WorldWideScience

Sample records for optimizing taq polymerase

  1. Optimizing Taq polymerase concentration for improved signal-to-noise in the broad range detection of low abundance bacteria.

    Rudolph Spangler

    Full Text Available BACKGROUND: PCR in principle can detect a single target molecule in a reaction mixture. Contaminating bacterial DNA in reagents creates a practical limit on the use of PCR to detect dilute bacterial DNA in environmental or public health samples. The most pernicious source of contamination is microbial DNA in DNA polymerase preparations. Importantly, all commercial Taq polymerase preparations inevitably contain contaminating microbial DNA. Removal of DNA from an enzyme preparation is problematical. METHODOLOGY/PRINCIPAL FINDINGS: This report demonstrates that the background of contaminating DNA detected by quantitative PCR with broad host range primers can be decreased greater than 10-fold through the simple expedient of Taq enzyme dilution, without altering detection of target microbes in samples. The general method is: For any thermostable polymerase used for high-sensitivity detection, do a dilution series of the polymerase crossed with a dilution series of DNA or bacteria that work well with the test primers. For further work use the concentration of polymerase that gave the least signal in its negative control (H(2O while also not changing the threshold cycle for dilutions of spiked DNA or bacteria compared to higher concentrations of Taq polymerase. CONCLUSIONS/SIGNIFICANCE: It is clear from the studies shown in this report that a straightforward procedure of optimizing the Taq polymerase concentration achieved "treatment-free" attenuation of interference by contaminating bacterial DNA in Taq polymerase preparations. This procedure should facilitate detection and quantification with broad host range primers of a small number of bona fide bacteria (as few as one in a sample.

  2. Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.

    2003-01-01

    Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...

  3. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  4. Purification and Characterization of Taq Polymerase: A 9-Week Biochemistry Laboratory Project for Undergraduate Students

    Bellin, Robert M.; Bruno, Mary K.; Farrow, Melissa A.

    2010-01-01

    We have developed a 9-week undergraduate laboratory series focused on the purification and characterization of "Thermus aquaticus" DNA polymerase (Taq). Our aim was to provide undergraduate biochemistry students with a full-semester continuing project simulating a research-like experience, while having each week's procedure focus on a single…

  5. Real-time TaqMan polymerase chain reaction to quantify the effects ...

    TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...

  6. Data of self-made Taq DNA polymerase prepared for screening purposes

    E.V. Konovalova

    2017-04-01

    Full Text Available DNA analysis is a key procedure in genetic engineering. Nowadays the analysis is often done by PCR with Taq DNA polymerase. Although the last enzyme price is quite low, demand for numerous analyses results in much money expenditure which are not affordable for many laboratories. In a meanwhile, many screening tasks do not require the highly purified enzyme. Taking into account the enzyme unique properties it makes possible to marginally simplify its production without resorting to costly or lengthy techniques such as column chromatography and/or dialysis. Here the data of routine usage of Taq DNA polymerase prepared according to the protocol developed in our laboratory is presented. The protocol takes only several hours to realize and does not need qualified personnel or expensive equipment. Yet it gives the enzyme preparation suitable for most screening purposes. The isolated Taq DNA polymerase stock can be stored as ammonium sulfate suspension in a refrigerator for prolonged period, not less than 6 months. The working enzyme solution is prepared from the stock suspension on demand, not more than once in a month and can be stored also in a refrigerator.

  7. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

    2001-08-15

    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  8. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  9. Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

    Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2010-06-01

    Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

  10. Real-time PCR-based genotyping from whole blood using Taq DNA polymerase and a buffer supplemented with 1,2-propanediol and trehalose

    Utekal, Pavol; Kocanda, Lukáš; Matoušek, P.; Wagner, P.; Bugajev, Viktor; Dráber, Petr

    2015-01-01

    Roč. 416, January (2015), s. 178-182 ISSN 0022-1759 R&D Projects: GA ČR(CZ) GBP302/12/G101; GA MPO FR-TI3/067; GA ČR(CZ) GA14-09807S; GA ČR(CZ) GA14-00703S Institutional support: RVO:68378050 Keywords : 1,2-Propanediol * real-time PCR * SYBR Green I * Taq DNA polymerase * trehalose * Unseparated blood Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.858, year: 2015

  11. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    Lorenz, Todd C

    2012-05-22

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  12. Compartmentalized self-replication under fast PCR cycling conditions yields Taq DNA polymerase mutants with increased DNA-binding affinity and blood resistance.

    Arezi, Bahram; McKinney, Nancy; Hansen, Connie; Cayouette, Michelle; Fox, Jeffrey; Chen, Keith; Lapira, Jennifer; Hamilton, Sarah; Hogrefe, Holly

    2014-01-01

    Faster-cycling PCR formulations, protocols, and instruments have been developed to address the need for increased throughput and shorter turn-around times for PCR-based assays. Although run times can be cut by up to 50%, shorter cycle times have been correlated with lower detection sensitivity and increased variability. To address these concerns, we applied Compartmentalized Self Replication (CSR) to evolve faster-cycling mutants of Taq DNA polymerase. After five rounds of selection using progressively shorter PCR extension times, individual mutations identified in the fastest-cycling clones were randomly combined using ligation-based multi-site mutagenesis. The best-performing combinatorial mutants exhibit 35- to 90-fold higher affinity (lower Kd ) for primed template and a moderate (2-fold) increase in extension rate compared to wild-type Taq. Further characterization revealed that CSR-selected mutations provide increased resistance to inhibitors, and most notably, enable direct amplification from up to 65% whole blood. We discuss the contribution of individual mutations to fast-cycling and blood-resistant phenotypes.

  13. TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget.

    Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub

    2016-01-01

    This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.

  14. Designing a time-effective TaqMan probe-based real-time polymerase chain reaction protocol for the identification of Yersinia enterocolitica in raw pork meat

    Milena Alicja Stachelska

    2017-01-01

    Full Text Available The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detect Yersinia enterocolitica strains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg of Yersinia enterocolitica in pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenic Yersinia enterocolitica strains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.

  15. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

    2017-05-17

    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  16. Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide

    Yuexia Wang

    2015-09-01

    Full Text Available Real-time polymerase chain reaction (PCR allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at −18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 103 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 100 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach.

  17. TaqMan real-time polymerase chain reaction for detection of Ophidiomyces ophiodiicola, the fungus associated with snake fungal disease.

    Bohuski, Elizabeth; Lorch, Jeffrey M; Griffin, Kathryn M; Blehert, David S

    2015-04-15

    Fungal skin infections associated with Ophidiomyces ophiodiicola, a member of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex, have been linked to an increasing number of cases of snake fungal disease (SFD) in captive snakes around the world and in wild snake populations in eastern North America. The emergence of SFD in both captive and wild situations has led to an increased need for tools to better diagnose and study the disease. We developed two TaqMan real-time polymerase chain reaction (PCR) assays to rapidly detect O. ophiodiicola in clinical samples. One assay targets the internal transcribed spacer region (ITS) of the fungal genome while the other targets the more variable intergenic spacer region (IGS). The PCR assays were qualified using skin samples collected from 50 snakes for which O. ophiodiicola had been previously detected by culture, 20 snakes with gross skin lesions suggestive of SFD but which were culture-negative for O. ophiodiicola, and 16 snakes with no clinical signs of infection. Both assays performed equivalently and proved to be more sensitive than traditional culture methods, detecting O. ophiodiicola in 98% of the culture-positive samples and in 40% of the culture-negative snakes that had clinical signs of SFD. In addition, the assays did not cross-react with a panel of 28 fungal species that are closely related to O. ophiodiicola or that commonly occur on the skin of snakes. The assays did, however, indicate that some asymptomatic snakes (~6%) may harbor low levels of the fungus, and that PCR should be paired with histology when a definitive diagnosis is required. These assays represent the first published methods to detect O. ophiodiicola by real-time PCR. The ITS assay has great utility for assisting with SFD diagnoses whereas the IGS assay offers a valuable tool for research-based applications.

  18. Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide.

    Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao

    2015-09-01

    Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3  CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0  CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.

  19. Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

    Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

    2013-07-01

    Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

  20. Bat white-nose syndrome: A real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructans

    Laura K Muller; Jeffrey M. Lorch; Daniel L. Lindner; Michael O' Connor; Andrea Gargas; David S. Blehert

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The...

  1. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

    Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

  2. Polymerase study: Improved detection of Salmonella and Campylobacter through the optimized use of DNA polymerases in diagnostic real-time PCR

    Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer

    DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...

  3. MeltMan: Optimization, Evaluation, and Universal Application of a qPCR System Integrating the TaqMan qPCR and Melting Analysis into a Single Assay

    Nagy, Alexander; Černíková, Lenka; Vitásková, Eliška; Křivda, Vlastimil; Dán, Ádám; Dirbáková, Zuzana; Jiřincová, Helena; Procházka, Bohumír; Sedlák, Kamil; Havlíčková, Martina

    2016-01-01

    In the present work, we optimised and evaluated a qPCR system integrating 6-FAM (6-carboxyfluorescein)-labelled TaqMan probes and melting analysis using the SYTO 82 (S82) DNA binding dye in a single reaction. We investigated the influence of the S82 on various TaqMan and melting analysis parameters and defined its optimal concentration. In the next step, the method was evaluated in 36 different TaqMan assays with a total of 729 paired reactions using various DNA and RNA templates, including field specimens. In addition, the melting profiles of interest were correlated with the electrophoretic patterns. We proved that the S82 is fully compatible with the FAM-TaqMan system. Further, the advantages of this approach in routine diagnostic TaqMan qPCR were illustrated with practical examples. These included solving problems with flat or other atypical amplification curves or even false negativity as a result of probe binding failure. Our data clearly show that the integration of the TaqMan qPCR and melting analysis into a single assay provides an additional control option as well as the opportunity to perform more complex analyses, get more data from the reactions, and obtain analysis results with higher confidence. PMID:27031831

  4. PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.

    Cline, J; Braman, J C; Hogrefe, H H

    1996-09-15

    The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.

  5. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

    2014-01-01

    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

  6. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Tom eKillelea

    2014-05-01

    Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

  7. PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.

    Cline, J; Braman, J C; Hogrefe, H H

    1996-01-01

    The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) < Deep Vent (2.7 x 10(-6)) < Vent (2.8 x 10(-6)) < Taq (8.0 x 10(-6)) < < exo- Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at p...

  8. Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.

    Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide

    2018-05-05

    Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. TaqMan Real-Time Polymerase Chain Reaction and ...

    ISSN: 1596-5996 (print); 1596-9827 (electronic) ... Alcohol in humans is oxidized to acetaldehyde, which in turn is oxidized to .... cool to room temperature (15 - 25 oC) for at least. 5 min, and .... logical candidate gene for alcohol dependence. A.

  10. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

  11. The cobas p 630 instrument: a dedicated pre-analytic solution to optimize COBAS® AmpliPrep/COBAS® TaqMan® system workflow and turn-around-time.

    Vallefuoco, L; Sorrentino, R; Spalletti Cernia, D; Colucci, G; Portella, G

    2012-12-01

    The cobas p 630, a fully automated pre-analytical instrument for primary tube handling recently introduced to complete the Cobas(®) TaqMan systems portfolio, was evaluated in conjunction with: the COBAS(®) AmpliPrep/COBAS(®) TaqMan HBV Test, v2.0, COBAS(®) AmpliPrep/COBAS(®) TaqMan HCV Test, v1.0 and COBAS(®) AmpliPrep/COBAS(®) TaqMan HIV Test, v2.0. The instrument performance in transferring samples from primary to secondary tubes, its impact in improving COBAS(®) AmpliPrep/COBAS(®) TaqMan workflow and hands-on reduction and the risk of possible cross-contamination were assessed. Samples from 42 HBsAg positive, 42 HCV and 42 HIV antibody (Ab) positive patients as well as 21 healthy blood donors were processed with or without automated primary tubes. HIV, HCV and HBsAg positive samples showed a correlation index of 0.999, 0.987 and of 0.994, respectively. To assess for cross-contamination, high titer HBV DNA positive samples, HCV RNA and HIV RNA positive samples were distributed in the cobas p 630 in alternate tube positions, adjacent to negative control samples within the same rack. None of the healthy donor samples showed any reactivity. Based on these results, the cobas p 630 can improve workflow and sample tracing in laboratories performing molecular tests, and reduce turnaround time, errors, and risks. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Polymerase chain reaction for the detection of Mycobacterium leprae

    Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

    1989-01-01

    A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

  13. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  14. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    Samira Mohammadi

    2017-01-01

    Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  15. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms.

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

    2016-03-01

    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The

  16. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Arbefeville S

    2015-09-01

    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  17. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...

  18. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  19. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Winny Xie

    2013-12-01

    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  20. Association Study of Transforming Growth Factor Alpha TaqI Polymorphism and the Risk of Cleft Lip and/or Palate in an Iranian Population.

    Bagheri, Fahimeh; Ebadifar, Asghar; Khorram Khorshid, Hamid Reza; Kamali, Koorosh

    2017-10-16

    The aim of this study is to evaluate the association of TGFA TaqI polymorphism with nonsyndromic cleft lip and/or palate (NSCLP) in an Iranian population. In this case-control study, 113 children with NSCLP and 209 controls were included. Genotyping of the TaqI polymorphism was performed by polymerase chain reaction and restriction fragment length polymorphism methods. A p-value of control group (p = 0.422) were in Hardy-Weinberg equilibrium. There was no statistically significant difference in the genotype distribution (p = 0.059) and allele frequency (p = 0.065) of the TGFA TaqI polymorphism in the NSCLP and control groups. TGFA TaqI polymorphism was not associated with the risk of NSCLP in Iranian children. Birth Defects Research 109:1386-1389, 2017.© 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. Cost-effective optimization of real-time PCR based detection of Campylobacter and Salmonella with inhibitor tolerant DNA polymerases

    Fachmann, Mette Sofie Rousing; Josefsen, Mathilde Hasseldam; Hoorfar, Jeffrey

    2015-01-01

    bacterial cells in two validated real-time PCR assays for Campylobacter and Salmonella. The five best performing (based on: limit of detection (LOD), maximum fluorescence, shape of amplification curves, and amplification efficiency) were subsequently applied to meat and fecal samples. The VeriQuest q......PCR master mix performed best for both meat and fecal samples (LODs of 102 and 104 CFU ml-1 in the purest and crudest DNA extractions, respectively) compared with Tth (LOD=102 -103 and 105 -106 CFU ml-1 ). AmpliTaqGold and HotMasterTaq both performed well (LOD=102 -104 CFU ml-1 ) with meat samples and poorly...... (LOD=103 -106 CFU ml-1 /not detected) with fecal samples. CONCLUSIONS: Applying the VeriQuest qPCR master mix in the two tested real-time PCR assays could allow for simpler sample preparation and thus a reduction in cost. SIGNIFICANCE AND IMPACT OF STUDY: This work exemplifies a cost-effective strategy...

  2. Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

    Taylor, P.W.; Winton, J.R.

    2002-01-01

    Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

  3. Investigations of Flare Gas Emissions in Taq Taq Oil Field on the Surrounding Land

    Jafar A. Ali

    2014-11-01

    Full Text Available Environmental pollution caused by oil takes many different forms; one of the most damaging sources is simply the combustion of oil products, such as a well flare burn-off. This paper presents the results of a survey of the agriculture lands around the Taq Taq Oil Production Company. The aim of the survey was to determine the potential contamination caused by the gas emissions from the well flares. Taq Taq field is located in the Kurdistan Region of Iraq, 60 km north of the giant Kirkuk oil field, 85 km south-east of Erbil and 120 km north-west of Suleimani. Samples of soil were collected from several locations around the site and analyzed to determine the content of Polycyclic Aromatic Hydrocarbons PAH present. A gas chromatography linked to a mass spectrometry (GCMS machine was used for these measurements. The PAH contamination at each location of soil was determined and the 16-PAHs, as listed in the US Environmental Protection Agency (EPA documentation were investigated. The average content of total PAH in all samples of the agricultural soil was 0.654 mg·kg-1 with the concentrations ranging from 0.310 to 0.869 mg·kg-1. It was found that the PAH concentrations decreased with increasing distance from the TTOPCO oil field, indicating that pollution was evident, the area close to the field being more affected by the gas pollution.

  4. A TaqMan-based real-time PCR assay for porcine parvovirus 4 detection and quantification in reproductive tissues of sows

    Porcine parvovirus 4 (PPV4) is a DNA virus, and a member of the Parvoviridae family within the Bocavirus genera. It was recently detected in swine, but its epidemiology and pathology remain unclear. A TaqMan-based real-time polymerase chain reaction (qPCR) assay targeting a conserved region of the O...

  5. COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

    Masashi Miura

    2013-12-01

    Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

  6. Identification of field caught Anopheles gambiae s.s. and Anopheles arabiensis by TaqMan single nucleotide polymorphism genotyping

    Bayoh Nabie M

    2007-02-01

    Full Text Available Abstract Background Identification of Anopheles gambiae s.s. and Anopheles arabiensis from field-collected Anopheles gambiae s.l. is often necessary in basic and applied research, and in operational control programmes. The currently accepted method involves use of standard polymerase chain reaction amplification of ribosomal DNA (rDNA from the 3' 28S to 5' intergenic spacer region of the genome, and visual confirmation of amplicons of predicted size on agarose gels, after electrophoresis. This report describes development and evaluation of an automated, quantitative PCR method based upon TaqMan™ single nucleotide polymorphism (SNP genotyping. Methods Standard PCR, and TaqMan SNP genotyping with newly designed primers and fluorophore-labeled probes hybridizing to sequences of complementary rDNA specific for either An. gambiae s.s. or An. arabiensis, were conducted in three experiments involving field-collected An. gambiae s.l. from western Kenya, and defined laboratory strains. DNA extraction was from a single leg, sonicated for five minutes in buffer in wells of 96-well PCR plates. Results TaqMan SNP genotyping showed a reaction success rate, sensitivity, and species specificity comparable to that of standard PCR. In an extensive field study, only 29 of 3,041 (0.95% were determined to be hybrids by TaqMan (i.e., having rDNA sequences from both species, however, all but one were An. arabiensis by standard PCR, suggesting an acceptably low (ca. 1% error rate for TaqMan genotyping in mistakenly identifying species hybrids. Conclusion TaqMan SNP genotyping proved to be a sensitive and rapid method for identification of An. gambiae s.l. and An. arabiensis, with a high success rate, specific results, and congruence with the standard PCR method.

  7. Application of GP IIIa gene Taq I polymorphism to determination of carrier status in Glanzmann's thrombasthenia families of Chinese origin

    Ruan Changgeng; Gu Jianmin; Wang Xiaodong; Chu Xiaohong; Pan Junliang; Wu Qingyu

    1992-08-01

    Glanzmann's thrombasthenia is a bleeding disorder caused by qualitative and/or quantitative defects of platelet membrane glycoprotein (GP) Ii b /III a complex. The disease is inherited in an autosomal recessive manner. The use of cDNA probes to study restriction fragment length polymorphisms (RFLPs) in GPIII a gene is reported. A Taq I polymorphism was identified and this RFLP consisted of variant bands of 6.5 kb/4.0 and 2.5 kb with a frequency of 0.46/0.54 in Chinese population. The Taq I polymorphism was further localized by polymerase chain reaction (PCR) method to exon VIII of the GPIII a gene. In two Glanzmann's thrombasthenia families, the Taq I RFLP studied with both Southern blotting and PCR methods identified defective GPIII a gene inherited by patients, and determined the genotype of asymptomatic subjects. Analysis of this Taq I polymorphism by PCR method should be potentially useful in future for the carrier detection and prenatal diagnosis in Glanzmann's thrombasthenia families

  8. Optimization of randomly amplified polymorphic DNA-polymerase chain reaction for molecular typing of Salmonella enterica serovar Typhi Otimização da reação de amplificação aleatória do DNA polimórfico - reação em cadeia da polimerase para tipagem molecular de Salmonella enterica sorovar Typhi

    Bianca Ramalho Quintaes

    2004-03-01

    Full Text Available Optimization of the RAPD reaction for characterizing Salmonella enterica serovar Typhi strains was studied in order to ensure the reproducibility and the discriminatory power of this technique. Eight Salmonella serovar Typhi strains isolated from various regions in Brazil were examined for the fragment patterns produced using different concentrations of DNA template, primer, MgCl2 and Taq DNA polymerase. Using two different low stringency thermal cycle profiles, the RAPD fingerprints obtained were compared. A set of sixteen primers was evaluated for their ability to produce a high number of distinct fragments. We found that variations associated to all of the tested parameters modified the fingerprinting patterns. For the strains of Salmonella enterica serovar Typhi used in this experiment, we have defined a set of conditions for RAPD-PCR reaction, which result in a simple, fast and reproducible typing method.A otimização da reação de RAPD para a caracterização de cepas de Salmonella enterica sorovar Typhi foi estudada com o objetivo de assegurar a reprodutibilidade e o poder discriminatório desta técnica. Oito cepas de Salmonella sorovar Typhi isoladas de algumas regiões do Brasil foram usadas para examinar os padrões de fragmentação produzidos quando foram empregadas concentrações diferentes do DNA molde, do iniciador, do MgCl2 e da enzima Taq DNA polimerase. Com a utilização de dois diferentes perfis de ciclos termais de baixa estringência, foram comparados os padrões de bandeamento obtidos. Um conjunto de dezesseis iniciadores foi avaliado quanto à capacidade de produzir elevado número de fragmentos distintos. Observou-se que variações associadas a todos os parâmetros testados modificaram os padrões de bandeamento. Para as amostras de Salmonella enterica sorovar Typhi utilizadas neste experimento, definiu-se um conjunto de condições para a reação de RAPD-PCR que resultou num método de tipagem simples, rápido e

  9. Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases.

    Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes

    2017-02-07

    Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

  10. Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

    Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

    2010-06-01

    Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

  11. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Evolving a polymerase for hydrophobic base analogues.

    Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

    2009-10-21

    Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

  13. Reverse line blot probe design and polymerase chain reaction optimization for bloodmeal analysis of ticks from the eastern United States.

    Scott, M C; Harmon, J R; Tsao, J I; Jones, C J; Hickling, G J

    2012-05-01

    Determining the host preference of vector ticks is vital to elucidating the eco-epidemiology of the diseases they spread. Detachment of ticks from captured hosts can provide evidence of feeding on those host species, but only for those species that are feasible to capture. Recently developed, highly sensitive molecular assays show great promise in allowing host selection to be determined from minute traces of host DNA that persist in recently molted ticks. Using methods developed in Europe as a starting-point, we designed 12S rDNA mitochondrial gene probes suitable for use in a reverse line blot (RLB) assay of ticks feeding on common host species in the eastern United States. This is the first study to use the 12S mitochondrial gene in a RLB bloodmeal assay in North America. The assay combines conventional PCR with a biotin-labeled primer and reverse line blots that can be stripped and rehybridized up to 20 times, making the method less expensive and more straightforward to interpret than previous methods of tick bloodmeal identification. Probes were designed that target the species, genus, genus group, family, order, or class of eight reptile, 13 birds, and 32 mammal hosts. After optimization, the RLB assay correctly identified the current hostspecies for 99% of ticks [Amblyomma americanum (L.) and eight other ixodid tick species] collected directly from known hosts. The method identified previous-host DNA for approximately half of all questing ticks assayed. Multiple bloodmeal determinations were obtained in some instances from feeding and questing ticks; this pattern is consistent with previous RLB studies but requires further investigation. Development of this probe library, suitable for eastern U.S. ecosystems, opens new avenues for eco-epidemiological investigations of this region's tick-host systems.

  14. Association between vitamin D receptor gene polymorphism (TaqI ...

    Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...

  15. Association between vitamin D receptor gene polymorphism (TaqI)

    Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...

  16. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

  17. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  18. Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil

    Marilia Farignoli Romeiro

    2016-06-01

    Full Text Available Abstract: INTRODUCTION: The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR method for the diagnosis of the Flavivirus genus. METHODS: We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. RESULTS: The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410 of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. CONCLUSIONS: The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

  19. Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

    Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

    2018-02-26

    Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

  20. Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.

    Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik

    2010-04-01

    To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.

  1. Effects of two different high-fidelity DNA polymerases on genetic analysis of the cyanobacterial community structure in a subtropical deep freshwater reservoir

    Zhen, Zhuo; Liu, Jingwen; Rensing, Christopher Günther T

    2017-01-01

    and diversity analysis. In this study, two clone libraries were constructed with two different DNA polymerases, Q5 high-fidelity DNA polymerase and exTaq polymerase, to compare the differences in their capability to accurately reflect the cyanobacterial community structure and diversity in a subtropical deep......-fidelity DNA polymerase. It is noteworthy that so far Q5 high-fidelity DNA polymerase was the first time to be employed in the genetic analysis of cyanobacterial community. And it is for the first time that the cyanobacterial community structure in Dongzhen reservoir was analyzed using molecular methods...

  2. A quantitative PCR (TaqMan assay for pathogenic Leptospira spp

    Symonds Meegan L

    2002-07-01

    Full Text Available Abstract Background Leptospirosis is an emerging infectious disease. The differential diagnosis of leptospirosis is difficult due to the varied and often "flu like" symptoms which may result in a missed or delayed diagnosis. There are over 230 known serovars in the genus Leptospira. Confirmatory serological diagnosis of leptospirosis is usually made using the microscopic agglutination test (MAT which relies on the use of live cultures as the source of antigen, often performed using a panel of antigens representative of local serovars. Other techniques, such as the enzyme linked immunosorbent assay (ELISA and slide agglutination test (SAT, can detect different classes of antibody but may be subject to false positive reactions and require confirmation of these results by the MAT. Methods The polymerase chain reaction (PCR has been used to detect a large number of microorganisms, including those of clinical significance. The sensitivity of PCR often precludes the need for isolation and culture, thus making it ideal for the rapid detection of organisms involved in acute infections. We employed real-time (quantitative PCR using TaqMan chemistry to detect leptospires in clinical and environmental samples. Results and Conclusions The PCR assay can be applied to either blood or urine samples and does not rely on the isolation and culture of the organism. Capability exists for automation and high throughput testing in a clinical laboratory. It is specific for Leptospira and may discriminate pathogenic and non-pathogenic species. The limit of detection is as low as two cells.

  3. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  4. Vitamin D receptor gene TaqI and Apal polymorphisms and steroid responsiveness in childhood idiopathic nephrotic syndrome

    Al-Eisa AA

    2016-08-01

    Full Text Available Amal A Al-Eisa, Mohammad Z Haider Department of Pediatrics, Faculty of Medicine, Kuwait University, Safat, Kuwait Background: Vitamin D activity is controlled by vitamin D receptors (VDRs, which are affected by different genetic polymorphisms, including TaqI and Apal restriction fragment length polymorphisms (RFLPs, which have been reported to be associated with several diseases. The aim of this study was to determine the frequency and the association of VDR gene polymorphisms with idiopathic nephrotic syndrome (INS and steroid responsiveness in Kuwaiti children. Subjects and methods: Genotypes of the VDR TaqI gene polymorphism and the Apal gene polymorphism were analyzed using polymerase chain reaction-RFLP in 78 INS patients and 56 matched controls. Results: A total of 78 INS (62 steroid sensitive [SS] and 16 steroid resistant [SR] patients with a mean age of 6.5±3.1 years were studied. Male:female ratio was 2:1. The TT genotype of VDR–TaqI polymorphism was detected in 41% of the INS patients compared to 42% of the controls (P=0.816. The heterozygous TC genotype was detected in 33% of INS patients compared to 46% of the controls (P=0.462. The CC genotype was detected in 25.6% of INS patients and 21% of the controls (P=0.719. The C-allele frequency, in its homozygous and heterozygous forms, was 71% in INS patients compared to 63% in the controls (P=0.342. Similarly, no significant difference was detected in terms of VDR–Apal polymorphism in INS patients compared to the controls for all the three genotypes (P=0.76, P=0.207, and P=0.364, respectively, for GG, GT, and TT genotypes. The T-allele frequency, in its homozygous and heterozygous forms, was 89% in INS patients compared to 93% in the controls (P=0.076. No significant difference was found in any of the allele frequencies between SS and SR subgroups when compared with each other or when compared to the controls. Conclusion: Our data do not support the use of VDR–TaqI or

  5. Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

    Kho, S L; Chua, K H; George, E; Tan, J A M A

    2013-07-15

    Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

  6. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  7. Association of vitamin D receptor gene polymorphism (TaqI and Apa1) with bone mineral density in North Indian postmenopausal women.

    Ahmad, Israr; Jafar, Tabrez; Mahdi, Farzana; Ameta, Keerti; Arshad, Md; Das, Siddharth Kumar; Waliullah, Shah; Rizvi, Imran; Mahdi, Abbas Ali

    2018-06-15

    Vitamin D receptor (VDR) gene has an important role as a candidate gene for the regulation of bone mass in osteoporosis. However, its association with bone mineral density (BMD) is controversial and has not been established in different ethnic populations. To enhance the understanding of VDR gene polymorphism in the context of BMD, we investigated the plausible genetic association of TaqI and ApaI polymorphism with BMD in North Indian postmenopausal women with osteoporosis.254 osteoporotic women (Age 55.82 ± 6.91) and 254 postmenopausal non osteoporotic women (Age 54.76 ± 6.26) were included in the study. VDR TaqI and ApaI polymorphism were determined by PCR (polymerase chain reaction) and RFLP (restriction fragment length polymorphism). BMD was assessed by dual energy X-ray absorptiometry (DXA) at the lumbar spine (L 1 -L 4 ), hip, forearm and femoral neck. The average BMD with TT genotype was significantly lower at lumbar spine, hip and forearm. The Frequency of TT genotype and t allele was significantly high in osteoporotic women when compared with controls. The average BMD with Aa genotype was higher in ApaI. Furthermore, comparison of frequency distribution of genotype and allele for VDR ApaI between osteoporotic patients and controls did not show any significant difference. Our findings revealed that TaqI gene TT genotype was associated with low BMD in North Indian osteoporotic women. Moreover, TT genotype and t allele associated significantly with osteoporosis in postmenopausal women. Therefore, VDR TaqI gene is an important determinant of risk factor for osteoporosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Water Bridging Dynamics of Polymerase Chain Reaction in the Gauge Theory Paradigm of Quantum Fields

    L. Montagnier

    2017-05-01

    Full Text Available We discuss the role of water bridging the DNA-enzyme interaction by resorting to recent results showing that London dispersion forces between delocalized electrons of base pairs of DNA are responsible for the formation of dipole modes that can be recognized by Taq polymerase. We describe the dynamic origin of the high efficiency and precise targeting of Taq activity in PCR. The spatiotemporal distribution of interaction couplings, frequencies, amplitudes, and phase modulations comprise a pattern of fields which constitutes the electromagnetic image of DNA in the surrounding water, which is what the polymerase enzyme actually recognizes in the DNA water environment. The experimental realization of PCR amplification, achieved through replacement of the DNA template by the treatment of pure water with electromagnetic signals recorded from viral and bacterial DNA solutions, is found consistent with the gauge theory paradigm of quantum fields.

  9. RFLP for TaqI at the human tyrosinase locus

    Spritz, R; Strunk, K; Oetting, W; King, R

    1988-10-25

    A 1.4-kb EcoRI-PstI fragment from the mouse tyrosinase cDNA plasmid pTyrs-33 containing virtually the complete coding sequences. TaqI identifies a two-allele polymorphism with fragments of either 2.8 kb or 2.4 kb that contain most of the tyrosinase coding region. Three weak (1.4 kb, 0.9 kb, and 0.6 kb) and two very weak (5.0 and 3.2 kb) constant bands are also seen. The human tyrosinase gene has been regionally mapped to 11q14->21, and a wealy cross-hybridizing tyrosinase-related sequence mapped to 11p11.2->cen. Co-dominant segregation has been shown in two families. The RFLP was observed under normal hybridization and wash conditions.

  10. Linguistic grammar learning and DRD2-TAQ-IA polymorphism.

    Wong, Patrick C M; Ettlinger, Marc; Zheng, Jing

    2013-01-01

    As research into the neurobiology of language has focused primarily on the systems level, fewer studies have examined the link between molecular genetics and normal variations in language functions. Because the ability to learn a language varies in adults and our genetic codes also vary, research linking the two provides a unique window into the molecular neurobiology of language. We consider a candidate association between the dopamine receptor D2 gene (DRD2) and linguistic grammar learning. DRD2-TAQ-IA polymorphism (rs1800497) is associated with dopamine receptor D2 distribution and dopamine impact in the human striatum, such that A1 allele carriers show reduction in D2 receptor binding relative to carriers who are homozygous for the A2 allele. The individual differences in grammatical rule learning that are particularly prevalent in adulthood are also associated with striatal function and its role in domain-general procedural memory. Therefore, we reasoned that procedurally-based grammar learning could be associated with DRD2-TAQ-IA polymorphism. Here, English-speaking adults learned artificial concatenative and analogical grammars, which have been respectively associated with procedural and declarative memory. Language learning capabilities were tested while learners' neural hemodynamic responses were simultaneously measured by fMRI. Behavioral learning and brain activation data were subsequently compared with the learners' DRD2 (rs1800497) genotype. Learners who were homozygous for the A2 allele were better at concatenative (but not analogical) grammar learning and had higher striatal responses relative to those who have at least one A1 allele. These results provide preliminary evidence for the neurogenetic basis of normal variations in linguistic grammar learning and its link to domain-general functions.

  11. Linguistic grammar learning and DRD2-TAQ-IA polymorphism.

    Patrick C M Wong

    Full Text Available As research into the neurobiology of language has focused primarily on the systems level, fewer studies have examined the link between molecular genetics and normal variations in language functions. Because the ability to learn a language varies in adults and our genetic codes also vary, research linking the two provides a unique window into the molecular neurobiology of language. We consider a candidate association between the dopamine receptor D2 gene (DRD2 and linguistic grammar learning. DRD2-TAQ-IA polymorphism (rs1800497 is associated with dopamine receptor D2 distribution and dopamine impact in the human striatum, such that A1 allele carriers show reduction in D2 receptor binding relative to carriers who are homozygous for the A2 allele. The individual differences in grammatical rule learning that are particularly prevalent in adulthood are also associated with striatal function and its role in domain-general procedural memory. Therefore, we reasoned that procedurally-based grammar learning could be associated with DRD2-TAQ-IA polymorphism. Here, English-speaking adults learned artificial concatenative and analogical grammars, which have been respectively associated with procedural and declarative memory. Language learning capabilities were tested while learners' neural hemodynamic responses were simultaneously measured by fMRI. Behavioral learning and brain activation data were subsequently compared with the learners' DRD2 (rs1800497 genotype. Learners who were homozygous for the A2 allele were better at concatenative (but not analogical grammar learning and had higher striatal responses relative to those who have at least one A1 allele. These results provide preliminary evidence for the neurogenetic basis of normal variations in linguistic grammar learning and its link to domain-general functions.

  12. TaqMan探针荧光定量PCR检测花生油中掺入棕榈油的研究%Determination of palm oil adulterated in peanut oil with the TaqMan probe -based RT- PCR method

    周慧; 梁宇斌; 吴苏喜; 李晓明; 裴伟; 杨涛

    2011-01-01

    The method of Real - time fluorescence quantitative polymerase chain reaction ( RT - PCR) with TaqMan fluorescent probe was chosen to fast detect the amount of palm oil mixed in peanut oil. MT3 - B gene of palm was selected as target gene to detect palm oil from peanut oil. The primers of MT3 - B and TaqMan probe were designed, MT3 - B gene reconstructed plasmid was built as absolute quantitative criteria for quantitative RT - PCR to establish standard curve. Peanut oil blended with 1% -40% concentration gradient palm oil was extracted DNA to test palm content by RT - PCR. The result showed that the correlation coefficient (R1) of standard curve with logarithmic linear regression analysis was 0.996. When the adulteration of palm oil in peanut oil reached 5% volume, MT3 - B gene of 17.431 copies per milli-liter of mixed oil could be detected . The method showed good sensitivity, specificity and repeatability.%根据棕榈内源基因MT3 -B设计引物和TaqMan探针,采用基因重组技术构建用于检测棕榈基因MT3 -B的重组质粒作为绝对定量标准品,建立标准曲线,对花生油中掺入棕榈油1% ~40%梯度混合油品提取DNA进行棕榈成分定量检测.结果表明,重组质粒标准品荧光定量标准曲线对数线性回归分析相关系数(R2)为0.996;花生油中掺入棕榈油达到5%时,可检出每亳升混合油品中棕榈MT3 -B基因17.431 copies,检测的重复性和特异性好.

  13. Are There Mutator Polymerases?

    Miguel Garcia-Diaz

    2003-01-01

    Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.

  14. Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.

    Singh, Prashant; Mustapha, Azlin

    2013-09-02

    Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.

  15. Gly184 of the Escherichia coli cAMP receptor protein provides optimal context for both DNA binding and RNA polymerase interaction.

    Hicks, Matt N; Gunasekara, Sanjiva; Serate, Jose; Park, Jin; Mosharaf, Pegah; Zhou, Yue; Lee, Jin-Won; Youn, Hwan

    2017-10-01

    The Escherichia coli cAMP receptor protein (CRP) utilizes the helix-turn-helix motif for DNA binding. The CRP's recognition helix, termed F-helix, includes a stretch of six amino acids (Arg180, Glu181, Thr182, Val183, Gly184, and Arg185) for direct DNA contacts. Arg180, Glu181 and Arg185 are known as important residues for DNA binding and specificity, but little has been studied for the other residues. Here we show that Gly184 is another F-helix residue critical for the transcriptional activation function of CRP. First, glycine was repeatedly selected at CRP position 184 for its unique ability to provide wild type-level transcriptional activation activity. To dissect the glycine requirement, wild type CRP and mutants G184A, G184F, G184S, and G184Y were purified and their in vitro DNA-binding activity was measured. G184A and G184F displayed reduced DNA binding, which may explain their low transcriptional activation activity. However, G184S and G184Y displayed apparently normal DNA affinity. Therefore, an additional factor is needed to account for the diminished transcriptional activation function in G184S and G184Y, and the best explanation is perturbations in their interaction with RNA polymerase. The fact that glycine is the smallest amino acid could not fully warrant its suitability, as shown in this study. We hypothesize that Gly184 fulfills the dual functions of DNA binding and RNA polymerase interaction by conferring conformational flexibility to the F-helix.

  16. Development of a real-time TaqMan assay to detect mendocina sublineage Pseudomonas species in contaminated metalworking fluids.

    Saha, Ratul; Donofrio, Robert S; Bagley, Susan T

    2010-08-01

    A TaqMan quantitative real-time polymerase chain reaction (qPCR) assay was developed for the detection and enumeration of three Pseudomonas species belonging to the mendocina sublineage (P. oleovorans, P. pseudoalcaligenes, and P. oleovorans subsp. lubricantis) found in contaminated metalworking fluids (MWFs). These microbes are the primary colonizers and serve as indicator organisms of biodegradation of used MWFs. Molecular techniques such as qPCR are preferred for the detection of these microbes since they grow poorly on typical growth media such as R2A agar and Pseudomonas isolation agar (PIA). Traditional culturing techniques not only underestimate the actual distribution of these bacteria but are also time-consuming. The primer-probe pair developed from gyrase B (gyrB) sequences of the targeted bacteria was highly sensitive and specific for the three species. qPCR was performed with both whole cell and genomic DNA to confirm the specificity and sensitivity of the assay. The sensitivity of the assay was 10(1) colony forming units (CFU)/ml for whole cell and 13.7 fg with genomic DNA. The primer-probe pair was successful in determining concentrations from used MWF samples, indicating levels between 2.9 x 10(3) and 3.9 x 10(6) CFU/ml. In contrast, the total count of Pseudomonas sp. recovered on PIA was in the range of <1.0 x 10(1) to 1.4 x 10(5) CFU/ml for the same samples. Based on these results from the qPCR assay, the designed TaqMan primer-probe pair can be efficiently used for rapid (within 2 h) determination of the distribution of these species of Pseudomonas in contaminated MWFs.

  17. [A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

    Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

    2013-10-18

    To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

  18. Single nucleotide polymorphisms at interleukin (IL-1β + 3954 and vitamin D receptor (VDR TaqI in chronic periodontitis patients: A pilot study in North Indian population

    Anika Daing

    2015-01-01

    Full Text Available Background: Increasing evidences support the role of genetic factors in susceptibility to chronic periodontitis. The aim of the present pilot study was to explore the association of two potential single nucleotide polymorphisms (SNPs: Interleukin (IL-1β + 3954 (rs1143634, C > T and vitamin D receptor (VDR TaqI (rs731236, T > C with chronic periodontitis in a North Indian population. Materials and Methods: Twenty-eight chronic periodontitis subjects and 47 periodontally healthy controls were recruited. Individual samples of venous blood were obtained from each subject. Genotyping was done by polymerase chain reaction, followed by restriction fragment length polymorphism (PCR-RFLP. Logistic regression and chi square test were used for genetic association analysis and a P value less than 0.05 taken as statistical significance. Statistical Analysis Used: Chi square test and odds ratio (OR was used. Results: Genotypes and alleles of SNP IL-1β + 3954 did not show a significant association (P > 0.05 with chronic periodontitis. Genotype CC and allele C of VDR TaqI were significantly associated with a higher risk for chronic periodontitis as compared to subjects with TT genotype (CC/TT OR = 4.615; 95% confidence interval [CI]: 1.17 to 18.078 P = 0.028 and allele T (C/T OR = 2.423; 95% CI: 1.179 to 4.980. Conclusion: In North Indian population, genotype CC and allele C of VDR TaqI were associated with risk of chronic periodontitis. No significant correlation was found for IL-1β + 3954 polymorphism and chronic periodontitis.

  19. DNA polymerase preference determines PCR priming efficiency.

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

  20. The expanding polymerase universe.

    Goodman, M F; Tippin, B

    2000-11-01

    Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.

  1. α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

    Olivier Martínez

    Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

  2. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  3. Determining Annealing Temperatures for Polymerase Chain Reaction

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  4. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  5. Detection and differentiation of Cryptosporidium by real-time polymerase chain reaction in stool samples from patients in Rio de Janeiro, Brazil

    Roberta Flávia Ribeiro Rolando

    2012-06-01

    Full Text Available This study reports the first genetic characterisation of Cryptosporidium isolates in Brazil using real-time polymerase chain reaction (RT-PCR. A total of 1,197 faecal specimens from children and 10 specimens from human immunodeficiency virus-infected patients were collected between 1999-2010 and screened using microscopy. Forty-eight Cryptosporidium oocyst-positive isolates were identified and analysed using a generic TaqMan assay targeting the 18S rRNA to detect Cryptosporidium species and two other TaqMan assays to identify Cryptosporidium hominis and Cryptosporidium parvum. The 18S rRNA assay detected Cryptosporidium species in all 48 of the stool specimens. The C. parvum TaqMan assay correctly identified five/48 stool samples, while 37/48 stool specimens were correctly amplified in the C. hominis TaqMan assay. The results obtained in this study support previous findings showing that C. hominis infections are more prevalent than C. parvum infections in Brazil and they demonstrate that the TaqMan RT-PCR procedure is a simple, fast and valuable tool for the detection and differentiation of Cryptosporidium species.

  6. Effects of aripiprazole and the Taq1A polymorphism in the dopamine D2 receptor gene on the clinical response and plasma monoamine metabolites level during the acute phase of schizophrenia.

    Miura, Itaru; Takeuchi, Satoshi; Katsumi, Akihiko; Mori, Azuma; Kanno, Keiko; Yang, Qiaohui; Mashiko, Hirobumi; Numata, Yoshihiko; Niwa, Shin-Ichi

    2012-02-01

    The Taq1A polymorphism in the dopamine D2 receptor (DRD2) gene could be related to the response to antipsychotics. We examined the effects of the Taq1A polymorphism on the plasma monoamine metabolites during the treatment of schizophrenia with aripiprazole, a DRD2 partial agonist. Thirty Japanese patients with schizophrenia were treated with aripiprazole for 6 weeks. We measured plasma levels of homovanillic acid (pHVA) and 3-methoxy-4hydroxyphenylglycol (pMHPG) before and after treatment. The Taq1A polymorphism was genotyped with polymerase chain reaction. Aripiprazole improved the acute symptoms of schizophrenia and decreased pHVA in responders (P = 0.023) but not in nonresponders (P = 0.28). Although A1 allele carriers showed a tendency to respond to aripiprazole (61.5%) compared to A1 allele noncarriers (29.4%) (P = 0.078), there was not statistically significant difference in the response between the 2 genotype groups. There were significant effect for response (P = 0.013) and genotype × response interaction (P = 0.043) on the change of pHVA. The changes of pHVA differ between responders and nonresponders in A1 allele carriers but not in A1 allele noncarriers. There were no genotype or response effects or genotype × response interaction on the changes of the plasma levels of 3-methoxy-4hydroxyphenylglycol. Our preliminary results suggest that Taq1A polymorphism may be partly associated with changes in pHVA during acute schizophrenia.

  7. APOE and CETP TaqIB polymorphisms influence metabolic responses to Hibiscus sabdariffa L. and Gynostemma pentaphyllum Makino tea consumption in hypercholesterolemic subjects.

    Jeenduang, Nutjaree; Sangkaew, Boonnisa; Chantaracha, Pacharee; Chanchareonsri, Sirada; Plyduang, Thunyaluk; Thitdee, Wanida; Samae, Cathaleeya; Pitumanon, Wacharaporn

    2017-03-01

    Hibiscus sabdariffa L. (HS) and Gynostemma pentaphyllum Makino (GP) have been used as traditional medicines to treat diabetes and hypercholesterolemia. Nevertheless, there is interindividual variation in the metabolic responses to HS and GP consumption. This may be due to genetic factors. The aim of this study was to investigate the effects of HS and GP tea consumption on anthropometric data, fasting blood glucose (FBG), and lipid concentrations in hypercholesterolemia subjects with different genotypes of the APOE and CETP TaqIB polymorphisms. Forty-eight subjects with hypercholesterolemia were given either HS or GP tea for 30 days. Anthropometric and biochemical variables were determined, and APOE and CETP TaqIB polymorphisms were analyzed using the polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP). E4 (p=0.008) and homozygous B1B1 (p=0.010) carriers had significantly decreased HDL-C concentrations after HS consumption; in addition, B2 carriers who consumed HS showed significantly decreased triglyceride (TG) concentrations (p=0.039). Regarding GP consumption, non-E4 carriers had significantly decreased HDL-C (p=0.009) and FBG (p=0.042) concentrations. Furthermore, B2 carriers had significantly decreased total cholesterol (TC) (p=0.045), HDL-C (p=0.004), and FBG (p=0.026) concentrations. HS consumption may have beneficial effects with respect to TG concentrations in the B2 carriers, but it may adversely affect HDL-C concentrations in homozygous B1B1 and E4 carriers. In contrast, GP consumption may have favorable effects on TC and FBG concentrations but not on HDL-C concentrations for B2 and/or non-E4 carriers.

  8. Interim Report on Multiple Sequence Alignments and TaqMan Signature Mapping to Phylogenetic Trees

    Gardner, S; Jaing, C

    2012-03-27

    The goal of this project is to develop forensic genotyping assays for select agent viruses, addressing a significant capability gap for the viral bioforensics and law enforcement community. We used a multipronged approach combining bioinformatics analysis, PCR-enriched samples, microarrays and TaqMan assays to develop high resolution and cost effective genotyping methods for strain level forensic discrimination of viruses. We have leveraged substantial experience and efficiency gained through year 1 on software development, SNP discovery, TaqMan signature design and phylogenetic signature mapping to scale up the development of forensics signatures in year 2. In this report, we have summarized the Taqman signature development for South American hemorrhagic fever viruses, tick-borne encephalitis viruses and henipaviruses, Old World Arenaviruses, filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus and Japanese encephalitis virus.

  9. Association study between the Taq1A (rs1800497 polymorphism and schizophrenia in a Brazilian sample

    Quirino Cordeiro

    2014-08-01

    Full Text Available Schizophrenia is a severe psychotic disorder with recurrent relapse and functional impairment. It results from a poorly understood gene-environment interaction. The Taq1A polymorphism (located in the gene cluster NTAD is a likely candidate for schizophrenia. Its rs1800497 polymorphism was shown to be associated with DRD2 gene expression. Therefore the present work aims to investigate a possible association between schizophrenia and such polymorphism. The compared distribution of the alleles and genotypes of the studied polymorphism was investigated in a Brazilian sample of 235 patients and 834 controls. Genotypic frequencies were in Hardy-Weinberg equilibrium. There was a trend of allelic association between the Taq1A polymorphism (rs1800497 with schizophrenia in the studied sample. However no statistically differences were found between cases and controls when analyzed by gender or schizophrenia subtypes.

  10. The formulation of a peer evaluation measure for special forces: operational forces operator traits and attitude questionnaire (SFO-TAQ)

    Van Heerden, A

    2016-11-01

    Full Text Available International Military Testing Association (IMTA) Conference, New Delhi, India, 7-11 November 2016 The formulation of a peer evaluation measure for special forces: operational forces operator traits and attitude questionnaire (SFO-TAQ) Van Heerden A...

  11. Thermally multiplexed polymerase chain reaction.

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  12. Smallpox and pan-orthopox virus detection by real-time 3'-minor groove binder TaqMan assays on the roche LightCycler and the Cepheid smart Cycler platforms.

    Kulesh, David A; Baker, Robert O; Loveless, Bonnie M; Norwood, David; Zwiers, Susan H; Mucker, Eric; Hartmann, Chris; Herrera, Rafael; Miller, David; Christensen, Deanna; Wasieloski, Leonard P; Huggins, John; Jahrling, Peter B

    2004-02-01

    We designed, optimized, and extensively tested several sensitive and specific real-time PCR assays for rapid detection of both smallpox and pan-orthopox virus DNAs. The assays are based on TaqMan 3'-minor groove binder chemistry and were performed on both the rapid-cycling Roche LightCycler and the Cepheid Smart Cycler platforms. The hemagglutinin (HA) J7R, B9R, and B10R genes were used as targets for the variola virus-specific assays, and the HA and DNA polymerase-E9L genes were used as targets for the pan-orthopox virus assays. The five orthopox virus assays were tested against a panel of orthopox virus DNAs (both genomic and cloned) at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID). The results indicated that each assay was capable of detecting both the appropriate cloned gene and genomic DNA. The assays showed no cross-reactivity to the 78 DNAs in the USAMRIID bacterial cross-reactivity panel. The limit of detection (LOD) of each assay was determined to be between 12 and 25 copies of target DNA. The assays were also run against a blind panel of DNAs at the Centers for Disease Control and Prevention (CDC) on both the LightCycler and the Smart Cycler. The panel consisted of eight different variola virus isolates, five non-variola virus orthopox virus isolates, two varicella-zoster virus isolates, and one herpes simplex virus isolate. Each sample was tested in triplicate at 2.5 ng, 25 pg, 250 fg, and 2.5 fg, which represent 1.24 x 10(7), 1.24 x 10(5), 1.24 x 10(3), and 1.24 x 10(1) genome equivalents, respectively. The results indicated that each of the five assays was 100% specific (no false positives) when tested against both the USAMRIID panels and the CDC blind panel. With the CDC blind panel, the LightCycler was capable of detecting 96.2% of the orthopox virus DNAs and 93.8% of the variola virus DNAs. The Smart Cycler was capable of detecting 92.3% of the orthopox virus DNAs and between 75 and 93.8% of the variola virus DNAs

  13. Smallpox and pan-Orthopox Virus Detection by Real-Time 3′-Minor Groove Binder TaqMan Assays on the Roche LightCycler and the Cepheid Smart Cycler Platforms

    Kulesh, David A.; Baker, Robert O.; Loveless, Bonnie M.; Norwood, David; Zwiers, Susan H.; Mucker, Eric; Hartmann, Chris; Herrera, Rafael; Miller, David; Christensen, Deanna; Wasieloski, Leonard P.; Huggins, John; Jahrling, Peter B.

    2004-01-01

    We designed, optimized, and extensively tested several sensitive and specific real-time PCR assays for rapid detection of both smallpox and pan-orthopox virus DNAs. The assays are based on TaqMan 3′-minor groove binder chemistry and were performed on both the rapid-cycling Roche LightCycler and the Cepheid Smart Cycler platforms. The hemagglutinin (HA) J7R, B9R, and B10R genes were used as targets for the variola virus-specific assays, and the HA and DNA polymerase-E9L genes were used as targets for the pan-orthopox virus assays. The five orthopox virus assays were tested against a panel of orthopox virus DNAs (both genomic and cloned) at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID). The results indicated that each assay was capable of detecting both the appropriate cloned gene and genomic DNA. The assays showed no cross-reactivity to the 78 DNAs in the USAMRIID bacterial cross-reactivity panel. The limit of detection (LOD) of each assay was determined to be between 12 and 25 copies of target DNA. The assays were also run against a blind panel of DNAs at the Centers for Disease Control and Prevention (CDC) on both the LightCycler and the Smart Cycler. The panel consisted of eight different variola virus isolates, five non-variola virus orthopox virus isolates, two varicella-zoster virus isolates, and one herpes simplex virus isolate. Each sample was tested in triplicate at 2.5 ng, 25 pg, 250 fg, and 2.5 fg, which represent 1.24 × 107, 1.24 × 105, 1.24 × 103, and 1.24 × 101 genome equivalents, respectively. The results indicated that each of the five assays was 100% specific (no false positives) when tested against both the USAMRIID panels and the CDC blind panel. With the CDC blind panel, the LightCycler was capable of detecting 96.2% of the orthopox virus DNAs and 93.8% of the variola virus DNAs. The Smart Cycler was capable of detecting 92.3% of the orthopox virus DNAs and between 75 and 93.8% of the variola virus DNAs. However

  14. Development of an optimized random amplified polymorphic DNA protocol for fingerprinting of Klebsiella pneumoniae.

    Ashayeri-Panah, M; Eftekhar, F; Feizabadi, M M

    2012-04-01

    To develop an optimized random amplified polymorphic DNA (RAPD) protocol for fingerprinting clinical isolates of Klebsiella pneumoniae. Employing factorial design of experiments, repeatable amplification patterns were obtained for 54 nosocomial isolates using 1 μmol 1(-1) primer, 4 mmol 1(-1) MgCl(2), 0·4 mmol 1(-1) dNTPs, 2·5 U Taq DNA polymerase and 90 ng DNA template in a total volume of 25 μl. The optimum thermocycling program was: initial denaturation at 94°C for 4 min followed by 50 cycles of 1 min at 94°C, 2 min at 34°C, 2 min at 72°C and a final extension at 72°C for 10 min. The optimized RAPD protocol was highly discriminatory (Simpson's diversity index, 0·982), and all isolates were typable with repeatable patterns (Pearson's similarity coefficient ≈ 100%). Seven main clusters were obtained on a similarity level of 70% and 32 distinct clusters on a similarity level of 85%, reflecting the heterogeneity of the isolates. Systematic optimization of RAPD generated reliable DNA fingerprints for nosocomial isolates of K. pneumoniae. This is the first report on RAPD optimization based on factorial design of experiments for discrimination of K. pneumoniae. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  15. A TaqI RFLP in the locus D9S29 on human chromosome 9

    Weitnauer, L.; Antonelli, A.; Pandolfo, M. (Istituto Neurologico, Milan (Italy))

    1989-12-25

    Phage LAMP92 was isolated from the Los Alamos chromosome 9 library and its 3.8 Kbp insert was subcloned into the Eco RI site of pUC19. Taq I identifies a three allele RFLP (B1: 7.6 kb + 3 kb, B2: 14 kb + 3 kb, B3: 17 kb). A two allele Pvu II RFLP detected by the same probe was described previously. It was localized on 9q22-q31 by in situ hybridization and linkage analysis. Co-dominant segregation was shown in 14 informative families.

  16. Typisierung von HLA-Klasse-II-Merkmalen mittels des TaqMan-Verfahrens

    Tremmel, Matthias

    2001-01-01

    In Anlehnung an die konventionelle SSP-PCR-Methode wurde ein Low-Resolution-Panel mittels des TaqMan-Prinzips entwickelt und es wurde exemplarisch für DR4 und DR15/16 gezeigt, daß die auf dem 5 Nuklease-Assay beruhende Methode fähig ist, auch einzelne Punktmutationen voneinander zu unterscheiden. Das Grundprinzip dieser Methode basiert ähnlich dem der PCR-SSP auf dem Verfahren der PCR und auf dem Ausnutzen genetischer Unterschiede. So kommt es nur zu einer Amplifizierung wenn beide Primer spe...

  17. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    Takao Ito

    Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  18. Association Between Stool Enteropathogen Quantity and Disease in Tanzanian Children Using TaqMan Array Cards: A Nested Case-Control Study

    Platts-Mills, James A.; Gratz, Jean; Mduma, Esto; Svensen, Erling; Amour, Caroline; Liu, Jie; Maro, Athanasia; Saidi, Queen; Swai, Ndealilia; Kumburu, Happiness; McCormick, Benjamin J. J.; Kibiki, Gibson; Houpt, Eric R.

    2014-01-01

    Etiologic studies of diarrhea are limited by uneven diagnostic methods and frequent asymptomatic detection of enteropathogens. Polymerase chain reaction-based stool pathogen quantification may help distinguish clinically significant infections. We performed a nested case-control study of diarrhea in infants from a community-based birth cohort in Tanzania. We tested 71 diarrheal samples and pre-diarrheal matched controls with a laboratory-developed TaqMan Array Card for 19 enteropathogens. With qualitative detection, no pathogens were significantly associated with diarrhea. When pathogen quantity was considered, rotavirus (odds ratio [OR] = 2.70 per log10 increase, P < 0.001), astrovirus (OR = 1.49, P = 0.01), and Shigella/enteroinvasive Escherichia coli (OR = 1.47, P = 0.04) were associated with diarrhea. Enterotoxigenic E. coli (0.15 SD decline in length-for-age z score after 3 months per log10 increase, P < 0.001) and Campylobacter jejuni/C. coli (0.11 SD decline, P = 0.003) in pre-diarrheal stools were associated with poor linear growth. Quantitative analysis can help refine the association between enteropathogens and disease in endemic settings. PMID:24189366

  19. Rapid and Quantitative Detection of Leifsonia xyli subsp. xyli in Sugarcane Stalk Juice Using a Real-Time Fluorescent (TaqMan PCR Assay

    Hua-Ying Fu

    2016-01-01

    Full Text Available Ratoon stunting disease (RSD of sugarcane, one of the most important diseases seriously affecting the productivity of sugarcane crops, was caused by the bacterial agent Leifsonia xyli subsp. xyli (Lxx. A TaqMan probe-based real-time quantitative polymerase chain reaction (qPCR assay was established in this study for the quantification of Lxx detection in sugarcane stalk juice. A pair of PCR primers (Pat1-QF/Pat1-QR and a fluorogenic probe (Pat1-QP targeting the Part1 gene of Lxx were used for the qPCR assay. The assay had a detection limit of 100 copies of plasmid DNA and 100 fg of Lxx genomic DNA, which was 100-fold more sensitive than the conventional PCR. Fifty (28.7% of 174 stalk juice samples from two field trials were tested to be positive by qPCR assay, whereas, by conventional PCR, only 12.1% (21/174 were tested to be positive with a published primer pair CxxITSf#5/CxxITSr#5 and 15.5% (27/174 were tested to be positive with a newly designed primer pair Pat1-F2/Pat1-R2. The new qPCR assay can be used as an alternative to current diagnostic methods for Lxx, especially when dealing with certificating a large number of healthy cane seedlings and determining disease incidence accurately in commercial fields.

  20. Detecting beef meatball contamination with polymerase chain reaction

    Hoda A.

    2017-10-01

    Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.

  1. Detection and Quantification of Viable and Nonviable Trypanosoma cruzi Parasites by a Propidium Monoazide Real-Time Polymerase Chain Reaction Assay

    Cancino-Faure, Beatriz; Fisa, Roser; Alcover, M. Magdalena; Jimenez-Marco, Teresa; Riera, Cristina

    2016-01-01

    Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification. PMID:27139452

  2. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  3. Engineering of a DNA Polymerase for Direct m6 A Sequencing.

    Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas

    2018-01-08

    Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  4. Association of dopamine receptor D2 gene (DRD2) Taq1 polymorphisms with eating behaviors and obesity among Chinese and Indian Malaysian university students.

    Lek, Fang-Ying; Ong, Hing-Huat; Say, Yee-How

    2018-01-01

    This study investigated the association of DRD2 Taq1A, Taq1B and Taq1D gene polymorphisms with eating behavior, the preference/intake frequency/craving of high-fat foods and obesity in 394 Malaysian adults (161 males, 233 females; 308 Chinese, 86 Indians; 67 obese, 327 non-obese). Eating behaviors namely Cognitive Restraint, Uncontrolled Eating and Emotional Eating scores were assessed by the Three Factor Eating Questionnaire-R18. The preference/intake frequency/craving of 26 common high-fat Malaysian foods was assessed using a 7-point hedonic scale. Anthropometric measurements were taken and Taq1 gene polymorphisms were genotyped by PCR-Restriction Fragment Length Polymorphism using DNA extracted from mouthwash samples. The overall minor allele frequencies of Taq1A, Taq1B and Taq1D according to ethnicities (Chinese/Indian) were 0.37/0.29, 0.39/0.28, 0.06/0.30, respectively; genotype and allele distributions of Taq1B and Taq1D were significantly different between ethnicities. Eating behaviorscores were not significantly different between gender and ethnicities. Those with A1 or B1 allele had lower Cognitive Restraint score and higher Uncontrolled Eating score, while those with A1/A1 or B1/B1 genotype had higher fast food preference. D1 allele was associated with increased starchy food craving and mamak (Malaysian Indian-Muslim) food preference, but not eating behavior scores. All three gene variants were not associated with obesity and adiposity. Taken together, we posit that three DRD2 Taq1 gene polymorphisms influence the eating behavior and preference/intake frequency/craving of certain high-fat foods in Malaysian adults, but their role in obesity and adiposity is still inconclusive and needs further investigation.

  5. A TaqI RFLP identified at the retinoblastoma locus on chromosome 13

    Shiang, R; Murray, J C [Univ. of Iowa, Iowa City (USA); Wiggs, J; Dryja, T [Massachusetts Eye and Ear Infirmary, Boston (USA)

    1988-09-26

    Probe D95HS0.5 is a 0.6 kb fragment subcloned into Bluescribe a pUC19 derivative from a bacterio phage library isolated by a cDNA probe of the retinoblastoma gene. The fragment is released with the enzymes HindIII and SaII. TaqI identifies a 2 allele polymorphism with a band at 2.1 kb and 1.8 kb with a frequency of 0.97 and 0.03 respectively. There are no constant bands. The probe was assigned to chromosome 13 using a linkage analysis with retinoblastoma. Co-dominant inheritance was shown in 3 CEPH pedigrees.

  6. Taq I RFLP in the human cellular retinol-binding protein (CRBP) gene

    Pellegrino, A [Istituto di Ricovero e Cura a Carattere Scientifico SANATRIX, Vena (Italy); Garofalo, S; Cocozza, S; Monticelli, A; Varrone, S [CNR Universita degli Studi di Napoli (Italy); Faraonio, R; Colantuoni, V [Universita degli Studi di Napoli (Italy)

    1988-08-11

    The probe was a Pst I - Bam HI fragment of cDNA, about 600 bp long, encoding for the human CRBP gene. The clone was isolated by screening a human liver cDNA library in the expression vector pEX with antibodies against rat CRBP. Taq I digestion of genomic DNA and hybridization with the CRBP probe detects a two allele polymorphism with allelic fragments of 3.0 kb and 2.7 kb. There are two invariant bands at 2.4 and 2.2 kb. Human CRBP gene has been mapped on the long arm of chromosome 3 using somatic cell hybrids. Co-dominant segregation was observed in two caucasian families (10 individuals).

  7. GFA Taq I polymorphism and cleft lip with or without cleft palate (CL/P) risk

    Dong, Lijia; Ma, Lian

    2015-01-01

    The transforming growth factor alpha (TGFA) Taq I polymorphism has been indicated to be correlated with cleft lip with or without cleft palate (CL/P) susceptibility, but study results are still debatable. Thus, a meta-analysis was conducted. We conducted a comprehensive search of Embase, Ovid, Web of Science, the Cochrane database, PubMed, the Chinese Biomedical Literature Database (CBM-disc, 1979-2014), the database of National Knowledge Infrastructure (CNKI, 1979-2014) and the full paper database of Chinese Science and Technology of Chongqing (VIP, 1989-2014) to identify suitable studies. There were 18 studies suitable for this meta-analysis, involving a total of 3135 cases and 3575 controls. Significantly increased CL/P risk was observed (OR = 1.49; 95% CI 1.17-1.89; P = 0.001). In subgroup analyses stratified by ethnicity, there was evidence in the Caucasian population for an association between this polymorphism and CL/P risk (OR = 1.52; 95% CI 1.14-2.02; P = 0.004). However, no significant association was found between this his polymorphism and CL/P risk in African and Hispanic populations. According to a specific CL/P type, increased clip lip and palate risk and clip palate risk were found (OR = 1.38; 95% CI 1.10-1.73; P = 0.005; OR = 1.29; 95% CI 1.01-1.66; P = 0.042). In conclusion, the present meta-analysis found that the TGFA Taq I polymorphism may be associated with CL/P susceptibility. PMID:26064247

  8. A Laboratory-Developed TaqMan Array Card for Simultaneous Detection of 19 Enteropathogens

    Liu, Jie; Gratz, Jean; Amour, Caroline; Kibiki, Gibson; Becker, Stephen; Janaki, Lalitha; Verweij, Jaco J.; Taniuchi, Mami; Sobuz, Shihab U.; Haque, Rashidul; Haverstick, Doris M.

    2013-01-01

    The TaqMan Array Card (TAC) system is a 384-well singleplex real-time PCR format that has been used to detect multiple infection targets. Here we developed an enteric TaqMan Array Card to detect 19 enteropathogens, including viruses (adenovirus, astrovirus, norovirus GII, rotavirus, and sapovirus), bacteria (Campylobacter jejuni/C. coli, Clostridium difficile, Salmonella, Vibrio cholerae, diarrheagenic Escherichia coli strains including enteroaggregative E. coli [EAEC], enterotoxigenic E. coli [ETEC], enteropathogenic E. coli [EPEC], and Shiga-toxigenic E. coli [STEC]), Shigella/enteroinvasive E. coli (EIEC), protozoa (Cryptosporidium, Giardia lamblia, and Entamoeba histolytica), and helminths (Ascaris lumbricoides and Trichuris trichiura), as well as two extrinsic controls to monitor extraction and amplification efficiency (the bacteriophage MS2 and phocine herpesvirus). Primers and probes were newly designed or adapted from published sources and spotted onto microfluidic cards. Fecal samples were spiked with extrinsic controls, and DNA and RNA were extracted using the QiaAmp Stool DNA minikit and the QuickGene RNA Tissue kit, respectively, and then mixed with Ag-Path-ID One Step real-time reverse transcription-PCR (RT-PCR) reagents and loaded into cards. PCR efficiencies were between 90% and 105%, with linearities of 0.988 to 1. The limit of detection of the assays in the TAC was within a 10-fold difference from the cognate assays performed on plates. Precision testing demonstrated a coefficient of variation of below 5% within a run and 14% between runs. Accuracy was evaluated for 109 selected clinical specimens and revealed an average sensitivity and specificity of 85% and 77%, respectively, compared with conventional methods (including microscopy, culture, and immunoassay) and 98% and 96%, respectively, compared with our laboratory-developed PCR-Luminex assays. This TAC allows fast, accurate, and quantitative detection of a broad spectrum of enteropathogens and

  9. Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

    Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

    1998-04-01

    Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

  10. Advancing Polymerase Ribozymes Towards Self-Replication

    Tjhung, K. F.; Joyce, G. F.

    2017-07-01

    Autocatalytic replication and evolution in vitro by (i) a cross-chiral RNA polymerase catalyzing polymerization of mononucleotides of the opposite handedness; (ii) non-covalent assembly of component fragments of an existing RNA polymerase ribozyme.

  11. T.I.M.S: TaqMan Information Management System, tools to organize data flow in a genotyping laboratory

    Albion Tim

    2005-10-01

    Full Text Available Abstract Background Single Nucleotide Polymorphism (SNP genotyping is a major activity in biomedical research. The Taqman technology is one of the most commonly used approaches. It produces large amounts of data that are difficult to process by hand. Laboratories not equipped with a Laboratory Information Management System (LIMS need tools to organize the data flow. Results We propose a package of Visual Basic programs focused on sample management and on the parsing of input and output TaqMan files. The code is written in Visual Basic, embedded in the Microsoft Office package, and it allows anyone to have access to those tools, without any programming skills and with basic computer requirements. Conclusion We have created useful tools focused on management of TaqMan genotyping data, a critical issue in genotyping laboratories whithout a more sophisticated and expensive system, such as a LIMS.

  12. T.I.M.S: TaqMan Information Management System, tools to organize data flow in a genotyping laboratory

    Monnier, Stéphanie; Cox, David G; Albion, Tim; Canzian, Federico

    2005-01-01

    Background Single Nucleotide Polymorphism (SNP) genotyping is a major activity in biomedical research. The Taqman technology is one of the most commonly used approaches. It produces large amounts of data that are difficult to process by hand. Laboratories not equipped with a Laboratory Information Management System (LIMS) need tools to organize the data flow. Results We propose a package of Visual Basic programs focused on sample management and on the parsing of input and output TaqMan files. The code is written in Visual Basic, embedded in the Microsoft Office package, and it allows anyone to have access to those tools, without any programming skills and with basic computer requirements. Conclusion We have created useful tools focused on management of TaqMan genotyping data, a critical issue in genotyping laboratories whithout a more sophisticated and expensive system, such as a LIMS. PMID:16221298

  13. Taq I polymorphism in the 5' region of the von Willebrand Factor (vWF) gene

    Lavergne, J M; Bahnak, B R; Assouline, Z; Pietu, G; Kerbiriou-Nabias, D; Meulien, P; Pavirani, A; Meyer, D

    1988-03-25

    pvWFIPC8 is a 2.28 Kb partial cDNA clone for human von Willebrand factor (vWF) isolated from a human lung cDNA library and inserted into the EcoRI site of pUC9. The sequence includes the last 1330 nucleotides that encode for vWF propeptide and 950 nucleotides that encode for mature vWF. Taq I (TCGA) identifies plural invariant bands and two variant bands with alleles at 2.3 (Al) and 1.0 (A2). The frequency was determined in 33 unrelated European and North American caucasians. The extreme 3' region of pvWFIPC8 corresponds to the 5' boundary of an area that could possibly hybridize with similar sequences on human chromosome 22. The 5' 1.74 Kb portion of pvWFIPC8 generated by Bam HI digestion that corresponds to sequences only on chromosome 12 also demonstrates the polymorphism. Co-dominant segregation was demonstrated in 6 families of 48 individuals.

  14. A Taq 1 polymorphism for the human platelet glycoprotein IIIa gene (GP3A)

    Burk, C; Ingram, C; Weiner, M; Rappaport, E F; Schwartz, E; Poncz, M [Univ. of Pennsylvania School of Medicine, Philadelphia (USA)

    1988-07-25

    A cDNA clone containing a 4.0 kb GPIIIa insert was isolated from a human erythroleukemia (HEL) cell cDNA library. A 2.3 kb Eco RI fragment, representing the 5{prime} portion of this insert, was used as a probe for these Southern blot experiments. Taq I (T/CGA) identifies invariant bands of 5.0, 3.5, 1.3, 1.1, and 0.8 kb and a simple polymorphism with a band(s) at 8.0 kb or 4.8 and 3.2 kb. The frequency of the gene was studied in 17 persons (11 Caucasians, 3 Asians, and 3 blacks). The GPIIIa gene has been localized to the region 17q21{r arrow}22 by somatic cell hybrid and in situ hybridization studies. Mendelian inheritance was demonstrated in one family. The father is homozygous for the 8.0 kb band, and the mother is heterozygous for the 8.0/4.8 and 3.2 kb bands.

  15. Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.

    Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E

    2016-11-01

    Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

  16. Association between Serum 25-hydroxy Vitamin D Concentration and TaqI Vitamin D Receptor Gene Polymorphism among Jordanian Females with Breast Cancer

    Manar Fayiz Atoum

    2017-01-01

    Conclusions: An inverse association was found between 25(OHD serum level and breast cancer risk. Statistical difference was also found between different VDR TaqI genotypes and circulating levels of 25(OHD among Jordanian females with breast cancer.

  17. Cortical NMDA receptor expression in human chronic alcoholism: influence of the TaqIA allele of ANKK1.

    Ridge, Justin P; Dodd, Peter R

    2009-10-01

    Real-time RT-PCR normalized to GAPDH was used to assay N-methyl-D-aspartate (NMDA) receptor NR1, NR2A and NR2B subunit mRNA in human autopsy cortex tissue from chronic alcoholics with and without comorbid cirrhosis of the liver and matched controls. Subunit expression was influenced by the subject's genotype. The TaqIA polymorphism selectively modulated NMDA receptor mean transcript expression in cirrhotic-alcoholic superior frontal cortex, in diametrically opposite ways in male and female subjects. Genetic make-up may differentially influence vulnerability to brain damage by altering the excitation: inhibition balance, particularly in alcoholics with comorbid cirrhosis of the liver. The TaqIA polymorphism occurs within the poorly characterised ankyrin-repeat containing kinase 1 (ANKK1) gene. Using PCR, ANKK1 mRNA transcript was detected in inferior temporal, occipital, superior frontal and primary motor cortex of control human brain. ANKK1 expression may mediate the influence of the TaqIA polymorphism on phenotype.

  18. Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB).

    Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini

    2015-06-01

    Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.

  19. Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction.

    Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František

    2017-05-01

    The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB

    Lenice Roteia Cardoso Jung

    2015-06-01

    Full Text Available Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR. The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.

  1. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  2. Evaluation of a TaqMan Array Card for Detection of Central Nervous System Infections.

    Onyango, Clayton O; Loparev, Vladimir; Lidechi, Shirley; Bhullar, Vinod; Schmid, D Scott; Radford, Kay; Lo, Michael K; Rota, Paul; Johnson, Barbara W; Munoz, Jorge; Oneko, Martina; Burton, Deron; Black, Carolyn M; Neatherlin, John; Montgomery, Joel M; Fields, Barry

    2017-07-01

    Infections of the central nervous system (CNS) are often acute, with significant morbidity and mortality. Routine diagnosis of such infections is limited in developing countries and requires modern equipment in advanced laboratories that may be unavailable to a number of patients in sub-Saharan Africa. We developed a TaqMan array card (TAC) that detects multiple pathogens simultaneously from cerebrospinal fluid. The 21-pathogen CNS multiple-pathogen TAC (CNS-TAC) assay includes two parasites ( Balamuthia mandrillaris and Acanthamoeba ), six bacterial pathogens ( Streptococcus pneumonia e, Haemophilus influenzae , Neisseria meningitidis , Mycoplasma pneumoniae , Mycobacterium tuberculosis , and Bartonella ), and 13 viruses (parechovirus, dengue virus, Nipah virus, varicella-zoster virus, mumps virus, measles virus, lyssavirus, herpes simplex viruses 1 and 2, Epstein-Barr virus, enterovirus, cytomegalovirus, and chikungunya virus). The card also includes human RNase P as a nucleic acid extraction control and an internal manufacturer control, GAPDH (glyceraldehyde-3-phosphate dehydrogenase). This CNS-TAC assay can test up to eight samples for all 21 agents within 2.5 h following nucleic acid extraction. The assay was validated for linearity, limit of detection, sensitivity, and specificity by using either live viruses (dengue, mumps, and measles viruses) or nucleic acid material (Nipah and chikungunya viruses). Of 120 samples tested by individual real-time PCR, 35 were positive for eight different targets, whereas the CNS-TAC assay detected 37 positive samples across nine different targets. The CNS-TAC assays showed 85.6% sensitivity and 96.7% specificity. Therefore, the CNS-TAC assay may be useful for outbreak investigation and surveillance of suspected neurological disease. Copyright © 2017 American Society for Microbiology.

  3. A quantitative TaqMan PCR assay for the detection of Ureaplasma diversum.

    Marques, Lucas M; Amorim, Aline T; Martins, Hellen Braga; Rezende, Izadora Souza; Barbosa, Maysa Santos; Lobão, Tassia Neves; Campos, Guilherme B; Timenetsky, Jorge

    2013-12-27

    Ureaplasma diversum in veterinary studies is an undesirable microbe, which may cause infection in bulls and may result in seminal vesiculitis, balanopostitis, and alterations in spermatozoids, whereas in cows, it may cause placentitis, fetal alveolitis, abortion, and birth of weak calves. U. diversum is released through organic secretions, especially semen, preputial and vaginal mucus, conjunctival secretion, and milk. The aim of the present study was to develop a TaqMan probe, highly sensitive and specific quantitative PCR (qPCR) assay for the detection and quantification of U. diversum from genital swabs of bovines. Primers and probes specific to U. diversum 16S rRNA gene were designed. The specificity, detection limit, intra- and inter-assay variability of qPCR to detect this ureaplasma was compared with the results of the conventional PCR assay (cPCR). Swabs of vaginal mucus from 169 cows were tested. The qPCR assay detected as few as 10 copies of U. diversum and was 100-fold more sensitive than the cPCR. No cross-reactivity with other Mollicutes or eubacteria was observed. U. diversum was detected in 79 swabs (46.42%) by qPCR, while using cPCR it was detected in 42 (25%) samples. The difference in cPCR and qPCR ureaplasma detection between healthy and sick animals was not statistically significant. But the U. diversum load in samples from animals with genital disorders was higher than in healthy animals. The qPCR assay developed herein is highly sensitive and specific for the detection and quantification of U. diversum in vaginal bovine samples. Copyright © 2013. Published by Elsevier B.V.

  4. Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.

    Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q

    2011-03-01

    The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

  5. Optimization of a 12-hour TaqMan PCR-based method for detection of Salmonella bacteria in meat

    Josefsen, Mathilde Hartmann; Krause, Michael; Hansen, F.

    2007-01-01

    no positive effects and resulted in decreased reproducibility. Increasing the amount of PCR template DNA from 5 to 20 mu l improved the threshold cycle value by approximately 2. The improved 12-h PCR method was successfully compared to a reference culture method with 100 minced meat and poultry samples...... the highest number of salmonellae. When analyzing minced meat samples, positive effects of increasing the initial sampling volume from 1 to 5 ml and increasing the amount of paramagnetic particles to 90 mu l were observed. However, washing the pellet and eluting the DNA in reduced volumes (25 and 50 mu l) had...

  6. Polymerase Gamma Disease through the Ages

    Saneto, Russell P.; Naviaux, Robert K.

    2010-01-01

    The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…

  7. DNA Polymerase Fidelity: Beyond Right and Wrong.

    Washington, M Todd

    2016-11-01

    Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. CYP2D7 sequence variation interferes with TaqMan CYP2D6*15 and *35 genotyping

    Amanda K Riffel

    2016-01-01

    Full Text Available TaqMan™ genotyping assays are widely used to genotype CYP2D6, which encodes a major drug metabolizing enzyme. Assay design for CYP2D6 can be challenging owing to the presence of two pseudogenes, CYP2D7 and CYP2D8, structural and copy number variation and numerous single nucleotide polymorphisms (SNPs some of which reflect the wild-type sequence of the CYP2D7 pseudogene. The aim of this study was to identify the mechanism causing false positive CYP2D6*15 calls and remediate those by redesigning and validating alternative TaqMan genotype assays. Among 13,866 DNA samples genotyped by the CompanionDx® lab on the OpenArray platform, 70 samples were identified as heterozygotes for 137Tins, the key SNP of CYP2D6*15. However, only 15 samples were confirmed when tested with the Luminex xTAG CYP2D6 Kit and sequencing of CYP2D6-specific long range (XL-PCR products. Genotype and gene resequencing of CYP2D6 and CYP2D7-specific XL-PCR products revealed a CC>GT dinucleotide SNP in exon 1 of CYP2D7 that reverts the sequence to CYP2D6 and allows a TaqMan assay PCR primer to bind. Because CYP2D7 also carries a Tins, a false-positive mutation signal is generated. This CYP2D7 SNP was also responsible for generating false-positive signals for rs769258 (CYP2D6*35 which is also located in exon 1. Although alternative CYP2D6*15 and *35 assays resolved the issue, we discovered a novel CYP2D6*15 subvariant in one sample that carries additional SNPs preventing detection with the alternate assay. The frequency of CYP2D6*15 was 0.1% in this ethnically diverse U.S. population sample. In addition, we also discovered linkage between the CYP2D7 CC>GT dinucleotide SNP and the 77G>A (rs28371696 SNP of CYP2D6*43. The frequency of this tentatively functional allele was 0.2%. Taken together, these findings emphasize that regardless of how careful genotyping assays are designed and evaluated before being commercially marketed, rare or unknown SNPs underneath primer and/or probe

  9. Multiplex preamplification of specific cDNA targets prior to gene expression analysis by TaqMan Arrays

    Ribal María

    2008-06-01

    Full Text Available Abstract Background An accurate gene expression quantification using TaqMan Arrays (TA could be limited by the low RNA quantity obtained from some clinical samples. The novel cDNA preamplification system, the TaqMan PreAmp Master Mix kit (TPAMMK, enables a multiplex preamplification of cDNA targets and therefore, could provide a sufficient amount of specific amplicons for their posterior analysis on TA. Findings A multiplex preamplification of 47 genes was performed in 22 samples prior to their analysis by TA, and relative gene expression levels of non-preamplified (NPA and preamplified (PA samples were compared. Overall, the mean cycle threshold (CT decrement in the PA genes was 3.85 (ranging from 2.07 to 5.01. A high correlation (r between the gene expression measurements of NPA and PA samples was found (mean r = 0.970, ranging from 0.937 to 0.994; p Conclusion We demonstrate that cDNA preamplification using the TPAMMK before TA analysis is a reliable approach to simultaneously measure gene expression of multiple targets in a single sample. Moreover, this procedure was validated in genes from degraded RNA samples and low abundance expressed genes. This combined methodology could have wide applications in clinical research, where scarce amounts of degraded RNA are usually obtained and several genes need to be quantified in each sample.

  10. Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.

    Pegels, N; González, I; Fernández, S; García, T; Martín, R

    2012-01-01

    A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.

  11. TaqMan MGB probe fluorescence real-time quantitative PCR for rapid detection of Chinese Sacbrood virus.

    Ma Mingxiao

    Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.

  12. A TaqMan Real-Time PCR Assay for Detection and Quantification of Sporisorium scitamineum in Sugarcane

    Yachun Su

    2013-01-01

    Full Text Available Sporisorium scitamineum is a fungal smut pathogen epidemic in sugarcane producing areas. Early detection and proper identification of the smut are an essential requirement in its management practice. In this study, we developed a TaqMan real-time PCR assay using specific primers (bEQ-F/bEQ-R and a TaqMan probe (bEQ-P which were designed based on the bE (b East mating type gene (Genbank Accession no. U61290.1. This method was more sensitive (a detection limit of 10 ag pbE DNA and 0.8 ng sugarcane genomic DNA than that of conventional PCR (10 fg and 100 ng, resp.. Reliability was demonstrated through the positive detection of samples collected from artificially inoculated sugarcane plantlets (FN40. This assay was capable of detecting the smut pathogen at the initial stage (12 h of infection and suitable for inspection of sugarcane pathogen-free seed cane and seedlings. Furthermore, quantification of pathogen was verified in pathogen-challenged buds in different sugarcane genotypes, which suggested its feasibility for evaluation of smut resistance in different sugarcane genotypes. Taken together, this novel assay can be used as a diagnostic tool for sensitive, accurate, fast, and quantitative detection of the smut pathogen especially for asymptomatic seed cane or plants and evaluation of smut resistance of sugarcane genotypes.

  13. Variants of sequence family B Thermococcus kodakaraensis DNA polymerase with increased mismatch extension selectivity.

    Claudia Huber

    Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.

  14. Associations of Cholesteryl Ester Transfer Protein TaqIB Polymorphism with the Composite Ischemic Cardiovascular Disease Risk and HDL-C Concentrations: A Meta-Analysis

    Shu-xia Guo

    2016-09-01

    Full Text Available Background: Previous studies have evaluated the associations between the cholesteryl ester transfer protein (CETP TaqIB polymorphism (rs708272, the risk of developing composite ischemic cardiovascular disease (CVD and the concentration of high-density lipoprotein cholesterol (HDL-C, but results remain controversial. The objective of this study was to investigate whether a relationship exists between these factors. Methods: We conducted a meta-analysis of available studies to clarify the associations of the CETP TaqIB polymorphism with HDL-C concentration and the composite ischemic CVD risk in both Asians and Caucasians. All statistical analyses were done with Stata 12.0. Results: Through utilization of the Cochrane Library, Embase, PubMed, Web of Science, Springer, China Science and Technology Journal Database, China National Knowledge Infrastructure, Google Scholar, and Baidu Library, a total of 45 studies from 44 papers with 20,866 cases and 21,298 controls were combined showing a significant association between the CETP TaqIB variant and composite ischemic CVD risk. Carriers of allele TaqIB-B1 were found to have a higher risk of composite ischemic CVD than non-carriers: OR = 1.15, 95% CI = 1.09–1.21, p < 0.001. Meanwhile, 28 studies with 23,959 subjects were included in the association between the CETP TaqIB polymorphism and the concentration of HDL-C. Results suggested that carriers of the B1B1 genotype had lower concentrations of HDL-C than those of the B2B2 genotype: SMD = 0.50, 95% CI = 0.36–0.65, p < 0.001. Conclusions: The synthesis of available evidence demonstrates that the CETP TaqIB polymorphism protects against composite ischemic CVD risk and is associated with a higher HDL-C concentration in both Asians and Caucasians.

  15. Measurement of Epstein-Barr virus DNA loads in whole blood and plasma by TaqMan PCR and in peripheral blood lymphocytes by competitive PCR.

    Wadowsky, Robert M; Laus, Stella; Green, Michael; Webber, Steven A; Rowe, David

    2003-11-01

    Epstein-Barr virus (EBV) DNA load values were measured in samples of whole blood (n = 60) and plasma (n = 59) by TaqMan PCR and in samples of peripheral blood lymphocytes (PBLs) (n = 60) by competitive PCR (cPCR). The samples were obtained from 44 transplant recipients. The whole-blood and PBL loads correlated highly (r(2) > 0.900), whereas the plasma and PBL loads correlated poorly (r(2) = 0.512). Testing of whole blood by TaqMan PCR is an acceptable alternative to testing of PBLs by cPCR for quantifying EBV DNA load.

  16. Performance evaluation of the new Roche cobas AmpliPrep/cobas TaqMan HCV test, version 2.0, for detection and quantification of hepatitis C virus RNA

    S.D. Pas (Suzan); R. Molenkamp (Richard); J. Schinkel (Janke); S. Rebers; C. Copra (Cederick); S. Seven-Deniz; D. Thamke (Diana); R.J. de Knegt (Robert); B.L. Haagmans (Bart); M. Schutten (Martin)

    2013-01-01

    textabstractTo evaluate the analytical performance and explore the clinical applicability of the new Roche cobas AmpliPrep/cobas TaqMan HCV test, v2.0 (CAP/CTM v2.0), a platform comparison was performed on panels and diagnostic samples with the Roche cobas AmpliPrep/cobas TaqMan HCV test (CAP/CTM

  17. A new building block for DNA network formation by self-assembly and polymerase chain reaction.

    Bußkamp, Holger; Keller, Sascha; Robotta, Marta; Drescher, Malte; Marx, Andreas

    2014-01-01

    The predictability of DNA self-assembly is exploited in many nanotechnological approaches. Inspired by naturally existing self-assembled DNA architectures, branched DNA has been developed that allows self-assembly to predesigned architectures with dimensions on the nanometer scale. DNA is an attractive material for generation of nanostructures due to a plethora of enzymes which modify DNA with high accuracy, providing a toolbox for many different manipulations to construct nanometer scaled objects. We present a straightforward synthesis of a rigid DNA branching building block successfully used for the generation of DNA networks by self-assembly and network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel electrophoresis, atomic force microscopy, dynamic light scattering, and electron paramagnetic resonance spectroscopy. The findings indicate that rather rigid DNA networks were formed. This presents a new bottom-up approach for DNA material formation and might find applications like in the generation of functional hydrogels.

  18. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Luiz Tadeu M Figueiredo

    1997-05-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  19. Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism

    Gildo Almeida da Silva

    Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.

  20. Development of a Tandem Repeat-Based Polymerase Chain Displacement Reaction Method for Highly Sensitive Detection of 'Candidatus Liberibacter asiaticus'.

    Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong

    2018-02-01

    Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.

  1. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie

    2009-01-01

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  2. Vitamin-D receptor (VDR) gene polymorphisms (Taq-I & Apa-I) in Syrian healthy population.

    Haddad, Shaden

    2014-12-01

    The vitamin D endocrine system regulates bone metabolism and calcium homeostasis as well as cellular proliferation and differentiation. Vitamin D receptor (VDR) mediates Vit-D activity, thus VDR gene polymorphisms may correlate with different diseases. This study aimed to determine the distribution of VDR gene (Taq-I and Apa-I) polymorphisms using a RFLP in unrelated normal healthy individuals of Syrian population. Allelic frequencies were 65% vs 35% and 66% vs 34% for T vs t and A vs a alleles, respectively. Genotype distribution was 36%, 58% and 6% for TT, Tt and tt and 42%, 47% and 10% for AA, Aa and aa, respectively. These results demonstrate that the frequency and distribution of the VDR polymorphisms in Syrian population are different from other populations worldwide.

  3. A TaqMan real-time PCR assay for detection of Meloidogyne hapla in root galls and in soil

    Sapkota, Rumakanta; Skantar, Andrea M.; Nicolaisen, Mogens

    2016-01-01

    . haplaand showed no significant amplification of DNA from non-target nematodes. The assay was able to detect M. haplain a background of plant and soil DNA. A dilution series of M. haplaeggs in soil showed a high correlation ( R 2 = 0 . 95 , P ...Early detection and quantification of Meloidogyne haplain soil is essential for effective disease management. The purpose of this study was to develop a real-time PCR assay for detection of M. haplain soil. Primers and a TaqMan probe were designed for M. hapladetection. The assay detected M......-knot development in carrots by testing soils before planting. The assay could be useful for management decisions in carrot cultivation....

  4. Quantification of Paratrichodorus allius in DNA extracted from soil using TaqMan probe and SYBR green real-time PCR assays

    The ectoparasitic stubby root nematode Paratrichodorus allius transmits Tobacco rattle virus, which causes corky ringspot disease resulting in significant economic losses in the potato industry. This study developed a diagnostic method for direct quantification of P. allius from soil DNA using a Taq...

  5. Quantitative and specific detection of the biocontrol agent, Serratia plymuthica, in plant extracts using a real-time TaqMan® assay

    Czajkowski, R.L.; Wolf, van der J.M.

    2012-01-01

    A Serratia plymuthica-specific TaqMan® assay was designed based on the consensus nucleotide sequence from the 3'- end of the luxS gene present in all S. plymuthica strains tested. The specificity of the assay was demonstrated by testing 21 Serratia spp. strains and 30 isolates belonging to various

  6. The Association of DRD2 Gene TaqI Polymorphism with Attention Deficit Hyperactivity Disorder a Population Sample of Iranian Azeri-children

    Leila Mehdizadeh Fanid

    2016-05-01

    Full Text Available Background Attention deficit hyperactivity disorder (ADHD is a multi-factorial disorder that has defined by hyperactivity, impulsivity and attention deficits. Various neurotransmitters such as dopamine can play a role in its pathophysiology. The aim of this study was to examine the association of two common single nucleotide polymorphisms in DRD2 gene, Taq I A (T/C and Taq I B (G/A, with ADHA risk among Iranian-Azeri population. Materials and Methods A study of case–control association was performed with 89 samples with attention deficit hyperactivity disorder and 96 healthy subjects. Peripheral blood samples were used for Genomic DNA extraction by salting-out method. SNP genotyping was carried out by PCR-RFLP technique. The collected data were analyzed through javastant online statistics software, using Chi-square, with a significance level of 0.05. Results There was not a significant difference in the allele and genotype frequencies between ADHD and Taq1B polymorphism in cases and controls (P>0.05. In the Taq IA of DRD2 gene, TT homozygous dominants and CC homozygous recessives were more frequent in case group than in control group but significant difference was not observed (P>0.05. Also, T/C heterozygotes were more frequent among the control group than the case group, and difference was significant (P

  7. Use of a Real-Time PCR TaqMan Assay for Rapid Identification and Differentiation of Burkholderia pseudomallei and Burkholderia mallei

    U'Ren, Jana M.; Van Ert, Matthew N.; Schupp, James M.; Easterday, W. Ryan; Simonson, Tatum S.; Okinaka, Richard T.; Pearson, Talima; Keim, Paul

    2005-01-01

    A TaqMan allelic-discrimination assay designed around a synonymous single-nucleotide polymorphism was used to genotype Burkholderia pseudomallei and Burkholderia mallei isolates. The assay rapidly identifies and discriminates between these two highly pathogenic bacteria and does not cross-react with genetic near neighbors, such as Burkholderia thailandensis and Burkholderia cepacia.

  8. Quantitative and specific detection of the biocontrol agent, Serratia plymuthica, in plant extracts using a real-time TaqMan(A (R)) assay

    Czajkowski, R.L.; Van der Wolf, J.M.

    2012-01-01

    A Serratia plymuthica-specific TaqManA (R) assay was designed based on the consensus nucleotide sequence from the 3'- end of the luxS gene present in all S. plymuthica strains tested. The specificity of the assay was demonstrated by testing 21 Serratia spp. strains and 30 isolates belonging to

  9. Performance evaluation of the Cobas TaqMan MTB assay on respiratory specimens according to clinical application

    Jong Eun Park

    2017-11-01

    Full Text Available Objective: To evaluate the performance of the Cobas TaqMan MTB assay (Cobas assay with respect to its clinical application. Methods: This was a retrospective analysis of 1154 results from 1034 patients for whom mycobacterial cultures and the Cobas assay were performed simultaneously. Based on the patient medical records, two categories of clinical application were defined: (1 the diagnosis of patients with a high probability of pulmonary tuberculosis according to clinical and radiological features (n = 128, and (2 the exclusion of tuberculosis in clinically indeterminate patients (n = 1026. Standard culture was used as the reference method. Results: The sensitivity of the Cobas assay for the detection of Mycobacterium tuberculosis was 70.4% (95% confidence interval (CI 49.7–85.5% for category 1, but only 25.0% (95% CI 4.5–64.4% for category 2. The specificity was ≥95.0% for both categories. The positive predictive value was 79.2% (95% CI 57.3–92.1% for category 1 and 33.3% (95% CI 6.0–75.9% for category 2, while the negative predictive value was 92.3% (95% CI 85.0–96.4% for category 1 and 99.4% (95% CI 98.7–99.8% for category 2. Conclusions: The results of this study indicate that Cobas assay results must be interpreted carefully according to the clinical purpose of the assay. Keywords: Mycobacterium tuberculosis, Pulmonary tuberculosis, Cobas TaqMan MTB assay, Korea

  10. Primate community of the tropical rain forests of Saracá-Taqüera National Forest, Pará, Brazil

    LC. Oliveira

    Full Text Available Brazil is the richest country in the world in terms of primate species and the Amazonian rain forest is one of the richest biomes containing 15 (ca. 90% of the Neotropical primate genera. Although considered key elements in conservation strategies, there is only anecdotal information on primates for several protected areas within the region. Here we present new data on the community composition of the primates in the Saracá-Taqüera National Forest (429,600 ha, an actively mined, bauxite rich area, in Pará, Brazil. We used information from the literature, technical reports, museum data, and interviews conducted with agents from the Brazilian Institute of the Environment and Natural Renewable Resources (Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis - IBAMA and members of the local "Quilombo" community. In addition, from July 2003 to June 2007, we carried out 19 field trips ranging from 10 to15 days each, amounting to a total effort of 1,230 hours and 1,420 km of censuses, resulting in 1,034 records of eight primate species (Saguinus martinsi, Saguinus midas, Saimiri sciureus, Cebus apella, Pithecia pithecia, Chiropotes sagulatus, Ateles paniscus, and Alouatta macconelli. Two other species (Cebus olivaceus and Aotus trivirgatus were recorded only indirectly, through interviews and literature data. In all, Alouatta macconelli was the most frequently recorded species (43% of all records; while Saguinus midas and P. pithecia were the least (ca. 0.4 and 0.6% of all records. Based on our results, we discuss group sizes as well as taxonomic problems concerning the genera Pithecia and Chiropotes, for which we registered individuals displaying phenotypic geographical variation and two different forms, respectively. Despite the deforestation inherent in bauxite mining, the Saracá-Taqüera National Forest still has a remarkable richness of primate species. Our study results place this National Forest amongst the richest

  11. Real-Time Polymerase Chain Reaction Detection of Trichomonas vaginalis from vaginal swabs: Validation of a Diagnostic Method and Preliminary Epidemiological Application

    Carlo Mengoli

    2009-06-01

    Full Text Available Background Trichomonas vaginalis is the most common nonviral sexually trasmitted diseases (STDs agent. For females, the diagnostic gold standard is the culture of vaginal swab, which is labour-exacting.The direct microscopic examination of vaginal secretions is the most used approach, but its sensitivity depends on the skill of the observer. Objectives We evaluated an original real-time TaqMan-based Polymerase Chain Reaction (PCR technique.The scope of the study was to confirm the effectiveness of the molecular approach in a clinical context and to explore its relevance to an epidemiological investigation. Study Design a ß-tubulin gene was chosen as target sequence.The assay was designed to exploit the quantitative potential of the TaqMan procedure.The population sample was 583 adult females presenting at the Service from January 2005 to December 2005.Three vaginal swabs were collected from each patient, one for wet mount microscopy, one for broth culture, and one for the molecular assay. Results The prevalence was 3.3% (culture, 3.1% (microscopy, 3.8% (PCR.An excess risk was detected in the immigrant population (risk ratio by PCR = 28. Conclusions The molecular approach was the most accurate way to detect the protozoon.The real-time PCR is convenient in a busy laboratory, provided the necessary equipment is available, and it is suitable for epidemiological investigation.

  12. Structure and function of DNA polymerase μ

    Matsumoto, Takuro; Maezawa, So

    2013-01-01

    DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)

  13. Comparison of allelic discrimination by dHPLC, HRM, and TaqMan in the detection of BRAF mutation V600E.

    Carbonell, Pablo; Turpin, María C; Torres-Moreno, Daniel; Molina-Martínez, Irene; García-Solano, José; Perez-Guillermo, Miguel; Conesa-Zamora, Pablo

    2011-09-01

    The V600E mutation in the BRAF oncogene is associated with colorectal carcinomas, with mismatch-repair deficiency and, recently, with nonresponse to epidermal growth factor receptor inhibitor therapy. The use of reliable techniques for its detection is important. The aim of our study was to compare the performance characteristics in V600E detection of denaturing high-performance liquid chromatography (dHPLC) and high-resolution melting (HRM) with TaqMan allelic discrimination as well as direct-sequencing methods in a series of 195 colorectal paraffin-embedded specimens up to the age of 15 years. The effectiveness for obtaining results on mutation status was best using TaqMan (96.9%), followed by dHPLC (93.3%), HRM (88.7%), and sequencing (88.2%). In general, TaqMan was best for analyzing older tissues, whereas sequencing was the least efficient. Heterozygotic V600E was detected in 11.6%, 9.9%, 11.6%, and 9.9% of tissues using TaqMan, dHPLC, HRM, and sequencing, respectively. Result concordances between dHPLC and TaqMan or sequencing were excellent (κ = 0.9411 and κ = 0.8988, respectively); for HRM, the concordances were good (κ = 0.7973 and κ = 0.7488, respectively). By using DNA dilutions from tumor tissue, a minimum of 10% of V600E harboring cancer content was required for the analysis by dHPLC and HRM. dHPLC could detect four non-V600E mutations, whereas HRM detected one. Our results indicate that dHPLC and HRM are techniques that can be reliably used for the detection of the BRAFV600E mutation in archival paraffin-embedded tissues. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  14. Dopamine genes (DRD2/ANKK1-TaqA1 and DRD4-7R and executive function: their interaction with obesity.

    Mar Ariza

    Full Text Available Obesity is a multifactorial disease caused by the interaction between genotype and environment, and it is considered to be a type of addictive alteration. The A1 allele of the DRD2/ANKK1-TaqIA gene has been associated with addictive disorders, with obesity and with the performance in executive functions. The 7 repeat allele of the DRD4 gene has likewise been associated with the performance in executive functions, as well as with addictive behaviors and impulsivity. Participants were included in the obesity group (N = 42 if their body mass index (BMI was equal to or above 30, and in the lean group (N = 42 if their BMI was below 25. The DRD2/ANKK1-TaqIA and DRD4 VNTR polymorphisms were obtained. All subjects underwent neuropsychological assessment. Eating behavior traits were evaluated. The 'DRD2/ANKK1-TaqIA A1-allele status' had a significant effect on almost all the executive variables, but no significant 'DRD4 7R-allele status' effects were observed for any of the executive variables analyzed. There was a significant 'group' x 'DRD2/ANKK1-TaqIA A1-allele status' interaction effect on LN and 'group' x 'DRD4 7R-allele status' interaction effect on TMT B-A score. Being obese and a carrier of the A1 allele of DRD2/ANKK1-TaqIA or the 7R allele of DRD4 VNTR polymorphisms could confer a weakness as regards the performance of executive functions.

  15. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-01

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

  16. Towards the molecular bases of polymerase dynamics

    Chela Flores, J.

    1991-03-01

    One aspect of the strong relationship that is known to exist between the processes of DNA replication and transcription is manifest in the coupling of the rates of movement of the replication fork (r f ) and RNA polymerase (r t ). We address two issues concerning the largely unexplored area of polymerase dynamics: (i) The validity of an approximate kinematic formula linking r f and r t suggested by experiments in which transcription is initiated in some prokaryotes with the antibiotic streptolydigin, and (ii) What are the molecular bases of the kinematic formula? An analysis of the available data suggests possible molecular bases for polymerase dynamics. In particular, we are led to a hypothesis: In active chromatin r t may depend on the length (λ t ) of the transcript of the primary messenger RNA (pre-mRNA). This new effect is subject to experimental verification. We discuss possible experiments that may be performed in order to test this prediction. (author). Refs, 6 tabs

  17. Development of a Quantitative TaqMan(trademark)-PCR Assay and Feasibility of Atmosphoric Collection for Coccidioides Immits for Ecological Studies

    Daniels, J.I.; Wilson, W.J.; DeSantis, T.Z.; Gouveia, F.J.; Anderson, G.L.; Shinn, J.H.; Pletcher, R.; Johnson, S.M.; Pappagianis, D.

    2002-01-01

    Understanding and then modeling the complex relationships between environmental, climatological, and biological systems can present great opportunities for developing effective strategies to prevent outbreaks of environmentally linked infectious disease. For example, a report from the American Academy of Microbiology (Rose et al., 2001) points out that including climatic signals and ecological triggers into the decision making process for disease management, is going to be essential for developing a proactive approach for protecting public health, and circumventing the practice of having to wait for clinical cases to appear before any action is taken. To meet this grand challenge, specific and sensitive analytical techniques and effective collection devices are required for finding the microorganisms of concern in environmentally relevant media (air, soil, water, vegetation, etc.), and a multidisciplinary approach is needed for evaluating all of the environmental and biological data and building the applicable predictive models. In this study, the unique capabilities in biotechnology and environmental science available at Lawrence Livermore National Laboratory (LLNL) are combined with the distinguished and highly regarded expertise for clinically investigating and treating infectious disease at the Department of Microbiology and Immunology in the School of Medicine of the University of California, Davis, in order to develop, standardize, validate, and test safely the feasibility of applying advanced polymerase chain reaction (PCR) technology and new air-sample collection media that would be appropriate for addressing comprehensively the environmentally linked, medically important infectious disease Valley Fever (coccidioidomycosis). The responsible agent for this disease is the airborne spore (arthroconidia) of the pathogenic fungus Coccidioides immitis, which is a microorganism that is endemic to California, Arizona, and the southwestern United States, and also is

  18. RNA Polymerase II–The Transcription Machine

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 3. RNA Polymerase II – The Transcription Machine - Nobel Prize in Chemistry 2006. Jiyoti Verma Aruna Naorem Anand Kumar Manimala Sen Parag Sadhale. General Article Volume 12 Issue 3 March 2007 pp 47-53 ...

  19. RNA polymerase II collision interrupts convergent transcription

    Hobson, David J; Wei, Wu; Steinmetz, Lars M

    2012-01-01

    Antisense noncoding transcripts, genes-within-genes, and convergent gene pairs are prevalent among eukaryotes. The existence of such transcription units raises the question of what happens when RNA polymerase II (RNAPII) molecules collide head-to-head. Here we use a combination of biochemical...

  20. RNA polymerase of the killer virus of yeast

    Georgopoulos, D.E.; Leibowitz, M.J.

    1984-01-01

    The L/sub A/ and M double-stranded (ds) RNA segments of the cytoplasmically inherited killer virus of Saccharomyces cerevisiae are encapsidated in virions that contain a DNA-independent transcriptase activity. This enzyme catalyzes the synthesis of full-length (+) stranded copies of the genomic dsRNA segments, denoted l/sub A/ and m. The L/sub A/ dsRNA segment appears to encode the major capsid protein in which both dsRNA molecules are encapsidated, while M dsRNA encodes products responsible for the two killer phenotypes of toxin production and resistance to toxin. Proteins extracted from transcriptionally active virions fail to cross-react with antibody to yeast DNA-dependent RNA polymerases, suggesting that none of the subunits of the host cell polymerases are active in viral transcription. Sequence analysis of the in vitro transcripts reveals neither to be 3'-terminally polyadenylated, although m contains an apparent internal polyA-like tract. In the presence of any three ribonucleoside triphosphates (0.5 mM), the fourth ribonucleoside triphosphate shows an optimal rate of incorporation into transcript at a concentration of 20 μM. However, in a 3-hour reaction, the yield of a product RNA increases with the concentration of the limiting ribonucleotide up to 0.5 mM. Gel electrophoresis of the reaction products reveals that increasing the substrate concentration accelerates the appearance of radioactivity in full-length l/sub A/ and m transcripts

  1. A polymerase chain reaction strategy for the diagnosis of camelpox.

    Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

    2009-03-01

    Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

  2. Real-time polymerase chain reaction-based approach for quantification of the pat gene in the T25 Zea mays event.

    Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy

    2004-01-01

    In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement

  3. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  4. Functional roles of DNA polymerases β and γ

    Huebscher, U.; Kuenzle, C.C.; Spadari, S.

    1979-01-01

    The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded

  5. A TaqMan real-time PCR-based assay for the identification of Fasciola spp.

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-30

    Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Association of Taq I, Fok I and Apa I polymorphisms in Vitamin D Receptor (VDR) gene with leprosy.

    Neela, Venkata Sanjeev Kumar; Suryadevara, Naveen Chandra; Shinde, Vidya Gouri; Pydi, Satya Sudheer; Jain, Suman; Jonnalagada, Subbanna; Singh, Surya Satyanarayana; Valluri, Vijaya Lakshmi; Anandaraj, M P J S

    2015-06-01

    Vitamin D Receptor (VDR) is a transacting transcription factor which mediates immunomodulatory function and plays a key role in innate and adaptive immune responses through its ligand and polymorphisms in VDR gene may affect its regulatory function. To investigate the association of three VDR gene polymorphisms (TaqI rs731236, FokI rs2228570 and ApaI rs7975232) with leprosy. The study group includes 404 participants of which 222 were leprosy patients (paucibacillary=87, multibacillary=135) and 182 healthy controls. Genotyping was done using PCR-RFLP technique. Statistical analysis was performed using SNP Stats and PLINK software. The VDR FokI (rs2228570) ff genotype, ApaI (rs7975232) AA, Aa genotype and haplotype T-f-a, T-F-A were positively associated with leprosy when compared to healthy controls. The two variants at Fok and Apa positions in VDR gene are significantly associated with leprosy. Genotypes at FokI (ff), ApaI (aa) and haplotype (T-F-a, T-f-a) may contribute to the risk of developing leprosy by altering VDR phenotype/levels subsequently modulation of immune response. Copyright © 2015 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  7. Detection and Quantification of Methyl tert-Butyl Ether-Degrading Strain PM1 by Real-Time TaqMan PCR

    Hristova, Krassimira R.; Lutenegger, Christian M.; Scow, Kate M.

    2001-01-01

    The fuel oxygenate methyl tert-butyl ether (MTBE), a widely distributed groundwater contaminant, shows potential for treatment by in situ bioremediation. The bacterial strain PM1 rapidly mineralizes and grows on MTBE in laboratory cultures and can degrade the contaminant when inoculated into groundwater or soil microcosms. We applied the TaqMan quantitative PCR method to detect and quantify strain PM1 in laboratory and field samples. Specific primers and probes were designed for the 16S ribos...

  8. Competitive fitness during feast and famine: how SOS DNA polymerases influence physiology and evolution in Escherichia coli.

    Corzett, Christopher H; Goodman, Myron F; Finkel, Steven E

    2013-06-01

    Escherichia coli DNA polymerases (Pol) II, IV, and V serve dual roles by facilitating efficient translesion DNA synthesis while simultaneously introducing genetic variation that can promote adaptive evolution. Here we show that these alternative polymerases are induced as cells transition from exponential to long-term stationary-phase growth in the absence of induction of the SOS regulon by external agents that damage DNA. By monitoring the relative fitness of isogenic mutant strains expressing only one alternative polymerase over time, spanning hours to weeks, we establish distinct growth phase-dependent hierarchies of polymerase mutant strain competitiveness. Pol II confers a significant physiological advantage by facilitating efficient replication and creating genetic diversity during periods of rapid growth. Pol IV and Pol V make the largest contributions to evolutionary fitness during long-term stationary phase. Consistent with their roles providing both a physiological and an adaptive advantage during stationary phase, the expression patterns of all three SOS polymerases change during the transition from log phase to long-term stationary phase. Compared to the alternative polymerases, Pol III transcription dominates during mid-exponential phase; however, its abundance decreases to SOS induction by exogenous agents and indicate that cell populations require appropriate expression of all three alternative DNA polymerases during exponential, stationary, and long-term stationary phases to attain optimal fitness and undergo adaptive evolution.

  9. Prediction of Active Site and Distal Residues in E. coli DNA Polymerase III alpha Polymerase Activity.

    Parasuram, Ramya; Coulther, Timothy A; Hollander, Judith M; Keston-Smith, Elise; Ondrechen, Mary Jo; Beuning, Penny J

    2018-02-20

    The process of DNA replication is carried out with high efficiency and accuracy by DNA polymerases. The replicative polymerase in E. coli is DNA Pol III, which is a complex of 10 different subunits that coordinates simultaneous replication on the leading and lagging strands. The 1160-residue Pol III alpha subunit is responsible for the polymerase activity and copies DNA accurately, making one error per 10 5 nucleotide incorporations. The goal of this research is to determine the residues that contribute to the activity of the polymerase subunit. Homology modeling and the computational methods of THEMATICS and POOL were used to predict functionally important amino acid residues through their computed chemical properties. Site-directed mutagenesis and biochemical assays were used to validate these predictions. Primer extension, steady-state single-nucleotide incorporation kinetics, and thermal denaturation assays were performed to understand the contribution of these residues to the function of the polymerase. This work shows that the top 15 residues predicted by POOL, a set that includes the three previously known catalytic aspartate residues, seven remote residues, plus five previously unexplored first-layer residues, are important for function. Six previously unidentified residues, R362, D405, K553, Y686, E688, and H760, are each essential to Pol III activity; three additional residues, Y340, R390, and K758, play important roles in activity.

  10. Biochemical characterization of enzyme fidelity of influenza A virus RNA polymerase complex.

    Shilpa Aggarwal

    2010-04-01

    Full Text Available It is widely accepted that the highly error prone replication process of influenza A virus (IAV, together with viral genome assortment, facilitates the efficient evolutionary capacity of IAV. Therefore, it has been logically assumed that the enzyme responsible for viral RNA replication process, influenza virus type A RNA polymerase (IAV Pol, is a highly error-prone polymerase which provides the genomic mutations necessary for viral evolution and host adaptation. Importantly, however, the actual enzyme fidelity of IAV RNA polymerase has never been characterized.Here we established new biochemical assay conditions that enabled us to assess both polymerase activity with physiological NTP pools and enzyme fidelity of IAV Pol. We report that IAV Pol displays highly active RNA-dependent RNA polymerase activity at unbiased physiological NTP substrate concentrations. With this robust enzyme activity, for the first time, we were able to compare the enzyme fidelity of IAV Pol complex with that of bacterial phage T7 RNA polymerase and the reverse transcriptases (RT of human immunodeficiency virus (HIV-1 and murine leukemia virus (MuLV, which are known to be low and high fidelity enzymes, respectively. We observed that IAV Pol displayed significantly higher fidelity than HIV-1 RT and T7 RNA polymerase and equivalent or higher fidelity than MuLV RT. In addition, the IAV Pol complex showed increased fidelity at lower temperatures. Moreover, upon replacement of Mg(++ with Mn(++, IAV Pol displayed increased polymerase activity, but with significantly reduced processivity, and misincorporation was slightly elevated in the presence of Mn(++. Finally, when the IAV nucleoprotein (NP was included in the reactions, the IAV Pol complex exhibited enhanced polymerase activity with increased fidelity.Our study indicates that IAV Pol is a high fidelity enzyme. We envision that the high fidelity nature of IAV Pol may be important to counter-balance the multiple rounds of

  11. The Influence of Ḥāfiẓ on Muḥammad Taqī Bahār

    Bahman Solati

    2016-06-01

    Full Text Available Looking through the eyes of Persian culture, we see that man is not all noetic; he is not driven by intellect or consistent in his use of reason. On the contrary, he is most moved by emotion. A perfect example: Persian philosophy is most commonly uttered in both poetry and prose. This is, I believe, where the brilliance of Persians rests, in the beauty of its language and the expression of its culture. The endurance of Iranian literature and language over two and a half millennia is remarkable and thus deserving of both thorough research and an in-depth study. Here, I attempt to demonstrate the influence of Ḥāfiẓ, one of the greatest classical poets of Persia who ever lived, on the thoughts, poetic language, and philosophy of the gifted nineteenth-century Persian poet Muḥammad Taqī Bahār, otherwise known as Malik al-Shu‘arā. I will accomplish this feat through close readings of the parts of Ḥāfiẓ’s poems and juxtapose them with Bahār’s poems. My contention here, is to demonstrate any direct or indirect influence Ḥāfiẓ had on Bahār, and to also measure the extent of Ḥāfiẓ’s reception during Bahār’s period. With some modifications, the translations of Ḥāfiẓ’s ghazals used herein follow those of Peter Avery, while other translations throughout the book are my own, unless otherwise stated. Keywords: Persian literature, languages, Persian contemporary and classical poetry, Hafiz, Styles and manners

  12. The potential of TaqMan Array Cards for detection of multiple biological agents by real-time PCR.

    Phillip A Rachwal

    Full Text Available The TaqMan Array Card architecture, normally used for gene expression studies, was evaluated for its potential to detect multiple bacterial agents by real-time PCR. Ten PCR assays targeting five biological agents (Bacillus anthracis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, and Yersinia pestis were incorporated onto Array Cards. A comparison of PCR performance of each PCR in Array Card and singleplex format was conducted using DNA extracted from pure bacterial cultures. When 100 fg of agent DNA was added to Array Card channels the following levels of agent detection (where at least one agent PCR replicate returned a positive result were observed: Y. pestis 100%, B. mallei & F. tularensis 93%; B. anthracis 71%; B. pseudomallei 43%. For B. mallei & pseudomallei detection the BPM2 PCR, which detects both species, outperformed PCR assays specific to each organism indicating identification of the respective species would not be reproducible at the 100 fg level. Near 100% levels of detection were observed when 100 fg of DNA was added to each PCR in singleplex format with singleplex PCRs also returning sporadic positives at the 10 fg per PCR level. Before evaluating the use of Array Cards for the testing of environmental and clinical sample types, with potential levels of background DNA and PCR inhibitors, users would therefore have to accept a 10-fold reduction in sensitivity of PCR assays on the Array Card format, in order to benefit for the capacity to test multiple samples for multiple agents. A two PCR per agent strategy would allow the testing of 7 samples for the presence of 11 biological agents or 3 samples for 23 biological agents per card (with negative control channels.

  13. Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

    Yan, Guiping; Smiley, Richard W

    2010-03-01

    The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

  14. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  15. Chemical fidelity of an RNA polymerase ribozyme

    Attwater, J.; Tagami, S.; Kimoto, M.

    2013-01-01

    for function. Here we have explored the chemical fidelity, i.e. substrate selectivity and specificity for both single and multiple catalytic steps of the Z RNA polymerase ribozyme-a modern day analogue of the primordial RNA replicase. Using a wide range of nucleotide analogues and ionic conditions, we observe......The emergence of catalytically active RNA enzymes (ribozymes) is widely believed to have been an important transition in the origin of life. In the context of a likely heterogeneous chemical environment, substrate specificity and selectivity of these primordial enzymes would have been critical...

  16. Bordetella pertussis diagnosed by polymerase chain reaction

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...

  17. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    Laurent Dacheux

    2016-07-01

    Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

  18. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-07-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  19. RNA polymerase activity of Ustilago maydis virus

    Yie, S.W.

    1986-01-01

    Ustilago maydis virus has an RNA polymerase enzyme which is associated with virion capsids. In the presence of Mg/sup 2 +/ ion and ribonucleotide triphosphate, the enzyme catalyzes the in vitro synthesis of mRNA by using dsRNA as a template. The products of the UmV RNA polymerase were both ssRNA and dsRNA. The dsRNA was determined by characteristic mobilities in gel electrophoresis, lack of sensitivity to RNase, and specific hybridization tests. The ssRNAs were identified by elution from a CF-11 column and by their RNase sensitivity. On the basis of the size of ssRNAs, it was concluded that partial transcripts were produced from H dsRNA segments, and full length transcripts were produced from M and L dsRNA segments. The following observations indicates that transcription occurs by strand displacement; (1) Only the positive strand of M2 dsRNA was labeled by the in vitro reaction. (2) The M2 dsRNA which had been labeled with /sup 32/''P-UTP in vitro could be chased from dsRNA with unlabeled UTP. The transcription products of three UmV strains were compared, and the overall pattern of transcription was very similar among them.

  20. Replicative DNA polymerase mutations in cancer☆

    Heitzer, Ellen; Tomlinson, Ian

    2014-01-01

    Three DNA polymerases — Pol α, Pol δ and Pol ɛ — are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson–Crick base pairing and 3′exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to ‘polymerase proofreading associated polyposis’ (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an ‘ultramutator’ phenotype, with a dramatic increase in base substitutions. PMID:24583393

  1. Replicative DNA polymerase mutations in cancer.

    Heitzer, Ellen; Tomlinson, Ian

    2014-02-01

    Three DNA polymerases - Pol α, Pol δ and Pol ɛ - are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson-Crick base pairing and 3'exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to 'polymerase proofreading associated polyposis' (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an 'ultramutator' phenotype, with a dramatic increase in base substitutions. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Solving the RNA polymerase I structural puzzle

    Moreno-Morcillo, María [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Taylor, Nicholas M. I. [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); Gruene, Tim [Georg-August-University, Tammannstrasse 4, 37077 Göttingen (Germany); Legrand, Pierre [SOLEIL Synchrotron, L’Orme de Merisiers, Saint Aubin, Gif-sur-Yvette (France); Rashid, Umar J. [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Ruiz, Federico M. [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); Steuerwald, Ulrich; Müller, Christoph W. [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Fernández-Tornero, Carlos, E-mail: cftornero@cib.csic.es [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany)

    2014-10-01

    Details of the RNA polymerase I crystal structure determination provide a framework for solution of the structures of other multi-subunit complexes. Simple crystallographic experiments are described to extract relevant biological information such as the location of the enzyme active site. Knowing the structure of multi-subunit complexes is critical to understand basic cellular functions. However, when crystals of these complexes can be obtained they rarely diffract beyond 3 Å resolution, which complicates X-ray structure determination and refinement. The crystal structure of RNA polymerase I, an essential cellular machine that synthesizes the precursor of ribosomal RNA in the nucleolus of eukaryotic cells, has recently been solved. Here, the crucial steps that were undertaken to build the atomic model of this multi-subunit enzyme are reported, emphasizing how simple crystallographic experiments can be used to extract relevant biological information. In particular, this report discusses the combination of poor molecular replacement and experimental phases, the application of multi-crystal averaging and the use of anomalous scatterers as sequence markers to guide tracing and to locate the active site. The methods outlined here will likely serve as a reference for future structural determination of large complexes at low resolution.

  3. DNA repair synthesis in human fibroblasts requires DNA polymerase delta

    Nishida, C.; Reinhard, P.; Linn, S.

    1988-01-01

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

  4. Novel Polymerase Gene Mutations for Human Adaptation in Clinical Isolates of Avian H5N1 Influenza Viruses.

    Yasuha Arai

    2016-04-01

    Full Text Available A major determinant in the change of the avian influenza virus host range to humans is the E627K substitution in the PB2 polymerase protein. However, the polymerase activity of avian influenza viruses with a single PB2-E627K mutation is still lower than that of seasonal human influenza viruses, implying that avian viruses require polymerase mutations in addition to PB2-627K for human adaptation. Here, we used a database search of H5N1 clade 2.2.1 virus sequences with the PB2-627K mutation to identify other polymerase adaptation mutations that have been selected in infected patients. Several of the mutations identified acted cooperatively with PB2-627K to increase viral growth in human airway epithelial cells and mouse lungs. These mutations were in multiple domains of the polymerase complex other than the PB2-627 domain, highlighting a complicated avian-to-human adaptation pathway of avian influenza viruses. Thus, H5N1 viruses could rapidly acquire multiple polymerase mutations that function cooperatively with PB2-627K in infected patients for optimal human adaptation.

  5. Construction, Expression, and Characterization of Recombinant Pfu DNA Polymerase in Escherichia coli.

    Zheng, Wenjun; Wang, Qingsong; Bi, Qun

    2016-04-01

    Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.

  6. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  7. Clinical evaluation of a quantitative real time polymerase chain reaction assay for diagnosis of primary Epstein-Barr virus infection in children.

    Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M

    2003-08-01

    Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all

  8. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

    Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

    2017-06-01

    A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Development of SYBR Green and TaqMan quantitative real-time PCR assays for hepatopancreatic parvovirus (HPV) infecting Penaeus monodon in India.

    Yadav, Reena; Paria, Anutosh; Mankame, Smruti; Makesh, M; Chaudhari, Aparna; Rajendran, K V

    2015-12-01

    Hepatopancreatic parvovirus (HPV) infects Penaeus monodon and causes mortality in the larval stages. Further, it has been implicated in the growth retardation in cultured P. monodon. Though different geographical isolates of HPV show large sequence variations, a sensitive PCR assay specific to Indian isolate has not yet been reported. Here, we developed a sensitive SYBR Green-based and TaqMan real-time PCR for the detection and quantification of the virus. A 441-bp PCR amplicon was cloned in pTZ57 R/T vector and the plasmid copy number was estimated. A 10-fold serial dilution of the plasmid DNA from 1 × 10(9) copies to 1 copy was prepared and used as the standard. The primers were tested initially using the standard on a conventional PCR format to determine the linearity of detection. The standards were further tested on real-time PCR format using SYBR Green and TaqMan chemistry and standard curves were generated based on the Ct values from three well replicates for each dilution. The assays were found to be sensitive, specific and reproducible with a wide dynamic range (1 × 10(9) to 10 copies) with coefficient of regression (R(2)) > 0.99, calculated average slope -3.196 for SYBR Green assay whereas, for TaqMan assay it was >0.99 and -3.367, respectively. The intra- and inter-assay variance of the Ct values ranged from 0.26% to 0.94% and 0.12% to 0.81%, respectively, for SYBR Green assay, and the inter-assay variance of the Ct values for TaqMan assay ranged from 0.07% to 1.93%. The specificity of the assays was proved by testing other DNA viruses of shrimp such as WSSV, IHHNV and MBV. Standardized assays were further tested to detect and quantify HPV in the post-larvae of P. monodon. The result was further compared with conventional PCR to test the reproducibility of the test. The assay was also used to screen Litopeneaus vannamei, Macrobrachium rosenbergii and Scylla serrata for HPV. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. DNA polymerase ι: The long and the short of it!

    Frank, Ekaterina G; McLenigan, Mary P; McDonald, John P; Huston, Donald; Mead, Samantha; Woodgate, Roger

    2017-10-01

    The cDNA encoding human DNA polymerase ι (POLI) was cloned in 1999. At that time, it was believed that the POLI gene encoded a protein of 715 amino acids. Advances in DNA sequencing technologies led to the realization that there is an upstream, in-frame initiation codon that would encode a DNA polymerase ι (polι) protein of 740 amino acids. The extra 25 amino acid region is rich in acidic residues (11/25) and is reasonably conserved in eukaryotes ranging from fish to humans. As a consequence, the curated Reference Sequence (RefSeq) database identified polι as a 740 amino acid protein. However, the existence of the 740 amino acid polι has never been shown experimentally. Using highly specific antibodies to the 25 N-terminal amino acids of polι, we were unable to detect the longer 740 amino acid (ι-long) isoform in western blots. However, trace amounts of the ι-long isoform were detected after enrichment by immunoprecipitation. One might argue that the longer isoform may have a distinct biological function, if it exhibits significant differences in its enzymatic properties from the shorter, well-characterized 715 amino acid polι. We therefore purified and characterized recombinant full-length (740 amino acid) polι-long and compared it to full-length (715 amino acid) polι-short in vitro. The metal ion requirements for optimal catalytic activity differ slightly between ι-long and ι-short, but under optimal conditions, both isoforms exhibit indistinguishable enzymatic properties in vitro. We also report that like ι-short, the ι-long isoform can be monoubiquitinated and polyubiuquitinated in vivo, as well as form damage induced foci in vivo. We conclude that the predominant isoform of DNA polι in human cells is the shorter 715 amino acid protein and that if, or when, expressed, the longer 740 amino acid isoform has identical properties to the considerably more abundant shorter isoform. Published by Elsevier B.V.

  11. Relación del polimorfismo TaqI del gen del receptor de la vitamina D con la lepra lepromatosa en población mexicana Association between the TaqI polymorphism of Vitamin D Receptor gene and lepromatous leprosy in a Mexican population sample

    Jesús Salvador Velarde Félix

    2009-02-01

    Full Text Available OBJETIVO: Determinar la relación del polimorfismo TaqI del gen del receptor de la vitamina D (RVD con la lepra lepromatosa (LL en individuos originarios de Sinaloa, México. MATERIAL Y MÉTODOS: Se amplificó un fragmento de 740 pb del gen RVD en muestras de ADN de 71 pacientes con LL y 144 controles en el Hospital General de Culiacán durante el periodo 2004-2007. El polimorfismo se identificó mediante la endonucleasa TaqI. RESULTADOS: Se observó un aumento de relevancia estadística del genotipo TT en pacientes con LL en comparación con los controles (p= 0.040; RM= 1.82. CONCLUSIÓN: Se demuestra un nexo entre el genotipo TT y la susceptibilidad a la LL.OBJETIVE: To establish the association of the vitamin D receptor gene TaqI polymorphism with lepromatous leprosy (LL in individuals from Sinaloa, Mexico. MATERIAL AND METHODS: A 740 bp fragment was amplified from the VDR gene in DNA samples of 71 patients with LL and 144 controls in the Hospital General de Culiacán during 2004-2007. Polymorphism was identified through TaqI endonuclease. RESULTS: A significant increase in the genotype TT of the VDR gene was observed in patients when compared to controls (p = 0.040; OR = 1.82. CONCLUSIONS: Our data support the association between the TT genotype and susceptibility to LL in this Mexican population.

  12. Specific Reaction Patterns to Distinct Positive Emotional Cues Related to Incentive Motivation in Dependence of the Taq1A-Polymorphism: Molecular Genetic Associations of Early and Late Event-Related Potentials.

    Munk, Aisha J L; Wielpuetz, Catrin; Osinsky, Roman; Müller, Erik M; Grant, Phillip; Hennig, Jürgen

    2016-01-01

    Early and late event-related potential (ERP) responses, representing early subconscious and late motivational processes, were recorded for positive emotional words related to 'wanting' and 'liking', in dependence of the dopamine-related Taq1A genotype (ANKK1/DRD2). Research suggests that 'wanting' as opposed to 'liking' is related to dopaminergic processes. Therefore, it was hypothesized that risk allele carriers of the Taq1A polymorphism exhibit late ERP changes in reaction to words representing incentive motivation, i.e. 'wanting' (word categories 'lust' and 'anticipation'), but not to words representing 'liking' ('closeness'). Seventy-two male participants performed an emotional-word Stroop task during EEG recording and were genotyped according to the Taq1A polymorphism of ANKK1/DRD2. Positive emotional words related to anticipation and lust revealed blunted responses in the late positive potential (LPP) in carriers of the A1 allele, an effect absent in response to 'liking'-related words. These differences were not evident in the earlier posterior negativity (EPN). As no differences in dependence of the Taq1A genotype were observed in reaction to 'wanting'- and 'liking'-related words in the EPN, but merely in the LPP, it can be assumed that incentive-motivational stimuli only modify motivation-related ERP responses in carriers of the A1 allele of the Taq1A polymorphism, indicating the role of dopamine in late ERP components. © 2016 S. Karger AG, Basel.

  13. Pathogen detection by the polymerase chain reaction

    Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

    1994-05-01

    In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

  14. Polymerase chain reaction methods (PCR in agrobiotechnology

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  15. RNA binding and replication by the poliovirus RNA polymerase

    Oberste, M.S.

    1988-01-01

    RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to 32 P-labeled ribohomopolymeric RNAs was examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K a for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 x 10 9 M -1 . The polymerase binds to a subgenomic RNAs which contain the 3' end of the genome with a K a similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3' noncoding region

  16. Otimização de metodologia para o estudo de genes KIR Methodology optimization for KIR genotyping

    Cristiane Conceição Chagas Rudnick

    2010-06-01

    Full Text Available Receptores killer cell immunoglobulin-like (KIRs são moléculas localizadas na superfície de células natural killer (NK e em subpopulações de linfócitos T codificadas por genes do cromossomo 19q13.4. A interação entre receptores KIR e moléculas antígeno leucocitário humano (HLA de classe I determina se células NK exercerão ou não sua função citotóxica e/ou secretora de citocinas ou se esta será inibida. Este trabalho teve por finalidade otimizar a metodologia para a genotipagem KIR, baseando-se nas condições descritas por Martin (2004. A técnica utilizada foi a reação em cadeia da polimerase com primers de sequência específica (PCR-SSP com iniciadores sintetizados pela Invitrogen® e visualização do produto amplificado em gel de agarose a 2% com brometo de etídio. Adaptações foram realizadas e a concentração de alguns reagentes foi alterada, como a do controle interno de 100 nM para 150 nM, iniciadores específicos senso e antissenso de KIR12.5/12.3, KIR13.5/13.3, KIR14.5/14.3, KIR22.5/22.3 e KIR36.5/36.3 de 500 nM para 750 nM e da solução de MgCl2 de 1,5 mM para 2 mM. As concentrações dos demais reagentes e temperaturas de amplificação foram mantidas. Nessas condições, o uso da Taq DNA polimerase recombinante (Invitrogen® foi satisfatório. Os resultados das genotipagens de 70 indivíduos foram confirmados por rSSO-Luminex® (One Lambda, Canoga Park, CA, EUA. A tipagem de genes KIR por essa técnica apresentou sensibilidade, especificidade, reprodutibilidade e baixo custo.The killer cell immunoglobulin-like receptors (KIRs are molecules expressed on natural killer (NK cells surface and in T-cell subsets encoded by genes located in chromosome 19q13.4. The interaction between KIR receptors and HLA class I molecules determines if the NK cells will fulfill their cytotoxic function and/or cytokine secretion or if this function will be inhibited. The objective of this work was to optimize KIR genotyping method

  17. Development and evaluation of novel one-step TaqMan realtime RT-PCR assays for the detection and direct genotyping of genogroup I and II noroviruses

    Schultz, Anna Charlotte; Vega, Everado; Dalsgaard, Anders

    2011-01-01

    BackgroundCurrent detection and genotyping methods of genogroup (G) I and II noroviruses (NoVs) consist of a 2-step approach including detection of viral RNA by TaqMan realtime RT-PCR (RT-qPCR) followed by conventional RT-PCR and sequencing of partial regions of ORF1 or ORF2. ObjectiveTo develop ......Man RT-qPCR assays for the sensitive detection and direct genotyping of GI and GII NoVs from clinical and environmental matrices...... novel long-template one-step TaqMan assays (L-RT-qPCR) for the rapid detection and direct genotyping of GI and GII NoVs and to evaluate the sensitivity and specificity of the assays. Study designGI and GII-specific broadly reactive L-RT-qPCR assays were developed by combining existing NoV primers...... and probes targeting the open reading frame (ORF)1–ORF2 junction as well as region C at the 5′–ORF2. The assays were validated using GI and GII RNA transcripts and a coded panel of 75 stool samples containing NoV strains representing 9 GI genotypes and 12 GII genotypes, as well as sapoviruses, astroviruses...

  18. D2 dopamine receptor (DRD2) gene Taq1A polymorphism and the eating-related psychological traits in eating disorders (anorexia nervosa and bulimia) and obesity.

    Nisoli, E; Brunani, A; Borgomainerio, E; Tonello, C; Dioni, L; Briscini, L; Redaelli, G; Molinari, E; Cavagnini, F; Carruba, M O

    2007-06-01

    Food is considered a reinforcing agent, like a variety of substances such as alcohol and other drugs of abuse that produce pleasure. Psychopathological traits related to food intake are demonstrated in eating disorders as in obesity with different genetic aspects for these diseases. Recently, the prevalence of TaqA1 allele has been associated to alcohol, drug abuse and carbohydrate preference. For this reason, the aim of this study was to evaluate if the presence of A1 allele, in eating disorders and obesity, is associated with some particular psycho-pathological characteristics. We studied the presence of TaqA1 in Italian subjects affected by obesity (n=71), anorexia (n=28), bulimia (n=20) and in control group (n=54). The Eating Disorders Inventory (EDI test) was used to evaluate the psychological profiles. Patients without alcohol and drugs abuse were selected (>125 ml/day). The A1+ allele, both in A1/A1 and A1/A2 genotypes, was not differently distributed among disease groups; on the contrary two EDI subscales (Drive for thinness and Ineffectiveness) resulted associated with A1+ allele without effect of the eating disease or obesity. These results confirm that the presence of A1+ allele is not simply related to body weight but the A1+ allele might be a marker of a genetic psychological condition in people with high risk to develop pathological eating behaviour.

  19. Development and Validation of a TaqMan Real-Time PCR Assay for the Specific Detection and Quantification of Fusarium fujikuroi in Rice Plants and Seeds.

    Carneiro, Greice Amaral; Matić, Slavica; Ortu, Giuseppe; Garibaldi, Angelo; Spadaro, Davide; Gullino, Maria Lodovica

    2017-07-01

    Bakanae disease, which is caused by the seedborne pathogen Fusarium fujikuroi, is found throughout the world on rice. A TaqMan real-time PCR has been developed on the TEF 1-α gene to detect F. fujikuroi in different rice tissues. Three primer/probe sets were tested. The selected set produced an amplicon of 84 bp and was specific for F. fujikuroi with respect to eight Fusarium species of rice and six other rice common pathogens. The assay was validated for specificity, selectivity, sensitivity, repeatability, and reproducibility. The detection limit was set at 27.5 fg of DNA, which is approximately equivalent to one haploid genome of F. fujikuroi. The developed TaqMan real-time assay was able to efficiently detect and quantify F. fujikuroi from rice culms, leaves, roots, and seeds. At 1 week post-germination (wpg), the pathogen was more diffused in the green tissues, while at 3 wpg it was uniformly spread also in the roots. The highest concentration of F. fujikuroi was measured in the M6 cultivar, which showed around 1,450 fungal cells/g. The assay was sufficiently sensitive to detect a few genomic equivalents in the rice seeds, corresponding to 9.89 F. fujikuroi cells/g. The assay permitted bakanae disease to be detected in asymptomatic tissues at the early rice development stages.

  20. Lack of association between TaqI A1 Allele of dopamine D2 receptor gene and alcohol-use disorders in Atayal natives of Taiwan

    Chia-Hsiang Chen [Cheng Hsin Rehabilitation and Medical Center, Taipei (Taiwan, Province of China); Shih-Hsiang Chien; Hai-Gwo Hwu [National Taiwan Univ., Taipei (Taiwan, Province of China)

    1996-09-20

    Association studies between the A1 allele of the dopamine D2 receptor (DRD2) gene TaqI A polymorphism and alcoholism remain controversial. A recent study from Japan demonstrated that the A1 allele is associated with severe alcoholism in the Japanese population. We were interested in knowing if this association also exists in the Atayals of Taiwan, who were found to have a higher prevalence of alcohol-use disorders than the Han Chinese in Taiwan. Genotype and allele frequencies were determined in alcohol-abusing, alcohol-dependent, and nonalcoholic control Atayal natives in Taiwan. A1 allele frequencies in alcohol-dependent, alcohol-abusing, and normal control Atayals were 0.39, 0.42, and 0.39, respectively. No difference in A1 allele frequency was found among these three groups. Our data do not support the hypothesis that the A1 allele of the TaqI A polymorphism of the DRD2 gene increases susceptibility to alcohol-use disorders in the Atayals of Taiwan. 18 refs., 1 tab.

  1. Polymerase chain reaction to search for Herpes viruses in uveitic ...

    Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.

  2. A Double Polymerase Chain Reaction Method for Detecting African ...

    Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.

  3. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  4. Role of polymerase η in mitochondrial mutagenesis of Saccharomyces cerevisiae

    Chatterjee, Nimrat; Pabla, Ritu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States); Siede, Wolfram, E-mail: wolfram.siede@unthsc.edu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States)

    2013-02-08

    Highlights: ► DNA polymerase η is detectable in mitochondria of budding yeast. ► Pol η reduces UV-induced mitochondrial base pair substitutions and frameshifts. ► For UV-induced base pair substitutions, Pol η and Pol ζ interact epistatically. -- Abstract: DNA polymerase η mostly catalyzes an error-free bypass of the most frequent UV lesions, pyrimidine dimers of the cyclobutane-type. In addition to its nuclear localization, we show here for the first time its mitochondrial localization in budding yeast. In mitochondria, this polymerase improves bypass replication fidelity opposite UV damage as shown in base pair substitution and frameshift assays. For base pair substitutions, polymerase η appears to be related in function and epistatic to DNA polymerase ζ which, however, plays the opposite role in the nucleus.

  5. CDK9-dependent RNA polymerase II pausing controls transcription initiation.

    Gressel, Saskia; Schwalb, Björn; Decker, Tim Michael; Qin, Weihua; Leonhardt, Heinrich; Eick, Dirk; Cramer, Patrick

    2017-10-10

    Gene transcription can be activated by decreasing the duration of RNA polymerase II pausing in the promoter-proximal region, but how this is achieved remains unclear. Here we use a 'multi-omics' approach to demonstrate that the duration of polymerase pausing generally limits the productive frequency of transcription initiation in human cells ('pause-initiation limit'). We further engineer a human cell line to allow for specific and rapid inhibition of the P-TEFb kinase CDK9, which is implicated in polymerase pause release. CDK9 activity decreases the pause duration but also increases the productive initiation frequency. This shows that CDK9 stimulates release of paused polymerase and activates transcription by increasing the number of transcribing polymerases and thus the amount of mRNA synthesized per time. CDK9 activity is also associated with long-range chromatin interactions, suggesting that enhancers can influence the pause-initiation limit to regulate transcription.

  6. Kinetic mechanism of DNA polymerase I (Klenow)

    Kuchta, R.D.; Mizrahi, V.; Benkovic, P.A.; Johnson, K.A.; Benkovic, S.J.

    1987-01-01

    The minimal kinetic scheme for DNA polymerization catalyzed by the Klenow fragment of DNA polymerase I (KF) from Escherichia coli has been determined with short DNA oligomers of defined sequence, labeled with [ 32 P]-nucleotides. A key feature of this scheme is a minimal two-step sequence that interconverts the ternary KF-DNA/sub n/-dNTP and KF-DNA/sub n+1/-PP/sub i/ complexes. The rate is not limited by the actual polymerization but by a separate step, possibly important in ensuring fidelity. Evidence for this sequence is supplied by the observation of biphasic kinetics in single-turnover pyrophosphorolysis experiments (the microscopic reverse of polymerization). Data analysis then provides an estimate of the internal equilibrium constant. The dissociations of DNA, dNTP, and PP/sub i/ from the various binary and ternary complexes were measured by partitioning (isotope-trapping) experiments. The rate constant for DNA dissociation from KF is sequence dependent and is rate limiting during nonprocessive DNA synthesis. The combination of single-turnover (both directions) and isotope-trapping experiments provides sufficient information to permit a quantitative evaluation of the kinetic scheme for specific DNA sequences

  7. Validation of the DNATyper™15 PCR Genotyping System for Forensic Application

    Jian Ye; Chengtao Jiang; Xingchun Zhao; Le Wang; Caixia Li; Anquan Ji; Li Yuan; Jing Sun; Shuaifeng Chen

    2015-01-01

    We describe the optimization and validation of the DNATyper™15 multiplex polymerase chain reaction (PCR) genotyping system for autosomal short tandem repeat (STR) amplification at 14 autosomal loci (D6S1043, D21S11, D7S820, CSF1PO, D2S1338, D3S1358, D13S317, D8S1179, D16S539, Penta E, D5S818, vWA, D18S51, and FGA) and  amelogenin, a sex-determining locus. Several DNATyper™15 assay variables were optimized, including hot start Taq polymerase concentration, Taq polymerase activation time, magne...

  8. Standardization and application of real-time polymerase chain reaction for rapid detection of bluetongue virus

    I. Karthika Lakshmi

    2018-04-01

    Full Text Available Aim: The present study was designed to standardize real-time polymerase chain reaction (PCR for detecting the bluetongue virus from blood samples of sheep collected during outbreaks of bluetongue disease in the year 2014 in Andhra Pradesh and Telangana states of India. Materials and Methods: A 10-fold serial dilution of Plasmid PUC59 with bluetongue virus (BTV NS3 insert was used to plot the standard curve. BHK-21 and KC cells were used for in vitro propagation of virus BTV-9 at a TCID50/ml of 105 ml and RNA was isolated by the Trizol method. Both reverse transcription -PCR and real-time PCR using TaqMan probe were carried out with RNA extracted from virus-spiked culture medium and blood to compare the sensitivity by means of finding out the limit of detection (LoD. The results were verified by inoculating the detected and undetected dilutions onto cell cultures with further cytological (cytopathic effect and molecular confirmation (by BTV-NS1 group-specific PCR. The standardized technique was then applied to field samples (blood for detecting BTV. Results: The slope of the standard curve obtained was -3.23, and the efficiency was 103%. The LoD with RT-PCR was 8.269Ex103 number of copies of plasmid, whereas it was 13 with real-time PCR for plasmid dilutions. Similarly, LoD was determined for virus-spiked culture medium, and blood with both the types of PCR and the values were 103 TCID 50/ml and 104 TCID 50/ml with RT-PCR and 10° TCID 50/ml and 102 TCID 50/ml with real-time PCR, respectively. The standardized technique was applied to blood samples collected from BTV suspected animals; 10 among 20 samples were found positive with Cq values ranging from 27 to 39. The Cq value exhibiting samples were further processed in cell cultures and were confirmed to be BT positive. Likewise, Cq undetected samples on processing in cell cultures turned out to be BTV negative. Conclusion: Real-time PCR was found to be a very sensitive as well as reliable method

  9. Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

    Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

    2011-08-01

    DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

  10. Improved Safety for Molecular Diagnosis of Classical Rabies Viruses by Use of a TaqMan Real-Time Reverse Transcription-PCR "Double Check" Strategy

    Hoffmann, B.; Freuling, C. M.; Wakeley, P. R.

    2010-01-01

    To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus...... sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany......), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome...

  11. Rapid identification of tomato Sw-5 resistance-breaking isolates of Tomato spotted wilt virus using high resolution melting and TaqMan SNP Genotyping assays as allelic discrimination techniques.

    Valentina di Rienzo

    Full Text Available In tomato, resistance to Tomato spotted wilt virus (TSWV is conferred by the dominant gene, designated Sw-5. Virulent Sw-5 resistance breaking (SRB mutants of TSWV have been reported on Sw-5 tomato cultivars. Two different PCR-based allelic discrimination techniques, namely Custom TaqMan™ SNP Genotyping and high-resolution melting (HRM assays, were developed and compared for their ability to distinguish between avirulent (Sw-5 non-infecting, SNI and SRB biotypes. TaqMan assays proved to be more sensitive (threshold of detection in a range of 50-70 TSWV RNA copies and more reliable than HRM, assigning 25 TSWV isolates to their correct genotype with an accuracy of 100%. Moreover, the TaqMan SNP assays were further improved developing a rapid and simple protocol that included crude leaf extraction for RNA template preparations. On the other hand, HRM assays showed higher levels of sensitivity than TaqMan when used to co-detect both biotypes in different artificial mixtures. These diagnostic assays contributed to gain preliminary information on the epidemiology of TSWV isolates in open field conditions. In fact, the presented data suggest that SRB isolates are present as stable populations established year round, persisting on both winter (globe artichoke and summer (tomato crops, in the same cultivated areas of Southern Italy.

  12. The effect of the Taq1A variant in the dopamine D2 receptor gene and common CYP2D6 alleles on prolactin levels in risperidone-treated boys

    Roke, Y.; Harten, P.N. van; Franke, B.; Galesloot, T.E.; Boot, A.M.; Buitelaar, J.K.

    2013-01-01

    OBJECTIVE: To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders. METHODS:

  13. The effect of the Taq1A variant in the dopamine D-2 receptor gene and common CYP2D6 alleles on prolactin levels in risperidone-treated boys

    Roke, Yvette; van Harten, Peter N.; Franke, Barbara; Galesloot, Tessel E.; Boot, Annemieke M.; Buitelaar, Jan K.

    Objective To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders.Methods

  14. Assembling a dual purpose TaqMan-based panel of single-nucleotide polymorphism markers in rainbow trout and steelhead (Oncorhynchus mykiss) for association mapping and population genetics analysis

    Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede

    2011-01-01

    We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...

  15. Results of the Abbott RealTime HIV-1 Assay for Specimens Yielding “Target Not Detected” Results by the Cobas AmpliPrep/Cobas TaqMan HIV-1 Test▿

    Babady, N. Esther; Germer, Jeffrey J.; Yao, Joseph D. C.

    2009-01-01

    No significantly discordant results were observed between the Abbott RealTime HIV-1 assay and the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test (CTM) among 1,190 unique clinical plasma specimens obtained from laboratories located in 40 states representing all nine U.S. geographic regions and previously yielding “target not detected” results by CTM.

  16. Results of the Abbott RealTime HIV-1 assay for specimens yielding "target not detected" results by the Cobas AmpliPrep/Cobas TaqMan HIV-1 Test.

    Babady, N Esther; Germer, Jeffrey J; Yao, Joseph D C

    2010-03-01

    No significantly discordant results were observed between the Abbott RealTime HIV-1 assay and the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test (CTM) among 1,190 unique clinical plasma specimens obtained from laboratories located in 40 states representing all nine U.S. geographic regions and previously yielding "target not detected" results by CTM.

  17. Development of a TaqMan Array Card for Acute-Febrile-Illness Outbreak Investigation and Surveillance of Emerging Pathogens, Including Ebola Virus.

    Liu, Jie; Ochieng, Caroline; Wiersma, Steve; Ströher, Ute; Towner, Jonathan S; Whitmer, Shannon; Nichol, Stuart T; Moore, Christopher C; Kersh, Gilbert J; Kato, Cecilia; Sexton, Christopher; Petersen, Jeannine; Massung, Robert; Hercik, Christine; Crump, John A; Kibiki, Gibson; Maro, Athanasia; Mujaga, Buliga; Gratz, Jean; Jacob, Shevin T; Banura, Patrick; Scheld, W Michael; Juma, Bonventure; Onyango, Clayton O; Montgomery, Joel M; Houpt, Eric; Fields, Barry

    2016-01-01

    Acute febrile illness (AFI) is associated with substantial morbidity and mortality worldwide, yet an etiologic agent is often not identified. Convalescent-phase serology is impractical, blood culture is slow, and many pathogens are fastidious or impossible to cultivate. We developed a real-time PCR-based TaqMan array card (TAC) that can test six to eight samples within 2.5 h from sample to results and can simultaneously detect 26 AFI-associated organisms, including 15 viruses (chikungunya, Crimean-Congo hemorrhagic fever [CCHF] virus, dengue, Ebola virus, Bundibugyo virus, Sudan virus, hantaviruses [Hantaan and Seoul], hepatitis E, Marburg, Nipah virus, o'nyong-nyong virus, Rift Valley fever virus, West Nile virus, and yellow fever virus), 8 bacteria (Bartonella spp., Brucella spp., Coxiella burnetii, Leptospira spp., Rickettsia spp., Salmonella enterica and Salmonella enterica serovar Typhi, and Yersinia pestis), and 3 protozoa (Leishmania spp., Plasmodium spp., and Trypanosoma brucei). Two extrinsic controls (phocine herpesvirus 1 and bacteriophage MS2) were included to ensure extraction and amplification efficiency. Analytical validation was performed on spiked specimens for linearity, intra-assay precision, interassay precision, limit of detection, and specificity. The performance of the card on clinical specimens was evaluated with 1,050 blood samples by comparison to the individual real-time PCR assays, and the TAC exhibited an overall 88% (278/315; 95% confidence interval [CI], 84% to 92%) sensitivity and a 99% (5,261/5,326, 98% to 99%) specificity. This TaqMan array card can be used in field settings as a rapid screen for outbreak investigation or for the surveillance of pathogens, including Ebola virus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Development of a TaqMan Allelic Discrimination Assay for detection of Single Nucleotides Polymorphisms associated with anti-malarial drug resistance

    Kamau Edwin

    2012-01-01

    Full Text Available Abstract Background Anti-malarial drug resistance poses a threat to current global efforts towards control and elimination of malaria. Several methods are used in monitoring anti-malarial drug resistance. Molecular markers such as single nucleotide polymorphism (SNP for example are increasingly being used to identify genetic mutations related to anti-malarial drug resistance. Several methods are currently being used in analysis of SNP associated with anti-malarial drug resistance and although each one of these methods has unique strengths and shortcoming, there is still need to improve and/or develop new methods that will close the gap found in the current methods. Methods TaqMan Allelic Discrimination assays for detection of SNPs associated with anti-malarial drug resistance were designed for analysis on Applied Biosystems PCR platform. These assays were designed by submitting SNP sequences associated with anti-malarial drug resistance to Applied Biosystems website. Eleven SNPs associated with resistance to anti-malarial drugs were selected and tested. The performance of each SNP assay was tested by creating plasmid DNAs carrying codons of interests and analysing them for analysis. To test the sensitivity and specificity of each SNP assay, 12 clinical samples were sequenced at codons of interest and used in the analysis. Plasmid DNAs were used to establish the Limit of Detection (LoD for each assay. Results Data from genetic profiles of the Plasmodium falciparum laboratory strains and sequence data from 12 clinical samples was used as the reference method with which the performance of the SNP assays were compared to. The sensitivity and specificity of each SNP assay was establish at 100%. LoD for each assay was established at 2 GE, equivalent to less than 1 parasite/μL. SNP assays performed well in detecting mixed infection and analysis of clinical samples. Conclusion TaqMan Allelic Discrimination assay provides a good alternative tool in

  19. TaqMan real-time PCR assays for single-nucleotide polymorphisms which identify Francisella tularensis and its subspecies and subpopulations.

    Dawn N Birdsell

    Full Text Available Francisella tularensis, the etiologic agent of tularemia and a Class A Select Agent, is divided into three subspecies and multiple subpopulations that differ in virulence and geographic distribution. Given these differences, there is a need to rapidly and accurately determine if a strain is F. tularensis and, if it is, assign it to subspecies and subpopulation. We designed TaqMan real-time PCR genotyping assays using eleven single nucleotide polymorphisms (SNPs that were potentially specific to closely related groups within the genus Francisella, including numerous subpopulations within F. tularensis species. We performed extensive validation studies to test the specificity of these SNPs to particular populations by screening the assays across a set of 565 genetically and geographically diverse F. tularensis isolates and an additional 21 genetic near-neighbor (outgroup isolates. All eleven assays correctly determined the genetic groups of all 565 F. tularensis isolates. One assay differentiates F. tularensis, F. novicida, and F. hispaniensis from the more genetically distant F. philomiragia and Francisella-like endosymbionts. Another assay differentiates F. tularensis isolates from near neighbors. The remaining nine assays classify F. tularensis-confirmed isolates into F. tularensis subspecies and subpopulations. The genotyping accuracy of these nine assays diminished when tested on outgroup isolates (i.e. non F. tularensis, therefore a hierarchical approach of assay usage is recommended wherein the F. tularensis-specific assay is used before the nine downstream assays. Among F. tularensis isolates, all eleven assays were highly sensitive, consistently amplifying very low concentrations of DNA. Altogether, these eleven TaqMan real-time PCR assays represent a highly accurate, rapid, and sensitive means of identifying the species, subspecies, and subpopulation of any F. tularensis isolate if used in a step-wise hierarchical scheme. These assays

  20. No association between the TaqI A1 RFLP of the D2 receptor gene and alcoholism in a Mexican population

    Cruz-Fuentes, C.; Carmarena, B.; Eroza, V. [and others

    1994-09-01

    The suggested association of the A1 allele of the D2 dopamine receptor (DRD2) human gene with alcoholism was studied by comparing the DRD2/TaqI genotypes of 36 healthy controls and 38 individuals who met the DSM-III-R diagnostic criteria for alcohol dependence. All subjects were unrelated, with parents and grandparents of Mexican origin. The alcoholics in our sample suffered one of the following conditions: delirium tremens (16.6%), alcohol hallucinosis (56.6%) or uncomplicated alcohol withdrawal (26.4%). Eight-eight percent of the controls carried the A1 allele. The frequency of the DRD2 A1 allele in the Mexican urban sample (pA1 = 0.61) was 2 to 3-fold higher than reported in Caucasian populations from the USA and Europe, but similar to the allele frequencies found in defined Amerindian populations. There were not significant differences in the prevalence or allele frequency between alcoholics (pA1 = 0.64) and controls, regardless if the alcoholics were subtyped accordingly to severity, age of onset or positive family history. Alcoholics had higher scores than controls in the neuroticism (N) and psychoticism (P) subscales on the Eysenck personality test: alcoholics P = 6.2 {+-} 2.9, N = 16.0 {+-} 4.2 vs. controls P = 2.5 {+-} 2.3, N = 5.7 {+-} 5.1; p<0.001 and p<0.001, respectively. However, no relationship between personality traits and genotypes was found. Our results do not support a consistent association between the TaqI A1 RFLP for the DRD2 gene and alcoholism.

  1. Translesion DNA polymerases Pol ζ, Pol η, Pol ι, Pol κ and Rev1 are ...

    MADU

    Specialized DNA polymerases called translesion polymerases are among the major determinants of spontaneous and DNA damage-induced mutation in both prokaryotes and eukaryotes. (Livneh 2001). The classical replicative DNA polymerases can synthesize DNA with remarkable efficiency and fidelity.

  2. Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.

    Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L

    2018-03-27

    The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.

  3. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    zino

    2014-02-05

    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  4. The application of polymerase chain reaction-denaturing gradient ...

    Jane

    2011-05-23

    May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.

  5. Inhibiting DNA Polymerases as a Therapeutic Intervention against Cancer

    Anthony J. Berdis

    2017-11-01

    Full Text Available Inhibiting DNA synthesis is an important therapeutic strategy that is widely used to treat a number of hyperproliferative diseases including viral infections, autoimmune disorders, and cancer. This chapter describes two major categories of therapeutic agents used to inhibit DNA synthesis. The first category includes purine and pyrmidine nucleoside analogs that directly inhibit DNA polymerase activity. The second category includes DNA damaging agents including cisplatin and chlorambucil that modify the composition and structure of the nucleic acid substrate to indirectly inhibit DNA synthesis. Special emphasis is placed on describing the molecular mechanisms of these inhibitory effects against chromosomal and mitochondrial DNA polymerases. Discussions are also provided on the mechanisms associated with resistance to these therapeutic agents. A primary focus is toward understanding the roles of specialized DNA polymerases that by-pass DNA lesions produced by DNA damaging agents. Finally, a section is provided that describes emerging areas in developing new therapeutic strategies targeting specialized DNA polymerases.

  6. Hepatitis B virus DNA polymerase gene polymorphism based ...

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  7. Ubiquitylation and degradation of elongating RNA polymerase II

    Wilson, Marcus D; Harreman, Michelle; Svejstrup, Jesper Q

    2013-01-01

    During its journey across a gene, RNA polymerase II has to contend with a number of obstacles to its progression, including nucleosomes, DNA-binding proteins, DNA damage, and sequences that are intrinsically difficult to transcribe. Not surprisingly, a large number of elongation factors have....... In this review, we describe the mechanisms and factors responsible for the last resort mechanism of transcriptional elongation. This article is part of a Special Issue entitled: RNA polymerase II Transcript Elongation....

  8. Enhancement of DNA polymerase activity in potato tuber slices

    Watanabe, Akira; Imaseki, Hidemasa

    1977-01-01

    DNA polymerase was extracted from potato (Soleum tuberosum L.) tuber discs and the temporal correlation of its activity change to DNA synthesis in vivo was examined during aging of the discs. Most of the DNA polymerase was recovered as a bound form in the 18,000 x g precipitate. Reaction with the bound-form enzyme was dependent on the presence of four deoxynucleoside triphosphates, Mg 2+ , and a template. ''Activated'' DNA and heat-denatured DNA, but not native DNA, were utilized as templates. The polymerase activity was sensitive to SH reagents. Fresh discs, which do not synthesize DNA in vivo, contained a significant amount of DNA polymerase and its activity increased linearly with time until 48 hr after slicing and became four times that of fresh discs after 72 hr, whereas the activity of DNA synthesis in vivo increased with time and decreased after reaching a maximum at 30 hr. Cycloheximide inhibited the enhancement of polymerase activity. DNA polymerase from aged and fresh discs had identical requirements for deoxynucleotides and a template in their reactions, sensitivity to SH reagent, and affinity to thymidine triphosphate. (auth.)

  9. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  10. Optimisation of a quantitative polymerase chain reaction-based strategy for the detection and quantification of human herpesvirus 6 DNA in patients undergoing allogeneic haematopoietic stem cell transplantation

    Miriam YH Ueda

    2015-06-01

    Full Text Available Human herpesvirus 6 (HHV-6 may cause severe complications after haematopoietic stem cell transplantation (HSCT. Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance.

  11. Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

    R Mirnejad

    2011-01-01

    Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

  12. Dembo polymerase chain reaction technique for detection of bovine abortion, diarrhea, and respiratory disease complex infectious agents in potential vectors and reservoirs.

    Rahpaya, Sayed Samim; Tsuchiaka, Shinobu; Kishimoto, Mai; Oba, Mami; Katayama, Yukie; Nunomura, Yuka; Kokawa, Saki; Kimura, Takashi; Kobayashi, Atsushi; Kirino, Yumi; Okabayashi, Tamaki; Nonaka, Nariaki; Mekata, Hirohisa; Aoki, Hiroshi; Shiokawa, Mai; Umetsu, Moeko; Morita, Tatsushi; Hasebe, Ayako; Otsu, Keiko; Asai, Tetsuo; Yamaguchi, Tomohiro; Makino, Shinji; Murata, Yoshiteru; Abi, Ahmad Jan; Omatsu, Tsutomu; Mizutani, Tetsuya

    2018-05-31

    Bovine abortion, diarrhea, and respiratory disease complexes, caused by infectious agents, result in high and significant economic losses for the cattle industry. These pathogens are likely transmitted by various vectors and reservoirs including insects, birds, and rodents. However, experimental data supporting this possibility are scarce. We collected 117 samples and screened them for 44 bovine abortive, diarrheal, and respiratory disease complex pathogens by using Dembo polymerase chain reaction (PCR), which is based on TaqMan real-time PCR. Fifty-seven samples were positive for at least one pathogen, including bovine viral diarrhea virus, bovine enterovirus, Salmonella enterica ser. Dublin, Salmonella enterica ser. Typhimurium, and Neospora caninum ; some samples were positive for multiple pathogens. Bovine viral diarrhea virus and bovine enterovirus were the most frequently detected pathogens, especially in flies, suggesting an important role of flies in the transmission of these viruses. Additionally, we detected the N. caninum genome from a cockroach sample for the first time. Our data suggest that insects (particularly flies), birds, and rodents are potential vectors and reservoirs of abortion, diarrhea, and respiratory infectious agents, and that they may transmit more than one pathogen at the same time.

  13. Optimization and Optimal Control

    Chinchuluun, Altannar; Enkhbat, Rentsen; Tseveendorj, Ider

    2010-01-01

    During the last four decades there has been a remarkable development in optimization and optimal control. Due to its wide variety of applications, many scientists and researchers have paid attention to fields of optimization and optimal control. A huge number of new theoretical, algorithmic, and computational results have been observed in the last few years. This book gives the latest advances, and due to the rapid development of these fields, there are no other recent publications on the same topics. Key features: Provides a collection of selected contributions giving a state-of-the-art accou

  14. Optimally Stopped Optimization

    Vinci, Walter; Lidar, Daniel

    We combine the fields of heuristic optimization and optimal stopping. We propose a strategy for benchmarking randomized optimization algorithms that minimizes the expected total cost for obtaining a good solution with an optimal number of calls to the solver. To do so, rather than letting the objective function alone define a cost to be minimized, we introduce a further cost-per-call of the algorithm. We show that this problem can be formulated using optimal stopping theory. The expected cost is a flexible figure of merit for benchmarking probabilistic solvers that can be computed when the optimal solution is not known, and that avoids the biases and arbitrariness that affect other measures. The optimal stopping formulation of benchmarking directly leads to a real-time, optimal-utilization strategy for probabilistic optimizers with practical impact. We apply our formulation to benchmark the performance of a D-Wave 2X quantum annealer and the HFS solver, a specialized classical heuristic algorithm designed for low tree-width graphs. On a set of frustrated-loop instances with planted solutions defined on up to N = 1098 variables, the D-Wave device is between one to two orders of magnitude faster than the HFS solver.

  15. Efficient cell-free expression with the endogenous E. Coli RNA polymerase and sigma factor 70

    Noireaux Vincent

    2010-06-01

    Full Text Available Abstract Background Escherichia coli cell-free expression systems use bacteriophage RNA polymerases, such as T7, to synthesize large amounts of recombinant proteins. These systems are used for many applications in biotechnology, such as proteomics. Recently, informational processes have been reconstituted in vitro with cell-free systems. These synthetic approaches, however, have been seriously limited by a lack of transcription modularity. The current available cell-free systems have been optimized to work with bacteriophage RNA polymerases, which put significant restrictions to engineer processes related to biological information. The development of efficient cell-free systems with broader transcription capabilities is required to study complex informational processes in vitro. Results In this work, an efficient cell-free expression system that uses the endogenous E. coli RNA polymerase only and sigma factor 70 for transcription was prepared. Approximately 0.75 mg/ml of Firefly luciferase and enhanced green fluorescent protein were produced in batch mode. A plasmid was optimized with different regulatory parts to increase the expression. In addition, a new eGFP was engineered that is more translatable in cell-free systems than the original eGFP. The protein production was characterized with three different adenosine triphosphate (ATP regeneration systems: creatine phosphate (CP, phosphoenolpyruvate (PEP, and 3-phosphoglyceric acid (3-PGA. The maximum protein production was obtained with 3-PGA. Preparation of the crude extract was streamlined to a simple routine procedure that takes 12 hours including cell culture. Conclusions Although it uses the endogenous E. coli transcription machinery, this cell-free system can produce active proteins in quantities comparable to bacteriophage systems. The E. coli transcription provides much more possibilities to engineer informational processes in vitro. Many E. coli promoters/operators specific to sigma

  16. Repair of Clustered Damage and DNA Polymerase Iota.

    Belousova, E A; Lavrik, O I

    2015-08-01

    Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

  17. File list: Pol.Neu.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Neu.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Neural ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.50.RNA_Polymerase_III.AllCell.bed ...

  18. File list: Pol.Oth.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Oth.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Others S...RX1027436,SRX1027435,SRX1027434,SRX1027433,SRX668218,SRX099880,SRX099879 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.20.RNA_polymerase_II.AllCell.bed ...

  19. File list: Pol.Myo.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Muscle SR.../dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.05.RNA_Polymerase_II.AllCell.bed ...

  20. File list: Pol.YSt.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.YSt.10.RNA_Polymerase_II.AllCell sacCer3 RNA polymerase RNA Polymerase II Yeast... strain SRX092435,SRX360917,SRX360914,SRX497380,SRX497382,SRX497381,SRX360915 http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.YSt.10.RNA_Polymerase_II.AllCell.bed ...

  1. File list: Pol.Lar.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lar.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Larvae SR...SRX151962,SRX182775,SRX661503,SRX013070,SRX013072,SRX013113,SRX013082,SRX151961 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.05.RNA_polymerase_II.AllCell.bed ...

  2. File list: Pol.CDV.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.CDV.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Cardiova...,SRX080152,SRX080153,SRX367018,SRX367016 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.10.RNA_polymerase_II.AllCell.bed ...

  3. File list: Pol.Lar.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lar.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Larvae h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_Polymerase_II.AllCell.bed ...

  4. File list: Pol.Bld.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bld.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Blood SRX...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.20.RNA_Polymerase_II.AllCell.bed ...

  5. File list: Pol.Bld.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bld.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Blood h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.20.RNA_Polymerase_III.AllCell.bed ...

  6. File list: Pol.Epd.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Epd.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...247,SRX080162,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.50.RNA_polymerase_II.AllCell.bed ...

  7. File list: Pol.Lng.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lng.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Lung SRX1...43816,SRX062976,SRX020252 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Lng.10.RNA_Polymerase_II.AllCell.bed ...

  8. File list: Pol.Plc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Plc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Placent...a http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Plc.50.RNA_Polymerase_III.AllCell.bed ...

  9. File list: Pol.Myo.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Muscle ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.10.RNA_Polymerase_III.AllCell.bed ...

  10. File list: Pol.Lar.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lar.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.50.RNA_polymerase_III.AllCell.bed ...

  11. File list: Pol.Oth.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Oth.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Others ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.20.RNA_Polymerase_III.AllCell.bed ...

  12. File list: Pol.Emb.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043867 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.10.RNA_polymerase_II.AllCell.bed ...

  13. File list: Pol.Utr.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Utr.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Uterus S...SRX573070,SRX027921,SRX1048949,SRX1136641,SRX1136638,SRX099217 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.05.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.CDV.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.CDV.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Cardiov...ascular http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.20.RNA_Polymerase_III.AllCell.bed ...

  15. File list: Pol.Neu.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Neu.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Neural S...6,SRX743838,SRX743832,SRX743834,SRX743840 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.20.RNA_polymerase_II.AllCell.bed ...

  16. File list: Pol.Plc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Plc.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_II.AllCell.bed ...

  17. File list: Pol.Oth.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Oth.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Others SR...X143827,SRX112963,SRX736456,SRX736457,SRX112981,SRX143834,SRX335666,SRX957689 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.05.RNA_Polymerase_II.AllCell.bed ...

  18. File list: Pol.Emb.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043869 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.20.RNA_polymerase_II.AllCell.bed ...

  19. File list: Pol.Adp.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adp.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Adipocy...te http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.20.RNA_Polymerase_III.AllCell.bed ...

  20. File list: Pol.Gon.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Gon.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Gonad ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.20.RNA_polymerase_II.AllCell.bed ...

  1. File list: Pol.Adl.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adl.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Adult ...SRX395531,SRX331268,SRX331270,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.05.RNA_polymerase_III.AllCell.bed ...

  2. File list: Pol.Unc.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.05.RNA_Polymerase_II.AllCell.bed ...

  3. File list: Pol.Adp.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adp.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Adipocyte... SRX800011,SRX800010,SRX341031,SRX341032,SRX341029,SRX800016,SRX800017,SRX341030 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.50.RNA_Polymerase_II.AllCell.bed ...

  4. File list: Pol.Oth.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Oth.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Others ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.05.RNA_Polymerase_III.AllCell.bed ...

  5. File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II All cell...,SRX1013886,SRX1013900 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...

  6. File list: Pol.CDV.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.CDV.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Cardiovas...X320034,SRX346170,SRX346169,SRX373605,SRX680476 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.20.RNA_Polymerase_II.AllCell.bed ...

  7. File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

  8. File list: Pol.Spl.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Spl.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Spleen SR...X062981,SRX143838,SRX020253 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.10.RNA_Polymerase_II.AllCell.bed ...

  9. File list: Pol.Myo.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Muscle ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.05.RNA_Polymerase_III.AllCell.bed ...

  10. File list: Pol.Unc.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Unclassif...ied SRX254629 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.05.RNA_Polymerase_II.AllCell.bed ...

  11. File list: Pol.ALL.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II All cell ...//dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.20.RNA_Polymerase_II.AllCell.bed ...

  12. File list: Pol.Pan.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Pan.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Pancre...as http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.05.RNA_polymerase_III.AllCell.bed ...

  13. File list: Pol.CDV.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.CDV.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Cardiov...ascular http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.05.RNA_Polymerase_III.AllCell.bed ...

  14. File list: Pol.Utr.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Utr.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX018606,SRX017002,SRX017001 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.20.RNA_polymerase_III.AllCell.bed ...

  15. File list: Pol.Epd.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Epd.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.10.RNA_polymerase_III.AllCell.bed ...

  16. File list: Pol.Brs.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Brs.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Breast ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Brs.50.RNA_Polymerase_III.AllCell.bed ...

  17. File list: Pol.Lar.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lar.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.20.RNA_polymerase_III.AllCell.bed ...

  18. File list: Pol.Unc.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.10.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.10.RNA_Polymerase_II.AllCell.bed ...

  19. File list: Pol.Neu.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Neu.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Neural SR...,SRX685285,SRX217736 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.20.RNA_Polymerase_II.AllCell.bed ...

  20. File list: Pol.Unc.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Unclass...ified http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.10.RNA_Polymerase_III.AllCell.bed ...

  1. File list: Pol.ALL.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III All cel...l types ERX204069 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.20.RNA_Polymerase_III.AllCell.bed ...

  2. File list: Pol.Unc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Unclass...ified http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.50.RNA_Polymerase_III.AllCell.bed ...

  3. File list: Pol.Dig.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Dig.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Digesti...ve tract http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.05.RNA_Polymerase_III.AllCell.bed ...

  4. File list: Pol.Bld.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bld.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Blood SRX...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.50.RNA_Polymerase_II.AllCell.bed ...

  5. File list: Pol.Pup.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Pup.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Pupae SRX...013069 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Pup.10.RNA_polymerase_II.AllCell.bed ...

  6. File list: Pol.Dig.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Dig.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Digesti...ve tract http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.50.RNA_Polymerase_III.AllCell.bed ...

  7. File list: Pol.Lng.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lng.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Lung S...RX016555,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.05.RNA_polymerase_III.AllCell.bed ...

  8. File list: Pol.Emb.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.50.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Embryo h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_Polymerase_II.AllCell.bed ...

  9. File list: Pol.CDV.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.CDV.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.10.RNA_polymerase_III.AllCell.bed ...

  10. File list: Pol.Unc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Unclas...sified http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.50.RNA_polymerase_III.AllCell.bed ...

  11. File list: Pol.Unc.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Unclassif...ied SRX254629 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.20.RNA_Polymerase_II.AllCell.bed ...

  12. File list: Pol.Lng.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lng.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Lung SRX0...62976,SRX143816,SRX020252 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Lng.05.RNA_Polymerase_II.AllCell.bed ...

  13. File list: Pol.ALL.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III All cel...l types ERX204069 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.50.RNA_Polymerase_III.AllCell.bed ...

  14. File list: Pol.Lng.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lng.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Lung SRX0...62976,SRX143816,SRX020252 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Lng.20.RNA_Polymerase_II.AllCell.bed ...

  15. File list: Pol.Plc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Plc.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_III.AllCell.bed ...

  16. File list: Pol.Bon.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bon.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.20.RNA_polymerase_III.AllCell.bed ...

  17. File list: Pol.Gon.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Gon.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Gonad ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.50.RNA_polymerase_II.AllCell.bed ...

  18. File list: Pol.Emb.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Embryo ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Emb.05.RNA_Polymerase_III.AllCell.bed ...

  19. File list: Pol.Kid.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Kid.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...SRX1206072,SRX1206066,SRX326423,SRX1206067,SRX003883,SRX003882,SRX367323 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.20.RNA_polymerase_II.AllCell.bed ...

  20. File list: Pol.Emb.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.10.RNA_polymerase_III.AllCell.bed ...

  1. File list: Pol.Pan.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Pan.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Pancrea...s http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Pan.10.RNA_Polymerase_III.AllCell.bed ...

  2. File list: Pol.Adl.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adl.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Adult SR...SRX1388757,SRX1388756 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.05.RNA_Polymerase_II.AllCell.bed ...

  3. File list: Pol.PSC.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.PSC.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Pluripote...SRX213760,SRX213764 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.PSC.50.RNA_Polymerase_II.AllCell.bed ...

  4. File list: Pol.Bon.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bon.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Bone ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bon.05.RNA_Polymerase_III.AllCell.bed ...

  5. File list: Pol.Epd.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Epd.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...246,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.10.RNA_polymerase_II.AllCell.bed ...

  6. File list: Pol.Epd.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Epd.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Epidermis... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Epd.10.RNA_Polymerase_II.AllCell.bed ...

  7. File list: Pol.Adp.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adp.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Adipoc...yte http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.20.RNA_polymerase_III.AllCell.bed ...

  8. File list: Pol.Brs.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Brs.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Breast SR...078990 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Brs.10.RNA_Polymerase_II.AllCell.bed ...

  9. File list: Pol.Spl.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Spl.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Spleen ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.10.RNA_Polymerase_III.AllCell.bed ...

  10. File list: Pol.Dig.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Dig.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Digestive... tract SRX112957,SRX143802 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.20.RNA_Polymerase_II.AllCell.bed ...

  11. File list: Pol.Spl.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Spl.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Spleen SR...X062981,SRX143838,SRX020253 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.05.RNA_Polymerase_II.AllCell.bed ...

  12. File list: Pol.PSC.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.PSC.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Pluripote...SRX213760,SRX213764 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.PSC.20.RNA_Polymerase_II.AllCell.bed ...

  13. File list: Pol.Pup.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Pup.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Pupae SRX...013069 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Pup.05.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.Unc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.50.RNA_polymerase_II.AllCell.bed ...

  15. File list: Pol.Plc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Plc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_II.AllCell.bed ...

  16. File list: Pol.Adp.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adp.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Adipoc...yte http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.10.RNA_polymerase_III.AllCell.bed ...

  17. File list: Pol.Dig.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Dig.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Digest...ive tract http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.20.RNA_polymerase_III.AllCell.bed ...

  18. File list: Pol.Myo.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.10.RNA_polymerase_III.AllCell.bed ...

  19. File list: Pol.Epd.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Epd.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.20.RNA_polymerase_III.AllCell.bed ...

  20. File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Unclassif...ied SRX110774 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

  1. File list: Pol.Plc.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Plc.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_III.AllCell.bed ...

  2. File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...013077,SRX050604,SRX050605 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...

  3. File list: Pol.Adp.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adp.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Adipocyt...e SRX682084,SRX682086,SRX682085,SRX682083 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.50.RNA_polymerase_II.AllCell.bed ...

  4. File list: Pol.ALL.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II All cell...3965,SRX043869,SRX043867,SRX043875,SRX043967,SRX043881,SRX043879 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.ALL.10.RNA_polymerase_II.AllCell.bed ...

  5. File list: Pol.Brs.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Brs.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.20.RNA_polymerase_III.AllCell.bed ...

  6. File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...

  7. File list: Pol.Emb.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.50.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Embryo SR...7582,SRX050604,SRX050605,SRX013073 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.50.RNA_polymerase_II.AllCell.bed ...

  8. File list: Pol.Brs.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Brs.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.05.RNA_polymerase_III.AllCell.bed ...

  9. File list: Pol.PSC.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.PSC.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Plurip...otent stem cell http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.05.RNA_polymerase_III.AllCell.bed ...

  10. File list: Pol.Epd.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Epd.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...248,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.20.RNA_polymerase_II.AllCell.bed ...

  11. File list: Pol.Plc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Plc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_II.AllCell.bed ...

  12. File list: Pol.Unc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.20.RNA_polymerase_II.AllCell.bed ...

  13. File list: Pol.Kid.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Kid.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...X1206068,SRX1206073,SRX1206074,SRX1206072,SRX1206071,SRX003882,SRX367323 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.10.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.Prs.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Prs.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Prosta...te http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.10.RNA_polymerase_III.AllCell.bed ...

  15. File list: Pol.Oth.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Oth.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.50.RNA_polymerase_III.AllCell.bed ...

  16. File list: Pol.Utr.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Utr.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX017001,SRX018606,SRX017002 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.10.RNA_polymerase_III.AllCell.bed ...

  17. File list: Pol.Adl.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adl.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Adult SR...SRX043965,SRX005629,SRX043964,SRX554718 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.50.RNA_polymerase_II.AllCell.bed ...

  18. File list: Pol.CDV.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.CDV.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.05.RNA_polymerase_III.AllCell.bed ...

  19. File list: Pol.Prs.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Prs.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...932,SRX020922,SRX022582 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.50.RNA_polymerase_II.AllCell.bed ...

  20. File list: Pol.PSC.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.PSC.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pluripot...670820,SRX702057,SRX702061 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.20.RNA_polymerase_II.AllCell.bed ...

  1. File list: Pol.Utr.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Utr.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Uterus S...RX099218,SRX1136641,SRX1048949,SRX1136639,SRX665233,SRX1136638 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.50.RNA_polymerase_II.AllCell.bed ...

  2. File list: Pol.Brs.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Brs.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.10.RNA_polymerase_III.AllCell.bed ...

  3. File list: Pol.Adl.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adl.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Adult SR...SRX554718,SRX043965,SRX043963,SRX043964 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.20.RNA_polymerase_II.AllCell.bed ...

  4. File list: Pol.Kid.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Kid.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.10.RNA_polymerase_III.AllCell.bed ...

  5. File list: Pol.ALL.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III All ce...ll types SRX331268,SRX331270,SRX395531,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.ALL.20.RNA_polymerase_III.AllCell.bed ...

  6. File list: Pol.Emb.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.05.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043867 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.05.RNA_polymerase_II.AllCell.bed ...

  7. File list: Pol.Dig.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Dig.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.05.RNA_polymerase_II.AllCell.bed ...

  8. File list: Pol.Neu.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Neu.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Neural S...6,SRX743834,SRX743838,SRX743840,SRX743832 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.50.RNA_polymerase_II.AllCell.bed ...

  9. File list: Pol.Emb.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Embryo SR...7582,SRX013077,SRX050604,SRX050605 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.05.RNA_polymerase_II.AllCell.bed ...

  10. File list: Pol.Liv.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Liv.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Liver SR...1013886 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.20.RNA_polymerase_II.AllCell.bed ...

  11. File list: Pol.Prs.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Prs.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...866,SRX173198,SRX173197 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.10.RNA_polymerase_II.AllCell.bed ...

  12. File list: Pol.Pan.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Pan.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.10.RNA_polymerase_II.AllCell.bed ...

  13. File list: Pol.Liv.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Liv.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.05.RNA_polymerase_III.AllCell.bed ...

  14. File list: Pol.Neu.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Neu.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Neural S...1,SRX099887,SRX099886,SRX743834,SRX743832 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.05.RNA_polymerase_II.AllCell.bed ...

  15. File list: Pol.Myo.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.05.RNA_polymerase_III.AllCell.bed ...

  16. File list: Pol.Lng.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lng.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Lung S...RX016555,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.20.RNA_polymerase_III.AllCell.bed ...

  17. File list: Pol.Kid.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Kid.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.05.RNA_polymerase_III.AllCell.bed ...

  18. File list: Pol.ALL.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III All ce...,SRX150396,SRX015144,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.05.RNA_polymerase_III.AllCell.bed ...

  19. File list: Pol.Dig.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Dig.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Digest...ive tract http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.50.RNA_polymerase_III.AllCell.bed ...

  20. File list: Pol.Oth.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Oth.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.20.RNA_polymerase_III.AllCell.bed ...

  1. File list: Pol.Lng.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lng.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.10.RNA_polymerase_II.AllCell.bed ...

  2. File list: Pol.Lar.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lar.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.10.RNA_polymerase_III.AllCell.bed ...

  3. File list: Pol.Liv.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Liv.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.50.RNA_polymerase_III.AllCell.bed ...

  4. File list: Pol.Unc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.20.RNA_polymerase_II.AllCell.bed ...

  5. File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II Uncla...ssified http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

  6. File list: Pol.Gon.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Gon.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.10.RNA_polymerase_III.AllCell.bed ...

  7. File list: Pol.Bld.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bld.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Blood ...SRX150560,SRX018610,SRX015143,SRX017006,SRX150396,SRX015144 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.50.RNA_polymerase_III.AllCell.bed ...

  8. File list: Pol.Lar.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lar.20.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Larvae SR...SRX661503,SRX026742,SRX013070,SRX013072,SRX182775,SRX151961,SRX013082,SRX013113 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.20.RNA_polymerase_II.AllCell.bed ...

  9. File list: Pol.ALL.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III All ce...ll types SRX395531,SRX331268,SRX331270,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.ALL.05.RNA_polymerase_III.AllCell.bed ...

  10. File list: Pol.Prs.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Prs.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...363,SRX173198,SRX173197 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.05.RNA_polymerase_II.AllCell.bed ...

  11. File list: Pol.Plc.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Plc.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_III.AllCell.bed ...

  12. File list: Pol.Lng.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lng.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Lung S...RX016555,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.50.RNA_polymerase_III.AllCell.bed ...

  13. File list: Pol.Bon.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bon.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Bone SRX...,SRX351408 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.20.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.Myo.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.50.RNA_polymerase_II.AllCell.bed ...

  15. File list: Pol.ALL.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.20.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.20.RNA_polymerase_II.AllCell.bed ...

  16. File list: Pol.Oth.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Oth.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Others S...RX1027436,SRX1027435,SRX1027434,SRX1027433,SRX668218,SRX099880,SRX099879 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.50.RNA_polymerase_II.AllCell.bed ...

  17. File list: Pol.Bld.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bld.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Blood SR...,SRX153079,SRX017717,SRX103447,SRX386121,SRX038919,SRX038920,SRX080132 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.50.RNA_polymerase_II.AllCell.bed ...

  18. File list: Pol.Myo.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.10.RNA_polymerase_II.AllCell.bed ...

  19. File list: Pol.Myo.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.05.RNA_polymerase_II.AllCell.bed ...

  20. File list: Pol.Emb.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043866 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_polymerase_II.AllCell.bed ...

  1. File list: Pol.Emb.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_polymerase_III.AllCell.bed ...

  2. File list: Pol.ALL.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II All cell...,SRX1013886,SRX1013900 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.10.RNA_polymerase_II.AllCell.bed ...

  3. File list: Pol.Oth.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Oth.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.05.RNA_polymerase_III.AllCell.bed ...

  4. File list: Pol.Liv.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Liv.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Liver SR...1013886 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.50.RNA_polymerase_II.AllCell.bed ...

  5. File list: Pol.Bon.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bon.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.05.RNA_polymerase_III.AllCell.bed ...

  6. File list: Pol.Unc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Unclas...sified http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.20.RNA_polymerase_III.AllCell.bed ...

  7. File list: Pol.Gon.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Gon.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.20.RNA_polymerase_III.AllCell.bed ...

  8. File list: Pol.Emb.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.05.RNA_polymerase_III.AllCell.bed ...

  9. File list: Pol.PSC.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.PSC.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Plurip...otent stem cell http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.50.RNA_polymerase_III.AllCell.bed ...

  10. File list: Pol.Adl.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adl.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Adult ...SRX395531,SRX331268,SRX331270,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.10.RNA_polymerase_III.AllCell.bed ...

  11. File list: Pol.Kid.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Kid.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...SRX128201,SRX128200,SRX003882,SRX1206065,SRX1206066,SRX1206067,SRX367323 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.05.RNA_polymerase_II.AllCell.bed ...

  12. File list: Pol.Myo.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.50.RNA_polymerase_III.AllCell.bed ...

  13. File list: Pol.Plc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Plc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.Pan.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Pan.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.50.RNA_polymerase_II.AllCell.bed ...

  15. File list: Pol.Bon.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bon.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Bone SRX...,SRX351408 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.10.RNA_polymerase_II.AllCell.bed ...

  16. File list: Pol.Bld.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bld.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Blood SR...,SRX017986,SRX017985,SRX728781,SRX017717,SRX005163,SRX024360,SRX017718 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.10.RNA_polymerase_II.AllCell.bed ...

  17. File list: Pol.Plc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Plc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_III.AllCell.bed ...

  18. File list: Pol.Epd.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Epd.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...245,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.05.RNA_polymerase_II.AllCell.bed ...

  19. File list: Pol.Lar.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lar.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_polymerase_III.AllCell.bed ...

  20. File list: Pol.Emb.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Embryo SR...7582,SRX050604,SRX050605,SRX013077 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.10.RNA_polymerase_II.AllCell.bed ...

  1. File list: Pol.Myo.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.20.RNA_polymerase_II.AllCell.bed ...

  2. File list: Pol.Bon.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bon.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.50.RNA_polymerase_III.AllCell.bed ...

  3. File list: Pol.Oth.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Oth.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.10.RNA_polymerase_III.AllCell.bed ...

  4. File list: Pol.ALL.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.50.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...050605,SRX013073 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.50.RNA_polymerase_II.AllCell.bed ...

  5. File list: Pol.Kid.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Kid.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.50.RNA_polymerase_III.AllCell.bed ...

  6. File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

  7. File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

  8. File list: Pol.CDV.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.CDV.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.50.RNA_polymerase_III.AllCell.bed ...

  9. File list: Pol.PSC.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.PSC.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pluripot...833412,SRX149642,SRX702059 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.05.RNA_polymerase_II.AllCell.bed ...

  10. File list: Pol.Kid.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Kid.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...SRX1206066,SRX1206067,SRX003882,SRX003883,SRX1206065,SRX367323,SRX326416 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.50.RNA_polymerase_II.AllCell.bed ...

  11. File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

  12. File list: Pol.Prs.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Prs.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Prosta...te http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.05.RNA_polymerase_III.AllCell.bed ...

  13. File list: Pol.Dig.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Dig.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.50.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.Bld.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Bld.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Blood ...SRX017006,SRX015143,SRX150560,SRX018610,SRX150396,SRX015144 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.20.RNA_polymerase_III.AllCell.bed ...

  15. File list: Pol.Prs.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Prs.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...557,SRX173197,SRX173198 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.20.RNA_polymerase_II.AllCell.bed ...

  16. File list: Pol.Emb.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Emb.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.20.RNA_polymerase_III.AllCell.bed ...

  17. File list: Pol.YSt.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.YSt.20.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II Yeast... strain http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.YSt.20.RNA_polymerase_II.AllCell.bed ...

  18. File list: Pol.ALL.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.50.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.50.RNA_polymerase_II.AllCell.bed ...

  19. File list: Pol.Lng.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lng.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.05.RNA_polymerase_II.AllCell.bed ...

  20. File list: Pol.Epd.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Epd.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.50.RNA_polymerase_III.AllCell.bed ...

  1. File list: Pol.Oth.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Oth.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Others S...RX1027435,SRX668218,SRX1027436,SRX1027434,SRX1027433,SRX099879,SRX099880 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.05.RNA_polymerase_II.AllCell.bed ...

  2. File list: Pol.Pan.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Pan.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.05.RNA_polymerase_II.AllCell.bed ...

  3. File list: Pol.Utr.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Utr.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX017001,SRX018606,SRX017002 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.05.RNA_polymerase_III.AllCell.bed ...

  4. File list: Pol.Unc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Unc.50.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II Uncla...ssified http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.Unc.50.RNA_polymerase_II.AllCell.bed ...

  5. File list: Pol.Kid.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Kid.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.20.RNA_polymerase_III.AllCell.bed ...

  6. File list: Pol.Pan.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Pan.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Pancre...as http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.10.RNA_polymerase_III.AllCell.bed ...

  7. File list: Pol.Adl.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Adl.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Adult ...SRX331268,SRX331270,SRX395531 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.50.RNA_polymerase_III.AllCell.bed ...

  8. File list: Pol.Neu.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Neu.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Neural... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.05.RNA_polymerase_III.AllCell.bed ...

  9. File list: Pol.Lng.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Lng.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.50.RNA_polymerase_II.AllCell.bed ...

  10. File list: Pol.Dig.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Dig.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.10.RNA_polymerase_II.AllCell.bed ...

  11. File list: Pol.ALL.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.ALL.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...050604,SRX050605,SRX013077 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.10.RNA_polymerase_II.AllCell.bed ...

  12. File list: Pol.Myo.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Myo.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.20.RNA_polymerase_III.AllCell.bed ...

  13. File list: Pol.CDV.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.CDV.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Cardiova...,SRX346933,SRX346936,SRX367018,SRX367016 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.20.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.Liv.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Liv.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.20.RNA_polymerase_III.AllCell.bed ...

  15. File list: Pol.Gon.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Full Text Available Pol.Gon.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.50.RNA_polymerase_III.AllCell.bed ...

  16. A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

  17. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

    2013-01-01

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

  18. PCNA mono-ubiquitination and activation of translesion DNA polymerases by DNA polymerase {alpha}.

    Suzuki, Motoshi; Niimi, Atsuko; Limsirichaikul, Siripan; Tomida, Shuta; Miao Huang, Qin; Izuta, Shunji; Usukura, Jiro; Itoh, Yasutomo; Hishida, Takashi; Akashi, Tomohiro; Nakagawa, Yoshiyuki; Kikuchi, Akihiko; Pavlov, Youri; Murate, Takashi; Takahashi, Takashi

    2009-07-01

    Translesion DNA synthesis (TLS) involves PCNA mono-ubiquitination and TLS DNA polymerases (pols). Recent evidence has shown that the mono-ubiquitination is induced not only by DNA damage but also by other factors that induce stalling of the DNA replication fork. We studied the effect of spontaneous DNA replication errors on PCNA mono-ubiquitination and TLS induction. In the pol1L868F strain, which expressed an error-prone pol alpha, PCNA was spontaneously mono-ubiquitinated. Pol alpha L868F had a rate-limiting step at the extension from mismatched primer termini. Electron microscopic observation showed the accumulation of a single-stranded region at the DNA replication fork in yeast cells. For pol alpha errors, pol zeta participated in a generation of +1 frameshifts. Furthermore, in the pol1L868F strain, UV-induced mutations were lower than in the wild-type and a pol delta mutant strain (pol3-5DV), and deletion of the RAD30 gene (pol eta) suppressed this defect. These data suggest that nucleotide misincorporation by pol alpha induces exposure of single-stranded DNA, PCNA mono-ubiquitination and activates TLS pols.

  19. Active RNA polymerases: mobile or immobile molecular machines?

    Argyris Papantonis

    2010-07-01

    Full Text Available It is widely assumed that active RNA polymerases track along their templates to produce a transcript. We test this using chromosome conformation capture and human genes switched on rapidly and synchronously by tumour necrosis factor alpha (TNFalpha; one is 221 kbp SAMD4A, which a polymerase takes more than 1 h to transcribe. Ten minutes after stimulation, the SAMD4A promoter comes together with other TNFalpha-responsive promoters. Subsequently, these contacts are lost as new downstream ones appear; contacts are invariably between sequences being transcribed. Super-resolution microscopy confirms that nascent transcripts (detected by RNA fluorescence in situ hybridization co-localize at relevant times. Results are consistent with an alternative view of transcription: polymerases fixed in factories reel in their respective templates, so different parts of the templates transiently lie together.

  20. Backtracking dynamics of RNA polymerase: pausing and error correction

    Sahoo, Mamata; Klumpp, Stefan

    2013-09-01

    Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

  1. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  2. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    Leem, S H; Ropp, P A; Sugino, A

    1994-01-01

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...

  3. Recent Insight into the Kinetic Mechanisms and Conformational Dynamics of Y-Family DNA Polymerases

    Maxwell, Brian A.; Suo, Zucai

    2014-01-01

    The kinetic mechanisms by which DNA polymerases catalyze DNA replication and repair have long been areas of active research. Recently discovered Y-family DNA polymerases catalyze the bypass of damaged DNA bases that would otherwise block replicative DNA polymerases and stall replication forks. Unlike DNA polymerases from the five other families, the Y-family DNA polymerases have flexible, solvent-accessible active sites that are able to tolerate various types of damaged template bases and all...

  4. Comparative analytical evaluation of the respiratory TaqMan Array Card with real-time PCR and commercial multi-pathogen assays.

    Harvey, John J; Chester, Stephanie; Burke, Stephen A; Ansbro, Marisela; Aden, Tricia; Gose, Remedios; Sciulli, Rebecca; Bai, Jing; DesJardin, Lucy; Benfer, Jeffrey L; Hall, Joshua; Smole, Sandra; Doan, Kimberly; Popowich, Michael D; St George, Kirsten; Quinlan, Tammy; Halse, Tanya A; Li, Zhen; Pérez-Osorio, Ailyn C; Glover, William A; Russell, Denny; Reisdorf, Erik; Whyte, Thomas; Whitaker, Brett; Hatcher, Cynthia; Srinivasan, Velusamy; Tatti, Kathleen; Tondella, Maria Lucia; Wang, Xin; Winchell, Jonas M; Mayer, Leonard W; Jernigan, Daniel; Mawle, Alison C

    2016-02-01

    In this study, a multicenter evaluation of the Life Technologies TaqMan(®) Array Card (TAC) with 21 custom viral and bacterial respiratory assays was performed on the Applied Biosystems ViiA™ 7 Real-Time PCR System. The goal of the study was to demonstrate the analytical performance of this platform when compared to identical individual pathogen specific laboratory developed tests (LDTs) designed at the Centers for Disease Control and Prevention (CDC), equivalent LDTs provided by state public health laboratories, or to three different commercial multi-respiratory panels. CDC and Association of Public Health Laboratories (APHL) LDTs had similar analytical sensitivities for viral pathogens, while several of the bacterial pathogen APHL LDTs demonstrated sensitivities one log higher than the corresponding CDC LDT. When compared to CDC LDTs, TAC assays were generally one to two logs less sensitive depending on the site performing the analysis. Finally, TAC assays were generally more sensitive than their counterparts in three different commercial multi-respiratory panels. TAC technology allows users to spot customized assays and design TAC layout, simplify assay setup, conserve specimen, dramatically reduce contamination potential, and as demonstrated in this study, analyze multiple samples in parallel with good reproducibility between instruments and operators. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. A TaqMan-based real time PCR assay for specific detection and quantification of Xylella fastidiosa strains causing bacterial leaf scorch in oleander.

    Guan, Wei; Shao, Jonathan; Singh, Raghuwinder; Davis, Robert E; Zhao, Tingchang; Huang, Qi

    2013-02-15

    A TaqMan-based real-time PCR assay was developed for specific detection of strains of X. fastidiosa causing oleander leaf scorch. The assay uses primers WG-OLS-F1 and WG-OLS-R1 and the fluorescent probe WG-OLS-P1, designed based on unique sequences found only in the genome of oleander strain Ann1. The assay is specific, allowing detection of only oleander-infecting strains, not other strains of X. fastidiosa nor other plant-associated bacteria tested. The assay is also sensitive, with a detection limit of 10.4fg DNA of X. fastidiosa per reaction in vitro and in planta. The assay can also be applied to detect low numbers of X. fastidiosa in insect samples, or further developed into a multiplex real-time PCR assay to simultaneously detect and distinguish diverse strains of X. fastidiosa that may occupy the same hosts or insect vectors. Specific and sensitive detection and quantification of oleander strains of X. fastidiosa should be useful for disease diagnosis, epidemiological studies, management of oleander leaf scorch disease, and resistance screening for oleander shrubs. Published by Elsevier B.V.

  6. Quantification of the biocontrol agent Trichoderma harzianum with real-time TaqMan PCR and its potential extrapolation to the hyphal biomass.

    López-Mondéjar, Rubén; Antón, Anabel; Raidl, Stefan; Ros, Margarita; Pascual, José Antonio

    2010-04-01

    The species of the genus Trichoderma are used successfully as biocontrol agents against a wide range of phytopathogenic fungi. Among them, Trichoderma harzianum is especially effective. However, to develop more effective fungal biocontrol strategies in organic substrates and soil, tools for monitoring the control agents are required. Real-time PCR is potentially an effective tool for the quantification of fungi in environmental samples. The aim of this study consisted of the development and application of a real-time PCR-based method to the quantification of T. harzianum, and the extrapolation of these data to fungal biomass values. A set of primers and a TaqMan probe for the ITS region of the fungal genome were designed and tested, and amplification was correlated to biomass measurements obtained with optical microscopy and image analysis, of the hyphal length of the mycelium of the colony. A correlation of 0.76 between ITS copies and biomass was obtained. The extrapolation of the quantity of ITS copies, calculated based on real-time PCR data, into quantities of fungal biomass provides potentially a more accurate value of the quantity of soil fungi. Copyright 2009 Elsevier Ltd. All rights reserved.

  7. Characterization of Phytophthora nicotianae isolates in southeast Spain and their detection and quantification through a real-time TaqMan PCR.

    Blaya, Josefa; Lacasa, Carmen; Lacasa, Alfredo; Martínez, Victoriano; Santísima-Trinidad, Ana B; Pascual, Jose A; Ros, Margarita

    2015-04-01

    The soil-borne pathogens Phytophthora nicotianae and P. capsici are the causal agents of root and stem rot of many plant species. Although P. capsici was considered the causal agent in one of the main pepper production areas of Spain to date, evidence of the presence of P. nicotianae was found. We aimed to survey the presence of P. nicotianae and study the variability in its populations in this area in order to improve the management of Tristeza disease. A new specific primer and a TaqMan probe were designed based on the internal transcribed spacer regions of ribosomal DNA to detect and quantify P. nicotianae. Both morphological and molecular analysis showed its presence and confirmed it to be the causal agent of the Phytophthora disease symptoms in the studied area. The genetic characterization among P. nicotianae populations showed a low variability of genetic diversity among the isolates. Only isolates of the A2 mating type were detected. Not only is a specific and early detection of P. nicotianae essential but also the study of genetic variability among isolates for the appropriate management of the disease, above all, in producing areas with favorable conditions for the advance of the disease. © 2014 Society of Chemical Industry.

  8. Performance evaluation of cobas HBV real-time PCR assay on Roche cobas 4800 System in comparison with COBAS AmpliPrep/COBAS TaqMan HBV Test.

    Kim, Hanah; Hur, Mina; Bae, Eunsin; Lee, Kyung-A; Lee, Woo-In

    2018-02-19

    Hepatitis B virus (HBV) nucleic acid amplification testing (NAAT) is important for the diagnosis and management of HBV infection. We evaluated the analytical performance of the cobas HBV NAAT (Roche Diagnostics GmbH, Mannheim, Germany) on the cobas 4800 System in comparison with COBAS AmpliPrep/COBAS TaqMan HBV Test (CAP/CTM HBV). Precision was evaluated using three levels of cobas HBV/HCV/HIV-1 Control Kit, and linearity was evaluated across the anticipated measuring range (10.0-1.0×109 IU/mL) at seven levels using clinical samples. Detection capability, including limit of blank (LOB), limit of detection (LOD) and limit of quantitation (LOQ), was verified using the 4th WHO International Standard for HBV DNA for NAT (NIBSC code: 10/266). Correlation between the two systems was compared using 205 clinical samples (102 sera and 103 EDTA plasma). Repeatability and total imprecision (coefficient of variation) ranged from 0.5% to 3.8% and from 0.5% to 3.5%, respectively. Linearity (coefficient of determination, R2) was 0.999. LOB, LOD and LOQ were all acceptable within the observed proportion rate (85%). Correlation was very high between the two systems in both serum and plasma samples (correlation coefficient [r]=0.995). The new cobas HBV real-time PCR assay on the cobas 4800 System showed reliable analytical performances.

  9. Changes in human fecal microbiota due to chemotherapy analyzed by TaqMan-PCR, 454 sequencing and PCR-DGGE fingerprinting.

    Jutta Zwielehner

    Full Text Available BACKGROUND: We investigated whether chemotherapy with the presence or absence of antibiotics against different kinds of cancer changed the gastrointestinal microbiota. METHODOLOGY/PRINCIPAL FINDINGS: Feces of 17 ambulant patients receiving chemotherapy with or without concomitant antibiotics were analyzed before and after the chemotherapy cycle at four time points in comparison to 17 gender-, age- and lifestyle-matched healthy controls. We targeted 16S rRNA genes of all bacteria, Bacteroides, bifidobacteria, Clostridium cluster IV and XIVa as well as C. difficile with TaqMan qPCR, denaturing gradient gel electrophoresis (DGGE fingerprinting and high-throughput sequencing. After a significant drop in the abundance of microbiota (p = 0.037 following a single treatment the microbiota recovered within a few days. The chemotherapeutical treatment marginally affected the Bacteroides while the Clostridium cluster IV and XIVa were significantly more sensitive to chemotherapy and antibiotic treatment. DGGE fingerprinting showed decreased diversity of Clostridium cluster IV and XIVa in response to chemotherapy with cluster IV diversity being particularly affected by antibiotics. The occurrence of C. difficile in three out of seventeen subjects was accompanied by a decrease in the genera Bifidobacterium, Lactobacillus, Veillonella and Faecalibacterium prausnitzii. Enterococcus faecium increased following chemotherapy. CONCLUSIONS/SIGNIFICANCE: Despite high individual variations, these results suggest that the observed changes in the human gut microbiota may favor colonization with C. difficile and Enterococcus faecium. Perturbed microbiota may be a target for specific mitigation with safe pre- and probiotics.

  10. A novel TaqI polymorphism in the coding region of the ovine TNXB gene in the MHC class III region: morphostructural and physiological influences.

    Ajayi, Oyeyemi O; Adefenwa, Mufliat A; Agaviezor, Brilliant O; Ikeobi, Christian O N; Wheto, Matthew; Okpeku, Moses; Amusan, Samuel A; Yakubu, Abdulmojeed; De Donato, Marcos; Peters, Sunday O; Imumorin, Ikhide G

    2014-02-01

    The tenascin-XB (TNXB) gene has antiadhesive effects, functions in matrix maturation in connective tissues, and localizes to the major histocompatibility complex class III region. We hypothesized that it may influence adaptive physiological response through an effect on blood vessel function. We identified a novel g.1324 A→G polymorphism at a TaqI recognition site in a 454 bp fragment of ovine TNXB and genotyped it in 150 Nigerian sheep using PCR-RFLP. The missense mutation changes glutamic acid (GAA) to glycine (GGA). Among SNP genotypes, significant differences (P bone length. Interaction effects of breed, SNP genotype, and geographic location had a significant effect (P < 0.05) on chest girth. The SNP genotype was significantly (P < 0.05) associated with physiological traits of pulse rate and skin temperature. The observed effect of this novel polymorphism may be mediated through its role in connective tissue biology, requiring further association and functional studies.

  11. On the genetics of loss aversion: An interaction effect of BDNF Val66Met and DRD2/ANKK1 Taq1a.

    Voigt, Gesine; Montag, Christian; Markett, Sebastian; Reuter, Martin

    2015-12-01

    Loss aversion is the tendency to overweight losses compared with gains in decision situations. Several studies have investigated the neurobiological background of this phenomenon and it was found that activation in the mesolimbic-mesocortical dopamine system during a gambling decision correlates with loss aversion. In a behavioral experiment with N = 143 subjects, the present study investigates the influence of 2 functional single-nucleotide polymorphisms on the BDNF gene (BDNF Val66Met polymorphism) and ANKK1 gene (DRD2 Taq1a/ANKK1 polymorphism), that are known to affect the dopamine system, on loss aversion. Additionally, associations of alexithymia, a personality construct describing the disability to consciously experience emotions in the self, with loss aversion and with the mentioned polymorphisms were assessed using the TAS-20 questionnaire, to replicate associations that have been reported before. Results revealed a significant interaction effect of the 2 polymorphisms on loss aversion. Carriers of the genetic constellation 66Met+/A1+ had the lowest loss aversion scores, compared with all other allelic groups. According to the literature this allelic configuration is characterized by a relatively low D2/3 receptor binding in the striatum and an impaired activity-dependent secretion of BDNF. This is the first study showing that loss aversion is related to naturally occurring differences in dopamine function. (c) 2015 APA, all rights reserved).

  12. Cross-platform comparison of SYBR® Green real-time PCR with TaqMan PCR, microarrays and other gene expression measurement technologies evaluated in the MicroArray Quality Control (MAQC study

    Dial Stacey L

    2008-07-01

    Full Text Available Abstract Background The MicroArray Quality Control (MAQC project evaluated the inter- and intra-platform reproducibility of seven microarray platforms and three quantitative gene expression assays in profiling the expression of two commercially available Reference RNA samples (Nat Biotechnol 24:1115-22, 2006. The tested microarrays were the platforms from Affymetrix, Agilent Technologies, Applied Biosystems, GE Healthcare, Illumina, Eppendorf and the National Cancer Institute, and quantitative gene expression assays included TaqMan® Gene Expression PCR Assay, Standardized (Sta RT-PCR™ and QuantiGene®. The data showed great consistency in gene expression measurements across different microarray platforms, different technologies and test sites. However, SYBR® Green real-time PCR, another common technique utilized by half of all real-time PCR users for gene expression measurement, was not addressed in the MAQC study. In the present study, we compared the performance of SYBR Green PCR with TaqMan PCR, microarrays and other quantitative technologies using the same two Reference RNA samples as the MAQC project. We assessed SYBR Green real-time PCR using commercially available RT2 Profiler™ PCR Arrays from SuperArray, containing primer pairs that have been experimentally validated to ensure gene-specificity and high amplification efficiency. Results The SYBR Green PCR Arrays exhibit good reproducibility among different users, PCR instruments and test sites. In addition, the SYBR Green PCR Arrays have the highest concordance with TaqMan PCR, and a high level of concordance with other quantitative methods and microarrays that were evaluated in this study in terms of fold-change correlation and overlap of lists of differentially expressed genes. Conclusion These data demonstrate that SYBR Green real-time PCR delivers highly comparable results in gene expression measurement with TaqMan PCR and other high-density microarrays.

  13. BsmI, ApaI and TaqI Polymorphisms in the Vitamin D Receptor Gene (VDR and Association with Lumbar Spine Pathologies: An Italian Case-Control Study.

    Alessandra Colombini

    Full Text Available Three adjacent single nucleotide polymorphisms of the vitamin D receptor gene (VDR BsmI (rs1544410, ApaI (rs7975232, and TaqI (rs731236 are commonly studied in several pathologies. We aimed to evaluate the distribution of VDR BsmI, ApaI, and TaqI allele, genotype, and haplotype frequencies in an Italian cohort of 266 patients with lumbar spine disorders assessed by Magnetic Resonance Imaging and 252 asymptomatic controls. The exposure to putative risk factors was evaluated by a questionnaire. Polymorphisms were detected by PCR-RFLP and TaqMan® SNP Genotyping Assay. The results were statistically adjusted for the identified conventional risk factors. The three SNPs were in linkage disequilibrium. For all cases BbAaTT was a 3-fold risk factor OR = 3.38, whereas bbAATT (OR = 0.22, and bbaaTT (OR = 0.47 genotypes were found to be protective. Specifically, for patients affected by disc herniation only (n = 88 and all lumbar pathologies excluding stenosis and/or spondylolistesis (n = 215 B allele, Bb, Aa, and BbAaTT genotypes were risky, whereas b allele, bb, aa, and bbaaTT genotypes were protective. In patients affected by osteochondrosis with or without disc hernation (n = 50, T allele, Aa, and bbAaTT genotypes were risky, whereas t allele, AA, tt genotypes were protective. In patients affected by stenosis and/or spondylolistesis (n = 51 no significant associations were found. This is the first study showing an association of the three genetic VDR variants BsmI, ApaI, and TaqI and lumbar spine pathologies. Our study contributes to delineate genetic risk factors for specific subgroups of patients with lumbar spine pathologies highlighting the importance of haplotype analysis, and of detailed clinical evaluation of the patients for identification of genetic biomarkers.

  14. Comparison of polymerase chain reaction (PCR) and loop-mediated ...

    Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...

  15. Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters

    Helbo, Alexandra Søgaard; Lay, Fides D; Jones, Peter A

    2017-01-01

    Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high...

  16. Rapid establishment of polymerase chain reaction-restriction ...

    2012-03-30

    Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...

  17. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  18. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

  19. Polymerase Chain Reaction (PCR) provides a superior tool for the ...

    Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...

  20. EBV DNA polymerase inhibition of tannins from Eugenia uniflora.

    Lee, M H; Chiou, J F; Yen, K Y; Yang, L L

    2000-06-30

    Nasopharyngeal carcinoma (NPC) is one of the high population malignant tumors among Chinese in southern China and southeast Asia. Epstein-Barr virus (EBV) is a human B lymphotropic herpes virus which is known to be closely associated with NPC. EBV DNA polymerase is a key enzyme during EBV replication and is measured by its radioactivity. The addition of phorbol 12-myristate 13-acetate to Raji cell cultures led to a large increase in EBV DNA polymerase, which was purified by sequential DEAE-cellulose, phosphocellulose and DNA-cellulose column chromatography. Four tannins were isolated from the active fractions of Eugenia uniflora L., which were tested for the inhibition of EBV DNA polymerase. The results showed the 50% inhibitory concentration (IC(50)) values of gallocatechin, oenothein B, eugeniflorins D(1) and D(2) were 26.5 62.3, 3.0 and 3.5 microM, respectively. Furthermore, when compared with the positive control (phosphonoacetic acid), an inhibitor of EBV replication, the IC(50) value was 16.4 microM. In view of the results, eugeniflorins D(1) and D(2) are the potency principles in the inhibition of EBV DNA polymerase from E. uniflora.

  1. Niacin, poly(ADP-ribose) polymerase-1 and genomic stability

    Hageman, G.J.; Stierum, R.H.

    2001-01-01

    Nicotinic acid (NA) and nicotinamide (NAM), commonly called niacin, are the dietary precursors for NAD+ (nicotinamide adenine dinucleotide), which is required for DNA synthesis, as well as for the activity of the enzyme poly(ADP-ribose) polymerase-1 (PARP-1; EC 2.4.2.30) for which NAD+ is the sole

  2. Estimation of the reaction efficiency in polymerase chain reaction

    Lalam, N.

    2006-01-01

    Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

  3. Polymerase chain reaction versus enzyme-linked immunosorbent ...

    Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.

  4. A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.

    Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang

    2005-12-01

    The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.

  5. Development and application of a T7 RNA polymerase-dependent expression system for antibiotic production improvement in Streptomyces.

    Wei, Junhong; Tian, Jinjin; Pan, Guoqing; Xie, Jie; Bao, Jialing; Zhou, Zeyang

    2017-06-01

    To develop a reliable and easy to use expression system for antibiotic production improvement of Streptomyces. A two-compound T7 RNA polymerase-dependent gene expression system was developed to fulfill this demand. In this system, the T7 RNA polymerase coding sequence was optimized based on the codon usage of Streptomyces coelicolor. To evaluate the functionality of this system, we constructed an activator gene overexpression strain for enhancement of actinorhodin production. By overexpression of the positive regulator actII-ORF4 with this system, the maximum actinorhodin yield of engineered strain was 15-fold higher and the fermentation time was decreased by 48 h. The modified two-compound T7 expression system improves both antibiotic production and accelerates the fermentation process in Streptomyces. This provides a general and useful strategy for strain improvement of important antibiotic producing Streptomyces strains.

  6. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    Nasarabadi, Shanavaz [Livermore, CA

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  7. Competition between replicative and translesion polymerases during homologous recombination repair in Drosophila.

    Daniel P Kane

    Full Text Available In metazoans, the mechanism by which DNA is synthesized during homologous recombination repair of double-strand breaks is poorly understood. Specifically, the identities of the polymerase(s that carry out repair synthesis and how they are recruited to repair sites are unclear. Here, we have investigated the roles of several different polymerases during homologous recombination repair in Drosophila melanogaster. Using a gap repair assay, we found that homologous recombination is impaired in Drosophila lacking DNA polymerase zeta and, to a lesser extent, polymerase eta. In addition, the Pol32 protein, part of the polymerase delta complex, is needed for repair requiring extensive synthesis. Loss of Rev1, which interacts with multiple translesion polymerases, results in increased synthesis during gap repair. Together, our findings support a model in which translesion polymerases and the polymerase delta complex compete during homologous recombination repair. In addition, they establish Rev1 as a crucial factor that regulates the extent of repair synthesis.

  8. The Paramyxovirus Polymerase Complex as a Target for Next-Generation Anti-Paramyxovirus Therapeutics

    Richard K Plemper

    2015-05-01

    Full Text Available The paramyxovirus family includes major human and animal pathogens, including measles virus, mumps virus, and human respiratory syncytial virus (RSV, as well as the emerging zoonotic Hendra and Nipah viruses. In the United States, RSV is the leading cause of infant hospitalizations due to viral infectious disease. Despite their clinical significance, effective drugs for the improved management of paramyxovirus disease are lacking. The development of novel anti-paramyxovirus therapeutics is therefore urgently needed. Paramyxoviruses contain RNA genomes of negative polarity, necessitating a virus-encoded RNA-dependent RNA polymerase (RdRp complex for replication and transcription. Since an equivalent enzymatic activity is absent in host cells, the RdRp complex represents an attractive druggable target, although structure-guided drug development campaigns are hampered by the lack of high-resolution RdRp crystal structures. Here, we review the current structural and functional insight into the paramyxovirus polymerase complex in conjunction with an evaluation of the mechanism of activity and developmental status of available experimental RdRp inhibitors. Our assessment spotlights the importance of the RdRp complex as a premier target for therapeutic intervention and examines how high-resolution insight into the organization of the complex will pave the path towards the structure-guided design and optimization of much-needed next-generation paramyxovirus RdRp blockers.

  9. Association of vitamin D receptor BsmI, TaqI, FokI, and ApaI polymorphisms with susceptibility of chronic periodontitis: A systematic review and meta-analysis based on 38 case -control studies.

    Mashhadiabbas, Fatemeh; Neamatzadeh, Hossein; Nasiri, Rezvan; Foroughi, Elnaz; Farahnak, Soudabeh; Piroozmand, Parisa; Mazaheri, Mahta; Zare-Shehneh, Masoud

    2018-01-01

    There has been increasing interest in the study of the association between Vitamin D receptor (VDR) gene polymorphisms and risk of chronic periodontitis. However, the results remain inconclusive. To better understand the roles of VDR polymorphisms (BsmI, TaqI, FokI, and ApaI) in chronic periodontitis susceptibility, we conducted this systematic review and meta-analysis. The PubMed, Google Scholar, and Web of Science database were systemically searched to determine all the eligible studies about VDR polymorphisms and risk of chronic periodontitis up to April 2017. Odds ratio (OR) and 95% confidence interval (CI) were used to evaluate the associations between VDR polymorphisms and chronic periodontitis risk. All the statistical analyses were performed by Comprehensive Meta-Analysis. All P values were two-tailed with a significant level at 0.05. Finally, a total of 38 case-control studies in 19 publications were identified which met our inclusion criteria. There are ten studies with 866 chronic periodontitis cases and 786 controls for BsmI, 16 studies with 1570 chronic periodontitis cases and 1676 controls for TaqI, five studies with 374 chronic periodontitis cases and 382 controls for FokI, and seven studies with 632 chronic periodontitis cases and 604 controls for ApaI. Overall, no significant association was observed between VDR gene BsmI, TaqI, FokI, and ApaI polymorphisms and risk of chronic periodontitis in any genetic model. Subgroup analysis stratified by ethnicity suggested a significant association between BsmI polymorphism and chronic periodontitis risk in the Caucasian subgroup under allele model (A vs. G: OR = 1.747, 95% CI = 1.099-2.778, P = 0.018). Further, no significant associations were observed when stratified by Hardy-Weinberg equilibrium status for BsmI, TaqI, and ApaI. Our results suggest that BsmI, TaqI, FokI, and ApaI polymorphisms in the VDR gene might not be associated with risk of chronic periodontitis in overall population.

  10. Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens.

    Qu, X S; Wanner, L A; Christ, B J

    2011-03-01

    To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  11. The associations among the dopamine D2 receptor Taq1, emotional intelligence, creative potential measured by divergent thinking, and motivational state and these associations' sex differences.

    Takeuchi, Hikaru; Tomita, Hiroaki; Taki, Yasuyuki; Kikuchi, Yoshie; Ono, Chiaki; Yu, Zhiqian; Sekiguchi, Atsushi; Nouchi, Rui; Kotozaki, Yuka; Nakagawa, Seishu; Miyauchi, Carlos M; Iizuka, Kunio; Yokoyama, Ryoichi; Shinada, Takamitsu; Yamamoto, Yuki; Hanawa, Sugiko; Araki, Tsuyoshi; Hashizume, Hiroshi; Kunitoki, Keiko; Sassa, Yuko; Kawashima, Ryuta

    2015-01-01

    Previous neuroscientific studies have shown that the dopaminergic system plays an important role in creative potential measured by divergent thinking (CPMDT), emotional control, and motivational state. However, although associations between two of these four components have been previously established (e.g., the association between CPMDT and emotional control, the association between CPMDT and motivational state, etc.), the interactions between these four remain unknown. The purpose of this study was to reveal these interactions using path analyses. The Taq1A polymorphism of the dopamine D2 receptor (DRD2) gene was used for this purpose. For measuring emotional intelligence (EI), we used the Japanese version of the Emotional Intelligence Scale. CPMDT was measured using the S-A creativity test. Motivational state was measured using the Vigor subscale of the Japanese version of the Profile of Mood Scale (POMS). Data from 766 healthy, right-handed individuals (426 men and 340 women; 20.7 ± 1.9 years of age) were used in this study. There were significant and robust positive relationships among measures of CPMDT, EI, and motivational state across sex. In addition, the polymorphism of the DRD2 gene was significantly associated with EI, specifically in females. Path analysis in females indicates that the model in which (a) the DRD2 polymorphism primarily facilitates EI, (b) EI in turn facilitates CPMDT and leads to a better motivational state, and (c) a better motivational state also directly facilitates CPMDT explains the data in the most accurate manner. This study suggested a comprehensive picture of the cascade of the associations among dopamine, EI, motivational state, and CPMDT at least in females.

  12. Separation of DNA-dependent polymerase activities in Micrococcus radiodurans

    Kitayama, S; Matsuyama, A [Institute of Physical and Chemical Research, Wako, Saitama (Japan)

    1977-03-02

    DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by ..gamma.. radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans.

  13. Atomistic Molecular Dynamics Simulations of Mitochondrial DNA Polymerase γ

    Euro, Liliya; Haapanen, Outi; Róg, Tomasz

    2017-01-01

    of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable......DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site...... changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform...

  14. Polymerase chain reaction: Theory, practice and application: A review

    S E Atawodi

    2010-01-01

    Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

  15. UVB DNA dosimeters analyzed by polymerase chain reactors

    Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL

    1997-01-01

    Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)

  16. Backtracking dynamics of RNA polymerase: pausing and error correction

    Sahoo, Mamata; Klumpp, Stefan

    2013-01-01

    Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield–Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates. (paper)

  17. Allosteric inhibitors of Coxsackie virus A24 RNA polymerase.

    Schein, Catherine H; Rowold, Diane; Choi, Kyung H

    2016-02-15

    Coxsackie virus A24 (CVA24), a causative agent of acute hemorrhagic conjunctivitis, is a prototype of enterovirus (EV) species C. The RNA polymerase (3D(pol)) of CVA24 can uridylylate the viral peptide linked to the genome (VPg) from distantly related EV and is thus, a good model for studying this reaction. Once UMP is bound, VPgpU primes RNA elongation. Structural and mutation data have identified a conserved binding surface for VPg on the RNA polymerase (3D(pol)), located about 20Å from the active site. Here, computational docking of over 60,000 small compounds was used to select those with the lowest (best) specific binding energies (BE) for this allosteric site. Compounds with varying structures and low BE were assayed for their effect on formation of VPgU by CVA24-3D(pol). Two compounds with the lowest specific BE for the site inhibited both uridylylation and formation of VPgpolyU at 10-20μM. These small molecules can be used to probe the role of this allosteric site in polymerase function, and may be the basis for novel antiviral compounds. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms

    Lars Gerdes

    2016-03-01

    The droplet separation value allows for easy and reproducible assay performance evaluation. The combination of separation value with the experience matrix simplifies the choice of adequate assay parameters for a given GMO event.

  19. Enzymological description of multitemplate PCR-Shrinking amplification bias by optimizing the polymerase-template ratio

    Ingr, M.; Dostál, Jiří; Majerová, Taťána

    2015-01-01

    Roč. 382, Oct 7 (2015), s. 178-186 ISSN 0022-5193 R&D Projects: GA MŠk LO1302; GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : amplification efficiency * amplicons pooling * species diversity * library preparation * processivity Subject RIV: CE - Biochemistry Impact factor: 2.049, year: 2015

  20. Thioredoxin suppresses microscopic hopping of T7 DNA polymerase on duplex DNA

    Etson, Candice M.; Hamdan, Samir M.; Richardson, Charles C.; Oijen, Antoine M. van; Richardson, Charles C.

    2010-01-01

    The DNA polymerases involved in DNA replication achieve high processivity of nucleotide incorporation by forming a complex with processivity factors. A model system for replicative DNA polymerases, the bacteriophage T7 DNA polymerase (gp5), encoded by gene 5, forms a tight, 1:1 complex with

  1. Production of DNA polymerase by recombinant pET-17b/Pfu-Pol ...

    Although this enzyme has been produced worldwide, there is no reported cloning or production of polymerases in Egypt. In the current work, plasmid coding Pfu polymerase enzyme (pET-17b/Pfu-Pol) was transformed into E. coli Top10. The plasmid coding Pfu- polymerase was confirmed by restriction analysis using HindIII ...

  2. The role of DNA polymerase {iota} in UV mutational spectra

    Choi, Jun-Hyuk [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Besaratinia, Ahmad [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Dong-Hyun [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Chong-Soon [Department of Biochemistry, College of Natural Sciences, Yeungnam University, Gyongsan 712-749 (Korea, Republic of); Pfeifer, Gerd P. [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States)]. E-mail: gpfeifer@coh.org

    2006-07-25

    UVB (280-320 nm) and UVC (200-280 nm) irradiation generate predominantly cyclobutane pyrimidine dimers (CPDs) and (6-4) photoproducts in DNA. CPDs are thought to be responsible for most of the UV-induced mutations. Thymine-thymine CPDs, and probably also CPDs containing cytosine, are replicated in vivo in a largely accurate manner by a DNA polymerase {eta} (Pol {eta}) dependent process. Pol {eta} is a DNA damage-tolerant and error-prone DNA polymerase encoded by the POLH (XPV) gene in humans. Another member of the Y family of error-prone DNA polymerases is POLI encoding DNA polymerase iota (Pol {iota}). In order to clarify the specific role of Pol {iota} in UV mutagenesis, we have used an siRNA knockdown approach in combination with a supF shuttle vector which replicates in mammalian cells, similar as we have previously done for Pol {eta}. Synthetic RNA duplexes were used to efficiently inhibit Pol {iota} expression in 293T cells. The supF shuttle vector was irradiated with 254 nm UVC and replicated in 293T cells in presence of anti-Pol {iota} siRNA. Surprisingly, there was a consistent reduction of recovered plasmid from cells with Pol {iota} knockdown and this was independent of UV irradiation of the plasmid. The supF mutant frequency was unchanged in the siRNA knockdown cells relative to control cells confirming that Pol {iota} does not play an important role in UV mutagenesis. UV-induced supF mutants were sequenced from siRNA-treated cells and controls. Neither the type of mutations nor their distribution along the supF gene were significantly different between controls and siRNA knockdown cells and were predominantly C to T and CC to TT transitions at dipyrimidine sites. These results show that Pol {iota} has no significant role in UV lesion bypass and mutagenesis in vivo and provides some initial data suggesting that this polymerase may be involved in replication of extrachromosomal DNA.

  3. Poliovirus Polymerase Leu420 Facilitates RNA Recombination and Ribavirin Resistance

    Kempf, Brian J.; Peersen, Olve B.

    2016-01-01

    ABSTRACT RNA recombination is important in the formation of picornavirus species groups and the ongoing evolution of viruses within species groups. In this study, we examined the structure and function of poliovirus polymerase, 3Dpol, as it relates to RNA recombination. Recombination occurs when nascent RNA products exchange one viral RNA template for another during RNA replication. Because recombination is a natural aspect of picornavirus replication, we hypothesized that some features of 3Dpol may exist, in part, to facilitate RNA recombination. Furthermore, we reasoned that alanine substitution mutations that disrupt 3Dpol-RNA interactions within the polymerase elongation complex might increase and/or decrease the magnitudes of recombination. We found that an L420A mutation in 3Dpol decreased the frequency of RNA recombination, whereas alanine substitutions at other sites in 3Dpol increased the frequency of recombination. The 3Dpol Leu420 side chain interacts with a ribose in the nascent RNA product 3 nucleotides from the active site of the polymerase. Notably, the L420A mutation that reduced recombination also rendered the virus more susceptible to inhibition by ribavirin, coincident with the accumulation of ribavirin-induced G→A and C→U mutations in viral RNA. We conclude that 3Dpol Leu420 is critically important for RNA recombination and that RNA recombination contributes to ribavirin resistance. IMPORTANCE Recombination contributes to the formation of picornavirus species groups and the emergence of circulating vaccine-derived polioviruses (cVDPVs). The recombinant viruses that arise in nature are occasionally more fit than either parental strain, especially when the two partners in recombination are closely related, i.e., members of characteristic species groups, such as enterovirus species groups A to H or rhinovirus species groups A to C. Our study shows that RNA recombination requires conserved features of the viral polymerase. Furthermore, a

  4. Biochemical characterization of recombinant influenza A polymerase heterotrimer complex: Polymerase activity and mechanisms of action of nucleotide analogs

    Barauskas, O.; Xing, W.; Aguayo, E.; Willkom, M.; Sapre, A.; Clarke, M.; Birkuš, Gabriel; Schultz, B. E.; Sakowicz, R.; Kwon, H. J.; Feng, J. Y.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0185998. E-ISSN 1932-6203 Institutional support: RVO:61388963 Keywords : virus RNA polymerase * T-705 Favipiravir * structural basis Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 2.806, year: 2016 http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0185998

  5. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  6. Simultaneous detection of Acidovorax avenae subsp. citrulli and Didymella bryoniae in cucurbit seedlots using magnetic capture hybridization and real-time polymerase chain reaction.

    Ha, Y; Fessehaie, A; Ling, K S; Wechter, W P; Keinath, A P; Walcott, R R

    2009-06-01

    To improve the simultaneous detection of two pathogens in cucurbit seed, a combination of magnetic capture hybridization (MCH) and multiplex real-time polymerase chain reaction (PCR) was developed. Single-stranded DNA hybridization capture probes targeting DNA of Acidovorax avenae subsp. citrulli, causal agent of bacterial fruit blotch, and Didymella bryoniae, causal agent of gummy stem blight, were covalently attached to magnetic particles and used to selectively concentrate template DNA from cucurbit seed samples. Sequestered template DNAs were subsequently amplified by multiplex real-time PCR using pathogen-specific TaqMan PCR assays. The MCH multiplex real-time PCR assay displayed a detection threshold of A. avenae subsp. citrulli at 10 CFU/ml and D. bryoniae at 10(5) conidia/ml in mixtures of pure cultures of the two pathogens, which was 10-fold more sensitive than the direct real-time PCR assays for the two pathogens separately. Although the direct real-time PCR assay displayed a detection threshold for A. avenae subsp. citrulli DNA of 100 fg/microl in 25% (1/4 samples) of the samples assayed, MCH real-time PCR demonstrated 100% detection frequency (4/4 samples) at the same DNA concentration. MCH did not improve detection sensitivity for D. bryoniae relative to direct real-time PCR using conidial suspensions or seed washes from D. bryoniae-infested cucurbit seed. However, MCH real-time PCR facilitated detection of both target pathogens in watermelon and melon seed samples (n = 5,000 seeds/sample) in which 0.02% of the seed were infested with A. avenae subsp. citrulli and 0.02% were infested with D. bryoniae.

  7. Development of TaqMan probes targeting the four major celiac disease epitopes found in α-gliadin sequences of spelt (Triticum aestivum ssp. spelta) and bread wheat (Triticum aestivum ssp. aestivum).

    Dubois, Benjamin; Bertin, Pierre; Muhovski, Yordan; Escarnot, Emmanuelle; Mingeot, Dominique

    2017-01-01

    Celiac disease (CD) is caused by specific sequences of gluten proteins found in cereals such as bread wheat ( Triticum aestivum ssp. aestivum ) and spelt ( T. aestivum ssp. spelta ). Among them, the α-gliadins display the highest immunogenicity, with four T-cell stimulatory epitopes. The toxicity of each epitope sequence can be reduced or even suppressed according to the allelic form of each sequence. One way to address the CD problem would be to make use of this allelic variability in breeding programs to develop safe varieties, but tools to track the presence of toxic epitopes are required. The objective of this study was to develop a tool to accurately detect and quantify the immunogenic content of expressed α-gliadins of spelt and bread wheat. Four TaqMan probes that only hybridize to the canonical-i.e. toxic-form of each of the four epitopes were developed and their specificity was demonstrated. Six TaqMan probes targeting stable reference genes were also developed and constitute a tool to normalize qPCR data. The probes were used to measure the epitope expression levels of 11 contrasted spelt accessions and three ancestral diploid accessions of bread wheat and spelt. A high expression variability was highlighted among epitopes and among accessions, especially in Asian spelts, which showed lower epitope expression levels than the other spelts. Some discrepancies were identified between the canonical epitope expression level and the global amount of expressed α-gliadins, which makes the designed TaqMan probes a useful tool to quantify the immunogenic potential independently of the global amount of expressed α-gliadins. The results obtained in this study provide useful tools to study the immunogenic potential of expressed α-gliadin sequences from Triticeae accessions such as spelt and bread wheat. The application of the designed probes to contrasted spelt accessions revealed a high variability and interesting low canonical epitope expression levels in the

  8. Multiplex Real-Time PCR Assay Using TaqMan Probes for the Identification of Trypanosoma cruzi DTUs in Biological and Clinical Samples

    Cura, Carolina I.; Duffy, Tomas; Lucero, Raúl H.; Bisio, Margarita; Péneau, Julie; Jimenez-Coello, Matilde; Calabuig, Eva; Gimenez, María J.; Valencia Ayala, Edward; Kjos, Sonia A.; Santalla, José; Mahaney, Susan M.; Cayo, Nelly M.; Nagel, Claudia; Barcán, Laura; Málaga Machaca, Edith S.; Acosta Viana, Karla Y.; Brutus, Laurent; Ocampo, Susana B.; Aznar, Christine; Cuba Cuba, Cesar A.; Gürtler, Ricardo E.; Ramsey, Janine M.; Ribeiro, Isabela; VandeBerg, John L.; Yadon, Zaida E.; Osuna, Antonio; Schijman, Alejandro G.

    2015-01-01

    Background Trypanosoma cruzi has been classified into six Discrete Typing Units (DTUs), designated as TcI–TcVI. In order to effectively use this standardized nomenclature, a reproducible genotyping strategy is imperative. Several typing schemes have been developed with variable levels of complexity, selectivity and analytical sensitivity. Most of them can be only applied to cultured stocks. In this context, we aimed to develop a multiplex Real-Time PCR method to identify the six T. cruzi DTUs using TaqMan probes (MTq-PCR). Methods/Principal Findings The MTq-PCR has been evaluated in 39 cultured stocks and 307 biological samples from vectors, reservoirs and patients from different geographical regions and transmission cycles in comparison with a multi-locus conventional PCR algorithm. The MTq-PCR was inclusive for laboratory stocks and natural isolates and sensitive for direct typing of different biological samples from vectors, reservoirs and patients with acute, congenital infection or Chagas reactivation. The first round SL-IR MTq-PCR detected 1 fg DNA/reaction tube of TcI, TcII and TcIII and 1 pg DNA/reaction tube of TcIV, TcV and TcVI reference strains. The MTq-PCR was able to characterize DTUs in 83% of triatomine and 96% of reservoir samples that had been typed by conventional PCR methods. Regarding clinical samples, 100% of those derived from acute infected patients, 62.5% from congenitally infected children and 50% from patients with clinical reactivation could be genotyped. Sensitivity for direct typing of blood samples from chronic Chagas disease patients (32.8% from asymptomatic and 22.2% from symptomatic patients) and mixed infections was lower than that of the conventional PCR algorithm. Conclusions/Significance Typing is resolved after a single or a second round of Real-Time PCR, depending on the DTU. This format reduces carryover contamination and is amenable to quantification, automation and kit production. PMID:25993316

  9. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

    İLHAK, O. İrfan; ARSLAN, Ali

    2014-01-01

    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  10. Building block synthesis using the polymerase chain assembly method.

    Marchand, Julie A; Peccoud, Jean

    2012-01-01

    De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).

  11. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  12. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-01

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

  13. A nonsense mutation causing decreased levels of insulin receptor mRNA: Detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction

    Kadowaki, T.; Kadowaki, H.; Taylor, S.I.

    1990-01-01

    Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. The authors have studied a patient with leprechaunism (leprechaun/Minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. Genomic DNA from the patient was amplified by the polymerase chain reaction catalyzed by Thermus aquaticus (Taq) DNA polymerase, and the amplified DNA was directly sequenced. A nonsense mutations was identified at codon 897 in exon 14 in the paternal allele of the patient's insulin receptor gene. Levels of insulin receptor mRNA are decreased to <10% of normal in Epstein-Barr virus-transformed lymphoblasts and cultured skin fibroblasts from this patient. Thus, this nonsense mutation appears to cause a decrease in the levels of insulin receptor mRNA. In addition, they have obtained indirect evidence that the patient's maternal allele of the insulin receptor gene contains a cis-acting dominant mutation that also decreases the level of mRNA, but by a different mechanism. The nucleotide sequence of the entire protein-coding domain and the sequences of the intron-exon boundaries for all 22 exons of the maternal allele were normal. Presumably, the mutation in the maternal allele maps elsewhere in the insulin receptor gene. Thus, they conclude that the patient is a compound heterozygote for two cis-acting dominant mutations in the insulin receptor gene: (i) a nonsense mutation in the paternal allel that reduces the level of insulin receptor mRNA and (ii) an as yet unidentified mutation in the maternal allele that either decreases the rate of transcription or decreases the stability of the mRNA

  14. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. DNA polymerase beta participates in mitochondrial DNA repair

    Sykora, P; Kanno, S; Akbari, M

    2017-01-01

    We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...

  16. Chromosomal location of the human gene for DNA polymerase β

    McBride, O.W.; Zmudzka, B.Z.; Wilson, S.H.

    1987-01-01

    Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene

  17. Structure and mechanism of human DNA polymerase [eta

    Biertümpfel, Christian; Zhao, Ye; Kondo, Yuji; Ramón-Maiques, Santiago; Gregory, Mark; Lee, Jae Young; Masutani, Chikahide; Lehmann, Alan R.; Hanaoka, Fumio; Yang, Wei (Sussex); (NIH); (Gakushuin); (Osaka)

    2010-11-03

    The variant form of the human syndrome xeroderma pigmentosum (XPV) is caused by a deficiency in DNA polymerase {eta} (Pol{eta}), a DNA polymerase that enables replication through ultraviolet-induced pyrimidine dimers. Here we report high-resolution crystal structures of human Pol{eta} at four consecutive steps during DNA synthesis through cis-syn cyclobutane thymine dimers. Pol{eta} acts like a 'molecular splint' to stabilize damaged DNA in a normal B-form conformation. An enlarged active site accommodates the thymine dimer with excellent stereochemistry for two-metal ion catalysis. Two residues conserved among Pol{eta} orthologues form specific hydrogen bonds with the lesion and the incoming nucleotide to assist translesion synthesis. On the basis of the structures, eight Pol{eta} missense mutations causing XPV can be rationalized as undermining the molecular splint or perturbing the active-site alignment. The structures also provide an insight into the role of Pol{eta} in replicating through D loop and DNA fragile sites.

  18. Genetic linkage map of cowpea (Vigna unguiculata (L.) Walp) using ...

    DR.ADETUNMBI

    2016-05-18

    May 18, 2016 ... Constructed map provides basic information that could assist in genetic improvement of .... mix contains two universal (FRET) fluorescent resonance energy transfer cassettes. (FAM and HEX), ROX™ passive reference dye, Taq polymerase, free nucleotides and MgCl2 in an optimized buffer solution, while ...

  19. Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

    Khan, S. A.; Ahmed, S.; Khan, F. A.; Shamshad, G. U.; Joyia, Z.; Mushahid, N.; Saeed, S.

    2013-01-01

    Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

  20. File list: Pol.CeL.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Full Text Available Pol.CeL.50.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Cell line...70,SRX749072,SRX749071,SRX749073,SRX017852,SRX529168 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.CeL.50.RNA_polymerase_II.AllCell.bed ...