaka embryos without affecting aldehyde dehydrogenase 1A2 (Aldh1A2) promoter methylation

    Hu, Yuhui; Willett, Kristine L.; Khan, Ikhlas A.; Scheffler, Brian E.; Dasmahapatra, Asok K.

    2009-01-01

    Medaka (Oryzias latipes) embryos at different developmental stages were exposed to ethanol for 48 h, then allowed to hatch. Teratogenic effects were evaluated in hatchlings after examining chondrocranial cartilage deformities. Ethanol disrupted cartilage development in medaka in a dose and developmental stage-specific manner. Compared to controls, the linear length of the neurocranium and other cartilages were reduced in ethanol-treated groups. Moreover, the chondrification in cartilages, specifically trabeculae and polar cartilages, were inhibited by ethanol. To understand the mechanism of ethanol teratogenesis, NAD+: NADH status during embryogenesis and the methylation pattern of Aldh1A2 promoter in whole embryos and adult tissues (brain, eye, heart and liver) were analyzed. Embryos 6 dpf had higher NAD+ than embryos 0 or 2 dpf. Ethanol (200 or 400 mM) was able to reduce NAD+ content in 2 and 6 dpf embryos. However, in both cases reductions were not significantly different from the controls. Moreover, no significant difference in either NADH content or in NAD+: NADH status of the ethanol-treated embryos, with regard to controls, was observed. The promoter of Aldh1A2 contains 31 CpG dinucleotides (-705 to +154, ATG = +1); none of which were methylated. Compared to controls, embryonic ethanol exposure (100 and 400 mM) was unable to alter Aldh1A2 promoter methylation in embryos or in the tissues of adults (breeding) developmentally exposed to ethanol (300 mM, 48 hpf). From these data we conclude that ethanol teratogenesis in medaka does not induce alteration in the methylation pattern of Aldh1A2 promoter, but does change cartilage development. PMID:19651241

  9. Histological and Transcriptomic Analysis of Adult Japanese Medaka Sampled Onboard the International Space Station.

    Yasuhiko Murata

    Full Text Available To understand how humans adapt to the space environment, many experiments can be conducted on astronauts as they work aboard the Space Shuttle or the International Space Station (ISS. We also need animal experiments that can apply to human models and help prevent or solve the health issues we face in space travel. The Japanese medaka (Oryzias latipes is a suitable model fish for studying space adaptation as evidenced by adults of the species having mated successfully in space during 15 days of flight during the second International Microgravity Laboratory mission in 1994. The eggs laid by the fish developed normally and hatched as juveniles in space. In 2012, another space experiment ("Medaka Osteoclast" was conducted. Six-week-old male and female Japanese medaka (Cab strain osteoblast transgenic fish were maintained in the Aquatic Habitat system for two months in the ISS. Fish of the same strain and age were used as the ground controls. Six fish were fixed with paraformaldehyde or kept in RNA stabilization reagent (n = 4 and dissected for tissue sampling after being returned to the ground, so that several principal investigators working on the project could share samples. Histology indicated no significant changes except in the ovary. However, the RNA-seq analysis of 5345 genes from six tissues revealed highly tissue-specific space responsiveness after a two-month stay in the ISS. Similar responsiveness was observed among the brain and eye, ovary and testis, and the liver and intestine. Among these six tissues, the intestine showed the highest space response with 10 genes categorized as oxidation-reduction processes (gene ontogeny term GO:0055114, and the expression levels of choriogenin precursor genes were suppressed in the ovary. Eleven genes including klf9, klf13, odc1, hsp70 and hif3a were upregulated in more than four of the tissues examined, thus suggesting common immunoregulatory and stress responses during space adaptation.

  10. p53-Dependent suppression of genome instability in germ cells

    Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi

    2014-01-01

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells

  11. Development of space-fertilized eggs and formation of primordial germ cells in the embryos of medaka fish

    Ijiri, K.

    In the second International Microgravity Laboratory (IML-2) mission in 1994, four small Japanese killifish (Medaka, Oryzias latipes) made a space travel of 15 days aboard a space shuttle. These four adult Medaka fish successfully mated in space for the first time among vertebrate animals. Moreover, the eggs they laid developed normally, at least in their external appearance, hatching as fry (baby fish) in space. Fish mated and laid eggs every day during the first week. Near the end of the mission most of the eggs had a well-developed body with two pigmented eyes. In total, 43 eggs were laid (detected), out of which 8 fry hatched in space, as truly `space-originated' babies. A further 30 fry hatched within 3 days after landing. This is the normal hatching rate, compared with the ground-based data. Among the 8 space-originated fry, four were killed for histological sections, and germ cells at the gonadal region were counted for each fry. Their numbers were in the range of the germ cells of the normal control fry (ground-kept samples). Thus, as embryos developed normally in their external appearance, inside the embryos the formation of primordial germ cells took place normally in space, and their migration to the genital ridges was not hindered by microgravity. The two of the remaining space-originated fry have grown up and been creating their offspring in the laboratory. This proved that the primordial germ cells formed in space were also normal from a functional point of view. The four space-travelled adult fish re-started mating and laying eggs on the 7th day after landing and continued to do so every day afterward. Fertilization rate and hatchability of these eggs were as high as the eggs laid by the laboratory-kept fish. This fact implies that in gametogenesis of adult fish, there are no specific stages of germ cells extremely susceptible to microgravity.

  12. Changes in the dielectric properties of medaka fish embryos during development, studied by electrorotation

    Shirakashi, Ryo, E-mail: aa21150@iis.u-tokyo.ac.jp [Institute of Industrial Science, The University of Tokyo, Tokyo 153-8505 (Japan); Mischke, Miriam [Lehrstuhl fuer Biotechnologie und Biophysik, Biozentrum, Universitaet Wuerzburg, Wuerzburg (Germany); Fischer, Peter [Physiologische Chemie, Biozentrum, Universitaet Wuerzburg, Wuerzburg (Germany); Memmel, Simon [Lehrstuhl fuer Biotechnologie und Biophysik, Biozentrum, Universitaet Wuerzburg, Wuerzburg (Germany); Krohne, Georg [Abteilung fuer Elektronenmikroskopie, Biozentrum, Universitaet Wuerzburg, Wuerzburg (Germany); Fuhr, Guenter R. [Lehrstuhl fuer Biotechnologie und Medizintechnik, Universitaet des Saarlandes, Saarbruecken (Germany); Zimmermann, Heiko [Lehrstuhl fuer Molekulare und Zellulaere Biotechnologie, Universitaet des Saarlandes, Saarbruecken (Germany); Sukhorukov, Vladimir L., E-mail: sukhorukov@biozentrum.uni-wuerzburg.de [Lehrstuhl fuer Biotechnologie und Biophysik, Biozentrum, Universitaet Wuerzburg, Wuerzburg (Germany)

    2012-11-09

    Highlights: Black-Right-Pointing-Pointer Electrorotation offers a non-invasive tool for dielectric analysis of fish embryos. Black-Right-Pointing-Pointer The three-shell dielectric model matches the rotation spectra of medaka eggs. Black-Right-Pointing-Pointer The capacitance value suggests a double-membrane structure of yolk envelope. -- Abstract: The Japanese medaka fish, Oryzias latipes, has become a powerful vertebrate model organism in developmental biology and genetics. The present study explores the dielectric properties of medaka embryos during pre-hatching development by means of the electrorotation (ROT) technique. Due to their layered structure, medaka eggs exhibited up to three ROT peaks in the kHz-MHz frequency range. During development from blastula to early somite stage, ROT spectra varied only slightly. But as the embryo progressed to the late-somite stage, the ROT peaks underwent significant changes in frequency and amplitude. Using morphological data obtained by light and electron microscopy, we analyzed the ROT spectra with a three-shell dielectric model that accounted for the major embryonic compartments. The analysis yielded a very high value for the ionic conductivity of the egg shell (chorion), which was confirmed by independent osmotic experiments. A relatively low capacitance of the yolk envelope was consistent with its double-membrane structure revealed by transmission electron microscopy. Yolk-free dead eggs exhibited only one co-field ROT peak, shifted markedly to lower frequencies with respect to the corresponding peak of live embryos. The dielectric data may be useful for monitoring the development and changes in fish embryos' viability/conditions in basic research and industrial aquaculture.

  13. Evolutionary growth process of highly conserved sequences in vertebrate genomes.

    Ishibashi, Minaka; Noda, Akiko Ogura; Sakate, Ryuichi; Imanishi, Tadashi

    2012-08-01

    Genome sequence comparison between evolutionarily distant species revealed ultraconserved elements (UCEs) among mammals under strong purifying selection. Most of them were also conserved among vertebrates. Because they tend to be located in the flanking regions of developmental genes, they would have fundamental roles in creating vertebrate body plans. However, the evolutionary origin and selection mechanism of these UCEs remain unclear. Here we report that UCEs arose in primitive vertebrates, and gradually grew in vertebrate evolution. We searched for UCEs in two teleost fishes, Tetraodon nigroviridis and Oryzias latipes, and found 554 UCEs with 100% identity over 100 bps. Comparison of teleost and mammalian UCEs revealed 43 pairs of common, jawed-vertebrate UCEs (jUCE) with high sequence identities, ranging from 83.1% to 99.2%. Ten of them retain lower similarities to the Petromyzon marinus genome, and the substitution rates of four non-exonic jUCEs were reduced after the teleost-mammal divergence, suggesting that robust conservation had been acquired in the jawed vertebrate lineage. Our results indicate that prototypical UCEs originated before the divergence of jawed and jawless vertebrates and have been frozen as perfect conserved sequences in the jawed vertebrate lineage. In addition, our comparative sequence analyses of UCEs and neighboring regions resulted in a discovery of lineage-specific conserved sequences. They were added progressively to prototypical UCEs, suggesting step-wise acquisition of novel regulatory roles. Our results indicate that conserved non-coding elements (CNEs) consist of blocks with distinct evolutionary history, each having been frozen since different evolutionary era along the vertebrate lineage. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Myosin II activity is required for functional leading-edge cells and closure of epidermal sheets in fish skin ex vivo.

    Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi

    2011-09-01

    Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.

  15. The medaka novel immune-type receptor (NITR gene clusters reveal an extraordinary degree of divergence in variable domains

    Litman Gary W

    2008-06-01

    Full Text Available Abstract Background Novel immune-type receptor (NITR genes are members of diversified multigene families that are found in bony fish and encode type I transmembrane proteins containing one or two extracellular immunoglobulin (Ig domains. The majority of NITRs can be classified as inhibitory receptors that possess cytoplasmic immunoreceptor tyrosine-based inhibition motifs (ITIMs. A much smaller number of NITRs can be classified as activating receptors by the lack of cytoplasmic ITIMs and presence of a positively charged residue within their transmembrane domain, which permits partnering with an activating adaptor protein. Results Forty-four NITR genes in medaka (Oryzias latipes are located in three gene clusters on chromosomes 10, 18 and 21 and can be organized into 24 families including inhibitory and activating forms. The particularly large dataset acquired in medaka makes direct comparison possible to another complete dataset acquired in zebrafish in which NITRs are localized in two clusters on different chromosomes. The two largest medaka NITR gene clusters share conserved synteny with the two zebrafish NITR gene clusters. Shared synteny between NITRs and CD8A/CD8B is limited but consistent with a potential common ancestry. Conclusion Comprehensive phylogenetic analyses between the complete datasets of NITRs from medaka and zebrafish indicate multiple species-specific expansions of different families of NITRs. The patterns of sequence variation among gene family members are consistent with recent birth-and-death events. Similar effects have been observed with mammalian immunoglobulin (Ig, T cell antigen receptor (TCR and killer cell immunoglobulin-like receptor (KIR genes. NITRs likely diverged along an independent pathway from that of the somatically rearranging antigen binding receptors but have undergone parallel evolution of V family diversity.

  16. A comprehensive study of the toxicity of natural multi-contaminated sediments: New insights brought by the use of a combined approach using the medaka embryo-larval assay and physico-chemical analyses.

    Barjhoux, Iris; Clérandeau, Christelle; Menach, Karyn Le; Anschutz, Pierre; Gonzalez, Patrice; Budzinski, Hélène; Morin, Bénédicte; Baudrimont, Magalie; Cachot, Jérôme

    2017-08-01

    Sediment compartment is a long term sink for pollutants and a secondary source of contamination for aquatic species. The abiotic factors controlling the bioavailability and thus the toxicity of complex mixtures of pollutants accumulated in sediments are poorly documented. To highlight the different factors influencing sediment toxicity, we identified and analyzed the physico-chemical properties, micro-pollutant contents, and toxicity level of six contrasted sediments in the Lot-Garonne continuum. Sediment toxicity was evaluated using the recently described Japanese medaka (Oryzias latipes) embryo-larval assay with direct exposure to whole sediment (MELAc). Multiple toxicity endpoints including embryotoxicity, developmental defects and DNA damage were analyzed in exposed embryos. Chemical analyses revealed significant variations in the nature and contamination profile of sediments, mainly impacted by metallic trace elements and, unexpectedly, polycyclic aromatic hydrocarbons. Exposure to sediments induced different toxic impacts on medaka early life stages when compared with the reference site. Principal component analysis showed that the toxic responses following exposure to sediments from the Lot River and its tributary were associated with micro-pollutant contamination: biometric measurements, hatching success, genotoxicity, craniofacial deformities and yolk sac malabsorption were specifically correlated to metallic and organic contaminants. Conversely, the main biological responses following exposure to the Garonne River sediments were more likely related to their physico-chemical properties than to their contamination level. Time to hatch, cardiovascular injuries and spinal deformities were correlated to organic matter content, fine particles and dissolved oxygen levels. These results emphasize the necessity of combining physico-chemical analysis of sediment with toxicity assessment to accurately evaluate the environmental risks associated with sediment

  17. Early warning signs of endocrine disruption in adult fish from the ingestion of polyethylene with and without sorbed chemical pollutants from the marine environment

    Rochman, Chelsea M.; Kurobe, Tomofumi; Flores, Ida; Teh, Swee J.

    2014-01-01

    Plastic debris is associated with several chemical pollutants known to disrupt the functioning of the endocrine system. To determine if the exposure to plastic debris and associated chemicals promotes endocrine-disrupting effects in fish, we conducted a chronic two-month dietary exposure using Japanese medaka (Oryzias latipes) and environmentally relevant concentrations of microplastic (< 1 mm) and associated chemicals. We exposed fish to three treatments: a no-plastic (i.e. negative control), virgin-plastic (i.e. virgin polyethylene pre-production pellets) and marine-plastic treatment (i.e. polyethylene pellets deployed in San Diego Bay, CA for 3 months). Altered gene expression was observed in male fish exposed to the marine-plastic treatment, whereas altered gene expression was observed in female fish exposed to both the marine- and virgin-plastic treatment. Significant down-regulation of choriogenin (Chg H) gene expression was observed in males and significant down-regulation of vitellogenin (Vtg I), Chg H and the estrogen receptor (ERα) gene expression was observed in females. In addition, histological observation revealed abnormal proliferation of germ cells in one male fish from the marine-plastic treatment. Overall, our study suggests that the ingestion of plastic debris at environmentally relevant concentrations may alter endocrine system function in adult fish and warrants further research. - Highlights: • We saw down-regulation of Chg H in males exposed to marine plastic. • We saw down-regulation of Vtg I, Chg H and ERα in females exposed to plastic. • We saw abnormal proliferation of germ cells in a male exposed to marine plastic. • Our results suggest that the ingestion of plastic may alter endocrine system function

  18. Multiple TPR motifs characterize the Fanconi anemia FANCG protein.

    Blom, Eric; van de Vrugt, Henri J; de Vries, Yne; de Winter, Johan P; Arwert, Fré; Joenje, Hans

    2004-01-05

    The genome protection pathway that is defective in patients with Fanconi anemia (FA) is controlled by at least eight genes, including BRCA2. A key step in the pathway involves the monoubiquitylation of FANCD2, which critically depends on a multi-subunit nuclear 'core complex' of at least six FANC proteins (FANCA, -C, -E, -F, -G, and -L). Except for FANCL, which has WD40 repeats and a RING finger domain, no significant domain structure has so far been recognized in any of the core complex proteins. By using a homology search strategy comparing the human FANCG protein sequence with its ortholog sequences in Oryzias latipes (Japanese rice fish) and Danio rerio (zebrafish) we identified at least seven tetratricopeptide repeat motifs (TPRs) covering a major part of this protein. TPRs are degenerate 34-amino acid repeat motifs which function as scaffolds mediating protein-protein interactions, often found in multiprotein complexes. In four out of five TPR motifs tested (TPR1, -2, -5, and -6), targeted missense mutagenesis disrupting the motifs at the critical position 8 of each TPR caused complete or partial loss of FANCG function. Loss of function was evident from failure of the mutant proteins to complement the cellular FA phenotype in FA-G lymphoblasts, which was correlated with loss of binding to FANCA. Although the TPR4 mutant fully complemented the cells, it showed a reduced interaction with FANCA, suggesting that this TPR may also be of functional importance. The recognition of FANCG as a typical TPR protein predicts this protein to play a key role in the assembly and/or stabilization of the nuclear FA protein core complex.

  19. TALENs-mediated gene disruption of myostatin produces a larger phenotype of medaka with an apparently compromised immune system.

    Chiang, Yi-An; Kinoshita, Masato; Maekawa, Shun; Kulkarni, Amod; Lo, Chu-Fang; Yoshiura, Yasutoshi; Wang, Han-Ching; Aoki, Takashi

    2016-01-01

    Although myostatin, a suppressor of skeletal muscle development and growth, has been well studied in mammals, its function in fish remains unclear. In this study, we used a popular genome editing tool with high efficiency and target specificity (TALENs; transcription activator-like effector nucleases) to mutate the genome sequence of myostatin (MSTN) in medaka (Oryzias latipes). After the TALEN pair targeting OlMyostatin was injected into fertilized medaka eggs, mutant G0 fish carrying different TALENs-induced frameshifts in the OlMSTN coding sequence were mated together in order to transmit the mutant sequences to the F1 generation. Two F1 mutants with frameshifted myostatin alleles were then mated to produce the F2 generation, and these F2 OlMSTN null (MSTN(-/-)) medaka were evaluated for growth performance. The F2 fish showed significantly increased body length and weight compared to the wild type fish at the juvenile and post-juvenile stages. At the post-juvenile stage, the average body weight of the MSTN(-/-) medaka was ∼25% greater than the wild type. However, we also found that when the F3 generation were challenged with red spotted grouper nervous necrosis virus (RGNNV), the expression levels of the interferon-stimulated genes were lower than in the wild type, and the virus copy number was maintained at a high level. We therefore conclude that although the MSTN(-/-) medaka had a larger phenotype, their immune system appeared to be at least partially suppressed or undeveloped. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Conserved regulatory modules in the Sox9 testis-specific enhancer predict roles for SOX, TCF/LEF, Forkhead, DMRT, and GATA proteins in vertebrate sex determination.

    Bagheri-Fam, Stefan; Sinclair, Andrew H; Koopman, Peter; Harley, Vincent R

    2010-03-01

    While the primary sex determining switch varies between vertebrate species, a key downstream event in testicular development, namely the male-specific up-regulation of Sox9, is conserved. To date, only two sex determining switch genes have been identified, Sry in mammals and the Dmrt1-related gene Dmy (Dmrt1bY) in the medaka fish Oryzias latipes. In mice, Sox9 expression is evidently up-regulated by SRY and maintained by SOX9 both of which directly activate the core 1.3 kb testis-specific enhancer of Sox9 (TESCO). How Sox9 expression is up-regulated and maintained in species without Sry (i.e. non-mammalian species) is not understood. In this study, we have undertaken an in-depth comparative genomics approach and show that TESCO contains an evolutionarily conserved region (ECR) of 180 bp which is present in marsupials, monotremes, birds, reptiles and amphibians. The ECR contains highly conserved modules that predict regulatory roles for SOX, TCF/LEF, Forkhead, DMRT, and GATA proteins in vertebrate sex determination/differentiation. Our data suggest that tetrapods share common aspects of Sox9 regulation in the testis, despite having different sex determining switch mechanisms. They also suggest that Sox9 autoregulation is an ancient mechanism shared by all tetrapods, raising the possibility that in mammals, SRY evolved by mimicking this regulation. The validation of ECR regulatory sequences conserved from human to frogs will provide new insights into vertebrate sex determination. Copyright 2009 Elsevier Ltd. All rights reserved.

  1. Nanosecond pulsed electric field incorporation technique to predict molecular mechanisms of teratogenicity and developmental toxicity of estradiol-17β on medaka embryos.

    Yamaguchi, Akemi; Ishibashi, Hiroshi; Kono, Susumu; Iida, Midori; Uchida, Masaya; Arizono, Koji; Tominaga, Nobuaki

    2018-05-01

    Herein, we propose using a nanosecond pulsed electric field (nsPEF) technique to assess teratogenicity and embryonic developmental toxicity of estradiol-17β (E 2 ) and predict the molecular mechanisms of teratogenicity and embryonic developmental defects caused by E 2 on medaka (Oryzias latipes). The 5 hour post-fertilization embryos were exposed to co-treatment with 10 μm E 2 and nsPEF for 2 hours and then continuously cultured under non-E 2 and nsPEF conditions until hatching. Results documented that the time to hatching of embryos was significantly delayed in comparison to the control group and that typical abnormal embryo development, such as the delay of blood vessel formation, was observed. For DNA microarray analysis, 6 day post-fertilization embryos that had been continuously cultured under the non-E 2 and nsPEF condition after 2 hour co-treatments were used. DNA microarray analysis identified 542 upregulated genes and one downregulated gene in the 6 day post-fertilization embryos. Furthermore, bioinformatic analyses using differentially expressed genes revealed that E 2 exposure affected various gene ontology terms, such as response to hormone stimulus. The network analysis also documented that the estrogen receptor α in the mitogen-activated protein kinase signaling pathway may be involved in regulating several transcription factors, such as FOX, AKT1 and epidermal growth factor receptor. These results suggest that our nsPEF technique is a powerful tool for assessing teratogenicity and embryonic developmental toxicity of E 2 and predict their molecular mechanisms in medaka embryos. Copyright © 2017 John Wiley & Sons, Ltd.

  2. Early warning signs of endocrine disruption in adult fish from the ingestion of polyethylene with and without sorbed chemical pollutants from the marine environment

    Rochman, Chelsea M., E-mail: cmrochman@ucdavis.edu; Kurobe, Tomofumi; Flores, Ida; Teh, Swee J.

    2014-09-15

    Plastic debris is associated with several chemical pollutants known to disrupt the functioning of the endocrine system. To determine if the exposure to plastic debris and associated chemicals promotes endocrine-disrupting effects in fish, we conducted a chronic two-month dietary exposure using Japanese medaka (Oryzias latipes) and environmentally relevant concentrations of microplastic (< 1 mm) and associated chemicals. We exposed fish to three treatments: a no-plastic (i.e. negative control), virgin-plastic (i.e. virgin polyethylene pre-production pellets) and marine-plastic treatment (i.e. polyethylene pellets deployed in San Diego Bay, CA for 3 months). Altered gene expression was observed in male fish exposed to the marine-plastic treatment, whereas altered gene expression was observed in female fish exposed to both the marine- and virgin-plastic treatment. Significant down-regulation of choriogenin (Chg H) gene expression was observed in males and significant down-regulation of vitellogenin (Vtg I), Chg H and the estrogen receptor (ERα) gene expression was observed in females. In addition, histological observation revealed abnormal proliferation of germ cells in one male fish from the marine-plastic treatment. Overall, our study suggests that the ingestion of plastic debris at environmentally relevant concentrations may alter endocrine system function in adult fish and warrants further research. - Highlights: • We saw down-regulation of Chg H in males exposed to marine plastic. • We saw down-regulation of Vtg I, Chg H and ERα in females exposed to plastic. • We saw abnormal proliferation of germ cells in a male exposed to marine plastic. • Our results suggest that the ingestion of plastic may alter endocrine system function.

  3. Two azole fungicides (carcinogenic triadimefon and non-carcinogenic myclobutanil) exhibit different hepatic cytochrome P450 activities in medaka fish

    Lin, Chun-Hung [Department of Agricultural Chemistry, National Taiwan University, Taipei, Taiwan (China); Chou, Pei-Hsin [Department of Environmental Engineering, National Cheng-Kung University, Tainan, Taiwan (China); Chen, Pei-Jen, E-mail: chenpj@ntu.edu.tw [Department of Agricultural Chemistry, National Taiwan University, Taipei, Taiwan (China)

    2014-07-30

    Highlights: • We assess ecotoxicological impact of azole fungicides in the aquatic environment. • Carcinogenic and non-carcinogenic azoles show different CYP activities in medaka. • We compare azole-induced CYP expression and carcinogenesis between fish and rodents. • Liver CYP-enzyme induction is a key event in conazole-induced tumorigenesis. • We suggest toxicity evaluation methods for azole fungicides using medaka fish. - Abstract: Conazoles are a class of imidazole- or triazole-containing drugs commonly used as fungicides in agriculture and medicine. The broad application of azole drugs has led to the contamination of surface aquifers receiving the effluent of municipal or hospital wastewater or agricultural runoff. Several triazoles are rodent carcinogens; azole pollution is a concern to environmental safety and human health. However, the carcinogenic mechanisms associated with cytochrome P450 enzymes (CYPs) of conazoles remain unclear. We exposed adult medaka fish (Oryzias latipes) to continuous aqueous solutions of carcinogenic triadimefon and non-carcinogenic myclobutanil for 7 to 20 days at sub-lethal or environmentally relevant concentrations and assessed hepatic CYP activity and gene expression associated with CYP-mediated toxicity. Both triadimefon and myclobutanil induced hepatic CYP3A activity, but only triadimefon enhanced CYP1A activity. The gene expression of cyp3a38, cyp3a40, pregnane x receptor (pxr), cyp26b, retinoid acid receptor γ1 (rarγ1) and p53 was higher with triadimefon than myclobutanil. As well, yeast-based reporter gene assay revealed that 4 tested conazoles were weak agonists of aryl hydrocarbon receptor (AhR). We reveal differential CYP gene expression with carcinogenic and non-carcinogenic conazoles in a lower vertebrate, medaka fish. Liver CYP-enzyme induction may be a key event in conazole-induced tumorigenesis. This information is essential to evaluate the potential threat of conazoles to human health and fish

  4. Extended fish short term reproduction assays with the fathead minnow and Japanese medaka: No evidence of impaired fecundity from exposure to atrazine.

    Brain, Richard A; Schneider, Suzanne Z; Anderson, Julie C; Knopper, Loren D; Wolf, Jeffrey C; Hanson, Mark L

    2018-08-01

    Short-term reproduction assays were conducted with fathead minnow (Pimephales promelas) and Japanese medaka (Oryzias latipes) to evaluate responses from atrazine exposure at environmentally relevant concentrations and above. Breeding groups of fish with multiple males and females were exposed to atrazine under flow-through conditions. Fathead minnows were exposed to mean measured concentrations of 1.0, 10, 26, 52, and 105 μg atrazine/L for 28 days. Medaka were exposed to mean measured concentrations of 9.4, 48, 74, 97, and 244 μg atrazine/L for 28 or 29 days. Fish were evaluated for survival, fecundity, fertility, total length, wet weight, secondary sex characteristics, gonadosomatic index (GSI) (P. promelas only), plasma or hepatic vitellogenin (VTG), and histopathology of gonads. General observations of health and behaviour were also conducted. There were no statistically significant effects (i.e., p < 0.05) of atrazine on survival, size, reproduction, behaviour, GSI, VTG, or secondary sex characteristics in either species at any exposure level. In fathead minnows, there were no histopathological findings associated with atrazine exposure in male fish, but there was an increased proportion of Stage 4.0 ovaries accompanied by an increase in proportion of Grade 3 post-ovulatory follicles in females of the 105 μg/L treatment group. Without a concomitant increase in oocyte atresia, neither of these findings are considered adverse for the health of the fish. In medaka, there were no significant effects of atrazine exposure on histopathology in either sex. These data support current weight-of-evidence assessments that atrazine does not cause direct adverse effects on fish reproduction at environmentally realistic concentrations. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Environmentally relevant concentrations of di(2-ethylhexyl)phthalate exposure alter larval growth and locomotion in medaka fish via multiple pathways.

    Yang, Wen-Kai; Chiang, Li-Fen; Tan, Shi-Wei; Chen, Pei-Jen

    2018-06-01

    Di(2-ethylhexyl)phthalate (DEHP) is a commonly used plasticizer, with evidence of ubiquitous human exposure and widespread occurrence in the aquatic environment. It is an emerging environmental pollutant with regulatory priority; however, most studies have focused on the toxicity of DEHP related to endocrine disruption and reproduction in mammals. The ecotoxicological impact of phthalates (e.g., DEHP) on early life stages of fish under environmentally relevant concentrations of chronic exposure remains unclear. In this study, 7-day post-hatching fry of medaka fish (Oryzias latipes) underwent 21-day continuous exposure to DEHP solutions at 20, 100 and 200 μg/L to assess the effects on fish development and locomotion and related toxic mechanisms. Larval mortality was low with DEHP (20-200 μg/L) within 21 days, but such exposure significantly reduced fish body weight and length and altered swimming behavior. At 21 days, DEHP exposure resulted in specific patterns of larval locomotion (e.g., increased maximum velocity and absolute turn angle) and dose-dependently increased the mRNA expression of acetylcholinesterase (ache) but did not alter AChE activity. Transcriptional expression of antioxidants such as superoxide dismutase, catalase, glutathione peroxidase, and glutathione S-transferase and peroxisome proliferation-activated receptor and retinoid X receptor genes was significantly suppressed with 21-day DEHP exposure (20-200 μg/L), with marginal alteration in reactive oxygen species levels and antioxidant activities within the dosing period. As well, DEHP altered the mRNA expression of p53-regulated apoptosis pathways, such as upregulated p53, p21 and bcl-2 and downregulated caspase-3 expression, with increased enzymatic activity of caspase-3 in larvae. Our results suggest that toxic mechanisms of waterborne DEHP altered fish growth and locomotion likely via a combined effect of oxidative stress, neurotoxicity and apoptosis pathways. Copyright © 2018

  6. Changes in the dielectric properties of medaka fish embryos during development, studied by electrorotation

    Shirakashi, Ryo; Mischke, Miriam; Fischer, Peter; Memmel, Simon; Krohne, Georg; Fuhr, Günter R.; Zimmermann, Heiko; Sukhorukov, Vladimir L.

    2012-01-01

    Highlights: ► Electrorotation offers a non-invasive tool for dielectric analysis of fish embryos. ► The three-shell dielectric model matches the rotation spectra of medaka eggs. ► The capacitance value suggests a double-membrane structure of yolk envelope. -- Abstract: The Japanese medaka fish, Oryzias latipes, has become a powerful vertebrate model organism in developmental biology and genetics. The present study explores the dielectric properties of medaka embryos during pre-hatching development by means of the electrorotation (ROT) technique. Due to their layered structure, medaka eggs exhibited up to three ROT peaks in the kHz–MHz frequency range. During development from blastula to early somite stage, ROT spectra varied only slightly. But as the embryo progressed to the late-somite stage, the ROT peaks underwent significant changes in frequency and amplitude. Using morphological data obtained by light and electron microscopy, we analyzed the ROT spectra with a three-shell dielectric model that accounted for the major embryonic compartments. The analysis yielded a very high value for the ionic conductivity of the egg shell (chorion), which was confirmed by independent osmotic experiments. A relatively low capacitance of the yolk envelope was consistent with its double-membrane structure revealed by transmission electron microscopy. Yolk-free dead eggs exhibited only one co-field ROT peak, shifted markedly to lower frequencies with respect to the corresponding peak of live embryos. The dielectric data may be useful for monitoring the development and changes in fish embryos’ viability/conditions in basic research and industrial aquaculture.

  7. Highly efficient generation of knock-in transgenic medaka by CRISPR/Cas9-mediated genome engineering.

    Watakabe, Ikuko; Hashimoto, Hisashi; Kimura, Yukiko; Yokoi, Saori; Naruse, Kiyoshi; Higashijima, Shin-Ichi

    2018-01-01

    Medaka ( Oryzias latipes ) is a popular animal model used in vertebrate genetic analysis. Recently, an efficient (~ 30%) knock-in system via non-homologous end joining (NHEJ) was established in zebrafish using the CRISPR/Cas9 system. If the same technique were applicable in medaka, it would greatly expand the usefulness of this model organism. The question of the applicability of CRISPR/Cas9 in medaka, however, has yet to be addressed. We report the highly efficient generation of knock-in transgenic medaka via non-homologous end joining (NHEJ). Donor plasmid containing a heat-shock promoter and a reporter gene was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, an sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. Broad transgene expression in the expression domain of a target gene was observed in approximately 25% of injected embryos. By raising these animals, we established stable knock-in transgenic fish with several different constructs for five genetic loci, obtaining transgenic founders at efficiencies of > 50% for all five loci. Further, we show that the method is useful for obtaining mutant alleles. In the experiments where transgene integrations were targeted between the transcription start site and the initiation methionine, the resultant transgenic fish became mutant alleles. With its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in via NHEJ will become a standard method for the generation of transgenic and mutant medaka.

  8. Two azole fungicides (carcinogenic triadimefon and non-carcinogenic myclobutanil) exhibit different hepatic cytochrome P450 activities in medaka fish

    Lin, Chun-Hung; Chou, Pei-Hsin; Chen, Pei-Jen

    2014-01-01

    Highlights: • We assess ecotoxicological impact of azole fungicides in the aquatic environment. • Carcinogenic and non-carcinogenic azoles show different CYP activities in medaka. • We compare azole-induced CYP expression and carcinogenesis between fish and rodents. • Liver CYP-enzyme induction is a key event in conazole-induced tumorigenesis. • We suggest toxicity evaluation methods for azole fungicides using medaka fish. - Abstract: Conazoles are a class of imidazole- or triazole-containing drugs commonly used as fungicides in agriculture and medicine. The broad application of azole drugs has led to the contamination of surface aquifers receiving the effluent of municipal or hospital wastewater or agricultural runoff. Several triazoles are rodent carcinogens; azole pollution is a concern to environmental safety and human health. However, the carcinogenic mechanisms associated with cytochrome P450 enzymes (CYPs) of conazoles remain unclear. We exposed adult medaka fish (Oryzias latipes) to continuous aqueous solutions of carcinogenic triadimefon and non-carcinogenic myclobutanil for 7 to 20 days at sub-lethal or environmentally relevant concentrations and assessed hepatic CYP activity and gene expression associated with CYP-mediated toxicity. Both triadimefon and myclobutanil induced hepatic CYP3A activity, but only triadimefon enhanced CYP1A activity. The gene expression of cyp3a38, cyp3a40, pregnane x receptor (pxr), cyp26b, retinoid acid receptor γ1 (rarγ1) and p53 was higher with triadimefon than myclobutanil. As well, yeast-based reporter gene assay revealed that 4 tested conazoles were weak agonists of aryl hydrocarbon receptor (AhR). We reveal differential CYP gene expression with carcinogenic and non-carcinogenic conazoles in a lower vertebrate, medaka fish. Liver CYP-enzyme induction may be a key event in conazole-induced tumorigenesis. This information is essential to evaluate the potential threat of conazoles to human health and fish

  9. Tritium behavior in an aquatic ecosystem

    Komatsu, K.

    1982-01-01

    Tritium behavior in aquatic organisms through a model food chain was investigated. In this model food chain, tritium in water reaches bacteria or Japanese killifish via diatoms and brine shrimps. Tritium accumulation in these organisms as organic bound form was expressed as the R value which is defined as the ratio of tritium specific activity in lyophilized organisms (μCi/gH) to that in water (μCi/gH). The maximum R values were 0.5 in diatoms: Chaetoceros gracilis, 0.2 in bacteria: Escherichia coli, 0.5 in brine shrimps: Artemia salina, and 0.32 in Japanese killifish: Oryzias latipes under the growing condition in which tritium accumulation was due to tritium in tritiated water and not tritiated foods. Brine shrimps and Japanese killifish were grown from larve to adult in tritiated sea water and were fed on tritiated foods (model food chain). Their R values were 0.70 and 0.67, respectively. Bacteria, which grew in tritiated water by adding the hydrolysate of tritiated brine shrimps, showed a maximum R value at 0.32. The R values of each organ of Japanese killifish and of DNA and the nucleotides purified from brine shrimps growing in tritiated water with or without tritiated food were measured to estimate the tritium distribution in the body or various molecules of the organisms. These results did not indicate concentration of tritium in specific organs or compounds. The changes of specific activity of tritium in these organisms were measured when they were transferred to non-tritiated water. These retention of tritium was not only different among the tissues but also depended on whether or not the organisms were reared with tritiated foods. (author)

  10. Radioecological studies of {sup 137}Cs in limnological ecosystems. Accumulation and excretion of {sup 137}Cs in goldfish, Carassius auratus auratus, from diets

    Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki [Saitama Inst. of Public Health, Urawa (Japan); Ogata, Hiromitsu; Izumo, Yoshiro; Nakamura, Fumio

    1996-06-01

    Accumulation and excretion Of {sup 137}Cs in goldfish, Carassius auratus auratus, from radioactive diets (killifish, Oryzias latipes, meats accumulated {sup 137}Cs in the radioactive freshwater) or control diets (killifish meats mixed {sup 137}CsCl) were investigated in order to elucidate the accumulation mechanism of the radionuclide in natural living fishes. The accumulation of {sup 137}Cs, expressed in concentration ratio, in whole body of the fish showed a increasing tendency in proportion to the rearing time. On the other hand, the excretion of {sup 137}Cs, expressed in retention rate, in whole body rearing by administration of non-radioactive commercial diets after the accumulation above for 7 days, demonstrated a rapid decreasing at first few days, and followed a gradual decreasing tendency (the biological half lives were about 1.5 days and 52 days, respectively). As for the tissues and organs, higher accumulation and higher excretion were found in the viscera than those in the muscle. It is so suggested that the metabolic turnover rate of this radionuclide for the viscera is more rapid than that for the muscle. From the experimental results, it was confirmed that the relative contribution by ingestion of the radioactive diets in the accumulation of {sup 137}Cs in natural environmental fish was comparatively higher in comparison with uptake of the radionuclide in the radioactive freshwater. With regard to the difference between the radioactive diets and the control diets, the accumulation of {sup 137}Cs in whole body of the fish from the radioactive diets was less than that from the control diets to rearing 5 days, but afterward was not different. The difference of the accumulation between these diets will be attributable to that of the metabolic turnover between these diets. (author)

  11. Comparative safety of the antifouling compound butenolide and 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT) to the marine medaka (Oryzias melastigma)

    Chen, Lianguo; Ye, Rui; Xu, Ying; Gao, Zhaoming; Au, Doris W.T.; Qian, Pei-Yuan

    2014-01-01

    medaka exposed to DCOIT. This greatly imbalanced sex hormones ratio (E2/T) in exposed males, indicating that DCOIT is a potent endocrine disruptive chemical. In contrast, butenolide induced only moderate effects on sex hormone levels in exposed males

  12. Comparative radiation genetics. What we learnt from our studies on Medaka germ cell mutagenesis

    Shima, Akihiro

    2004-01-01

    Having been interested in studying germ cell mutagenesis from the biodiversity viewpoint, in 1985 we started developing a nonmammalian specific-locus test (SLT) system using the Medaka, Oryzias latipes. The tester strain with five marker loci, which is a prerequisite for SLT, was established by consecutive crossings of five spontaneous single mutants followed by selection based on the phenotype of each mutant. The genetic endpoints available were dominant lethal mutations (DLM), total specific-locus mutations (TSLM) and viable specific-locus mutations. Using γ-rays, ethylnitrosourea and Fe-ion beam as mutagens to which wild type males or females were exposed, we screened approx. 1.6 million F1 embryos that correspond to approx. 4.7 million loci. In an attempt to best express the comparative sensitivity of Medaka germ cells to the genetic effects of γ-rays, the gametic doubling doses for acute and high-dose γ-rays were estimated. Extensive sex differences within the wild type (HNI) strain as well as strain differences in male germ cells between the two wild type strains (HNI and Sakura) were notably found in doubling doses for DLM and TSLM. Interestingly, among these values, the doubling dose for TSLM in spermatogonia of the HNI strain (0.33 Gy) nearly coincided with that estimated from the Russell 7-locus system of mice (0.44 Gy). Our data also suggested that the initial genomic changes induced in male germ cells would not straightforwardly manifest themselves as phenotypic effects in F1 progeny, but that twofold checks, one a prefertilization check in the gonads against genomic alterations using DNA repair machinery as well as apoptotic response, and the other postfertilization check in developing embryos through dominant lethal effects. should operate to restore or ameliorate those genomic changes. More mechanistically, AP/PCR-RAPD DNA fingerprinting was employed in order to scan as wider regions of the zygotic genome as possible. These anonymous DNA markers

  13. Population modelling to compare chronic external radiotoxicity between individual and population endpoints in four taxonomic groups.

    Alonzo, Frédéric; Hertel-Aas, Turid; Real, Almudena; Lance, Emilie; Garcia-Sanchez, Laurent; Bradshaw, Clare; Vives I Batlle, Jordi; Oughton, Deborah H; Garnier-Laplace, Jacqueline

    2016-02-01

    In this study, we modelled population responses to chronic external gamma radiation in 12 laboratory species (including aquatic and soil invertebrates, fish and terrestrial mammals). Our aim was to compare radiosensitivity between individual and population endpoints and to examine how internationally proposed benchmarks for environmental radioprotection protected species against various risks at the population level. To do so, we used population matrix models, combining life history and chronic radiotoxicity data (derived from laboratory experiments and described in the literature and the FREDERICA database) to simulate changes in population endpoints (net reproductive rate R0, asymptotic population growth rate λ, equilibrium population size Neq) for a range of dose rates. Elasticity analyses of models showed that population responses differed depending on the affected individual endpoint (juvenile or adult survival, delay in maturity or reduction in fecundity), the considered population endpoint (R0, λ or Neq) and the life history of the studied species. Among population endpoints, net reproductive rate R0 showed the lowest EDR10 (effective dose rate inducing 10% effect) in all species, with values ranging from 26 μGy h(-1) in the mouse Mus musculus to 38,000 μGy h(-1) in the fish Oryzias latipes. For several species, EDR10 for population endpoints were lower than the lowest EDR10 for individual endpoints. Various population level risks, differing in severity for the population, were investigated. Population extinction (predicted when radiation effects caused population growth rate λ to decrease below 1, indicating that no population growth in the long term) was predicted for dose rates ranging from 2700 μGy h(-1) in fish to 12,000 μGy h(-1) in soil invertebrates. A milder risk, that population growth rate λ will be reduced by 10% of the reduction causing extinction, was predicted for dose rates ranging from 24 μGy h(-1) in mammals to 1800 μGy h(-1) in

  14. Integrated gene mapping and synteny studies give insights into the evolution of a sex proto-chromosome in Solea senegalensis.

    Portela-Bens, Silvia; Merlo, Manuel Alejandro; Rodríguez, María Esther; Cross, Ismael; Manchado, Manuel; Kosyakova, Nadezda; Liehr, Thomas; Rebordinos, Laureana

    2017-03-01

    The evolution of genes related to sex and reproduction in fish shows high plasticity and, to date, the sex determination system has only been identified in a few species. Solea senegalensis has 42 chromosomes and an XX/XY chromosome system for sex determination, while related species show the ZZ/ZW system. Next-generation sequencing (NGS), multi-color fluorescence in situ hybridization (mFISH) techniques, and bioinformatics analysis have been carried out, with the objective of revealing new information about sex determination and reproduction in S. senegalensis. To that end, several bacterial artificial chromosome (BAC) clones that contain candidate genes involved in such processes (dmrt1, dmrt2, dmrt3, dmrt4, sox3, sox6, sox8, sox9, lh, cyp19a1a, amh, vasa, aqp3, and nanos3) were analyzed and compared with the same region in other related species. Synteny studies showed that the co-localization of dmrt1-dmrt2-drmt3 in the largest metacentric chromosome of S. senegalensis is coincident with that found in the Z chromosome of Cynoglossus semilaevis, which would potentially make this a sex proto-chromosome. Phylogenetic studies show the close proximity of S. senegalensis to Oryzias latipes, a species with an XX/XY system and a sex master gene. Comparative mapping provides evidence of the preferential association of these candidate genes in particular chromosome pairs. By using the NGS and mFISH techniques, it has been possible to obtain an integrated genetic map, which shows that 15 out of 21 chromosome pairs of S. senegalensis have at least one BAC clone. This result is important for distinguishing those chromosome pairs of S. senegalensis that are similar in shape and size. The mFISH analysis shows the following co-localizations in the same chromosomes: dmrt1-dmrt2-dmrt3, dmrt4-sox9-thrb, aqp3-sox8, cyp19a1a-fshb, igsf9b-sox3, and lysg-sox6.

  15. Protanopia (red color-blindness) in medaka: a simple system for producing color-blind fish and testing their spectral sensitivity.

    Homma, Noriko; Harada, Yumi; Uchikawa, Tamaki; Kamei, Yasuhiro; Fukamachi, Shoji

    2017-02-06

    Color perception is important for fish to survive and reproduce in nature. Visual pigments in the retinal photoreceptor cells are responsible for receiving light stimuli, but the function of the pigments in vivo has not been directly investigated in many animals due to the lack of color-blind lines and appropriate color-perception tests. In this study, we established a system for producing color-blind fish and testing their spectral sensitivity. First, we disrupted long-wavelength-sensitive (LWS) opsins of medaka (Oryzias latipes) using the CRISPR/Cas9 system to make red-color-blind lines. Single guide RNAs were designed using the consensus sequences between the paralogous LWSa and LWSb genes to simultaneously introduce double-frameshift mutations. Next, we developed a non-invasive and no-prior-learning test for spectral sensitivity by applying an optomotor response (OMR) test under an Okazaki Large Spectrograph (OLS), termed the O-O test. We constructed an electrical-rotary cylinder with black/white stripes, into which a glass aquarium containing one or more fish was placed under various monochromatic light conditions. The medaka were irradiated by the OLS every 10 nm, from wavelengths of 700 nm to 900 nm, and OMR was evaluated under each condition. We confirmed that the lws - medaka were indeed insensitive to red light (protanopia). While the control fish responded to wavelengths of up to 830 nm (λ = 830 nm), the lws - mutants responded up to λ = 740 nm; however, this difference was not observed after adaptation to dark: both the control and lws - fish could respond up to λ = 820 ~ 830 nm. These results suggest that the lws - mutants lost photopic red-cone vision, but retained scotopic rod vision. Considering that the peak absorption spectra (λ max ) of medaka LWSs are about 560 nm, but the light-adapted control medaka could respond behaviorally to light at λ = 830 nm, red-cone vision could cover an unexpectedly wide range of

  16. Trend of environmental radiation protection and its current related studies

    Yoshida, Satoshi

    2011-01-01

    Reviewed are the international trend of environmental radiation protection (ERP), Japanese studies of radiation effects on environmental livings from aspects of ecosystem to molecular level, and the future view. ERP is particularly closed up toward promotion after its first involvement in the general global conference, UN Conference on Environment and Development (1992). International Commission of Radiological Protection (ICRP) has conducted such actions for the environment as establishing protection essentials for non-human species (2003), organizing Committee 5 (2005), and defining Reference Animals and Plants (2008) where Derived Consideration Reference Levels of 0.1-100 mGy/d are proposed, together with cooperative actions by United Nations Scientific Committee on the Effects of Atomic Radiation (UNSCEAR), International Atomic Energy Agency (IAEA), The Organization for Economic Co-operation and Development (OECD)/Nuclear Energy Agency (NEA) and European projects. Japanese NIRS is now enrolled in the project of Environmental Modeling for Radiation Safety-II (IAEA). Major Japanese studies of radiation effects on environmental livings have utilized killifish (medaka: Oryzias latipes), springtail, earthworm, nematode, cultured plant cell (cedar), poplar, etc. Studies of the radiation effect on microcosm consisting of 3 livings have led to establishing a model for mathematical analysis and of 8 livings, have defined 50% affect dose of 5600 Gy gamma-ray. Irradiation of gamma-ray at 1 Gy/d for 5-10 days to the soil has been shown to result in alteration of the composition of natural earth bacterial population by denaturant gradient gel electrophoresis, which being a promising tool for evaluating the alteration of soil composition and function. At molecular levels, transcriptome analysis of various cells from yeast to man, is performed after irradiation of gamma-ray, neutron, heavy particles and others to reveal radiation-induced gene expression; and Hi-CEP (high

  17. Early life exposure to a rodent carcinogen propiconazole fungicide induces oxidative stress and hepatocarcinogenesis in medaka fish

    Tu, Tzu-Yi; Hong, Chwan-Yang [Department of Agricultural Chemistry, College of Bio-Resources and Agriculture, National Taiwan University, Taipei, Taiwan (China); Sasado, Takao [Laboratory of Bioresources, National Institute for Basic Biology, Okazaki (Japan); Kashiwada, Shosaku [Research Center for Life and Environmental Sciences, Department of Life Sciences, the Toyo University, Gunma (Japan); Chen, Pei-Jen, E-mail: chenpj@ntu.edu.tw [Department of Agricultural Chemistry, College of Bio-Resources and Agriculture, National Taiwan University, Taipei, Taiwan (China)

    2016-01-15

    Highlights: • Propiconazole initiates ROS-induced oxidative stress and damage in medaka fish. • Early life exposure to propiconazole increases incidence of hepatocarcionogensis in p53{sup −/−} medaka. • Oxidative stress and CYP induction involved in p53 regulation are key events in propiconazole-induced hepatotumorigenesis. • Propiconazole-induced toxic response in medaka is compatible with that in rodents. - Abstract: Conazole pollution is an emerging concern to human health and environmental safety because of the broad use of conazole fungicides in agriculture and medicine and their frequent occurrence in aquifers. The agricultural pesticide propiconazole has received much regulatory interest because it is a known rodent carcinogen with evidence of multiple adverse effects in mammals and non-targeted organisms. However, the carcinogenic effect and associated mechanism of propiconazole in fish under microgram-per-liter levels of environmental-relevant exposure remains unclear. To explore whether early life of propiconzaole exposure would induce oxidative stress and latent carcinogenic effects in fish, we continuously exposed larvae of wild type or p53{sup −/−} mutant of medaka fish (Oryzias latipes) to propiconazole (2.5–250 μg/L) for 3, 7, 14 or 28 days and assessed liver histopathology and/or the oxidative stress response and gene expression during exposure and throughout adulthood. Propiconazole dose-dependently induced reactive oxygen species (ROS) level, altered homeostasis of antioxidant superoxide dismutase, catalase and glutathione S-transferase and caused lipid and protein peroxidation during early life exposure in wild type medaka. Such exposure also significantly upregulated gene expression of the cytochrome P450 CYP1A, but marginally suppressed that of tumor suppressor p53 in adults. Furthermore, histopathology revealed that p53{sup −/−} mutant medaka with early life exposure to propiconazole showed increased incidence of

  18. Early life exposure to a rodent carcinogen propiconazole fungicide induces oxidative stress and hepatocarcinogenesis in medaka fish

    Tu, Tzu-Yi; Hong, Chwan-Yang; Sasado, Takao; Kashiwada, Shosaku; Chen, Pei-Jen

    2016-01-01

    Highlights: • Propiconazole initiates ROS-induced oxidative stress and damage in medaka fish. • Early life exposure to propiconazole increases incidence of hepatocarcionogensis in p53"−"/"− medaka. • Oxidative stress and CYP induction involved in p53 regulation are key events in propiconazole-induced hepatotumorigenesis. • Propiconazole-induced toxic response in medaka is compatible with that in rodents. - Abstract: Conazole pollution is an emerging concern to human health and environmental safety because of the broad use of conazole fungicides in agriculture and medicine and their frequent occurrence in aquifers. The agricultural pesticide propiconazole has received much regulatory interest because it is a known rodent carcinogen with evidence of multiple adverse effects in mammals and non-targeted organisms. However, the carcinogenic effect and associated mechanism of propiconazole in fish under microgram-per-liter levels of environmental-relevant exposure remains unclear. To explore whether early life of propiconzaole exposure would induce oxidative stress and latent carcinogenic effects in fish, we continuously exposed larvae of wild type or p53"−"/"− mutant of medaka fish (Oryzias latipes) to propiconazole (2.5–250 μg/L) for 3, 7, 14 or 28 days and assessed liver histopathology and/or the oxidative stress response and gene expression during exposure and throughout adulthood. Propiconazole dose-dependently induced reactive oxygen species (ROS) level, altered homeostasis of antioxidant superoxide dismutase, catalase and glutathione S-transferase and caused lipid and protein peroxidation during early life exposure in wild type medaka. Such exposure also significantly upregulated gene expression of the cytochrome P450 CYP1A, but marginally suppressed that of tumor suppressor p53 in adults. Furthermore, histopathology revealed that p53"−"/"− mutant medaka with early life exposure to propiconazole showed increased incidence of

  19. Evaluación toxicológica de residuos orgánicos Toxicological evaluation of organic residues

    Eduardo de la Peña de Torres

    2005-12-01

    Full Text Available Se reseña el empleo de los ensayos de corta duración para la caracterización de los residuos orgánicos, en especial de algunos de los métodos de evaluación toxicológica, mutagénica, genotóxica y citotóxica (Vibrio fischeri, Salmonella typhimurium y Allium cepa que son empleados en la caracterización de lixiviados de mezclas complejas ambientales. Estos métodos forman parte, junto a otros bioensayos, de la valoración por identificación toxicológica (VIT, que permite la valoración de otros tipos de efectos ecotoxicológicos: a inhibición de la bioluminiscencia en Vibrio ficheri; b tasa de germinación y longitud de las raíces en Lepidum sativum; c longitud de las raices en Allium cepa y Tradescantia sp.; d inhibición de la movilidad en Daphnia magna; y e anormalidades en el desarrollo en Oryzias latipes, o pez medaka. Todos estos ensayos forman parte de la batería de bioensayos empleada en la UE, que se aplican para discriminar y seleccionar las matrices ambientales que deben ser objeto de una específica caracterización química más compleja.Se hace una revisión de los métodos de evaluación toxicológica que se emplean en la caracterización de los compuestos o las mezclas complejas, así como de la utilización de sus resultados en la evaluación del riesgo para el ser humano y el medio ambiente. Esta evaluación consta, en síntesis, de la identificación de los peligros, la evaluación de la relación dosis-respuesta, la valoración de la exposición y la caracterización del riesgo, con el consecuente análisis, manejo y comunicación del mismo. Se destaca de alguno de estos bioensayos el alto valor predictivo que tiene sobre la carcinogenicidad de un producto.Se indica la utilidad y oportunidad de emplear los ensayos de corta duración a la hora de evaluar sustancias, productos y mezclas de sustancias, lo que contribuiría a un incremento en el conocimiento toxicológico de un mayor número de sustancias. Ésta es

  20. Proteomic changes in brain tissues of marine medaka (Oryzias melastigma) after chronic exposure to two antifouling compounds: Butenolide and 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOIT)

    Chen, Lianguo; Zhang, Huoming; Sun, Jin; Wong, Yuehim; Han, Zhuang; Au, Doris W T; Bajic, Vladimir B.; Qian, Peiyuan

    2014-01-01

    the neurotransmission in nervous system, but the underlying mechanism has not been clarified. In the present study, we used TMT six-plex labeling coupled with two-dimensional LC-MS/MS analysis to investigate the protein expression profiles in brain tissues of the marine

  1. Evaluación toxicológica de residuos orgánicos

    Eduardo de la Peña de Torres

    2005-12-01

    Full Text Available Se reseña el empleo de los ensayos de corta duración para la caracterización de los residuos orgánicos, en especial de algunos de los métodos de evaluación toxicológica, mutagénica, genotóxica y citotóxica (Vibrio fischeri, Salmonella typhimurium y Allium cepa que son empleados en la caracterización de lixiviados de mezclas complejas ambientales. Estos métodos forman parte, junto a otros bioensayos, de la valoración por identificación toxicológica (VIT, que permite la valoración de otros tipos de efectos ecotoxicológicos: a inhibición de la bioluminiscencia en Vibrio ficheri; b tasa de germinación y longitud de las raíces en Lepidum sativum; c longitud de las raices en Allium cepa y Tradescantia sp.; d inhibición de la movilidad en Daphnia magna; y e anormalidades en el desarrollo en Oryzias latipes, o pez medaka. Todos estos ensayos forman parte de la batería de bioensayos empleada en la UE, que se aplican para discriminar y seleccionar las matrices ambientales que deben ser objeto de una específica caracterización química más compleja.Se hace una revisión de los métodos de evaluación toxicológica que se emplean en la caracterización de los compuestos o las mezclas complejas, así como de la utilización de sus resultados en la evaluación del riesgo para el ser humano y el medio ambiente. Esta evaluación consta, en síntesis, de la identificación de los peligros, la evaluación de la relación dosis-respuesta, la valoración de la exposición y la caracterización del riesgo, con el consecuente análisis, manejo y comunicación del mismo. Se destaca de alguno de estos bioensayos el alto valor predictivo que tiene sobre la carcinogenicidad de un producto.Se indica la utilidad y oportunidad de emplear los ensayos de corta duración a la hora de evaluar sustancias, productos y mezclas de sustancias, lo que contribuiría a un incremento en el conocimiento toxicológico de un mayor número de sustancias. Ésta es

  2. Population modelling to compare chronic external radiotoxicity between individual and population endpoints in four taxonomic groups

    Alonzo, Frédéric; Hertel-Aas, Turid; Real, Almudena; Lance, Emilie; Garcia-Sanchez, Laurent; Bradshaw, Clare; Vives i Batlle, Jordi; Oughton, Deborah H.; Garnier-Laplace, Jacqueline

    2016-01-01

    In this study, we modelled population responses to chronic external gamma radiation in 12 laboratory species (including aquatic and soil invertebrates, fish and terrestrial mammals). Our aim was to compare radiosensitivity between individual and population endpoints and to examine how internationally proposed benchmarks for environmental radioprotection protected species against various risks at the population level. To do so, we used population matrix models, combining life history and chronic radiotoxicity data (derived from laboratory experiments and described in the literature and the FREDERICA database) to simulate changes in population endpoints (net reproductive rate R_0, asymptotic population growth rate λ, equilibrium population size N_e_q) for a range of dose rates. Elasticity analyses of models showed that population responses differed depending on the affected individual endpoint (juvenile or adult survival, delay in maturity or reduction in fecundity), the considered population endpoint (R_0, λ or N_e_q) and the life history of the studied species. Among population endpoints, net reproductive rate R_0 showed the lowest EDR_1_0 (effective dose rate inducing 10% effect) in all species, with values ranging from 26 μGy h"−"1 in the mouse Mus musculus to 38,000 μGy h"−"1 in the fish Oryzias latipes. For several species, EDR_1_0 for population endpoints were lower than the lowest EDR_1_0 for individual endpoints. Various population level risks, differing in severity for the population, were investigated. Population extinction (predicted when radiation effects caused population growth rate λ to decrease below 1, indicating that no population growth in the long term) was predicted for dose rates ranging from 2700 μGy h"−"1 in fish to 12,000 μGy h"−"1 in soil invertebrates. A milder risk, that population growth rate λ will be reduced by 10% of the reduction causing extinction, was predicted for dose rates ranging from 24 μGy h"−"1

  3. Checklist of the family Simuliidae (Diptera of Finland

    Jari Ilmonen

    2014-09-01

    Full Text Available A checklist of the family Simuliidae (Diptera is provided for Finland and recognizes 56 species. One new record has been added (Simulium latipes and one name sunken in synonymy (Simulium carpathicum. Furthermore, Simulium tsheburovae is treated as a doubtful record.

  4. Assessing the distribution, origins, and ecological risk of polycyclic aromatic hydrocarbons (PAHs) in the habitat of Medaka fish at Keramat Kebo River and Estuary, Tangerang, Banten

    Falahudin, D.; Yogaswara, D.; Khozanah; Edward

    2018-02-01

    Indonesia has a variety of coastal systems such as coral reef, mangrove, seagrass, mudflat, and dune, each of which has high biodiversity of species. The primary concern in Indonesia is that rapid economic growth would endanger some essential natural ecosystems and resources, and cause deterioration of environmental condition. As a part of bioindicator development to recognize pollutants with small fish of the genus Oryzias, this study was conducted to assess baseline status of PAHs distribution and sources in seawater, sediments and Oryzias fish. The ecological risk of PAHs in sediments was also evaluated. Concentrations of fifteen USEPA PAH based on GCMS analysis in seawater, sediments, and Oryzias fish vary from 0.00 to 30,600 ng/l, 6.7 to 138.6 ng/g dry weight (dw) and 25.2 to 30.5 ng/g dw, respectively. Based on the diagnostic ratio of PAH compounds, the potential sources of PAHs originated mainly from pyrogenic sources. The status of sediment from this Oryzias fish habitat was considered to be low polluted with PAHs.

  5. Functional Heterogeneity in Posterior Parietal Cortex Across Attention and Episodic Memory Retrieval

    Hutchinson, J. Benjamin; Uncapher, Melina R.; Weiner, Kevin S.; Bressler, David W.; Silver, Michael A.; Preston, Alison R.; Wagner, Anthony D.

    2014-01-01

    While attention is critical for event memory, debate has arisen regarding the extent to which posterior parietal cortex (PPC) activation during episodic retrieval reflects engagement of PPC-mediated mechanisms of attention. Here, we directly examined the relationship between attention and memory, within and across subjects, using functional magnetic resonance imaging attention-mapping and episodic retrieval paradigms. During retrieval, 4 functionally dissociable PPC regions were identified. Specifically, 2 PPC regions positively tracked retrieval outcomes: lateral intraparietal sulcus (latIPS) indexed graded item memory strength, whereas angular gyrus (AnG) tracked recollection. By contrast, 2 other PPC regions demonstrated nonmonotonic relationships with retrieval: superior parietal lobule (SPL) tracked retrieval reaction time, consistent with a graded engagement of top-down attention, whereas temporoparietal junction displayed a complex pattern of below-baseline retrieval activity, perhaps reflecting disengagement of bottom-up attention. Analyses of retrieval effects in PPC topographic spatial attention maps (IPS0-IPS5; SPL1) revealed that IPS5 and SPL1 exhibited a nonmonotonic relationship with retrieval outcomes resembling that in the SPL region, further suggesting that SPL activation during retrieval reflects top-down attention. While demands on PPC attention mechanisms vary during retrieval attempts, the present functional parcellation of PPC indicates that 2 additional mechanisms (mediated by latIPS and AnG) positively track retrieval outcomes. PMID:23019246

  6. Population dynamics of caterpillars on three cover crops before sowing cotton in Mato Grosso (Brazil).

    Silvie, P J; Menzel, C A; Mello, A; Coelho, A G

    2010-01-01

    Direct seeding mulch-based cropping systems under a preliminary cover crop such as millet are common in some areas of Brazil. Lepidopteran pests that damage cotton, soybean and maize crops can proliferate on cover crops, so preventive chemical treatments are necessary. Very little data is available on these pests on cover crops. This paper presents the dynamics of Spodoptera frugiperda, S. eridania, Mocis latipes and Diatraea saccharalis caterpillars monitored at Primavera do Leste, Mato Grosso state (Brazil) during the of 2005/2006 and 2006/2007 cropping seasons on four cover crops, i.e. finger millet (Eleusine coracana), pearl millet (Pennisetum glaucum), sorghum (Sorghum bicolor) and ruzigrass (Brachiaria ruziziensis). The pests were visually counted on plants within a 1 m2 transect (wooden frame). Caterpillars were reared to facilitate identification of collected species and parasitoids. Many S. frugiperda caterpillars were observed on millet in 2005, with a maximum of 37 caterpillars/m2. On sorghum, we found 30 caterpillars/m2, or 0.83 caterpillars/plant. The Diatraea borer attacked sorghum later than the other pests. M. latipes was also observed on millet. The millet cover crop had to be dried for at least 1 month before direct drilling the main cotton crop in order to impede S. frugiperda infestations on cotton plantlets, thus avoiding the need for substantial resowing. The comparative methodological aspects are discussed.

  7. Effect of agglomeration of silver nanoparticle on nanotoxicity depression

    Bae, Eunjoo; Yi, Jongheop [Seoul National University, Seoul (Korea, Republic of); Lee, Byung-Cheun; Choi, Kyunghee [National Institute of Environmental Research, Incheon (Korea, Republic of); Kim, Younghun [Kwangwoon University, Seoul (Korea, Republic of)

    2013-02-15

    Silver nanoparticles (AgNPs) are used commercially in a variety of applications, including textiles, cosmetics, spray cleaning agents, and metal products. AgNP itself, however, is classified as an environmental hazard by Environmental Protection Agency (EPA, USA) Nanotechnology White Paper, due to its toxic, persistent and bioaccumulative characteristics when exposed to the environment. We investigated the cumulative mortality and abnormalities in Japanese medaka (Oryziaslatipes) embryos after exposure to AgNPs. Free AgNPs in solution have a high activity with respect to biological interactions regarding blocking blood flow and distribution of AgNPs into the cells from head to tail of hatched O. latipes. Interestingly, the agglomeration of AgNPs (loss of nanosized characteristics) played an important role in the environmental toxicity. The present study demonstrated that when the AgNPs were exposed in the ecosystem and then formed agglomerates, nanotoxicity was reduced.

  8. Effect of agglomeration of silver nanoparticle on nanotoxicity depression

    Bae, Eunjoo; Yi, Jongheop; Lee, Byung-Cheun; Choi, Kyunghee; Kim, Younghun

    2013-01-01

    Silver nanoparticles (AgNPs) are used commercially in a variety of applications, including textiles, cosmetics, spray cleaning agents, and metal products. AgNP itself, however, is classified as an environmental hazard by Environmental Protection Agency (EPA, USA) Nanotechnology White Paper, due to its toxic, persistent and bioaccumulative characteristics when exposed to the environment. We investigated the cumulative mortality and abnormalities in Japanese medaka (Oryziaslatipes) embryos after exposure to AgNPs. Free AgNPs in solution have a high activity with respect to biological interactions regarding blocking blood flow and distribution of AgNPs into the cells from head to tail of hatched O. latipes. Interestingly, the agglomeration of AgNPs (loss of nanosized characteristics) played an important role in the environmental toxicity. The present study demonstrated that when the AgNPs were exposed in the ecosystem and then formed agglomerates, nanotoxicity was reduced

  9. Dicty_cDB: Contig-U16208-1 [Dicty_cDB

    Full Text Available H306-1B3, complete sequ... 42 0.001 8 ( EY487360 ) CBBP15754.fwd CBBP Hirudo medicinalis hermaphrodi... 58 0....27 1 ( EY489283 ) CBBP16951.fwd CBBP Hirudo medicinalis hermaphrodi... 50 0.27 1 ( EY385189 ) CAXA5562.fwd ...ev CAWZ Helobdella robusta Primary Late... 42 0.37 2 ( EY485499 ) CBBP14631.fwd CBBP Hirudo medicinalis herm...zias latipes EST, clone M046--B11_093. 38 0.39 3 ( EY490006 ) CBBP17391.fwd CBBP Hirudo medicinalis hermaphr...odi... 44 0.39 2 ( EY485498 ) CBBP14631.rev CBBP Hirudo medicinalis hermaphrodi... 44 0.39 2 ( EY503416 ) CB

  10. New Records of some Filth Flies Species (Diptera: Milichiidae) in Southwest Saudi Arabia

    Dawah, H.A; Abdullah, M.A

    2007-01-01

    A Malaise trap was used during different time periods between 2002 and 2006, in the Asir province of Saudi Arabia at different localities. Nine known species of Milichiidae (some of them of medical importance) have been identified. These are: Desmometopa m-nigrum (Zetterstedt, 1848); D. varipalpis Malloch 1927; D. singaporensis Kertesz 1899; Leptometopa rufifrons Becker 1903; L. latipes (Meigen 1830); L. nilssoni Sabrosky, 1987; Milichia pubescens Becker 1907; Milichiella lacteipennis (Loew 1866); Enigmilichia dimorphica Deeming, 1981, from South-Western Saudi Arabia, the last seven species of the above are recorded for the first time. Biological information and distribution of these species are included. The fauna of Milichiidae found in this study is much more of Afrotropical than Palaearctic origin. (author)

  11. Microsatellite and mitochondrial DNA polymorphism reveals life history dependent interbreeding between hatchery and wild brown trout ( Salmo trutta L.)

    Hansen, Michael Møller; Ruzzante, D.E.; Eg Nielsen, Einar

    2000-01-01

    The effects of stocking hatchery trout into wild populations were studied in a Danish river, using microsatellite and mitochondrial DNA (mtDNA) markers. Baseline samples were taken from hatchery trout and wild trout assumed to be unaffected by previous stocking. Also, samples were taken from...... resident and sea trout from a stocked section of the river. Genetic differentiation between the hatchery strain and the local wild population was modest (microsatellite F-ST = 0.06). Using assignment tests, more than 90% of individuals from the baseline samples were classified correctly. Assignment tests...... involving samples from the stocked river section suggested that the contribution by hatchery trout was low among sea trout (trout. Hybrid index analysis and a high percentage of mtDNA haplotypes specific to indigenous trout observed among resident trout that were assigned...

  12. A Near-Complete Haplotype-Phased Genome of the Dikaryotic Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici Reveals High Interhaplotype Diversity.

    Schwessinger, Benjamin; Sperschneider, Jana; Cuddy, William S; Garnica, Diana P; Miller, Marisa E; Taylor, Jennifer M; Dodds, Peter N; Figueroa, Melania; Park, Robert F; Rathjen, John P

    2018-02-20

    A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N 50 of 1.5 Mb) and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies. IMPORTANCE Current representations of eukaryotic microbial genomes are haploid, hiding the genomic diversity intrinsic to diploid and polyploid life forms. This hidden diversity contributes to the organism's evolutionary potential and ability to adapt to stress conditions. Yet, it is

  13. Bioaccumulation of Stentorin, the Probable Causative Agent for Discolored ("Purple") Eggs and Ovaries in Blue Catfish (Ictalurus furcatus) from Eufaula Lake, Oklahoma, USA.

    Gale, Robert W; Papoulias, Diana M; Schmitt, Christopher J

    2015-08-18

    Observations of reddish to "purple" discolored eggs in the ovaries of adult female blue catfish (Ictalurus furcatus) from the northern arm of Eufaula Lake, a eutrophic multiuse impoundment in east-central Oklahoma, were first reported in 2006. Blue catfish eggs are normally cream to light yellow. Reports peaked in 2007-2008 and declined through 2009-2010; purple eggs have not been reported between 2010 and 2014. In the laboratory, all tissues and fluids of affected fish were strongly orange-red fluorescent under UV illumination, with the fluorescence most apparent in the lipid-rich ovaries and eggs. The causative agent was isolated chromatographically and confirmed by mass spectrometry as stentorin (1,3,4,6,8,10,11,13-octahydroxy-2,5-diisopropyl-phenanthro[1,10,9,8,o,p,q,r,a]perylene-7,14-dione), the fluorescent, lipophilic pigment associated with the photoreceptor protein of the ciliated protozoan Stentor coeruleus (Heterotrichea; Stentoridae). Larval medaka (Orizias latipes) readily consumed S. coeruleus in the laboratory and were observed to fluoresce in the same manner as the affected blue catfish. Potential deleterious effects of stentorin bioaccumulation remain to be determined, as do the geographic extent and the identities of other fluorescent compounds isolated from catfish eggs and ovaries.

  14. Bioaccumulation of stentorin, the probable causative agent for discolored (“purple”) eggs and ovaries in blue catfish (Ictalurus furcatus) from Eufaula Lake, Oklahoma, USA

    Gale, Robert W.; Papoulias, Diana M.; Schmitt, Christopher J.

    2015-01-01

    Observations of reddish to “purple” discolored eggs in the ovaries of adult female blue catfish (Ictalurus furcatus) from the northern arm of Eufaula Lake, a eutrophic multiuse impoundment in east-central Oklahoma, were first reported in 2006. Blue catfish eggs are normally cream to light yellow. Reports peaked in 2007–2008 and declined through 2009–2010; purple eggs have not been reported between 2010 and 2014. In the laboratory, all tissues and fluids of affected fish were strongly orange-red fluorescent under UV illumination, with the fluorescence most apparent in the lipid-rich ovaries and eggs. The causative agent was isolated chromatographically and confirmed by mass spectrometry as stentorin (1,3,4,6,8,10,11,13-octahydroxy-2,5-diisopropyl-phenanthro[1,10,9,8,o,p,q,r,a]perylene-7,14-dione), the fluorescent, lipophilic pigment associated with the photoreceptor protein of the ciliated protozoan Stentor coeruleus (Heterotrichea; Stentoridae). Larval medaka (Orizias latipes) readily consumed S. coeruleus in the laboratory and were observed to fluoresce in the same manner as the affected blue catfish. Potential deleterious effects of stentorin bioaccumulation remain to be determined, as do the geographic extent and the identities of other fluorescent compounds isolated from catfish eggs and ovaries.

  15. Keanekaragaman, aktivitas kunjungan, dan keefektifan lebah penyerbuk pada tanaman tomat (Solanum lycopersicum L: Solanaceae

    Andi Gita Maulidyah Indraswari

    2016-12-01

    Full Text Available Tomato (Solanum lycopersicum L. is a hermaphrodite plant and capable of auto pollination. However it still need pollinators to maximize pollination success. This research was aimed to determine the diversity, foraging activity of pollinator bees and its effectiveness on seeds and fruits formation of tomato. Scan sampling method was used to determine the diversity of pollinators and focal sampling method was used to observe visiting behavior of the bees. We conducted two experiments i.e., screen caged plants and open plants to compare the effect of the bee pollinators on fruits and seeds set formation. Results showed that eleven species of bees were found, i.e., Megachile conjuncta Smith, Megachile fulfifrons Smith, Megachile unbripennis Smith, Xylocopa confusa Latreille, Xylocopa latipes Drury, Xylocopa caerulea Fabricius, Ceratina cognata Latreille, Nomia quadridentata Bingham, Amegilla cyrtandrae Lieftinck, Amegilla burneensis Friese, and Apis cerana Fabricius. Three species of bees were dominant, i.e., X. confusa, A. cyrtandrae, and C. cognata. Bee, X. confusa visited more flowers per minute, followed by A. cyrtandrae and C. cognata. The longest species visiting in plants were C. cognata, followed by X. confusa and A. cyrtandrae. Bee pollinators increase 8.92% of fruiting, 43% of fruit size, 189% of number of seeds per fruit, and 355% of weight of seeds of tomato plants.

  16. Predation as the primary selective force in recurrent evolution of gigantism in Poecilozonites land snails in Quaternary Bermuda

    Olson, Storrs L.; Hearty, Paul J.

    2010-01-01

    During the last half million years, pulses of gigantism in the anagenetic lineage of land snails of the subgenus Poecilozonites on Bermuda were correlated with glacial periods when lower sea level resulted in an island nearly an order of magnitude larger than at present. During those periods, the island was colonized by large vertebrate predators that created selection pressure for large size and rapid growth in the snails. Extreme reduction in land area from rising seas, along with changes in ecological conditions at the onset of interglacial episodes, marked extinction events for large predators, after which snails reverted to much smaller size. The giant snails were identical in morphology during the last two glacials when the predators included a large flightless rail Rallus recessus (marine isotope stages (MIS) 4-2) and a crane Grus latipes and a duck Anas pachysceles (MIS 6). In a preceding glacial period (MIS 10), when the fauna also included the tortoise Hesperotestudo bermudae, the snails were not only large, but the shells were much thicker, presumably to prevent crushing by tortoises. Evolution of Poecilozonites provides an outstanding example of dramatic morphological change in response to environmental pressures in the absence of cladogenesis. PMID:20554560

  17. Genetic diversity of a late prehispanic group of the Quebrada de Humahuaca, northwestern Argentina.

    Mendisco, Fanny; Keyser, Christine; Seldes, Veronica; Rivolta, Clara; Mercolli, Pablo; Cruz, Pablo; Nielsen, Axel E; Crubezy, Eric; Ludes, Bertrand

    2014-09-01

    This palaeogenetic study focused on the analysis of a late prehispanic Argentinean group from the Humahuaca valley, with the main aim of reconstructing its (micro)evolutionary history. The Humahuaca valley, a natural passageway from the eastern plains to the highlands, was the living environment of Andean societies whose cultural but especially biological diversity is still poorly understood. We analyzed the DNA extracted from 39 individuals who populated this upper valley during the Regional Development period (RDP) (between the 11th and 15th centuries CE), to determine their maternal and paternal genetic ancestry. Some mitochondrial and Y-chromosomal haplotypes specific to the Andean region are consistent with an origin in the highlands of Central Andes. On the other hand, a significant genetic affinity with contemporary admixed communities of the Chaco area was detected. Expectedly, recent demographic events, such as the expansion of the Inca Empire or the European colonization, have changed the original mitochondrial gene pool of the ancient Humahuaca Valley community. Finally, we identified a particular geographical organization of the prehispanic populations of Northwestern Argentina. Our results suggest that the communities of the region were divided between two different spheres of interaction, which is consistent with assumptions made by means of craniometric traits. © 2014 John Wiley & Sons Ltd/University College London.

  18. A Comprehensive, Ethnically Diverse Library of Sickle Cell Disease-Specific Induced Pluripotent Stem Cells

    Seonmi Park

    2017-04-01

    Full Text Available Summary: Sickle cell anemia affects millions of people worldwide and is an emerging global health burden. As part of a large NIH-funded NextGen Consortium, we generated a diverse, comprehensive, and fully characterized library of sickle-cell-disease-specific induced pluripotent stem cells (iPSCs from patients of different ethnicities, β-globin gene (HBB haplotypes, and fetal hemoglobin (HbF levels. iPSCs stand to revolutionize the way we study human development, model disease, and perhaps eventually, treat patients. Here, we describe this unique resource for the study of sickle cell disease, including novel haplotype-specific polymorphisms that affect disease severity, as well as for the development of patient-specific therapeutics for this phenotypically diverse disorder. As a complement to this library, and as proof of principle for future cell- and gene-based therapies, we also designed and employed CRISPR/Cas gene editing tools to correct the sickle hemoglobin (HbS mutation. : In this resource article, Mostoslavsky, Murphy, and colleagues of the NextGen consortium describe a diverse, comprehensive, and characterized library of sickle cell disease-specific induced pluripotent stem cells (iPSCs from patients of different ethnicities, β-globin gene (HBB haplotypes and fetal hemoglobin (HbF levels. This bank is readily available and accessible to all investigators. Keywords: induced pluripotent stem cells, iPSCs, sickle cell disease, disease modeling, directed differentiation, gene correction

  19. Insights into the Prunus-Specific S-RNase-Based Self-Incompatibility System from a Genome-Wide Analysis of the Evolutionary Radiation of S Locus-Related F-box Genes.

    Akagi, Takashi; Henry, Isabelle M; Morimoto, Takuya; Tao, Ryutaro

    2016-06-01

    Self-incompatibility (SI) is an important plant reproduction mechanism that facilitates the maintenance of genetic diversity within species. Three plant families, the Solanaceae, Rosaceae and Plantaginaceae, share an S-RNase-based gametophytic SI (GSI) system that involves a single S-RNase as the pistil S determinant and several F-box genes as pollen S determinants that act via non-self-recognition. Previous evidence has suggested a specific self-recognition mechanism in Prunus (Rosaceae), raising questions about the generality of the S-RNase-based GSI system. We investigated the evolution of the pollen S determinant by comparing the sequences of the Prunus S haplotype-specific F-box gene (SFB) with those of its orthologs in other angiosperm genomes. Our results indicate that the Prunus SFB does not cluster with the pollen S of other plants and diverged early after the establishment of the Eudicots. Our results further indicate multiple F-box gene duplication events, specifically in the Rosaceae family, and suggest that the Prunus SFB gene originated in a recent Prunus-specific gene duplication event. Transcriptomic and evolutionary analyses of the Prunus S paralogs are consistent with the establishment of a Prunus-specific SI system, and the possibility of subfunctionalization differentiating the newly generated SFB from the original pollen S determinant. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  20. Evolutionary origin of Rosaceae-specific active non-autonomous hAT elements and their contribution to gene regulation and genomic structural variation.

    Wang, Lu; Peng, Qian; Zhao, Jianbo; Ren, Fei; Zhou, Hui; Wang, Wei; Liao, Liao; Owiti, Albert; Jiang, Quan; Han, Yuepeng

    2016-05-01

    Transposable elements account for approximately 30 % of the Prunus genome; however, their evolutionary origin and functionality remain largely unclear. In this study, we identified a hAT transposon family, termed Moshan, in Prunus. The Moshan elements consist of three types, aMoshan, tMoshan, and mMoshan. The aMoshan and tMoshan types contain intact or truncated transposase genes, respectively, while the mMoshan type is miniature inverted-repeat transposable element (MITE). The Moshan transposons are unique to Rosaceae, and the copy numbers of different Moshan types are significantly correlated. Sequence homology analysis reveals that the mMoshan MITEs are direct deletion derivatives of the tMoshan progenitors, and one kind of mMoshan containing a MuDR-derived fragment were amplified predominately in the peach genome. The mMoshan sequences contain cis-regulatory elements that can enhance gene expression up to 100-fold. The mMoshan MITEs can serve as potential sources of micro and long noncoding RNAs. Whole-genome re-sequencing analysis indicates that mMoshan elements are highly active, and an insertion into S-haplotype-specific F-box gene was reported to cause the breakdown of self-incompatibility in sour cherry. Taken together, all these results suggest that the mMoshan elements play important roles in regulating gene expression and driving genomic structural variation in Prunus.

  1. A Comprehensive, Ethnically Diverse Library of Sickle Cell Disease-Specific Induced Pluripotent Stem Cells.

    Park, Seonmi; Gianotti-Sommer, Andreia; Molina-Estevez, Francisco Javier; Vanuytsel, Kim; Skvir, Nick; Leung, Amy; Rozelle, Sarah S; Shaikho, Elmutaz Mohammed; Weir, Isabelle; Jiang, Zhihua; Luo, Hong-Yuan; Chui, David H K; Figueiredo, Maria Stella; Alsultan, Abdulraham; Al-Ali, Amein; Sebastiani, Paola; Steinberg, Martin H; Mostoslavsky, Gustavo; Murphy, George J

    2017-04-11

    Sickle cell anemia affects millions of people worldwide and is an emerging global health burden. As part of a large NIH-funded NextGen Consortium, we generated a diverse, comprehensive, and fully characterized library of sickle-cell-disease-specific induced pluripotent stem cells (iPSCs) from patients of different ethnicities, β-globin gene (HBB) haplotypes, and fetal hemoglobin (HbF) levels. iPSCs stand to revolutionize the way we study human development, model disease, and perhaps eventually, treat patients. Here, we describe this unique resource for the study of sickle cell disease, including novel haplotype-specific polymorphisms that affect disease severity, as well as for the development of patient-specific therapeutics for this phenotypically diverse disorder. As a complement to this library, and as proof of principle for future cell- and gene-based therapies, we also designed and employed CRISPR/Cas gene editing tools to correct the sickle hemoglobin (HbS) mutation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  2. Molecular mechanism of the S-RNase-based gametophytic self-incompatibility in fruit trees of Rosaceae.

    Sassa, Hidenori

    2016-01-01

    Self-incompatibility (SI) is a major obstacle for stable fruit production in fruit trees of Rosaceae. SI of Rosaceae is controlled by the S locus on which at least two genes, pistil S and pollen S, are located. The product of the pistil S gene is a polymorphic and extracellular ribonuclease, called S-RNase, while that of the pollen S gene is a protein containing the F-box motif, SFB (S haplotype-specific F-box protein)/SFBB (S locus F-box brothers). Recent studies suggested that SI of Rosaceae includes two different systems, i.e., Prunus of tribe Amygdaleae exhibits a self-recognition system in which its SFB recognizes self-S-RNase, while tribe Pyreae (Pyrus and Malus) shows a non-self-recognition system in which many SFBB proteins are involved in SI, each recognizing subset of non-self-S-RNases. Further biochemical and biological characterization of the S locus genes, as well as other genes required for SI not located at the S locus, will help our understanding of the molecular mechanisms, origin, and evolution of SI of Rosaceae, and may provide the basis for breeding of self-compatible fruit tree cultivars.

  3. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  4. Split tolerance in nude mice transplanted with 2'-deoxyguanosine-treated allogeneic thymus lobes

    Suzuki, G.; Moriyama, T.; Takeuchi, Y.; Kawase, Y.; Habu, S.

    1989-01-01

    To elucidate the acquisition of self tolerance in the thymus, full-allogeneic thymic chimeras were constructed. Athymic C3H and BALB/c nude mice were reconstituted with the thymic lobes of BALB/c and B10.BR fetuses, respectively, that were organ cultured for 5 days in the presence of 2'-deoxyguanosine. T cells in these chimeras were tolerized to the host MHC in both MLR and CTL assays. In contrast, T cells in the chimeras exhibited split tolerance for the thymic MHC haplotype. CTL specific for class I MHC of the thymic haplotype were generated not only from the peripheral T cells of the chimeras but also from thymocytes re-populated in the engrafted thymic lobes. However, T cells in these chimeras responded poorly to the class II MHC of the thymic haplotype in a standard MLR assay. In a syngeneic MLR culture upon stimulation with enriched APC of the thymic haplotype, only 22 to 48% of the responses were mediated by CD4+ cells, and proliferations of CD4- cells were prominent. There were no haplotype-specific suppressor cells detected which would cause the unresponsiveness to the thymic class II MHC. These results indicated that the thymic lobes treated with 2'-deoxyguanosine were defective in the ability to induce the transplantation tolerance for the class I MHC expressed on the thymus, although the same thymic lobes were able to induce the transplantation tolerance for the thymic class II MHC

  5. Characterization of genomic sequence showing strong association with polyembryony among diverse Citrus species and cultivars, and its synteny with Vitis and Populus.

    Nakano, Michiharu; Shimada, Takehiko; Endo, Tomoko; Fujii, Hiroshi; Nesumi, Hirohisa; Kita, Masayuki; Ebina, Masumi; Shimizu, Tokurou; Omura, Mitsuo

    2012-02-01

    Polyembryony, in which multiple somatic nucellar cell-derived embryos develop in addition to the zygotic embryo in a seed, is common in the genus Citrus. Previous genetic studies indicated polyembryony is mainly determined by a single locus, but the underlying molecular mechanism is still unclear. As a step towards identification and characterization of the gene or genes responsible for nucellar embryogenesis in Citrus, haplotype-specific physical maps around the polyembryony locus were constructed. By sequencing three BAC clones aligned on the polyembryony haplotype, a single contiguous draft sequence consisting of 380 kb containing 70 predicted open reading frames (ORFs) was reconstructed. Single nucleotide polymorphism genotypes detected in the sequenced genomic region showed strong association with embryo type in Citrus, indicating a common polyembryony locus is shared among widely diverse Citrus cultivars and species. The arrangement of the predicted ORFs in the characterized genomic region showed high collinearity to the genomic sequence of chromosome 4 of Vitis vinifera and linkage group VI of Populus trichocarpa, suggesting that the syntenic relationship among these species is conserved even though V. vinifera and P. trichocarpa are non-apomictic species. This is the first study to characterize in detail the genomic structure of an apomixis locus determining adventitious embryony. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  6. Haplotype reconstruction error as a classical misclassification problem: introducing sensitivity and specificity as error measures.

    Claudia Lamina

    Full Text Available BACKGROUND: Statistically reconstructing haplotypes from single nucleotide polymorphism (SNP genotypes, can lead to falsely classified haplotypes. This can be an issue when interpreting haplotype association results or when selecting subjects with certain haplotypes for subsequent functional studies. It was our aim to quantify haplotype reconstruction error and to provide tools for it. METHODS AND RESULTS: By numerous simulation scenarios, we systematically investigated several error measures, including discrepancy, error rate, and R(2, and introduced the sensitivity and specificity to this context. We exemplified several measures in the KORA study, a large population-based study from Southern Germany. We find that the specificity is slightly reduced only for common haplotypes, while the sensitivity was decreased for some, but not all rare haplotypes. The overall error rate was generally increasing with increasing number of loci, increasing minor allele frequency of SNPs, decreasing correlation between the alleles and increasing ambiguity. CONCLUSIONS: We conclude that, with the analytical approach presented here, haplotype-specific error measures can be computed to gain insight into the haplotype uncertainty. This method provides the information, if a specific risk haplotype can be expected to be reconstructed with rather no or high misclassification and thus on the magnitude of expected bias in association estimates. We also illustrate that sensitivity and specificity separate two dimensions of the haplotype reconstruction error, which completely describe the misclassification matrix and thus provide the prerequisite for methods accounting for misclassification.

  7. The 3'-untranslated region of the HLA-G gene in relation to pre-eclampsia: revisited

    Larsen, M H; Hylenius, S; Andersen, Anne-Marie Nybo

    2010-01-01

    Abnormal human leukocyte antigen G (HLA-G) expression may be involved in pre-eclampsia. A 14 bp insertion/deletion polymorphism exists in exon 8 of the HLA-G gene. Fetal +14/+14 bp HLA-G genotype may predispose to pre-eclampsia in the mother. Other polymorphisms, besides the 14 bp polymorphism (rs......66554220), in the 3'-untranslated region (3'-UTR) (exon 8) of the HLA-G gene might be associated with severe pre-eclampsia, especially in primiparas. By haplotype-specific polymerase chain reaction amplification and DNA sequence analysis in the offspring from 50 pre-eclamptic cases and 85 controls (35.......008, P(C) = 0.04) were significantly associated with severe pre-eclampsia in primiparas. In conclusion, this study indicates that the +14 bp HLA-G allele defines a nearly unique exon 8 haplotype, and fetuses homozygous for this haplotype [SNP 2995(C)/SNP 3127(G)/SNP 3172(A)/SNP 3181(G)/+14 bp...

  8. Toxicity and Estrogenic Endocrine Disrupting Activity of Phthalates and Their Mixtures

    Xueping Chen

    2014-03-01

    Full Text Available Phthalates, widely used in flexible plastics and consumer products, have become ubiquitous contaminants worldwide. This study evaluated the acute toxicity and estrogenic endocrine disrupting activity of butyl benzyl phthalate (BBP, di(n-butyl phthalate (DBP, bis(2-ethylhexyl phthalate (DEHP, diisodecyl phthalate (DIDP, diisononyl phthalate (DINP, di-n-octyl phthalate (DNOP and their mixtures. Using a 72 h zebrafish embryo toxicity test, the LC50 values of BBP, DBP and a mixture of the six phthalates were found to be 0.72, 0.63 and 0.50 ppm, respectively. The other four phthalates did not cause more than 50% exposed embryo mortality even at their highest soluble concentrations. The typical toxicity symptoms caused by phthalates were death, tail curvature, necrosis, cardio edema and no touch response. Using an estrogen-responsive ChgH-EGFP transgenic medaka (Oryzias melastigma eleutheroembryos based 24 h test, BBP demonstrated estrogenic activity, DBP, DEHP, DINP and the mixture of the six phthalates exhibited enhanced-estrogenic activity and DIDP and DNOP showed no enhanced- or anti-estrogenic activity. These findings highlighted the developmental toxicity of BBP and DBP, and the estrogenic endocrine disrupting activity of BBP, DBP, DEHP and DINP on intact organisms, indicating that the widespread use of these phthalates may cause potential health risks to human beings.

  9. Metabolomics approach reveals metabolic disorders and potential biomarkers associated with the developmental toxicity of tetrabromobisphenol A and tetrachlorobisphenol A

    Ye, Guozhu; Chen, Yajie; Wang, Hong-Ou; Ye, Ting; Lin, Yi; Huang, Qiansheng; Chi, Yulang; Dong, Sijun

    2016-10-01

    Tetrabromobisphenol A and tetrachlorobisphenol A are halogenated bisphenol A (H-BPA), and has raised concerns about their adverse effects on the development of fetuses and infants, however, the molecular mechanisms are unclear, and related metabolomics studies are limited. Accordingly, a metabolomics study based on gas chromatography-mass spectrometry was employed to elucidate the molecular developmental toxicology of H-BPA using the marine medaka (Oryzias melastigmas) embryo model. Here, we revealed decreased synthesis of nucleosides, amino acids and lipids, and disruptions in the TCA (tricarboxylic acid) cycle, glycolysis and lipid metabolism, thus inhibiting the developmental processes of embryos exposed to H-BPA. Unexpectedly, we observed enhanced neural activity accompanied by lactate accumulation and accelerated heart rates due to an increase in dopamine pathway and a decrease in inhibitory neurotransmitters following H-BPA exposure. Notably, disorders of the neural system, and disruptions in glycolysis, the TCA cycle, nucleoside metabolism, lipid metabolism, glutamate and aspartate metabolism induced by H-BPA exposure were heritable. Furthermore, lactate and dopa were identified as potential biomarkers of the developmental toxicity of H-BPA and related genetic effects. This study has demonstrated that the metabolomics approach is a useful tool for obtaining comprehensive and novel insights into the molecular developmental toxicity of environmental pollutants.

  10. An assay of optimal cytochrome c oxidase activity in fish gills.

    Hu, Yau-Chung; Chung, Meng-Han; Lee, Tsung-Han

    2018-07-15

    Cytochrome c oxidase (COX) catalyzes the terminal oxidation reaction in the electron transport chain (ETC) of aerobic respiratory systems. COX activity is an important indicator for the evaluation of energy production by aerobic respiration in various tissues. On the basis of the respiratory characteristics of muscle, we established an optimal method for the measurement of maximal COX activity. To validate the measurement of cytochrome c absorbance, different ionic buffer concentrations and tissue homogenate protein concentrations were used to investigate COX activity. The results showed that optimal COX activity is achieved when using 50-100 μg fish gill homogenate in conjunction with 75-100 mM potassium phosphate buffer. Furthermore, we compared branchial COX activities among three species of euryhaline teleost (Chanos chanos, Oreochromis mossambicus, and Oryzias dancena) to investigate differences in aerobic respiration of osmoregulatory organs. COX activities in the gills of these three euryhaline species were compared with COX subunit 4 (COX4) protein levels. COX4 protein abundance and COX activity patterns in the three species occurring in environments with various salinities increased when fish encountered salinity challenges. This COX activity assay therefore provides an effective and accurate means of assessing aerobic metabolism in fish. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Development of a marine fish model for studying in vivo molecular responses in ecotoxicology

    Kong, R.Y.C.; Giesy, J.P.; Wu, R.S.S.; Chen, E.X.H.; Chiang, M.W.L.; Lim, P.L.; Yuen, B.B.H.; Yip, B.W.P.; Mok, H.O.L.; Au, D.W.T.

    2008-01-01

    A protocol for fixation and processing of whole adult marine medaka (Oryzias melastigma) was developed in parallel with in situ hybridization (ISH) and immunohistochemistry (IHC) for molecular analysis of in vivo gene and protein responses in fish. Over 200 serial sagittal sections (5 μm) can be produced from a single adult medaka to facilitate simultaneous localization and quantification of gene-specific mRNAs and proteins in different tissues and subcellular compartments of a single fish. Stereological analysis (as measured by volume density, V v ) was used to quantify ISH and IHC signals on tissue sections. Using the telomerase reverse transcriptase (omTERT) gene, omTERT and proliferating cell nuclear antigen (PCNA) proteins as examples, we demonstrated that it is possible to localize, quantify and correlate their tissue expression profiles in a whole fish system. Using chronic hypoxia (1.8 ± 0.2 mg O 2 L -1 for 3 months) as an environmental stressor, we were able to identify significant alterations in levels of omTERT mRNA, omTERT protein, PCNA (cell proliferation marker) and TUNEL (apoptosis) in livers of hypoxic O. melastigma (p < 0.05). Overall, the results suggest that O. melastigma can serve as a model marine fish for assessing multiple in vivo molecular responses to stresses in the marine environment

  12. Immune competence assessment in marine medaka (Orzyias melastigma)-a holistic approach for immunotoxicology.

    Ye, Roy R; Peterson, Drew R; Seemann, Frauke; Kitamura, Shin-Ichi; Lee, J S; Lau, Terrance C K; Tsui, Stephen K W; Au, Doris W T

    2017-12-01

    Many anthropogenic pollutants in coastal marine environments can induce immune impairments in wild fish and reduce their survival fitness. There is a pressing need to establish sensitive and high throughput in vivo tools to systematically evaluate the immunosuppressive effects of contaminants in marine teleosts. This study reviewed a battery of in vivo immune function detection technologies established for different biological hierarchies at molecular (immune function pathways and genes by next generation sequencing (NGS)), cellular (leukocytes profiles by flow cytometry), tissues/organ system (whole adult histo-array), and organism (host resistance assays (HRAs)) levels, to assess the immune competence of marine medaka Oryzias melastigma. This approach enables a holistic assessment of fish immune competence under different chemical exposure or environmental scenarios. The data obtained will also be useful to unravel the underlying immunotoxic mechanisms. Intriguingly, NGS analysis of hepatic immune gene expression profiles (male > female) are in support of the bacterial HRA findings, in which infection-induced mortality was consistently higher in females than in males. As such, reproductive stages and gender-specific responses must be taken into consideration when assessing the risk of immunotoxicants in the aquatic environment. The distinct phenotypic sexual dimorphism and short generation time (3 months) of marine medaka offer additional advantages for sex-related immunotoxicological investigation.

  13. Test results on vegetable cultivation using fish breeding water; Yogyosui riyo ni yoru yasai saibai shikenkekka ni tsuite

    Nishida, S. [Hokuriku Electric Power Co. Inc., Toyama (Japan)

    1997-10-30

    Although a part of the entrails of fishes, birds and livestock is used for food, most of them are treated by costly combustion because of their bad odor and looking, and International Environment and Welfare Laboratory, Toyama prefecture in Japan is studying their profitable treatment. As a part of such study, possibility of hydroponic cultivation of vegetable was tested using fish breeding water including excretions of fishes and residual feeds after use of waste as feed, and the growth condition, safety and effectiveness of cultured vegetable were verified. Three-hundred and fifty viviparous Oryzias were released into a breeding water area with no controlled pH and EC (electric conductivity). For comparison a culture solution area of 6.0 in pH and 1.2ms/cm in EC was prepared. The result on cultivation of 6 kinds of vegetable in culture beds supported by circulation of these water showed that hydroponic cultivation of vegetable using fish breeding water is possible, and average growth of 68% is obtained although difference in growth for every vegetable is found. 8 figs., 5 tabs.

  14. Noctuidae moths occurring in grape orchards in Serra Gaúcha, Brazil and their relation to fruit-piercing Mariposas Noctuidae presentes em parreirais na Serra Gaúcha, Brasil e sua relação com a perfuração dos frutos

    Maurício Moraes Zenker

    2010-06-01

    Full Text Available There is no study aiming to investigate if Noctuidae moths are responsible for piercing cultivated fruits in South America. This research aims to survey noctuid moths and list the species with mouth-parts (proboscis morphology that suggest the capacity to cause damages to grape orchards in the state of Rio Grande do Sul, Brazil. Catches were carried out weekly from late November 2007 to late March 2008 (fructification period using light traps and McPhail traps in three grape orchards in the region of Serra Gaúcha. The catches resulted in 187 taxa, with 149 identified at the specific level and 38 at genus level. The proboscises of representative taxa were removed and analyzed under stereomicroscope and scan electron microscope. It was verified that only Oraesia argyrosema (Hampson, 1926 and Gonodonta biarmata Guenée, 1852 show proboscis with suitable morphology for piercing rind and pulp of a grape berry. Achaea ablunaris (Guenée, 1852; Ascalapha odorata (Linnaeus, 1758; Letis mineis Geyer, 1827; Mocis latipes Hübner, 1823; Ophisma tropicalis Guenée, 1852, and Zale exhausta (Guenée, 1852 show proboscis only adapted to lacerate the pulp. The proboscis morphology of the remaining noctuid moths suggests lack of capacity to cause damage. Despite the presence of species capable of piercing grape berries, the populations of such species are very reduced and unable to cause damage of economic level.Na América do Sul inexistem estudos que investiguem se noctuídeos adultos são responsáveis pela perfuração de frutos cultivados. Visando avaliar a ocorrência e listar as espécies que apresentam aparelho bucal (espirotromba com morfologia que sugira a capacidade de causar danos à cultura da uva no Rio Grande do Sul, Brasil, foram realizadas coletas semanais entre o final de novembro de 2007 e o final de março de 2008 (período de frutificação utilizando armadilhas luminosas e McPhail em três áreas de cultivo na Serra Gaúcha. As coletas

  15. Evolutionary plasticity of habenular asymmetry with a conserved efferent connectivity pattern.

    Aldo Villalón

    Full Text Available The vertebrate habenulae (Hb is an evolutionary conserved dorsal diencephalic nuclear complex that relays information from limbic and striatal forebrain regions to the ventral midbrain. One key feature of this bilateral nucleus is the presence of left-right differences in size, cytoarchitecture, connectivity, neurochemistry and/or gene expression. In teleosts, habenular asymmetry has been associated with preferential innervation of left-right habenular efferents into dorso-ventral domains of the midbrain interpeduncular nucleus (IPN. However, the degree of conservation of this trait and its relation to the structural asymmetries of the Hb are currently unknown. To address these questions, we performed the first systematic comparative analysis of structural and connectional asymmetries of the Hb in teleosts. We found striking inter-species variability in the overall shape and cytoarchitecture of the Hb, and in the frequency, strength and to a lesser degree, laterality of habenular volume at the population level. Directional asymmetry of the Hb was either to the left in D. rerio, E. bicolor, O. latipes, P. reticulata, B. splendens, or to the right in F. gardneri females. In contrast, asymmetry was absent in P. scalare and F. gardneri males at the population level, although in these species the Hb displayed volumetric asymmetries at the individual level. Inter-species variability was more pronounced across orders than within a single order, and coexisted with an overall conserved laterotopic representation of left-right habenular efferents into dorso-ventral domains of the IPN. These results suggest that the circuit design involving the Hb of teleosts promotes structural flexibility depending on developmental, cognitive and/or behavioural pressures, without affecting the main midbrain connectivity output, thus unveiling a key conserved role of this connectivity trait in the function of the circuit. We propose that ontogenic plasticity in habenular

  16. A Genome-wide Combinatorial Strategy Dissects Complex Genetic Architecture of Seed Coat Color in Chickpea.

    Bajaj, Deepak; Das, Shouvik; Upadhyaya, Hari D; Ranjan, Rajeev; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C L Laxmipathi; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K; Parida, Swarup K

    2015-01-01

    The study identified 9045 high-quality SNPs employing both genome-wide GBS- and candidate gene-based SNP genotyping assays in 172, including 93 cultivated (desi and kabuli) and 79 wild chickpea accessions. The GWAS in a structured population of 93 sequenced accessions detected 15 major genomic loci exhibiting significant association with seed coat color. Five seed color-associated major genomic loci underlying robust QTLs mapped on a high-density intra-specific genetic linkage map were validated by QTL mapping. The integration of association and QTL mapping with gene haplotype-specific LD mapping and transcript profiling identified novel allelic variants (non-synonymous SNPs) and haplotypes in a MATE secondary transporter gene regulating light/yellow brown and beige seed coat color differentiation in chickpea. The down-regulation and decreased transcript expression of beige seed coat color-associated MATE gene haplotype was correlated with reduced proanthocyanidins accumulation in the mature seed coats of beige than light/yellow brown seed colored desi and kabuli accessions for their coloration/pigmentation. This seed color-regulating MATE gene revealed strong purifying selection pressure primarily in LB/YB seed colored desi and wild Cicer reticulatum accessions compared with the BE seed colored kabuli accessions. The functionally relevant molecular tags identified have potential to decipher the complex transcriptional regulatory gene function of seed coat coloration and for understanding the selective sweep-based seed color trait evolutionary pattern in cultivated and wild accessions during chickpea domestication. The genome-wide integrated approach employed will expedite marker-assisted genetic enhancement for developing cultivars with desirable seed coat color types in chickpea.

  17. MHC class II super-enhancer increases surface expression of HLA-DR and HLA-DQ and affects cytokine production in autoimmune vitiligo.

    Cavalli, Giulio; Hayashi, Masahiro; Jin, Ying; Yorgov, Daniel; Santorico, Stephanie A; Holcomb, Cherie; Rastrou, Melinda; Erlich, Henry; Tengesdal, Isak W; Dagna, Lorenzo; Neff, C Preston; Palmer, Brent E; Spritz, Richard A; Dinarello, Charles A

    2016-02-02

    Genetic risk for autoimmunity in HLA genes is most often attributed to structural specificity resulting in presentation of self-antigens. Autoimmune vitiligo is strongly associated with the MHC class II region. Here, we fine-map vitiligo MHC class II genetic risk to three SNPs only 47 bp apart, located within a predicted super-enhancer in an intergenic region between HLA-DRB1 and HLA-DQA1, localized by a genome-wide association study of 2,853 Caucasian vitiligo patients. The super-enhancer corresponds to an expression quantitative trait locus for expression of HLA-DR and HLA-DQ RNA; we observed elevated surface expression of HLA-DR (P = 0.008) and HLA-DQ (P = 0.02) on monocytes from healthy subjects homozygous for the high-risk SNP haplotype. Unexpectedly, pathogen-stimulated peripheral blood mononuclear cells from subjects homozygous for the high-risk super-enhancer haplotype exhibited greater increase in production of IFN-γ and IL-1β than cells from subjects homozygous for the low-risk haplotype. Specifically, production of IFN-γ on stimulation of dectin-1, mannose, and Toll-like receptors with Candida albicans and Staphylococcus epidermidis was 2.5- and 2.9-fold higher in high-risk subjects than in low-risk subjects, respectively (P = 0.007 and P = 0.01). Similarly, production of IL-1β was fivefold higher in high-risk subjects than in low-risk subjects (P = 0.02). Increased production of immunostimulatory cytokines in subjects carrying the high-risk haplotype may act as an "adjuvant" during the presentation of autoantigens, tying together genetic variation in the MHC with the development of autoimmunity. This study demonstrates that for risk of autoimmune vitiligo, expression level of HLA class II molecules is as or more important than antigen specificity.

  18. Association of vitamin D receptor gene polymorphisms with polycystic ovary syndrome among Indian women

    Shilpi Dasgupta

    2015-01-01

    Full Text Available Background & objectives: The Vitamin-D receptor (VDR regulates vitamin D levels and calcium metabolism in the body and these are known to be associated with endocrine dysfunctions, insulin resistance and type-2 diabetes in polycystic ovarian syndrome (PCOS. Studies on VDR polymorphisms among PCOS women are sparse. We undertook this study to investigate the association pattern of VDR polymorphisms (Cdx2, Fok1, Apa1 and Taq1 with PCOS among Indian women. Methods: For the present study, 250 women with PCOS and 250 normal healthy control women were selected from Hyderabad city, Telangana, India. The four VDR polymorphisms were genotyped and analysed using ASM-PCR (allele specific multiple PCR and PCR-RFLP (restriction fragment length polymorphism. Results: The genotype and allele frequency distributions of only Cdx2 showed significant difference between the PCOS cases and control women, indicating protective role of this SNP against PCOS phenotype. However, significant association was observed between VDR genotypes and some of the PCOS specific clinical/biochemical traits. For example, Fok1 showed a significant genotypic difference for the presence of infertility and Cdx2 genotpes showed association with testosterone levels. Further, the two haplotypes, ACCA and ACTA, were found to be significantly associated with PCOS indicating haplotype specific risk. Interpretation & conclusions: Although VDR polymorphisms have not shown significant association with PCOS, in view of functional significance of the SNPs considered, one cannot yet rule out the possibility of their association with PCOS. Further, specifically designed studies on large cohorts are required to conclusively establish the role of VDR polymorphisms in PCOS, particularly including data on vitamin D levels.

  19. A common polymorphism in the promoter region of the TNFSF4 gene is associated with lower allele-specific expression and risk of myocardial infarction.

    Massimiliano Ria

    Full Text Available BACKGROUND: The TNFSF4/TNFRSF4 system, along with several other receptor-ligand pairs, is involved in the recruitment and activation of T-cells and is therefore tentatively implicated in atherosclerosis and acute coronary syndromes. We have previously shown that genetic variants in TNFSF4 are associated with myocardial infarction (MI in women. This prompted functional studies of TNFSF4 expression. METHODS AND RESULTS: Based on a screening of the TNFSF4 genomic region, a promoter polymorphism (rs45454293 and a haplotype were identified, conceivably involved in gene regulation. The rs45454293T-allele, in agreement with the linked rs3850641G-allele, proved to be associated with increased risk of MI in women. Haplotype-specific chromatin immunoprecipitation of activated polymerase II, as a measure of transcriptional activity in vivo, suggested that the haplotype including the rs45454293 and rs3850641 polymorphisms is functionally important, the rs45454293T- and rs3850641G-alleles being associated with lower transcriptional activity in cells heterozygous for both polymorphisms. The functional role of rs45454293 on transcriptional levels of TNFSF4 was clarified by luciferase reporter assays, where the rs45454293T-allele decreased gene expression when compared with the rs45454293C-allele, while the rs3850641 SNP did not have any effect on TNFSF4 promoter activity. Electromobility shift assay showed that the rs45454293 polymorphism, but not rs3850641, affects the binding of nuclear factors, thus suggesting that the lower transcriptional activity is attributed to binding of one or more transcriptional repressor(s to the T-allele. CONCLUSIONS: Our data indicate that the TNFSF4 rs45454293T-allele is associated with lower TNFSF4 expression and increased risk of MI.

  20. Isolation and characterization of multiple F-box genes linked to the S9- and S10-RNase in apple (Malus × domestica Borkh.).

    Okada, Kazuma; Moriya, Shigeki; Haji, Takashi; Abe, Kazuyuki

    2013-06-01

    Using 11 consensus primer pairs designed from S-linked F-box genes of apple and Japanese pear, 10 new F-box genes (MdFBX21 to 30) were isolated from the apple cultivar 'Spartan' (S(9)S(10)). MdFBX21 to 23 and MdFBX24 to 30 were completely linked to the S(9) -RNase and S(10-)RNase, respectively, and showed pollen-specific expression and S-haplotype-specific polymorphisms. Therefore, these 10 F-box genes are good candidates for the pollen determinant of self-incompatibility in apple. Phylogenetic analysis and comparison of deduced amino acid sequences of MdFBX21 to 30 with those of 25 S-linked F-box genes previously isolated from apple showed that a deduced amino acid identity of greater than 88.0 % can be used as the tentative criterion to classify F-box genes into one type. Using this criterion, 31 of 35 F-box genes of apple were classified into 11 types (SFBB1-11). All types included F-box genes derived from S(3-) and S(9-)haplotypes, and seven types included F-box genes derived from S(3-), S(9-), and S(10-)haplotypes. Moreover, comparison of nucleotide sequences of S-RNases and multiple F-box genes among S(3-), S(9-), and S(10-)haplotypes suggested that F-box genes within each type showed high nucleotide identity regardless of the identity of the S-RNase. The large number of F-box genes as candidates for the pollen determinant and the high degree of conservation within each type are consistent with the collaborative non-self-recognition model reported for Petunia. These findings support that the collaborative non-self-recognition system also exists in apple.

  1. Identification of functional DNA variants in the constitutive promoter region of MDM2

    Lalonde Marie-Eve

    2012-09-01

    Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

  2. Association of vitamin D receptor gene polymorphisms with polycystic ovary syndrome among Indian women

    Dasgupta, Shilpi; Dutta, Joyita; Annamaneni, Sandhya; Kudugunti, Neelaveni; Battini, Mohan Reddy

    2015-01-01

    Background & objectives: The Vitamin-D receptor (VDR) regulates vitamin D levels and calcium metabolism in the body and these are known to be associated with endocrine dysfunctions, insulin resistance and type-2 diabetes in polycystic ovarian syndrome (PCOS). Studies on VDR polymorphisms among PCOS women are sparse. We undertook this study to investigate the association pattern of VDR polymorphisms (Cdx2, Fok1, Apa1 and Taq1) with PCOS among Indian women. Methods: For the present study, 250 women with PCOS and 250 normal healthy control women were selected from Hyderabad city, Telangana, India. The four VDR polymorphisms were genotyped and analysed using ASM-PCR (allele specific multiple PCR) and PCR-RFLP (restriction fragment length polymorphism). Results: The genotype and allele frequency distributions of only Cdx2 showed significant difference between the PCOS cases and control women, indicating protective role of this SNP against PCOS phenotype. However, significant association was observed between VDR genotypes and some of the PCOS specific clinical/biochemical traits. For example, Fok1 showed a significant genotypic difference for the presence of infertility and Cdx2 genotpes showed association with testosterone levels. Further, the two haplotypes, ACCA and ACTA, were found to be significantly associated with PCOS indicating haplotype specific risk. Interpretation & conclusions: Although VDR polymorphisms have not shown significant association with PCOS, in view of functional significance of the SNPs considered, one cannot yet rule out the possibility of their association with PCOS. Further, specifically designed studies on large cohorts are required to conclusively establish the role of VDR polymorphisms in PCOS, particularly including data on vitamin D levels. PMID:26458343

  3. Genetic and molecular characterization of three novel S-haplotypes in sour cherry (Prunus cerasus L.).

    Tsukamoto, Tatsuya; Potter, Daniel; Tao, Ryutaro; Vieira, Cristina P; Vieira, Jorge; Iezzoni, Amy F

    2008-01-01

    Tetraploid sour cherry (Prunus cerasus L.) exhibits gametophytic self-incompatibility (GSI) whereby the specificity of self-pollen rejection is controlled by alleles of the stylar and pollen specificity genes, S-RNase and SFB (S haplotype-specific F-box protein gene), respectively. As sour cherry selections can be either self-compatible (SC) or self-incompatible (SI), polyploidy per se does not result in SC. Instead the genotype-dependent loss of SI in sour cherry is due to the accumulation of non-functional S-haplotypes. The presence of two or more non-functional S-haplotypes within sour cherry 2x pollen renders that pollen SC. Two new S-haplotypes from sour cherry, S(33) and S(34), that are presumed to be contributed by the P. fruticosa species parent, the complete S-RNase and SFB sequences of a third S-haplotype, S(35), plus the presence of two previously identified sweet cherry S-haplotypes, S(14) and S(16) are described here. Genetic segregation data demonstrated that the S(16)-, S(33)-, S(34)-, and S(35)-haplotypes present in sour cherry are fully functional. This result is consistent with our previous finding that 'hetero-allelic' pollen is incompatible in sour cherry. Phylogenetic analyses of the SFB and S-RNase sequences from available Prunus species reveal that the relationships among S-haplotypes show no correspondence to known organismal relationships at any taxonomic level within Prunus, indicating that polymorphisms at the S-locus have been maintained throughout the evolution of the genus. Furthermore, the phylogenetic relationships among SFB sequences are generally incongruent with those among S-RNase sequences for the same S-haplotypes. Hypotheses compatible with these results are discussed.

  4. A Near-Complete Haplotype-Phased Genome of the Dikaryotic Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici Reveals High Interhaplotype Diversity

    Benjamin Schwessinger

    2018-02-01

    Full Text Available A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N50 of 1.5 Mb and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales. In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies.

  5. Association and linkage analysis of aluminum tolerance genes in maize.

    Allison M Krill

    Full Text Available BACKGROUND: Aluminum (Al toxicity is a major worldwide constraint to crop productivity on acidic soils. Al becomes soluble at low pH, inhibiting root growth and severely reducing yields. Maize is an important staple food and commodity crop in acidic soil regions, especially in South America and Africa where these soils are very common. Al exclusion and intracellular tolerance have been suggested as two important mechanisms for Al tolerance in maize, but little is known about the underlying genetics. METHODOLOGY: An association panel of 282 diverse maize inbred lines and three F2 linkage populations with approximately 200 individuals each were used to study genetic variation in this complex trait. Al tolerance was measured as net root growth in nutrient solution under Al stress, which exhibited a wide range of variation between lines. Comparative and physiological genomics-based approaches were used to select 21 candidate genes for evaluation by association analysis. CONCLUSIONS: Six candidate genes had significant results from association analysis, but only four were confirmed by linkage analysis as putatively contributing to Al tolerance: Zea mays AltSB like (ZmASL, Zea mays aluminum-activated malate transporter2 (ALMT2, S-adenosyl-L-homocysteinase (SAHH, and Malic Enzyme (ME. These four candidate genes are high priority subjects for follow-up biochemical and physiological studies on the mechanisms of Al tolerance in maize. Immediately, elite haplotype-specific molecular markers can be developed for these four genes and used for efficient marker-assisted selection of superior alleles in Al tolerance maize breeding programs.

  6. MHC variability in heritage breeds of chickens.

    Fulton, J E; Lund, A R; McCarron, A M; Pinegar, K N; Korver, D R; Classen, H L; Aggrey, S; Utterbach, C; Anthony, N B; Berres, M E

    2016-02-01

    The chicken Major Histocompatibility Complex (MHC) is very strongly associated with disease resistance and thus is a very important region of the chicken genome. Historically, MHC (B locus) has been identified by the use of serology with haplotype specific alloantisera. These antisera can be difficult to produce and frequently cross-react with multiple haplotypes and hence their application is generally limited to inbred and MHC-defined lines. As a consequence, very little information about MHC variability in heritage chicken breeds is available. DNA-based methods are now available for examining MHC variability in these previously uncharacterized populations. A high density SNP panel consisting of 101 SNP that span a 230,000 bp region of the chicken MHC was used to examine MHC variability in 17 heritage populations of chickens from five universities from Canada and the United States. The breeds included 6 heritage broiler lines, 3 Barred Plymouth Rock, 2 New Hampshire and one each of Rhode Island Red, Light Sussex, White Leghorn, Dark Brown Leghorn, and 2 synthetic lines. These heritage breeds contained from one to 11 haplotypes per line. A total of 52 unique MHC haplotypes were found with only 10 of them identical to serologically defined haplotypes. Furthermore, nine MHC recombinants with their respective parental haplotypes were identified. This survey confirms the value of these non-commercially utilized lines in maintaining genetic diversity. The identification of multiple MHC haplotypes and novel MHC recombinants indicates that diversity is being generated and maintained within these heritage populations. © 2016 Poultry Science Association Inc.

  7. Duplication of the dystroglycan gene in most branches of teleost fish

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  8. STK15 polymorphisms and association with risk of invasive ovarian cancer.

    Dicioccio, Richard A; Song, Honglin; Waterfall, Christy; Kimura, Makoto T; Nagase, Hiroki; McGuire, Valerie; Hogdall, Estrid; Shah, Mitul N; Luben, Robert N; Easton, Douglas F; Jacobs, Ian J; Ponder, Bruce A J; Whittemore, Alice S; Gayther, Simon A; Pharoah, Paul D P; Kruger-Kjaer, Susan

    2004-10-01

    STK15 is a putative oncogene that codes for a centrosome-associated, serine/threonine kinase, the normal function of which is to ensure accurate segregation of chromosomes during mitosis. Amplification of STK15 has been reported in ovarian tumors, suggesting a role in ovarian cancer pathology. STK15 is polymorphic with two single nucleotide substitutions (449t/a and 527g/a) in evolutionarily conserved regions causing amino acid changes (F31I and V57I). Two other nucleotide substitutions (287c/g and 1891g/c) of unknown significance are in 5' and 3' untranslated regions (UTR), respectively. To learn more about the involvement of STK15 in ovarian cancer, we genotyped and haplotyped these polymorphisms in three population-based ovarian cancer case-control studies from the United Kingdom, United States, and Denmark with 1,821 combined cases and 2,467 combined controls and calculated risks for developing ovarian cancer. Genotypes of individual polymorphisms in control groups of the United Kingdom, United States, and Denmark conformed to Hardy-Weinberg equilibrium. In combined cases and combined controls, rare allele frequencies were 0.23 and 0.21 for I31, 0.16 and 0.17 for I57, 0.08 and 0.07 for 5' UTR g, and 0.25 and 0.24 for 3' UTR c, respectively. Using FF common homozygotes of F31I as comparator, there was increased ovarian cancer risk to FI heterozygotes (odds ratio, 1.18; 95% confidence interval, 1.01-1.36), II homozygotes (odds ratio, 1.25; 95% confidence interval, 0.89-1.75), and I31 allele carriers (odds ratio, 1.17; 95% confidence interval, 1.02-1.35) in the combined group data. For either V57I, 5' UTR C/G, or 3' UTR G/C, all genotypic ovarian cancer risks were essentially in unity relative to their respective common homozygotes, VV, cc, or gg. Haplotype analysis of combined group data revealed seven haplotypes with frequencies between 0.02 and 0.5, with c-F-V-g the most common. None of the haplotype-specific risks significantly differed from unity relative to

  9. Broadly reactive antibodies specific for Plasmodium falciparum MSP-119 are associated with the protection of naturally exposed children against infection

    Dent Arlene E

    2012-08-01

    Full Text Available Abstract Background The 19 kDa C-terminal region of Plasmodium falciparum Merozoite Surface Protein-1 is a known target of naturally acquired humoral immunity and a malaria vaccine candidate. MSP-119 has four predominant haplotypes resulting in amino acid changes labelled EKNG, QKNG, QTSR and ETSR. IgG antibodies directed against all four variants have been detected, but it is not known if these variant specific antibodies are associated with haplotype-specific protection from infection. Methods Blood samples from 201 healthy Kenyan adults and children who participated in a 12-week treatment time-to-infection study were evaluated. Venous blood drawn at baseline (week 0 was examined for functional and serologic antibodies to MSP-119 and MSP-142 variants. MSP-119 haplotypes were detected by a multiplex PCR assay at baseline and weekly throughout the study. Generalized linear models controlling for age, baseline MSP-119 haplotype and parasite density were used to determine the relationship between infecting P. falciparum MSP-119 haplotype and variant-specific antibodies. Results A total of 964 infections resulting in 1,533 MSP-119 haplotypes detected were examined. The most common haplotypes were EKNG and QKNG, followed by ETSR and QTSR. Children had higher parasite densities, greater complexity of infection (>1 haplotype, and more frequent changes in haplotypes over time compared to adults. Infecting MSP-119 haplotype at baseline (week 0 had no influence on haplotypes detected over the subsequent 11 weeks among children or adults. Children but not adults with MSP-119 and some MSP-142 variant antibodies detected by serology at baseline had delayed time-to-infection. There was no significant association of variant-specific serology or functional antibodies at baseline with infecting haplotype at baseline or during 11 weeks of follow up among children or adults. Conclusions Variant transcending IgG antibodies to MSP-119 are associated with protection

  10. Common ADRB2 haplotypes derived from 26 polymorphic sites direct beta2-adrenergic receptor expression and regulation phenotypes.

    Alfredo Panebra

    2010-07-01

    Full Text Available The beta2-adrenergic receptor (beta2AR is expressed on numerous cell-types including airway smooth muscle cells and cardiomyocytes. Drugs (agonists or antagonists acting at these receptors for treatment of asthma, chronic obstructive pulmonary disease, and heart failure show substantial interindividual variability in response. The ADRB2 gene is polymorphic in noncoding and coding regions, but virtually all ADRB2 association studies have utilized the two common nonsynonymous coding SNPs, often reaching discrepant conclusions.We constructed the 8 common ADRB2 haplotypes derived from 26 polymorphisms in the promoter, 5'UTR, coding, and 3'UTR of the intronless ADRB2 gene. These were cloned into an expression construct lacking a vector-based promoter, so that beta2AR expression was driven by its promoter, and steady state expression could be modified by polymorphisms throughout ADRB2 within a haplotype. "Whole-gene" transfections were performed with COS-7 cells and revealed 4 haplotypes with increased cell surface beta2AR protein expression compared to the others. Agonist-promoted downregulation of beta2AR protein expression was also haplotype-dependent, and was found to be increased for 2 haplotypes. A phylogenetic tree of the haplotypes was derived and annotated by cellular phenotypes, revealing a pattern potentially driven by expression.Thus for obstructive lung disease, the initial bronchodilator response from intermittent administration of beta-agonist may be influenced by certain beta2AR haplotypes (expression phenotypes, while other haplotypes may influence tachyphylaxis during the response to chronic therapy (downregulation phenotypes. An ideal clinical outcome of high expression and less downregulation was found for two haplotypes. Haplotypes may also affect heart failure antagonist therapy, where beta2AR increase inotropy and are anti-apoptotic. The haplotype-specific expression and regulation phenotypes found in this transfection

  11. SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

    Onkar Singh

    Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

  12. Assessment of Markers of Antimalarial Drug Resistance in Plasmodium falciparum Isolates from Pregnant Women in Lagos, Nigeria.

    Chimere Obiora Agomo

    Full Text Available The use of antimalarial drugs for prevention and treatment is a major strategy in the prevention of malaria in pregnancy. Although sulphadoxine-pyrimethamine (SP is currently recommended for intermittent preventive treatment of malaria during pregnancy in Nigeria, previously used drugs for prophylaxis such as chloroquine (CQ and pyrimethamine are accessible as they are purchased over the counter. This study describes the markers of absence or presence of resistance to quinoline (Pfcrt and Pfmdr 1 and type 1 antifolate antimalarial medicines (Pfdhfr.Plasmodium falciparum-positive dried blood spots from pregnant women attending antenatal clinics for the first time during current pregnancy were investigated for the presence of mutations at codons 72-76 of Plasmodium falciparum chloroquine resistance transporter (Pfcrt gene by real time polymerase chain reaction (PCR using haplotype-specific probes. PCR followed by sequence analysis was used to identify mutations at codons 86, 184, 1034, 1042 and 1246 of P. falciparum multi-drug resistance-1 (Pfmdr1 gene; and codons 16, 50, 51, 59, 108, 140 and 164 of Pfdhfr gene.Two haplotypes of Pfcrt (n = 54 were observed: CVMNK 13(24.2% and CVIET 41 (75.9% of the samples. The SVMNT haplotype was absent in this population. The Pfmdr1 (n = 28 haplotypes were NYSND 15(53.6%, YYSND 5(17.9%, NFSND 6(21.4% and YFSND 2(7.1%. The Pfdhfr (n = 15 were ACNCSVI 4(26.7%, and ACICNSVI 1(6.7% and ACIRNVI 10 (66.7%. The rate of occurrence of Pfcrt 76T, Pfdhfr108N, Pfmdr186Y and 184F were 75.9%, 73.3%, 25% and 28.1% respectively. The Pfmdr1 86Y was associated with low parasitaemia (median = 71 parasites/μl, P = 0.024 while Pfcrt 76T was associated with young maternal age (mean 24.1 ± 4.5 years; P = 0.006. The median parasitaemia were similar (P>0.05 in wild and mutant strains of Pfcrt 76, Pfmdr1 184 and Pfdhfr 108. There was no association between gravidity or gestational age of the women and presence of mutations in the Pfcrt

  13. Phytoestrogen bakuchiol exhibits in vitro and in vivo anti-breast cancer effects by inducing S phase arrest and apoptosis

    Li eLi

    2016-05-01

    Full Text Available Phytoestrogen has been proposed as an alternative to hormone replacement therapy, which has been demonstrated to promote a high risk of breast cancer. However, the effect of phytoestrogen on breast cancer development has not been fully understood. Bakuchiol is an active ingredient of a traditional Chinese herbal medicine Fructus Psoraleae, the dried ripe fruit of Psoralea corylifolia L. (Fabaceae. The in vitro and in vivo estrogenic activities and anti-breast cancer effects of bakuchiol have not been well studied. We found that bakuchiol induced the GFP expression in transgenic medaka (Oryzias melastigma, Tg, Chg:GFP dose-dependently (0-1 µg/ml, demonstrating its in vivo estrogenic activity. Low dose of bakuchiol (1 µg/ml induced the cell proliferation and ERα expression in MCF-7 cells, which could be blocked by the antiestrogen ICI 182780, suggesting the in vitro estrogenic activity of bakuchiol. Our data indicated that high doses of bakuchiol (>2 µg/ml inhibited breast cancer cell growth, with a stronger antiproliferative effect than resveratrol, a widely studied analogue of bakuchiol. High doses of bakuchiol (4 µg/ml, 7 µg/ml and 10 µg/ml were used for the further in vitro anti-breast cancer studies. Bakuchiol induced ERβ expression and suppressed ERα expression in MCF-7 cells. It also induced S phase arrest in both MCF-7 and MDA-MB-231 cells, which could be rescued by caffeine. Knock-down of p21 also marginally rescued S phase arrest in MCF-7 cells. The S phase arrest was accompanied by the upregulation of ATM, P-Cdc2 (Tyr15, Myt1, P-Wee1 (Ser642, p21 and Cyclin B1, suggesting that blocking of Cdc2 activation may play an important role in bakuchiol-induced S phase arrest. Furthermore, bakuchiol induced cell apoptosis and disturbed mitochondrial membrane potential in MCF-7 cells. The bakuchiol-induced apoptosis was associated with increased expression of Caspase family and Bcl-2 family proteins, suggesting that bakuchiol may induce

  14. An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

    Ephrem Mekonnen

    with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC" explaining the overall association (haplotype-specific-p = 0.000103. Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496 but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

  15. Interpretación fitosociológica de la vegetación de las lomas del desierto peruano

    Antonio Galán de Mera

    2011-06-01

    lomas” constitutes the main originality of the Peruvian and Chilean desert with a high number of endemics that shapes the vicarious associations. in this work, a phytosociological view of sandy environments of the Peruvian coastal desert is presented. According to the Braun-Blanquet method, we have made up 32 phytosociological inventories and added 138 ones from others authors. in each inventory, we have analyzed its floristic composition and ecological parameters, as altitude, soil and geomorphology. All releves were synthesized in a table to deduce the different associations, higher phytosociological units, and the distribution of its flora along the Peruvian coast and the Andean Cordillera. Using the Shannon-Wiener diversity index, the diversity of this flora is discussed making a comparison with historical data about the use of the territory with livestock during pre-inca and inca cultures, and Spanish invasion. As a result, two associations from Southern Peru -Nolanetum scaposo-spathulatae and Palauetum camanensis-weberbaueri-, two alliances -Nolanion humifusae from central Peru, and Nolanion spathulatae from the Southern Peru- and a new order -Tetragonio crystallinae- Plantaginetalia limensis- are described. In Nolanetum scaposo-spathulatae, Dictyophragnus englerianus, Leptoglossis lomana, Nolana scaposa, N. spathulata, Palaua velutina and Tetragonia vestita are the main characteristics, while in Palauetum camanensis-weberbaueri association N. scaposa and P. velutina are replaced by Palaua camanensis and P. weberbaueri. Nolanion humifusae alliance integrates species as Geranium limae, Hymenocallis amancaes, Nolana humifusa, N. latipes, Palaua rhombifolia or Villanova oppositifolia. Likewise, Cistanthe weberbaueri, Cryptantha parviflora, Hoffmannseggia miranda, Lupinus mollendoensis, Nolana confinis, N. pallidula, N. scaposa, N. spathulata, Palaua camanensis, P. velutina, P. weberbaueri, Tetragonia vestita and Weberbauerella brongniartioides are the characteristic species of