Directory of Open Access Journals (Sweden)
Rudolph Spangler
Full Text Available BACKGROUND: PCR in principle can detect a single target molecule in a reaction mixture. Contaminating bacterial DNA in reagents creates a practical limit on the use of PCR to detect dilute bacterial DNA in environmental or public health samples. The most pernicious source of contamination is microbial DNA in DNA polymerase preparations. Importantly, all commercial Taq polymerase preparations inevitably contain contaminating microbial DNA. Removal of DNA from an enzyme preparation is problematical. METHODOLOGY/PRINCIPAL FINDINGS: This report demonstrates that the background of contaminating DNA detected by quantitative PCR with broad host range primers can be decreased greater than 10-fold through the simple expedient of Taq enzyme dilution, without altering detection of target microbes in samples. The general method is: For any thermostable polymerase used for high-sensitivity detection, do a dilution series of the polymerase crossed with a dilution series of DNA or bacteria that work well with the test primers. For further work use the concentration of polymerase that gave the least signal in its negative control (H(2O while also not changing the threshold cycle for dilutions of spiked DNA or bacteria compared to higher concentrations of Taq polymerase. CONCLUSIONS/SIGNIFICANCE: It is clear from the studies shown in this report that a straightforward procedure of optimizing the Taq polymerase concentration achieved "treatment-free" attenuation of interference by contaminating bacterial DNA in Taq polymerase preparations. This procedure should facilitate detection and quantification with broad host range primers of a small number of bona fide bacteria (as few as one in a sample.
Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.
2003-01-01
Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...
Angers, M; Cloutier, J F; Castonguay, A; Drouin, R
2001-08-15
Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.
Data of self-made Taq DNA polymerase prepared for screening purposes
Directory of Open Access Journals (Sweden)
E.V. Konovalova
2017-04-01
Full Text Available DNA analysis is a key procedure in genetic engineering. Nowadays the analysis is often done by PCR with Taq DNA polymerase. Although the last enzyme price is quite low, demand for numerous analyses results in much money expenditure which are not affordable for many laboratories. In a meanwhile, many screening tasks do not require the highly purified enzyme. Taking into account the enzyme unique properties it makes possible to marginally simplify its production without resorting to costly or lengthy techniques such as column chromatography and/or dialysis. Here the data of routine usage of Taq DNA polymerase prepared according to the protocol developed in our laboratory is presented. The protocol takes only several hours to realize and does not need qualified personnel or expensive equipment. Yet it gives the enzyme preparation suitable for most screening purposes. The isolated Taq DNA polymerase stock can be stored as ammonium sulfate suspension in a refrigerator for prolonged period, not less than 6 months. The working enzyme solution is prepared from the stock suspension on demand, not more than once in a month and can be stored also in a refrigerator.
Directory of Open Access Journals (Sweden)
Marcin Olszewski
Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.
Real-time TaqMan polymerase chain reaction to quantify the effects ...
African Journals Online (AJOL)
TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.
Cline, J; Braman, J C; Hogrefe, H H
1996-09-15
The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.
Bellin, Robert M.; Bruno, Mary K.; Farrow, Melissa A.
2010-01-01
We have developed a 9-week undergraduate laboratory series focused on the purification and characterization of "Thermus aquaticus" DNA polymerase (Taq). Our aim was to provide undergraduate biochemistry students with a full-semester continuing project simulating a research-like experience, while having each week's procedure focus on a single…
Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario
2010-06-01
Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.
PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.
Cline, J; Braman, J C; Hogrefe, H H
1996-01-01
The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) < Deep Vent (2.7 x 10(-6)) < Vent (2.8 x 10(-6)) < Taq (8.0 x 10(-6)) < < exo- Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at p...
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine
2014-01-01
DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Directory of Open Access Journals (Sweden)
Tom eKillelea
2014-05-01
Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.
DEFF Research Database (Denmark)
Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer
DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...
Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.
Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide
2018-05-05
Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550
Arezi, Bahram; McKinney, Nancy; Hansen, Connie; Cayouette, Michelle; Fox, Jeffrey; Chen, Keith; Lapira, Jennifer; Hamilton, Sarah; Hogrefe, Holly
2014-01-01
Faster-cycling PCR formulations, protocols, and instruments have been developed to address the need for increased throughput and shorter turn-around times for PCR-based assays. Although run times can be cut by up to 50%, shorter cycle times have been correlated with lower detection sensitivity and increased variability. To address these concerns, we applied Compartmentalized Self Replication (CSR) to evolve faster-cycling mutants of Taq DNA polymerase. After five rounds of selection using progressively shorter PCR extension times, individual mutations identified in the fastest-cycling clones were randomly combined using ligation-based multi-site mutagenesis. The best-performing combinatorial mutants exhibit 35- to 90-fold higher affinity (lower Kd ) for primed template and a moderate (2-fold) increase in extension rate compared to wild-type Taq. Further characterization revealed that CSR-selected mutations provide increased resistance to inhibitors, and most notably, enable direct amplification from up to 65% whole blood. We discuss the contribution of individual mutations to fast-cycling and blood-resistant phenotypes.
Czech Academy of Sciences Publication Activity Database
Utekal, Pavol; Kocanda, Lukáš; Matoušek, P.; Wagner, P.; Bugajev, Viktor; Dráber, Petr
2015-01-01
Roč. 416, January (2015), s. 178-182 ISSN 0022-1759 R&D Projects: GA ČR(CZ) GBP302/12/G101; GA MPO FR-TI3/067; GA ČR(CZ) GA14-09807S; GA ČR(CZ) GA14-00703S Institutional support: RVO:68378050 Keywords : 1,2-Propanediol * real-time PCR * SYBR Green I * Taq DNA polymerase * trehalose * Unseparated blood Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.858, year: 2015
Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes
2017-02-07
Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.
Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.
Lorenz, Todd C
2012-05-22
In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling
COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR
Directory of Open Access Journals (Sweden)
Masashi Miura
2013-12-01
Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Polymerase chain reaction for the detection of Mycobacterium leprae
Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.
1989-01-01
A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
Directory of Open Access Journals (Sweden)
Milena Alicja Stachelska
2017-01-01
Full Text Available The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detect Yersinia enterocolitica strains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg of Yersinia enterocolitica in pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenic Yersinia enterocolitica strains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.
Nagy, Alexander; Černíková, Lenka; Vitásková, Eliška; Křivda, Vlastimil; Dán, Ádám; Dirbáková, Zuzana; Jiřincová, Helena; Procházka, Bohumír; Sedlák, Kamil; Havlíčková, Martina
2016-01-01
In the present work, we optimised and evaluated a qPCR system integrating 6-FAM (6-carboxyfluorescein)-labelled TaqMan probes and melting analysis using the SYTO 82 (S82) DNA binding dye in a single reaction. We investigated the influence of the S82 on various TaqMan and melting analysis parameters and defined its optimal concentration. In the next step, the method was evaluated in 36 different TaqMan assays with a total of 729 paired reactions using various DNA and RNA templates, including field specimens. In addition, the melting profiles of interest were correlated with the electrophoretic patterns. We proved that the S82 is fully compatible with the FAM-TaqMan system. Further, the advantages of this approach in routine diagnostic TaqMan qPCR were illustrated with practical examples. These included solving problems with flat or other atypical amplification curves or even false negativity as a result of probe binding failure. Our data clearly show that the integration of the TaqMan qPCR and melting analysis into a single assay provides an additional control option as well as the opportunity to perform more complex analyses, get more data from the reactions, and obtain analysis results with higher confidence. PMID:27031831
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Toshiaki Higashi
2012-04-01
Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...
International Nuclear Information System (INIS)
Ruan Changgeng; Gu Jianmin; Wang Xiaodong; Chu Xiaohong; Pan Junliang; Wu Qingyu
1992-08-01
Glanzmann's thrombasthenia is a bleeding disorder caused by qualitative and/or quantitative defects of platelet membrane glycoprotein (GP) Ii b /III a complex. The disease is inherited in an autosomal recessive manner. The use of cDNA probes to study restriction fragment length polymorphisms (RFLPs) in GPIII a gene is reported. A Taq I polymorphism was identified and this RFLP consisted of variant bands of 6.5 kb/4.0 and 2.5 kb with a frequency of 0.46/0.54 in Chinese population. The Taq I polymorphism was further localized by polymerase chain reaction (PCR) method to exon VIII of the GPIII a gene. In two Glanzmann's thrombasthenia families, the Taq I RFLP studied with both Southern blotting and PCR methods identified defective GPIII a gene inherited by patients, and determined the genotype of asymptomatic subjects. Analysis of this Taq I polymorphism by PCR method should be potentially useful in future for the carrier detection and prenatal diagnosis in Glanzmann's thrombasthenia families
Bagheri, Fahimeh; Ebadifar, Asghar; Khorram Khorshid, Hamid Reza; Kamali, Koorosh
2017-10-16
The aim of this study is to evaluate the association of TGFA TaqI polymorphism with nonsyndromic cleft lip and/or palate (NSCLP) in an Iranian population. In this case-control study, 113 children with NSCLP and 209 controls were included. Genotyping of the TaqI polymorphism was performed by polymerase chain reaction and restriction fragment length polymorphism methods. A p-value of control group (p = 0.422) were in Hardy-Weinberg equilibrium. There was no statistically significant difference in the genotype distribution (p = 0.059) and allele frequency (p = 0.065) of the TGFA TaqI polymorphism in the NSCLP and control groups. TGFA TaqI polymorphism was not associated with the risk of NSCLP in Iranian children. Birth Defects Research 109:1386-1389, 2017.© 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Porcine parvovirus 4 (PPV4) is a DNA virus, and a member of the Parvoviridae family within the Bocavirus genera. It was recently detected in swine, but its epidemiology and pathology remain unclear. A TaqMan-based real-time polymerase chain reaction (qPCR) assay targeting a conserved region of the O...
Validation of the DNATyper™15 PCR Genotyping System for Forensic Application
Jian Ye; Chengtao Jiang; Xingchun Zhao; Le Wang; Caixia Li; Anquan Ji; Li Yuan; Jing Sun; Shuaifeng Chen
2015-01-01
We describe the optimization and validation of the DNATyper™15 multiplex polymerase chain reaction (PCR) genotyping system for autosomal short tandem repeat (STR) amplification at 14 autosomal loci (D6S1043, D21S11, D7S820, CSF1PO, D2S1338, D3S1358, D13S317, D8S1179, D16S539, Penta E, D5S818, vWA, D18S51, and FGA) and amelogenin, a sex-determining locus. Several DNATyper™15 assay variables were optimized, including hot start Taq polymerase concentration, Taq polymerase activation time, magne...
Directory of Open Access Journals (Sweden)
Bayoh Nabie M
2007-02-01
Full Text Available Abstract Background Identification of Anopheles gambiae s.s. and Anopheles arabiensis from field-collected Anopheles gambiae s.l. is often necessary in basic and applied research, and in operational control programmes. The currently accepted method involves use of standard polymerase chain reaction amplification of ribosomal DNA (rDNA from the 3' 28S to 5' intergenic spacer region of the genome, and visual confirmation of amplicons of predicted size on agarose gels, after electrophoresis. This report describes development and evaluation of an automated, quantitative PCR method based upon TaqMan™ single nucleotide polymorphism (SNP genotyping. Methods Standard PCR, and TaqMan SNP genotyping with newly designed primers and fluorophore-labeled probes hybridizing to sequences of complementary rDNA specific for either An. gambiae s.s. or An. arabiensis, were conducted in three experiments involving field-collected An. gambiae s.l. from western Kenya, and defined laboratory strains. DNA extraction was from a single leg, sonicated for five minutes in buffer in wells of 96-well PCR plates. Results TaqMan SNP genotyping showed a reaction success rate, sensitivity, and species specificity comparable to that of standard PCR. In an extensive field study, only 29 of 3,041 (0.95% were determined to be hybrids by TaqMan (i.e., having rDNA sequences from both species, however, all but one were An. arabiensis by standard PCR, suggesting an acceptably low (ca. 1% error rate for TaqMan genotyping in mistakenly identifying species hybrids. Conclusion TaqMan SNP genotyping proved to be a sensitive and rapid method for identification of An. gambiae s.l. and An. arabiensis, with a high success rate, specific results, and congruence with the standard PCR method.
Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming
2013-07-01
Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.
Water Bridging Dynamics of Polymerase Chain Reaction in the Gauge Theory Paradigm of Quantum Fields
Directory of Open Access Journals (Sweden)
L. Montagnier
2017-05-01
Full Text Available We discuss the role of water bridging the DNA-enzyme interaction by resorting to recent results showing that London dispersion forces between delocalized electrons of base pairs of DNA are responsible for the formation of dipole modes that can be recognized by Taq polymerase. We describe the dynamic origin of the high efficiency and precise targeting of Taq activity in PCR. The spatiotemporal distribution of interaction couplings, frequencies, amplitudes, and phase modulations comprise a pattern of fields which constitutes the electromagnetic image of DNA in the surrounding water, which is what the polymerase enzyme actually recognizes in the DNA water environment. The experimental realization of PCR amplification, achieved through replacement of the DNA template by the treatment of pure water with electromagnetic signals recorded from viral and bacterial DNA solutions, is found consistent with the gauge theory paradigm of quantum fields.
Investigations of Flare Gas Emissions in Taq Taq Oil Field on the Surrounding Land
Directory of Open Access Journals (Sweden)
Jafar A. Ali
2014-11-01
Full Text Available Environmental pollution caused by oil takes many different forms; one of the most damaging sources is simply the combustion of oil products, such as a well flare burn-off. This paper presents the results of a survey of the agriculture lands around the Taq Taq Oil Production Company. The aim of the survey was to determine the potential contamination caused by the gas emissions from the well flares. Taq Taq field is located in the Kurdistan Region of Iraq, 60 km north of the giant Kirkuk oil field, 85 km south-east of Erbil and 120 km north-west of Suleimani. Samples of soil were collected from several locations around the site and analyzed to determine the content of Polycyclic Aromatic Hydrocarbons PAH present. A gas chromatography linked to a mass spectrometry (GCMS machine was used for these measurements. The PAH contamination at each location of soil was determined and the 16-PAHs, as listed in the US Environmental Protection Agency (EPA documentation were investigated. The average content of total PAH in all samples of the agricultural soil was 0.654 mg·kg-1 with the concentrations ranging from 0.310 to 0.869 mg·kg-1. It was found that the PAH concentrations decreased with increasing distance from the TTOPCO oil field, indicating that pollution was evident, the area close to the field being more affected by the gas pollution.
Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub
2016-01-01
This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.
Kho, S L; Chua, K H; George, E; Tan, J A M A
2013-07-15
Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
Directory of Open Access Journals (Sweden)
Yuexia Wang
2015-09-01
Full Text Available Real-time polymerase chain reaction (PCR allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at −18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 103 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 100 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach.
Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao
2015-09-01
Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.
DEFF Research Database (Denmark)
Zhen, Zhuo; Liu, Jingwen; Rensing, Christopher Günther T
2017-01-01
and diversity analysis. In this study, two clone libraries were constructed with two different DNA polymerases, Q5 high-fidelity DNA polymerase and exTaq polymerase, to compare the differences in their capability to accurately reflect the cyanobacterial community structure and diversity in a subtropical deep......-fidelity DNA polymerase. It is noteworthy that so far Q5 high-fidelity DNA polymerase was the first time to be employed in the genetic analysis of cyanobacterial community. And it is for the first time that the cyanobacterial community structure in Dongzhen reservoir was analyzed using molecular methods...
Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro
2010-06-01
Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).
Bohuski, Elizabeth; Lorch, Jeffrey M; Griffin, Kathryn M; Blehert, David S
2015-04-15
Fungal skin infections associated with Ophidiomyces ophiodiicola, a member of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex, have been linked to an increasing number of cases of snake fungal disease (SFD) in captive snakes around the world and in wild snake populations in eastern North America. The emergence of SFD in both captive and wild situations has led to an increased need for tools to better diagnose and study the disease. We developed two TaqMan real-time polymerase chain reaction (PCR) assays to rapidly detect O. ophiodiicola in clinical samples. One assay targets the internal transcribed spacer region (ITS) of the fungal genome while the other targets the more variable intergenic spacer region (IGS). The PCR assays were qualified using skin samples collected from 50 snakes for which O. ophiodiicola had been previously detected by culture, 20 snakes with gross skin lesions suggestive of SFD but which were culture-negative for O. ophiodiicola, and 16 snakes with no clinical signs of infection. Both assays performed equivalently and proved to be more sensitive than traditional culture methods, detecting O. ophiodiicola in 98% of the culture-positive samples and in 40% of the culture-negative snakes that had clinical signs of SFD. In addition, the assays did not cross-react with a panel of 28 fungal species that are closely related to O. ophiodiicola or that commonly occur on the skin of snakes. The assays did, however, indicate that some asymptomatic snakes (~6%) may harbor low levels of the fungus, and that PCR should be paired with histology when a definitive diagnosis is required. These assays represent the first published methods to detect O. ophiodiicola by real-time PCR. The ITS assay has great utility for assisting with SFD diagnoses whereas the IGS assay offers a valuable tool for research-based applications.
Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.
2013-01-01
The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.
Directory of Open Access Journals (Sweden)
Roberta Flávia Ribeiro Rolando
2012-06-01
Full Text Available This study reports the first genetic characterisation of Cryptosporidium isolates in Brazil using real-time polymerase chain reaction (RT-PCR. A total of 1,197 faecal specimens from children and 10 specimens from human immunodeficiency virus-infected patients were collected between 1999-2010 and screened using microscopy. Forty-eight Cryptosporidium oocyst-positive isolates were identified and analysed using a generic TaqMan assay targeting the 18S rRNA to detect Cryptosporidium species and two other TaqMan assays to identify Cryptosporidium hominis and Cryptosporidium parvum. The 18S rRNA assay detected Cryptosporidium species in all 48 of the stool specimens. The C. parvum TaqMan assay correctly identified five/48 stool samples, while 37/48 stool specimens were correctly amplified in the C. hominis TaqMan assay. The results obtained in this study support previous findings showing that C. hominis infections are more prevalent than C. parvum infections in Brazil and they demonstrate that the TaqMan RT-PCR procedure is a simple, fast and valuable tool for the detection and differentiation of Cryptosporidium species.
Evolving a polymerase for hydrophobic base analogues.
Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp
2009-10-21
Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.
[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].
Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng
2013-10-18
To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.
Laura K Muller; Jeffrey M. Lorch; Daniel L. Lindner; Michael O' Connor; Andrea Gargas; David S. Blehert
2013-01-01
The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The...
Directory of Open Access Journals (Sweden)
Olivier Martínez
Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.
Ahmad, Israr; Jafar, Tabrez; Mahdi, Farzana; Ameta, Keerti; Arshad, Md; Das, Siddharth Kumar; Waliullah, Shah; Rizvi, Imran; Mahdi, Abbas Ali
2018-06-15
Vitamin D receptor (VDR) gene has an important role as a candidate gene for the regulation of bone mass in osteoporosis. However, its association with bone mineral density (BMD) is controversial and has not been established in different ethnic populations. To enhance the understanding of VDR gene polymorphism in the context of BMD, we investigated the plausible genetic association of TaqI and ApaI polymorphism with BMD in North Indian postmenopausal women with osteoporosis.254 osteoporotic women (Age 55.82 ± 6.91) and 254 postmenopausal non osteoporotic women (Age 54.76 ± 6.26) were included in the study. VDR TaqI and ApaI polymorphism were determined by PCR (polymerase chain reaction) and RFLP (restriction fragment length polymorphism). BMD was assessed by dual energy X-ray absorptiometry (DXA) at the lumbar spine (L 1 -L 4 ), hip, forearm and femoral neck. The average BMD with TT genotype was significantly lower at lumbar spine, hip and forearm. The Frequency of TT genotype and t allele was significantly high in osteoporotic women when compared with controls. The average BMD with Aa genotype was higher in ApaI. Furthermore, comparison of frequency distribution of genotype and allele for VDR ApaI between osteoporotic patients and controls did not show any significant difference. Our findings revealed that TaqI gene TT genotype was associated with low BMD in North Indian osteoporotic women. Moreover, TT genotype and t allele associated significantly with osteoporosis in postmenopausal women. Therefore, VDR TaqI gene is an important determinant of risk factor for osteoporosis. Copyright © 2018 Elsevier B.V. All rights reserved.
Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.
Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik
2010-04-01
To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.
Vallefuoco, L; Sorrentino, R; Spalletti Cernia, D; Colucci, G; Portella, G
2012-12-01
The cobas p 630, a fully automated pre-analytical instrument for primary tube handling recently introduced to complete the Cobas(®) TaqMan systems portfolio, was evaluated in conjunction with: the COBAS(®) AmpliPrep/COBAS(®) TaqMan HBV Test, v2.0, COBAS(®) AmpliPrep/COBAS(®) TaqMan HCV Test, v1.0 and COBAS(®) AmpliPrep/COBAS(®) TaqMan HIV Test, v2.0. The instrument performance in transferring samples from primary to secondary tubes, its impact in improving COBAS(®) AmpliPrep/COBAS(®) TaqMan workflow and hands-on reduction and the risk of possible cross-contamination were assessed. Samples from 42 HBsAg positive, 42 HCV and 42 HIV antibody (Ab) positive patients as well as 21 healthy blood donors were processed with or without automated primary tubes. HIV, HCV and HBsAg positive samples showed a correlation index of 0.999, 0.987 and of 0.994, respectively. To assess for cross-contamination, high titer HBV DNA positive samples, HCV RNA and HIV RNA positive samples were distributed in the cobas p 630 in alternate tube positions, adjacent to negative control samples within the same rack. None of the healthy donor samples showed any reactivity. Based on these results, the cobas p 630 can improve workflow and sample tracing in laboratories performing molecular tests, and reduce turnaround time, errors, and risks. Copyright © 2012 Elsevier B.V. All rights reserved.
Engineering of a DNA Polymerase for Direct m6 A Sequencing.
Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas
2018-01-08
Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.
Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing
2018-02-01
The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.
Miura, Itaru; Takeuchi, Satoshi; Katsumi, Akihiko; Mori, Azuma; Kanno, Keiko; Yang, Qiaohui; Mashiko, Hirobumi; Numata, Yoshihiko; Niwa, Shin-Ichi
2012-02-01
The Taq1A polymorphism in the dopamine D2 receptor (DRD2) gene could be related to the response to antipsychotics. We examined the effects of the Taq1A polymorphism on the plasma monoamine metabolites during the treatment of schizophrenia with aripiprazole, a DRD2 partial agonist. Thirty Japanese patients with schizophrenia were treated with aripiprazole for 6 weeks. We measured plasma levels of homovanillic acid (pHVA) and 3-methoxy-4hydroxyphenylglycol (pMHPG) before and after treatment. The Taq1A polymorphism was genotyped with polymerase chain reaction. Aripiprazole improved the acute symptoms of schizophrenia and decreased pHVA in responders (P = 0.023) but not in nonresponders (P = 0.28). Although A1 allele carriers showed a tendency to respond to aripiprazole (61.5%) compared to A1 allele noncarriers (29.4%) (P = 0.078), there was not statistically significant difference in the response between the 2 genotype groups. There were significant effect for response (P = 0.013) and genotype × response interaction (P = 0.043) on the change of pHVA. The changes of pHVA differ between responders and nonresponders in A1 allele carriers but not in A1 allele noncarriers. There were no genotype or response effects or genotype × response interaction on the changes of the plasma levels of 3-methoxy-4hydroxyphenylglycol. Our preliminary results suggest that Taq1A polymorphism may be partly associated with changes in pHVA during acute schizophrenia.
Directory of Open Access Journals (Sweden)
Al-Eisa AA
2016-08-01
Full Text Available Amal A Al-Eisa, Mohammad Z Haider Department of Pediatrics, Faculty of Medicine, Kuwait University, Safat, Kuwait Background: Vitamin D activity is controlled by vitamin D receptors (VDRs, which are affected by different genetic polymorphisms, including TaqI and Apal restriction fragment length polymorphisms (RFLPs, which have been reported to be associated with several diseases. The aim of this study was to determine the frequency and the association of VDR gene polymorphisms with idiopathic nephrotic syndrome (INS and steroid responsiveness in Kuwaiti children. Subjects and methods: Genotypes of the VDR TaqI gene polymorphism and the Apal gene polymorphism were analyzed using polymerase chain reaction-RFLP in 78 INS patients and 56 matched controls. Results: A total of 78 INS (62 steroid sensitive [SS] and 16 steroid resistant [SR] patients with a mean age of 6.5±3.1 years were studied. Male:female ratio was 2:1. The TT genotype of VDR–TaqI polymorphism was detected in 41% of the INS patients compared to 42% of the controls (P=0.816. The heterozygous TC genotype was detected in 33% of INS patients compared to 46% of the controls (P=0.462. The CC genotype was detected in 25.6% of INS patients and 21% of the controls (P=0.719. The C-allele frequency, in its homozygous and heterozygous forms, was 71% in INS patients compared to 63% in the controls (P=0.342. Similarly, no significant difference was detected in terms of VDR–Apal polymorphism in INS patients compared to the controls for all the three genotypes (P=0.76, P=0.207, and P=0.364, respectively, for GG, GT, and TT genotypes. The T-allele frequency, in its homozygous and heterozygous forms, was 89% in INS patients compared to 93% in the controls (P=0.076. No significant difference was found in any of the allele frequencies between SS and SR subgroups when compared with each other or when compared to the controls. Conclusion: Our data do not support the use of VDR–TaqI or
Institute of Scientific and Technical Information of China (English)
周慧; 梁宇斌; 吴苏喜; 李晓明; 裴伟; 杨涛
2011-01-01
The method of Real - time fluorescence quantitative polymerase chain reaction ( RT - PCR) with TaqMan fluorescent probe was chosen to fast detect the amount of palm oil mixed in peanut oil. MT3 - B gene of palm was selected as target gene to detect palm oil from peanut oil. The primers of MT3 - B and TaqMan probe were designed, MT3 - B gene reconstructed plasmid was built as absolute quantitative criteria for quantitative RT - PCR to establish standard curve. Peanut oil blended with 1% -40% concentration gradient palm oil was extracted DNA to test palm content by RT - PCR. The result showed that the correlation coefficient (R1) of standard curve with logarithmic linear regression analysis was 0.996. When the adulteration of palm oil in peanut oil reached 5% volume, MT3 - B gene of 17.431 copies per milli-liter of mixed oil could be detected . The method showed good sensitivity, specificity and repeatability.%根据棕榈内源基因MT3 -B设计引物和TaqMan探针,采用基因重组技术构建用于检测棕榈基因MT3 -B的重组质粒作为绝对定量标准品,建立标准曲线,对花生油中掺入棕榈油1% ~40%梯度混合油品提取DNA进行棕榈成分定量检测.结果表明,重组质粒标准品荧光定量标准曲线对数线性回归分析相关系数(R2)为0.996;花生油中掺入棕榈油达到5%时,可检出每亳升混合油品中棕榈MT3 -B基因17.431 copies,检测的重复性和特异性好.
Genetic linkage map of cowpea (Vigna unguiculata (L.) Walp) using ...
African Journals Online (AJOL)
DR.ADETUNMBI
2016-05-18
May 18, 2016 ... Constructed map provides basic information that could assist in genetic improvement of .... mix contains two universal (FRET) fluorescent resonance energy transfer cassettes. (FAM and HEX), ROX™ passive reference dye, Taq polymerase, free nucleotides and MgCl2 in an optimized buffer solution, while ...
Directory of Open Access Journals (Sweden)
Skorić Marijana
2012-01-01
Full Text Available Random amplified polymorphic DNA (RAPD analysis is a simple and reliable method used to detect DNA polymorphism. Several factors can affect the amplification profiles, thereby causing false bands and non-reproducibility of the assay. In this study, we analyzed the effects of different concentrations of primer, magnesium chloride, template DNA and Taq DNA polymerase to develop and standardize a RAPD protocol for Centaurium species. The optimized PCR reaction mixture included: 50 ng of DNA extracted using a CTbased protocol, 2.5 mM MgCl2, 7.5 pmol primer and 2 U of Taq polymerase in a final volume of 25 μl. Each of the five primers used in experiments (OPB11, OPB15, OPB18, OPF05 and OPH02 generated reproducible and distinguishable fingerprinting patterns of four Centaurium species. The obtained optimized RAPD protocol and the selected primers are useful for our further work in the genetic diversity studies of Centaurium species.
Directory of Open Access Journals (Sweden)
Anika Daing
2015-01-01
Full Text Available Background: Increasing evidences support the role of genetic factors in susceptibility to chronic periodontitis. The aim of the present pilot study was to explore the association of two potential single nucleotide polymorphisms (SNPs: Interleukin (IL-1β + 3954 (rs1143634, C > T and vitamin D receptor (VDR TaqI (rs731236, T > C with chronic periodontitis in a North Indian population. Materials and Methods: Twenty-eight chronic periodontitis subjects and 47 periodontally healthy controls were recruited. Individual samples of venous blood were obtained from each subject. Genotyping was done by polymerase chain reaction, followed by restriction fragment length polymorphism (PCR-RFLP. Logistic regression and chi square test were used for genetic association analysis and a P value less than 0.05 taken as statistical significance. Statistical Analysis Used: Chi square test and odds ratio (OR was used. Results: Genotypes and alleles of SNP IL-1β + 3954 did not show a significant association (P > 0.05 with chronic periodontitis. Genotype CC and allele C of VDR TaqI were significantly associated with a higher risk for chronic periodontitis as compared to subjects with TT genotype (CC/TT OR = 4.615; 95% confidence interval [CI]: 1.17 to 18.078 P = 0.028 and allele T (C/T OR = 2.423; 95% CI: 1.179 to 4.980. Conclusion: In North Indian population, genotype CC and allele C of VDR TaqI were associated with risk of chronic periodontitis. No significant correlation was found for IL-1β + 3954 polymorphism and chronic periodontitis.
Quadruplex genotype analysis at HumTH01, HumTPOX, HumCSF1PO and amelogenin Loci by FoLT-PCR
Energy Technology Data Exchange (ETDEWEB)
Lee, Y.H.; Lim, S.K.; Kang, P.W.; Choi, D.H.; Yoon, S.R.; Han, M.S. [National Institute of Scientific Investigation, Seoul (Korea)
1999-06-01
A simple and rapid procedure, called FoLT-PCR(Formamide Low Temperature-Polymerase Chain Reaction) was applied to amplifying DNA directly from various forensic biological evidences including human blood, saliva, hair root, or semen without any DNA preparative steps. We added washing step with non-ionic detergent, 1% Triton X-100, and used Taq DNA polymerase instead of Tth DNA polymerase to amplify 3 STR loci and gender allele simultaneously. Optimal concentration of formamide and annealing temperature were determined empirically to 8%(v/v), and 48{sup o} C respectively. We also compared this method with standard PCR. 8 refs., 4 figs.
Association between vitamin D receptor gene polymorphism (TaqI)
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...
Association between vitamin D receptor gene polymorphism (TaqI ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...
Saha, Ratul; Donofrio, Robert S; Bagley, Susan T
2010-08-01
A TaqMan quantitative real-time polymerase chain reaction (qPCR) assay was developed for the detection and enumeration of three Pseudomonas species belonging to the mendocina sublineage (P. oleovorans, P. pseudoalcaligenes, and P. oleovorans subsp. lubricantis) found in contaminated metalworking fluids (MWFs). These microbes are the primary colonizers and serve as indicator organisms of biodegradation of used MWFs. Molecular techniques such as qPCR are preferred for the detection of these microbes since they grow poorly on typical growth media such as R2A agar and Pseudomonas isolation agar (PIA). Traditional culturing techniques not only underestimate the actual distribution of these bacteria but are also time-consuming. The primer-probe pair developed from gyrase B (gyrB) sequences of the targeted bacteria was highly sensitive and specific for the three species. qPCR was performed with both whole cell and genomic DNA to confirm the specificity and sensitivity of the assay. The sensitivity of the assay was 10(1) colony forming units (CFU)/ml for whole cell and 13.7 fg with genomic DNA. The primer-probe pair was successful in determining concentrations from used MWF samples, indicating levels between 2.9 x 10(3) and 3.9 x 10(6) CFU/ml. In contrast, the total count of Pseudomonas sp. recovered on PIA was in the range of <1.0 x 10(1) to 1.4 x 10(5) CFU/ml for the same samples. Based on these results from the qPCR assay, the designed TaqMan primer-probe pair can be efficiently used for rapid (within 2 h) determination of the distribution of these species of Pseudomonas in contaminated MWFs.
International Nuclear Information System (INIS)
Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie
2009-01-01
Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.
A quantitative PCR (TaqMan assay for pathogenic Leptospira spp
Directory of Open Access Journals (Sweden)
Symonds Meegan L
2002-07-01
Full Text Available Abstract Background Leptospirosis is an emerging infectious disease. The differential diagnosis of leptospirosis is difficult due to the varied and often "flu like" symptoms which may result in a missed or delayed diagnosis. There are over 230 known serovars in the genus Leptospira. Confirmatory serological diagnosis of leptospirosis is usually made using the microscopic agglutination test (MAT which relies on the use of live cultures as the source of antigen, often performed using a panel of antigens representative of local serovars. Other techniques, such as the enzyme linked immunosorbent assay (ELISA and slide agglutination test (SAT, can detect different classes of antibody but may be subject to false positive reactions and require confirmation of these results by the MAT. Methods The polymerase chain reaction (PCR has been used to detect a large number of microorganisms, including those of clinical significance. The sensitivity of PCR often precludes the need for isolation and culture, thus making it ideal for the rapid detection of organisms involved in acute infections. We employed real-time (quantitative PCR using TaqMan chemistry to detect leptospires in clinical and environmental samples. Results and Conclusions The PCR assay can be applied to either blood or urine samples and does not rely on the isolation and culture of the organism. Capability exists for automation and high throughput testing in a clinical laboratory. It is specific for Leptospira and may discriminate pathogenic and non-pathogenic species. The limit of detection is as low as two cells.
Lek, Fang-Ying; Ong, Hing-Huat; Say, Yee-How
2018-01-01
This study investigated the association of DRD2 Taq1A, Taq1B and Taq1D gene polymorphisms with eating behavior, the preference/intake frequency/craving of high-fat foods and obesity in 394 Malaysian adults (161 males, 233 females; 308 Chinese, 86 Indians; 67 obese, 327 non-obese). Eating behaviors namely Cognitive Restraint, Uncontrolled Eating and Emotional Eating scores were assessed by the Three Factor Eating Questionnaire-R18. The preference/intake frequency/craving of 26 common high-fat Malaysian foods was assessed using a 7-point hedonic scale. Anthropometric measurements were taken and Taq1 gene polymorphisms were genotyped by PCR-Restriction Fragment Length Polymorphism using DNA extracted from mouthwash samples. The overall minor allele frequencies of Taq1A, Taq1B and Taq1D according to ethnicities (Chinese/Indian) were 0.37/0.29, 0.39/0.28, 0.06/0.30, respectively; genotype and allele distributions of Taq1B and Taq1D were significantly different between ethnicities. Eating behaviorscores were not significantly different between gender and ethnicities. Those with A1 or B1 allele had lower Cognitive Restraint score and higher Uncontrolled Eating score, while those with A1/A1 or B1/B1 genotype had higher fast food preference. D1 allele was associated with increased starchy food craving and mamak (Malaysian Indian-Muslim) food preference, but not eating behavior scores. All three gene variants were not associated with obesity and adiposity. Taken together, we posit that three DRD2 Taq1 gene polymorphisms influence the eating behavior and preference/intake frequency/craving of certain high-fat foods in Malaysian adults, but their role in obesity and adiposity is still inconclusive and needs further investigation.
DEFF Research Database (Denmark)
Fachmann, Mette Sofie Rousing; Josefsen, Mathilde Hasseldam; Hoorfar, Jeffrey
2015-01-01
bacterial cells in two validated real-time PCR assays for Campylobacter and Salmonella. The five best performing (based on: limit of detection (LOD), maximum fluorescence, shape of amplification curves, and amplification efficiency) were subsequently applied to meat and fecal samples. The VeriQuest q......PCR master mix performed best for both meat and fecal samples (LODs of 102 and 104 CFU ml-1 in the purest and crudest DNA extractions, respectively) compared with Tth (LOD=102 -103 and 105 -106 CFU ml-1 ). AmpliTaqGold and HotMasterTaq both performed well (LOD=102 -104 CFU ml-1 ) with meat samples and poorly...... (LOD=103 -106 CFU ml-1 /not detected) with fecal samples. CONCLUSIONS: Applying the VeriQuest qPCR master mix in the two tested real-time PCR assays could allow for simpler sample preparation and thus a reduction in cost. SIGNIFICANCE AND IMPACT OF STUDY: This work exemplifies a cost-effective strategy...
Ashayeri-Panah, M; Eftekhar, F; Feizabadi, M M
2012-04-01
To develop an optimized random amplified polymorphic DNA (RAPD) protocol for fingerprinting clinical isolates of Klebsiella pneumoniae. Employing factorial design of experiments, repeatable amplification patterns were obtained for 54 nosocomial isolates using 1 μmol 1(-1) primer, 4 mmol 1(-1) MgCl(2), 0·4 mmol 1(-1) dNTPs, 2·5 U Taq DNA polymerase and 90 ng DNA template in a total volume of 25 μl. The optimum thermocycling program was: initial denaturation at 94°C for 4 min followed by 50 cycles of 1 min at 94°C, 2 min at 34°C, 2 min at 72°C and a final extension at 72°C for 10 min. The optimized RAPD protocol was highly discriminatory (Simpson's diversity index, 0·982), and all isolates were typable with repeatable patterns (Pearson's similarity coefficient ≈ 100%). Seven main clusters were obtained on a similarity level of 70% and 32 distinct clusters on a similarity level of 85%, reflecting the heterogeneity of the isolates. Systematic optimization of RAPD generated reliable DNA fingerprints for nosocomial isolates of K. pneumoniae. This is the first report on RAPD optimization based on factorial design of experiments for discrimination of K. pneumoniae. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.
Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R
1998-04-01
Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.
Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo
2014-03-01
The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.
Jeenduang, Nutjaree; Sangkaew, Boonnisa; Chantaracha, Pacharee; Chanchareonsri, Sirada; Plyduang, Thunyaluk; Thitdee, Wanida; Samae, Cathaleeya; Pitumanon, Wacharaporn
2017-03-01
Hibiscus sabdariffa L. (HS) and Gynostemma pentaphyllum Makino (GP) have been used as traditional medicines to treat diabetes and hypercholesterolemia. Nevertheless, there is interindividual variation in the metabolic responses to HS and GP consumption. This may be due to genetic factors. The aim of this study was to investigate the effects of HS and GP tea consumption on anthropometric data, fasting blood glucose (FBG), and lipid concentrations in hypercholesterolemia subjects with different genotypes of the APOE and CETP TaqIB polymorphisms. Forty-eight subjects with hypercholesterolemia were given either HS or GP tea for 30 days. Anthropometric and biochemical variables were determined, and APOE and CETP TaqIB polymorphisms were analyzed using the polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP). E4 (p=0.008) and homozygous B1B1 (p=0.010) carriers had significantly decreased HDL-C concentrations after HS consumption; in addition, B2 carriers who consumed HS showed significantly decreased triglyceride (TG) concentrations (p=0.039). Regarding GP consumption, non-E4 carriers had significantly decreased HDL-C (p=0.009) and FBG (p=0.042) concentrations. Furthermore, B2 carriers had significantly decreased total cholesterol (TC) (p=0.045), HDL-C (p=0.004), and FBG (p=0.026) concentrations. HS consumption may have beneficial effects with respect to TG concentrations in the B2 carriers, but it may adversely affect HDL-C concentrations in homozygous B1B1 and E4 carriers. In contrast, GP consumption may have favorable effects on TC and FBG concentrations but not on HDL-C concentrations for B2 and/or non-E4 carriers.
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction
Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka
2005-01-01
AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152
Platts-Mills, James A.; Gratz, Jean; Mduma, Esto; Svensen, Erling; Amour, Caroline; Liu, Jie; Maro, Athanasia; Saidi, Queen; Swai, Ndealilia; Kumburu, Happiness; McCormick, Benjamin J. J.; Kibiki, Gibson; Houpt, Eric R.
2014-01-01
Etiologic studies of diarrhea are limited by uneven diagnostic methods and frequent asymptomatic detection of enteropathogens. Polymerase chain reaction-based stool pathogen quantification may help distinguish clinically significant infections. We performed a nested case-control study of diarrhea in infants from a community-based birth cohort in Tanzania. We tested 71 diarrheal samples and pre-diarrheal matched controls with a laboratory-developed TaqMan Array Card for 19 enteropathogens. With qualitative detection, no pathogens were significantly associated with diarrhea. When pathogen quantity was considered, rotavirus (odds ratio [OR] = 2.70 per log10 increase, P < 0.001), astrovirus (OR = 1.49, P = 0.01), and Shigella/enteroinvasive Escherichia coli (OR = 1.47, P = 0.04) were associated with diarrhea. Enterotoxigenic E. coli (0.15 SD decline in length-for-age z score after 3 months per log10 increase, P < 0.001) and Campylobacter jejuni/C. coli (0.11 SD decline, P = 0.003) in pre-diarrheal stools were associated with poor linear growth. Quantitative analysis can help refine the association between enteropathogens and disease in endemic settings. PMID:24189366
Ridge, Justin P; Dodd, Peter R
2009-10-01
Real-time RT-PCR normalized to GAPDH was used to assay N-methyl-D-aspartate (NMDA) receptor NR1, NR2A and NR2B subunit mRNA in human autopsy cortex tissue from chronic alcoholics with and without comorbid cirrhosis of the liver and matched controls. Subunit expression was influenced by the subject's genotype. The TaqIA polymorphism selectively modulated NMDA receptor mean transcript expression in cirrhotic-alcoholic superior frontal cortex, in diametrically opposite ways in male and female subjects. Genetic make-up may differentially influence vulnerability to brain damage by altering the excitation: inhibition balance, particularly in alcoholics with comorbid cirrhosis of the liver. The TaqIA polymorphism occurs within the poorly characterised ankyrin-repeat containing kinase 1 (ANKK1) gene. Using PCR, ANKK1 mRNA transcript was detected in inferior temporal, occipital, superior frontal and primary motor cortex of control human brain. ANKK1 expression may mediate the influence of the TaqIA polymorphism on phenotype.
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
Interim Report on Multiple Sequence Alignments and TaqMan Signature Mapping to Phylogenetic Trees
Energy Technology Data Exchange (ETDEWEB)
Gardner, S; Jaing, C
2012-03-27
The goal of this project is to develop forensic genotyping assays for select agent viruses, addressing a significant capability gap for the viral bioforensics and law enforcement community. We used a multipronged approach combining bioinformatics analysis, PCR-enriched samples, microarrays and TaqMan assays to develop high resolution and cost effective genotyping methods for strain level forensic discrimination of viruses. We have leveraged substantial experience and efficiency gained through year 1 on software development, SNP discovery, TaqMan signature design and phylogenetic signature mapping to scale up the development of forensics signatures in year 2. In this report, we have summarized the Taqman signature development for South American hemorrhagic fever viruses, tick-borne encephalitis viruses and henipaviruses, Old World Arenaviruses, filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus and Japanese encephalitis virus.
Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.
Singh, Prashant; Mustapha, Azlin
2013-09-02
Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.
Dopamine genes (DRD2/ANKK1-TaqA1 and DRD4-7R and executive function: their interaction with obesity.
Directory of Open Access Journals (Sweden)
Mar Ariza
Full Text Available Obesity is a multifactorial disease caused by the interaction between genotype and environment, and it is considered to be a type of addictive alteration. The A1 allele of the DRD2/ANKK1-TaqIA gene has been associated with addictive disorders, with obesity and with the performance in executive functions. The 7 repeat allele of the DRD4 gene has likewise been associated with the performance in executive functions, as well as with addictive behaviors and impulsivity. Participants were included in the obesity group (N = 42 if their body mass index (BMI was equal to or above 30, and in the lean group (N = 42 if their BMI was below 25. The DRD2/ANKK1-TaqIA and DRD4 VNTR polymorphisms were obtained. All subjects underwent neuropsychological assessment. Eating behavior traits were evaluated. The 'DRD2/ANKK1-TaqIA A1-allele status' had a significant effect on almost all the executive variables, but no significant 'DRD4 7R-allele status' effects were observed for any of the executive variables analyzed. There was a significant 'group' x 'DRD2/ANKK1-TaqIA A1-allele status' interaction effect on LN and 'group' x 'DRD4 7R-allele status' interaction effect on TMT B-A score. Being obese and a carrier of the A1 allele of DRD2/ANKK1-TaqIA or the 7R allele of DRD4 VNTR polymorphisms could confer a weakness as regards the performance of executive functions.
Directory of Open Access Journals (Sweden)
Jesús Salvador Velarde Félix
2009-02-01
Full Text Available OBJETIVO: Determinar la relación del polimorfismo TaqI del gen del receptor de la vitamina D (RVD con la lepra lepromatosa (LL en individuos originarios de Sinaloa, México. MATERIAL Y MÉTODOS: Se amplificó un fragmento de 740 pb del gen RVD en muestras de ADN de 71 pacientes con LL y 144 controles en el Hospital General de Culiacán durante el periodo 2004-2007. El polimorfismo se identificó mediante la endonucleasa TaqI. RESULTADOS: Se observó un aumento de relevancia estadística del genotipo TT en pacientes con LL en comparación con los controles (p= 0.040; RM= 1.82. CONCLUSIÓN: Se demuestra un nexo entre el genotipo TT y la susceptibilidad a la LL.OBJETIVE: To establish the association of the vitamin D receptor gene TaqI polymorphism with lepromatous leprosy (LL in individuals from Sinaloa, Mexico. MATERIAL AND METHODS: A 740 bp fragment was amplified from the VDR gene in DNA samples of 71 patients with LL and 144 controls in the Hospital General de Culiacán during 2004-2007. Polymorphism was identified through TaqI endonuclease. RESULTS: A significant increase in the genotype TT of the VDR gene was observed in patients when compared to controls (p = 0.040; OR = 1.82. CONCLUSIONS: Our data support the association between the TT genotype and susceptibility to LL in this Mexican population.
Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA
Directory of Open Access Journals (Sweden)
Bruynseels Peggy
2009-07-01
Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.
Carbonell, Pablo; Turpin, María C; Torres-Moreno, Daniel; Molina-Martínez, Irene; García-Solano, José; Perez-Guillermo, Miguel; Conesa-Zamora, Pablo
2011-09-01
The V600E mutation in the BRAF oncogene is associated with colorectal carcinomas, with mismatch-repair deficiency and, recently, with nonresponse to epidermal growth factor receptor inhibitor therapy. The use of reliable techniques for its detection is important. The aim of our study was to compare the performance characteristics in V600E detection of denaturing high-performance liquid chromatography (dHPLC) and high-resolution melting (HRM) with TaqMan allelic discrimination as well as direct-sequencing methods in a series of 195 colorectal paraffin-embedded specimens up to the age of 15 years. The effectiveness for obtaining results on mutation status was best using TaqMan (96.9%), followed by dHPLC (93.3%), HRM (88.7%), and sequencing (88.2%). In general, TaqMan was best for analyzing older tissues, whereas sequencing was the least efficient. Heterozygotic V600E was detected in 11.6%, 9.9%, 11.6%, and 9.9% of tissues using TaqMan, dHPLC, HRM, and sequencing, respectively. Result concordances between dHPLC and TaqMan or sequencing were excellent (κ = 0.9411 and κ = 0.8988, respectively); for HRM, the concordances were good (κ = 0.7973 and κ = 0.7488, respectively). By using DNA dilutions from tumor tissue, a minimum of 10% of V600E harboring cancer content was required for the analysis by dHPLC and HRM. dHPLC could detect four non-V600E mutations, whereas HRM detected one. Our results indicate that dHPLC and HRM are techniques that can be reliably used for the detection of the BRAFV600E mutation in archival paraffin-embedded tissues. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Shu-xia Guo
2016-09-01
Full Text Available Background: Previous studies have evaluated the associations between the cholesteryl ester transfer protein (CETP TaqIB polymorphism (rs708272, the risk of developing composite ischemic cardiovascular disease (CVD and the concentration of high-density lipoprotein cholesterol (HDL-C, but results remain controversial. The objective of this study was to investigate whether a relationship exists between these factors. Methods: We conducted a meta-analysis of available studies to clarify the associations of the CETP TaqIB polymorphism with HDL-C concentration and the composite ischemic CVD risk in both Asians and Caucasians. All statistical analyses were done with Stata 12.0. Results: Through utilization of the Cochrane Library, Embase, PubMed, Web of Science, Springer, China Science and Technology Journal Database, China National Knowledge Infrastructure, Google Scholar, and Baidu Library, a total of 45 studies from 44 papers with 20,866 cases and 21,298 controls were combined showing a significant association between the CETP TaqIB variant and composite ischemic CVD risk. Carriers of allele TaqIB-B1 were found to have a higher risk of composite ischemic CVD than non-carriers: OR = 1.15, 95% CI = 1.09–1.21, p < 0.001. Meanwhile, 28 studies with 23,959 subjects were included in the association between the CETP TaqIB polymorphism and the concentration of HDL-C. Results suggested that carriers of the B1B1 genotype had lower concentrations of HDL-C than those of the B2B2 genotype: SMD = 0.50, 95% CI = 0.36–0.65, p < 0.001. Conclusions: The synthesis of available evidence demonstrates that the CETP TaqIB polymorphism protects against composite ischemic CVD risk and is associated with a higher HDL-C concentration in both Asians and Caucasians.
Determining Annealing Temperatures for Polymerase Chain Reaction
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy
2004-01-01
In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement
Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB
Directory of Open Access Journals (Sweden)
Lenice Roteia Cardoso Jung
2015-06-01
Full Text Available Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR. The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.
Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB).
Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini
2015-06-01
Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.
Directory of Open Access Journals (Sweden)
Carlo Mengoli
2009-06-01
Full Text Available Background Trichomonas vaginalis is the most common nonviral sexually trasmitted diseases (STDs agent. For females, the diagnostic gold standard is the culture of vaginal swab, which is labour-exacting.The direct microscopic examination of vaginal secretions is the most used approach, but its sensitivity depends on the skill of the observer. Objectives We evaluated an original real-time TaqMan-based Polymerase Chain Reaction (PCR technique.The scope of the study was to confirm the effectiveness of the molecular approach in a clinical context and to explore its relevance to an epidemiological investigation. Study Design a ß-tubulin gene was chosen as target sequence.The assay was designed to exploit the quantitative potential of the TaqMan procedure.The population sample was 583 adult females presenting at the Service from January 2005 to December 2005.Three vaginal swabs were collected from each patient, one for wet mount microscopy, one for broth culture, and one for the molecular assay. Results The prevalence was 3.3% (culture, 3.1% (microscopy, 3.8% (PCR.An excess risk was detected in the immigrant population (risk ratio by PCR = 28. Conclusions The molecular approach was the most accurate way to detect the protozoon.The real-time PCR is convenient in a busy laboratory, provided the necessary equipment is available, and it is suitable for epidemiological investigation.
Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria
2003-12-15
Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.
Directory of Open Access Journals (Sweden)
Bianca Ramalho Quintaes
2004-03-01
Full Text Available Optimization of the RAPD reaction for characterizing Salmonella enterica serovar Typhi strains was studied in order to ensure the reproducibility and the discriminatory power of this technique. Eight Salmonella serovar Typhi strains isolated from various regions in Brazil were examined for the fragment patterns produced using different concentrations of DNA template, primer, MgCl2 and Taq DNA polymerase. Using two different low stringency thermal cycle profiles, the RAPD fingerprints obtained were compared. A set of sixteen primers was evaluated for their ability to produce a high number of distinct fragments. We found that variations associated to all of the tested parameters modified the fingerprinting patterns. For the strains of Salmonella enterica serovar Typhi used in this experiment, we have defined a set of conditions for RAPD-PCR reaction, which result in a simple, fast and reproducible typing method.A otimização da reação de RAPD para a caracterização de cepas de Salmonella enterica sorovar Typhi foi estudada com o objetivo de assegurar a reprodutibilidade e o poder discriminatório desta técnica. Oito cepas de Salmonella sorovar Typhi isoladas de algumas regiões do Brasil foram usadas para examinar os padrões de fragmentação produzidos quando foram empregadas concentrações diferentes do DNA molde, do iniciador, do MgCl2 e da enzima Taq DNA polimerase. Com a utilização de dois diferentes perfis de ciclos termais de baixa estringência, foram comparados os padrões de bandeamento obtidos. Um conjunto de dezesseis iniciadores foi avaliado quanto à capacidade de produzir elevado número de fragmentos distintos. Observou-se que variações associadas a todos os parâmetros testados modificaram os padrões de bandeamento. Para as amostras de Salmonella enterica sorovar Typhi utilizadas neste experimento, definiu-se um conjunto de condições para a reação de RAPD-PCR que resultou num método de tipagem simples, rápido e
Linguistic grammar learning and DRD2-TAQ-IA polymorphism.
Wong, Patrick C M; Ettlinger, Marc; Zheng, Jing
2013-01-01
As research into the neurobiology of language has focused primarily on the systems level, fewer studies have examined the link between molecular genetics and normal variations in language functions. Because the ability to learn a language varies in adults and our genetic codes also vary, research linking the two provides a unique window into the molecular neurobiology of language. We consider a candidate association between the dopamine receptor D2 gene (DRD2) and linguistic grammar learning. DRD2-TAQ-IA polymorphism (rs1800497) is associated with dopamine receptor D2 distribution and dopamine impact in the human striatum, such that A1 allele carriers show reduction in D2 receptor binding relative to carriers who are homozygous for the A2 allele. The individual differences in grammatical rule learning that are particularly prevalent in adulthood are also associated with striatal function and its role in domain-general procedural memory. Therefore, we reasoned that procedurally-based grammar learning could be associated with DRD2-TAQ-IA polymorphism. Here, English-speaking adults learned artificial concatenative and analogical grammars, which have been respectively associated with procedural and declarative memory. Language learning capabilities were tested while learners' neural hemodynamic responses were simultaneously measured by fMRI. Behavioral learning and brain activation data were subsequently compared with the learners' DRD2 (rs1800497) genotype. Learners who were homozygous for the A2 allele were better at concatenative (but not analogical) grammar learning and had higher striatal responses relative to those who have at least one A1 allele. These results provide preliminary evidence for the neurogenetic basis of normal variations in linguistic grammar learning and its link to domain-general functions.
Directory of Open Access Journals (Sweden)
Leila Mehdizadeh Fanid
2016-05-01
Full Text Available Background Attention deficit hyperactivity disorder (ADHD is a multi-factorial disorder that has defined by hyperactivity, impulsivity and attention deficits. Various neurotransmitters such as dopamine can play a role in its pathophysiology. The aim of this study was to examine the association of two common single nucleotide polymorphisms in DRD2 gene, Taq I A (T/C and Taq I B (G/A, with ADHA risk among Iranian-Azeri population. Materials and Methods A study of case–control association was performed with 89 samples with attention deficit hyperactivity disorder and 96 healthy subjects. Peripheral blood samples were used for Genomic DNA extraction by salting-out method. SNP genotyping was carried out by PCR-RFLP technique. The collected data were analyzed through javastant online statistics software, using Chi-square, with a significance level of 0.05. Results There was not a significant difference in the allele and genotype frequencies between ADHD and Taq1B polymorphism in cases and controls (P>0.05. In the Taq IA of DRD2 gene, TT homozygous dominants and CC homozygous recessives were more frequent in case group than in control group but significant difference was not observed (P>0.05. Also, T/C heterozygotes were more frequent among the control group than the case group, and difference was significant (P
TaqMan Real-Time Polymerase Chain Reaction and ...
African Journals Online (AJOL)
ISSN: 1596-5996 (print); 1596-9827 (electronic) ... Alcohol in humans is oxidized to acetaldehyde, which in turn is oxidized to .... cool to room temperature (15 - 25 oC) for at least. 5 min, and .... logical candidate gene for alcohol dependence. A.
Directory of Open Access Journals (Sweden)
Takao Ito
Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.
Association study between the Taq1A (rs1800497 polymorphism and schizophrenia in a Brazilian sample
Directory of Open Access Journals (Sweden)
Quirino Cordeiro
2014-08-01
Full Text Available Schizophrenia is a severe psychotic disorder with recurrent relapse and functional impairment. It results from a poorly understood gene-environment interaction. The Taq1A polymorphism (located in the gene cluster NTAD is a likely candidate for schizophrenia. Its rs1800497 polymorphism was shown to be associated with DRD2 gene expression. Therefore the present work aims to investigate a possible association between schizophrenia and such polymorphism. The compared distribution of the alleles and genotypes of the studied polymorphism was investigated in a Brazilian sample of 235 patients and 834 controls. Genotypic frequencies were in Hardy-Weinberg equilibrium. There was a trend of allelic association between the Taq1A polymorphism (rs1800497 with schizophrenia in the studied sample. However no statistically differences were found between cases and controls when analyzed by gender or schizophrenia subtypes.
Linguistic grammar learning and DRD2-TAQ-IA polymorphism.
Directory of Open Access Journals (Sweden)
Patrick C M Wong
Full Text Available As research into the neurobiology of language has focused primarily on the systems level, fewer studies have examined the link between molecular genetics and normal variations in language functions. Because the ability to learn a language varies in adults and our genetic codes also vary, research linking the two provides a unique window into the molecular neurobiology of language. We consider a candidate association between the dopamine receptor D2 gene (DRD2 and linguistic grammar learning. DRD2-TAQ-IA polymorphism (rs1800497 is associated with dopamine receptor D2 distribution and dopamine impact in the human striatum, such that A1 allele carriers show reduction in D2 receptor binding relative to carriers who are homozygous for the A2 allele. The individual differences in grammatical rule learning that are particularly prevalent in adulthood are also associated with striatal function and its role in domain-general procedural memory. Therefore, we reasoned that procedurally-based grammar learning could be associated with DRD2-TAQ-IA polymorphism. Here, English-speaking adults learned artificial concatenative and analogical grammars, which have been respectively associated with procedural and declarative memory. Language learning capabilities were tested while learners' neural hemodynamic responses were simultaneously measured by fMRI. Behavioral learning and brain activation data were subsequently compared with the learners' DRD2 (rs1800497 genotype. Learners who were homozygous for the A2 allele were better at concatenative (but not analogical grammar learning and had higher striatal responses relative to those who have at least one A1 allele. These results provide preliminary evidence for the neurogenetic basis of normal variations in linguistic grammar learning and its link to domain-general functions.
Typisierung von HLA-Klasse-II-Merkmalen mittels des TaqMan-Verfahrens
Tremmel, Matthias
2001-01-01
In Anlehnung an die konventionelle SSP-PCR-Methode wurde ein Low-Resolution-Panel mittels des TaqMan-Prinzips entwickelt und es wurde exemplarisch für DR4 und DR15/16 gezeigt, daß die auf dem 5 Nuklease-Assay beruhende Methode fähig ist, auch einzelne Punktmutationen voneinander zu unterscheiden. Das Grundprinzip dieser Methode basiert ähnlich dem der PCR-SSP auf dem Verfahren der PCR und auf dem Ausnutzen genetischer Unterschiede. So kommt es nur zu einer Amplifizierung wenn beide Primer spe...
Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František
2017-05-01
The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.
Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism
Directory of Open Access Journals (Sweden)
Gildo Almeida da Silva
Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.
S.D. Pas (Suzan); R. Molenkamp (Richard); J. Schinkel (Janke); S. Rebers; C. Copra (Cederick); S. Seven-Deniz; D. Thamke (Diana); R.J. de Knegt (Robert); B.L. Haagmans (Bart); M. Schutten (Martin)
2013-01-01
textabstractTo evaluate the analytical performance and explore the clinical applicability of the new Roche cobas AmpliPrep/cobas TaqMan HCV test, v2.0 (CAP/CTM v2.0), a platform comparison was performed on panels and diagnostic samples with the Roche cobas AmpliPrep/cobas TaqMan HCV test (CAP/CTM
Cancino-Faure, Beatriz; Fisa, Roser; Alcover, M. Magdalena; Jimenez-Marco, Teresa; Riera, Cristina
2016-01-01
Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification. PMID:27139452
Sang, Fuming; Yang, Yang; Yuan, Lin; Ren, Jicun; Zhang, Zhizhou
2015-09-01
Hot start (HS) PCR is an excellent alternative for high-throughput real time PCR due to its ability to prevent nonspecific amplification at low temperature. Development of a cost-effective and simple HS PCR technique to guarantee high-throughput PCR specificity and consistency still remains a great challenge. In this study, we systematically investigated the HS characteristics of QDs triggered in real time PCR with EvaGreen and SYBR Green I dyes by the analysis of amplification curves, standard curves and melting curves. Two different kinds of DNA polymerases, Pfu and Taq, were employed. Here we showed that high specificity and efficiency of real time PCR were obtained in a plasmid DNA and an error-prone two-round PCR assay using QD-based HS PCR, even after an hour preincubation at 50 °C before real time PCR. Moreover, the results obtained by QD-based HS PCR were comparable to a commercial Taq antibody DNA polymerase. However, no obvious HS effect of QDs was found in real time PCR using Taq DNA polymerase. The findings of this study demonstrated that a cost-effective high-throughput real time PCR based on QD triggered HS PCR could be established with high consistency, sensitivity and accuracy.Hot start (HS) PCR is an excellent alternative for high-throughput real time PCR due to its ability to prevent nonspecific amplification at low temperature. Development of a cost-effective and simple HS PCR technique to guarantee high-throughput PCR specificity and consistency still remains a great challenge. In this study, we systematically investigated the HS characteristics of QDs triggered in real time PCR with EvaGreen and SYBR Green I dyes by the analysis of amplification curves, standard curves and melting curves. Two different kinds of DNA polymerases, Pfu and Taq, were employed. Here we showed that high specificity and efficiency of real time PCR were obtained in a plasmid DNA and an error-prone two-round PCR assay using QD-based HS PCR, even after an hour
Growth differentiation factor 9 gene variants in Sudanese desert ...
African Journals Online (AJOL)
User
2016-11-12
Nov 12, 2016 ... divided by an intron of 1126 base pairs. The exons code for a ... nucleotide polymorphisms (SNPs) cause amino acid substitutions, and some of them have an effect on ovulation rate and .... MgCl2, 20 pmol of each primer, 1.5 U Go Taq Flexi Polymerase in 1-fold Colourless GoTaq Flexi buffer. (Promega ...
RFLP for TaqI at the human tyrosinase locus
Energy Technology Data Exchange (ETDEWEB)
Spritz, R; Strunk, K; Oetting, W; King, R
1988-10-25
A 1.4-kb EcoRI-PstI fragment from the mouse tyrosinase cDNA plasmid pTyrs-33 containing virtually the complete coding sequences. TaqI identifies a two-allele polymorphism with fragments of either 2.8 kb or 2.4 kb that contain most of the tyrosinase coding region. Three weak (1.4 kb, 0.9 kb, and 0.6 kb) and two very weak (5.0 and 3.2 kb) constant bands are also seen. The human tyrosinase gene has been regionally mapped to 11q14->21, and a wealy cross-hybridizing tyrosinase-related sequence mapped to 11p11.2->cen. Co-dominant segregation has been shown in two families. The RFLP was observed under normal hybridization and wash conditions.
Detecting beef meatball contamination with polymerase chain reaction
Directory of Open Access Journals (Sweden)
Hoda A.
2017-10-01
Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.
Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong
2018-02-01
Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.
in differentiation of selected species of Cucumis grown in Southern ...
African Journals Online (AJOL)
Jane
2011-08-22
Aug 22, 2011 ... series, Operon, USA) primers for amplification products. The PCR reaction was performed with 20 ng template DNA; Taq buffer with 1.5 mM MgCl2; dNTPs (1 mM/µl);. Taq polymerase (2 units); primer (5 pm); spermidine (20 mM) and reaction volume of 20 µl. Amplifications were performed on a. Eppendorf ...
Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.
Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q
2011-03-01
The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.
Zheng, Wenjun; Wang, Qingsong; Bi, Qun
2016-04-01
Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.
Monnier, Stéphanie; Cox, David G; Albion, Tim; Canzian, Federico
2005-01-01
Background Single Nucleotide Polymorphism (SNP) genotyping is a major activity in biomedical research. The Taqman technology is one of the most commonly used approaches. It produces large amounts of data that are difficult to process by hand. Laboratories not equipped with a Laboratory Information Management System (LIMS) need tools to organize the data flow. Results We propose a package of Visual Basic programs focused on sample management and on the parsing of input and output TaqMan files. The code is written in Visual Basic, embedded in the Microsoft Office package, and it allows anyone to have access to those tools, without any programming skills and with basic computer requirements. Conclusion We have created useful tools focused on management of TaqMan genotyping data, a critical issue in genotyping laboratories whithout a more sophisticated and expensive system, such as a LIMS. PMID:16221298
Validation of the DNATyper™15 PCR Genotyping System for Forensic Application
Directory of Open Access Journals (Sweden)
Jian Ye
2015-01-01
Full Text Available We describe the optimization and validation of the DNATyper™15 multiplex polymerase chain reaction (PCR genotyping system for autosomal short tandem repeat (STR amplification at 14 autosomal loci (D6S1043, D21S11, D7S820, CSF1PO, D2S1338, D3S1358, D13S317, D8S1179, D16S539, Penta E, D5S818, vWA, D18S51, and FGA and amelogenin, a sex-determining locus. Several DNATyper™15 assay variables were optimized, including hot start Taq polymerase concentration, Taq polymerase activation time, magnesium concentration, primer concentration, annealing temperature, reaction volume, and cycle number. The performance of the assay was validated with respect to species specificity, sensitivity to template concentration, stability, accuracy, influence of the DNA extraction methods, and the ability to genotype the mixture samples. The performance of the DNATyper™15 system on casework samples was compared with that of two widely used STR amplification kits, Identifiler™ (Applied Biosystems, Carlsbad, CA, USA and PowerPlex 16 ® (Promega, Madison, WI, USA. The conditions for PCR-based DNATyper™15 genotyping were optimized. Contamination from forensically relevant nonhuman DNA was not found to impact genotyping results, and full profiles were generated for all the reactions containing ≥ 0.125 ng of DNA template. No significant difference in performance was observed even after the DNATyper™15 assay components were subjected to 20 freeze-thaw cycles. The performances of DNATyper™15, Identifiler™, and PowerPlex 16 ® were comparable in terms of sensitivity and the ability to genotype the mixed samples and case-type samples, with the assays giving the same genotyping results for all the shared loci. The DNA extraction methods did not affect the performance of any of the systems. Our results demonstrate that the DNATyper™15 system is suitable for genotyping in both forensic DNA database work and case-type samples.
Directory of Open Access Journals (Sweden)
Albion Tim
2005-10-01
Full Text Available Abstract Background Single Nucleotide Polymorphism (SNP genotyping is a major activity in biomedical research. The Taqman technology is one of the most commonly used approaches. It produces large amounts of data that are difficult to process by hand. Laboratories not equipped with a Laboratory Information Management System (LIMS need tools to organize the data flow. Results We propose a package of Visual Basic programs focused on sample management and on the parsing of input and output TaqMan files. The code is written in Visual Basic, embedded in the Microsoft Office package, and it allows anyone to have access to those tools, without any programming skills and with basic computer requirements. Conclusion We have created useful tools focused on management of TaqMan genotyping data, a critical issue in genotyping laboratories whithout a more sophisticated and expensive system, such as a LIMS.
Wadowsky, Robert M; Laus, Stella; Green, Michael; Webber, Steven A; Rowe, David
2003-11-01
Epstein-Barr virus (EBV) DNA load values were measured in samples of whole blood (n = 60) and plasma (n = 59) by TaqMan PCR and in samples of peripheral blood lymphocytes (PBLs) (n = 60) by competitive PCR (cPCR). The samples were obtained from 44 transplant recipients. The whole-blood and PBL loads correlated highly (r(2) > 0.900), whereas the plasma and PBL loads correlated poorly (r(2) = 0.512). Testing of whole blood by TaqMan PCR is an acceptable alternative to testing of PBLs by cPCR for quantifying EBV DNA load.
Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M
2003-08-01
Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
CSIR Research Space (South Africa)
Van Heerden, A
2016-11-01
Full Text Available International Military Testing Association (IMTA) Conference, New Delhi, India, 7-11 November 2016 The formulation of a peer evaluation measure for special forces: operational forces operator traits and attitude questionnaire (SFO-TAQ) Van Heerden A...
A TaqI RFLP identified at the retinoblastoma locus on chromosome 13
Energy Technology Data Exchange (ETDEWEB)
Shiang, R; Murray, J C [Univ. of Iowa, Iowa City (USA); Wiggs, J; Dryja, T [Massachusetts Eye and Ear Infirmary, Boston (USA)
1988-09-26
Probe D95HS0.5 is a 0.6 kb fragment subcloned into Bluescribe a pUC19 derivative from a bacterio phage library isolated by a cDNA probe of the retinoblastoma gene. The fragment is released with the enzymes HindIII and SaII. TaqI identifies a 2 allele polymorphism with a band at 2.1 kb and 1.8 kb with a frequency of 0.97 and 0.03 respectively. There are no constant bands. The probe was assigned to chromosome 13 using a linkage analysis with retinoblastoma. Co-dominant inheritance was shown in 3 CEPH pedigrees.
Are There Mutator Polymerases?
Directory of Open Access Journals (Sweden)
Miguel Garcia-Diaz
2003-01-01
Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.
A new building block for DNA network formation by self-assembly and polymerase chain reaction.
Bußkamp, Holger; Keller, Sascha; Robotta, Marta; Drescher, Malte; Marx, Andreas
2014-01-01
The predictability of DNA self-assembly is exploited in many nanotechnological approaches. Inspired by naturally existing self-assembled DNA architectures, branched DNA has been developed that allows self-assembly to predesigned architectures with dimensions on the nanometer scale. DNA is an attractive material for generation of nanostructures due to a plethora of enzymes which modify DNA with high accuracy, providing a toolbox for many different manipulations to construct nanometer scaled objects. We present a straightforward synthesis of a rigid DNA branching building block successfully used for the generation of DNA networks by self-assembly and network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel electrophoresis, atomic force microscopy, dynamic light scattering, and electron paramagnetic resonance spectroscopy. The findings indicate that rather rigid DNA networks were formed. This presents a new bottom-up approach for DNA material formation and might find applications like in the generation of functional hydrogels.
Directory of Open Access Journals (Sweden)
Hua-Ying Fu
2016-01-01
Full Text Available Ratoon stunting disease (RSD of sugarcane, one of the most important diseases seriously affecting the productivity of sugarcane crops, was caused by the bacterial agent Leifsonia xyli subsp. xyli (Lxx. A TaqMan probe-based real-time quantitative polymerase chain reaction (qPCR assay was established in this study for the quantification of Lxx detection in sugarcane stalk juice. A pair of PCR primers (Pat1-QF/Pat1-QR and a fluorogenic probe (Pat1-QP targeting the Part1 gene of Lxx were used for the qPCR assay. The assay had a detection limit of 100 copies of plasmid DNA and 100 fg of Lxx genomic DNA, which was 100-fold more sensitive than the conventional PCR. Fifty (28.7% of 174 stalk juice samples from two field trials were tested to be positive by qPCR assay, whereas, by conventional PCR, only 12.1% (21/174 were tested to be positive with a published primer pair CxxITSf#5/CxxITSr#5 and 15.5% (27/174 were tested to be positive with a newly designed primer pair Pat1-F2/Pat1-R2. The new qPCR assay can be used as an alternative to current diagnostic methods for Lxx, especially when dealing with certificating a large number of healthy cane seedlings and determining disease incidence accurately in commercial fields.
Munk, Aisha J L; Wielpuetz, Catrin; Osinsky, Roman; Müller, Erik M; Grant, Phillip; Hennig, Jürgen
2016-01-01
Early and late event-related potential (ERP) responses, representing early subconscious and late motivational processes, were recorded for positive emotional words related to 'wanting' and 'liking', in dependence of the dopamine-related Taq1A genotype (ANKK1/DRD2). Research suggests that 'wanting' as opposed to 'liking' is related to dopaminergic processes. Therefore, it was hypothesized that risk allele carriers of the Taq1A polymorphism exhibit late ERP changes in reaction to words representing incentive motivation, i.e. 'wanting' (word categories 'lust' and 'anticipation'), but not to words representing 'liking' ('closeness'). Seventy-two male participants performed an emotional-word Stroop task during EEG recording and were genotyped according to the Taq1A polymorphism of ANKK1/DRD2. Positive emotional words related to anticipation and lust revealed blunted responses in the late positive potential (LPP) in carriers of the A1 allele, an effect absent in response to 'liking'-related words. These differences were not evident in the earlier posterior negativity (EPN). As no differences in dependence of the Taq1A genotype were observed in reaction to 'wanting'- and 'liking'-related words in the EPN, but merely in the LPP, it can be assumed that incentive-motivational stimuli only modify motivation-related ERP responses in carriers of the A1 allele of the Taq1A polymorphism, indicating the role of dopamine in late ERP components. © 2016 S. Karger AG, Basel.
Chase, D.M.; Elliott, D.G.; Pascho, R.J.
2006-01-01
Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
Biochemical characterization of enzyme fidelity of influenza A virus RNA polymerase complex.
Directory of Open Access Journals (Sweden)
Shilpa Aggarwal
2010-04-01
Full Text Available It is widely accepted that the highly error prone replication process of influenza A virus (IAV, together with viral genome assortment, facilitates the efficient evolutionary capacity of IAV. Therefore, it has been logically assumed that the enzyme responsible for viral RNA replication process, influenza virus type A RNA polymerase (IAV Pol, is a highly error-prone polymerase which provides the genomic mutations necessary for viral evolution and host adaptation. Importantly, however, the actual enzyme fidelity of IAV RNA polymerase has never been characterized.Here we established new biochemical assay conditions that enabled us to assess both polymerase activity with physiological NTP pools and enzyme fidelity of IAV Pol. We report that IAV Pol displays highly active RNA-dependent RNA polymerase activity at unbiased physiological NTP substrate concentrations. With this robust enzyme activity, for the first time, we were able to compare the enzyme fidelity of IAV Pol complex with that of bacterial phage T7 RNA polymerase and the reverse transcriptases (RT of human immunodeficiency virus (HIV-1 and murine leukemia virus (MuLV, which are known to be low and high fidelity enzymes, respectively. We observed that IAV Pol displayed significantly higher fidelity than HIV-1 RT and T7 RNA polymerase and equivalent or higher fidelity than MuLV RT. In addition, the IAV Pol complex showed increased fidelity at lower temperatures. Moreover, upon replacement of Mg(++ with Mn(++, IAV Pol displayed increased polymerase activity, but with significantly reduced processivity, and misincorporation was slightly elevated in the presence of Mn(++. Finally, when the IAV nucleoprotein (NP was included in the reactions, the IAV Pol complex exhibited enhanced polymerase activity with increased fidelity.Our study indicates that IAV Pol is a high fidelity enzyme. We envision that the high fidelity nature of IAV Pol may be important to counter-balance the multiple rounds of
Directory of Open Access Journals (Sweden)
Claudia Huber
Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.
The ectoparasitic stubby root nematode Paratrichodorus allius transmits Tobacco rattle virus, which causes corky ringspot disease resulting in significant economic losses in the potato industry. This study developed a diagnostic method for direct quantification of P. allius from soil DNA using a Taq...
Directory of Open Access Journals (Sweden)
Valentina di Rienzo
Full Text Available In tomato, resistance to Tomato spotted wilt virus (TSWV is conferred by the dominant gene, designated Sw-5. Virulent Sw-5 resistance breaking (SRB mutants of TSWV have been reported on Sw-5 tomato cultivars. Two different PCR-based allelic discrimination techniques, namely Custom TaqMan™ SNP Genotyping and high-resolution melting (HRM assays, were developed and compared for their ability to distinguish between avirulent (Sw-5 non-infecting, SNI and SRB biotypes. TaqMan assays proved to be more sensitive (threshold of detection in a range of 50-70 TSWV RNA copies and more reliable than HRM, assigning 25 TSWV isolates to their correct genotype with an accuracy of 100%. Moreover, the TaqMan SNP assays were further improved developing a rapid and simple protocol that included crude leaf extraction for RNA template preparations. On the other hand, HRM assays showed higher levels of sensitivity than TaqMan when used to co-detect both biotypes in different artificial mixtures. These diagnostic assays contributed to gain preliminary information on the epidemiology of TSWV isolates in open field conditions. In fact, the presented data suggest that SRB isolates are present as stable populations established year round, persisting on both winter (globe artichoke and summer (tomato crops, in the same cultivated areas of Southern Italy.
Directory of Open Access Journals (Sweden)
Ma Mingxiao
Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.
Taq I RFLP in the human cellular retinol-binding protein (CRBP) gene
Energy Technology Data Exchange (ETDEWEB)
Pellegrino, A [Istituto di Ricovero e Cura a Carattere Scientifico SANATRIX, Vena (Italy); Garofalo, S; Cocozza, S; Monticelli, A; Varrone, S [CNR Universita degli Studi di Napoli (Italy); Faraonio, R; Colantuoni, V [Universita degli Studi di Napoli (Italy)
1988-08-11
The probe was a Pst I - Bam HI fragment of cDNA, about 600 bp long, encoding for the human CRBP gene. The clone was isolated by screening a human liver cDNA library in the expression vector pEX with antibodies against rat CRBP. Taq I digestion of genomic DNA and hybridization with the CRBP probe detects a two allele polymorphism with allelic fragments of 3.0 kb and 2.7 kb. There are two invariant bands at 2.4 and 2.2 kb. Human CRBP gene has been mapped on the long arm of chromosome 3 using somatic cell hybrids. Co-dominant segregation was observed in two caucasian families (10 individuals).
Directory of Open Access Journals (Sweden)
Kush Shrivastava
2015-10-01
Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.
Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...
African Journals Online (AJOL)
apoptotic ... Quantitative real-time polymerase chain reaction (qPCR) was performed using Taq PCR Master ... Keywords: Anti-apoptotic genes, Cervical cancer, Apoptosis, Cell viability, BCL2, .... polyclonal anti-rabbit immunoglobulin HRP-linked.
CYP2D7 sequence variation interferes with TaqMan CYP2D6*15 and *35 genotyping
Directory of Open Access Journals (Sweden)
Amanda K Riffel
2016-01-01
Full Text Available TaqMan™ genotyping assays are widely used to genotype CYP2D6, which encodes a major drug metabolizing enzyme. Assay design for CYP2D6 can be challenging owing to the presence of two pseudogenes, CYP2D7 and CYP2D8, structural and copy number variation and numerous single nucleotide polymorphisms (SNPs some of which reflect the wild-type sequence of the CYP2D7 pseudogene. The aim of this study was to identify the mechanism causing false positive CYP2D6*15 calls and remediate those by redesigning and validating alternative TaqMan genotype assays. Among 13,866 DNA samples genotyped by the CompanionDx® lab on the OpenArray platform, 70 samples were identified as heterozygotes for 137Tins, the key SNP of CYP2D6*15. However, only 15 samples were confirmed when tested with the Luminex xTAG CYP2D6 Kit and sequencing of CYP2D6-specific long range (XL-PCR products. Genotype and gene resequencing of CYP2D6 and CYP2D7-specific XL-PCR products revealed a CC>GT dinucleotide SNP in exon 1 of CYP2D7 that reverts the sequence to CYP2D6 and allows a TaqMan assay PCR primer to bind. Because CYP2D7 also carries a Tins, a false-positive mutation signal is generated. This CYP2D7 SNP was also responsible for generating false-positive signals for rs769258 (CYP2D6*35 which is also located in exon 1. Although alternative CYP2D6*15 and *35 assays resolved the issue, we discovered a novel CYP2D6*15 subvariant in one sample that carries additional SNPs preventing detection with the alternate assay. The frequency of CYP2D6*15 was 0.1% in this ethnically diverse U.S. population sample. In addition, we also discovered linkage between the CYP2D7 CC>GT dinucleotide SNP and the 77G>A (rs28371696 SNP of CYP2D6*43. The frequency of this tentatively functional allele was 0.2%. Taken together, these findings emphasize that regardless of how careful genotyping assays are designed and evaluated before being commercially marketed, rare or unknown SNPs underneath primer and/or probe
Yadav, Reena; Paria, Anutosh; Mankame, Smruti; Makesh, M; Chaudhari, Aparna; Rajendran, K V
2015-12-01
Hepatopancreatic parvovirus (HPV) infects Penaeus monodon and causes mortality in the larval stages. Further, it has been implicated in the growth retardation in cultured P. monodon. Though different geographical isolates of HPV show large sequence variations, a sensitive PCR assay specific to Indian isolate has not yet been reported. Here, we developed a sensitive SYBR Green-based and TaqMan real-time PCR for the detection and quantification of the virus. A 441-bp PCR amplicon was cloned in pTZ57 R/T vector and the plasmid copy number was estimated. A 10-fold serial dilution of the plasmid DNA from 1 × 10(9) copies to 1 copy was prepared and used as the standard. The primers were tested initially using the standard on a conventional PCR format to determine the linearity of detection. The standards were further tested on real-time PCR format using SYBR Green and TaqMan chemistry and standard curves were generated based on the Ct values from three well replicates for each dilution. The assays were found to be sensitive, specific and reproducible with a wide dynamic range (1 × 10(9) to 10 copies) with coefficient of regression (R(2)) > 0.99, calculated average slope -3.196 for SYBR Green assay whereas, for TaqMan assay it was >0.99 and -3.367, respectively. The intra- and inter-assay variance of the Ct values ranged from 0.26% to 0.94% and 0.12% to 0.81%, respectively, for SYBR Green assay, and the inter-assay variance of the Ct values for TaqMan assay ranged from 0.07% to 1.93%. The specificity of the assays was proved by testing other DNA viruses of shrimp such as WSSV, IHHNV and MBV. Standardized assays were further tested to detect and quantify HPV in the post-larvae of P. monodon. The result was further compared with conventional PCR to test the reproducibility of the test. The assay was also used to screen Litopeneaus vannamei, Macrobrachium rosenbergii and Scylla serrata for HPV. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Manar Fayiz Atoum
2017-01-01
Conclusions: An inverse association was found between 25(OHD serum level and breast cancer risk. Statistical difference was also found between different VDR TaqI genotypes and circulating levels of 25(OHD among Jordanian females with breast cancer.
Directory of Open Access Journals (Sweden)
Laurent Dacheux
2016-07-01
Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
GFA Taq I polymorphism and cleft lip with or without cleft palate (CL/P) risk
Dong, Lijia; Ma, Lian
2015-01-01
The transforming growth factor alpha (TGFA) Taq I polymorphism has been indicated to be correlated with cleft lip with or without cleft palate (CL/P) susceptibility, but study results are still debatable. Thus, a meta-analysis was conducted. We conducted a comprehensive search of Embase, Ovid, Web of Science, the Cochrane database, PubMed, the Chinese Biomedical Literature Database (CBM-disc, 1979-2014), the database of National Knowledge Infrastructure (CNKI, 1979-2014) and the full paper database of Chinese Science and Technology of Chongqing (VIP, 1989-2014) to identify suitable studies. There were 18 studies suitable for this meta-analysis, involving a total of 3135 cases and 3575 controls. Significantly increased CL/P risk was observed (OR = 1.49; 95% CI 1.17-1.89; P = 0.001). In subgroup analyses stratified by ethnicity, there was evidence in the Caucasian population for an association between this polymorphism and CL/P risk (OR = 1.52; 95% CI 1.14-2.02; P = 0.004). However, no significant association was found between this his polymorphism and CL/P risk in African and Hispanic populations. According to a specific CL/P type, increased clip lip and palate risk and clip palate risk were found (OR = 1.38; 95% CI 1.10-1.73; P = 0.005; OR = 1.29; 95% CI 1.01-1.66; P = 0.042). In conclusion, the present meta-analysis found that the TGFA Taq I polymorphism may be associated with CL/P susceptibility. PMID:26064247
U'Ren, Jana M.; Van Ert, Matthew N.; Schupp, James M.; Easterday, W. Ryan; Simonson, Tatum S.; Okinaka, Richard T.; Pearson, Talima; Keim, Paul
2005-01-01
A TaqMan allelic-discrimination assay designed around a synonymous single-nucleotide polymorphism was used to genotype Burkholderia pseudomallei and Burkholderia mallei isolates. The assay rapidly identifies and discriminates between these two highly pathogenic bacteria and does not cross-react with genetic near neighbors, such as Burkholderia thailandensis and Burkholderia cepacia.
Directory of Open Access Journals (Sweden)
Yachun Su
2013-01-01
Full Text Available Sporisorium scitamineum is a fungal smut pathogen epidemic in sugarcane producing areas. Early detection and proper identification of the smut are an essential requirement in its management practice. In this study, we developed a TaqMan real-time PCR assay using specific primers (bEQ-F/bEQ-R and a TaqMan probe (bEQ-P which were designed based on the bE (b East mating type gene (Genbank Accession no. U61290.1. This method was more sensitive (a detection limit of 10 ag pbE DNA and 0.8 ng sugarcane genomic DNA than that of conventional PCR (10 fg and 100 ng, resp.. Reliability was demonstrated through the positive detection of samples collected from artificially inoculated sugarcane plantlets (FN40. This assay was capable of detecting the smut pathogen at the initial stage (12 h of infection and suitable for inspection of sugarcane pathogen-free seed cane and seedlings. Furthermore, quantification of pathogen was verified in pathogen-challenged buds in different sugarcane genotypes, which suggested its feasibility for evaluation of smut resistance in different sugarcane genotypes. Taken together, this novel assay can be used as a diagnostic tool for sensitive, accurate, fast, and quantitative detection of the smut pathogen especially for asymptomatic seed cane or plants and evaluation of smut resistance of sugarcane genotypes.
Directory of Open Access Journals (Sweden)
Ribal María
2008-06-01
Full Text Available Abstract Background An accurate gene expression quantification using TaqMan Arrays (TA could be limited by the low RNA quantity obtained from some clinical samples. The novel cDNA preamplification system, the TaqMan PreAmp Master Mix kit (TPAMMK, enables a multiplex preamplification of cDNA targets and therefore, could provide a sufficient amount of specific amplicons for their posterior analysis on TA. Findings A multiplex preamplification of 47 genes was performed in 22 samples prior to their analysis by TA, and relative gene expression levels of non-preamplified (NPA and preamplified (PA samples were compared. Overall, the mean cycle threshold (CT decrement in the PA genes was 3.85 (ranging from 2.07 to 5.01. A high correlation (r between the gene expression measurements of NPA and PA samples was found (mean r = 0.970, ranging from 0.937 to 0.994; p Conclusion We demonstrate that cDNA preamplification using the TPAMMK before TA analysis is a reliable approach to simultaneously measure gene expression of multiple targets in a single sample. Moreover, this procedure was validated in genes from degraded RNA samples and low abundance expressed genes. This combined methodology could have wide applications in clinical research, where scarce amounts of degraded RNA are usually obtained and several genes need to be quantified in each sample.
A TaqI RFLP in the locus D9S29 on human chromosome 9
Energy Technology Data Exchange (ETDEWEB)
Weitnauer, L.; Antonelli, A.; Pandolfo, M. (Istituto Neurologico, Milan (Italy))
1989-12-25
Phage LAMP92 was isolated from the Los Alamos chromosome 9 library and its 3.8 Kbp insert was subcloned into the Eco RI site of pUC19. Taq I identifies a three allele RFLP (B1: 7.6 kb + 3 kb, B2: 14 kb + 3 kb, B3: 17 kb). A two allele Pvu II RFLP detected by the same probe was described previously. It was localized on 9q22-q31 by in situ hybridization and linkage analysis. Co-dominant segregation was shown in 14 informative families.
A Laboratory-Developed TaqMan Array Card for Simultaneous Detection of 19 Enteropathogens
Liu, Jie; Gratz, Jean; Amour, Caroline; Kibiki, Gibson; Becker, Stephen; Janaki, Lalitha; Verweij, Jaco J.; Taniuchi, Mami; Sobuz, Shihab U.; Haque, Rashidul; Haverstick, Doris M.
2013-01-01
The TaqMan Array Card (TAC) system is a 384-well singleplex real-time PCR format that has been used to detect multiple infection targets. Here we developed an enteric TaqMan Array Card to detect 19 enteropathogens, including viruses (adenovirus, astrovirus, norovirus GII, rotavirus, and sapovirus), bacteria (Campylobacter jejuni/C. coli, Clostridium difficile, Salmonella, Vibrio cholerae, diarrheagenic Escherichia coli strains including enteroaggregative E. coli [EAEC], enterotoxigenic E. coli [ETEC], enteropathogenic E. coli [EPEC], and Shiga-toxigenic E. coli [STEC]), Shigella/enteroinvasive E. coli (EIEC), protozoa (Cryptosporidium, Giardia lamblia, and Entamoeba histolytica), and helminths (Ascaris lumbricoides and Trichuris trichiura), as well as two extrinsic controls to monitor extraction and amplification efficiency (the bacteriophage MS2 and phocine herpesvirus). Primers and probes were newly designed or adapted from published sources and spotted onto microfluidic cards. Fecal samples were spiked with extrinsic controls, and DNA and RNA were extracted using the QiaAmp Stool DNA minikit and the QuickGene RNA Tissue kit, respectively, and then mixed with Ag-Path-ID One Step real-time reverse transcription-PCR (RT-PCR) reagents and loaded into cards. PCR efficiencies were between 90% and 105%, with linearities of 0.988 to 1. The limit of detection of the assays in the TAC was within a 10-fold difference from the cognate assays performed on plates. Precision testing demonstrated a coefficient of variation of below 5% within a run and 14% between runs. Accuracy was evaluated for 109 selected clinical specimens and revealed an average sensitivity and specificity of 85% and 77%, respectively, compared with conventional methods (including microscopy, culture, and immunoassay) and 98% and 96%, respectively, compared with our laboratory-developed PCR-Luminex assays. This TAC allows fast, accurate, and quantitative detection of a broad spectrum of enteropathogens and
Corzett, Christopher H; Goodman, Myron F; Finkel, Steven E
2013-06-01
Escherichia coli DNA polymerases (Pol) II, IV, and V serve dual roles by facilitating efficient translesion DNA synthesis while simultaneously introducing genetic variation that can promote adaptive evolution. Here we show that these alternative polymerases are induced as cells transition from exponential to long-term stationary-phase growth in the absence of induction of the SOS regulon by external agents that damage DNA. By monitoring the relative fitness of isogenic mutant strains expressing only one alternative polymerase over time, spanning hours to weeks, we establish distinct growth phase-dependent hierarchies of polymerase mutant strain competitiveness. Pol II confers a significant physiological advantage by facilitating efficient replication and creating genetic diversity during periods of rapid growth. Pol IV and Pol V make the largest contributions to evolutionary fitness during long-term stationary phase. Consistent with their roles providing both a physiological and an adaptive advantage during stationary phase, the expression patterns of all three SOS polymerases change during the transition from log phase to long-term stationary phase. Compared to the alternative polymerases, Pol III transcription dominates during mid-exponential phase; however, its abundance decreases to SOS induction by exogenous agents and indicate that cell populations require appropriate expression of all three alternative DNA polymerases during exponential, stationary, and long-term stationary phases to attain optimal fitness and undergo adaptive evolution.
Functional roles of DNA polymerases β and γ
International Nuclear Information System (INIS)
Huebscher, U.; Kuenzle, C.C.; Spadari, S.
1979-01-01
The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded
Directory of Open Access Journals (Sweden)
Yasuha Arai
2016-04-01
Full Text Available A major determinant in the change of the avian influenza virus host range to humans is the E627K substitution in the PB2 polymerase protein. However, the polymerase activity of avian influenza viruses with a single PB2-E627K mutation is still lower than that of seasonal human influenza viruses, implying that avian viruses require polymerase mutations in addition to PB2-627K for human adaptation. Here, we used a database search of H5N1 clade 2.2.1 virus sequences with the PB2-627K mutation to identify other polymerase adaptation mutations that have been selected in infected patients. Several of the mutations identified acted cooperatively with PB2-627K to increase viral growth in human airway epithelial cells and mouse lungs. These mutations were in multiple domains of the polymerase complex other than the PB2-627 domain, highlighting a complicated avian-to-human adaptation pathway of avian influenza viruses. Thus, H5N1 viruses could rapidly acquire multiple polymerase mutations that function cooperatively with PB2-627K in infected patients for optimal human adaptation.
Directory of Open Access Journals (Sweden)
Alessandra Colombini
Full Text Available Three adjacent single nucleotide polymorphisms of the vitamin D receptor gene (VDR BsmI (rs1544410, ApaI (rs7975232, and TaqI (rs731236 are commonly studied in several pathologies. We aimed to evaluate the distribution of VDR BsmI, ApaI, and TaqI allele, genotype, and haplotype frequencies in an Italian cohort of 266 patients with lumbar spine disorders assessed by Magnetic Resonance Imaging and 252 asymptomatic controls. The exposure to putative risk factors was evaluated by a questionnaire. Polymorphisms were detected by PCR-RFLP and TaqMan® SNP Genotyping Assay. The results were statistically adjusted for the identified conventional risk factors. The three SNPs were in linkage disequilibrium. For all cases BbAaTT was a 3-fold risk factor OR = 3.38, whereas bbAATT (OR = 0.22, and bbaaTT (OR = 0.47 genotypes were found to be protective. Specifically, for patients affected by disc herniation only (n = 88 and all lumbar pathologies excluding stenosis and/or spondylolistesis (n = 215 B allele, Bb, Aa, and BbAaTT genotypes were risky, whereas b allele, bb, aa, and bbaaTT genotypes were protective. In patients affected by osteochondrosis with or without disc hernation (n = 50, T allele, Aa, and bbAaTT genotypes were risky, whereas t allele, AA, tt genotypes were protective. In patients affected by stenosis and/or spondylolistesis (n = 51 no significant associations were found. This is the first study showing an association of the three genetic VDR variants BsmI, ApaI, and TaqI and lumbar spine pathologies. Our study contributes to delineate genetic risk factors for specific subgroups of patients with lumbar spine pathologies highlighting the importance of haplotype analysis, and of detailed clinical evaluation of the patients for identification of genetic biomarkers.
16S rRNA phylogenetic analysis of actinomycetes isolated from ...
African Journals Online (AJOL)
SNPK
2012-07-26
Jul 26, 2012 ... Marine mangroves and eastern Ghats of Indian eco- systems facilitate the .... U of Ex Taq polymerase chain reaction (PCR). Conditions consisted of ... its building blocks of amino acids in the cell wall. (Fredimoses, 2010).
International Nuclear Information System (INIS)
Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu
2006-01-01
RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use
Czajkowski, R.L.; Wolf, van der J.M.
2012-01-01
A Serratia plymuthica-specific TaqMan® assay was designed based on the consensus nucleotide sequence from the 3'- end of the luxS gene present in all S. plymuthica strains tested. The specificity of the assay was demonstrated by testing 21 Serratia spp. strains and 30 isolates belonging to various
Genetic divergence between two clinostomatid fish endoparasites ...
African Journals Online (AJOL)
1998-11-16
. To identify usable oligonucleotide prim- ers, a trial study was conducted using parasite DNA and six different 10-mer primers. For amplification, we used a mix- ture including 0.125 ~I DNA polymerase (Takara Taq), 2.5 ~I.
Yan, Guiping; Smiley, Richard W
2010-03-01
The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.
Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.
Pegels, N; González, I; Fernández, S; García, T; Martín, R
2012-01-01
A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.
Cloning and shake flask expression of hrIDS-Like in Pichia pastoris
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... Restriction enzymes,. T4-ligase, Taq-DNA polymerase and culture media were from .... Each experiment was run at least 3 times, with a coef- ficient of variation ..... New York,. Greene Publishing ... Pichia expression kit. Protein ...
Medapati, Rooth Vasantha; Suvvari, Sridevi; Godi, Sudhakar; Gangisetti, Paddaiah
2017-06-05
The aim of the present study was to evaluate the association of NRAMP1 -3'UTR, 274-CT,VDR- Fok1 VDR-Taq1 Polymorphisms with the risk of pulmonary tuberculosis. A case -control study was conducted on Andhra Pradesh Population of India. Analysis of gene polymorphisms of NRAMP1 gene (3'UTR, 274CT) and VDR gene (Fok1 and Taq1) was done by using Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in Tuberculosis (TB) patients and healthy controls. The obtained results were observed using 2% Agarose Gel electrophoresis and analysed statistically using Chi-square test and Odds Ratio. Statistical significance was observed between the patients and the controls in the NRAMP1-3'UTR (P = 0.005; OR = 2.997; 95% CI = 1.019-8.813) and VDR-Taq1 (P 0.05). 3'UTR-NRAMP1 gene and VDR-Taq1 gene Polymorphisms are statistically associated with the susceptibility of TB in Andhra Pradesh Population in India.
Preliminary characterization of a death-related gene in silkworm ...
African Journals Online (AJOL)
STORAGESEVER
2009-05-18
May 18, 2009 ... 1Institute of Life Sciences, Jiangsu University, 301 Xuefu Road, Zhenjiang 212013, P. R. China. ... programmed cell death, named as Bombyx mori death- ... with Taq polymerase for 40 amplification cycles (94°C/20 s, 60°C.
Molecular screening of S769N mutation for PFATPASE in subjects ...
African Journals Online (AJOL)
2016-03-09
Mar 9, 2016 ... International Journal of Medicine and Biomedical Research. Volume 5 Issue 1 January .... primer (F/R), and 1X dream Taq green DNA polymerase. One microliters of .... Medicine and Hygiene 2002;96:91–95. 25. World Health ...
Czajkowski, R.L.; Van der Wolf, J.M.
2012-01-01
A Serratia plymuthica-specific TaqManA (R) assay was designed based on the consensus nucleotide sequence from the 3'- end of the luxS gene present in all S. plymuthica strains tested. The specificity of the assay was demonstrated by testing 21 Serratia spp. strains and 30 isolates belonging to
The expanding polymerase universe.
Goodman, M F; Tippin, B
2000-11-01
Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.
Detection and Quantification of Methyl tert-Butyl Ether-Degrading Strain PM1 by Real-Time TaqMan PCR
Hristova, Krassimira R.; Lutenegger, Christian M.; Scow, Kate M.
2001-01-01
The fuel oxygenate methyl tert-butyl ether (MTBE), a widely distributed groundwater contaminant, shows potential for treatment by in situ bioremediation. The bacterial strain PM1 rapidly mineralizes and grows on MTBE in laboratory cultures and can degrade the contaminant when inoculated into groundwater or soil microcosms. We applied the TaqMan quantitative PCR method to detect and quantify strain PM1 in laboratory and field samples. Specific primers and probes were designed for the 16S ribos...
Detrimental effect of expression of Bt endotoxin Cry1Ac on in vitro ...
Indian Academy of Sciences (India)
(50 U) of reverse transcriptase. This cDNA pool ... reverse primers for each and 0.2 μL Taq polymerase (1 U). The initial ..... learned from B.t. toxin genes; in Genetic engineering (ed) JK ... KO 2007 Improved drought tolerance without undesired.
Mashhadiabbas, Fatemeh; Neamatzadeh, Hossein; Nasiri, Rezvan; Foroughi, Elnaz; Farahnak, Soudabeh; Piroozmand, Parisa; Mazaheri, Mahta; Zare-Shehneh, Masoud
2018-01-01
There has been increasing interest in the study of the association between Vitamin D receptor (VDR) gene polymorphisms and risk of chronic periodontitis. However, the results remain inconclusive. To better understand the roles of VDR polymorphisms (BsmI, TaqI, FokI, and ApaI) in chronic periodontitis susceptibility, we conducted this systematic review and meta-analysis. The PubMed, Google Scholar, and Web of Science database were systemically searched to determine all the eligible studies about VDR polymorphisms and risk of chronic periodontitis up to April 2017. Odds ratio (OR) and 95% confidence interval (CI) were used to evaluate the associations between VDR polymorphisms and chronic periodontitis risk. All the statistical analyses were performed by Comprehensive Meta-Analysis. All P values were two-tailed with a significant level at 0.05. Finally, a total of 38 case-control studies in 19 publications were identified which met our inclusion criteria. There are ten studies with 866 chronic periodontitis cases and 786 controls for BsmI, 16 studies with 1570 chronic periodontitis cases and 1676 controls for TaqI, five studies with 374 chronic periodontitis cases and 382 controls for FokI, and seven studies with 632 chronic periodontitis cases and 604 controls for ApaI. Overall, no significant association was observed between VDR gene BsmI, TaqI, FokI, and ApaI polymorphisms and risk of chronic periodontitis in any genetic model. Subgroup analysis stratified by ethnicity suggested a significant association between BsmI polymorphism and chronic periodontitis risk in the Caucasian subgroup under allele model (A vs. G: OR = 1.747, 95% CI = 1.099-2.778, P = 0.018). Further, no significant associations were observed when stratified by Hardy-Weinberg equilibrium status for BsmI, TaqI, and ApaI. Our results suggest that BsmI, TaqI, FokI, and ApaI polymorphisms in the VDR gene might not be associated with risk of chronic periodontitis in overall population.
Advancing Polymerase Ribozymes Towards Self-Replication
Tjhung, K. F.; Joyce, G. F.
2017-07-01
Autocatalytic replication and evolution in vitro by (i) a cross-chiral RNA polymerase catalyzing polymerization of mononucleotides of the opposite handedness; (ii) non-covalent assembly of component fragments of an existing RNA polymerase ribozyme.
Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.
Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L
2018-03-27
The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.
Directory of Open Access Journals (Sweden)
Dial Stacey L
2008-07-01
Full Text Available Abstract Background The MicroArray Quality Control (MAQC project evaluated the inter- and intra-platform reproducibility of seven microarray platforms and three quantitative gene expression assays in profiling the expression of two commercially available Reference RNA samples (Nat Biotechnol 24:1115-22, 2006. The tested microarrays were the platforms from Affymetrix, Agilent Technologies, Applied Biosystems, GE Healthcare, Illumina, Eppendorf and the National Cancer Institute, and quantitative gene expression assays included TaqMan® Gene Expression PCR Assay, Standardized (Sta RT-PCR™ and QuantiGene®. The data showed great consistency in gene expression measurements across different microarray platforms, different technologies and test sites. However, SYBR® Green real-time PCR, another common technique utilized by half of all real-time PCR users for gene expression measurement, was not addressed in the MAQC study. In the present study, we compared the performance of SYBR Green PCR with TaqMan PCR, microarrays and other quantitative technologies using the same two Reference RNA samples as the MAQC project. We assessed SYBR Green real-time PCR using commercially available RT2 Profiler™ PCR Arrays from SuperArray, containing primer pairs that have been experimentally validated to ensure gene-specificity and high amplification efficiency. Results The SYBR Green PCR Arrays exhibit good reproducibility among different users, PCR instruments and test sites. In addition, the SYBR Green PCR Arrays have the highest concordance with TaqMan PCR, and a high level of concordance with other quantitative methods and microarrays that were evaluated in this study in terms of fold-change correlation and overlap of lists of differentially expressed genes. Conclusion These data demonstrate that SYBR Green real-time PCR delivers highly comparable results in gene expression measurement with TaqMan PCR and other high-density microarrays.
Vitamin-D receptor (VDR) gene polymorphisms (Taq-I & Apa-I) in Syrian healthy population.
Haddad, Shaden
2014-12-01
The vitamin D endocrine system regulates bone metabolism and calcium homeostasis as well as cellular proliferation and differentiation. Vitamin D receptor (VDR) mediates Vit-D activity, thus VDR gene polymorphisms may correlate with different diseases. This study aimed to determine the distribution of VDR gene (Taq-I and Apa-I) polymorphisms using a RFLP in unrelated normal healthy individuals of Syrian population. Allelic frequencies were 65% vs 35% and 66% vs 34% for T vs t and A vs a alleles, respectively. Genotype distribution was 36%, 58% and 6% for TT, Tt and tt and 42%, 47% and 10% for AA, Aa and aa, respectively. These results demonstrate that the frequency and distribution of the VDR polymorphisms in Syrian population are different from other populations worldwide.
Rahpaya, Sayed Samim; Tsuchiaka, Shinobu; Kishimoto, Mai; Oba, Mami; Katayama, Yukie; Nunomura, Yuka; Kokawa, Saki; Kimura, Takashi; Kobayashi, Atsushi; Kirino, Yumi; Okabayashi, Tamaki; Nonaka, Nariaki; Mekata, Hirohisa; Aoki, Hiroshi; Shiokawa, Mai; Umetsu, Moeko; Morita, Tatsushi; Hasebe, Ayako; Otsu, Keiko; Asai, Tetsuo; Yamaguchi, Tomohiro; Makino, Shinji; Murata, Yoshiteru; Abi, Ahmad Jan; Omatsu, Tsutomu; Mizutani, Tetsuya
2018-05-31
Bovine abortion, diarrhea, and respiratory disease complexes, caused by infectious agents, result in high and significant economic losses for the cattle industry. These pathogens are likely transmitted by various vectors and reservoirs including insects, birds, and rodents. However, experimental data supporting this possibility are scarce. We collected 117 samples and screened them for 44 bovine abortive, diarrheal, and respiratory disease complex pathogens by using Dembo polymerase chain reaction (PCR), which is based on TaqMan real-time PCR. Fifty-seven samples were positive for at least one pathogen, including bovine viral diarrhea virus, bovine enterovirus, Salmonella enterica ser. Dublin, Salmonella enterica ser. Typhimurium, and Neospora caninum ; some samples were positive for multiple pathogens. Bovine viral diarrhea virus and bovine enterovirus were the most frequently detected pathogens, especially in flies, suggesting an important role of flies in the transmission of these viruses. Additionally, we detected the N. caninum genome from a cockroach sample for the first time. Our data suggest that insects (particularly flies), birds, and rodents are potential vectors and reservoirs of abortion, diarrhea, and respiratory infectious agents, and that they may transmit more than one pathogen at the same time.
Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi
2009-07-14
Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.
Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi
2009-01-01
Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618
Taylor, P.W.; Winton, J.R.
2002-01-01
Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.
RNA binding and replication by the poliovirus RNA polymerase
International Nuclear Information System (INIS)
Oberste, M.S.
1988-01-01
RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to 32 P-labeled ribohomopolymeric RNAs was examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K a for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 x 10 9 M -1 . The polymerase binds to a subgenomic RNAs which contain the 3' end of the genome with a K a similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3' noncoding region
Parasuram, Ramya; Coulther, Timothy A; Hollander, Judith M; Keston-Smith, Elise; Ondrechen, Mary Jo; Beuning, Penny J
2018-02-20
The process of DNA replication is carried out with high efficiency and accuracy by DNA polymerases. The replicative polymerase in E. coli is DNA Pol III, which is a complex of 10 different subunits that coordinates simultaneous replication on the leading and lagging strands. The 1160-residue Pol III alpha subunit is responsible for the polymerase activity and copies DNA accurately, making one error per 10 5 nucleotide incorporations. The goal of this research is to determine the residues that contribute to the activity of the polymerase subunit. Homology modeling and the computational methods of THEMATICS and POOL were used to predict functionally important amino acid residues through their computed chemical properties. Site-directed mutagenesis and biochemical assays were used to validate these predictions. Primer extension, steady-state single-nucleotide incorporation kinetics, and thermal denaturation assays were performed to understand the contribution of these residues to the function of the polymerase. This work shows that the top 15 residues predicted by POOL, a set that includes the three previously known catalytic aspartate residues, seven remote residues, plus five previously unexplored first-layer residues, are important for function. Six previously unidentified residues, R362, D405, K553, Y686, E688, and H760, are each essential to Pol III activity; three additional residues, Y340, R390, and K758, play important roles in activity.
Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M
1986-09-01
The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.
Directory of Open Access Journals (Sweden)
Jong Eun Park
2017-11-01
Full Text Available Objective: To evaluate the performance of the Cobas TaqMan MTB assay (Cobas assay with respect to its clinical application. Methods: This was a retrospective analysis of 1154 results from 1034 patients for whom mycobacterial cultures and the Cobas assay were performed simultaneously. Based on the patient medical records, two categories of clinical application were defined: (1 the diagnosis of patients with a high probability of pulmonary tuberculosis according to clinical and radiological features (n = 128, and (2 the exclusion of tuberculosis in clinically indeterminate patients (n = 1026. Standard culture was used as the reference method. Results: The sensitivity of the Cobas assay for the detection of Mycobacterium tuberculosis was 70.4% (95% confidence interval (CI 49.7â85.5% for category 1, but only 25.0% (95% CI 4.5â64.4% for category 2. The specificity was â¥95.0% for both categories. The positive predictive value was 79.2% (95% CI 57.3â92.1% for category 1 and 33.3% (95% CI 6.0â75.9% for category 2, while the negative predictive value was 92.3% (95% CI 85.0â96.4% for category 1 and 99.4% (95% CI 98.7â99.8% for category 2. Conclusions: The results of this study indicate that Cobas assay results must be interpreted carefully according to the clinical purpose of the assay. Keywords: Mycobacterium tuberculosis, Pulmonary tuberculosis, Cobas TaqMan MTB assay, Korea
Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun
2014-09-01
The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
DNA repair synthesis in human fibroblasts requires DNA polymerase delta
International Nuclear Information System (INIS)
Nishida, C.; Reinhard, P.; Linn, S.
1988-01-01
When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone
Structure and function of DNA polymerase μ
International Nuclear Information System (INIS)
Matsumoto, Takuro; Maezawa, So
2013-01-01
DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)
Polymerase Gamma Disease through the Ages
Saneto, Russell P.; Naviaux, Robert K.
2010-01-01
The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…
Directory of Open Access Journals (Sweden)
Ester Sesmero
2015-07-01
Full Text Available Viral polymerases replicate and transcribe the genomes of several viruses of global health concern such as Hepatitis C virus (HCV, human immunodeficiency virus (HIV and Ebola virus. For this reason they are key targets for therapies to treat viral infections. Although there is little sequence similarity across the different types of viral polymerases, all of them present a right-hand shape and certain structural motifs that are highly conserved. These features allow their functional properties to be compared, with the goal of broadly applying the knowledge acquired from studying specific viral polymerases to other viral polymerases about which less is known. Here we review the structural and functional properties of the HCV RNA-dependent RNA polymerase (NS5B in order to understand the fundamental processes underlying the replication of viral genomes. We discuss recent insights into the process by which RNA replication occurs in NS5B as well as the role that conformational changes play in this process.
Energy Technology Data Exchange (ETDEWEB)
Chia-Hsiang Chen [Cheng Hsin Rehabilitation and Medical Center, Taipei (Taiwan, Province of China); Shih-Hsiang Chien; Hai-Gwo Hwu [National Taiwan Univ., Taipei (Taiwan, Province of China)
1996-09-20
Association studies between the A1 allele of the dopamine D2 receptor (DRD2) gene TaqI A polymorphism and alcoholism remain controversial. A recent study from Japan demonstrated that the A1 allele is associated with severe alcoholism in the Japanese population. We were interested in knowing if this association also exists in the Atayals of Taiwan, who were found to have a higher prevalence of alcohol-use disorders than the Han Chinese in Taiwan. Genotype and allele frequencies were determined in alcohol-abusing, alcohol-dependent, and nonalcoholic control Atayal natives in Taiwan. A1 allele frequencies in alcohol-dependent, alcohol-abusing, and normal control Atayals were 0.39, 0.42, and 0.39, respectively. No difference in A1 allele frequency was found among these three groups. Our data do not support the hypothesis that the A1 allele of the TaqI A polymorphism of the DRD2 gene increases susceptibility to alcohol-use disorders in the Atayals of Taiwan. 18 refs., 1 tab.
Improved thermal cycling durability and PCR compatibility of polymer coated quantum dot
International Nuclear Information System (INIS)
Xun Zhe; Guan Yifu; Zhao Xiaoyun
2013-01-01
Quantum dots have experienced rapid development in imaging, labeling and sensing in medicine and life science. To be suitable for polymerase chain reaction (PCR) assay, we have tested QD thermal cycling durability and compatibility, which have not been addressed in previous reports. In this study, we synthesized CdSe/ZnS QDs with a surface modification with high-MW amphiphilic copolymers and observed that Mg 2+ ions in the PCR reaction could induce the QDs to precipitate and reduce their fluorescence signal significantly after thermal cycling. To overcome this problem, we used mPEG2000 to conjugate the QD surface for further protection, and found that this modification enables QDs to endure 40 thermal cycles in the presence of other components essential for PCR reactions. We have also identified that QDs have different effects on rTaq and Ex Taq polymerization systems. A high QD concentration could apparently reduce the PCR efficiency, but this inhibition was relieved significantly in the Ex PCR system as the concentration of Ex Taq polymerase was increased. Real-time PCR amplification results showed that QDs could provide a sufficiently measurable fluorescence signal without excessively inhibiting the DNA amplification. Based on this improved thermal cycling durability and compatibility with the PCR system, QDs have the potential to be developed as stable fluorescent sensors in PCR and real-time PCR amplification. (paper)
Directory of Open Access Journals (Sweden)
Winny Xie
2013-12-01
Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.
Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi
2018-03-01
One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede
2011-01-01
We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...
RNA polymerase of the killer virus of yeast
International Nuclear Information System (INIS)
Georgopoulos, D.E.; Leibowitz, M.J.
1984-01-01
The L/sub A/ and M double-stranded (ds) RNA segments of the cytoplasmically inherited killer virus of Saccharomyces cerevisiae are encapsidated in virions that contain a DNA-independent transcriptase activity. This enzyme catalyzes the synthesis of full-length (+) stranded copies of the genomic dsRNA segments, denoted l/sub A/ and m. The L/sub A/ dsRNA segment appears to encode the major capsid protein in which both dsRNA molecules are encapsidated, while M dsRNA encodes products responsible for the two killer phenotypes of toxin production and resistance to toxin. Proteins extracted from transcriptionally active virions fail to cross-react with antibody to yeast DNA-dependent RNA polymerases, suggesting that none of the subunits of the host cell polymerases are active in viral transcription. Sequence analysis of the in vitro transcripts reveals neither to be 3'-terminally polyadenylated, although m contains an apparent internal polyA-like tract. In the presence of any three ribonucleoside triphosphates (0.5 mM), the fourth ribonucleoside triphosphate shows an optimal rate of incorporation into transcript at a concentration of 20 μM. However, in a 3-hour reaction, the yield of a product RNA increases with the concentration of the limiting ribonucleotide up to 0.5 mM. Gel electrophoresis of the reaction products reveals that increasing the substrate concentration accelerates the appearance of radioactivity in full-length l/sub A/ and m transcripts
Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.
Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J
2011-08-01
DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.
Protamine 3 expressions in crossbred bull spermatozoa may not be ...
African Journals Online (AJOL)
The mRNA expression of PRM3 gene among two groups was evaluated by real time quantitative polymerase chain reaction (PCR) using TaqMan chemistry, where peptidylprolyl isomerase A (PPIA) was used as an internal control. Our finding revealed that expression of PRM3 was down regulated in poor quality semen ...
Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng
2017-06-01
A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.
A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.
Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang
2005-12-01
The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.
A TaqMan real-time PCR assay for detection of Meloidogyne hapla in root galls and in soil
DEFF Research Database (Denmark)
Sapkota, Rumakanta; Skantar, Andrea M.; Nicolaisen, Mogens
2016-01-01
. haplaand showed no significant amplification of DNA from non-target nematodes. The assay was able to detect M. haplain a background of plant and soil DNA. A dilution series of M. haplaeggs in soil showed a high correlation ( R 2 = 0 . 95 , P ...Early detection and quantification of Meloidogyne haplain soil is essential for effective disease management. The purpose of this study was to develop a real-time PCR assay for detection of M. haplain soil. Primers and a TaqMan probe were designed for M. hapladetection. The assay detected M......-knot development in carrots by testing soils before planting. The assay could be useful for management decisions in carrot cultivation....
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Enhancement of DNA polymerase activity in potato tuber slices
International Nuclear Information System (INIS)
Watanabe, Akira; Imaseki, Hidemasa
1977-01-01
DNA polymerase was extracted from potato (Soleum tuberosum L.) tuber discs and the temporal correlation of its activity change to DNA synthesis in vivo was examined during aging of the discs. Most of the DNA polymerase was recovered as a bound form in the 18,000 x g precipitate. Reaction with the bound-form enzyme was dependent on the presence of four deoxynucleoside triphosphates, Mg 2+ , and a template. ''Activated'' DNA and heat-denatured DNA, but not native DNA, were utilized as templates. The polymerase activity was sensitive to SH reagents. Fresh discs, which do not synthesize DNA in vivo, contained a significant amount of DNA polymerase and its activity increased linearly with time until 48 hr after slicing and became four times that of fresh discs after 72 hr, whereas the activity of DNA synthesis in vivo increased with time and decreased after reaching a maximum at 30 hr. Cycloheximide inhibited the enhancement of polymerase activity. DNA polymerase from aged and fresh discs had identical requirements for deoxynucleotides and a template in their reactions, sensitivity to SH reagent, and affinity to thymidine triphosphate. (auth.)
DNA Polymerase Fidelity: Beyond Right and Wrong.
Washington, M Todd
2016-11-01
Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.
Identification of four squid species by quantitative real-time polymerase chain reaction.
Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan
2016-02-01
Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. Copyright © 2016 Elsevier Ltd. All rights reserved.
A TaqMan real-time PCR-based assay for the identification of Fasciola spp.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-30
Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.
A Taq 1 polymorphism for the human platelet glycoprotein IIIa gene (GP3A)
Energy Technology Data Exchange (ETDEWEB)
Burk, C; Ingram, C; Weiner, M; Rappaport, E F; Schwartz, E; Poncz, M [Univ. of Pennsylvania School of Medicine, Philadelphia (USA)
1988-07-25
A cDNA clone containing a 4.0 kb GPIIIa insert was isolated from a human erythroleukemia (HEL) cell cDNA library. A 2.3 kb Eco RI fragment, representing the 5{prime} portion of this insert, was used as a probe for these Southern blot experiments. Taq I (T/CGA) identifies invariant bands of 5.0, 3.5, 1.3, 1.1, and 0.8 kb and a simple polymorphism with a band(s) at 8.0 kb or 4.8 and 3.2 kb. The frequency of the gene was studied in 17 persons (11 Caucasians, 3 Asians, and 3 blacks). The GPIIIa gene has been localized to the region 17q21{r arrow}22 by somatic cell hybrid and in situ hybridization studies. Mendelian inheritance was demonstrated in one family. The father is homozygous for the 8.0 kb band, and the mother is heterozygous for the 8.0/4.8 and 3.2 kb bands.
Directory of Open Access Journals (Sweden)
Daniel P Kane
Full Text Available In metazoans, the mechanism by which DNA is synthesized during homologous recombination repair of double-strand breaks is poorly understood. Specifically, the identities of the polymerase(s that carry out repair synthesis and how they are recruited to repair sites are unclear. Here, we have investigated the roles of several different polymerases during homologous recombination repair in Drosophila melanogaster. Using a gap repair assay, we found that homologous recombination is impaired in Drosophila lacking DNA polymerase zeta and, to a lesser extent, polymerase eta. In addition, the Pol32 protein, part of the polymerase delta complex, is needed for repair requiring extensive synthesis. Loss of Rev1, which interacts with multiple translesion polymerases, results in increased synthesis during gap repair. Together, our findings support a model in which translesion polymerases and the polymerase delta complex compete during homologous recombination repair. In addition, they establish Rev1 as a crucial factor that regulates the extent of repair synthesis.
Directory of Open Access Journals (Sweden)
R Mirnejad
2011-01-01
Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.
International Nuclear Information System (INIS)
Kadowaki, T.; Kadowaki, H.; Taylor, S.I.
1990-01-01
Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. The authors have studied a patient with leprechaunism (leprechaun/Minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. Genomic DNA from the patient was amplified by the polymerase chain reaction catalyzed by Thermus aquaticus (Taq) DNA polymerase, and the amplified DNA was directly sequenced. A nonsense mutations was identified at codon 897 in exon 14 in the paternal allele of the patient's insulin receptor gene. Levels of insulin receptor mRNA are decreased to <10% of normal in Epstein-Barr virus-transformed lymphoblasts and cultured skin fibroblasts from this patient. Thus, this nonsense mutation appears to cause a decrease in the levels of insulin receptor mRNA. In addition, they have obtained indirect evidence that the patient's maternal allele of the insulin receptor gene contains a cis-acting dominant mutation that also decreases the level of mRNA, but by a different mechanism. The nucleotide sequence of the entire protein-coding domain and the sequences of the intron-exon boundaries for all 22 exons of the maternal allele were normal. Presumably, the mutation in the maternal allele maps elsewhere in the insulin receptor gene. Thus, they conclude that the patient is a compound heterozygote for two cis-acting dominant mutations in the insulin receptor gene: (i) a nonsense mutation in the paternal allel that reduces the level of insulin receptor mRNA and (ii) an as yet unidentified mutation in the maternal allele that either decreases the rate of transcription or decreases the stability of the mRNA
DEFF Research Database (Denmark)
Schultz, Anna Charlotte; Vega, Everado; Dalsgaard, Anders
2011-01-01
BackgroundCurrent detection and genotyping methods of genogroup (G) I and II noroviruses (NoVs) consist of a 2-step approach including detection of viral RNA by TaqMan realtime RT-PCR (RT-qPCR) followed by conventional RT-PCR and sequencing of partial regions of ORF1 or ORF2. ObjectiveTo develop ......Man RT-qPCR assays for the sensitive detection and direct genotyping of GI and GII NoVs from clinical and environmental matrices...... novel long-template one-step TaqMan assays (L-RT-qPCR) for the rapid detection and direct genotyping of GI and GII NoVs and to evaluate the sensitivity and specificity of the assays. Study designGI and GII-specific broadly reactive L-RT-qPCR assays were developed by combining existing NoV primers...... and probes targeting the open reading frame (ORF)1–ORF2 junction as well as region C at the 5′–ORF2. The assays were validated using GI and GII RNA transcripts and a coded panel of 75 stool samples containing NoV strains representing 9 GI genotypes and 12 GII genotypes, as well as sapoviruses, astroviruses...
Effect of γ-irradiated DNA on the activity of DNA polymerase
International Nuclear Information System (INIS)
Leadon, S.A.; Ward, J.F.
1981-01-01
A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. Irradiated poly(dA-dT) was more effective in reducing polymerase activity than calf thymus DNA. Thus the polymerase-inhibition site(s) appears to be associated with base damage, specifically adenine or thymine. Using a free-radical scavenger, OH radicals were found to be involved in producing the damage sites. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme and not for other proteins present in the assay. The inhibition of DNA polymerase occurred prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation
Repair of Clustered Damage and DNA Polymerase Iota.
Belousova, E A; Lavrik, O I
2015-08-01
Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.
Role of polymerase η in mitochondrial mutagenesis of Saccharomyces cerevisiae
Energy Technology Data Exchange (ETDEWEB)
Chatterjee, Nimrat; Pabla, Ritu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States); Siede, Wolfram, E-mail: wolfram.siede@unthsc.edu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States)
2013-02-08
Highlights: ► DNA polymerase η is detectable in mitochondria of budding yeast. ► Pol η reduces UV-induced mitochondrial base pair substitutions and frameshifts. ► For UV-induced base pair substitutions, Pol η and Pol ζ interact epistatically. -- Abstract: DNA polymerase η mostly catalyzes an error-free bypass of the most frequent UV lesions, pyrimidine dimers of the cyclobutane-type. In addition to its nuclear localization, we show here for the first time its mitochondrial localization in budding yeast. In mitochondria, this polymerase improves bypass replication fidelity opposite UV damage as shown in base pair substitution and frameshift assays. For base pair substitutions, polymerase η appears to be related in function and epistatic to DNA polymerase ζ which, however, plays the opposite role in the nucleus.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Babady, N Esther; Germer, Jeffrey J; Yao, Joseph D C
2010-03-01
No significantly discordant results were observed between the Abbott RealTime HIV-1 assay and the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test (CTM) among 1,190 unique clinical plasma specimens obtained from laboratories located in 40 states representing all nine U.S. geographic regions and previously yielding "target not detected" results by CTM.
Directory of Open Access Journals (Sweden)
Phillip Brumm
2016-12-01
Full Text Available Here we report the complete genome sequence of the chemoorganotrophic, extremely thermophilic bacterium, Dictyoglomus turgidum, which is a Gram negative, strictly anaerobic bacterium. D. turgidum and D. thermophilum together form the Dictyoglomi phylum. The two Dictyoglomus genomes are highly syntenic, and both are distantly related to Caldicellulosiruptor spp. D. turgidum is able to grow on a wide variety of polysaccharide substrates due to significant genomic commitment to glycosyl hydrolases, sixteen of which were cloned and expressed in our study. The GH5, GH10 and GH42 enzymes characterized in this study suggest that D. turgidum can utilize most plant-based polysaccharides except crystalline cellulose. The DNA polymerase I enzyme was also expressed and characterized. The pure enzyme showed improved amplification of long PCR targets compared to Taq polymerase. The genome contains a full complement of DNA modifying enzymes, and an unusually high copy number (4 of a new, ancestral family of polB type nucleotidyltransferases designated as MNT (minimal nucleotidyltransferases. Considering its optimal growth at 72ºC, D. turgidum has an anomalously low G+C content of 39.9% that may account for the presence of reverse gyrase, usually associated with hyperthermophiles.
DEFF Research Database (Denmark)
Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte
2013-01-01
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...
DEFF Research Database (Denmark)
Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...
General misincorporation frequency: Re-evaluation of the fidelity of DNA polymerases.
Yang, Jie; Li, Bianbian; Liu, Xiaoying; Tang, Hong; Zhuang, Xiyao; Yang, Mingqi; Xu, Ying; Zhang, Huidong; Yang, Chun
2018-02-19
DNA replication in cells is performed in the presence of four dNTPs and four rNTPs. In this study, we re-evaluated the fidelity of DNA polymerases using the general misincorporation frequency consisting of three incorrect dNTPs and four rNTPs but not using the traditional special misincorporation frequency with only the three incorrect dNTPs. We analyzed both the general and special misincorporation frequencies of nucleotide incorporation opposite dG, rG, or 8-oxoG by Pseudomonas aeruginosa phage 1 (PaP1) DNA polymerase Gp90 or Sulfolobus solfataricus DNA polymerase Dpo4. Both misincorporation frequencies of other DNA polymerases published were also summarized and analyzed. The general misincorporation frequency is obviously higher than the special misincorporation frequency for many DNA polymerases, indicating the real fidelity of a DNA polymerase should be evaluated using the general misincorporation frequency. Copyright © 2018 Elsevier Inc. All rights reserved.
DNA polymerase ι: The long and the short of it!
Frank, Ekaterina G; McLenigan, Mary P; McDonald, John P; Huston, Donald; Mead, Samantha; Woodgate, Roger
2017-10-01
The cDNA encoding human DNA polymerase ι (POLI) was cloned in 1999. At that time, it was believed that the POLI gene encoded a protein of 715 amino acids. Advances in DNA sequencing technologies led to the realization that there is an upstream, in-frame initiation codon that would encode a DNA polymerase ι (polι) protein of 740 amino acids. The extra 25 amino acid region is rich in acidic residues (11/25) and is reasonably conserved in eukaryotes ranging from fish to humans. As a consequence, the curated Reference Sequence (RefSeq) database identified polι as a 740 amino acid protein. However, the existence of the 740 amino acid polι has never been shown experimentally. Using highly specific antibodies to the 25 N-terminal amino acids of polι, we were unable to detect the longer 740 amino acid (ι-long) isoform in western blots. However, trace amounts of the ι-long isoform were detected after enrichment by immunoprecipitation. One might argue that the longer isoform may have a distinct biological function, if it exhibits significant differences in its enzymatic properties from the shorter, well-characterized 715 amino acid polι. We therefore purified and characterized recombinant full-length (740 amino acid) polι-long and compared it to full-length (715 amino acid) polι-short in vitro. The metal ion requirements for optimal catalytic activity differ slightly between ι-long and ι-short, but under optimal conditions, both isoforms exhibit indistinguishable enzymatic properties in vitro. We also report that like ι-short, the ι-long isoform can be monoubiquitinated and polyubiuquitinated in vivo, as well as form damage induced foci in vivo. We conclude that the predominant isoform of DNA polι in human cells is the shorter 715 amino acid protein and that if, or when, expressed, the longer 740 amino acid isoform has identical properties to the considerably more abundant shorter isoform. Published by Elsevier B.V.
CDK9-dependent RNA polymerase II pausing controls transcription initiation.
Gressel, Saskia; Schwalb, Björn; Decker, Tim Michael; Qin, Weihua; Leonhardt, Heinrich; Eick, Dirk; Cramer, Patrick
2017-10-10
Gene transcription can be activated by decreasing the duration of RNA polymerase II pausing in the promoter-proximal region, but how this is achieved remains unclear. Here we use a 'multi-omics' approach to demonstrate that the duration of polymerase pausing generally limits the productive frequency of transcription initiation in human cells ('pause-initiation limit'). We further engineer a human cell line to allow for specific and rapid inhibition of the P-TEFb kinase CDK9, which is implicated in polymerase pause release. CDK9 activity decreases the pause duration but also increases the productive initiation frequency. This shows that CDK9 stimulates release of paused polymerase and activates transcription by increasing the number of transcribing polymerases and thus the amount of mRNA synthesized per time. CDK9 activity is also associated with long-range chromatin interactions, suggesting that enhancers can influence the pause-initiation limit to regulate transcription.
Efficient cell-free expression with the endogenous E. Coli RNA polymerase and sigma factor 70
Directory of Open Access Journals (Sweden)
Noireaux Vincent
2010-06-01
Full Text Available Abstract Background Escherichia coli cell-free expression systems use bacteriophage RNA polymerases, such as T7, to synthesize large amounts of recombinant proteins. These systems are used for many applications in biotechnology, such as proteomics. Recently, informational processes have been reconstituted in vitro with cell-free systems. These synthetic approaches, however, have been seriously limited by a lack of transcription modularity. The current available cell-free systems have been optimized to work with bacteriophage RNA polymerases, which put significant restrictions to engineer processes related to biological information. The development of efficient cell-free systems with broader transcription capabilities is required to study complex informational processes in vitro. Results In this work, an efficient cell-free expression system that uses the endogenous E. coli RNA polymerase only and sigma factor 70 for transcription was prepared. Approximately 0.75 mg/ml of Firefly luciferase and enhanced green fluorescent protein were produced in batch mode. A plasmid was optimized with different regulatory parts to increase the expression. In addition, a new eGFP was engineered that is more translatable in cell-free systems than the original eGFP. The protein production was characterized with three different adenosine triphosphate (ATP regeneration systems: creatine phosphate (CP, phosphoenolpyruvate (PEP, and 3-phosphoglyceric acid (3-PGA. The maximum protein production was obtained with 3-PGA. Preparation of the crude extract was streamlined to a simple routine procedure that takes 12 hours including cell culture. Conclusions Although it uses the endogenous E. coli transcription machinery, this cell-free system can produce active proteins in quantities comparable to bacteriophage systems. The E. coli transcription provides much more possibilities to engineer informational processes in vitro. Many E. coli promoters/operators specific to sigma
File list: Pol.Dig.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Dig.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Dig.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Dig.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Dig.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Dig.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Neu.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Neu.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Neural ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.50.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Myo.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Muscle SR.../dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.05.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Myo.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Muscle ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.10.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Lar.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lar.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Oth.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Oth.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Others ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.20.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Plc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Plc.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Oth.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Oth.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Others ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.05.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Myo.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Muscle ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.05.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.ALL.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II All cell ...//dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.20.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Brs.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Brs.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Breast ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Brs.50.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Lar.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lar.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Emb.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Embryo ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Emb.05.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Emb.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Epd.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Epd.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Epidermis... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Epd.10.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Spl.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Spl.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Spleen ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.10.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Unc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Plc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Plc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Myo.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Brs.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Brs.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Brs.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Brs.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Plc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Plc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Unc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Oth.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Oth.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Brs.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Brs.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Liv.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Liv.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Myo.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Oth.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Oth.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Lar.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lar.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Liv.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Liv.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Gon.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Gon.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Emb.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Oth.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Oth.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Gon.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Gon.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Emb.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Myo.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Plc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Plc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Lar.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lar.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Oth.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Oth.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Emb.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Neu.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Neu.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Neural... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Myo.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Liv.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Liv.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Gon.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Gon.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.50.RNA_polymerase_III.AllCell.bed ...
Wei, Junhong; Tian, Jinjin; Pan, Guoqing; Xie, Jie; Bao, Jialing; Zhou, Zeyang
2017-06-01
To develop a reliable and easy to use expression system for antibiotic production improvement of Streptomyces. A two-compound T7 RNA polymerase-dependent gene expression system was developed to fulfill this demand. In this system, the T7 RNA polymerase coding sequence was optimized based on the codon usage of Streptomyces coelicolor. To evaluate the functionality of this system, we constructed an activator gene overexpression strain for enhancement of actinorhodin production. By overexpression of the positive regulator actII-ORF4 with this system, the maximum actinorhodin yield of engineered strain was 15-fold higher and the fermentation time was decreased by 48 h. The modified two-compound T7 expression system improves both antibiotic production and accelerates the fermentation process in Streptomyces. This provides a general and useful strategy for strain improvement of important antibiotic producing Streptomyces strains.
2011-06-03
bovine serum albumin, 3.0mM MgCl2, 250mM of each dNTP, 400 nM of the appropriate forward and reverse primers, 1.25U of Taq polymerase (Promega... mastitis pathogens. Sci.. Res. Essays 3, 66–73. Oksannen, J., Kindt, R., Legendre, P., O’Hara, B., Simpson, G. L., Solymos, P., Stevens, H. H., and
Monitoring paneer for Listeria monocytogenes- A high risk food ...
African Journals Online (AJOL)
Dr.Batish
2012-05-15
May 15, 2012 ... Taq DNA polymerase (Boehringer Mannheim). Appropriate positive and negative controls with each reaction were also set up. The PCR parametres included initial denaturation at 95°C for 4 min followed by. 25 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s ...
File list: Pol.Lar.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lar.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Larvae h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Bld.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bld.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Blood SRX...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.20.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Bld.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bld.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Blood h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.20.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Plc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Plc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Placent...a http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Plc.50.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.CDV.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.CDV.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Cardiov...ascular http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.20.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Adp.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adp.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Adipocy...te http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.20.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Gon.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Gon.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Gonad ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Unc.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.05.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Pan.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Pan.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Pancre...as http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.CDV.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.CDV.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Cardiov...ascular http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.05.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Unc.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.10.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.10.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Unc.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Unclass...ified http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.10.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Unc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Unclass...ified http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.50.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Bld.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bld.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Blood SRX...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.50.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Emb.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.50.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Embryo h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.CDV.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.CDV.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Unc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Unclas...sified http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Plc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Plc.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Bon.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bon.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Gon.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Gon.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Gonad ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Pan.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Pan.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Pancrea...s http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Pan.10.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Bon.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bon.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Bone ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bon.05.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Adp.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adp.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Adipoc...yte http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Adp.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adp.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Adipoc...yte http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Plc.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Plc.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Prs.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Prs.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Prosta...te http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.CDV.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.CDV.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Lng.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lng.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Unc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Plc.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Plc.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Myo.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Myo.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Myo.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Bon.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bon.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Unc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Unclas...sified http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Plc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Plc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Myo.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Myo.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Bon.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bon.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.CDV.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.CDV.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Prs.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Prs.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Prosta...te http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Lng.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lng.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Pan.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Pan.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Pancre...as http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Lng.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lng.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.50.RNA_polymerase_II.AllCell.bed ...
Taq I polymorphism in the 5' region of the von Willebrand Factor (vWF) gene
Energy Technology Data Exchange (ETDEWEB)
Lavergne, J M; Bahnak, B R; Assouline, Z; Pietu, G; Kerbiriou-Nabias, D; Meulien, P; Pavirani, A; Meyer, D
1988-03-25
pvWFIPC8 is a 2.28 Kb partial cDNA clone for human von Willebrand factor (vWF) isolated from a human lung cDNA library and inserted into the EcoRI site of pUC9. The sequence includes the last 1330 nucleotides that encode for vWF propeptide and 950 nucleotides that encode for mature vWF. Taq I (TCGA) identifies plural invariant bands and two variant bands with alleles at 2.3 (Al) and 1.0 (A2). The frequency was determined in 33 unrelated European and North American caucasians. The extreme 3' region of pvWFIPC8 corresponds to the 5' boundary of an area that could possibly hybridize with similar sequences on human chromosome 22. The 5' 1.74 Kb portion of pvWFIPC8 generated by Bam HI digestion that corresponds to sequences only on chromosome 12 also demonstrates the polymorphism. Co-dominant segregation was demonstrated in 6 families of 48 individuals.
File list: Pol.Dig.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Dig.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Digesti...ve tract http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.05.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Pup.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Pup.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Pupae SRX...013069 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Pup.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Dig.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Dig.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Digesti...ve tract http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.50.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Brs.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Brs.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Breast SR...078990 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Brs.10.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Pup.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Pup.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Pupae SRX...013069 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Pup.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Dig.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Dig.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Digest...ive tract http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Kid.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Kid.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Liv.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Liv.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Liver SR...1013886 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Pan.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Pan.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Kid.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Kid.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Dig.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Dig.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Digest...ive tract http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Liv.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Liv.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Liver SR...1013886 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Pan.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Pan.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Kid.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Kid.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Pan.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Pan.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Kid.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Kid.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Emb.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043867 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Emb.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043869 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Unc.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Unclassif...ied SRX254629 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.05.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Epd.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Epd.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Unc.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Unclassif...ied SRX254629 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.20.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.PSC.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.PSC.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Pluripote...SRX213760,SRX213764 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.PSC.50.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.PSC.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.PSC.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Pluripote...SRX213760,SRX213764 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.PSC.20.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Epd.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Epd.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Unclassif...ied SRX110774 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.PSC.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.PSC.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Plurip...otent stem cell http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Emb.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.05.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043867 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II Uncla...ssified http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Bon.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bon.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Bone SRX...,SRX351408 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Emb.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043866 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.PSC.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.PSC.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Plurip...otent stem cell http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Bon.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bon.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Bone SRX...,SRX351408 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.ALL.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.50.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...050605,SRX013073 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.YSt.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.YSt.20.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II Yeast... strain http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.YSt.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Epd.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Epd.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Unc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Unc.50.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II Uncla...ssified http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.Unc.50.RNA_polymerase_II.AllCell.bed ...
A Double Polymerase Chain Reaction Method for Detecting African ...
African Journals Online (AJOL)
Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.
Energy Technology Data Exchange (ETDEWEB)
Cruz-Fuentes, C.; Carmarena, B.; Eroza, V. [and others
1994-09-01
The suggested association of the A1 allele of the D2 dopamine receptor (DRD2) human gene with alcoholism was studied by comparing the DRD2/TaqI genotypes of 36 healthy controls and 38 individuals who met the DSM-III-R diagnostic criteria for alcohol dependence. All subjects were unrelated, with parents and grandparents of Mexican origin. The alcoholics in our sample suffered one of the following conditions: delirium tremens (16.6%), alcohol hallucinosis (56.6%) or uncomplicated alcohol withdrawal (26.4%). Eight-eight percent of the controls carried the A1 allele. The frequency of the DRD2 A1 allele in the Mexican urban sample (pA1 = 0.61) was 2 to 3-fold higher than reported in Caucasian populations from the USA and Europe, but similar to the allele frequencies found in defined Amerindian populations. There were not significant differences in the prevalence or allele frequency between alcoholics (pA1 = 0.64) and controls, regardless if the alcoholics were subtyped accordingly to severity, age of onset or positive family history. Alcoholics had higher scores than controls in the neuroticism (N) and psychoticism (P) subscales on the Eysenck personality test: alcoholics P = 6.2 {+-} 2.9, N = 16.0 {+-} 4.2 vs. controls P = 2.5 {+-} 2.3, N = 5.7 {+-} 5.1; p<0.001 and p<0.001, respectively. However, no relationship between personality traits and genotypes was found. Our results do not support a consistent association between the TaqI A1 RFLP for the DRD2 gene and alcoholism.
Babady, N. Esther; Germer, Jeffrey J.; Yao, Joseph D. C.
2009-01-01
No significantly discordant results were observed between the Abbott RealTime HIV-1 assay and the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test (CTM) among 1,190 unique clinical plasma specimens obtained from laboratories located in 40 states representing all nine U.S. geographic regions and previously yielding “target not detected” results by CTM.
Directory of Open Access Journals (Sweden)
Dawn N Birdsell
Full Text Available Francisella tularensis, the etiologic agent of tularemia and a Class A Select Agent, is divided into three subspecies and multiple subpopulations that differ in virulence and geographic distribution. Given these differences, there is a need to rapidly and accurately determine if a strain is F. tularensis and, if it is, assign it to subspecies and subpopulation. We designed TaqMan real-time PCR genotyping assays using eleven single nucleotide polymorphisms (SNPs that were potentially specific to closely related groups within the genus Francisella, including numerous subpopulations within F. tularensis species. We performed extensive validation studies to test the specificity of these SNPs to particular populations by screening the assays across a set of 565 genetically and geographically diverse F. tularensis isolates and an additional 21 genetic near-neighbor (outgroup isolates. All eleven assays correctly determined the genetic groups of all 565 F. tularensis isolates. One assay differentiates F. tularensis, F. novicida, and F. hispaniensis from the more genetically distant F. philomiragia and Francisella-like endosymbionts. Another assay differentiates F. tularensis isolates from near neighbors. The remaining nine assays classify F. tularensis-confirmed isolates into F. tularensis subspecies and subpopulations. The genotyping accuracy of these nine assays diminished when tested on outgroup isolates (i.e. non F. tularensis, therefore a hierarchical approach of assay usage is recommended wherein the F. tularensis-specific assay is used before the nine downstream assays. Among F. tularensis isolates, all eleven assays were highly sensitive, consistently amplifying very low concentrations of DNA. Altogether, these eleven TaqMan real-time PCR assays represent a highly accurate, rapid, and sensitive means of identifying the species, subspecies, and subpopulation of any F. tularensis isolate if used in a step-wise hierarchical scheme. These assays
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
File list: Pol.Epd.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Epd.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...247,SRX080162,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II All cell...,SRX1013886,SRX1013900 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Utr.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Utr.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX018606,SRX017002,SRX017001 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Neu.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Neu.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Neural SR...,SRX685285,SRX217736 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.20.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.ALL.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III All cel...l types ERX204069 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.20.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.ALL.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III All cel...l types ERX204069 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.50.RNA_Polymerase_III.AllCell.bed ...
File list: Pol.Adl.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adl.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Adult SR...SRX1388757,SRX1388756 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.05.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Epd.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Epd.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...246,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Dig.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Dig.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Digestive... tract SRX112957,SRX143802 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.20.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...013077,SRX050604,SRX050605 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Epd.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Epd.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...248,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Utr.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Utr.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX017001,SRX018606,SRX017002 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Prs.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Prs.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...932,SRX020922,SRX022582 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.PSC.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.PSC.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pluripot...670820,SRX702057,SRX702061 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Prs.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Prs.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...866,SRX173198,SRX173197 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Prs.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Prs.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...363,SRX173198,SRX173197 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.ALL.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.20.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.ALL.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II All cell...,SRX1013886,SRX1013900 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Epd.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Epd.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...245,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.PSC.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.PSC.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pluripot...833412,SRX149642,SRX702059 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Prs.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Prs.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...557,SRX173197,SRX173198 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.ALL.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.50.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Utr.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Utr.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX017001,SRX018606,SRX017002 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Adl.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adl.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Adult ...SRX331268,SRX331270,SRX395531 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.ALL.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...050604,SRX050605,SRX013077 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.CDV.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.CDV.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Cardiova...,SRX080152,SRX080153,SRX367018,SRX367016 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Lng.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lng.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Lung SRX1...43816,SRX062976,SRX020252 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Lng.10.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Adl.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adl.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Adult ...SRX395531,SRX331268,SRX331270,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Spl.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Spl.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Spleen SR...X062981,SRX143838,SRX020253 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.10.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Lng.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lng.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Lung S...RX016555,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Lng.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lng.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Lung SRX0...62976,SRX143816,SRX020252 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Lng.05.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Lng.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lng.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Lung SRX0...62976,SRX143816,SRX020252 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Lng.20.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Spl.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Spl.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Spleen SR...X062981,SRX143838,SRX020253 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.05.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Emb.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.50.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Embryo SR...7582,SRX050604,SRX050605,SRX013073 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Emb.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Embryo SR...7582,SRX013077,SRX050604,SRX050605 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Lng.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lng.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Lung S...RX016555,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Lng.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lng.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Lung S...RX016555,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Adl.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adl.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Adult ...SRX395531,SRX331268,SRX331270,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Emb.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Embryo SR...7582,SRX050604,SRX050605,SRX013077 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.CDV.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.CDV.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Cardiova...,SRX346933,SRX346936,SRX367018,SRX367016 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.20.RNA_polymerase_II.AllCell.bed ...
Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A
2014-01-01
The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Directory of Open Access Journals (Sweden)
Samira Mohammadi
2017-01-01
Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Kulesh, David A; Baker, Robert O; Loveless, Bonnie M; Norwood, David; Zwiers, Susan H; Mucker, Eric; Hartmann, Chris; Herrera, Rafael; Miller, David; Christensen, Deanna; Wasieloski, Leonard P; Huggins, John; Jahrling, Peter B
2004-02-01
We designed, optimized, and extensively tested several sensitive and specific real-time PCR assays for rapid detection of both smallpox and pan-orthopox virus DNAs. The assays are based on TaqMan 3'-minor groove binder chemistry and were performed on both the rapid-cycling Roche LightCycler and the Cepheid Smart Cycler platforms. The hemagglutinin (HA) J7R, B9R, and B10R genes were used as targets for the variola virus-specific assays, and the HA and DNA polymerase-E9L genes were used as targets for the pan-orthopox virus assays. The five orthopox virus assays were tested against a panel of orthopox virus DNAs (both genomic and cloned) at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID). The results indicated that each assay was capable of detecting both the appropriate cloned gene and genomic DNA. The assays showed no cross-reactivity to the 78 DNAs in the USAMRIID bacterial cross-reactivity panel. The limit of detection (LOD) of each assay was determined to be between 12 and 25 copies of target DNA. The assays were also run against a blind panel of DNAs at the Centers for Disease Control and Prevention (CDC) on both the LightCycler and the Smart Cycler. The panel consisted of eight different variola virus isolates, five non-variola virus orthopox virus isolates, two varicella-zoster virus isolates, and one herpes simplex virus isolate. Each sample was tested in triplicate at 2.5 ng, 25 pg, 250 fg, and 2.5 fg, which represent 1.24 x 10(7), 1.24 x 10(5), 1.24 x 10(3), and 1.24 x 10(1) genome equivalents, respectively. The results indicated that each of the five assays was 100% specific (no false positives) when tested against both the USAMRIID panels and the CDC blind panel. With the CDC blind panel, the LightCycler was capable of detecting 96.2% of the orthopox virus DNAs and 93.8% of the variola virus DNAs. The Smart Cycler was capable of detecting 92.3% of the orthopox virus DNAs and between 75 and 93.8% of the variola virus DNAs
File list: Pol.Neu.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Neu.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Neural S...6,SRX743838,SRX743832,SRX743834,SRX743840 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.CDV.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.CDV.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Cardiovas...X320034,SRX346170,SRX346169,SRX373605,SRX680476 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.20.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Adp.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adp.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Adipocyt...e SRX682084,SRX682086,SRX682085,SRX682083 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Adl.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adl.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Adult SR...SRX043965,SRX005629,SRX043964,SRX554718 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Adl.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adl.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Adult SR...SRX554718,SRX043965,SRX043963,SRX043964 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Neu.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Neu.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Neural S...6,SRX743834,SRX743838,SRX743840,SRX743832 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Neu.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Neu.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Neural S...1,SRX099887,SRX099886,SRX743834,SRX743832 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.ALL.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III All ce...,SRX150396,SRX015144,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.05.RNA_polymerase_III.AllCell.bed ...
Roke, Y.; Harten, P.N. van; Franke, B.; Galesloot, T.E.; Boot, A.M.; Buitelaar, J.K.
2013-01-01
OBJECTIVE: To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders. METHODS:
Roke, Yvette; van Harten, Peter N.; Franke, Barbara; Galesloot, Tessel E.; Boot, Annemieke M.; Buitelaar, Jan K.
Objective To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders.Methods
Directory of Open Access Journals (Sweden)
Rodrigo Jácome
Full Text Available The crystal structures of monomeric RNA-dependent RNA polymerases and reverse transcriptases of more than 20 different viruses are available in the Protein Data Bank. They all share the characteristic right-hand shape of DNA- and RNA polymerases formed by the fingers, palm and thumb subdomains, and, in many cases, "fingertips" that extend from the fingers towards the thumb subdomain, giving the viral enzyme a closed right-hand appearance. Six conserved structural motifs that contain key residues for the proper functioning of the enzyme have been identified in all these RNA-dependent polymerases. These enzymes share a two divalent metal-ion mechanism of polymerization in which two conserved aspartate residues coordinate the interactions with the metal ions to catalyze the nucleotidyl transfer reaction. The recent availability of crystal structures of polymerases of the Orthomyxoviridae and Bunyaviridae families allowed us to make pairwise comparisons of the tertiary structures of polymerases belonging to the four main RNA viral groups, which has led to a phylogenetic tree in which single-stranded negative RNA viral polymerases have been included for the first time. This has also allowed us to use a homology-based structural prediction approach to develop a general three-dimensional model of the Ebola virus RNA-dependent RNA polymerase. Our model includes several of the conserved structural motifs and residues described in other viral RNA-dependent RNA polymerases that define the catalytic and highly conserved palm subdomain, as well as portions of the fingers and thumb subdomains. The results presented here help to understand the current use and apparent success of antivirals, i.e. Brincidofovir, Lamivudine and Favipiravir, originally aimed at other types of polymerases, to counteract the Ebola virus infection.
File list: Pol.ALL.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III All ce...ll types SRX331268,SRX331270,SRX395531,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.ALL.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Bld.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bld.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Blood ...SRX150560,SRX018610,SRX015143,SRX017006,SRX150396,SRX015144 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.ALL.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III All ce...ll types SRX395531,SRX331268,SRX331270,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.ALL.05.RNA_polymerase_III.AllCell.bed ...
File list: Pol.Bld.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bld.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Blood ...SRX017006,SRX015143,SRX150560,SRX018610,SRX150396,SRX015144 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.20.RNA_polymerase_III.AllCell.bed ...
Towards the molecular bases of polymerase dynamics
International Nuclear Information System (INIS)
Chela Flores, J.
1991-03-01
One aspect of the strong relationship that is known to exist between the processes of DNA replication and transcription is manifest in the coupling of the rates of movement of the replication fork (r f ) and RNA polymerase (r t ). We address two issues concerning the largely unexplored area of polymerase dynamics: (i) The validity of an approximate kinematic formula linking r f and r t suggested by experiments in which transcription is initiated in some prokaryotes with the antibiotic streptolydigin, and (ii) What are the molecular bases of the kinematic formula? An analysis of the available data suggests possible molecular bases for polymerase dynamics. In particular, we are led to a hypothesis: In active chromatin r t may depend on the length (λ t ) of the transcript of the primary messenger RNA (pre-mRNA). This new effect is subject to experimental verification. We discuss possible experiments that may be performed in order to test this prediction. (author). Refs, 6 tabs
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
File list: Pol.Utr.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Utr.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Uterus S...SRX573070,SRX027921,SRX1048949,SRX1136641,SRX1136638,SRX099217 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.ALL.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.ALL.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II All cell...3965,SRX043869,SRX043867,SRX043875,SRX043967,SRX043881,SRX043879 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.ALL.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Utr.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Utr.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Uterus S...RX099218,SRX1136641,SRX1048949,SRX1136639,SRX665233,SRX1136638 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.50.RNA_polymerase_II.AllCell.bed ...
Inhibiting DNA Polymerases as a Therapeutic Intervention against Cancer
Directory of Open Access Journals (Sweden)
Anthony J. Berdis
2017-11-01
Full Text Available Inhibiting DNA synthesis is an important therapeutic strategy that is widely used to treat a number of hyperproliferative diseases including viral infections, autoimmune disorders, and cancer. This chapter describes two major categories of therapeutic agents used to inhibit DNA synthesis. The first category includes purine and pyrmidine nucleoside analogs that directly inhibit DNA polymerase activity. The second category includes DNA damaging agents including cisplatin and chlorambucil that modify the composition and structure of the nucleic acid substrate to indirectly inhibit DNA synthesis. Special emphasis is placed on describing the molecular mechanisms of these inhibitory effects against chromosomal and mitochondrial DNA polymerases. Discussions are also provided on the mechanisms associated with resistance to these therapeutic agents. A primary focus is toward understanding the roles of specialized DNA polymerases that by-pass DNA lesions produced by DNA damaging agents. Finally, a section is provided that describes emerging areas in developing new therapeutic strategies targeting specialized DNA polymerases.
File list: Pol.Oth.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Oth.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Others S...RX1027436,SRX1027435,SRX1027434,SRX1027433,SRX668218,SRX099880,SRX099879 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Adp.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Adp.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Adipocyte... SRX800011,SRX800010,SRX341031,SRX341032,SRX341029,SRX800016,SRX800017,SRX341030 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.50.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Kid.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Kid.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...SRX1206072,SRX1206066,SRX326423,SRX1206067,SRX003883,SRX003882,SRX367323 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Kid.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Kid.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...X1206068,SRX1206073,SRX1206074,SRX1206072,SRX1206071,SRX003882,SRX367323 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Oth.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Oth.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Others S...RX1027436,SRX1027435,SRX1027434,SRX1027433,SRX668218,SRX099880,SRX099879 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Bld.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bld.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Blood SR...,SRX153079,SRX017717,SRX103447,SRX386121,SRX038919,SRX038920,SRX080132 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Kid.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Kid.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...SRX128201,SRX128200,SRX003882,SRX1206065,SRX1206066,SRX1206067,SRX367323 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Bld.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Bld.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Blood SR...,SRX017986,SRX017985,SRX728781,SRX017717,SRX005163,SRX024360,SRX017718 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Kid.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Kid.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...SRX1206066,SRX1206067,SRX003882,SRX003883,SRX1206065,SRX367323,SRX326416 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Oth.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Oth.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Others S...RX1027435,SRX668218,SRX1027436,SRX1027434,SRX1027433,SRX099879,SRX099880 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.YSt.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.YSt.10.RNA_Polymerase_II.AllCell sacCer3 RNA polymerase RNA Polymerase II Yeast... strain SRX092435,SRX360917,SRX360914,SRX497380,SRX497382,SRX497381,SRX360915 http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.YSt.10.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Lar.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lar.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Larvae SR...SRX151962,SRX182775,SRX661503,SRX013070,SRX013072,SRX013113,SRX013082,SRX151961 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.Oth.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Oth.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Others SR...X143827,SRX112963,SRX736456,SRX736457,SRX112981,SRX143834,SRX335666,SRX957689 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.05.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.Lar.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Lar.20.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Larvae SR...SRX661503,SRX026742,SRX013070,SRX013072,SRX182775,SRX151961,SRX013082,SRX013113 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.20.RNA_polymerase_II.AllCell.bed ...
Otimização de metodologia para o estudo de genes KIR Methodology optimization for KIR genotyping
Directory of Open Access Journals (Sweden)
Cristiane Conceição Chagas Rudnick
2010-06-01
Full Text Available Receptores killer cell immunoglobulin-like (KIRs são moléculas localizadas na superfície de células natural killer (NK e em subpopulações de linfócitos T codificadas por genes do cromossomo 19q13.4. A interação entre receptores KIR e moléculas antígeno leucocitário humano (HLA de classe I determina se células NK exercerão ou não sua função citotóxica e/ou secretora de citocinas ou se esta será inibida. Este trabalho teve por finalidade otimizar a metodologia para a genotipagem KIR, baseando-se nas condições descritas por Martin (2004. A técnica utilizada foi a reação em cadeia da polimerase com primers de sequência específica (PCR-SSP com iniciadores sintetizados pela Invitrogen® e visualização do produto amplificado em gel de agarose a 2% com brometo de etídio. Adaptações foram realizadas e a concentração de alguns reagentes foi alterada, como a do controle interno de 100 nM para 150 nM, iniciadores específicos senso e antissenso de KIR12.5/12.3, KIR13.5/13.3, KIR14.5/14.3, KIR22.5/22.3 e KIR36.5/36.3 de 500 nM para 750 nM e da solução de MgCl2 de 1,5 mM para 2 mM. As concentrações dos demais reagentes e temperaturas de amplificação foram mantidas. Nessas condições, o uso da Taq DNA polimerase recombinante (Invitrogen® foi satisfatório. Os resultados das genotipagens de 70 indivíduos foram confirmados por rSSO-Luminex® (One Lambda, Canoga Park, CA, EUA. A tipagem de genes KIR por essa técnica apresentou sensibilidade, especificidade, reprodutibilidade e baixo custo.The killer cell immunoglobulin-like receptors (KIRs are molecules expressed on natural killer (NK cells surface and in T-cell subsets encoded by genes located in chromosome 19q13.4. The interaction between KIR receptors and HLA class I molecules determines if the NK cells will fulfill their cytotoxic function and/or cytokine secretion or if this function will be inhibited. The objective of this work was to optimize KIR genotyping method
Primate community of the tropical rain forests of Saracá-Taqüera National Forest, Pará, Brazil
Directory of Open Access Journals (Sweden)
LC. Oliveira
Full Text Available Brazil is the richest country in the world in terms of primate species and the Amazonian rain forest is one of the richest biomes containing 15 (ca. 90% of the Neotropical primate genera. Although considered key elements in conservation strategies, there is only anecdotal information on primates for several protected areas within the region. Here we present new data on the community composition of the primates in the Saracá-Taqüera National Forest (429,600 ha, an actively mined, bauxite rich area, in Pará, Brazil. We used information from the literature, technical reports, museum data, and interviews conducted with agents from the Brazilian Institute of the Environment and Natural Renewable Resources (Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis - IBAMA and members of the local "Quilombo" community. In addition, from July 2003 to June 2007, we carried out 19 field trips ranging from 10 to15 days each, amounting to a total effort of 1,230 hours and 1,420 km of censuses, resulting in 1,034 records of eight primate species (Saguinus martinsi, Saguinus midas, Saimiri sciureus, Cebus apella, Pithecia pithecia, Chiropotes sagulatus, Ateles paniscus, and Alouatta macconelli. Two other species (Cebus olivaceus and Aotus trivirgatus were recorded only indirectly, through interviews and literature data. In all, Alouatta macconelli was the most frequently recorded species (43% of all records; while Saguinus midas and P. pithecia were the least (ca. 0.4 and 0.6% of all records. Based on our results, we discuss group sizes as well as taxonomic problems concerning the genera Pithecia and Chiropotes, for which we registered individuals displaying phenotypic geographical variation and two different forms, respectively. Despite the deforestation inherent in bauxite mining, the Saracá-Taqüera National Forest still has a remarkable richness of primate species. Our study results place this National Forest amongst the richest
Study on the genetic diversity of native chickens in northwest ...
African Journals Online (AJOL)
STORAGESEVER
2009-04-06
Apr 6, 2009 ... Poultry production in Ethiopia is an important livestock sector contributing ... chickens, which are becoming important to design effective selection .... 10 X Buffer, 2 µl of. 100 mM dNTPs, 0.5 µl of each (10 pmol/µl) forward and reverse primers, 0.2 µl of 5U/µl Taq DNA polymerase, 0.6 µl of 25 mM. MgCl2 and ...
Kulesh, David A.; Baker, Robert O.; Loveless, Bonnie M.; Norwood, David; Zwiers, Susan H.; Mucker, Eric; Hartmann, Chris; Herrera, Rafael; Miller, David; Christensen, Deanna; Wasieloski, Leonard P.; Huggins, John; Jahrling, Peter B.
2004-01-01
We designed, optimized, and extensively tested several sensitive and specific real-time PCR assays for rapid detection of both smallpox and pan-orthopox virus DNAs. The assays are based on TaqMan 3′-minor groove binder chemistry and were performed on both the rapid-cycling Roche LightCycler and the Cepheid Smart Cycler platforms. The hemagglutinin (HA) J7R, B9R, and B10R genes were used as targets for the variola virus-specific assays, and the HA and DNA polymerase-E9L genes were used as targets for the pan-orthopox virus assays. The five orthopox virus assays were tested against a panel of orthopox virus DNAs (both genomic and cloned) at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID). The results indicated that each assay was capable of detecting both the appropriate cloned gene and genomic DNA. The assays showed no cross-reactivity to the 78 DNAs in the USAMRIID bacterial cross-reactivity panel. The limit of detection (LOD) of each assay was determined to be between 12 and 25 copies of target DNA. The assays were also run against a blind panel of DNAs at the Centers for Disease Control and Prevention (CDC) on both the LightCycler and the Smart Cycler. The panel consisted of eight different variola virus isolates, five non-variola virus orthopox virus isolates, two varicella-zoster virus isolates, and one herpes simplex virus isolate. Each sample was tested in triplicate at 2.5 ng, 25 pg, 250 fg, and 2.5 fg, which represent 1.24 × 107, 1.24 × 105, 1.24 × 103, and 1.24 × 101 genome equivalents, respectively. The results indicated that each of the five assays was 100% specific (no false positives) when tested against both the USAMRIID panels and the CDC blind panel. With the CDC blind panel, the LightCycler was capable of detecting 96.2% of the orthopox virus DNAs and 93.8% of the variola virus DNAs. The Smart Cycler was capable of detecting 92.3% of the orthopox virus DNAs and between 75 and 93.8% of the variola virus DNAs. However
Thioredoxin suppresses microscopic hopping of T7 DNA polymerase on duplex DNA
Etson, Candice M.; Hamdan, Samir M.; Richardson, Charles C.; Oijen, Antoine M. van; Richardson, Charles C.
2010-01-01
The DNA polymerases involved in DNA replication achieve high processivity of nucleotide incorporation by forming a complex with processivity factors. A model system for replicative DNA polymerases, the bacteriophage T7 DNA polymerase (gp5), encoded by gene 5, forms a tight, 1:1 complex with
File list: Pol.EmF.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.EmF.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Embryonic...RX143288 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.EmF.05.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.NoD.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III No des...cription http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.NoD.50.RNA_polymerase_III.AllCell.bed ...
File list: Pol.NoD.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.50.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II No descri...ption http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.NoD.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.NoD.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II No descri...ption http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.NoD.05.RNA_polymerase_II.AllCell.bed ...
File list: Pol.NoD.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III No des...cription http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.NoD.10.RNA_polymerase_III.AllCell.bed ...
File list: Pol.NoD.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II No descr...iption http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.NoD.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.NoD.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III No des...cription http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.NoD.20.RNA_polymerase_III.AllCell.bed ...
File list: Pol.NoD.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II No descr...iption http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.NoD.20.RNA_polymerase_II.AllCell.bed ...
Liu, Jie; Ochieng, Caroline; Wiersma, Steve; Ströher, Ute; Towner, Jonathan S; Whitmer, Shannon; Nichol, Stuart T; Moore, Christopher C; Kersh, Gilbert J; Kato, Cecilia; Sexton, Christopher; Petersen, Jeannine; Massung, Robert; Hercik, Christine; Crump, John A; Kibiki, Gibson; Maro, Athanasia; Mujaga, Buliga; Gratz, Jean; Jacob, Shevin T; Banura, Patrick; Scheld, W Michael; Juma, Bonventure; Onyango, Clayton O; Montgomery, Joel M; Houpt, Eric; Fields, Barry
2016-01-01
Acute febrile illness (AFI) is associated with substantial morbidity and mortality worldwide, yet an etiologic agent is often not identified. Convalescent-phase serology is impractical, blood culture is slow, and many pathogens are fastidious or impossible to cultivate. We developed a real-time PCR-based TaqMan array card (TAC) that can test six to eight samples within 2.5 h from sample to results and can simultaneously detect 26 AFI-associated organisms, including 15 viruses (chikungunya, Crimean-Congo hemorrhagic fever [CCHF] virus, dengue, Ebola virus, Bundibugyo virus, Sudan virus, hantaviruses [Hantaan and Seoul], hepatitis E, Marburg, Nipah virus, o'nyong-nyong virus, Rift Valley fever virus, West Nile virus, and yellow fever virus), 8 bacteria (Bartonella spp., Brucella spp., Coxiella burnetii, Leptospira spp., Rickettsia spp., Salmonella enterica and Salmonella enterica serovar Typhi, and Yersinia pestis), and 3 protozoa (Leishmania spp., Plasmodium spp., and Trypanosoma brucei). Two extrinsic controls (phocine herpesvirus 1 and bacteriophage MS2) were included to ensure extraction and amplification efficiency. Analytical validation was performed on spiked specimens for linearity, intra-assay precision, interassay precision, limit of detection, and specificity. The performance of the card on clinical specimens was evaluated with 1,050 blood samples by comparison to the individual real-time PCR assays, and the TAC exhibited an overall 88% (278/315; 95% confidence interval [CI], 84% to 92%) sensitivity and a 99% (5,261/5,326, 98% to 99%) specificity. This TaqMan array card can be used in field settings as a rapid screen for outbreak investigation or for the surveillance of pathogens, including Ebola virus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
File list: Pol.NoD.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.10.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II No de...scription http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.NoD.10.RNA_polymerase_II.AllCell.bed ...
File list: Pol.NoD.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.05.RNA_Polymerase_II.AllCell sacCer3 RNA polymerase RNA Polymerase II No de...scription http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.NoD.05.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.NoD.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.10.RNA_Polymerase_II.AllCell sacCer3 RNA polymerase RNA Polymerase II No de...scription http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.NoD.10.RNA_Polymerase_II.AllCell.bed ...
File list: Pol.NoD.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.20.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II No de...scription http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.NoD.20.RNA_polymerase_II.AllCell.bed ...
File list: Pol.NoD.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.NoD.50.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II No de...scription http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.NoD.50.RNA_polymerase_II.AllCell.bed ...
Active RNA polymerases: mobile or immobile molecular machines?
Directory of Open Access Journals (Sweden)
Argyris Papantonis
2010-07-01
Full Text Available It is widely assumed that active RNA polymerases track along their templates to produce a transcript. We test this using chromosome conformation capture and human genes switched on rapidly and synchronously by tumour necrosis factor alpha (TNFalpha; one is 221 kbp SAMD4A, which a polymerase takes more than 1 h to transcribe. Ten minutes after stimulation, the SAMD4A promoter comes together with other TNFalpha-responsive promoters. Subsequently, these contacts are lost as new downstream ones appear; contacts are invariably between sequences being transcribed. Super-resolution microscopy confirms that nascent transcripts (detected by RNA fluorescence in situ hybridization co-localize at relevant times. Results are consistent with an alternative view of transcription: polymerases fixed in factories reel in their respective templates, so different parts of the templates transiently lie together.
Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.
Gahlon, Hailey L; Romano, Louis J; Rueda, David
2017-11-20
Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.
Isolation and characterization of high affinity aptamers against DNA polymerase iota.
Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V
2012-02-01
Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.
Carneiro, Greice Amaral; Matić, Slavica; Ortu, Giuseppe; Garibaldi, Angelo; Spadaro, Davide; Gullino, Maria Lodovica
2017-07-01
Bakanae disease, which is caused by the seedborne pathogen Fusarium fujikuroi, is found throughout the world on rice. A TaqMan real-time PCR has been developed on the TEF 1-α gene to detect F. fujikuroi in different rice tissues. Three primer/probe sets were tested. The selected set produced an amplicon of 84 bp and was specific for F. fujikuroi with respect to eight Fusarium species of rice and six other rice common pathogens. The assay was validated for specificity, selectivity, sensitivity, repeatability, and reproducibility. The detection limit was set at 27.5 fg of DNA, which is approximately equivalent to one haploid genome of F. fujikuroi. The developed TaqMan real-time assay was able to efficiently detect and quantify F. fujikuroi from rice culms, leaves, roots, and seeds. At 1 week post-germination (wpg), the pathogen was more diffused in the green tissues, while at 3 wpg it was uniformly spread also in the roots. The highest concentration of F. fujikuroi was measured in the M6 cultivar, which showed around 1,450 fungal cells/g. The assay was sufficiently sensitive to detect a few genomic equivalents in the rice seeds, corresponding to 9.89 F. fujikuroi cells/g. The assay permitted bakanae disease to be detected in asymptomatic tissues at the early rice development stages.
Generation and comprehensive analysis of an influenza virus polymerase cellular interaction network.
Tafforeau, Lionel; Chantier, Thibault; Pradezynski, Fabrine; Pellet, Johann; Mangeot, Philippe E; Vidalain, Pierre-Olivier; Andre, Patrice; Rabourdin-Combe, Chantal; Lotteau, Vincent
2011-12-01
The influenza virus transcribes and replicates its genome inside the nucleus of infected cells. Both activities are performed by the viral RNA-dependent RNA polymerase that is composed of the three subunits PA, PB1, and PB2, and recent studies have shown that it requires host cell factors to transcribe and replicate the viral genome. To identify these cellular partners, we generated a comprehensive physical interaction map between each polymerase subunit and the host cellular proteome. A total of 109 human interactors were identified by yeast two-hybrid screens, whereas 90 were retrieved by literature mining. We built the FluPol interactome network composed of the influenza virus polymerase (PA, PB1, and PB2) and the nucleoprotein NP and 234 human proteins that are connected through 279 viral-cellular protein interactions. Analysis of this interactome map revealed enriched cellular functions associated with the influenza virus polymerase, including host factors involved in RNA polymerase II-dependent transcription and mRNA processing. We confirmed that eight influenza virus polymerase-interacting proteins are required for virus replication and transcriptional activity of the viral polymerase. These are involved in cellular transcription (C14orf166, COPS5, MNAT1, NMI, and POLR2A), translation (EIF3S6IP), nuclear transport (NUP54), and DNA repair (FANCG). Conversely, we identified PRKRA, which acts as an inhibitor of the viral polymerase transcriptional activity and thus is required for the cellular antiviral response.
Directory of Open Access Journals (Sweden)
Meng Shuang
2010-06-01
Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.
Recent Insight into the Kinetic Mechanisms and Conformational Dynamics of Y-Family DNA Polymerases
Maxwell, Brian A.; Suo, Zucai
2014-01-01
The kinetic mechanisms by which DNA polymerases catalyze DNA replication and repair have long been areas of active research. Recently discovered Y-family DNA polymerases catalyze the bypass of damaged DNA bases that would otherwise block replicative DNA polymerases and stall replication forks. Unlike DNA polymerases from the five other families, the Y-family DNA polymerases have flexible, solvent-accessible active sites that are able to tolerate various types of damaged template bases and all...
Production of DNA polymerase by recombinant pET-17b/Pfu-Pol ...
African Journals Online (AJOL)
Although this enzyme has been produced worldwide, there is no reported cloning or production of polymerases in Egypt. In the current work, plasmid coding Pfu polymerase enzyme (pET-17b/Pfu-Pol) was transformed into E. coli Top10. The plasmid coding Pfu- polymerase was confirmed by restriction analysis using HindIII ...
Nasarabadi, Shanavaz [Livermore, CA
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.
Ubiquitylation and degradation of elongating RNA polymerase II
DEFF Research Database (Denmark)
Wilson, Marcus D; Harreman, Michelle; Svejstrup, Jesper Q
2013-01-01
During its journey across a gene, RNA polymerase II has to contend with a number of obstacles to its progression, including nucleosomes, DNA-binding proteins, DNA damage, and sequences that are intrinsically difficult to transcribe. Not surprisingly, a large number of elongation factors have....... In this review, we describe the mechanisms and factors responsible for the last resort mechanism of transcriptional elongation. This article is part of a Special Issue entitled: RNA polymerase II Transcript Elongation....
File list: Pol.CeL.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.CeL.50.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Cell line...70,SRX749072,SRX749071,SRX749073,SRX017852,SRX529168 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.CeL.50.RNA_polymerase_II.AllCell.bed ...
File list: Pol.CeL.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.CeL.20.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Cell line...70,SRX749072,SRX749071,SRX749073,SRX017852,SRX529168 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.CeL.20.RNA_polymerase_II.AllCell.bed ...
DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli
International Nuclear Information System (INIS)
Dorson, J.W.; Moses, R.E.
1978-01-01
DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair
DNA polymerases in the rat pituitary gland. Effect of oestrogens and sulpiride.
Jahn, G A; Kalbermann, L E; Machiavelli, G; Szijan, I; Burdman, J A
1980-06-01
Changes in the activity of DNA polymerase and [3H]thymidine incorporation into the DNA of the anterior pituitary gland were studied in oestrogenized male and pregnant rats. The activities of DNA polymerases alpha and beta, extracted in Tris--HCl or in sodium phosphate buffer were characterized according to their optimum pH and sensitivity to N-ethyl-maleimide. In the Tris-soluble fraction DNA polymerase activity is almost exclusively alpha, while in the phosphate soluble fraction it is a mixture of alpha and beta. The administration of oestrogens to male rats increases [3H]thymidine incorporation and enhances the activity of DNA polymerases in the Tris-soluble fraction, while the activity of the phosphate-soluble enzyme does not change. Sulpiride administration results in a further increment of [3H]thymidine incorporation and of DNA polymerase activity in the Tris-soluble fraction. In pregnant rats sulpiride also produces an increment of DNA polymerase activity only in the Tris-soluble fraction. Thus, the activity of the Tris-soluble fraction from APG behaves as DNA polymerase alpha. This activity changes in parallel with [3H]thymidine incorporation into DNA which is an indication of cell proliferation in the gland. This is discussed with respect to a negative feedback mechanism between intracellular prolactin concentration and DNA synthesis in the APG.
EBV DNA polymerase inhibition of tannins from Eugenia uniflora.
Lee, M H; Chiou, J F; Yen, K Y; Yang, L L
2000-06-30
Nasopharyngeal carcinoma (NPC) is one of the high population malignant tumors among Chinese in southern China and southeast Asia. Epstein-Barr virus (EBV) is a human B lymphotropic herpes virus which is known to be closely associated with NPC. EBV DNA polymerase is a key enzyme during EBV replication and is measured by its radioactivity. The addition of phorbol 12-myristate 13-acetate to Raji cell cultures led to a large increase in EBV DNA polymerase, which was purified by sequential DEAE-cellulose, phosphocellulose and DNA-cellulose column chromatography. Four tannins were isolated from the active fractions of Eugenia uniflora L., which were tested for the inhibition of EBV DNA polymerase. The results showed the 50% inhibitory concentration (IC(50)) values of gallocatechin, oenothein B, eugeniflorins D(1) and D(2) were 26.5 62.3, 3.0 and 3.5 microM, respectively. Furthermore, when compared with the positive control (phosphonoacetic acid), an inhibitor of EBV replication, the IC(50) value was 16.4 microM. In view of the results, eugeniflorins D(1) and D(2) are the potency principles in the inhibition of EBV DNA polymerase from E. uniflora.
Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven
2016-03-01
Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The
Polymerase chain reaction to search for Herpes viruses in uveitic ...
African Journals Online (AJOL)
Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.
Structure of human DNA polymerase iota and the mechanism of DNA synthesis.
Makarova, A V; Kulbachinskiy, A V
2012-06-01
Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.
DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present
Directory of Open Access Journals (Sweden)
Cheng-Yao eChen
2014-06-01
Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.
In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants
Directory of Open Access Journals (Sweden)
Mokhtar Nosrati
2017-08-01
Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.
The Paramyxovirus Polymerase Complex as a Target for Next-Generation Anti-Paramyxovirus Therapeutics
Directory of Open Access Journals (Sweden)
Richard K Plemper
2015-05-01
Full Text Available The paramyxovirus family includes major human and animal pathogens, including measles virus, mumps virus, and human respiratory syncytial virus (RSV, as well as the emerging zoonotic Hendra and Nipah viruses. In the United States, RSV is the leading cause of infant hospitalizations due to viral infectious disease. Despite their clinical significance, effective drugs for the improved management of paramyxovirus disease are lacking. The development of novel anti-paramyxovirus therapeutics is therefore urgently needed. Paramyxoviruses contain RNA genomes of negative polarity, necessitating a virus-encoded RNA-dependent RNA polymerase (RdRp complex for replication and transcription. Since an equivalent enzymatic activity is absent in host cells, the RdRp complex represents an attractive druggable target, although structure-guided drug development campaigns are hampered by the lack of high-resolution RdRp crystal structures. Here, we review the current structural and functional insight into the paramyxovirus polymerase complex in conjunction with an evaluation of the mechanism of activity and developmental status of available experimental RdRp inhibitors. Our assessment spotlights the importance of the RdRp complex as a premier target for therapeutic intervention and examines how high-resolution insight into the organization of the complex will pave the path towards the structure-guided design and optimization of much-needed next-generation paramyxovirus RdRp blockers.
Directory of Open Access Journals (Sweden)
Miriam YH Ueda
2015-06-01
Full Text Available Human herpesvirus 6 (HHV-6 may cause severe complications after haematopoietic stem cell transplantation (HSCT. Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance.
Leem, S H; Ropp, P A; Sugino, A
1994-01-01
We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...
Mutations of mtDNA polymerase-γ and hyperlactataemia in the HIV ...
African Journals Online (AJOL)
Mutations of mtDNA polymerase-γ and hyperlactataemia in the HIV-infected Zulu population of South Africa. ... D B A Ojwach, C Aldous, P Kocheleff, B Sartorius ... of their capacity to impede human mitochondrial DNA polymerase-γ (POLG), ...
Banda, Srikanth; Cao, Nan; Tse-Dinh, Yuk-Ching
2017-09-15
We report here a distinct mechanism of interaction between topoisomerase I and RNA polymerase in Mycobacterium tuberculosis and Mycobacterium smegmatis that has evolved independently from the previously characterized interaction between bacterial topoisomerase I and RNA polymerase. Bacterial DNA topoisomerase I is responsible for preventing the hyper-negative supercoiling of genomic DNA. The association of topoisomerase I with RNA polymerase during transcription elongation could efficiently relieve transcription-driven negative supercoiling. Our results demonstrate a direct physical interaction between the C-terminal domains of topoisomerase I (TopoI-CTDs) and the β' subunit of RNA polymerase of M. smegmatis in the absence of DNA. The TopoI-CTDs in mycobacteria are evolutionarily unrelated in amino acid sequence and three-dimensional structure to the TopoI-CTD found in the majority of bacterial species outside Actinobacteria, including Escherichia coli. The functional interaction between topoisomerase I and RNA polymerase has evolved independently in mycobacteria and E. coli, with distinctively different structural elements of TopoI-CTD utilized for this protein-protein interaction. Zinc ribbon motifs in E. coli TopoI-CTD are involved in the interaction with RNA polymerase. For M. smegmatis TopoI-CTD, a 27-amino-acid tail that is rich in basic residues at the C-terminal end is responsible for the interaction with RNA polymerase. Overexpression of recombinant TopoI-CTD in M. smegmatis competed with the endogenous topoisomerase I for protein-protein interactions with RNA polymerase. The TopoI-CTD overexpression resulted in decreased survival following treatment with antibiotics and hydrogen peroxide, supporting the importance of the protein-protein interaction between topoisomerase I and RNA polymerase during stress response of mycobacteria. Copyright © 2017 Elsevier Ltd. All rights reserved.
Dubois, Benjamin; Bertin, Pierre; Muhovski, Yordan; Escarnot, Emmanuelle; Mingeot, Dominique
2017-01-01
Celiac disease (CD) is caused by specific sequences of gluten proteins found in cereals such as bread wheat ( Triticum aestivum ssp. aestivum ) and spelt ( T. aestivum ssp. spelta ). Among them, the α-gliadins display the highest immunogenicity, with four T-cell stimulatory epitopes. The toxicity of each epitope sequence can be reduced or even suppressed according to the allelic form of each sequence. One way to address the CD problem would be to make use of this allelic variability in breeding programs to develop safe varieties, but tools to track the presence of toxic epitopes are required. The objective of this study was to develop a tool to accurately detect and quantify the immunogenic content of expressed α-gliadins of spelt and bread wheat. Four TaqMan probes that only hybridize to the canonical-i.e. toxic-form of each of the four epitopes were developed and their specificity was demonstrated. Six TaqMan probes targeting stable reference genes were also developed and constitute a tool to normalize qPCR data. The probes were used to measure the epitope expression levels of 11 contrasted spelt accessions and three ancestral diploid accessions of bread wheat and spelt. A high expression variability was highlighted among epitopes and among accessions, especially in Asian spelts, which showed lower epitope expression levels than the other spelts. Some discrepancies were identified between the canonical epitope expression level and the global amount of expressed α-gliadins, which makes the designed TaqMan probes a useful tool to quantify the immunogenic potential independently of the global amount of expressed α-gliadins. The results obtained in this study provide useful tools to study the immunogenic potential of expressed α-gliadin sequences from Triticeae accessions such as spelt and bread wheat. The application of the designed probes to contrasted spelt accessions revealed a high variability and interesting low canonical epitope expression levels in the
DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds
Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.
2008-01-01
We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765
[DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells].
D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V
1980-11-01
A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.
Directory of Open Access Journals (Sweden)
Kamau Edwin
2012-01-01
Full Text Available Abstract Background Anti-malarial drug resistance poses a threat to current global efforts towards control and elimination of malaria. Several methods are used in monitoring anti-malarial drug resistance. Molecular markers such as single nucleotide polymorphism (SNP for example are increasingly being used to identify genetic mutations related to anti-malarial drug resistance. Several methods are currently being used in analysis of SNP associated with anti-malarial drug resistance and although each one of these methods has unique strengths and shortcoming, there is still need to improve and/or develop new methods that will close the gap found in the current methods. Methods TaqMan Allelic Discrimination assays for detection of SNPs associated with anti-malarial drug resistance were designed for analysis on Applied Biosystems PCR platform. These assays were designed by submitting SNP sequences associated with anti-malarial drug resistance to Applied Biosystems website. Eleven SNPs associated with resistance to anti-malarial drugs were selected and tested. The performance of each SNP assay was tested by creating plasmid DNAs carrying codons of interests and analysing them for analysis. To test the sensitivity and specificity of each SNP assay, 12 clinical samples were sequenced at codons of interest and used in the analysis. Plasmid DNAs were used to establish the Limit of Detection (LoD for each assay. Results Data from genetic profiles of the Plasmodium falciparum laboratory strains and sequence data from 12 clinical samples was used as the reference method with which the performance of the SNP assays were compared to. The sensitivity and specificity of each SNP assay was establish at 100%. LoD for each assay was established at 2 GE, equivalent to less than 1 parasite/μL. SNP assays performed well in detecting mixed infection and analysis of clinical samples. Conclusion TaqMan Allelic Discrimination assay provides a good alternative tool in
Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.
Pinkney, M; Hoggett, J G
1988-03-15
Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase.
RNA-dependent RNA polymerases from cowpea mosaic virus-infected cowpea leaves
Dorssers, L.
1983-01-01
The aim of the research described in this thesis was the purification and identification of the RNA-dependent RNA polymerase engaged in replicating viral RNA in cowpea mosaic virus (CPMV)- infected cowpea leaves.
Previously, an RNA-dependent RNA polymerase produced upon infection ofOptimization of a protocol for extraction of Plasmodium falciparum ...
African Journals Online (AJOL)
STORAGESEVER
2008-05-16
May 16, 2008 ... compared to saponin lysed samples when such whole blood ... infected blood intended for extraction of P. falciparum RNA for DNA microarrays and other sensitive ... TaqMan® and LightCycler® technology, and other.
Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene
International Nuclear Information System (INIS)
Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.
1987-01-01
DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus
Analysis of DNA polymerase activity in Petunia protoplasts treated with clastogenic agents
International Nuclear Information System (INIS)
Benediktsson, I.; Spampinato, C.P.; Andreo, C.S.; Schieder, O.
1994-01-01
Clastogenic agents, i.e. agents that can induce chromosome or DNA breakage, have been shown to enhance the role of direct gene transfer to protoplasts. The effect was analysed at the enzymatic level using protoplast homogenates as well as intact protoplasts. For that purpose existing procedures were modified to enable measurement of DNA polymerase in vivo. In the system used, external DNA was able to enter the cells without the addition of membrane-permeabilizing compounds. When comparing total DNA polymerase activity of protoplasts irradiated with X-rays or UV-light with that of untreated cells we did not observe significant differences. Incubation of protoplasts with high doses of bleomycin affected total DNA polymerase activity negatively. but dideoxythymidine triphosphate-sensitive activity was not influenced. We conclude that the DNA strand-breaks induced by low doses of X-rays. UV-light or bleomycin do not increase the total or the repair-DNA polymerase activity and. therefore. that the increase in the transformation rates after DNA strand-breaking is not preceded by enhanced DNA polymerase activity. (author)
DNA repair in DNA-polymerase-deficient mutants of Escherichia coli
International Nuclear Information System (INIS)
Smith, D.W.; Tait, R.C.; Harris, A.L.
1975-01-01
Escherichia coli mutants deficient in DNA polymerase I, in DNA polymerases I and II, or in DNA polymerase III can efficiently and completely execute excision-repair and postreplication repair of the uv-damaged DNA at 30 0 C and 43 0 C when assayed by alkaline sucrose gradients. Repair by Pol I - and Pol I - , Pol II - cells is inhibited by 1-β-D-arabinofuranosylcytosine (araC) at 43 0 C but not at 30 0 C, whereas that by Pol III - cells is insensitive to araC at any temperature. Thus, either Pol I or Pol III is required for complete and efficient repair, and in their absence Pol II mediates a limited, incomplete dark repair of uv-damaged DNA
A Structural Overview of RNA-Dependent RNA Polymerases from the Flaviviridae Family
Directory of Open Access Journals (Sweden)
Jiqin Wu
2015-06-01
Full Text Available RNA-dependent RNA polymerases (RdRPs from the Flaviviridae family are representatives of viral polymerases that carry out RNA synthesis through a de novo initiation mechanism. They share a ≈ 600-residue polymerase core that displays a canonical viral RdRP architecture resembling an encircled right hand with palm, fingers, and thumb domains surrounding the active site. Polymerase catalytic motifs A–E in the palm and motifs F/G in the fingers are shared by all viral RdRPs with sequence and/or structural conservations regardless of the mechanism of initiation. Different from RdRPs carrying out primer-dependent initiation, Flaviviridae and other de novo RdRPs utilize a priming element often integrated in the thumb domain to facilitate primer-independent initiation. Upon the transition to the elongation phase, this priming element needs to undergo currently unresolved conformational rearrangements to accommodate the growth of the template-product RNA duplex. In the genera of Flavivirus and Pestivirus, the polymerase module in the C-terminal part of the RdRP protein may be regulated in cis by the N-terminal region of the same polypeptide. Either being a methyltransferase in Flavivirus or a functionally unclarified module in Pestivirus, this region could play auxiliary roles for the canonical folding and/or the catalysis of the polymerase, through defined intra-molecular interactions.
DNA polymerase III of Escherichia coli is required for UV and ethyl methanesulfonate mutagenesis
Energy Technology Data Exchange (ETDEWEB)
Hagensee, M.E.; Timme, T.L.; Bryan, S.K.; Moses, R.E.
1987-06-01
Strains of Escherichia coli possessing the pcbA1 mutation, a functional DNA polymerase I, and a temperature-sensitive mutation in DNA polymerase III can survive at the restrictive temperature (43 degrees C) for DNA polymerase III. The mutation rate of the bacterial genome of such strains after exposure to either UV light or ethyl methanesulfonate was measured by its rifampicin resistance or amino acid requirements. In addition, Weigle mutagenesis of preirradiated lambda phage was also measured. In all cases, no increase in mutagenesis was noted at the restrictive temperature for DNA polymerase III. Introduction of a cloned DNA polymerase III gene returned the mutation rate of the bacterial genome as well as the Weigle mutagenesis to normal at 43 degrees C. Using a recA-lacZ fusion, the SOS response after UV irradiation was measured and found to be normal at the restrictive and permissive temperature for DNA polymerase III, as was induction of lambda prophage. Recombination was also normal at either temperature. Our studies demonstrate that a functional DNA polymerase III is strictly required for mutagenesis at a step other than SOS induction.
Nisoli, E; Brunani, A; Borgomainerio, E; Tonello, C; Dioni, L; Briscini, L; Redaelli, G; Molinari, E; Cavagnini, F; Carruba, M O
2007-06-01
Food is considered a reinforcing agent, like a variety of substances such as alcohol and other drugs of abuse that produce pleasure. Psychopathological traits related to food intake are demonstrated in eating disorders as in obesity with different genetic aspects for these diseases. Recently, the prevalence of TaqA1 allele has been associated to alcohol, drug abuse and carbohydrate preference. For this reason, the aim of this study was to evaluate if the presence of A1 allele, in eating disorders and obesity, is associated with some particular psycho-pathological characteristics. We studied the presence of TaqA1 in Italian subjects affected by obesity (n=71), anorexia (n=28), bulimia (n=20) and in control group (n=54). The Eating Disorders Inventory (EDI test) was used to evaluate the psychological profiles. Patients without alcohol and drugs abuse were selected (>125 ml/day). The A1+ allele, both in A1/A1 and A1/A2 genotypes, was not differently distributed among disease groups; on the contrary two EDI subscales (Drive for thinness and Ineffectiveness) resulted associated with A1+ allele without effect of the eating disease or obesity. These results confirm that the presence of A1+ allele is not simply related to body weight but the A1+ allele might be a marker of a genetic psychological condition in people with high risk to develop pathological eating behaviour.
Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.
Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J
2011-01-21
In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.
Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication.
Directory of Open Access Journals (Sweden)
Fabio Lapenta
Full Text Available DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics.
The replisome uses mRNA as a primer after colliding with RNA polymerase.
Pomerantz, Richard T; O'Donnell, Mike
2008-12-11
Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.
International Nuclear Information System (INIS)
Abbotts, J.; SenGupta, D.N.; Zmudzka, B.; Widen, S.G.; Notario, V.; Wilson, S.H.
1988-01-01
The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N 3 -methyl-dT or O 6 -methyl-dG
Fixing the model for transcription: the DNA moves, not the polymerase.
Papantonis, Argyris; Cook, Peter R
2011-01-01
The traditional model for transcription sees active polymerases tracking along their templates. An alternative (controversial) model has active enzymes immobilized in "factories." Recent evidence supports the idea that the DNA moves, not the polymerase, and points to alternative explanations of how regulatory motifs like enhancers and silencers work.
Directory of Open Access Journals (Sweden)
Ball Amanda
2007-08-01
Full Text Available Abstract Background Knockdown resistance (kdr is a well-characterized mechanism of resistance to pyrethroid insecticides in many insect species and is caused by point mutations of the pyrethroid target site the para-type sodium channel. The presence of kdr mutations in Anopheles gambiae, the most important malaria vector in Africa, has been monitored using a variety of molecular techniques. However, there are few reports comparing the performance of these different assays. In this study, two new high-throughput assays were developed and compared with four established techniques. Methods Fluorescence-based assays based on 1 TaqMan probes and 2 high resolution melt (HRM analysis were developed to detect kdr alleles in An. gambiae. Four previously reported techniques for kdr detection, Allele Specific Polymerase Chain Reaction (AS-PCR, Heated Oligonucleotide Ligation Assay (HOLA, Sequence Specific Oligonucleotide Probe – Enzyme-Linked ImmunoSorbent Assay (SSOP-ELISA and PCR-Dot Blot were also optimized. The sensitivity and specificity of all six assays was then compared in a blind genotyping trial of 96 single insect samples that included a variety of kdr genotypes and African Anopheline species. The relative merits of each assay was assessed based on the performance in the genotyping trial, the length/difficulty of each protocol, cost (both capital outlay and consumable cost, and safety (requirement for hazardous chemicals. Results The real-time TaqMan assay was both the most sensitive (with the lowest number of failed reactions and the most specific (with the lowest number of incorrect scores. Adapting the TaqMan assay to use a PCR machine and endpoint measurement with a fluorimeter showed a slight reduction in sensitivity and specificity. HRM initially gave promising results but was more sensitive to both DNA quality and quantity and consequently showed a higher rate of failure and incorrect scores. The sensitivity and specificity of AS
Bass, Chris; Nikou, Dimitra; Donnelly, Martin J; Williamson, Martin S; Ranson, Hilary; Ball, Amanda; Vontas, John; Field, Linda M
2007-01-01
Background Knockdown resistance (kdr) is a well-characterized mechanism of resistance to pyrethroid insecticides in many insect species and is caused by point mutations of the pyrethroid target site the para-type sodium channel. The presence of kdr mutations in Anopheles gambiae, the most important malaria vector in Africa, has been monitored using a variety of molecular techniques. However, there are few reports comparing the performance of these different assays. In this study, two new high-throughput assays were developed and compared with four established techniques. Methods Fluorescence-based assays based on 1) TaqMan probes and 2) high resolution melt (HRM) analysis were developed to detect kdr alleles in An. gambiae. Four previously reported techniques for kdr detection, Allele Specific Polymerase Chain Reaction (AS-PCR), Heated Oligonucleotide Ligation Assay (HOLA), Sequence Specific Oligonucleotide Probe – Enzyme-Linked ImmunoSorbent Assay (SSOP-ELISA) and PCR-Dot Blot were also optimized. The sensitivity and specificity of all six assays was then compared in a blind genotyping trial of 96 single insect samples that included a variety of kdr genotypes and African Anopheline species. The relative merits of each assay was assessed based on the performance in the genotyping trial, the length/difficulty of each protocol, cost (both capital outlay and consumable cost), and safety (requirement for hazardous chemicals). Results The real-time TaqMan assay was both the most sensitive (with the lowest number of failed reactions) and the most specific (with the lowest number of incorrect scores). Adapting the TaqMan assay to use a PCR machine and endpoint measurement with a fluorimeter showed a slight reduction in sensitivity and specificity. HRM initially gave promising results but was more sensitive to both DNA quality and quantity and consequently showed a higher rate of failure and incorrect scores. The sensitivity and specificity of AS-PCR, SSOP-ELISA, PCR Dot
Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro
Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi
2012-01-01
Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263
Backtracking dynamics of RNA polymerase: pausing and error correction
International Nuclear Information System (INIS)
Sahoo, Mamata; Klumpp, Stefan
2013-01-01
Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield–Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates. (paper)
Backtracking dynamics of RNA polymerase: pausing and error correction
Sahoo, Mamata; Klumpp, Stefan
2013-09-01
Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.
RNA Polymerase II–The Transcription Machine
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 3. RNA Polymerase II – The Transcription Machine - Nobel Prize in Chemistry 2006. Jiyoti Verma Aruna Naorem Anand Kumar Manimala Sen Parag Sadhale. General Article Volume 12 Issue 3 March 2007 pp 47-53 ...