Stochastic simulations of the tetracycline operon

Directory of Open Access Journals (Sweden)

Kaznessis Yiannis N

2011-01-01

Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

Science.gov (United States)

Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

2015-01-01

Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

Metazoan operons accelerate recovery from growth arrested states

Science.gov (United States)

Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

2011-01-01

Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

Directory of Open Access Journals (Sweden)

Lindblad Peter

2008-04-01

Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

Science.gov (United States)

Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

2015-05-25

Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

Science.gov (United States)

Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

2016-04-01

Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

Science.gov (United States)

Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

2016-01-01

The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

Science.gov (United States)

Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

2015-01-01

The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

Science.gov (United States)

Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

2016-10-15

Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

Teaching the Big Ideas of Biology with Operon Models

Science.gov (United States)

Cooper, Robert A.

2015-01-01

This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis

DEFF Research Database (Denmark)

Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin

1996-01-01

Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...

Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

2005-04-12

Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

Science.gov (United States)

Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

2014-01-01

Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

Directory of Open Access Journals (Sweden)

Enrico eMuhr

2016-01-01

Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

Science.gov (United States)

Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

2016-08-01

To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

Science.gov (United States)

Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

2017-01-01

Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

Science.gov (United States)

Chowdhury, Nilkanta; Bagchi, Angshuman

2017-07-01

Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

Science.gov (United States)

Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

2011-11-01

HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

Science.gov (United States)

Crawford, I P; Han, C Y; Silverman, M

1991-01-01

The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

Science.gov (United States)

Lawrence, J

1999-12-01

The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

Evolution and Biophysics of the Escherichia coli lac Operon

Science.gov (United States)

Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

2011-03-01

To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

Functional analysis of the pediocin operon of Pediococcus acidilactici PAC1.0 : PedB is the immunity protein and PedD is the precursor processing enzyme

NARCIS (Netherlands)

Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.

The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises

Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

Directory of Open Access Journals (Sweden)

April M Sapp

Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

NARCIS (Netherlands)

Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

2013-01-01

Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

Science.gov (United States)

Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

2014-07-08

We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

Directory of Open Access Journals (Sweden)

Gogarten J Peter

2008-01-01

Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

Science.gov (United States)

Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

2017-01-01

The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

REMap: Operon map of M. tuberculosis based on RNA sequence data.

Science.gov (United States)

Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

2016-07-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

Science.gov (United States)

Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

2012-01-01

During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

Science.gov (United States)

Ray, J. Christian J; Igoshin, Oleg A.

2012-01-01

Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

The Genomic Pattern of tDNA Operon Expression in E. coli.

Directory of Open Access Journals (Sweden)

2005-06-01

Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

Solving a discrete model of the lac operon using Z3

Science.gov (United States)

Gutierrez, Natalia A.

2014-05-01

A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

2003-01-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

2003-09-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

Science.gov (United States)

García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

2017-09-01

Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

Science.gov (United States)

Igoshin, Oleg

2011-03-01

Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

Rapid customised operon assembly by yeast recombinational cloning.

Science.gov (United States)

Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

2017-06-01

We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

Science.gov (United States)

Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

2017-01-15

The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

Science.gov (United States)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

Science.gov (United States)

Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

2013-07-01

The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis

DEFF Research Database (Denmark)

Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal

2005-01-01

control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...

CONDOP: an R package for CONdition-Dependent Operon Predictions.

Science.gov (United States)

Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

2016-10-15

The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The pyrimidine operon pyrRPB-carA from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Schallert, J.; Andersen, Birgit

2001-01-01

The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

DEFF Research Database (Denmark)

Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

1994-01-01

Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

NARCIS (Netherlands)

Meijer, W.G; van den Bergh, E.R E; Smith, L.M

In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence

N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-09-01

Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

The Dimerization Domain in DapE Enzymes Is required for Catalysis

OpenAIRE

Nocek, Boguslaw; Starus, Anna; Makowska-Grzyska, Magdalena; Gutierrez, Blanca; Sanchez, Stephen; Jedrzejczak, Robert; Mack, Jamey C.; Olsen, Kenneth W.; Joachimiak, Andrzej; Holz, Richard C.

2014-01-01

The emergence of antibiotic-resistant bacterial strains underscores the importance of identifying new drug targets and developing new antimicrobial compounds. Lysine and meso-diaminopimelic acid are essential for protein production and bacterial peptidoglycan cell wall remodeling and are synthesized in bacteria by enzymes encoded within dap operon. Therefore dap enzymes may serve as excellent targets for developing a new class of antimicrobial agents. The dapE-encoded N-succinyl-L,L-diaminopi...

Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

Science.gov (United States)

Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

2016-01-01

Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

NARCIS (Netherlands)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

The post-transcriptional operon

DEFF Research Database (Denmark)

Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

2011-01-01

model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

OpenAIRE

Stewart, V; Yanofsky, C

1986-01-01

We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

Directory of Open Access Journals (Sweden)

Juliana Teixeira de Magalhães

2005-06-01

Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

Science.gov (United States)

2012-01-01

Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

Directory of Open Access Journals (Sweden)

Dharmesh Harwani

2014-12-01

Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

Science.gov (United States)

Harwani, Dharmesh

2014-01-01

Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

Assembly and multiple gene expression of thermophilic enzymes in Escherichia coli for in vitro metabolic engineering.

Science.gov (United States)

Ninh, Pham Huynh; Honda, Kohsuke; Sakai, Takaaki; Okano, Kenji; Ohtake, Hisao

2015-01-01

In vitro reconstitution of an artificial metabolic pathway is an emerging approach for the biocatalytic production of industrial chemicals. However, several enzymes have to be separately prepared (and purified) for the construction of an in vitro metabolic pathway, thereby limiting the practical applicability of this approach. In this study, genes encoding the nine thermophilic enzymes involved in a non-ATP-forming chimeric glycolytic pathway were assembled in an artificial operon and co-expressed in a single recombinant Escherichia coli strain. Gene expression levels of the thermophilic enzymes were controlled by their sequential order in the artificial operon. The specific activities of the recombinant enzymes in the cell-free extract of the multiple-gene-expression E. coli were 5.0-1,370 times higher than those in an enzyme cocktail prepared from a mixture of single-gene-expression strains, in each of which a single one of the nine thermophilic enzymes was overproduced. Heat treatment of a crude extract of the multiple-gene-expression cells led to the denaturation of indigenous proteins and one-step preparation of an in vitro synthetic pathway comprising only a limited number of thermotolerant enzymes. Coupling this in vitro pathway with other thermophilic enzymes including the H2 O-forming NADH oxidase or the malate/lactate dehydrogenase facilitated one-pot conversion of glucose to pyruvate or lactate, respectively. © 2014 Wiley Periodicals, Inc.

Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

Science.gov (United States)

Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

2016-01-01

Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

Directory of Open Access Journals (Sweden)

Catherine E Dana

Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

Induction of the Nitrate Assimilation nirA Operon and Protein-Protein Interactions in the Maturation of Nitrate and Nitrite Reductases in the Cyanobacterium Anabaena sp. Strain PCC 7120.

Science.gov (United States)

Frías, José E; Flores, Enrique

2015-07-01

Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria

UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

International Nuclear Information System (INIS)

Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

1994-01-01

UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

Cop-like operon: Structure and organization in species of the Lactobacillale order

Directory of Open Access Journals (Sweden)

ANGÉLICA REYES

2006-01-01

Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

Elucidation of Operon Structures across Closely Related Bacterial Genomes

Science.gov (United States)

Li, Guojun

2014-01-01

About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase.

Science.gov (United States)

Branny, P; de la Torre, F; Garel, J R

1998-04-01

The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.

Definition of a second Bacillus subtilis pur regulon comprising the pur and xpt-pbuX operons plus pbuG, nupG (yxjA), and pbuE (ydhL)

DEFF Research Database (Denmark)

Johansen, L.E.; Nygaard, P.; Lassen, C.

2003-01-01

In Bacillus subtilis expression of genes or operons encoding enzymes and other proteins involved in purine synthesis is affected by purine bases and nucleosides in the growth medium. The genes belonging to the PurR regulon (purR, purA, glyA, guaC, pbuO, pbuG, and the pur, yqhZ-folD, and xpt...

An Automated Pipeline for Engineering Many-Enzyme Pathways: Computational Sequence Design, Pathway Expression-Flux Mapping, and Scalable Pathway Optimization.

Science.gov (United States)

Halper, Sean M; Cetnar, Daniel P; Salis, Howard M

2018-01-01

Engineering many-enzyme metabolic pathways suffers from the design curse of dimensionality. There are an astronomical number of synonymous DNA sequence choices, though relatively few will express an evolutionary robust, maximally productive pathway without metabolic bottlenecks. To solve this challenge, we have developed an integrated, automated computational-experimental pipeline that identifies a pathway's optimal DNA sequence without high-throughput screening or many cycles of design-build-test. The first step applies our Operon Calculator algorithm to design a host-specific evolutionary robust bacterial operon sequence with maximally tunable enzyme expression levels. The second step applies our RBS Library Calculator algorithm to systematically vary enzyme expression levels with the smallest-sized library. After characterizing a small number of constructed pathway variants, measurements are supplied to our Pathway Map Calculator algorithm, which then parameterizes a kinetic metabolic model that ultimately predicts the pathway's optimal enzyme expression levels and DNA sequences. Altogether, our algorithms provide the ability to efficiently map the pathway's sequence-expression-activity space and predict DNA sequences with desired metabolic fluxes. Here, we provide a step-by-step guide to applying the Pathway Optimization Pipeline on a desired multi-enzyme pathway in a bacterial host.

Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

DEFF Research Database (Denmark)

Givskov, M; Eberl, L; Christiansen, Gunna

1995-01-01

When a liquid culture of Serratia spp. reaches the last part of the logarithmic phase of growth it induces the synthesis of several extracellular hydrolytic enzymes. In this communication we show that synthesis and secretion of the extracellular phospholipase is coupled to expression of flagella....... Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...

A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

Science.gov (United States)

Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

2014-01-01

The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

Science.gov (United States)

Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

2011-10-01

Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

Dynamic model of gene regulation for the lac operon

International Nuclear Information System (INIS)

Angelova, Maia; Ben-Halim, Asma

2011-01-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

Dynamic model of gene regulation for the lac operon

Energy Technology Data Exchange (ETDEWEB)

Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

2011-03-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

Science.gov (United States)

Goh, Yong Jun; Klaenhammer, Todd R

2013-01-01

Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

Science.gov (United States)

Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

2017-10-01

One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

Science.gov (United States)

Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

2016-09-01

The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

Prevalence of transcription promoters within archaeal operons and coding sequences.

Science.gov (United States)

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

Science.gov (United States)

Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

2015-03-01

The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

Science.gov (United States)

Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

2016-01-01

The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

Directory of Open Access Journals (Sweden)

Marasco Rosangela

2006-11-01

Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

Science.gov (United States)

Cortes, Teresa; Cox, Robert Ashley

2015-04-01

Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

DEFF Research Database (Denmark)

Danielsen, S; Kilstrup, M; Barilla, K

1992-01-01

. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

Science.gov (United States)

Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

2013-10-01

The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

DEFF Research Database (Denmark)

Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

2014-01-01

We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

Structural characterization of the Salmonella typhimurium LT2 umu operon

International Nuclear Information System (INIS)

Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

1990-01-01

The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

Directory of Open Access Journals (Sweden)

Jan Ewald

2015-04-01

Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

Directory of Open Access Journals (Sweden)

Sun Yuan

2006-02-01

Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

Science.gov (United States)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

2015-01-01

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

Decreases in average bacterial community rRNA operon copy number during succession.

Science.gov (United States)

Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

2016-05-01

Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

OpenAIRE

Riyanti, Eny Ida; Rogers, Peter L

2009-01-01

Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

Science.gov (United States)

Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

2014-10-01

Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

DEFF Research Database (Denmark)

Givskov, M; Eberl, L; Christiansen, Gunna

1995-01-01

. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

Science.gov (United States)

Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

2014-12-01

Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

Eucaryotic operon genes can define highly conserved syntenies

Czech Academy of Sciences Publication Activity Database

Trachtulec, Zdeněk

2004-01-01

Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

Science.gov (United States)

Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

2013-02-01

Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

Science.gov (United States)

Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

2015-02-01

Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

Directory of Open Access Journals (Sweden)

Qinna Cui

Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

Science.gov (United States)

Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

2015-07-07

Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

Science.gov (United States)

Kim, Moonjeong; Kim, Kwang-Sun

2017-07-06

The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

OpenAIRE

Chung, T; Resnik, E; Stueland, C; LaPorte, D C

1993-01-01

Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

Science.gov (United States)

Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

2016-01-01

The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy

Directory of Open Access Journals (Sweden)

Keyhani Nemat O

2004-06-01

Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered

The pvc operon regulates the expression of the Pseudomonas aeruginosa fimbrial chaperone/usher pathway (cup genes.

Directory of Open Access Journals (Sweden)

Uzma Qaisar

Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.

A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

OpenAIRE

Goh, Yong Jun; Klaenhammer, Todd R

2013-01-01

Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

Science.gov (United States)

Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

2003-01-01

Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

Science.gov (United States)

Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

2013-07-01

Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

Science.gov (United States)

Boyd, D A; Mulvey, M R

2013-02-01

To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

Sequence analysis of the Legionella micdadei groELS operon

DEFF Research Database (Denmark)

Hindersson, P; Høiby, N; Bangsborg, Jette Marie

1991-01-01

shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

Science.gov (United States)

Sahukhal, Gyan S; Elasri, Mohamed O

2014-06-11

Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Unknown

[Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization.

Science.gov (United States)

Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya

2015-01-01

Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

Characterization of the Leptospira interrogans S10-spc-alpha operon

NARCIS (Netherlands)

Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

2000-01-01

A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

Science.gov (United States)

Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

2014-01-01

Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

Regulation of the rhaEWRBMA Operon Involved in l-Rhamnose Catabolism through Two Transcriptional Factors, RhaR and CcpA, in Bacillus subtilis.

Science.gov (United States)

Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro

2015-12-28

The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological

Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

Science.gov (United States)

Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

2017-01-01

The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

Science.gov (United States)

Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

2017-01-01

The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

Directory of Open Access Journals (Sweden)

Arkin Adam P

2006-01-01

Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

Science.gov (United States)

Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

2015-11-17

rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

Science.gov (United States)

Dixit, R; Trivedi, P K; Nath, P; Sane, P V

1999-09-01

Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

Science.gov (United States)

Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

2016-01-01

An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

Science.gov (United States)

Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

2014-01-01

Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

Science.gov (United States)

Ray, Sujay; Banerjee, Arundhati

2015-10-01

Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

Science.gov (United States)

Pérez-Oseguera, Angeles; Cevallos, Miguel A

2013-11-01

Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

Directory of Open Access Journals (Sweden)

Terezinha Knöbl

2006-06-01

Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

International Nuclear Information System (INIS)

Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

1988-01-01

The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

Science.gov (United States)

Lin, J W; Lu, H C; Chen, H Y; Weng, S F

1997-10-09

Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

Science.gov (United States)

Chopra, Paras; Bender, Andreas

The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Winson, MK; Sternberg, C

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

Science.gov (United States)

Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

2018-01-01

Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

Science.gov (United States)

Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

2014-12-01

The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

Science.gov (United States)

Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

2012-07-15

Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

Dynamics and bistability in a reduced model of the lac operon

Science.gov (United States)

Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

2004-06-01

It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

Science.gov (United States)

Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

2014-09-01

Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

DEFF Research Database (Denmark)

Brøndsted, Lone; Atlung, Tove

1996-01-01

The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

Science.gov (United States)

Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

2015-05-01

Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

The dimerization domain in DapE enzymes is required for catalysis.

Directory of Open Access Journals (Sweden)

Boguslaw Nocek

Full Text Available The emergence of antibiotic-resistant bacterial strains underscores the importance of identifying new drug targets and developing new antimicrobial compounds. Lysine and meso-diaminopimelic acid are essential for protein production and bacterial peptidoglycan cell wall remodeling and are synthesized in bacteria by enzymes encoded within dap operon. Therefore dap enzymes may serve as excellent targets for developing a new class of antimicrobial agents. The dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE converts N-succinyl-L,L-diaminopimelic acid to L,L-diaminopimelic acid and succinate. The enzyme is composed of catalytic and dimerization domains, and belongs to the M20 peptidase family. To understand the specific role of each domain of the enzyme we engineered dimerization domain deletion mutants of DapEs from Haemophilus influenzae and Vibrio cholerae, and characterized these proteins structurally and biochemically. No activity was observed for all deletion mutants. Structural comparisons of wild-type, inactive monomeric DapE enzymes with other M20 peptidases suggest that the dimerization domain is essential for DapE enzymatic activity. Structural analysis and molecular dynamics simulations indicate that removal of the dimerization domain increased the flexibility of a conserved active site loop that may provide critical interactions with the substrate.

The dimerization domain in DapE enzymes is required for catalysis.

Science.gov (United States)

Nocek, Boguslaw; Starus, Anna; Makowska-Grzyska, Magdalena; Gutierrez, Blanca; Sanchez, Stephen; Jedrzejczak, Robert; Mack, Jamey C; Olsen, Kenneth W; Joachimiak, Andrzej; Holz, Richard C

2014-01-01

The emergence of antibiotic-resistant bacterial strains underscores the importance of identifying new drug targets and developing new antimicrobial compounds. Lysine and meso-diaminopimelic acid are essential for protein production and bacterial peptidoglycan cell wall remodeling and are synthesized in bacteria by enzymes encoded within dap operon. Therefore dap enzymes may serve as excellent targets for developing a new class of antimicrobial agents. The dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) converts N-succinyl-L,L-diaminopimelic acid to L,L-diaminopimelic acid and succinate. The enzyme is composed of catalytic and dimerization domains, and belongs to the M20 peptidase family. To understand the specific role of each domain of the enzyme we engineered dimerization domain deletion mutants of DapEs from Haemophilus influenzae and Vibrio cholerae, and characterized these proteins structurally and biochemically. No activity was observed for all deletion mutants. Structural comparisons of wild-type, inactive monomeric DapE enzymes with other M20 peptidases suggest that the dimerization domain is essential for DapE enzymatic activity. Structural analysis and molecular dynamics simulations indicate that removal of the dimerization domain increased the flexibility of a conserved active site loop that may provide critical interactions with the substrate.

Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

DEFF Research Database (Denmark)

Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

2015-01-01

encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

High levels of bioplastic are produced in fertile transplastomic tobacco plants engineered with a synthetic operon for the production of polyhydroxybutyrate.

Science.gov (United States)

Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D

2011-04-01

An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.

HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid.

Science.gov (United States)

Roy, Ajit; Ranjan, Akash

2016-02-23

Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

International Nuclear Information System (INIS)

Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

2007-01-01

The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

2015-01-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

2015-09-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

The effect of stochasticity on the lac operon: an evolutionary perspective.

Directory of Open Access Journals (Sweden)

Milan van Hoek

2007-06-01

Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

OpenAIRE

Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

1993-01-01

CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways.

Science.gov (United States)

Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A

2017-11-01

The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and

Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

Science.gov (United States)

Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

2015-10-23

The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

Science.gov (United States)

Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

2017-05-01

Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Winson, MK; Sternberg, C

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

Science.gov (United States)

Kim, Dae Hun; Ko, Kwan Soo

2015-07-01

To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

Directory of Open Access Journals (Sweden)

Hiraku Takada

Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

DEFF Research Database (Denmark)

Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

2008-01-01

The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

Science.gov (United States)

Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

2017-05-05

Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

Directory of Open Access Journals (Sweden)

T Sabari Sankar

2009-03-01

Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

Science.gov (United States)

Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

2015-11-01

Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Christiansen, Gunna; Molin, S

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

Directory of Open Access Journals (Sweden)

Potrich D.P.

2001-01-01

Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.

Science.gov (United States)

Deaner, Matthew; Holzman, Allison; Alper, Hal S

2018-04-16

Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

Czech Academy of Sciences Publication Activity Database

Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

2007-01-01

Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

High Levels of Bioplastic Are Produced in Fertile Transplastomic Tobacco Plants Engineered with a Synthetic Operon for the Production of Polyhydroxybutyrate1[C][OA

Science.gov (United States)

Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P.; Snell, Kristi D.

2011-01-01

An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5′ end by the host plant’s psbA coding sequence and at the 3′ end by the host plant’s 3′ psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated. PMID:21325565

Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

Science.gov (United States)

Osipiuk, J; Joachimiak, A

1997-09-12

We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

Science.gov (United States)

de Oliveira, Rafael R; Nicholson, Wayne L

2016-01-01

To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

Science.gov (United States)

Stefanski, Katherine M.

A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

Rapid identification of sequences for orphan enzymes to power accurate protein annotation.

Directory of Open Access Journals (Sweden)

Kevin R Ramkissoon

Full Text Available The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the "back catalog" of enzymology--"orphan enzymes," those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC database alone. In this study, we demonstrate how this orphan enzyme "back catalog" is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology's "back catalog" another powerful tool to drive accurate genome annotation.

Rapid Identification of Sequences for Orphan Enzymes to Power Accurate Protein Annotation

Science.gov (United States)

Ojha, Sunil; Watson, Douglas S.; Bomar, Martha G.; Galande, Amit K.; Shearer, Alexander G.

2013-01-01

The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the “back catalog” of enzymology – “orphan enzymes,” those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC) database alone. In this study, we demonstrate how this orphan enzyme “back catalog” is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis) to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology’s “back catalog” another powerful tool to drive accurate genome annotation. PMID:24386392

Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

Science.gov (United States)

Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

2013-11-01

Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

Science.gov (United States)

Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

2001-01-01

Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

Science.gov (United States)

Tadmor, Arbel

2009-03-01

In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

CysB-dependent upregulation of the Salmonella Typhimurium cysJIH operon in response to antimicrobial compounds that induce oxidative stress.

Science.gov (United States)

Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando

2015-02-27

It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.

An ArsR/SmtB family member is involved in the regulation by arsenic of the arsenite oxidase operon in Thiomonas arsenitoxydans.

Science.gov (United States)

Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine

2014-10-01

The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

Science.gov (United States)

Ghosh, Semanti; Bagchi, Angshuman

2015-12-01

Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

Homology models guide discovery of diverse enzyme specificities among dipeptide epimerases in the enolase superfamily

Science.gov (United States)

Lukk, Tiit; Sakai, Ayano; Kalyanaraman, Chakrapani; Brown, Shoshana D.; Imker, Heidi J.; Song, Ling; Fedorov, Alexander A.; Fedorov, Elena V.; Toro, Rafael; Hillerich, Brandan; Seidel, Ronald; Patskovsky, Yury; Vetting, Matthew W.; Nair, Satish K.; Babbitt, Patricia C.; Almo, Steven C.; Gerlt, John A.; Jacobson, Matthew P.

2012-01-01

The rapid advance in genome sequencing presents substantial challenges for protein functional assignment, with half or more of new protein sequences inferred from these genomes having uncertain assignments. The assignment of enzyme function in functionally diverse superfamilies represents a particular challenge, which we address through a combination of computational predictions, enzymology, and structural biology. Here we describe the results of a focused investigation of a group of enzymes in the enolase superfamily that are involved in epimerizing dipeptides. The first members of this group to be functionally characterized were Ala-Glu epimerases in Eschericiha coli and Bacillus subtilis, based on the operon context and enzymological studies; these enzymes are presumed to be involved in peptidoglycan recycling. We have subsequently studied more than 65 related enzymes by computational methods, including homology modeling and metabolite docking, which suggested that many would have divergent specificities;, i.e., they are likely to have different (unknown) biological roles. In addition to the Ala-Phe epimerase specificity reported previously, we describe the prediction and experimental verification of: (i) a new group of presumed Ala-Glu epimerases; (ii) several enzymes with specificity for hydrophobic dipeptides, including one from Cytophaga hutchinsonii that epimerizes D-Ala-D-Ala; and (iii) a small group of enzymes that epimerize cationic dipeptides. Crystal structures for certain of these enzymes further elucidate the structural basis of the specificities. The results highlight the potential of computational methods to guide experimental characterization of enzymes in an automated, large-scale fashion. PMID:22392983

Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

Science.gov (United States)

Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

2017-11-01

Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Science.gov (United States)

Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

2017-01-01

Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Directory of Open Access Journals (Sweden)

Kathleen Jwanoswki

Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

Science.gov (United States)

Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

2015-01-01

Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

Degs and degu operon from Bacillus-brevis: a combination that enhances the production of commercially valuable enzymes

CSIR Research Space (South Africa)

Louw, M

1995-05-01

Full Text Available A novel method has been developed for increasing the production of commercially valuable enzymes, such as proteases, beta-glucanases, alpha-amylases and levansucrase. It is dependent on two genes cloned from Bacillus brevis, expressed on a multicopy...

Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

Science.gov (United States)

da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

2017-07-01

One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

NARCIS (Netherlands)

Nouwen, N; Driessen, AJM

2005-01-01

Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

Science.gov (United States)

Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

2010-07-01

Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

A phospho-sugar binding domain homologous to NagB enzymes regulates the activity of the central glycolytic genes repressor.

Science.gov (United States)

Doan, Thierry; Martin, Laetitia; Zorrilla, Silvia; Chaix, Denis; Aymerich, Stéphane; Labesse, Gilles; Declerck, Nathalie

2008-06-01

CggR belongs to the SorC family of bacterial transcriptional regulators which control the expression of genes and operons involved in carbohydrate catabolism. CggR was first identified in Bacillus subtilis where it represses the gapA operon encoding the five enzymes that catalyze the central part of glycolysis. Here we present a structure/function study demonstrating that the C-terminal region of CggR regulates the DNA binding activity of this repressor in response to binding of a phosphorylated sugar. Molecular modeling of CggR revealed a winged-helix DNA-binding motif followed by a C-terminal domain presenting weak but significant homology with glucosamine-6-phosphate deaminases from the NagB family. In silico ligand screening suggested that the CggR C-terminal domain would bind preferentially bi-phosphorylated compounds, in agreement with previous studies that proposed fructuose-1,6-biphosphate (FBP) as the inducer metabolite. In vitro, FBP was the only sugar compound capable of interfering with CggR cooperative binding to DNA. FBP was also found to protect CggR against trypsin degradation at two arginine residues predicted to reside in a mobile loop forming the active site lid of the NagB enzymes. Replacement of residues predicted to interact with FBP led to mutant CggR with altered repressor activity in vivo but retaining their structural integrity and DNA binding activity in vitro. Interestingly, some of the mutant repressors responded with different specificity towards mono- and di-phospho-fructosides. Based on these results, we propose that the activity of the CggR-like repressors is controlled by a phospho-sugar binding (PSB) domain presenting structural and functional homology with NagB enzymes. (c) 2008 Wiley-Liss, Inc.

Structure of Escherichia coli RutC, a member of the YjgF family and putative aminoacrylate peracid reductase of the rut operon

International Nuclear Information System (INIS)

Knapik, Aleksandra Alicja; Petkowski, Janusz Jurand; Otwinowski, Zbyszek; Cymborowski, Marcin Tadeusz; Cooper, David Robert; Chruszcz, Maksymilian; Krajewska, Wanda Małgorzata; Minor, Wladek

2012-01-01

The structure of the putative aminoacrylate peracid reductase RutC of the rut operon, a member of the YjgF family, is reported. RutC is the third enzyme in the Escherichia coli rut pathway of uracil degradation. RutC belongs to the highly conserved YjgF family of proteins. The structure of the RutC protein was determined and refined to 1.95 Å resolution. The crystal belonged to space group P2 1 2 1 2 and contained six molecules in the asymmetric unit. The structure was solved by SAD phasing and was refined to an R work of 19.3% (R free = 21.7%). The final model revealed that this protein has a Bacillus chorismate mutase-like fold and forms a homotrimer with a hydrophobic cavity in the center of the structure and ligand-binding clefts between two subunits. A likely function for RutC is the reduction of peroxy-aminoacrylate to aminoacrylate as a part of a detoxification process

Salmonella enterica Typhimurium fljBA operon stability: implications regarding the origin of Salmonella enterica I 4,[5],12:i:.

Science.gov (United States)

Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M

2015-12-29

Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.

Molecular evidence for the coordination of nitrogen and carbon metabolisms, revealed by a study on the transcriptional regulation of the agl3EFG operon that encodes a putative carbohydrate transporter in Streptomyces coelicolor.

Science.gov (United States)

Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin

2016-03-18

In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.

Deletion of the budBAC operon in Klebsiella pneumoniae to understand the physiological role of 2,3-butanediol biosynthesis.

Science.gov (United States)

Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon

2016-05-18

Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.

Functional characterization of a cadmium resistance operon in Staphylococcus aureus ATCC12600: CadC does not function as a repressor.

Science.gov (United States)

Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander

2015-02-01

Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

Science.gov (United States)

Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

2018-01-22

Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

Directory of Open Access Journals (Sweden)

Johanna Rintahaka

Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we

Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

Science.gov (United States)

Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

2014-01-01

A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

NARCIS (Netherlands)

Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

2005-01-01

Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

Prediction of DtxR regulon: Identification of binding sites and operons controlled by Diphtheria toxin repressor in Corynebacterium diphtheriae

Directory of Open Access Journals (Sweden)

Hasnain Seyed

2004-09-01

Full Text Available Abstract Background The diphtheria toxin repressor, DtxR, of Corynebacterium diphtheriae has been shown to be an iron-activated transcription regulator that controls not only the expression of diphtheria toxin but also of iron uptake genes. This study aims to identify putative binding sites and operons controlled by DtxR to understand the role of DtxR in patho-physiology of Corynebacterium diphtheriae. Result Positional Shannon relative entropy method was used to build the DtxR-binding site recognition profile and the later was used to identify putative regulatory sites of DtxR within C. diphtheriae genome. In addition, DtxR-regulated operons were also identified taking into account the predicted DtxR regulatory sites and genome annotation. Few of the predicted motifs were experimentally validated by electrophoretic mobility shift assay. The analysis identifies motifs upstream to the novel iron-regulated genes that code for Formamidopyrimidine-DNA glycosylase (FpG, an enzyme involved in DNA-repair and starvation inducible DNA-binding protein (Dps which is involved in iron storage and oxidative stress defense. In addition, we have found the DtxR motifs upstream to the genes that code for sortase which catalyzes anchoring of host-interacting proteins to the cell wall of pathogenic bacteria and the proteins of secretory system which could be involved in translocation of various iron-regulated virulence factors including diphtheria toxin. Conclusions We have used an in silico approach to identify the putative binding sites and genes controlled by DtxR in Corynebacterium diphtheriae. Our analysis shows that DtxR could provide a molecular link between Fe+2-induced Fenton's reaction and protection of DNA from oxidative damage. DtxR-regulated Dps prevents lethal combination of Fe+2 and H2O2 and also protects DNA by nonspecific DNA-binding. In addition DtxR could play an important role in host interaction and virulence by regulating the levels of sortase

Expression of the N2 fixation gene operon of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21.

Science.gov (United States)

Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng

2015-10-01

To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.

RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.

Science.gov (United States)

Lei, Mei G; Lee, Chia Y

2015-12-01

Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation

Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

Directory of Open Access Journals (Sweden)

Cataldi Angel A

2011-07-01

Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

Directory of Open Access Journals (Sweden)

Alexander William Eastman

2015-01-01

Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

Awakening sleeping beauty: production of propionic acid in Escherichia coli through the sbm operon requires the activity of a methylmalonyl-CoA epimerase.

Science.gov (United States)

Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban

2017-07-17

Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway

Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

Science.gov (United States)

Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

2016-11-08

Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133

Science.gov (United States)

2011-01-01

Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to

Genome analysis of the freshwater planktonic Vulcanococcus limneticus sp. nov. reveals horizontal transfer of nitrogenase operon and alternative pathways of nitrogen utilization.

Science.gov (United States)

Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana

2018-04-16

Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for

Identification and functional analysis of the L-ascorbate-specific enzyme II complex of the phosphotransferase system in Streptococcus mutans.

Science.gov (United States)

Wu, Xinyu; Hou, Jin; Chen, Xiaodan; Chen, Xuan; Zhao, Wanghong

2016-03-22

Streptococcus mutans is the primary etiological agent of human dental caries. It can metabolize a wide variety of carbohydrates and produce large amounts of organic acids that cause enamel demineralization. Phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS) plays an important role in carbohydrates uptake of S. mutans. The ptxA and ptxB genes in S. mutans encode putative enzyme IIA and enzyme IIB of the L-ascorbate-specific PTS. The aim of this study was to analyze the function of these proteins and understand the transcriptional regulatory mechanism. ptxA (-), ptxB (-), as well as ptxA (-) , ptxB (-) double-deletion mutants all had more extended lag phase and lower growth yield than wild-type strain UA159 when grown in the medium using L-ascorbate as the sole carbon source. Acid production and acid killing assays showed that the absence of the ptxA and ptxB genes resulted in a reduction in the capacity for acidogenesis, and all three mutant strains did not survive an acid shock. According to biofilm and extracellular polysaccharides (EPS) formation analysis, all the mutant strains formed much less prolific biofilms with small amounts of EPS than wild-type UA159 when using L-ascorbate as the sole carbon source. Moreover, PCR analysis and quantitative real-time PCR revealed that sgaT, ptxA, ptxB, SMU.273, SMU.274 and SMU.275 appear to be parts of the same operon. The transcription levels of these genes were all elevated in the presence of L-ascorbate, and the expression of ptxA gene decreased significantly once ptxB gene was knockout. The ptxA and ptxB genes are involved in the growth, aciduricity, acidogenesis, and formation of biofilms and EPS of S. mutans when L-ascorbate is the sole carbon source. In addition, the expression of ptxA is regulated by ptxB. ptxA, ptxB, and the upstream gene sgaT, the downstream genes SMU.273, SMU.274 and SMU.275 appear to be parts of the same operon, and L-ascorbate is a potential inducer of the operon.

Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

Directory of Open Access Journals (Sweden)

Astha Agarwal

2013-01-01

Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

The conserved nhaAR operon is drastically divergent between B2 and non-B2 Escherichia coli and is involved in extra-intestinal virulence.

Science.gov (United States)

Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier

2014-01-01

The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.

Fitness Effects of Network Non-Linearity Induced by Gene Expression Noise

Science.gov (United States)

Ray, Christian; Cooper, Tim; Balazsi, Gabor

2012-02-01

In the non-equilibrium dynamics of growing microbial cells, metabolic enzymes can create non-linearities in metabolite concentration because of non-linear degradation (utilization): an enzyme can saturate in the process of metabolite utilization. Increasing metabolite production past the saturation point then results in an ultrasensitive metabolite response. If the production rate of a metabolite depends on a second enzyme or other protein-mediated process, uncorrelated gene expression noise can thus cause transient metabolite concentration bursts. Such bursts are physiologically unnecessary and may represent a source of selection against the ultrasensitive switch, especially if the fluctuating metabolic intermediate is toxic. Selection may therefore favor correlated gene expression fluctuations for enzymes in the same pathway, such as by same-operon membership in bacteria. Using a modified experimental lac operon system, we are undertaking a combined theoretical-experimental approach to demonstrate that (i) the lac operon has an implicit ultrasensitive switch that we predict is avoided by gene expression correlations induced by same-operon membership; (ii) bacterial growth rates are sensitive to crossing the ultrasensitive threshold. Our results suggest that correlations in intrinsic gene expression noise are exploited by evolution to ameliorate the detrimental effects of nonlinearities in metabolite concentrations.

The antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 prevents premature expression of the flv4-2 operon upon shift in inorganic carbon supply.

Science.gov (United States)

Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari

2012-09-28

The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.

The Antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 Prevents Premature Expression of the flv4-2 Operon upon Shift in Inorganic Carbon Supply*

Science.gov (United States)

Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari

2012-01-01

The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Science.gov (United States)

Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin

2013-01-01

The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

Science.gov (United States)

Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

2012-05-01

The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

Science.gov (United States)

Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

2016-05-01

Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

NARCIS (Netherlands)

Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

2016-01-01

The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

DEFF Research Database (Denmark)

Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

2005-01-01

Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...

The TorR High-Affinity Binding Site Plays a Key Role in Both torR Autoregulation and torCAD Operon Expression in Escherichia coli

OpenAIRE

Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent

2000-01-01

In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...

Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

Czech Academy of Sciences Publication Activity Database

Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav

2015-01-01

Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

Purification and crystallization of Phd, the antitoxin of the phd/doc operon

International Nuclear Information System (INIS)

Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy

2010-01-01

The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

Science.gov (United States)

Khun, H H; Deved, V; Wong, H; Lee, B C

2000-12-01

The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA

DEFF Research Database (Denmark)

Poulsen, Peter; Jensen, Kaj Frank

1992-01-01

We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...

Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

Directory of Open Access Journals (Sweden)

Mariana Noelia Viale

2014-01-01

Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.

Science.gov (United States)

Marincola, Gabriella; Wolz, Christiane

2017-06-02

In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

Directory of Open Access Journals (Sweden)

Orlando Díaz-Hernández

2010-07-01

Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

Science.gov (United States)

Díaz-Hernández, Orlando; Santillán, Moisés

2010-01-01

In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon

Science.gov (United States)

Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.

2008-12-01

Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.

Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

OpenAIRE

Burbank, Lindsey P.; Van Horn, Christopher R.

2017-01-01

The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

Legionella dumoffii Tex-KL Mutated in an Operon Homologous to traC-traD is Defective in Epithelial Cell Invasion.

Science.gov (United States)

Qin, Tian; Ken-Ichiro, Iida; Ren, Hong Yu; Zhou, Hai Jian; Yoshida, Shin-Ichi

2016-06-01

To understand the mechanism of invasion by Legionella dumoffii. The L. dumoffii strain Tex-KL was mutated using the Tn903 derivative, Tn903dIIlacZ. After screening 799 transposon insertion mutants, we isolated one defective mutant. We then constructed the gene-disrupted mutant, KL16, and studied its invasion of and intracellular growth in HeLa and A549 cells, and in A/J mice survival experiments. The structure of traC-traD operon was analyzed by RT-PCR. The transposon insertion was in a gene homologous to Salmonella typhi traC, which is required for the assembly of F pilin into the mature F pilus structure and for conjugal DNA transmission. Results from RT-PCR suggested that the traC-traD region formed an operon. We found that when the traC gene was disrupted, invasion and intracellular growth of L. dumoffii Tex-KL were impaired in human epithelial cells. When mice were infected by intranasal inoculation with a traC deficient mutant, their survival significantly increased when compared to mice infected with the wild-type strain.. Our results indicated that the traC-traD operon is required for the invasion and intracellular growth abilities of L. dumoffii Tex-KL in epithelial cells. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

Science.gov (United States)

Rajagopalan, Ramya; Kroos, Lee

2017-05-15

Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans

Science.gov (United States)

Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.

2015-01-01

ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans.

Science.gov (United States)

Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G

2015-08-01

In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop

Carotenoid biosynthesis in bacteria: In vitro studies of a crt/bch transcription factor from Rhodobacter capsulatus and carotenoid enzymes from Erwinia herbicola

Energy Technology Data Exchange (ETDEWEB)

O' Brien, D.A.

1992-11-01

A putative transcription factor in Rhodobactor capsulatus which binds upstream of the crt and bch pigment biosynthesis operons and appears to play a role in the adaptation of the organism from the aerobic to the anaerobic-photosynthetic growth mode was characterized. Chapter 2 describes the identification of this factor through an in vitro mobility shift assay, as well as the determination of its binding properties and sequence specificity. Chapter 3 focuses on the isolation of this factor. Biochemistry of later carotenoid biosynthesis enzymes derived from the non-photosynthetic bacterium, Erwinia herbicola. Chapter 4 describes the separate overexpression and in vitro analysis of two enzymes involved in the main sequence of the carotenoid biosynthesis pathway, lycopene cyclase and 5-carotene hydroxylase. Chapter 5 examines the overexpression and enzymology of functionally active zeaxanthin glucosyltransferase, an enzyme which carries out a more unusual transformation, converting a carotenoid into its more hydrophilic mono- and diglucoside derivatives. In addition, amino acid homology with other glucosyltransferases suggests a putative binding site for the UDP-activated glucose substrate.

Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

DEFF Research Database (Denmark)

Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

2011-01-01

Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

Biofilm plasmids with a rhamnose operon are widely distributed determinants of the 'swim-or-stick' lifestyle in roseobacters.

Science.gov (United States)

Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn

2016-10-01

Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.

The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

Science.gov (United States)

Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

2014-01-01

The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

BrEPS: a flexible and automatic protocol to compute enzyme-specific sequence profiles for functional annotation

Directory of Open Access Journals (Sweden)

Schomburg D

2010-12-01

Full Text Available Abstract Background Models for the simulation of metabolic networks require the accurate prediction of enzyme function. Based on a genomic sequence, enzymatic functions of gene products are today mainly predicted by sequence database searching and operon analysis. Other methods can support these techniques: We have developed an automatic method "BrEPS" that creates highly specific sequence patterns for the functional annotation of enzymes. Results The enzymes in the UniprotKB are identified and their sequences compared against each other with BLAST. The enzymes are then clustered into a number of trees, where each tree node is associated with a set of EC-numbers. The enzyme sequences in the tree nodes are aligned with ClustalW. The conserved columns of the resulting multiple alignments are used to construct sequence patterns. In the last step, we verify the quality of the patterns by computing their specificity. Patterns with low specificity are omitted and recomputed further down in the tree. The final high-quality patterns can be used for functional annotation. We ran our protocol on a recent Swiss-Prot release and show statistics, as well as a comparison to PRIAM, a probabilistic method that is also specialized on the functional annotation of enzymes. We determine the amount of true positive annotations for five common microorganisms with data from BRENDA and AMENDA serving as standard of truth. BrEPS is almost on par with PRIAM, a fact which we discuss in the context of five manually investigated cases. Conclusions Our protocol computes highly specific sequence patterns that can be used to support the functional annotation of enzymes. The main advantages of our method are that it is automatic and unsupervised, and quite fast once the patterns are evaluated. The results show that BrEPS can be a valuable addition to the reconstruction of metabolic networks.

The MetaCyc database of metabolic pathways and enzymes and the BioCyc collection of pathway/genome databases

Science.gov (United States)

Caspi, Ron; Altman, Tomer; Dale, Joseph M.; Dreher, Kate; Fulcher, Carol A.; Gilham, Fred; Kaipa, Pallavi; Karthikeyan, Athikkattuvalasu S.; Kothari, Anamika; Krummenacker, Markus; Latendresse, Mario; Mueller, Lukas A.; Paley, Suzanne; Popescu, Liviu; Pujar, Anuradha; Shearer, Alexander G.; Zhang, Peifen; Karp, Peter D.

2010-01-01

The MetaCyc database (MetaCyc.org) is a comprehensive and freely accessible resource for metabolic pathways and enzymes from all domains of life. The pathways in MetaCyc are experimentally determined, small-molecule metabolic pathways and are curated from the primary scientific literature. With more than 1400 pathways, MetaCyc is the largest collection of metabolic pathways currently available. Pathways reactions are linked to one or more well-characterized enzymes, and both pathways and enzymes are annotated with reviews, evidence codes, and literature citations. BioCyc (BioCyc.org) is a collection of more than 500 organism-specific Pathway/Genome Databases (PGDBs). Each BioCyc PGDB contains the full genome and predicted metabolic network of one organism. The network, which is predicted by the Pathway Tools software using MetaCyc as a reference, consists of metabolites, enzymes, reactions and metabolic pathways. BioCyc PGDBs also contain additional features, such as predicted operons, transport systems, and pathway hole-fillers. The BioCyc Web site offers several tools for the analysis of the PGDBs, including Omics Viewers that enable visualization of omics datasets on two different genome-scale diagrams and tools for comparative analysis. The BioCyc PGDBs generated by SRI are offered for adoption by any party interested in curation of metabolic, regulatory, and genome-related information about an organism. PMID:19850718

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression

Directory of Open Access Journals (Sweden)

Ziqing eDeng

2013-07-01

Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Treponema pallidum 3-Phosphoglycerate Mutase Is a Heat-Labile Enzyme That May Limit the Maximum Growth Temperature for the Spirochete

Science.gov (United States)

Benoit, Stéphane; Posey, James E.; Chenoweth, Matthew R.; Gherardini, Frank C.

2001-01-01

In the causative agent of syphilis, Treponema pallidum, the gene encoding 3-phosphoglycerate mutase, gpm, is part of a six-gene operon (tro operon) that is regulated by the Mn-dependent repressor TroR. Since substrate-level phosphorylation via the Embden-Meyerhof pathway is the principal way to generate ATP in T. pallidum and Gpm is a key enzyme in this pathway, Mn could exert a regulatory effect on central metabolism in this bacterium. To study this, T. pallidum gpm was cloned, Gpm was purified from Escherichia coli, and antiserum against the recombinant protein was raised. Immunoblots indicated that Gpm was expressed in freshly extracted infective T. pallidum. Enzyme assays indicated that Gpm did not require Mn2+ while 2,3-diphosphoglycerate (DPG) was required for maximum activity. Consistent with these observations, Mn did not copurify with Gpm. The purified Gpm was stable for more than 4 h at 25°C, retained only 50% activity after incubation for 20 min at 34°C or 10 min at 37°C, and was completely inactive after 10 min at 42°C. The temperature effect was attenuated when 1 mM DPG was added to the assay mixture. The recombinant Gpm from pSLB2 complemented E. coli strain PL225 (gpm) and restored growth on minimal glucose medium in a temperature-dependent manner. Increasing the temperature of cultures of E. coli PL225 harboring pSLB2 from 34 to 42°C resulted in a 7- to 11-h period in which no growth occurred (compared to wild-type E. coli). These data suggest that biochemical properties of Gpm could be one contributing factor to the heat sensitivity of T. pallidum. PMID:11466272

Analysis of the multimer resolution system encoded by the parCBA operon of broad-host-range plasmid RP4

DEFF Research Database (Denmark)

Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian

1994-01-01

specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...

Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

Science.gov (United States)

Cao, Xin; Song, Yongli; Zhang, Tonghua

In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

Science.gov (United States)

Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

2000-10-01

Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

Mutation of a Broadly Conserved Operon (RL3499-RL3502) from Rhizobium leguminosarum Biovar viciae Causes Defects in Cell Morphology and Envelope Integrity▿†

Science.gov (United States)

Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.

2011-01-01

The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485

UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon

International Nuclear Information System (INIS)

Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.

1988-01-01

Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs

recA mediated spontaneous deletions of the icaADBC operon of clinical Staphylococcus epidermidis isolates : a new mechanism of phenotypic variations

NARCIS (Netherlands)

Nuryastuti, Titik; van der Mei, Henny C.; Busscher, Henk J.; Kuijer, Roel; Aman, Abu T.; Krom, Bastiaan P.

Phenotypic variation of Staphylococcus epidermidis involving the slime related ica operon results in heterogeneity in surface characteristics of individual bacteria in axenic cultures. Five clinical S. epidermidis isolates demonstrated phenotypic variation, i.e. both black and red colonies on Congo

Role of the Escherichia coli glnALG operon in regulation of ammonium transport

International Nuclear Information System (INIS)

Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.

1986-01-01

Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt

Proteomic pleiotropy of OpgGH, an operon necessary for efficient growth of Salmonella enterica serovar Typhimurium under low-osmotic conditions

Science.gov (United States)

Salmonella enterica, a bacterial, food-borne pathogen of humans, can contaminate raw fruits and vegetables. Causing much public concern, the bacteria can survive in water used to wash produce. The ability to survive the low-osmolarity of the wash waters is attributed to the OpgGH operon that leads...

Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis.

Science.gov (United States)

Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan

2014-11-01

The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.

Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols

Science.gov (United States)

Archana, G.; Naresh Kumar, G.

2014-01-01

Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024

Pseudomonas fluorescens ATCC 13525 containing an artificial oxalate operon and Vitreoscilla hemoglobin secretes oxalic acid and solubilizes rock phosphate in acidic alfisols.

Directory of Open Access Journals (Sweden)

Kavita Yadav

Full Text Available Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah, Fomitopsis plaustris oxalate transporter (FpOAR and Vitreoscilla hemoglobin (vgb in various combinations. Pf (pKCN2 transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4 secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2 transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2 containing artificial oxalate operon (plac-FpOAR-oah and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil.

Dissecting the Photoprotective Mechanism Encoded by the flv4-2 Operon: a Distinct Contribution of Sll0218 in Photosystem II Stabilization.

Science.gov (United States)

Bersanini, Luca; Allahverdiyeva, Yagut; Battchikova, Natalia; Heinz, Steffen; Lespinasse, Maija; Ruohisto, Essi; Mustila, Henna; Nickelsen, Jörg; Vass, Imre; Aro, Eva-Mari

2017-03-01

In Synechocystis sp. PCC 6803, the flv4-2 operon encodes the flavodiiron proteins Flv2 and Flv4 together with a small protein, Sll0218, providing photoprotection for Photosystem II (PSII). Here, the distinct roles of Flv2/Flv4 and Sll0218 were addressed, using a number of flv4-2 operon mutants. In the ∆sll0218 mutant, the presence of Flv2/Flv4 rescued PSII functionality as compared with ∆sll0218-flv2, where neither Sll0218 nor the Flv2/Flv4 heterodimer are expressed. Nevertheless, both the ∆sll0218 and ∆sll0218-flv2 mutants demonstrated deficiency in accumulation of PSII proteins suggesting a role for Sll0218 in PSII stabilization, which was further supported by photoinhibition experiments. Moreover, the accumulation of PSII assembly intermediates occurred in Sll0218-lacking mutants. The YFP-tagged Sll0218 protein localized in a few spots per cell at the external side of the thylakoid membrane, and biochemical membrane fractionation revealed clear enrichment of Sll0218 in the PratA-defined membranes, where the early biogenesis steps of PSII occur. Further, the characteristic antenna uncoupling feature of the ∆flv4-2 operon mutants is shown to be related to PSII destabilization in the absence of Sll0218. It is concluded that the Flv2/Flv4 heterodimer supports PSII functionality, while the Sll0218 protein assists PSII assembly and stabilization, including optimization of light harvesting. © 2016 The Authors. Plant, Cell & Enviroment Published by John Wiley & Sons Ltd.

Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

Science.gov (United States)

Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

2015-08-18

Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis

OpenAIRE

Ahn, Sang-Joon; Burne, Robert A.

2006-01-01

The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...

Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

Directory of Open Access Journals (Sweden)

Silvia Dossena

2013-12-01

Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

Directory of Open Access Journals (Sweden)

Altenbuchner Josef

2011-10-01

Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

Structural insights into RipC, a putative citrate lyase β subunit from a Yersinia pestis virulence operon

International Nuclear Information System (INIS)

Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.

2011-01-01

Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein

Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

Science.gov (United States)

Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

2006-03-01

Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

The Small Protein HemP Is a Transcriptional Activator for the Hemin Uptake Operon in Burkholderia multivorans ATCC 17616.

Science.gov (United States)

Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka

2017-08-15

Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the

Discovery of new enzymes and metabolic pathways using structure and genome context

Science.gov (United States)

Zhao, Suwen; Kumar, Ritesh; Sakai, Ayano; Vetting, Matthew W.; Wood, B. McKay; Brown, Shoshana; Bonanno, Jeffery B.; Hillerich, Brandan S.; Seidel, Ronald D.; Babbitt, Patricia C.; Almo, Steven C.; Sweedler, Jonathan V.; Gerlt, John A.; Cronan, John E.; Jacobson, Matthew P.

2014-01-01

Assigning valid functions to proteins identified in genome projects is challenging, with over-prediction and database annotation errors major concerns1. We, and others2, are developing computation-guided strategies for functional discovery using “metabolite docking” to experimentally derived3 or homology-based4 three-dimensional structures. Bacterial metabolic pathways often are encoded by “genome neighborhoods” (gene clusters and/or operons), which can provide important clues for functional assignment. We recently demonstrated the synergy of docking and pathway context by “predicting” the intermediates in the glycolytic pathway in E. coli5. Metabolite docking to multiple binding proteins/enzymes in the same pathway increases the reliability of in silico predictions of substrate specificities because the pathway intermediates are structurally similar. We report that structure-guided approaches for predicting the substrate specificities of several enzymes encoded by a bacterial gene cluster allowed i) the correct prediction of the in vitro activity of a structurally characterized enzyme of unknown function (PDB 2PMQ), 2-epimerization of trans-4-hydroxy-L-proline betaine (tHyp-B) and cis-4-hydroxy-D-proline betaine (cHyp-B), and ii) the correct identification of the catabolic pathway in which Hyp-B 2-epimerase participates. The substrate-liganded pose predicted by virtual library screening (docking) was confirmed experimentally. The enzymatic activities in the predicted pathway were confirmed by in vitro assays and genetic analyses; the intermediates were identified by metabolomics; and repression of the genes encoding the pathway by high salt was established by transcriptomics, confirming the osmolyte role of tHyp-B. This study establishes the utility of structure-guide functional predictions to enable the discovery of new metabolic pathways. PMID:24056934

High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

Science.gov (United States)

Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.

2016-01-01

Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575

Chromosomal insertion of the entire Escherichia coli lactose operon, into two strains of Pseudomonas, using a modified mini-Tn5 delivery system

DEFF Research Database (Denmark)

Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø

1997-01-01

A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...

Dynamic in vivo mutations within the ica operon during persistence of Staphylococcus aureus in the airways of cystic fibrosis patients.

Directory of Open Access Journals (Sweden)

Bianca Schwartbeck

2016-11-01

Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.

X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

Science.gov (United States)

Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln

The flagellar master operon flhDC is a pleiotropic regulator involved in motility and virulence of the fish pathogen Yersinia ruckeri

Science.gov (United States)

Aims: To investigate the function of the master flagellar operon flhDC in the fish pathogen Yersinia ruckeri and compare the effect of flhD mutation to a naturally occurring mutation causing loss-of-motility in emergent biotype 2 (BT2) strains. Methods and Results: In this study isogenic Y. ruckeri ...

SOS-like induction in Bacillus subtilis: induction of the RecA protein analog and a damage-inducible operon by DNA damage in Rec+ and DNA repair-deficient strains

International Nuclear Information System (INIS)

Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.

1988-01-01

We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation

The Transcriptional Repressor, MtrR, of the mtrCDE Efflux Pump Operon of Neisseria gonorrhoeae Can Also Serve as an Activator of “off Target” Gene (glnE Expression

Directory of Open Access Journals (Sweden)

Paul J. T. Johnson

2015-06-01

Full Text Available MtrR is a well-characterized repressor of the Neisseria gonorrhoeae mtrCDE efflux pump operon. However, results from a previous transcriptional profiling study suggested that MtrR also represses or activates expression of at least sixty genes outside of the mtr locus. Evidence that MtrR can directly repress so-called “off target” genes has previously been reported; in particular, MtrR was shown to directly repress glnA, which encodes glutamine synthetase. In contrast, evidence for the ability of MtrR to directly activate expression of gonococcal genes has been lacking; herein, we provide such evidence. We now report that MtrR has the ability to directly activate expression of glnE, which encodes the dual functional adenyltransferase/deadenylase enzyme GlnE that modifies GlnA resulting in regulation of its role in glutamine biosynthesis. With its capacity to repress expression of glnA, the results presented herein emphasize the diverse and often opposing regulatory properties of MtrR that likely contributes to the overall physiology and metabolism of N. gonorrhoeae.

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Participation of the arcRACME protein in self-activation of the arc operon located in the arginine catabolism mobile element in pandemic clone USA300.

Science.gov (United States)

Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier

2017-07-01

Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.

EseE of Edwardsiella tarda Augments Secretion of Translocon Protein EseC and Expression of the escC-eseE Operon.

Science.gov (United States)

Yi, Jia; Xiao, Shui Bing; Zeng, Zhi Xiong; Lu, Jin Fang; Liu, Lu Yi; Laghari, Zubair Ahmed; Nie, Pin; Yu, Hong Bing; Xie, Hai Xia

2016-08-01

Edwardsiella tarda is an important Gram-negative pathogen that employs a type III secretion system (T3SS) to deliver effectors into host cells to facilitate bacterial survival and replication. These effectors are translocated into host cells through a translocon complex composed of three secreted proteins, namely, EseB, EseC, and EseD. The secretion of EseB and EseD requires a chaperone protein called EscC, whereas the secretion of EseC requires the chaperone EscA. In this study, we identified a novel protein (EseE) that also regulates the secretion of EseC. An eseE deletion mutant secreted much less EseC into supernatants, accompanied by increased EseC levels within bacterial cells. We also demonstrated that EseE interacted directly with EseC in a pulldown assay. Interestingly, EseC, EseE, and EscA were able to form a ternary complex, as revealed by pulldown and gel filtration assays. Of particular importance, the deletion of eseE resulted in decreased levels of EseB and EseD proteins in both the bacterial pellet and supernatant fraction. Furthermore, real-time PCR assays showed that EseE positively regulated the transcription of the translocon operon escC-eseE, comprising escC, eseB, escA, eseC, eseD, and eseE These effects of EseE on the translocon components/operon appeared to have a functional consequence, since the ΔeseE strain was outcompeted by wild-type E. tarda in a mixed infection in blue gourami fish. Collectively, our results demonstrate that EseE not only functions as a chaperone for EseC but also acts as a positive regulator controlling the expression of the translocon operon escC-eseE, thus contributing to the pathogenesis of E. tarda in fish. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Analysis of gene order data supports vertical inheritance of the leukotoxin operon and genome rearrangements in the 5' flanking region in genus Mannheimia

DEFF Research Database (Denmark)

Larsen, Jesper; Kuhnert, Peter; Frey, Joachim

2007-01-01

subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...

Nonencapsulated or nontypeable Haemophilus influenzae are more likely than their encapsulated or serotypeable counterparts to have mutations in their fucose operon.

Science.gov (United States)

Shuel, Michelle L; Karlowsky, Kathleen E; Law, Dennis K S; Tsang, Raymond S W

2011-12-01

Population biology of Haemophilus influenzae can be studied by multilocus sequence typing (MLST), and isolates are assigned sequence types (STs) based on nucleotide sequence variations in seven housekeeping genes, including fucK. However, the ST cannot be assigned if one of the housekeeping genes is absent or cannot be detected by the current protocol. Occasionally, strains of H. influenzae have been reported to lack the fucK gene. In this study, we examined the prevalence of this mutation among our collection of H. influenzae isolates. Of the 704 isolates studied, including 282 encapsulated and 422 nonencapsulated isolates, nine were not typeable by MLST owing to failure to detect the fucK gene. All nine fucK-negative isolates were nonencapsulated and belonged to various biotypes. DNA sequencing of the fucose operon region confirmed complete deletion of genes in the operon in seven of the nine isolates, while in the remaining two isolates, some of the genes were found intact or in parts. The significance of these findings is discussed.

DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

DEFF Research Database (Denmark)

Mygind, T; Birkelund, Svend; Christiansen, Gunna

1998-01-01

To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

Science.gov (United States)

Burbank, Lindsey P; Van Horn, Christopher R

2017-11-01

The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

The davDT operon of Pseudomonas putida, involved in lysine catabolism, is induced in response to the pathway intermediate delta-aminovaleric acid

DEFF Research Database (Denmark)

Revelles, O.; Espinosa-Urgel, M.; Molin, Søren

2004-01-01

-aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single sigma(70)-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response...

Evidence of mercury trapping in biofilm-EPS and mer operon-based volatilization of inorganic mercury in a marine bacterium Bacillus cereus BW-201B.

Science.gov (United States)

Dash, Hirak R; Basu, Subham; Das, Surajit

2017-04-01

Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.

A combination of luxR1 and luxR2 genes activates Pr-promoters of psychrophilic Aliivibrio logei lux-operon independently of chaperonin GroEL/ES and protease Lon at high concentrations of autoinducer.

Science.gov (United States)

Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V

2016-05-13

Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

Integration Host Factor (IHF binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

Directory of Open Access Journals (Sweden)

Álvarez-Morales Ariel

2011-05-01

Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.

Thermostabilization of desulfurization enzymes from Rhodococcos sp. IGTS8. Final technical report

Energy Technology Data Exchange (ETDEWEB)

John J. Kilbane II

2000-12-15

The objective of this project was to develop thermophilic cultures capable of expressing the desulfurization (dsz) operon of Rhodococcus sp. IGTS8. The approaches taken in this project included the development of plasmid and integrative expression vectors that function well in Thermus thermophilus, the cloning of Rhodococcus dsz genes in Thermus expression vectors, and the isolation of bacterial cultures that express the dsz operon at thermophilic temperatures. This project has resulted in the development of plasmid and integrative expression vectors for use in T. thermophilus. The dsz genes have been expressed at moderately thermophilic temperatures (52 C) in Mycobacterium phlei and at temperatures as high as 72 C in T. thermophilus. The tools and methods developed in this project will be generally useful for the expression of heterologous genes in Thermus. Key developments in the project have been the isolation of a Mycobacterium phlei culture capable of expressing the desulfurization operon at 52 C, development of plasmid and integrative expression vectors for Thermus thermophilus, and the development of a host-vector system based on the malate dehydrogenase gene that allows plasmids to be stably maintained in T. thermophilus and provides a convenient reporter gene for the accurate quantification of gene expression. Publications have been prepared regarding each of these topics; these preprints are included.

The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

Science.gov (United States)

Ahn, Sang-Joon; Burne, Robert A

2006-10-01

The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum

Science.gov (United States)

2012-01-01

Background The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. Results By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. Conclusions The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation. PMID:22243621

Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum.

Science.gov (United States)

Schneider, Jens; Peters-Wendisch, Petra; Stansen, K Corinna; Götker, Susanne; Maximow, Stanislav; Krämer, Reinhard; Wendisch, Volker F

2012-01-13

The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation.

Isolation of a solventogenic Clostridium sp. strain: fermentation of glycerol to n-butanol, analysis of the bcs operon region and its potential regulatory elements.

Science.gov (United States)

Panitz, J C; Zverlov, V V; Pham, V T T; Stürzl, S; Schieder, D; Schwarz, W H

2014-02-01

A new solventogenic bacterium, strain GT6, was isolated from standing water sediment. 16S-rRNA gene analysis revealed that GT6 belongs to the heterogeneous Clostridium tetanomorphum group of bacteria exhibiting 99% sequence identity with C. tetanomorphum 4474(T). GT6 can utilize a wide range of carbohydrate substrates including glucose, fructose, maltose, xylose and glycerol to produce mainly n-butanol without any acetone. Additional products of GT6 metabolism were ethanol, butyric acid, acetic acid, and trace amounts of 1,3-propanediol. Medium and substrate composition, and culture conditions such as pH and temperature influenced product formation. The major fermentation product from glycerol was n-butanol with a final concentration of up to 11.5 g/L. 3% (v/v) glycerol lead to a total solvent concentration of 14 g/L within 72 h. Growth was not inhibited by glycerol concentrations as high as 15% (v/v). The solventogenesis genes crt, bcd, etfA/B and hbd composing the bcs (butyryl-CoA synthesis) operon of C. tetanomorphum GT6 were sequenced. They occur in a genomic arrangement identical to those in other solventogenic clostridia. Furthermore, the sequence of a potential regulator gene highly similar to that of the NADH-sensing Rex family of regulatory genes was found upstream of the bcs operon. Potential binding sites for Rex have been identified in the promoter region of the bcs operon of solvent producing clostridia as well as upstream of other genes involved in NADH oxidation. This indicates a fundamental role of Rex in the regulation of fermentation products in anaerobic, and especially in solventogenic bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

Enzymatic, immunological and phylogenetic characterization of Brucella suis urease

Directory of Open Access Journals (Sweden)

Sriranganathan Nammalwar

2008-07-01

Full Text Available Abstract Background The sequenced genomes of the Brucella spp. have two urease operons, ure-1 and ure-2, but there is evidence that only one is responsible for encoding an active urease. The present work describes the purification and the enzymatic and phylogenomic characterization of urease from Brucella suis strain 1330. Additionally, the urease reactivity of sera from patients diagnosed with brucellosis was examined. Results Urease encoded by the ure-1 operon of Brucella suis strain 1330 was purified to homogeneity using ion exchange and hydrophobic interaction chromatographies. The urease was purified 51-fold with a recovery of 12% of the enzyme activity and 0.24% of the total protein. The enzyme had an isoelectric point of 5, and showed optimal activity at pH 7.0 and 28–35°C. The purified enzyme exhibited a Michaelis-Menten saturation kinetics with a Km of 5.60 ± 0.69 mM. Hydroxyurea and thiourea are competitive inhibitors of the enzyme with Ki of 1.04 ± 0.31 mM and 26.12 ± 2.30 mM, respectively. Acetohydroxamic acid also inhibits the enzyme in a competitive way. The molecular weight estimated for the native enzyme was between 130–135 kDa by gel filtration chromatography and 157 ± 7 kDa using 5–10% polyacrylamide gradient non-denaturing gel. Only three subunits in SDS-PAGE were identified: two small subunits of 14,000 Da and 15,500 Da, and a major subunit of 66,000 Da. The amino terminal sequence of the purified large subunit corresponded to the predicted amino acid sequence encoded by ureC1. The UreC1 subunit was recognized by sera from patients with acute and chronic brucellosis. By phylogenetic and cluster structure analyses, ureC1 was related to the ureC typically present in the Rhizobiales; in contrast, the ureC2 encoded in the ure-2 operon is more related to distant species. Conclusion We have for the first time purified and characterized an active urease from B. suis. The enzyme was characterized at the kinetic

The CodY-dependent clhAB2 operon is involved in cell shape, chaining and autolysis in Bacillus cereus ATCC 14579.

Science.gov (United States)

Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier

2017-01-01

The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.

HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.

Science.gov (United States)

Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong

2016-01-01

Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

Science.gov (United States)

Zhu, Y; Lin, E C

1988-05-01

L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

Class IIa bacteriocin resistance in Enterococcus faecalis V583: The mannose PTS operon mediates global transcriptional responses

Directory of Open Access Journals (Sweden)

Opsata Mona

2010-08-01

Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.

The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

Science.gov (United States)

Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

2011-06-10

The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

DEFF Research Database (Denmark)

van Wezel, G P; Krab, I M; Douthwaite, S

1994-01-01

Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

Functional validation of putative toxin-antitoxin genes from the Gram-positive pathogen Streptococcus pneumoniae: phd-doc is the fourth bona-fide operon.

Science.gov (United States)

Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel

2014-01-01

Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.

Expression, crystallization and preliminary diffraction studies of the Pseudomonas putida cytochrome P450cam operon repressor CamR

International Nuclear Information System (INIS)

Maenaka, Katsumi; Fukushi, Kouji; Aramaki, Hironori; Shirakihara, Yasuo

2005-01-01

The P. putida cytochrome P450cam operon repressor CamR has been expressed in E. coli and crystallized in space group P2 1 2 1 2. The Pseudomonas putida cam repressor (CamR) is a homodimeric protein that binds to the camO DNA operator to inhibit the transcription of the cytochrome P450cam operon camDCAB. CamR has two functional domains: a regulatory domain and a DNA-binding domain. The binding of the inducer d-camphor to the regulatory domain renders the DNA-binding domain unable to bind camO. Native CamR and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. Native CamR was crystallized under the following conditions: (i) 12–14% PEG 4000, 50 mM Na PIPES, 0.1 M KCl, 1% glycerol pH 7.3 at 288 K with and without camphor and (ii) 1.6 M P i , 50 mM Na PIPES, 2 mM camphor pH 6.7 at 278 K. The selenomethionyl derivative CamR did not crystallize under either of these conditions, but did crystallize using 12.5% PEG MME 550, 25 mM Na PIPES, 2.5 mM MgCl 2 pH 7.3 at 298 K. Preliminary X-ray diffraction studies revealed the space group to be orthorhombic (P2 1 2 1 2), with unit-cell parameters a = 48.0, b = 73.3, c = 105.7 Å. Native and selenomethionyl derivative data sets were collected to 3 Å resolution at SPring-8 and the Photon Factory

High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

NARCIS (Netherlands)

Berendsen, Erwin M; Koning, Rosella A; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Wells-Bennik, Marjon H J

2016-01-01

Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA(2mob), present on a Tn1546

Structural insights into conserved L-arabinose metabolic enzymes reveal the substrate binding site of a thermophilic L-arabinose isomerase.

Science.gov (United States)

Lee, Yong-Jik; Lee, Sang-Jae; Kim, Seong-Bo; Lee, Sang Jun; Lee, Sung Haeng; Lee, Dong-Woo

2014-03-18

Structural genomics demonstrates that despite low levels of structural similarity of proteins comprising a metabolic pathway, their substrate binding regions are likely to be conserved. Herein based on the 3D-structures of the α/β-fold proteins involved in the ara operon, we attempted to predict the substrate binding residues of thermophilic Geobacillus stearothermophilus L-arabinose isomerase (GSAI) with no 3D-structure available. Comparison of the structures of L-arabinose catabolic enzymes revealed a conserved feature to form the substrate-binding modules, which can be extended to predict the substrate binding site of GSAI (i.e., D195, E261 and E333). Moreover, these data implicated that proteins in the l-arabinose metabolic pathway might retain their substrate binding niches as the modular structure through conserved molecular evolution even with totally different structural scaffolds. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Modular Organization of the NusA- and NusG-Stimulated RNA Polymerase Pause Signal That Participates in the Bacillus subtilis trp Operon Attenuation Mechanism.

Science.gov (United States)

Mondal, Smarajit; Yakhnin, Alexander V; Babitzke, Paul

2017-07-15

The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism in which tryptophan-activated TRAP binds to the nascent transcript and blocks the formation of an antiterminator structure such that the formation of an overlapping intrinsic terminator causes termination in the 5' untranslated region (5' UTR). In the absence of bound TRAP, the antiterminator forms and transcription continues into the trp genes. RNA polymerase pauses at positions U107 and U144 in the 5' UTR. The general transcription elongation factors NusA and NusG stimulate pausing at both positions. NusG-stimulated pausing at U144 requires sequence-specific contacts with a T tract in the nontemplate DNA (ntDNA) strand within the paused transcription bubble. Pausing at U144 participates in a trpE translation repression mechanism. Since U107 just precedes the critical overlap between the antiterminator and terminator structures, pausing at this position is thought to participate in attenuation. Here we carried out in vitro pausing and termination experiments to identify components of the U107 pause signal and to determine whether pausing affects the termination efficiency in the 5' UTR. We determined that the U107 and U144 pause signals are organized in a modular fashion containing distinct RNA hairpin, U-tract, and T-tract components. NusA-stimulated pausing was affected by hairpin strength and the U-tract sequence, whereas NusG-stimulated pausing was affected by hairpin strength and the T-tract sequence. We also determined that pausing at U107 results in increased TRAP-dependent termination in the 5' UTR, implying that NusA- and NusG-stimulated pausing participates in the trp operon attenuation mechanism by providing additional time for TRAP binding. IMPORTANCE The expression of several bacterial operons is controlled by regulated termination in the 5' untranslated region (5' UTR). Transcription attenuation is defined as situations in which the binding of a regulatory

Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

Science.gov (United States)

Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

2015-01-01

Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

Induction of the mar operon by miscellaneous groceries.

Science.gov (United States)

Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

2004-01-01

To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration.

Science.gov (United States)

Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A

2015-09-01

Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Enzyme

Science.gov (United States)

Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

Expression of Each Cistron in the gal Operon Can Be Regulated by Transcription Termination and Generation of a galK-Specific mRNA, mK2

Science.gov (United States)

Wang, Xun; Ji, Sang Chun; Yun, Sang Hoon; Jeon, Heung Jin; Kim, Si Wouk

2014-01-01

The gal operon of Escherichia coli has 4 cistrons, galE, galT, galK, and galM. In our previous report (H. J. Lee, H. J. Jeon, S. C. Ji, S. H. Yun, H. M. Lim, J. Mol. Biol. 378:318–327, 2008), we identified 6 different mRNA species, mE1, mE2, mT1, mK1, mK2, and mM1, in the gal operon and mapped these mRNAs. The mRNA map suggests a gradient of gene expression known as natural polarity. In this study, we investigated how the mRNAs are generated to understand the cause of natural polarity. Results indicated that mE1, mT1, mK1, and mM1, whose 3′ ends are located at the end of each cistron, are generated by transcription termination. Since each transcription termination is operating with a certain frequency and those 4 mRNAs have 5′ ends at the transcription initiation site(s), these transcription terminations are the basic cause of natural polarity. Transcription terminations at galE-galT and galT-galK junctions, making mE1 and mT1, are Rho dependent. However, the terminations to make mK1 and mM1 are partially Rho dependent. The 5′ ends of mK2 are generated by an endonucleolytic cleavage of a pre-mK2 by RNase P, and the 3′ ends are generated by Rho termination 260 nucleotides before the end of the operon. The 5′ portion of pre-mK2 is likely to become mE2. These results also suggested that galK expression could be regulated through mK2 production independent from natural polarity. PMID:24794565

Genetic control of nitrate assimilation in Klebsiella oxytoca. Final technical report; FINAL

International Nuclear Information System (INIS)

Stewart, Valley J.

2001-01-01

Some microorganisms can use nitrate as the sole source of nitrogen for biosynthesis. This project focused on the bacterium Klebsiella oxytoca, an enterobacterium found in soil and water. Mutagenesis and molecular cloning identified the nasFEDCBA operon encoding enzymes for the uptake and reduction of nitrate and nitrite to ammonium, and the adjacent nasR regulatory gene. Analysis of nasF operon expression revealed that transcription is activated by the Ntr (general nitrogen regulation ) system in response to nitrogen limitation. Transcription antitermination control in response to nitrate and nitrite is mediated by the NasR protein. Additional work established that the NasR protein is an RNA-binding protein that interacts with nasF operon leader RNA to control transcription readthrough

Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

Science.gov (United States)

Römling, Ute; Galperin, Michael Y.

2015-01-01

Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

Science.gov (United States)

Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

2012-06-01

In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols

OpenAIRE

Yadav, Kavita; Kumar, Chanchal; Archana, G.; Naresh Kumar, G.

2014-01-01

Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) s...

Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus species

Science.gov (United States)

Rey, Michael W; Ramaiya, Preethi; Nelson, Beth A; Brody-Karpin, Shari D; Zaretsky, Elizabeth J; Tang, Maria; de Leon, Alfredo Lopez; Xiang, Henry; Gusti, Veronica; Clausen, Ib Groth; Olsen, Peter B; Rasmussen, Michael D; Andersen, Jens T; Jørgensen, Per L; Larsen, Thomas S; Sorokin, Alexei; Bolotin, Alexander; Lapidus, Alla; Galleron, Nathalie; Ehrlich, S Dusko; Berka, Randy M

2004-01-01

Background Bacillus licheniformis is a Gram-positive, spore-forming soil bacterium that is used in the biotechnology industry to manufacture enzymes, antibiotics, biochemicals and consumer products. This species is closely related to the well studied model organism Bacillus subtilis, and produces an assortment of extracellular enzymes that may contribute to nutrient cycling in nature. Results We determined the complete nucleotide sequence of the B. licheniformis ATCC 14580 genome which comprises a circular chromosome of 4,222,336 base-pairs (bp) containing 4,208 predicted protein-coding genes with an average size of 873 bp, seven rRNA operons, and 72 tRNA genes. The B. licheniformis chromosome contains large regions that are colinear with the genomes of B. subtilis and Bacillus halodurans, and approximately 80% of the predicted B. licheniformis coding sequences have B. subtilis orthologs. Conclusions Despite the unmistakable organizational similarities between the B. licheniformis and B. subtilis genomes, there are notable differences in the numbers and locations of prophages, transposable elements and a number of extracellular enzymes and secondary metabolic pathway operons that distinguish these species. Differences include a region of more than 80 kilobases (kb) that comprises a cluster of polyketide synthase genes and a second operon of 38 kb encoding plipastatin synthase enzymes that are absent in the B. licheniformis genome. The availability of a completed genome sequence for B. licheniformis should facilitate the design and construction of improved industrial strains and allow for comparative genomics and evolutionary studies within this group of Bacillaceae. PMID:15461803

Identification and Characterization of EctR1, a New Transcriptional Regulator of the Ectoine Biosynthesis Genes in the Halotolerant Methanotroph Methylomicrobium alcaliphilum 20Z▿ †

OpenAIRE

Mustakhimov, Ildar I.; Reshetnikov, Alexander S.; Glukhov, Anatoly S.; Khmelenina, Valentina N.; Kalyuzhnaya, Marina G.; Trotsenko, Yuri A.

2009-01-01

Genes encoding key enzymes of the ectoine biosynthesis pathway in the halotolerant obligate methanotroph Methylomicrobium alcaliphilum 20Z have been shown to be organized into an ectABC-ask operon. Transcription of the ect operon is initiated from two promoters, ectAp1 and ectAp2 (ectAp1p2), similar to the σ70-dependent promoters of Escherichia coli. Upstream of the gene cluster, an open reading frame (ectR1) encoding a MarR-like transcriptional regulator was identified. Investigation of the ...

Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

Science.gov (United States)

Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

2008-10-01

Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

Predicting metabolic pathways by sub-network extraction.

Science.gov (United States)

Faust, Karoline; van Helden, Jacques

2012-01-01

Various methods result in groups of functionally related genes obtained from genomes (operons, regulons, syntheny groups, and phylogenetic profiles), transcriptomes (co-expression groups) and proteomes (modules of interacting proteins). When such groups contain two or more enzyme-coding genes, graph analysis methods can be applied to extract a metabolic pathway that interconnects them. We describe here the way to use the Pathway extraction tool available on the NeAT Web server ( http://rsat.ulb.ac.be/neat/ ) to piece together the metabolic pathway from a group of associated, enzyme-coding genes. The tool identifies the reactions that can be catalyzed by the products of the query genes (seed reactions), and applies sub-graph extraction algorithms to extract from a metabolic network a sub-network that connects the seed reactions. This sub-network represents the predicted metabolic pathway. We describe here the pathway prediction process in a step-by-step way, give hints about the main parametric choices, and illustrate how this tool can be used to extract metabolic pathways from bacterial genomes, on the basis of two study cases: the isoleucine-valine operon in Escherichia coli and a predicted operon in Cupriavidus (Ralstonia) metallidurans.

DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

DEFF Research Database (Denmark)

Mygind, T; Birkelund, Svend; Christiansen, Gunna

1998-01-01

To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....

lac operon induction in Escherichia coli: Systematic comparison of IPTG and TMG induction and influence of the transacetylase LacA.

Science.gov (United States)

Marbach, Anja; Bettenbrock, Katja

2012-01-01

Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.

Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

Science.gov (United States)

Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

2018-06-01

Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

Involvement of the Cra global regulatory protein in the expression of the iscRSUA operon, revealed during studies of tricarballylate catabolism in Salmonella enterica.

Science.gov (United States)

Lewis, Jeffrey A; Boyd, Jeffrey M; Downs, Diana M; Escalante-Semerena, Jorge C

2009-04-01

In Salmonella enterica, tricarballylate (Tcb) catabolism requires function of TcuB, a membrane-bound protein that contains [4Fe-4S] clusters and heme. TcuB transfers electrons from reduced flavin adenine dinucleotide in the Tcb dehydrogenase (TcuA) to electron acceptors in the membrane. We recently showed that functions needed to assemble [Fe-S] clusters (i.e., the iscRSUA-hscBA-fdx operon) compensate for the lack of ApbC during growth of an apbC strain on Tcb. ApbC had been linked to [Fe-S] cluster metabolism, and we showed that an apbC strain had decreased TcuB activity. Here we report findings that expand our understanding of the regulation of expression of the iscRSUA genes in Salmonella enterica. We investigated why low levels of glucose or other saccharides restored growth of an apbC strain on Tcb. Here we report the following findings. (i) A Cra. (iv) Putative Cra binding sites are present in the regulatory region of the iscRSUA operon. (v) Cra protein binds to all three sites in the iscRSUA promoter region in a concentration-dependent fashion. To our knowledge, this is the first report of the involvement of Cra in [Fe-S] cluster assembly.

Enzyme Informatics

Science.gov (United States)

Alderson, Rosanna G.; Ferrari, Luna De; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B. O.; Nath, Neetika

2012-01-01

Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCatDB, SFLD and MACiE are key repositories for data on the chemical mechanisms by which enzymes operate. At the current rate of genome sequencing and manual annotation, human curation will never finish the functional annotation of the ever-expanding list of known enzymes. Hence there is an increasing need for automated annotation, though it is not yet widespread for enzyme data. In contrast, functional ontologies such as the Gene Ontology already profit from automation. Despite our growing understanding of enzyme structure and dynamics, we are only beginning to be able to design novel enzymes. One can now begin to trace the functional evolution of enzymes using phylogenetics. The ability of enzymes to perform secondary functions, albeit relatively inefficiently, gives clues as to how enzyme function evolves. Substrate promiscuity in enzymes is one example of imperfect specificity in protein-ligand interactions. Similarly, most drugs bind to more than one protein target. This may sometimes result in helpful polypharmacology as a drug modulates plural targets, but also often leads to adverse side-effects. Many cheminformatics approaches can be used to model the interactions between druglike molecules and proteins in silico. We can even use quantum chemical techniques like DFT and QM/MM to compute the structural and energetic course of enzyme catalysed chemical reaction mechanisms, including a full description of bond making and breaking. PMID:23116471

Using fusions with luxAB from Vibrio harveyi MAV to quantify induction and catabolite repression of the xyl operon in Staphylococcus carnosus TM300.

Science.gov (United States)

Sizemore, C; Geissdörfer, W; Hillen, W

1993-03-01

The luxA,B genes from the Gram-negative marine bacterium Vibrio harveyi MAV were used in Staphylococcus carnosus TM300 as a reporter system for regulated expression of xylose utilization. The luciferase genes were fused to the xyl operon from Staphylococcus xylosus C2a. Expression of bioluminescence was induced through addition of xylose and repressed in the presence of glucose. A method to quantitate bioluminescence directly from the culture is described.

Tricistronic operon expression of the genes gcaD (tms), which encodes N-acetylglucosamine 1-phosphate uridyltransferase, prs, which encodes phosphoribosyl diphosphate synthetase, and ctc in vegetative cells of Bacillus subtilis

DEFF Research Database (Denmark)

Hilden, Ida; Krath, Britta N.; Hove-Jensen, Bjarne

1995-01-01

The gcaD, prs, and ctc genes were shown to be organized as a tricistronic operon. The transcription of the prs gene, measured as phosphoribosyl diphosphate synthetase activity, and of the ctc gene, measured as β-galactosidase activity specified by a ctc-lacZ protein fusion, were dependent...

Expression of a humanized viral 2A-mediated lux operon efficiently generates autonomous bioluminescence in human cells.

Directory of Open Access Journals (Sweden)

Tingting Xu

Full Text Available Expression of autonomous bioluminescence from human cells was previously reported to be impossible, suggesting that all bioluminescent-based mammalian reporter systems must therefore require application of a potentially influential chemical substrate. While this was disproven when the bacterial luciferase (lux cassette was demonstrated to function in a human cell, its expression required multiple genetic constructs, was functional in only a single cell type, and generated a significantly reduced signal compared to substrate-requiring systems. Here we investigate the use of a humanized, viral 2A-linked lux genetic architecture for the efficient introduction of an autobioluminescent phenotype across a variety of human cell lines.The lux cassette was codon optimized and assembled into a synthetic human expression operon using viral 2A elements as linker regions. Human kidney, breast cancer, and colorectal cancer cell lines were both transiently and stably transfected with the humanized operon and the resulting autobioluminescent phenotype was evaluated using common imaging instrumentation. Autobioluminescent cells were screened for cytotoxic effects resulting from lux expression and their utility as bioreporters was evaluated through the demonstration of repeated monitoring of single populations over a prolonged period using both a modified E-SCREEN assay for estrogen detection and a classical cytotoxic compound detection assay for the antibiotic Zeocin. Furthermore, the use of self-directed bioluminescent initiation in response to target detection was assessed to determine its amenability towards deployment as fully autonomous sensors. In all cases, bioluminescent measurements were supported with traditional genetic and transcriptomic evaluations.Our results demonstrate that the viral 2A-linked, humanized lux genetic architecture successfully produced autobioluminescent phenotypes in all cell lines tested without the induction of cytotoxicity

The Bacillus subtilis GntR family repressor YtrA responds to cell wall antibiotics.

Science.gov (United States)

Salzberg, Letal I; Luo, Yun; Hachmann, Anna-Barbara; Mascher, Thorsten; Helmann, John D

2011-10-01

The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σ(M). Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses.

The Bacillus subtilis GntR Family Repressor YtrA Responds to Cell Wall Antibiotics▿§

Science.gov (United States)

Salzberg, Letal I.; Luo, Yun; Hachmann, Anna-Barbara; Mascher, Thorsten; Helmann, John D.

2011-01-01

The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σM. Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses. PMID:21856850

Pancreatic Enzymes

Science.gov (United States)

... Contact Us DONATE NOW GENERAL DONATION PURPLESTRIDE Pancreatic enzymes Home Facing Pancreatic Cancer Living with Pancreatic Cancer ... and see a registered dietitian. What are pancreatic enzymes? Pancreatic enzymes help break down fats, proteins and ...

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Functions, Evolution, and Application of the Supramolecular Machines of Hg Detoxification

Energy Technology Data Exchange (ETDEWEB)

Miller, Susan M.

2009-11-27

The bacterial mercury resistance (mer) operon functions in Hg biogeochemistry and bioremediation by converting reactive inorganic [Hg(II)] and organic [RHg(I)] mercurials to relatively inert monoatomic mercury vapor, Hg(0). Its genes regulate expression (MerR, MerD, MerOP), import Hg(II) (MerT, MerP, and MerC), and demethylate (MerB) and reduce (MerA) mercurials. We focus on how these components interact with each other and with the host cell to allow cells to survive and detoxify Hg compounds. Understanding how this ubiquitous detoxification system fits into the biology and ecology of its bacterial host is essential to guide interventions that support and enhance Hg remediation. At a more basic level, studies of interactions between the metal ion trafficking proteins in this pathway provide insights into general mechanisms used by proteins in pathways involved in trafficking of other metal ions in cells of all types of organisms, including pathways for essential metal ions such as Cu and Zn and other toxic metal ions such as Cd. In this project we focused on investigations of proteins from mer operons found in gamma-proteobacteria with specific objectives to use biophysical and biochemical approaches to detect and define (1) interactions between the structural components of the key detoxifying mer operon enzyme, mercuric ion reductase (MerA), (2) interactions between the components of MerA and the other mer operon enzyme, organomercurial lyase (MerB), and (3) to investigate the structure and interactions of integral membrane transport proteins, MerT and MerC, with MerA.

Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens.

Science.gov (United States)

Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J

2015-06-19

The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

Science.gov (United States)

Varmanen, P; Rantanen, T; Palva, A

1996-12-01

A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

Measuring the Enzyme Activity of Arabidopsis Deubiquitylating Enzymes.

Science.gov (United States)

Kalinowska, Kamila; Nagel, Marie-Kristin; Isono, Erika

2016-01-01

Deubiquitylating enzymes, or DUBs, are important regulators of ubiquitin homeostasis and substrate stability, though the molecular mechanisms of most of the DUBs in plants are not yet understood. As different ubiquitin chain types are implicated in different biological pathways, it is important to analyze the enzyme characteristic for studying a DUB. Quantitative analysis of DUB activity is also important to determine enzyme kinetics and the influence of DUB binding proteins on the enzyme activity. Here, we show methods to analyze DUB activity using immunodetection, Coomassie Brilliant Blue staining, and fluorescence measurement that can be useful for understanding the basic characteristic of DUBs.

Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.

Science.gov (United States)

Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M

2016-09-12

The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .

Nanomaterials with enzyme-like characteristics (nanozymes): next-generation artificial enzymes.

Science.gov (United States)

Wei, Hui; Wang, Erkang

2013-07-21

Over the past few decades, researchers have established artificial enzymes as highly stable and low-cost alternatives to natural enzymes in a wide range of applications. A variety of materials including cyclodextrins, metal complexes, porphyrins, polymers, dendrimers and biomolecules have been extensively explored to mimic the structures and functions of naturally occurring enzymes. Recently, some nanomaterials have been found to exhibit unexpected enzyme-like activities, and great advances have been made in this area due to the tremendous progress in nano-research and the unique characteristics of nanomaterials. To highlight the progress in the field of nanomaterial-based artificial enzymes (nanozymes), this review discusses various nanomaterials that have been explored to mimic different kinds of enzymes. We cover their kinetics, mechanisms and applications in numerous fields, from biosensing and immunoassays, to stem cell growth and pollutant removal. We also summarize several approaches to tune the activities of nanozymes. Finally, we make comparisons between nanozymes and other catalytic materials (other artificial enzymes, natural enzymes, organic catalysts and nanomaterial-based catalysts) and address the current challenges and future directions (302 references).

[Advances on enzymes and enzyme inhibitors research based on microfluidic devices].

Science.gov (United States)

Hou, Feng-Hua; Ye, Jian-Qing; Chen, Zuan-Guang; Cheng, Zhi-Yi

2010-06-01

With the continuous development in microfluidic fabrication technology, microfluidic analysis has evolved from a concept to one of research frontiers in last twenty years. The research of enzymes and enzyme inhibitors based on microfluidic devices has also made great progress. Microfluidic technology improved greatly the analytical performance of the research of enzymes and enzyme inhibitors by reducing the consumption of reagents, decreasing the analysis time, and developing automation. This review focuses on the development and classification of enzymes and enzyme inhibitors research based on microfluidic devices.

Direct comparison of enzyme histochemical and immunohistochemical methods to localize an enzyme

NARCIS (Netherlands)

van Noorden, Cornelis J. F.

2002-01-01

Immunohistochemical localization of enzymes is compared directly with localization of enzyme activity with (catalytic) enzyme histochemical methods. The two approaches demonstrate principally different aspects of an enzyme. The immunohistochemical method localizes the enzyme protein whether it is

Computational enzyme design: transitioning from catalytic proteins to enzymes.

Science.gov (United States)

Mak, Wai Shun; Siegel, Justin B

2014-08-01

The widespread interest in enzymes stem from their ability to catalyze chemical reactions under mild and ecologically friendly conditions with unparalleled catalytic proficiencies. While thousands of naturally occurring enzymes have been identified and characterized, there are still numerous important applications for which there are no biological catalysts capable of performing the desired chemical transformation. In order to engineer enzymes for which there is no natural starting point, efforts using a combination of quantum chemistry and force-field based protein molecular modeling have led to the design of novel proteins capable of catalyzing chemical reactions not catalyzed by naturally occurring enzymes. Here we discuss the current status and potential avenues to pursue as the field of computational enzyme design moves forward. Published by Elsevier Ltd.

Isolation of the phe-operon from G. stearothermophilus comprising the phenol degradative meta-pathway genes and a novel transcriptional regulator

Directory of Open Access Journals (Sweden)

Reiss Monika

2008-11-01

Full Text Available Abstract Background Geobacillus stearothermophilus is able to utilize phenol as a sole carbon source. A DNA fragment encoding a phenol hydroxylase catalyzing the first step in the meta-pathway has been isolated previously. Based on these findings a PCR-based DNA walk was performed initially to isolate a catechol 2,3-dioxygenase for biosensoric applications but was continued to elucidate the organisation of the genes encoding the proteins for the metabolization of phenol. Results A 20.2 kb DNA fragment was isolated as a result of the DNA walk. Fifteen open reading frames residing on a low-copy megaplasmid were identified. Eleven genes are co-transcribed in one polycistronic mRNA as shown by reverse transcription-PCR. Ten genes encode proteins, that are directly linked with the meta-cleavage pathway. The deduced amino acid sequences display similarities to a two-component phenol hydroxylase, a catechol 2,3-dioxygenase, a 4-oxalocrotonate tautomerase, a 2-oxopent-4-dienoate hydratase, a 4-oxalocrotonate decarboxylase, a 4-hydroxy-2-oxovalerate aldolase, an acetaldehyde dehydrogenase, a plant-type ferredoxin involved in the reactivation of extradiol dioxygenases and a novel regulatory protein. The only enzymes missing for the complete mineralization of phenol are a 2-hydroxymuconic acid-6-semialdehyde hydrolase and/or 2-hydroxymuconic acid-6-semialdehyde dehydrogenase. Conclusion Research on the bacterial degradation of aromatic compounds on a sub-cellular level has been more intensively studied in gram-negative organisms than in gram-positive bacteria. Especially regulatory mechanisms in gram-positive (thermophilic prokaryotes remain mostly unknown. We isolated the first complete sequence of an operon from a thermophilic bacterium encoding the meta-pathway genes and analyzed the genetic organization. Moreover, the first transcriptional regulator of the phenol metabolism in gram-positive bacteria was identified. This is a first step to elucidate

Gene content and organization of a 281-kbp contig from the genome of the extremely thermophilic archaeon, Sulfolobus solfataricus P2

NARCIS (Netherlands)

Charlebois, R.; Confalonieri, F.; Curtis, B.; Doolittle, W.F.; Duguet, M.; Erauso, G.; Faguy, D.; Gaasterland, T.; Garrett, R.A.; Gordon, P.; Kozera, C.; Medina, N.; Oost, van der J.; Peng, X.; Ragan, M.; She, Q.; Singh, R.K.

2000-01-01

The sequence of a 281-kbp contig from the crenarchaeote Sulfolobus solfataricus P2 was determined and analysed. Notable features in this region include 29 ribosomal protein genes, 12 tRNA genes (four of which contain archaeal-type introns), operons encoding enzymes of histidine biosynthesis,

A Bayesian method for identifying missing enzymes in predicted metabolic pathway databases

Directory of Open Access Journals (Sweden)

Karp Peter D

2004-06-01

Full Text Available Abstract Background The PathoLogic program constructs Pathway/Genome databases by using a genome's annotation to predict the set of metabolic pathways present in an organism. PathoLogic determines the set of reactions composing those pathways from the enzymes annotated in the organism's genome. Most annotation efforts fail to assign function to 40–60% of sequences. In addition, large numbers of sequences may have non-specific annotations (e.g., thiolase family protein. Pathway holes occur when a genome appears to lack the enzymes needed to catalyze reactions in a pathway. If a protein has not been assigned a specific function during the annotation process, any reaction catalyzed by that protein will appear as a missing enzyme or pathway hole in a Pathway/Genome database. Results We have developed a method that efficiently combines homology and pathway-based evidence to identify candidates for filling pathway holes in Pathway/Genome databases. Our program not only identifies potential candidate sequences for pathway holes, but combines data from multiple, heterogeneous sources to assess the likelihood that a candidate has the required function. Our algorithm emulates the manual sequence annotation process, considering not only evidence from homology searches, but also considering evidence from genomic context (i.e., is the gene part of an operon? and functional context (e.g., are there functionally-related genes nearby in the genome? to determine the posterior belief that a candidate has the required function. The method can be applied across an entire metabolic pathway network and is generally applicable to any pathway database. The program uses a set of sequences encoding the required activity in other genomes to identify candidate proteins in the genome of interest, and then evaluates each candidate by using a simple Bayes classifier to determine the probability that the candidate has the desired function. We achieved 71% precision at a

Stabilization of enzymes in ionic liquids via modification of enzyme charge.

Science.gov (United States)

Nordwald, Erik M; Kaar, Joel L

2013-09-01

Due to the propensity of ionic liquids (ILs) to inactivate enzymes, the development of strategies to improve enzyme utility in these solvents is critical to fully exploit ILs for biocatalysis. We have developed a strategy to broadly improve enzyme utility in ILs based on elucidating the effect of charge modifications on the function of enzymes in IL environments. Results of stability studies in aqueous-IL mixtures indicated a clear connection between the ratio of enzyme-containing positive-to-negative sites and enzyme stability in ILs. Stability studies of the effect of [BMIM][Cl] and [EMIM][EtSO4 ] on chymotrypsin specifically found an optimum ratio of positively-charged amine-to-negatively-charged acid groups (0.39). At this ratio, the half-life of chymotrypsin was increased 1.6- and 4.3-fold relative to wild-type chymotrypsin in [BMIM][Cl] and [EMIM][EtSO4 ], respectively. The half-lives of lipase and papain were similarly increased as much as 4.0 and 2.4-fold, respectively, in [BMIM][Cl] by modifying the ratio of positive-to-negative sites of each enzyme. More generally, the results of stability studies found that modifications that reduce the ratio of enzyme-containing positive-to-negative sites improve enzyme stability in ILs. Understanding the impact of charge modification on enzyme stability in ILs may ultimately be exploited to rationally engineer enzymes for improved function in IL environments. Copyright © 2013 Wiley Periodicals, Inc.

Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

Directory of Open Access Journals (Sweden)

Løvdal Irene S

2012-03-01

Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

Science.gov (United States)

2012-01-01

Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

Artificial Enzymes, "Chemzymes"

DEFF Research Database (Denmark)

Bjerre, Jeannette; Rousseau, Cyril Andre Raphaël; Pedersen, Lavinia Georgeta M

2008-01-01

Enzymes have fascinated scientists since their discovery and, over some decades, one aim in organic chemistry has been the creation of molecules that mimic the active sites of enzymes and promote catalysis. Nevertheless, even today, there are relatively few examples of enzyme models that successf......Enzymes have fascinated scientists since their discovery and, over some decades, one aim in organic chemistry has been the creation of molecules that mimic the active sites of enzymes and promote catalysis. Nevertheless, even today, there are relatively few examples of enzyme models...... that successfully perform Michaelis-Menten catalysis under enzymatic conditions (i.e., aqueous medium, neutral pH, ambient temperature) and for those that do, very high rate accelerations are seldomly seen. This review will provide a brief summary of the recent developments in artificial enzymes, so called...... "Chemzymes", based on cyclodextrins and other molecules. Only the chemzymes that have shown enzyme-like activity that has been quantified by different methods will be mentioned. This review will summarize the work done in the field of artificial glycosidases, oxidases, epoxidases, and esterases, as well...

Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

Science.gov (United States)

Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

2002-01-01

Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

Enzyme detection by microfluidics

DEFF Research Database (Denmark)

2013-01-01

Microfluidic-implemented methods of detecting an enzyme, in particular a DNA-modifying enzyme, are provided, as well as methods for detecting a cell, or a microorganism expressing said enzyme. The enzyme is detected by providing a nucleic acid substrate, which is specifically targeted...... by that enzyme...

The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

Science.gov (United States)

Kessler, Peter S.; Blank, Carrine; Leigh, John A.

1998-01-01

Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

The LysR-type transcriptional regulator CbbR controlling autotrophic CO2 fixation by Xanthobacter flavus is an NADPH sensor

NARCIS (Netherlands)

van Keulen, G; Girbal, L; van den Bergh, E.R E; Dijkhuizen, L.; Meijer, W.G

Autotrophic growth of Xanthobacter flavus is dependent on the fixation of carbon dioxide via the Calvin cycle and on the oxidation of simple organic and inorganic compounds to provide the cell with energy. Maximal induction of the cbb and gap-pgk operons encoding enzymes of the Calvin cycle occurs

GenBank blastx search result: AK318593 [KOME

Lifescience Database Archive (English)

Full Text Available AK318593 J100055K16 J02708.1 ECOGUT E.coli glucitol (gut) operon: glucitol-specific enzyme II (gut...A), and III (gutB), glucitol-6-phosphate dehydrogenase (gutD), activator (gutM) and repressor (gutR) genes, complete cds. BCT 0.0 1 ...

Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

Science.gov (United States)

Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

1974-01-01

DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

7 CFR 58.436 - Rennet, pepsin, other milk clotting enzymes and flavor enzymes.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Rennet, pepsin, other milk clotting enzymes and flavor enzymes. 58.436 Section 58.436 Agriculture Regulations of the Department of Agriculture (Continued... clotting enzymes and flavor enzymes. Enzyme preparations used in the manufacture of cheese shall be safe...

Elevated Liver Enzymes

Science.gov (United States)

Symptoms Elevated liver enzymes By Mayo Clinic Staff Elevated liver enzymes may indicate inflammation or damage to cells in the liver. Inflamed or ... than normal amounts of certain chemicals, including liver enzymes, into the bloodstream, which can result in elevated ...

Stability of Enzymes in Granular Enzyme Products for Laundry Detergents

DEFF Research Database (Denmark)

Biran, Suzan; Bach, Poul; Simonsen, Ole

Enzymes have long been of interest to the detergent industry due to their ability to improve the cleaning efficiency of synthetic detergents, contribute to shortening washing times, and reduce energy and water consumption, provision of environmentally friendlier wash water effluents and fabric care....... However, incorporating enzymes in detergent formulations gives rise to numerous practical problems due to their incompatibility with and stability against various detergent components. In powdered detergent formulations, these issues can be partly overcome by physically isolating the enzymes in separate...... particles. However, enzymes may loose a significant part of their activity over a time period of several weeks. Possible causes of inactivation of enzymes in a granule may be related to the release of hydrogen peroxide from the bleaching chemicals in a moisture-containing atmosphere, humidity, autolysis...

Mutational Analysis of the Escherichia coli melR Gene Suggests a Two-State Concerted Model To Explain Transcriptional Activation and Repression in the Melibiose Operon

OpenAIRE

Kahramanoglou, Christina; Webster, Christine L.; el-Robh, Mohamed Samir; Belyaeva, Tamara A.; Busby, Stephen J. W.

2006-01-01

Transcription of the Escherichia coli melAB operon is regulated by the MelR protein, an AraC family member whose activity is modulated by the binding of melibiose. In the absence of melibiose, MelR is unable to activate the melAB promoter but autoregulates its own expression by repressing the melR promoter. Melibiose triggers MelR-dependent activation of the melAB promoter and relieves MelR-dependent repression of the melR promoter. Twenty-nine single amino acid substitutions in MelR that res...

Enzyme structure, enzyme function and allozyme diversity in ...

African Journals Online (AJOL)

In estimates of population genetic diversity based on allozyme heterozygosity, some enzymes are regularly more variable than others. Evolutionary theory suggests that functionally less important molecules, or parts of molecules, evolve more rapidly than more important ones; the latter enzymes should then theoretically be ...

Differential recognition and hydrolysis of host carbohydrate antigens by Streptococcus pneumoniae family 98 glycoside hydrolases.

Science.gov (United States)

Higgins, Melanie A; Whitworth, Garrett E; El Warry, Nahida; Randriantsoa, Mialy; Samain, Eric; Burke, Robert D; Vocadlo, David J; Boraston, Alisdair B

2009-09-18

The presence of a fucose utilization operon in the Streptococcus pneumoniae genome and its established importance in virulence indicates a reliance of this bacterium on the harvesting of host fucose-containing glycans. The identities of these glycans, however, and how they are harvested is presently unknown. The biochemical and high resolution x-ray crystallographic analysis of two family 98 glycoside hydrolases (GH98s) from distinctive forms of the fucose utilization operon that originate from different S. pneumoniae strains reveal that one enzyme, the predominant type among pneumococcal isolates, has a unique endo-beta-galactosidase activity on the LewisY antigen. Altered active site topography in the other species of GH98 enzyme tune its endo-beta-galactosidase activity to the blood group A and B antigens. Despite their different specificities, these enzymes, and by extension all family 98 glycoside hydrolases, use an inverting catalytic mechanism. Many bacterial and viral pathogens exploit host carbohydrate antigens for adherence as a precursor to colonization or infection. However, this is the first evidence of bacterial endoglycosidase enzymes that are known to play a role in virulence and are specific for distinct host carbohydrate antigens. The strain-specific distribution of two distinct types of GH98 enzymes further suggests that S. pneumoniae strains may specialize to exploit host-specific antigens that vary from host to host, a factor that may feature in whether a strain is capable of colonizing a host or establishing an invasive infection.

Control analysis of the dependence of Escherichia coli physiology on the H⁺ -ATPase

DEFF Research Database (Denmark)

Jensen, Peter Ruhdal; Michelsen, Ole; Westerhoff, Hans V.

1993-01-01

The H+-ATPase plays a central role in Escherichia coli free-energy transduction and hence in E. coli physiology. We here investigate the extent to which this enzyme also controls the growth rate, growth yield, and respiratory rate of E. coli. We modulate the expression of the atp operon and deter...

Immobilized enzymes: understanding enzyme - surface interactions at the molecular level.

Science.gov (United States)

Hoarau, Marie; Badieyan, Somayesadat; Marsh, E Neil G

2017-11-22

Enzymes immobilized on solid supports have important and industrial and medical applications. However, their uses are limited by the significant reductions in activity and stability that often accompany the immobilization process. Here we review recent advances in our understanding of the molecular level interactions between proteins and supporting surfaces that contribute to changes in stability and activity. This understanding has been facilitated by the application of various surface-sensitive spectroscopic techniques that allow the structure and orientation of enzymes at the solid/liquid interface to be probed, often with monolayer sensitivity. An appreciation of the molecular interactions between enzyme and surface support has allowed the surface chemistry and method of enzyme attachement to be fine-tuned such that activity and stability can be greatly enhanced. These advances suggest that a much wider variety of enzymes may eventually be amenable to immobilization as green catalysts.

A NodD-like protein activates transcription of genes involved with naringenin degradation in a flavonoid-dependent manner in Herbaspirillum seropedicae.

Science.gov (United States)

Wassem, R; Marin, A M; Daddaoua, A; Monteiro, R A; Chubatsu, L S; Ramos, J L; Deakin, W J; Broughton, W J; Pedrosa, F O; Souza, E M

2017-03-01

Herbaspirillum seropedicae is an associative, endophytic non-nodulating diazotrophic bacterium that colonises several grasses. An ORF encoding a LysR-type transcriptional regulator, very similar to NodD proteins of rhizobia, was identified in its genome. This nodD-like gene, named fdeR, is divergently transcribed from an operon encoding enzymes involved in flavonoid degradation (fde operon). Apigenin, chrysin, luteolin and naringenin strongly induce transcription of the fde operon, but not that of the fdeR, in an FdeR-dependent manner. The intergenic region between fdeR and fdeA contains several generic LysR consensus sequences (T-N 11 -A) and we propose a binding site for FdeR, which is conserved in other bacteria. DNase I foot-printing revealed that the interaction with the FdeR binding site is modified by the four flavonoids that stimulate transcription of the fde operon. Moreover, FdeR binds naringenin and chrysin as shown by isothermal titration calorimetry. Interestingly, FdeR also binds in vitro to the nod-box from the nodABC operon of Rhizobium sp. NGR234 and is able to activate its transcription in vivo. These results show that FdeR exhibits two features of rhizobial NodD proteins: nod-box recognition and flavonoid-dependent transcription activation, but its role in H. seropedicae and related organisms seems to have evolved to control flavonoid metabolism. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Expanding the Halohydrin Dehalogenase Enzyme Family: Identification of Novel Enzymes by Database Mining.

Science.gov (United States)

Schallmey, Marcus; Koopmeiners, Julia; Wells, Elizabeth; Wardenga, Rainer; Schallmey, Anett

2014-12-01

Halohydrin dehalogenases are very rare enzymes that are naturally involved in the mineralization of halogenated xenobiotics. Due to their catalytic potential and promiscuity, many biocatalytic reactions have been described that have led to several interesting and industrially important applications. Nevertheless, only a few of these enzymes have been made available through recombinant techniques; hence, it is of general interest to expand the repertoire of these enzymes so as to enable novel biocatalytic applications. After the identification of specific sequence motifs, 37 novel enzyme sequences were readily identified in public sequence databases. All enzymes that could be heterologously expressed also catalyzed typical halohydrin dehalogenase reactions. Phylogenetic inference for enzymes of the halohydrin dehalogenase enzyme family confirmed that all enzymes form a distinct monophyletic clade within the short-chain dehydrogenase/reductase superfamily. In addition, the majority of novel enzymes are substantially different from previously known phylogenetic subtypes. Consequently, four additional phylogenetic subtypes were defined, greatly expanding the halohydrin dehalogenase enzyme family. We show that the enormous wealth of environmental and genome sequences present in public databases can be tapped for in silico identification of very rare but biotechnologically important biocatalysts. Our findings help to readily identify halohydrin dehalogenases in ever-growing sequence databases and, as a consequence, make even more members of this interesting enzyme family available to the scientific and industrial community. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Metagenomics as a Tool for Enzyme Discovery: Hydrolytic Enzymes from Marine-Related Metagenomes.

Science.gov (United States)

Popovic, Ana; Tchigvintsev, Anatoly; Tran, Hai; Chernikova, Tatyana N; Golyshina, Olga V; Yakimov, Michail M; Golyshin, Peter N; Yakunin, Alexander F

2015-01-01

This chapter discusses metagenomics and its application for enzyme discovery, with a focus on hydrolytic enzymes from marine metagenomic libraries. With less than one percent of culturable microorganisms in the environment, metagenomics, or the collective study of community genetics, has opened up a rich pool of uncharacterized metabolic pathways, enzymes, and adaptations. This great untapped pool of genes provides the particularly exciting potential to mine for new biochemical activities or novel enzymes with activities tailored to peculiar sets of environmental conditions. Metagenomes also represent a huge reservoir of novel enzymes for applications in biocatalysis, biofuels, and bioremediation. Here we present the results of enzyme discovery for four enzyme activities, of particular industrial or environmental interest, including esterase/lipase, glycosyl hydrolase, protease and dehalogenase.

Enzymes and Enzyme Activity Encoded by Nonenveloped Viruses.

Science.gov (United States)

Azad, Kimi; Banerjee, Manidipa; Johnson, John E

2017-09-29

Viruses are obligate intracellular parasites that rely on host cell machineries for their replication and survival. Although viruses tend to make optimal use of the host cell protein repertoire, they need to encode essential enzymatic or effector functions that may not be available or accessible in the host cellular milieu. The enzymes encoded by nonenveloped viruses-a group of viruses that lack any lipid coating or envelope-play vital roles in all the stages of the viral life cycle. This review summarizes the structural, biochemical, and mechanistic information available for several classes of enzymes and autocatalytic activity encoded by nonenveloped viruses. Advances in research and development of antiviral inhibitors targeting specific viral enzymes are also highlighted.

The use of lac-type promoters in control analysis

DEFF Research Database (Denmark)

Jensen, Peter Ruhdal; Westerhoff, H. v.; Michelsen, Ole

1993-01-01

experimentally by constructing E. coli strains, in which the chromosomal atp operon is transcribed from the lacUV5 and the tacI promoter. We measured the concentration of the c subunit of H+-ATPase, and found that the expression of this enzyme could be modulated between non-detectable levels and up to five times...... the wild-type level. Thus, in the absence of inducer, no expression of atp genes could be detected when the atp operon was controlled by the lacUV5 promoter, and we estimate that the expression was less than 0.0025 times the wild-type level. We show that the introduction of a lac Y mutation facilitated...

The surface science of enzymes

DEFF Research Database (Denmark)

Rod, Thomas Holm; Nørskov, Jens Kehlet

2002-01-01

One of the largest challenges to science in the coming years is to find the relation between enzyme structure and function. Can we predict which reactions an enzyme catalyzes from knowledge of its structure-or from its amino acid sequence? Can we use that knowledge to modify enzyme function......? To solve these problems we must understand in some detail how enzymes interact with reactants from its surroundings. These interactions take place at the surface of the enzyme and the question of enzyme function can be viewed as the surface science of enzymes. In this article we discuss how to describe...... catalysis by enzymes, and in particular the analogies between enzyme catalyzed reactions and surface catalyzed reactions. We do this by discussing two concrete examples of reactions catalyzed both in nature (by enzymes) and in industrial reactors (by inorganic materials), and show that although analogies...

Magnetically responsive enzyme powders

Energy Technology Data Exchange (ETDEWEB)

Pospiskova, Kristyna, E-mail: kristyna.pospiskova@upol.cz [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 11, 783 71 Olomouc (Czech Republic); Safarik, Ivo, E-mail: ivosaf@yahoo.com [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 11, 783 71 Olomouc (Czech Republic); Department of Nanobiotechnology, Institute of Nanobiology and Structural Biology of GCRC, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic)

2015-04-15

Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (−20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties. - Highlights: • Cross-linked enzyme powders were prepared in various liquid media. • Insoluble enzymes were magnetized using iron oxides particles. • Magnetic iron oxides particles were prepared by microwave-assisted synthesis. • Magnetic modification was performed under low (freezing) temperature. • Cross-linked powdered trypsin and lipase can be used repeatedly for reaction.

Enzymes in Fermented Fish.

Science.gov (United States)

Giyatmi; Irianto, H E

Fermented fish products are very popular particularly in Southeast Asian countries. These products have unique characteristics, especially in terms of aroma, flavor, and texture developing during fermentation process. Proteolytic enzymes have a main role in hydrolyzing protein into simpler compounds. Fermentation process of fish relies both on naturally occurring enzymes (in the muscle or the intestinal tract) as well as bacteria. Fermented fish products processed using the whole fish show a different characteristic compared to those prepared from headed and gutted fish. Endogenous enzymes like trypsin, chymotrypsin, elastase, and aminopeptidase are the most involved in the fermentation process. Muscle tissue enzymes like cathepsins, peptidases, transaminases, amidases, amino acid decarboxylases, glutamic dehydrogenases, and related enzymes may also play a role in fish fermentation. Due to the decreased bacterial number during fermentation, contribution of microbial enzymes to proteolysis may be expected prior to salting of fish. Commercial enzymes are supplemented during processing for specific purposes, such as quality improvement and process acceleration. In the case of fish sauce, efforts to accelerate fermentation process and to improve product quality have been studied by addition of enzymes such as papain, bromelain, trypsin, pepsin, and chymotrypsin. © 2017 Elsevier Inc. All rights reserved.

Thermodynamic activity-based intrinsic enzyme kinetic sheds light on enzyme-solvent interactions.

Science.gov (United States)

Grosch, Jan-Hendrik; Wagner, David; Nistelkas, Vasilios; Spieß, Antje C

2017-01-01

The reaction medium has major impact on biocatalytic reaction systems and on their economic significance. To allow for tailored medium engineering, thermodynamic phenomena, intrinsic enzyme kinetics, and enzyme-solvent interactions have to be discriminated. To this end, enzyme reaction kinetic modeling was coupled with thermodynamic calculations based on investigations of the alcohol dehydrogenase from Lactobacillus brevis (LbADH) in monophasic water/methyl tert-butyl ether (MTBE) mixtures as a model solvent. Substrate concentrations and substrate thermodynamic activities were varied separately to identify the individual thermodynamic and kinetic effects on the enzyme activity. Microkinetic parameters based on concentration and thermodynamic activity were derived to successfully identify a positive effect of MTBE on the availability of the substrate to the enzyme, but a negative effect on the enzyme performance. In conclusion, thermodynamic activity-based kinetic modeling might be a suitable tool to initially curtail the type of enzyme-solvent interactions and thus, a powerful first step to potentially understand the phenomena that occur in nonconventional media in more detail. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 33:96-103, 2017. © 2016 American Institute of Chemical Engineers.

Profiling the orphan enzymes

Science.gov (United States)

2014-01-01

The emergence of Next Generation Sequencing generates an incredible amount of sequence and great potential for new enzyme discovery. Despite this huge amount of data and the profusion of bioinformatic methods for function prediction, a large part of known enzyme activities is still lacking an associated protein sequence. These particular activities are called “orphan enzymes”. The present review proposes an update of previous surveys on orphan enzymes by mining the current content of public databases. While the percentage of orphan enzyme activities has decreased from 38% to 22% in ten years, there are still more than 1,000 orphans among the 5,000 entries of the Enzyme Commission (EC) classification. Taking into account all the reactions present in metabolic databases, this proportion dramatically increases to reach nearly 50% of orphans and many of them are not associated to a known pathway. We extended our survey to “local orphan enzymes” that are activities which have no representative sequence in a given clade, but have at least one in organisms belonging to other clades. We observe an important bias in Archaea and find that in general more than 30% of the EC activities have incomplete sequence information in at least one superkingdom. To estimate if candidate proteins for local orphans could be retrieved by homology search, we applied a simple strategy based on the PRIAM software and noticed that candidates may be proposed for an important fraction of local orphan enzymes. Finally, by studying relation between protein domains and catalyzed activities, it appears that newly discovered enzymes are mostly associated with already known enzyme domains. Thus, the exploration of the promiscuity and the multifunctional aspect of known enzyme families may solve part of the orphan enzyme issue. We conclude this review with a presentation of recent initiatives in finding proteins for orphan enzymes and in extending the enzyme world by the discovery of new

Effect of irradiation on immobilized enzymes compared with that on enzymes in solution

International Nuclear Information System (INIS)

Schachinger, L.; Schippel, C.; Altmann, E.; Diepold, B.; Yang, C.; Jaenike, M.; Hochhaeuser, E.

1985-01-01

Glucose oxidase and catalase were immobilized by attaching them to nylon fibers that had been treated with triethyloxonium-tetrafluoroborate, diaminohexane and glutaraldialdehyde according to Morris, Campell and Hornby (1975). This method assures that the enzymes are bound to a side chain of the polyamide structure. Enzyme activity (as measured by the O 2 -uptake and by microcalorimetry) was found to be unchanged after 2 years. The apparent Ksub(m)-constants of the immobilized enzymes with glucose were the same as those for enzymes in solution. GOD and catalase immobilized in poly(acrylamide) gel had the same Ksub(m)-value. Despite the high stability during storage, the radiation induced inactivation of enzymes immobilized on gel or chromosorb, an inorganic carrier, was of the same order of magnitude as that of the dissolved enzymes. The enzymes bound to nylon fibers showed a higher radiation sensitivity. This might have been caused by an additional attack on the binding site of the carrier. (orig.)

Direct Electron Transfer of Enzymes in a Biologically Assembled Conductive Nanomesh Enzyme Platform.

Science.gov (United States)

Lee, Seung-Woo; Lee, Ki-Young; Song, Yong-Won; Choi, Won Kook; Chang, Joonyeon; Yi, Hyunjung

2016-02-24

Nondestructive assembly of a nanostructured enzyme platform is developed in combination of the specific biomolecular attraction and electrostatic coupling for highly efficient direct electron transfer (DET) of enzymes with unprecedented applicability and versatility. The biologically assembled conductive nanomesh enzyme platform enables DET-based flexible integrated biosensors and DET of eight different enzyme with various catalytic activities. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Characterization of the biocontrol activity of pseudomonas fluorescens strain X reveals novel genes regulated by glucose.

Directory of Open Access Journals (Sweden)

Gerasimos F Kremmydas

Full Text Available Pseudomonas fluorescens strain X, a bacterial isolate from the rhizosphere of bean seedlings, has the ability to suppress damping-off caused by the oomycete Pythium ultimum. To determine the genes controlling the biocontrol activity of strain X, transposon mutagenesis, sequencing and complementation was performed. Results indicate that, biocontrol ability of this isolate is attributed to gcd gene encoding glucose dehydrogenase, genes encoding its co-enzyme pyrroloquinoline quinone (PQQ, and two genes (sup5 and sup6 which seem to be organized in a putative operon. This operon (named supX consists of five genes, one of which encodes a non-ribosomal peptide synthase. A unique binding site for a GntR-type transcriptional factor is localized upstream of the supX putative operon. Synteny comparison of the genes in supX revealed that they are common in the genus Pseudomonas, but with a low degree of similarity. supX shows high similarity only to the mangotoxin operon of Ps. syringae pv. syringae UMAF0158. Quantitative real-time PCR analysis indicated that transcription of supX is strongly reduced in the gcd and PQQ-minus mutants of Ps. fluorescens strain X. On the contrary, transcription of supX in the wild type is enhanced by glucose and transcription levels that appear to be higher during the stationary phase. Gcd, which uses PQQ as a cofactor, catalyses the oxidation of glucose to gluconic acid, which controls the activity of the GntR family of transcriptional factors. The genes in the supX putative operon have not been implicated before in the biocontrol of plant pathogens by pseudomonads. They are involved in the biosynthesis of an antimicrobial compound by Ps. fluorescens strain X and their transcription is controlled by glucose, possibly through the activity of a GntR-type transcriptional factor binding upstream of this putative operon.

Enzymes for improved biomass conversion

Science.gov (United States)

Brunecky, Roman; Himmel, Michael E.

2016-02-02

Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

The fruRBA Operon Is Necessary for Group A Streptococcal Growth in Fructose and for Resistance to Neutrophil Killing during Growth in Whole Human Blood

Science.gov (United States)

Valdes, Kayla M.; Sundar, Ganesh S.; Vega, Luis A.; Belew, Ashton T.; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M.

2016-01-01

Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes (the group A Streptococcus [GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the fru locus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fru operon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-d-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. PMID:26787724

An overview of technologies for immobilization of enzymes and surface analysis techniques for immobilized enzymes

Science.gov (United States)

Mohamad, Nur Royhaila; Marzuki, Nur Haziqah Che; Buang, Nor Aziah; Huyop, Fahrul; Wahab, Roswanira Abdul

2015-01-01

The current demands of sustainable green methodologies have increased the use of enzymatic technology in industrial processes. Employment of enzyme as biocatalysts offers the benefits of mild reaction conditions, biodegradability and catalytic efficiency. The harsh conditions of industrial processes, however, increase propensity of enzyme destabilization, shortening their industrial lifespan. Consequently, the technology of enzyme immobilization provides an effective means to circumvent these concerns by enhancing enzyme catalytic properties and also simplify downstream processing and improve operational stability. There are several techniques used to immobilize the enzymes onto supports which range from reversible physical adsorption and ionic linkages, to the irreversible stable covalent bonds. Such techniques produce immobilized enzymes of varying stability due to changes in the surface microenvironment and degree of multipoint attachment. Hence, it is mandatory to obtain information about the structure of the enzyme protein following interaction with the support surface as well as interactions of the enzymes with other proteins. Characterization technologies at the nanoscale level to study enzymes immobilized on surfaces are crucial to obtain valuable qualitative and quantitative information, including morphological visualization of the immobilized enzymes. These technologies are pertinent to assess efficacy of an immobilization technique and development of future enzyme immobilization strategies. PMID:26019635

Enzyme inhibition by iminosugars

DEFF Research Database (Denmark)

López, Óscar; Qing, Feng-Ling; Pedersen, Christian Marcus

2013-01-01

Imino- and azasugar glycosidase inhibitors display pH dependant inhibition reflecting that both the inhibitor and the enzyme active site have groups that change protonation state with pH. With the enzyme having two acidic groups and the inhibitor one basic group, enzyme-inhibitor complexes...

Targeted enzyme prodrug therapies.

Science.gov (United States)

Schellmann, N; Deckert, P M; Bachran, D; Fuchs, H; Bachran, C

2010-09-01

The cure of cancer is still a formidable challenge in medical science. Long-known modalities including surgery, chemotherapy and radiotherapy are successful in a number of cases; however, invasive, metastasized and inaccessible tumors still pose an unresolved and ongoing problem. Targeted therapies designed to locate, detect and specifically kill tumor cells have been developed in the past three decades as an alternative to treat troublesome cancers. Most of these therapies are either based on antibody-dependent cellular cytotoxicity, targeted delivery of cytotoxic drugs or tumor site-specific activation of prodrugs. The latter is a two-step procedure. In the first step, a selected enzyme is accumulated in the tumor by guiding the enzyme or its gene to the neoplastic cells. In the second step, a harmless prodrug is applied and specifically converted by this enzyme into a cytotoxic drug only at the tumor site. A number of targeting systems, enzymes and prodrugs were investigated and improved since the concept was first envisioned in 1974. This review presents a concise overview on the history and latest developments in targeted therapies for cancer treatment. We cover the relevant technologies such as antibody-directed enzyme prodrug therapy (ADEPT), gene-directed enzyme prodrug therapy (GDEPT) as well as related therapies such as clostridial- (CDEPT) and polymer-directed enzyme prodrug therapy (PDEPT) with emphasis on prodrug-converting enzymes, prodrugs and drugs.

Enzyme-MOF (metal-organic framework) composites.

Science.gov (United States)

Lian, Xizhen; Fang, Yu; Joseph, Elizabeth; Wang, Qi; Li, Jialuo; Banerjee, Sayan; Lollar, Christina; Wang, Xuan; Zhou, Hong-Cai

2017-06-06

The ex vivo application of enzymes in various processes, especially via enzyme immobilization techniques, has been extensively studied in recent years in order to enhance the recyclability of enzymes, to minimize enzyme contamination in the product, and to explore novel horizons for enzymes in biomedical applications. Possessing remarkable amenability in structural design of the frameworks as well as almost unparalelled surface tunability, Metal-Organic Frameworks (MOFs) have been gaining popularity as candidates for enzyme immobilization platforms. Many MOF-enzyme composites have achieved unprecedented results, far outperforming free enzymes in many aspects. This review summarizes recent developments of MOF-enzyme composites with special emphasis on preparative techniques and the synergistic effects of enzymes and MOFs. The applications of MOF-enzyme composites, primarily in transferation, catalysis and sensing, are presented as well. The enhancement of enzymatic activity of the composites over free enzymes in biologically incompatible conditions is emphasized in many cases.

CLONING AND SEQUENCING OF THE GENE FOR A LACTOCOCCAL ENDOPEPTIDASE, AN ENZYME WITH SEQUENCE SIMILARITY TO MAMMALIAN ENKEPHALINASE

NARCIS (Netherlands)

Mierau, Igor; Tan, Paris S.T.; Haandrikman, Alfred J.; Kok, Jan; Leenhouts, Kees J.; Konings, Wil N.; Venema, Gerard

The gene specifying an endopeptidase of Lactococcus lactis, named pepO, was cloned from a genomic library of L. lactis subsp. cremoris P8-247 in lambdaEMBL3 and was subsequently sequenced. pepO is probably the last gene of an operon encoding the binding-protein-dependent oligopeptide transport

Identification and in vitro analysis of the GatD/MurT enzyme-complex catalyzing lipid II amidation in Staphylococcus aureus.

Directory of Open Access Journals (Sweden)

Daniela Münch

2012-01-01

Full Text Available The peptidoglycan of Staphylococcus aureus is characterized by a high degree of crosslinking and almost completely lacks free carboxyl groups, due to amidation of the D-glutamic acid in the stem peptide. Amidation of peptidoglycan has been proposed to play a decisive role in polymerization of cell wall building blocks, correlating with the crosslinking of neighboring peptidoglycan stem peptides. Mutants with a reduced degree of amidation are less viable and show increased susceptibility to methicillin. We identified the enzymes catalyzing the formation of D-glutamine in position 2 of the stem peptide. We provide biochemical evidence that the reaction is catalyzed by a glutamine amidotransferase-like protein and a Mur ligase homologue, encoded by SA1707 and SA1708, respectively. Both proteins, for which we propose the designation GatD and MurT, are required for amidation and appear to form a physically stable bi-enzyme complex. To investigate the reaction in vitro we purified recombinant GatD and MurT His-tag fusion proteins and their potential substrates, i.e. UDP-MurNAc-pentapeptide, as well as the membrane-bound cell wall precursors lipid I, lipid II and lipid II-Gly₅. In vitro amidation occurred with all bactoprenol-bound intermediates, suggesting that in vivo lipid II and/or lipid II-Gly₅ may be substrates for GatD/MurT. Inactivation of the GatD active site abolished lipid II amidation. Both, murT and gatD are organized in an operon and are essential genes of S. aureus. BLAST analysis revealed the presence of homologous transcriptional units in a number of gram-positive pathogens, e.g. Mycobacterium tuberculosis, Streptococcus pneumonia and Clostridium perfringens, all known to have a D-iso-glutamine containing PG. A less negatively charged PG reduces susceptibility towards defensins and may play a general role in innate immune signaling.

Enzyme recycling in lignocellulosic biorefineries

DEFF Research Database (Denmark)

Jørgensen, Henning; Pinelo, Manuel

2017-01-01

platform. Cellulases are the most important enzymes required in this process, but the complex nature of lignocellulose requires several other enzymes (hemicellulases and auxiliary enzymes) for efficient hydrolysis. Enzyme recycling increases the catalytic productivity of the enzymes by reusing them...... for several batches of hydrolysis, and thereby reduces the overall cost associated with the hydrolysis. Research on this subject has been ongoing for many years and several promising technologies and methods have been developed and demonstrated. But only in a very few cases have these technologies been...... upscaled and tested in industrial settings, mainly because of many difficulties with recycling of enzymes from the complex lignocellulose hydrolyzate at industrially relevant conditions, i.e., high solids loadings. The challenges are associated with the large number of different enzymes required...

Enzymes of industrial purpose - review of the market of enzyme preparations and prospects for its development

Directory of Open Access Journals (Sweden)

A. A. Tolkacheva

2017-01-01

Full Text Available Microbial enzyme preparations are increasingly replacing conventional chemical catalysts in a number of industrial processes. Such drugs, in addition to environmental friendliness and high activity, have a number of advantages over enzyme preparations of vegetable and animal origin, namely: the production of microbial enzymes in bioreactors is easily controlled and predictable; excreted microbiological enzymes are more stable than intracellular animals and plant enzymes; the genetic diversity of microorganisms makes it possible to produce enzyme preparations with a wide range of specificity; microbiological enzymes can be synthesized year-round, in contrast to the production of plant enzymes, which is often seasonal. The leaders of the world market of enzymes are proteases and amylases, which account for 25% and 15%, respectively. Over the past five years, the world market for carbohydrases, including mainly amylases, cellulases and xylanases, has been the fastest growing segment of the enzyme market with an aggregate annual growth rate of more than 7.0%. Another major product of the industrial enzyme market, which has a great potential for growth, is lipases. From the point of view of designation, the main part is represented by food and food enzymes. The Russian market continues to be unsaturated - the current supply is not able to meet the needs of the Russian feed and food industry in enzyme preparations. Enzyme preparations of domestic producers are in demand in forage production, while food industrial enterprises prefer imported products. The most significant enterprises in the enzymatic industry in Russia at the moment are Sibbiofarm, AgroSistema, Agroferment. In the light of the Russian policy of increasing food security, the development of the domestic enzyme industry is an extremely topical task.

Continuous enzyme reactions with immobilized enzyme tubes prepared by radiation cast-polymerization

International Nuclear Information System (INIS)

Kumakura, Minoru; Kaetsu, Isao

1986-01-01

Immobilized glucose oxidase tubes were prepared by radiation cast-polymerization of 2-hydroxyethyl methacrylate and tetraethyleneglycol diacrylate monomer at low temperatures. The immobilized enzyme tubes which were spirally set in a water bath were used as reactor, in which the enzyme activity varied with tube size and flow rate of the substrate. The conversion yield of the substrate in continuous enzyme reaction was about 80%. (author)

Elucidation of the regulatory role of the fructose operon reveals a novel target for enhancing the NADPH supply in Corynebacterium glutamicum

DEFF Research Database (Denmark)

Wang, Zhihao; Chan, Siu Hung Joshua; Sudarsan, Suresh

2016-01-01

is linked to redox and to the general metabolism. We here provide new insights into the regulation of the metabolism of this important platform organism by systematically characterizing mutants carrying various lesions in the fructose operon. Initially, we found that a strain where the dedicated fructose...... uptake system had been inactivated (KO-ptsF) was hampered in growth on sucrose minimal medium, and suppressor mutants appeared readily. Comparative genomic analysis in conjunction with enzymatic assays revealed that suppression was linked to inactivation of the pfkB gene, encoding a fructose-1-phosphate...... kinase. Detailed characterization of KO-ptsF, KO-pfkB and double knock-out (DKO) derivatives revealed a strong role for sugar-phosphates, especially fructose-1-phosphate (F1P), in governing sugar as well as redox metabolism due to effects on transcriptional regulation of key genes. These findings allowed...

Non-homologous isofunctional enzymes: a systematic analysis of alternative solutions in enzyme evolution.

Science.gov (United States)

Omelchenko, Marina V; Galperin, Michael Y; Wolf, Yuri I; Koonin, Eugene V

2010-04-30

Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. These results indicate that at least some of the non-homologous isofunctional enzymes were recruited relatively recently from enzyme families that are active against related substrates and are sufficiently flexible to accommodate changes in substrate specificity.

Bistability and Biofilm Formation in Bacillus subtilis

Science.gov (United States)

Chai, Yunrong; Chu, Frances; Kolter, Roberto; Losick, Richard

2008-01-01

Summary Biofilms of Bacillus subtilis consist of long chains of cells that are held together in bundles by an extracellular matrix of exopolysaccharide and the protein TasA. The exopolysaccharide is produced by enzymes encoded by the epsA-O operon and the gene encoding TasA is located in the yqxM-sipW-tasA operon. Both operons are under the control of the repressor SinR. Derepression is mediated by the antirepressor SinI, which binds to SinR with a 1:1 stoichiometry. Paradoxically, in medium promoting derepression of the matrix operons, the overall concentration of SinR in the culture greatly exceeded that of SinI. We show that under biofilm-promoting conditions sinI, which is under the control of the response regulator Spo0A, was expressed only in a small subpopulation of cells, whereas sinR was expressed in almost all cells. Activation of Spo0A is known to be subject to a bistable switch, and we infer that SinI reaches levels sufficient to trigger matrix production only in the subpopulation of cells in which Spo0A is active. Additionally, evidence suggests that sinI is expressed at intermediate, but not low or high, levels of Spo0A activity, which may explain why certain nutritional conditions are more effective in promoting biofilm formation than others. PMID:18047568

Enzyme activity assay of glycoprotein enzymes based on a boronate affinity molecularly imprinted 96-well microplate.

Science.gov (United States)

Bi, Xiaodong; Liu, Zhen

2014-12-16

Enzyme activity assay is an important method in clinical diagnostics. However, conventional enzyme activity assay suffers from apparent interference from the sample matrix. Herein, we present a new format of enzyme activity assay that can effectively eliminate the effects of the sample matrix. The key is a 96-well microplate modified with molecularly imprinted polymer (MIP) prepared according to a newly proposed method called boronate affinity-based oriented surface imprinting. Alkaline phosphatase (ALP), a glycoprotein enzyme that has been routinely used as an indicator for several diseases in clinical tests, was taken as a representative target enzyme. The prepared MIP exhibited strong affinity toward the template enzyme (with a dissociation constant of 10(-10) M) as well as superb tolerance for interference. Thus, the enzyme molecules in a complicated sample matrix could be specifically captured and cleaned up for enzyme activity assay, which eliminated the interference from the sample matrix. On the other hand, because the boronate affinity MIP could well retain the enzymatic activity of glycoprotein enzymes, the enzyme captured by the MIP was directly used for activity assay. Thus, additional assay time and possible enzyme or activity loss due to an enzyme release step required by other methods were avoided. Assay of ALP in human serum was successfully demonstrated, suggesting a promising prospect of the proposed method in real-world applications.

Enzymic lactose hydrolysis

Energy Technology Data Exchange (ETDEWEB)

Miller, J J; Brand, J C

1980-01-01

Acid or enzymic hydrolysis can be used to hydrolyze lactose. Advantages of both are compared and details of enzymic hydrolysis using yeast or fungal enzymes given. The new scheme outlined involves recycling lactase. Because lactose and lactase react to ultrafiltration (UF) membranes differently separation is possible. Milk or milk products are ultrafiltered to separate a concentrate from a lactose-rich permeate which is treated with lactase in a reactor until hydrolysis reaches a required level. The lactase can be removed by UF as it does not permeate the membrane, and it is recycled back to the reactor. Permeate from the second UF stage may or may not be recombined with the concentrate from the first stage to produce a low lactose product (analysis of a typical low-lactose dried whole milk is given). Batch or continuous processes are explained and a batch process without enzyme recovery is discussed. (Refs. 4).

Enzyme Mimics: Advances and Applications.

Science.gov (United States)

Kuah, Evelyn; Toh, Seraphina; Yee, Jessica; Ma, Qian; Gao, Zhiqiang

2016-06-13

Enzyme mimics or artificial enzymes are a class of catalysts that have been actively pursued for decades and have heralded much interest as potentially viable alternatives to natural enzymes. Aside from having catalytic activities similar to their natural counterparts, enzyme mimics have the desired advantages of tunable structures and catalytic efficiencies, excellent tolerance to experimental conditions, lower cost, and purely synthetic routes to their preparation. Although still in the midst of development, impressive advances have already been made. Enzyme mimics have shown immense potential in the catalysis of a wide range of chemical and biological reactions, the development of chemical and biological sensing and anti-biofouling systems, and the production of pharmaceuticals and clean fuels. This Review concerns the development of various types of enzyme mimics, namely polymeric and dendrimeric, supramolecular, nanoparticulate and proteinic enzyme mimics, with an emphasis on their synthesis, catalytic properties and technical applications. It provides an introduction to enzyme mimics and a comprehensive summary of the advances and current standings of their applications, and seeks to inspire researchers to perfect the design and synthesis of enzyme mimics and to tailor their functionality for a much wider range of applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Adsorption of monocomponent enzymes in enzyme mixture analyzed quantitatively during hydrolysis of lignocellulose substrates.

Science.gov (United States)

Várnai, Anikó; Viikari, Liisa; Marjamaa, Kaisa; Siika-aho, Matti

2011-01-01

The adsorption of purified Trichoderma reesei cellulases (TrCel7A, TrCel6A and TrCel5A) and xylanase TrXyn11 and Aspergillus niger β-glucosidase AnCel3A was studied in enzyme mixture during hydrolysis of two pretreated lignocellulosic materials, steam pretreated and catalytically delignified spruce, along with microcrystalline cellulose (Avicel). The enzyme mixture was compiled to resemble the composition of commercial cellulase preparations. The hydrolysis was carried out at 35 °C to mimic the temperature of the simultaneous saccharification and fermentation (SSF). Enzyme adsorption was followed by analyzing the activity and the protein amount of the individual free enzymes in the hydrolysis supernatant. Most enzymes adsorbed quickly at early stages of the hydrolysis and remained bound throughout the hydrolysis, although the conversion reached was fairly high. Only with the catalytically oxidized spruce samples, the bound enzymes started to be released as the hydrolysis degree reached 80%. The results based on enzyme activities and protein assay were in good accordance. Copyright © 2010 Elsevier Ltd. All rights reserved.

Characterising Complex Enzyme Reaction Data.

Directory of Open Access Journals (Sweden)

Handan Melike Dönertaş

Full Text Available The relationship between enzyme-catalysed reactions and the Enzyme Commission (EC number, the widely accepted classification scheme used to characterise enzyme activity, is complex and with the rapid increase in our knowledge of the reactions catalysed by enzymes needs revisiting. We present a manual and computational analysis to investigate this complexity and found that almost one-third of all known EC numbers are linked to more than one reaction in the secondary reaction databases (e.g., KEGG. Although this complexity is often resolved by defining generic, alternative and partial reactions, we have also found individual EC numbers with more than one reaction catalysing different types of bond changes. This analysis adds a new dimension to our understanding of enzyme function and might be useful for the accurate annotation of the function of enzymes and to study the changes in enzyme function during evolution.

Enzyme Immobilization: An Overview on Methods, Support Material, and Applications of Immobilized Enzymes.

Science.gov (United States)

Sirisha, V L; Jain, Ankita; Jain, Amita

Immobilized enzymes can be used in a wide range of processes. In recent years, a variety of new approaches have emerged for the immobilization of enzymes that have greater efficiency and wider usage. During the course of the last two decades, this area has rapidly expanded into a multidisciplinary field. This current study is a comprehensive review of a variety of literature produced on the different enzymes that have been immobilized on various supporting materials. These immobilized enzymes have a wide range of applications. These include applications in the sugar, fish, and wine industries, where they are used for removing organic compounds from waste water. This study also reviews their use in sophisticated biosensors for metabolite control and in situ measurements of environmental pollutants. Immobilized enzymes also find significant application in drug metabolism, biodiesel and antibiotic production, bioremediation, and the food industry. The widespread usage of immobilized enzymes is largely due to the fact that they are cheaper, environment friendly, and much easier to use when compared to equivalent technologies. © 2016 Elsevier Inc. All rights reserved.

Random-walk enzymes

Science.gov (United States)

Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.

2015-09-01

Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C →U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.

Enzyme stabilization for pesticide degradation

Energy Technology Data Exchange (ETDEWEB)

Rivers, D.B.; Frazer, F.R. III; Mason, D.W.; Tice, T.R.

1988-01-01

Enzymes offer inherent advantages and limitations as active components of formulations used to decontaminate soil and equipment contaminated with toxic materials such as pesticides. Because of the catalytic nature of enzymes, each molecule of enzyme has the potential to destroy countless molecules of a contaminating toxic compound. This degradation takes place under mild environmental conditions of pH, temperature, pressure, and solvent. The basic limitation of enzymes is their degree of stability during storage and application conditions. Stabilizing methods such as the use of additives, covalent crosslinking, covalent attachment, gel entrapment, and microencapsulation have been directed developing an enzyme preparation that is stable under extremes of pH, temperature, and exposure to organic solvents. Initial studies were conducted using the model enzymes subtilisin and horseradish peroxidase.

Enzyme Molecules in Solitary Confinement

Directory of Open Access Journals (Sweden)

Raphaela B. Liebherr

2014-09-01

Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.

Enzyme technology: Key to selective biorefining

DEFF Research Database (Denmark)

Meyer, Anne S.

2014-01-01

to the reaction is a unique trait of enzyme catalysis. Since enzyme selectivity means that a specific reaction is catalysed between particular species to produce definite products, enzymes are particularly fit for converting specific compounds in mixed biomass streams. Since enzymes are protein molecules...... their rational use in biorefinery processes requires an understanding of the basic features of enzymes and reaction traits with respect to specificity, kinetics, reaction optima, stability and structure-function relations – we are now at a stage where it is possible to use nature’s enzyme structures as starting...... point and then improve the functional traits by targeted mutation of the protein. The talk will display some of our recent hypotheses related to enzyme action, recently obtained results within knowledge-based enzyme improvements as well as cast light on research methods used in optimizing enzyme...

Phage lytic enzymes: a history.

Science.gov (United States)

Trudil, David

2015-02-01

There are many recent studies regarding the efficacy of bacteriophage-related lytic enzymes: the enzymes of 'bacteria-eaters' or viruses that infect bacteria. By degrading the cell wall of the targeted bacteria, these lytic enzymes have been shown to efficiently lyse Gram-positive bacteria without affecting normal flora and non-related bacteria. Recent studies have suggested approaches for lysing Gram-negative bacteria as well (Briersa Y, et al., 2014). These enzymes include: phage-lysozyme, endolysin, lysozyme, lysin, phage lysin, phage lytic enzymes, phageassociated enzymes, enzybiotics, muralysin, muramidase, virolysin and designations such as Ply, PAE and others. Bacteriophages are viruses that kill bacteria, do not contribute to antimicrobial resistance, are easy to develop, inexpensive to manufacture and safe for humans, animals and the environment. The current focus on lytic enzymes has been on their use as anti-infectives in humans and more recently in agricultural research models. The initial translational application of lytic enzymes, however, was not associated with treating or preventing a specific disease but rather as an extraction method to be incorporated in a rapid bacterial detection assay (Bernstein D, 1997).The current review traces the translational history of phage lytic enzymes-from their initial discovery in 1986 for the rapid detection of group A streptococcus in clinical specimens to evolving applications in the detection and prevention of disease in humans and in agriculture.

The Staphylococcus aureus group II biotin protein ligase BirA is an effective regulator of biotin operon transcription and requires the DNA binding domain for full enzymatic activity.

Science.gov (United States)

Henke, Sarah K; Cronan, John E

2016-11-01

Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.

Nanoarmored Enzymes for Organic Enzymology: Synthesis and Characterization of Poly(2-Alkyloxazoline)-Enzyme Conjugates.

Science.gov (United States)

Leurs, Melanie; Tiller, Joerg C

2017-01-01

The properties of enzymes can be altered significantly by modification with polymers. Numerous different methods are known to obtain such polymer-enzyme conjugates (PECs). However, there is no universal method to render enzymes into PECs that are fully soluble in organic solvents. Here, we present a method, which achieves such high degree of modification of proteins that the majority of modified enzymes will be soluble in organic solvents. This is achieved by preparing poly(2-alkyloxazoline)s (POx) with an NH 2 end group and coupling this functional polymer via pyromellitic acid dianhydride onto the amino groups of the respective protein. The resulting PECs are capable of serving as surfactants for unmodified proteins, rendering the whole mixture organosoluble. Depending on the nature of the POx and the molecular weight and the nature of the enzyme, the PECs are soluble in chloroform or even toluene. Another advantage of this method is that the poly(2-alkyloxazoline) can be activated with the coupling agent and used for the enzyme conjugation without further purification. The POx-enzyme conjugates generated by this modification strategy show modulated catalytic activity in both, aqueous and organic, systems. © 2017 Elsevier Inc. All rights reserved.

Engineering Cellulase Enzymes for Bioenergy

Science.gov (United States)

Atreya, Meera Elizabeth

Sustainable energy sources, such as biofuels, offer increasingly important alternatives to fossil fuels that contribute less to global climate change. The energy contained within cellulosic biofuels derives from sunlight energy stored in the form of carbon-carbon bonds comprising sugars such as glucose. Second-generation biofuels are produced from lignocellulosic biomass feedstocks, including agricultural waste products and non-food crops like Miscanthus, that contain lignin and the polysaccharides hemicellulose and cellulose. Cellulose is the most abundant biological material on Earth; it is a polymer of glucose and a structural component of plant cell walls. Accessing the sugar is challenging, as the crystalline structure of cellulose resists degradation; biochemical and thermochemical means can be used to depolymerize cellulose. Cellulase enzymes catalyze the biochemical depolymerization of cellulose into glucose. Glucose can be used as a carbon source for growth of a biofuel-producing microorganism. When it converts glucose to a hydrocarbon fuel, this microbe completes the biofuels process of transforming sunlight energy into accessible, chemical energy capable of replacing non-renewable transportation fuels. Due to strong intermolecular interactions between polymer chains, cellulose is significantly more challenging to depolymerize than starch, a more accessible polymer of glucose utilized in first-generation biofuels processes (often derived from corn). While most mammals cannot digest cellulose (dietary fiber), certain fungi and bacteria produce cellulase enzymes capable of hydrolyzing it. These organisms secrete a wide variety of glycoside hydrolase and other classes of enzymes that work in concert. Because cellulase enzymes are slow-acting and expensive to produce, my aim has been to improve the properties of these enzymes as a means to make a cellulosic biofuels process possible that is more efficient and, consequently, more economical than current

Impact of enzyme loading on the efficacy and recovery of cellulolytic enzymes immobilized on enzymogel nanoparticles.

Science.gov (United States)

Samaratunga, Ashani; Kudina, Olena; Nahar, Nurun; Zakharchenko, Andrey; Minko, Sergiy; Voronov, Andriy; Pryor, Scott W

2015-03-01

Cellulase and β-glucosidase were adsorbed on a polyacrylic acid polymer brush grafted on silica nanoparticles to produce enzymogels as a form of enzyme immobilization. Enzyme loading on the enzymogels was increased to a saturation level of approximately 110 μg (protein) mg(-1) (particle) for each enzyme. Enzymogels with varied enzyme loadings were then used to determine the impact on hydrolysis rate and enzyme recovery. Soluble sugar concentrations during the hydrolysis of filter paper and Solka-Floc with the enzymogels were 45 and 53%, respectively, of concentrations when using free cellulase. β-Glucosidase enzymogels showed lower performance; hydrolyzate glucose concentrations were just 38% of those using free enzymes. Increasing enzyme loading on the enzymogels did not reduce net efficacy for cellulase and improved efficacy for β-glucosidase. The use of free cellulases and cellulase enzymogels resulted in hydrolyzates with different proportions of cellobiose and glucose, suggesting differential attachment or efficacy of endoglucanases, exoglucanases, and β-glucosidases present in cellulase mixtures. When loading β-glucosidase individually, higher enzyme loadings on the enzymogels produced higher hydrolyzate glucose concentrations. Approximately 96% of cellulase and 66 % of β-glucosidase were recovered on the enzymogels, while enzyme loading level did not impact recovery for either enzyme.

A two-component regulatory system, pehR-pehS, controls endopolygalacturonase production and virulence in the plant pathogen Erwinia carotovora subsp. carotovora.

Science.gov (United States)

Flego, D; Marits, R; Eriksson, A R; Kõiv, V; Karlsson, M B; Heikinheimo, R; Palva, E T

2000-04-01

Genes coding for the main virulence determinants of the plant pathogen Erwinia carotovora subsp. carotovora, the plant cell wall-degrading enzymes, are under the coordinate control of global regulator systems including both positive and negative factors. In addition to this global control, some virulence determinants are subject to specific regulation. We have previously shown that mutations in the pehR locus result in reduced virulence and impaired production of one of these enzymes, an endopolygalacturonase (PehA). In contrast, these pehR strains produce essentially wild-type levels of other extracellular enzymes including pectate lyases and cellulases. In this work, we characterized the pehR locus and showed that the DNA sequence is composed of two genes, designated pehR and pehS, present in an operon. Mutations in either pehR or pehS caused a Peh-negative phenotype and resulted in reduced virulence on tobacco seedlings. Complementation experiments indicated that both genes are required for transcriptional activation of the endopolygalacturonase gene, pehA, as well as restoration of virulence. Structural characterization of the pehR-pehS operon demonstrated that the corresponding polypeptides are highly similar to the two-component transcriptional regulators PhoP-PhoQ of both Escherichia coli and Salmonella typhimurium. Functional similarity of PehR-PehS with PhoP-PhoQ of E. coli and S. typhimurium was demonstrated by genetic complementation.

[Interaction between CYP450 enzymes and metabolism of traditional Chinese medicine as well as enzyme activity assay].

Science.gov (United States)

Lu, Tu-lin; Su, Lian-lin; Ji, De; Gu, Wei; Mao, Chun-qin

2015-09-01

Drugs are exogenous compounds for human bodies, and will be metabolized by many enzymes after administration. CYP450 enzyme, as a major metabolic enzyme, is an important phase I drug metabolizing enzyme. In human bodies, about 75% of drug metabolism is conducted by CYP450 enzymes, and CYP450 enzymes is the key factor for drug interactions between traditional Chinese medicine( TCM) -TCM, TCM-medicine and other drug combination. In order to make clear the interaction between metabolic enzymes and TCM metabolism, we generally chose the enzymatic activity as an evaluation index. That is to say, the enhancement or reduction of CYP450 enzyme activity was used to infer the inducing or inhibitory effect of active ingredients and extracts of traditional Chinese medicine on enzymes. At present, the common method for measuring metabolic enzyme activity is Cocktail probe drugs, and it is the key to select the suitable probe substrates. This is of great significance for study drug's absorption, distribution, metabolism and excretion (ADME) process in organisms. The study focuses on the interaction between TCMs, active ingredients, herbal extracts, cocktail probe substrates as well as CYP450 enzymes, in order to guide future studies.

BAKERY ENZYMES IN CEREAL TECHNOLOGIES

Directory of Open Access Journals (Sweden)

Václav Koman

2012-10-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE Bread is the most common and traditional food in the world. For years, enzymes such as malt and fungal alpha-amylase have been used in bread making. Due to the changes in the baking industry and the ever-increasing demand for more natural products, enzymes have gained real importance in bread-making. If an enzyme is added, it is often destroyed by the heat during the baking process. For generations, enzymes have been used for the improvement of texture and appearance, enhancement of nutritional values and generation of appealing flavours and aromas. Enzymes used in bakery industry constitute nearly one third of the market. The bakery products have undergone radical improvements in quality over the past years in terms of flavour, texture and shelf-life. The the biggest contributor for these improvementsis the usage of enzymes. Present work seeks to systematically describe bakery enzymes, their classification, benefits, usage and chemical reactions in the bread making process.doi:10.5219/193

Crosslinked Enzyme Aggregates in Hierarchically-Ordered Mesoporous Silica: A Simple and Effective Method for Enzyme Stabilization

Energy Technology Data Exchange (ETDEWEB)

Kim, Moon Il; Kim, Jungbae; Lee, Jinwoo; Jia, Hongfei; Na, Hyon Bin; Youn, Jongkyu; Kwak, Ja Hun; Dohnalkova, Alice; Grate, Jay W.; Wang, Ping; Hyeon, Taeghwan; Park, Hyun-Gyu; Chang, Ho Nam

2007-02-01

alpha-chymotrypsin (CT) and lipase (LP) were immobilized in hierarchically-ordered mesocellular mesoporous silica (HMMS) in a simple but effective way for the enzyme stabilization, which was achieved by the enzyme adsorption followed by glutaraldehyde (GA) crosslinking. This resulted in the formation of nanometer scale crosslinked enzyme aggregates (CLEAs) entrapped in the mesocellular pores of HMMS (37 nm), which did not leach out of HMMS through narrow mesoporous channels (13 nm). CLEA of alpha-chymotrypsin (CLEA-CT) in HMMS showed a high enzyme loading capacity and significantly increased enzyme stability. No activity decrease of CLEA-CT was observed for two weeks under even rigorously shaking condition, while adsorbed CT in HMMS and free CT showed a rapid inactivation due to the enzyme leaching and presumably autolysis, respectively. With the CLEA-CT in HMMS, however, there was no tryptic digestion observed suggesting that the CLEA-CT is not susceptible to autolysis. Moreover, CLEA of lipase (CLEA-LP) in HMMS retained 30% specific activity of free lipase with greatly enhanced stability. This work demonstrates that HMMS can be efficiently employed as host materials for enzyme immobilization leading to highly enhanced stability of the immobilized enzymes with high enzyme loading and activity.

Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

International Nuclear Information System (INIS)

Thomas, S.M.; Sedgwick, S.G.

1989-01-01

Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

Immobilized enzymes and cells

Energy Technology Data Exchange (ETDEWEB)

Bucke, C; Wiseman, A

1981-04-04

This article reviews the current state of the art of enzyme and cell immobilization and suggests advances which might be made during the 1980's. Current uses of immobilized enzymes include the use of glucoamylase in the production of glucose syrups from starch and glucose isomerase in the production of high fructose corn syrup. Possibilities for future uses of immobilized enzymes and cells include the utilization of whey and the production of ethanol.

Terminator Operon Reporter: combining a transcription termination switch with reporter technology for improved gene synthesis and synthetic biology applications.

Science.gov (United States)

Zampini, Massimiliano; Mur, Luis A J; Rees Stevens, Pauline; Pachebat, Justin A; Newbold, C James; Hayes, Finbarr; Kingston-Smith, Alison

2016-05-25

Synthetic biology is characterized by the development of novel and powerful DNA fabrication methods and by the application of engineering principles to biology. The current study describes Terminator Operon Reporter (TOR), a new gene assembly technology based on the conditional activation of a reporter gene in response to sequence errors occurring at the assembly stage of the synthetic element. These errors are monitored by a transcription terminator that is placed between the synthetic gene and reporter gene. Switching of this terminator between active and inactive states dictates the transcription status of the downstream reporter gene to provide a rapid and facile readout of the accuracy of synthetic assembly. Designed specifically and uniquely for the synthesis of protein coding genes in bacteria, TOR allows the rapid and cost-effective fabrication of synthetic constructs by employing oligonucleotides at the most basic purification level (desalted) and without the need for costly and time-consuming post-synthesis correction methods. Thus, TOR streamlines gene assembly approaches, which are central to the future development of synthetic biology.

Imbalance between pulmonary angiotensin-converting enzyme and angiotensin-converting enzyme 2 activity in acute respiratory distress syndrome

NARCIS (Netherlands)

Wösten-van Asperen, Roelie M.; Bos, Albert P.; Bem, Reinout A.; Dierdorp, Barbara S.; Dekker, Tamara; van Goor, Harry; Kamilic, Jelena; van der Loos, Chris M.; van den Berg, Elske; Bruijn, Martijn; van Woensel, Job B.; Lutter, René

2013-01-01

Angiotensin-converting enzyme and its effector peptide angiotensin II have been implicated in the pathogenesis of acute respiratory distress syndrome. Recently, angiotensin-converting enzyme 2 was identified as the counter-regulatory enzyme of angiotensin-converting enzyme that converts angiotensin

Imbalance between pulmonary angiotensin-converting enzyme and angiotensin-converting enzyme 2 activity in acute respiratory distress syndrome

NARCIS (Netherlands)

Wosten-van Asperen, Roelie M.; Bos, Albert; Bem, Reinout A.; Dierdorp, Barbara S.; Dekker, Tamara; van Goor, Harry; Kamilic, Jelena; van der Loos, Chris M.; van den Berg, Elske; Bruijn, Martijn; van Woensel, Job B.; Lutter, Rene

2013-01-01

Objective: Angiotensin-converting enzyme and its effector peptide angiotensin II have been implicated in the pathogenesis of acute respiratory distress syndrome. Recently, angiotensin-converting enzyme 2 was identified as the counter-regulatory enzyme of angiotensin-converting enzyme that converts

Immobilization of enzymes using non-ionic colloidal liquid aphrons (CLAs): Surface and enzyme effects.

Science.gov (United States)

Ward, Keeran; Xi, Jingshu; Stuckey, David C

2015-12-01

The use of non-ionic colloidal liquid aphrons (CLAs) as a support for enzyme immobilisation was investigated. Formulation required the mixing of an aqueous-surfactant solution with a relatively non-polar solvent-surfactant solution, forming a solvent droplet surrounded by a thin stabilised aqueous film (soapy shell). Studies utilising anionic surfactants have showed increased retention, however, very little have been understood about the forces governing immobilisation. This study seeks to determine the effects of enzyme properties on CLA immobilisation by examining a non-ionic/non-polar solvent system comprised of two non-ionic surfactants, Tween 20 and 80, mineral oil and the enzymes lipase, aprotinin and α-chymotrypsin. From these results it was deduced that hydrophobic interactions strongly governed immobilisation. Confocal Scanning Laser Microscopy (CSLM) revealed that immobilisation was predominantly achieved by surface adsorption attributed to hydrophobic interactions between the enzyme and the CLA surface. Enzyme surface affinity was found to increase when added directly to the formulation (pre-manufacture addition), as opposed to the bulk continuous phase (post-manufacture addition), with α-chymotrypsin and aprotinin being the most perturbed, while lipase was relatively unaffected. The effect of zeta potential on immobilisation showed that enzymes adsorbed better closer to their pI, indicating that charge minimisation was necessary for immobilisation. Finally, the effect of increasing enzyme concentration in the aqueous phase resulted in an increase in adsorption for all enzymes due to cooperativity between protein molecules, with saturation occurring faster at higher adsorption rates. Copyright © 2015 Elsevier B.V. All rights reserved.

Allosteric regulation of epigenetic modifying enzymes.

Science.gov (United States)

Zucconi, Beth E; Cole, Philip A

2017-08-01

Epigenetic enzymes including histone modifying enzymes are key regulators of gene expression in normal and disease processes. Many drug development strategies to target histone modifying enzymes have focused on ligands that bind to enzyme active sites, but allosteric pockets offer potentially attractive opportunities for therapeutic development. Recent biochemical studies have revealed roles for small molecule and peptide ligands binding outside of the active sites in modulating the catalytic activities of histone modifying enzymes. Here we highlight several examples of allosteric regulation of epigenetic enzymes and discuss the biological significance of these findings. Copyright © 2017 Elsevier Ltd. All rights reserved.

What makes ribosome-mediated transcriptional attenuation sensitive to amino acid limitation?

Directory of Open Access Journals (Sweden)

Johan Elf

2005-06-01

Full Text Available Ribosome-mediated transcriptional attenuation mechanisms are commonly used to control amino acid biosynthetic operons in bacteria. The mRNA leader of such an operon contains an open reading frame with "regulatory" codons, cognate to the amino acid that is synthesized by the enzymes encoded by the operon. When the amino acid is in short supply, translation of the regulatory codons is slow, which allows transcription to continue into the structural genes of the operon. When amino acid supply is in excess, translation of regulatory codons is rapid, which leads to termination of transcription. We use a discrete master equation approach to formulate a probabilistic model for the positioning of the RNA polymerase and the ribosome in the attenuator leader sequence. The model describes how the current rate of amino acid supply compared to the demand in protein synthesis (signal determines the expression of the amino acid biosynthetic operon (response. The focus of our analysis is on the sensitivity of operon expression to a change in the amino acid supply. We show that attenuation of transcription can be hyper-sensitive for two main reasons. The first is that its response depends on the outcome of a race between two multi-step mechanisms with synchronized starts: transcription of the leader of the operon, and translation of its regulatory codons. The relative change in the probability that transcription is aborted (attenuated can therefore be much larger than the relative change in the time it takes for the ribosome to read a regulatory codon. The second is that the general usage frequencies of codons of the type used in attenuation control are small. A small percentage decrease in the rate of supply of the controlled amino acid can therefore lead to a much larger percentage decrease in the rate of reading a regulatory codon. We show that high sensitivity further requires a particular choice of regulatory codon among several synonymous codons for the

DGAT enzymes and triacylglycerol biosynthesis

Science.gov (United States)

Yen, Chi-Liang Eric; Stone, Scot J.; Koliwad, Suneil; Harris, Charles; Farese, Robert V.

2008-01-01

Triacylglycerols (triglycerides) (TGs) are the major storage molecules of metabolic energy and FAs in most living organisms. Excessive accumulation of TGs, however, is associated with human diseases, such as obesity, diabetes mellitus, and steatohepatitis. The final and the only committed step in the biosynthesis of TGs is catalyzed by acyl-CoA:diacylglycerol acyltransferase (DGAT) enzymes. The genes encoding two DGAT enzymes, DGAT1 and DGAT2, were identified in the past decade, and the use of molecular tools, including mice deficient in either enzyme, has shed light on their functions. Although DGAT enzymes are involved in TG synthesis, they have distinct protein sequences and differ in their biochemical, cellular, and physiological functions. Both enzymes may be useful as therapeutic targets for diseases. Here we review the current knowledge of DGAT enzymes, focusing on new advances since the cloning of their genes, including possible roles in human health and diseases. PMID:18757836

de novo computational enzyme design.

Science.gov (United States)

Zanghellini, Alexandre

2014-10-01

Recent advances in systems and synthetic biology as well as metabolic engineering are poised to transform industrial biotechnology by allowing us to design cell factories for the sustainable production of valuable fuels and chemicals. To deliver on their promises, such cell factories, as much as their brick-and-mortar counterparts, will require appropriate catalysts, especially for classes of reactions that are not known to be catalyzed by enzymes in natural organisms. A recently developed methodology, de novo computational enzyme design can be used to create enzymes catalyzing novel reactions. Here we review the different classes of chemical reactions for which active protein catalysts have been designed as well as the results of detailed biochemical and structural characterization studies. We also discuss how combining de novo computational enzyme design with more traditional protein engineering techniques can alleviate the shortcomings of state-of-the-art computational design techniques and create novel enzymes with catalytic proficiencies on par with natural enzymes. Copyright © 2014 Elsevier Ltd. All rights reserved.

Measurement of enzyme activity.

Science.gov (United States)

Harris, T K; Keshwani, M M

2009-01-01

To study and understand the nature of living cells, scientists have continually employed traditional biochemical techniques aimed to fractionate and characterize a designated network of macromolecular components required to carry out a particular cellular function. At the most rudimentary level, cellular functions ultimately entail rapid chemical transformations that otherwise would not occur in the physiological environment of the cell. The term enzyme is used to singularly designate a macromolecular gene product that specifically and greatly enhances the rate of a chemical transformation. Purification and characterization of individual and collective groups of enzymes has been and will remain essential toward advancement of the molecular biological sciences; and developing and utilizing enzyme reaction assays is central to this mission. First, basic kinetic principles are described for understanding chemical reaction rates and the catalytic effects of enzymes on such rates. Then, a number of methods are described for measuring enzyme-catalyzed reaction rates, which mainly differ with regard to techniques used to detect and quantify concentration changes of given reactants or products. Finally, short commentary is given toward formulation of reaction mixtures used to measure enzyme activity. Whereas a comprehensive treatment of enzymatic reaction assays is not within the scope of this chapter, the very core principles that are presented should enable new researchers to better understand the logic and utility of any given enzymatic assay that becomes of interest.

Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

International Nuclear Information System (INIS)

Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.

1987-01-01

The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury

Thermodynamics of Enzyme-Catalyzed Reactions Database

Science.gov (United States)

SRD 74 Thermodynamics of Enzyme-Catalyzed Reactions Database (Web, free access)   The Thermodynamics of Enzyme-Catalyzed Reactions Database contains thermodynamic data on enzyme-catalyzed reactions that have been recently published in the Journal of Physical and Chemical Reference Data (JPCRD). For each reaction the following information is provided: the reference for the data, the reaction studied, the name of the enzyme used and its Enzyme Commission number, the method of measurement, the data and an evaluation thereof.

Respiratory arsenate reductase as a bidirectional enzyme

Science.gov (United States)

Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.

2009-01-01

The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

Identification of a locus controlling expression of luminescence genes in Vibrio harveyi.

Science.gov (United States)

Martin, M; Showalter, R; Silverman, M

1989-05-01

Mutagenesis with transposon mini-Mulac was used to identify loci containing genes for bioluminescence (lux) in the marine bacterium Vibrio harveyi. Transposon insertions which resulted in a Lux- phenotype were mapped to two unlinked regions of the genome. Region I contained the luxCDABE operon which was previously shown to encode the enzymes luciferase and fatty acid reductase, which are required for light production. The other locus, region II, which was identified for the first time in this study, appeared to have a regulatory function. In Northern blot analysis of mRNA from mutants with defects in this region, no transcription from the luxCDABE operon could be detected. Strains with transposon-generated lux::lacZ gene fusions were used to analyze control of the transcription of these regions. Expression of luminescence in the wild type was strongly influenced by the density of the culture, and in strains with the lacZ indicator gene coupled to the luxCDABE operon, beta-galactosidase synthesis was density dependent. So, transcription of this operon is responsive to a density-sensing mechanism. However, beta-galactosidase synthesis in strains with lacZ fused to the region II transcriptional unit did not respond to cell density. The organization and regulation of the lux genes of V. harveyi are discussed, particularly with regard to the contrasts observed with the lux system of the fish light-organ symbiont Vibrio fischeri.

Highly efficient enzyme encapsulation in a protein nanocage: towards enzyme catalysis in a cellular nanocompartment mimic

Science.gov (United States)

Schoonen, Lise; Nolte, Roeland J. M.; van Hest, Jan C. M.

2016-07-01

The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions.The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions. Electronic supplementary information (ESI) available: Experimental procedures for the cloning, expression, and purification of all proteins, as well as supplementary figures and calculations. See DOI: 10.1039/c6nr04181g

Enzymes in biogenesis of plant cell wall polysaccharides. Enzyme characterization using tracer techniques

International Nuclear Information System (INIS)

Dickinson, D.B.

1975-01-01

Enzymes and metabolic pathways, by which starch and cell wall polysaccharides are formed, were investigated in order to learn how these processes are regulated and to identify the enzymatic regulatory mechanisms involved. Germinating lily pollen was used for studies of cell wall formation, and pollen and maize endosperm for studies of starch biosynthesis. Hexokinase being the first step in conversion of hexoses to starch, wall polysaccharides and respiratory substrates, maize endosperm enzyme was assayed by its conversion of 14 C-hexose to 14 C-hexose-6-P, and rapid separation of the two labelled compounds on anion-exchange paper. This enzyme did not appear to be under tight regulation by feed-back inhibition or activation, nor to be severely inhibited by glucose-6-P or activated by citrate. ADP-glucose pyrophosphorylase and other pyrophosphorylases were assayed radiochemically with 14 C-glucose-1-P (forward direction) or 32-PPsub(i) (reverse direction). They showed that the maize endosperm enzyme was activated by the glycolytic intermediates fructose-6-P and 3-phosphoglycerate, and that low levels of the enzyme were present in the high sucrose-low starch mutant named shrunken-2. Under optimal in-vitro assay conditions, the pollen enzyme reacted four times faster than the observed in-vivo rate of starch accumulation. Biogenesis of plant cell wall polysaccharides requires the conversion of hexose phosphates to various sugar nucleotides and utilization of the latter by the appropriate polysaccharide synthetases. Lily pollen possesses a β-1,3-glucan synthetase which is activated up to six-fold by β-linked oligosaccharides. Hence, the in-vivo activity of this enzyme may be modulated by such effector molecules

DNA-Based Enzyme Reactors and Systems

Directory of Open Access Journals (Sweden)

Veikko Linko

2016-07-01

Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.

Cold-Adapted Enzymes

Science.gov (United States)

Georlette, D.; Bentahir, M.; Claverie, P.; Collins, T.; D'amico, S.; Delille, D.; Feller, G.; Gratia, E.; Hoyoux, A.; Lonhienne, T.; Meuwis, M.-a.; Zecchinon, L.; Gerday, Ch.

In the last few years, increased attention has been focused on enzymes produced by cold-adapted micro-organisms. It has emerged that psychrophilic enzymes represent an extremely powerful tool in both protein folding investigations and for biotechnological purposes. Such enzymes are characterised by an increased thermosensitivity and, most of them, by a higher catalytic efficiency at low and moderate temperatures, when compared to their mesophilic counterparts. The high thermosensitivity probably originates from an increased flexibility of either a selected area of the molecular edifice or the overall protein structure, providing enhanced abilities to undergo conformational changes during catalysis at low temperatures. Structure modelling and recent crystallographic data have allowed to elucidate the structural parameters that could be involved in this higher resilience. It was demonstrated that each psychrophilic enzyme adopts its own adaptive strategy. It appears, moreover, that there is a continuum in the strategy of protein adaptation to temperature, as the previously mentioned structural parameters are implicated in the stability of thermophilic proteins. Additional 3D crystal structures, site-directed and random mutagenesis experiments should now be undertaken to further investigate the stability-flexibility-activity relationship.

Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

Science.gov (United States)

Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Enzyme Engineering for In Situ Immobilization.

Science.gov (United States)

Rehm, Fabian B H; Chen, Shuxiong; Rehm, Bernd H A

2016-10-14

Enzymes are used as biocatalysts in a vast range of industrial applications. Immobilization of enzymes to solid supports or their self-assembly into insoluble particles enhances their applicability by strongly improving properties such as stability in changing environments, re-usability and applicability in continuous biocatalytic processes. The possibility of co-immobilizing various functionally related enzymes involved in multistep synthesis, conversion or degradation reactions enables the design of multifunctional biocatalyst with enhanced performance compared to their soluble counterparts. This review provides a brief overview of up-to-date in vitro immobilization strategies while focusing on recent advances in enzyme engineering towards in situ self-assembly into insoluble particles. In situ self-assembly approaches include the bioengineering of bacteria to abundantly form enzymatically active inclusion bodies such as enzyme inclusions or enzyme-coated polyhydroxyalkanoate granules. These one-step production strategies for immobilized enzymes avoid prefabrication of the carrier as well as chemical cross-linking or attachment to a support material while the controlled oriented display strongly enhances the fraction of accessible catalytic sites and hence functional enzymes.

[The rise of enzyme engineering in China].

Science.gov (United States)

Li, Gaoxiang

2015-06-01

Enzyme engineering is an important part of the modern biotechnology. Industrial biocatalysis is considered the third wave of biotechnology following pharmaceutical and agricultural waves. In 25 years, China has made a mighty advances in enzyme engineering research. This review focuses on enzyme genomics, enzyme proteomics, biosynthesis, microbial conversion and biosensors in the Chinese enzyme engineering symposiums and advances in enzyme preparation industry in China.

Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

Science.gov (United States)

Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

1994-10-25

DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.

The Legionella pneumophila kai operon is implicated in stress response and confers fitness in competitive environments

Science.gov (United States)

Loza-Correa, Maria; Sahr, Tobias; Rolando, Monica; Daniels, Craig; Petit, Pierre; Skarina, Tania; Valero, Laura Gomez; Dervins-Ravault, Delphine; Honoré, Nadine; Savchenko, Aleksey; Buchrieser, Carmen

2014-01-01

Summary Legionella pneumophila uses aquatic protozoa as replication niche and protection from harsh environments. Although L. pneumophila is not known to have a circadian clock, it encodes homologues of the KaiBC proteins of Cyanobacteria that regulate circadian gene expression. We show that L. pneumophila kaiB, kaiC and the downstream gene lpp1114, are transcribed as a unit under the control of the stress sigma factor RpoS. KaiC and KaiB of L. pneumophila do not interact as evidenced by yeast and bacterial two-hybrid analyses. Fusion of the C-terminal residues of cyanobacterial KaiB to Legionella KaiB restores their interaction. In contrast, KaiC of L. pneumophila conserved autophosphorylation activity, but KaiB does not trigger the dephosphorylation of KaiC like in Cyanobacteria. The crystal structure of L. pneumophila KaiB suggests that it is an oxidoreductase-like protein with a typical thioredoxin fold. Indeed, mutant analyses revealed that the kai operon-encoded proteins increase fitness of L. pneumophila in competitive environments, and confer higher resistance to oxidative and sodium stress. The phylogenetic analysis indicates that L. pneumophila KaiBC resemble Synechosystis KaiC2B2 and not circadian KaiB1C1. Thus, the L. pneumophila Kai proteins do not encode a circadian clock, but enhance stress resistance and adaption to changes in the environments. PMID:23957615

Enzyme structure and interaction with inhibitors

International Nuclear Information System (INIS)

London, R.E.

1983-01-01

This article reviews some of the results of studies on the 13 C-labeled enzyme dihydrofolate reductase (DHFR). Nuclear magnetic resonance (NMR) techniques are used in combination with isotopic labeling to learn about the structure and dynamics of this enzyme. 13 C-labeling is used for the purpose of studying enzyme/substrate and enzyme/inhibitor interactions. A second set of studies with DHFR was designed to investigate the basis for the high affinity between the inhibitor methotrexate and DHFR. The label was placed on the inhibitor, rather than the enzyme

Positron emitter labeled enzyme inhibitors

International Nuclear Information System (INIS)

Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.; Langstrom, B.

1990-01-01

This invention involves a new strategy for imagining and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography

Interplay of protein and DNA structure revealed in simulations of the lac operon.

Directory of Open Access Journals (Sweden)

Luke Czapla

Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

Interplay of protein and DNA structure revealed in simulations of the lac operon.

Science.gov (United States)

Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

2013-01-01

The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

Compounds from silicones alter enzyme activity in curing barnacle glue and model enzymes.

Science.gov (United States)

Rittschof, Daniel; Orihuela, Beatriz; Harder, Tilmann; Stafslien, Shane; Chisholm, Bret; Dickinson, Gary H

2011-02-17

Attachment strength of fouling organisms on silicone coatings is low. We hypothesized that low attachment strength on silicones is, in part, due to the interaction of surface available components with natural glues. Components could alter curing of glues through bulk changes or specifically through altered enzyme activity. GC-MS analysis of silicone coatings showed surface-available siloxanes when the coatings were gently rubbed with a cotton swab for 15 seconds or given a 30 second rinse with methanol. Mixtures of compounds were found on 2 commercial and 8 model silicone coatings. The hypothesis that silicone components alter glue curing enzymes was tested with curing barnacle glue and with commercial enzymes. In our model, barnacle glue curing involves trypsin-like serine protease(s), which activate enzymes and structural proteins, and a transglutaminase which cross-links glue proteins. Transglutaminase activity was significantly altered upon exposure of curing glue from individual barnacles to silicone eluates. Activity of purified trypsin and, to a greater extent, transglutaminase was significantly altered by relevant concentrations of silicone polymer constituents. Surface-associated silicone compounds can disrupt glue curing and alter enzyme properties. Altered curing of natural glues has potential in fouling management.

Prediction of Wild-type Enzyme Characteristics

DEFF Research Database (Denmark)

Geertz-Hansen, Henrik Marcus

of biotechnology, including enzyme discovery and characterization. This work presents two articles on sequence-based discovery and functional annotation of enzymes in environmental samples, and two articles on analysis and prediction of enzyme thermostability and cofactor requirements. The first article presents...... a sequence-based approach to discovery of proteolytic enzymes in metagenomes obtained from the Polar oceans. We show that microorganisms living in these extreme environments of constant low temperature harbour genes encoding novel proteolytic enzymes with potential industrial relevance. The second article...... presents a web server for the processing and annotation of functional metagenomics sequencing data, tailored to meet the requirements of non-bioinformaticians. The third article presents analyses of the molecular determinants of enzyme thermostability, and a feature-based prediction method of the melting...

Therapeutic Enzymes: Applications and Approaches to Pharmacological Improvement.

Science.gov (United States)

Yari, Maryam; Ghoshoon, Mohammad B; Vakili, Bahareh; Ghasemi, Younes

2017-01-01

Among therapeutic proteins, enzymes represent small and of course profitable market. They can be used to treat important, rare, and deadly diseases. Enzyme therapy is the only available treatment for certain disorders. Here, pharmaceutical enzymes are reviewed. They are categorized in four main groups, enzymes in replacement therapy, enzymes in cancer treatment, enzymes for fibrinolysis, and finally enzymes that are used topically for various treatments. Furthermore, enzyme gene therapy and future perspective of therapeutic enzymes are mentioned in brief. There are many important approved enzymes in pharmaceutical market. Several approaches such as point mutation, fusion protein designing, glycoengineering, and PEGylation were used to achieve improved enzymes. Although sometimes enzymes were engineered to facilitate production and purification process, appropriate delivery to target sites, extending half-life, and reducing immunogenicity are among the main goals of engineering approaches. Overall, enzymes play a critical role in treatment of common and rare diseases. Evaluation of new enzymes as well as improvement of approved enzymes are of the most important challenges in biotechnology. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Specific DNA Binding of a Potential Transcriptional Regulator, Inosine 5′-Monophosphate Dehydrogenase-Related Protein VII, to the Promoter Region of a Methyl Coenzyme M Reductase I-Encoding Operon Retrieved from Methanothermobacter thermautotrophicus Strain ΔH▿

OpenAIRE

Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

2008-01-01

Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...

Immobilized enzyme reactor chromatography: Optimization of protein retention and enzyme activity in monolithic silica stationary phases

International Nuclear Information System (INIS)

Besanger, Travis R.; Hodgson, Richard J.; Green, James R.A.; Brennan, John D.

2006-01-01

Our group recently reported on the application of protein-doped monolithic silica columns for immobilized enzyme reactor chromatography, which allowed screening of enzyme inhibitors present in mixtures using mass spectrometry for detection. The enzyme was immobilized by entrapment within a bimodal meso/macroporous silica material prepared by a biocompatible sol-gel processing route. While such columns proved to be useful for applications such as screening of protein-ligand interactions, significant amounts of entrapped proteins leached from the columns owing to the high proportion of macropores within the materials. Herein, we describe a detailed study of factors affecting the morphology of protein-doped bioaffinity columns and demonstrate that specific pH values and concentrations of poly(ethylene glycol) can be used to prepare essentially mesoporous columns that retain over 80% of initially loaded enzyme in an active and accessible form and yet still retain sufficient porosity to allow pressure-driven flow in the low μL/min range. Using the enzyme γ-glutamyl transpeptidase (γ-GT), we further evaluated the catalytic constants of the enzyme entrapped in capillary columns with different silica morphologies as a function of flowrate and backpressure using the enzyme reactor assay mode. It was found that the apparent activity of the enzyme was highest in mesoporous columns that retained high levels of enzyme. In such columns, enzyme activity increased by ∼2-fold with increases in both flowrate (from 250 to 1000 nL/min) and backpressure generated (from 500 to 2100 psi) during the chromatographic activity assay owing to increases in k cat and decreases in K M , switching from diffusion controlled to reaction controlled conditions at ca. 2000 psi. These results suggest that columns with minimal macropore volumes (<5%) are advantageous for the entrapment of soluble proteins for bioaffinity and bioreactor chromatography

Toward mechanistic classification of enzyme functions.

Science.gov (United States)

Almonacid, Daniel E; Babbitt, Patricia C

2011-06-01

Classification of enzyme function should be quantitative, computationally accessible, and informed by sequences and structures to enable use of genomic information for functional inference and other applications. Large-scale studies have established that divergently evolved enzymes share conserved elements of structure and common mechanistic steps and that convergently evolved enzymes often converge to similar mechanisms too, suggesting that reaction mechanisms could be used to develop finer-grained functional descriptions than provided by the Enzyme Commission (EC) system currently in use. Here we describe how evolution informs these structure-function mappings and review the databases that store mechanisms of enzyme reactions along with recent developments to measure ligand and mechanistic similarities. Together, these provide a foundation for new classifications of enzyme function. Copyright © 2011 Elsevier Ltd. All rights reserved.

Production of Enzymes from Marine Actinobacteria.

Science.gov (United States)

Zhao, X Q; Xu, X N; Chen, L Y

Marine actinobacteria are well recognized for their capabilities to produce valuable natural products, which have great potential for applications in medical, agricultural, and fine chemical industries. In addition to producing unique enzymes responsible for biosynthesis of natural products, many marine actinobacteria also produce hydrolytic enzymes which are able to degrade various biopolymers, such as cellulose, xylan, and chitin. These enzymes are important to produce biofuels and biochemicals of interest from renewable biomass. In this chapter, the recent reports of novel enzymes produced by marine actinobacteria are reviewed, and advanced technologies that can be applied to search for novel marine enzymes as well as for improved enzyme production by marine actinobacteria are summarized, which include ribosome engineering, genome mining, as well as synthetic biology studies. © 2016 Elsevier Inc. All rights reserved.

Zymography methods for visualizing hydrolytic enzymes

OpenAIRE

Vandooren, Jennifer; Geurts, Nathalie; Martens, Erik; Van den Steen, Philippe E.; Opdenakker, Ghislain

2013-01-01

Zymography is a technique for studying hydrolytic enzymes on the basis of substrate degradation. It is a powerful., but often misinterpreted, tool. yielding information on potential. hydrolytic activities, enzyme forms and the locations of active enzymes. In this Review, zymography techniques are compared in terms of advantages, limitations and interpretations. With in gel zymography, enzyme forms are visualized according to their molecular weights. Proteolytic activities are localized in tis...

Pentachlorophenol induction of the Pseudomonas aeruginosa mexAB-oprM efflux operon: involvement of repressors NalC and MexR and the antirepressor ArmR.

Directory of Open Access Journals (Sweden)

Lisa M Starr

Full Text Available Pentachlorophenol (PCP induced expression of the NalC repressor-regulated PA3720-armR operon and the MexR repressor-controlled mexAB-oprM multidrug efflux operon of Pseudomonas aeruginosa. PCP's induction of PA3720-armR resulted from its direct modulation of NalC, the repressor's binding to PA3720-armR promoter-containing DNA as seen in electromobility shift assays (EMSAs being obviated in the presence of this agent. The NalC binding site was localized to an inverted repeat (IR sequence upstream of PA3720-armR and overlapping a promoter region whose transcription start site was mapped. While modulation of MexR by the ArmR anti-repressor explains the upregulation of mexAB-oprM in nalC mutants hyperexpressing PA3720-armR, the induction of mexAB-oprM expression by PCP is not wholly explainable by PCP induction of PA3720-armR and subsequent ArmR modulation of MexR, inasmuch as armR deletion mutants still showed PCP-inducible mexAB-oprM expression. PCP failed, however, to induce mexAB-oprM in a mexR deletion strain, indicating that MexR was required for this, although PCP did not modulate MexR binding to mexAB-oprM promoter-containing DNA in vitro. One possibility is that MexR responds to PCP-generated in vivo effector molecules in controlling mexAB-oprM expression in response to PCP. PCP is an unlikely effector and substrate for NalC and MexAB-OprM--its impact on NalC binding to the PA3720-armR promoter DNA occurred only at high µM levels--suggesting that it mimics an intended phenolic effector/substrate(s. In this regard, plants are an abundant source of phenolic antimicrobial compounds and, so, MexAB-OprM may function to protect P. aeruginosa from plant antimicrobials that it encounters in nature.

Role of the two-component regulatory system arlRS in ica operon and aap positive but non-biofilm-forming Staphylococcus epidermidis isolates from hospitalized patients.

Science.gov (United States)

Wu, Yang; Liu, Jingran; Jiang, Juan; Hu, Jian; Xu, Tao; Wang, Jiaxue; Qu, Di

2014-11-01

The ica operon and aap gene are important factors for Staphylococcus epidermidis biofilm formation. However, we found 15 out of 101 S. epidermidis strains isolated from patients had both the ica operon and the aap gene in the genome but could not form biofilms (ica(+)aap(+)/BF(-) isolates). Compared with standard strain RP62A, the 15 ica(+)aap(+)/BF(-) isolates had similar growth curves and initial attachment abilities, but had much lower apparent transcription levels of the icaA gene and significantly less production of polysaccharide intercellular adhesion (PIA). Furthermore, the expression of accumulation-associated protein in ica(+)aap(+)/BF(-) isolates was much weaker than in RP62A. The mRNA levels of icaADBC transcription-related regulatory genes, including icaR, sarA, rsbU, srrA, arlRS and luxS, were measured in the 15 ica(+)aap(+)/BF(-) clinical isolates. The mRNA levels of arlR and rsbU in all of the ica(+)aap(+)/BF(-) isolates were lower than in RP62A at 4 h. At 10 h, 14/15 of the isolates showed lower mRNA levels of arlR and rsbU than shown by RP62A. However, expression of sarA, luxS, srrA and icaR varied in different ica(+)aap(+)/BF(-) isolates. To further investigate the role of arlRS in biofilm formation, we analyzed icaA, sarA and rsbU transcription, PIA synthesis, Aap expression and biofilm formation in an arlRS deletion mutant of S. epidermidis strain 1457 and all were much less than in the wild type strain. This is consistent with the hypothesis that ArlRS may play an important role in regulating biofilm formation by the ica(+)aap(+)/BF(-)S. epidermidis clinical isolates and operate via both ica-dependent and Aap-dependent pathways. Copyright © 2014 Elsevier Ltd. All rights reserved.

Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

Energy Technology Data Exchange (ETDEWEB)

Hong, J. S.; Kim, D.H.

1981-01-01

Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

Multi-enzyme Process Modeling

DEFF Research Database (Denmark)

Andrade Santacoloma, Paloma de Gracia

are affected (in a positive or negative way) by the presence of the other enzymes and compounds in the media. In this thesis the concept of multi-enzyme in-pot term is adopted for processes that are carried out by the combination of enzymes in a single reactor and implemented at pilot or industrial scale...... features of the process and provides the information required to structure the process model by using a step-by-step procedure with the required tools and methods. In this way, this framework increases efficiency of the model development process with respect to time and resources needed (fast and effective....... In this way the model parameters that drives the main dynamic behavior can be identified and thus a better understanding of this type of processes. In order to develop, test and verify the methodology, three case studies were selected, specifically the bi-enzyme process for the production of lactobionic acid...

Photoperiodism and Enzyme Activity

Science.gov (United States)

Queiroz, Orlando; Morel, Claudine

1974-01-01

Metabolic readjustments after a change from long days to short days appear, in Kalanchoe blossfeldiana, to be achieved through the operation of two main mechanisms: variation in enzyme capacity, and circadian rhythmicity. After a lag time, capacity in phosphoenolpyruvate carboxylase and capacity in aspartate aminotransferase increase exponentially and appear to be allometrically linked during 50 to 60 short days; then a sudden fall takes place in the activity of the former. Malic enzyme and alanine aminotransferase behave differently. Thus, the operation of the two sections of the pathway (before and after the malate step) give rise to a continuously changing functional compartmentation in the pathway. Circadian rhythmicity, on the other hand, produces time compartmentation through phase shifts and variation in amplitude, independently for each enzyme. These characteristics suggest that the operation of a so-called biological clock would be involved. We propose the hypothesis that feedback regulation would be more accurate and efficient when applied to an already oscillating, clock-controlled enzyme system. PMID:16658749

Descriptive and predictive assessment of enzyme activity and enzyme related processes in biorefinery using IR spectroscopy and chemometrics

DEFF Research Database (Denmark)

Baum, Andreas

the understanding of the structural properties of the extracted pectin. Secondly, enzyme kinetics of biomass converting enzymes was examined in terms of measuring enzyme activity by spectral evolution profiling utilizing FTIR. Chemometric multiway methods were used to analyze the tensor datasets enabling the second......-order calibration advantage (reference Theory of Analytical chemistry). As PAPER 3 illustrates the method is universally applicable without the need of any external standards and was exemplified by performing quantitative enzyme activity determinations for glucose oxidase, pectin lyase and a cellolytic enzyme blend...... (Celluclast 1.5L). In PAPER 4, the concept is extended to quantify enzyme activity of two simultaneously acting enzymes, namely pectin lyase and pectin methyl esterase. By doing so the multiway methods PARAFAC, TUCKER3 and NPLS were compared and evaluated towards accuracy and precision....

Engineering of GlcNAc-1-Phosphotransferase for Production of Highly Phosphorylated Lysosomal Enzymes for Enzyme Replacement Therapy.

Science.gov (United States)

Liu, Lin; Lee, Wang-Sik; Doray, Balraj; Kornfeld, Stuart

2017-06-16

Several lysosomal enzymes currently used for enzyme replacement therapy in patients with lysosomal storage diseases contain very low levels of mannose 6-phosphate, limiting their uptake via mannose 6-phosphate receptors on the surface of the deficient cells. These enzymes are produced at high levels by mammalian cells and depend on endogenous GlcNAc-1-phosphotransferase α/β precursor to phosphorylate the mannose residues on their glycan chains. We show that co-expression of an engineered truncated GlcNAc-1-phosphotransferase α/β precursor and the lysosomal enzyme of interest in the producing cells resulted in markedly increased phosphorylation and cellular uptake of the secreted lysosomal enzyme. This method also results in the production of highly phosphorylated acid β-glucocerebrosidase, a lysosomal enzyme that normally has just trace amounts of this modification.

Evaluation of pressure tuning of enzymes

DEFF Research Database (Denmark)

Naghshineh, Mahsa

and high energy consumption. Therefore, searching for an environmentally friendly method of pectin extraction is a task for science and industry. Employment of hydrolytic enzymes may represent a green approach to obtain intact pectin polymer. However, the low stability/activity of enzymes, and low polymer...... yield of enzymatic extraction limits the application of enzyme in pectin production. There is evidence that emerging technology of high hydrostatic pressure processing can result in stabilization and activation of some enzymes. Therefore, the use of high hydrostatic pressure in combination with enzyme...... (cellulase/xylanase: 50/0, 50/25, 50/50, 25/50, and 0/50 U/g lime peel) at ambient pressure, 100 and 200 MPa were used to extract pectin from dried lime peel waste. It was found that pressure level, type and concentration of enzyme significantly influenced pectin yield and degree of esterification (DE...

Photoreactivating enzyme from Escherichia coli

International Nuclear Information System (INIS)

Snapka, R.M.; Fuselier, C.O.

1977-01-01

Escherichia coli photoreactivating enzyme (PRE) has been purified in large amounts from an E.coli strain lysogenic for a defective lambda bacteriophage carrying the phr gene. The resulting enzyme had a pH optimum of 7.2 and an ionic strength optimum of 0.18. It consisted of an apoprotein and cofactor, both of which were necessary for catalytic activity. The apoprotein had a monomer molecular weight of 35,200 and showed stable aggregates under denaturing conditions. The amino acid analysis of the E.coli enzyme was very similar to that of the photoreactivating enzyme from orchid seedlings (Cattelya aurantiaca). Both had arginine at the amino terminus. The cofactor, like the holoenzyme, showed absorption, magnetic circular dichroism, and emission properties indicative of an adenine moiety. Although the isolated enzyme had an action spectrum which peaked at about 360 nm, neither the cofactor, apoenzyme nor holoenzyme showed any detectable absorption between 300 and 400 nm. (author)

Practical steady-state enzyme kinetics.

Science.gov (United States)

Lorsch, Jon R

2014-01-01

Enzymes are key components of most biological processes. Characterization of enzymes is therefore frequently required during the study of biological systems. Steady-state kinetics provides a simple and rapid means of assessing the substrate specificity of an enzyme. When combined with site-directed mutagenesis (see Site-Directed Mutagenesis), it can be used to probe the roles of particular amino acids in the enzyme in substrate recognition and catalysis. Effects of interaction partners and posttranslational modifications can also be assessed using steady-state kinetics. This overview explains the general principles of steady-state enzyme kinetics experiments in a practical, rather than theoretical, way. Any biochemistry textbook will have a section on the theory of Michaelis-Menten kinetics, including derivations of the relevant equations. No specific enzymatic assay is described here, although a method for monitoring product formation or substrate consumption over time (an assay) is required to perform the experiments described. © 2014 Elsevier Inc. All rights reserved.

Photoreactivating enzyme from Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Snapka, R M; Fuselier, C O [California Univ., Irvine (USA)

1977-05-01

Escherichia coli photoreactivating enzyme (PRE) has been purified in large amounts from an E.coli strain lysogenic for a defective lambda bacteriophage carrying the phr gene. The resulting enzyme had a pH optimum of 7.2 and an ionic strength optimum of 0.18. It consisted of an apoprotein and cofactor, both of which were necessary for catalytic activity. The apoprotein had a monomer molecular weight of 35,200 and showed stable aggregates under denaturing conditions. The amino acid analysis of the E.coli enzyme was very similar to that of the photoreactivating enzyme from orchid seedlings (Cattelya aurantiaca). Both had arginine at the amino terminus. The cofactor, like the holoenzyme, showed absorption, magnetic circular dichroism, and emission properties indicative of an adenine moiety. Although the isolated enzyme had an action spectrum which peaked at about 360 nm, neither the cofactor, apoenzyme nor holoenzyme showed any detectable absorption between 300 and 400 nm.

Enzymes for Enhanced Oil Recovery (EOR)

Energy Technology Data Exchange (ETDEWEB)

Nasiri, Hamidreza

2011-04-15

Primary oil recovery by reservoir pressure depletion and secondary oil recovery by waterflooding usually result in poor displacement efficiency. As a consequence there is always some trapped oil remaining in oil reservoirs. Oil entrapment is a result of complex interactions between viscous, gravity and capillary forces. Improving recovery from hydrocarbon fields typically involves altering the relative importance of the viscous and capillary forces. The potential of many EOR methods depends on their influence on fluid/rock interactions related to wettability and fluid/fluid interactions reflected in IFT. If the method has the potential to change the interactions favorably, it may be considered for further investigation, i.e. core flooding experiment, pilot and reservoir implementation. Enzyme-proteins can be introduced as an enhanced oil recovery method to improve waterflood performance by affecting interactions at the oil-water-rock interfaces. An important part of this thesis was to investigate how selected enzymes may influence wettability and capillary forces in a crude oil-brine-rock system, and thus possibly contribute to enhanced oil recovery. To investigate further by which mechanisms selected enzyme-proteins may contribute to enhance oil recovery, groups of enzymes with different properties and catalytic functions, known to be interfacially active, were chosen to cover a wide range of possible effects. These groups include (1) Greenzyme (GZ) which is a commercial EOR enzyme and consists of enzymes and stabilizers (surfactants), (2) The Zonase group consists of two types of pure enzyme, Zonase1 and Zonase2 which are protease enzymes and whose catalytic functions are to hydrolyze (breakdown) peptide bonds, (3) The Novozyme (NZ) group consists of three types of pure enzyme, NZ2, NZ3 and NZ6 which are esterase enzymes and whose catalytic functions are to hydrolyze ester bonds, and (4) Alpha-Lactalbumin ( -La) which is an important whey protein. The effect of

A new tessera into the interactome of the isc operon:A novel interaction between HscB and IscS

Directory of Open Access Journals (Sweden)

Annalisa Pastore

2016-09-01

Full Text Available Iron sulfur clusters are essential universal prosthetic groups which can be formed inorganically but, in biology, are bound to proteins and produced enzymatically. Most of the components of the machine that produces the clusters are conserved throughout evolution. In bacteria, they are encoded in the isc operon. Previous reports provide information on the role of specific components but a clear picture of how the whole machine works is still missing. We have carried out a study of the effects of the co-chaperone HscB from the model system E. coli. We document a previously undetected weak interaction between the chaperone HscB and the desulfurase IscS, one of the two main players of the machine. The binding site involves a region of HscB in the longer stem of the approximately L-shaped molecules, whereas the interacting surface of IscS overlaps with the surface previously involved in binding other proteins, such as ferredoxin and frataxin. Our findings provide an entirely new perspective to our comprehension of the role of HscB and propose this protein as a component of the IscS complex.

Study of vitamin D serum level in patients with epilepsy treated with enzyme-inducing and non enzyme-inducing medications

Directory of Open Access Journals (Sweden)

sima Hashemipour

2014-01-01

Full Text Available Background : Changes of serum minerals and vitamin D have been reported in anticonvulsant drugs user patients. The present study aimed at comparing the changes of serum minerals and vitamin D among two groups of enzyme-inducing and non enzyme-inducing anticonvulsant drug users. Methods: In this study 22 patients treated with enzyme-inducing drugs (carbamazepin, phenytoin, phenobarbital were compared to 25 patients of matched sex, age, and BMI treated with non enzyme-inducing drugs (sodium evaporate, lamotrigine. Serum calcium, phosphate, parathormone, and 25-hydroxy vitamin D were calculated in both groups. Calcium was measured by Calorimetery method. Parathormone and vitamin D were measured using ELISA method. Results: The mean serum vitamin D level was lower in enzyme-inducing than non enzyme-inducing drugs users (15.9±8.3 and 24.2±14.8, P=0.02. Frequency of vitamin D deficiency was higher in enzyme-inducing compared to non enzyme-inducing drugs users, 84% and 48% , respectively (P=0.016. The mean serum calcium level was significantly lower in enzyme-inducing drugs users. (8.7±0.2 vs. 9.0± 0.7, p= 0.05. Four percent in enzyme-inducing group compared to twenty four percent of non enzyme-inducing group had secondary hyperparathyroidism (P=0.016. Conclusion: While vitamin D deficiency is more frequent in enzyme-inducing drug users, secondary hyperparathyroidism is less frequent.

Molecular determinants of enzyme cold adaptation: comparative structural and computational studies of cold- and warm-adapted enzymes.

Science.gov (United States)

Papaleo, Elena; Tiberti, Matteo; Invernizzi, Gaetano; Pasi, Marco; Ranzani, Valeria

2011-11-01

The identification of molecular mechanisms underlying enzyme cold adaptation is a hot-topic both for fundamental research and industrial applications. In the present contribution, we review the last decades of structural computational investigations on cold-adapted enzymes in comparison to their warm-adapted counterparts. Comparative sequence and structural studies allow the definition of a multitude of adaptation strategies. Different enzymes carried out diverse mechanisms to adapt to low temperatures, so that a general theory for enzyme cold adaptation cannot be formulated. However, some common features can be traced in dynamic and flexibility properties of these enzymes, as well as in their intra- and inter-molecular interaction networks. Interestingly, the current data suggest that a family-centered point of view is necessary in the comparative analyses of cold- and warm-adapted enzymes. In fact, enzymes belonging to the same family or superfamily, thus sharing at least the three-dimensional fold and common features of the functional sites, have evolved similar structural and dynamic patterns to overcome the detrimental effects of low temperatures.

Flavourzyme, an Enzyme Preparation with Industrial Relevance: Automated Nine-Step Purification and Partial Characterization of Eight Enzymes.

Science.gov (United States)

Merz, Michael; Eisele, Thomas; Berends, Pieter; Appel, Daniel; Rabe, Swen; Blank, Imre; Stressler, Timo; Fischer, Lutz

2015-06-17

Flavourzyme is sold as a peptidase preparation from Aspergillus oryzae. The enzyme preparation is widely and diversely used for protein hydrolysis in industrial and research applications. However, detailed information about the composition of this mixture is still missing due to the complexity. The present study identified eight key enzymes by mass spectrometry and partially by activity staining on native polyacrylamide gels or gel zymography. The eight enzymes identified were two aminopeptidases, two dipeptidyl peptidases, three endopeptidases, and one α-amylase from the A. oryzae strain ATCC 42149/RIB 40 (yellow koji mold). Various specific marker substrates for these Flavourzyme enzymes were ascertained. An automated, time-saving nine-step protocol for the purification of all eight enzymes within 7 h was designed. Finally, the purified Flavourzyme enzymes were biochemically characterized with regard to pH and temperature profiles and molecular sizes.

Monovalent Cation Activation of the Radical SAM Enzyme Pyruvate Formate-Lyase Activating Enzyme.

Science.gov (United States)

Shisler, Krista A; Hutcheson, Rachel U; Horitani, Masaki; Duschene, Kaitlin S; Crain, Adam V; Byer, Amanda S; Shepard, Eric M; Rasmussen, Ashley; Yang, Jian; Broderick, William E; Vey, Jessica L; Drennan, Catherine L; Hoffman, Brian M; Broderick, Joan B

2017-08-30

Pyruvate formate-lyase activating enzyme (PFL-AE) is a radical S-adenosyl-l-methionine (SAM) enzyme that installs a catalytically essential glycyl radical on pyruvate formate-lyase. We show that PFL-AE binds a catalytically essential monovalent cation at its active site, yet another parallel with B 12 enzymes, and we characterize this cation site by a combination of structural, biochemical, and spectroscopic approaches. Refinement of the PFL-AE crystal structure reveals Na + as the most likely ion present in the solved structures, and pulsed electron nuclear double resonance (ENDOR) demonstrates that the same cation site is occupied by 23 Na in the solution state of the as-isolated enzyme. A SAM carboxylate-oxygen is an M + ligand, and EPR and circular dichroism spectroscopies reveal that both the site occupancy and the identity of the cation perturb the electronic properties of the SAM-chelated iron-sulfur cluster. ENDOR studies of the PFL-AE/[ 13 C-methyl]-SAM complex show that the target sulfonium positioning varies with the cation, while the observation of an isotropic hyperfine coupling to the cation by ENDOR measurements establishes its intimate, SAM-mediated interaction with the cluster. This monovalent cation site controls enzyme activity: (i) PFL-AE in the absence of any simple monovalent cations has little-no activity; and (ii) among monocations, going down Group 1 of the periodic table from Li + to Cs + , PFL-AE activity sharply maximizes at K + , with NH 4 + closely matching the efficacy of K + . PFL-AE is thus a type I M + -activated enzyme whose M + controls reactivity by interactions with the cosubstrate, SAM, which is bound to the catalytic iron-sulfur cluster.

Magnetic cross-linked enzyme aggregates (CLEAs): a novel concept towards carrier free immobilization of lignocellulolytic enzymes.

Science.gov (United States)

Bhattacharya, Abhishek; Pletschke, Brett I

2014-01-01

The enzymatic conversion of lignocellulosic biomass into biofuels has been identified as an excellent strategy to generate clean energy. However, the current process is cost-intensive as an effective immobilization approach to reuse the enzyme(s) has been a major challenge. The present study introduces the concept and application of novel magnetic cross-linked enzyme aggregates (mag-CLEAs). Both mag-CLEAs and calcium-mag-CLEAs (Ca-mag-CLEAs) exhibited a 1.35 fold higher xylanase activity compared to the free enzyme and retained more than 80.0% and 90.0% activity, respectively, after 136h of incubation at 50°C, compared to 50% activity retained by CLEAs. A 7.4 and 9.0 fold higher sugar release from lime-pretreated and NH4OH pre-treated sugar bagasse, respectively, was achieved with Ca-mag-CLEAs compared to the free enzymes. The present study promotes the successful application of mag-CLEAs and Ca-mag-CLEAs as carrier free immobilized enzymes for the effective hydrolysis of lignocellulolytic biomass and associated biofuel feedstocks. Copyright © 2014 Elsevier Inc. All rights reserved.

21 CFR 864.9400 - Stabilized enzyme solution.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Stabilized enzyme solution. 864.9400 Section 864... and Blood Products § 864.9400 Stabilized enzyme solution. (a) Identification. A stabilized enzyme... enzyme solutions include papain, bromelin, ficin, and trypsin. (b) Classification. Class II (performance...

Castor Oil Transesterification Catalysed by Liquid Enzymes

DEFF Research Database (Denmark)

Andrade, Thalles; Errico, Massimiliano; Christensen, Knud Villy

2017-01-01

In the present work, biodiesel production by reaction of non-edible castor oil with methanol under enzymatic catalysis is investigated. Two liquid enzymes were tested: Eversa Transform and Resinase HT. Reactions were performed at 35 °C and with a molar ratio of methanol to oil of 6:1. The reaction...... time was 8 hours. Stepwise addition of methanol was necessary to avoid enzyme inhibition by methanol. In order to minimize the enzyme costs, the influence of enzyme activity loss during reuse of both enzymes was evaluated under two distinct conditions. In the former, the enzymes were recovered...... and fully reused; in the latter, a mixture of 50 % reused and 50 % fresh enzymes was tested. In the case of total reuse after three cycles, both enzymes achieved only low conversions. The biodiesel content in the oil-phase using Eversa Transform was 94.21 % for the first cycle, 68.39 % in the second, and 33...

A virus-based single-enzyme nanoreactor

NARCIS (Netherlands)

Comellas Aragones, M.; Engelkamp, H.; Claessen, V.I.; Sommerdijk, N.A.J.M.; Rowan, A.E.; Christianen, P.C.M.; Maan, J.C.; Verduin, B.J.M.; Cornelissen, J.J.L.M.; Nolte, R.J.M.

2007-01-01

Most enzyme studies are carried out in bulk aqueous solution, at the so-called ensemble level, but more recently studies have appeared in which enzyme activity is measured at the level of a single molecule, revealing previously unseen properties. To this end, enzymes have been chemically or

PROCESS FOR DUST-FREE ENZYME MANUFACTURE

NARCIS (Netherlands)

Andela, C.; Feijen, Jan; Dillissen, Marc

1994-01-01

New enzyme granules are provided with improved properties. The granules are based on core particles having a good pore size and pore size distribution to allow an enzyme solution to enter into the particle. Accordingly, the core material comprises the enzyme in liquid form, thus eliminating the

Applications of Microbial Enzymes in Food Industry

Directory of Open Access Journals (Sweden)

Binod Parameswaran

2018-01-01

Full Text Available The use of enzymes or microorganisms in food preparations is an age-old process. With the advancement of technology, novel enzymes with wide range of applications and specificity have been developed and new application areas are still being explored. Microorganisms such as bacteria, yeast and fungi and their enzymes are widely used in several food preparations for improving the taste and texture and they offer huge economic benefits to industries. Microbial enzymes are the preferred source to plants or animals due to several advantages such as easy, cost-effective and consistent production. The present review discusses the recent advancement in enzyme technology for food industries. A comprehensive list of enzymes used in food processing, the microbial source of these enzymes and the wide range of their application are discussed.

Targeted quantification of functional enzyme dynamics in environmental samples for microbially mediated biogeochemical processes: Targeted quantification of functional enzyme dynamics

Energy Technology Data Exchange (ETDEWEB)

Li, Minjing [School of Environmental Studies, China University of Geosciences, Wuhan 430074 People' s Republic of China; Gao, Yuqian [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Qian, Wei-Jun [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Shi, Liang [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Liu, Yuanyuan [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Nelson, William C. [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Nicora, Carrie D. [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Resch, Charles T. [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Thompson, Christopher [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Yan, Sen [School of Environmental Studies, China University of Geosciences, Wuhan 430074 People' s Republic of China; Fredrickson, James K. [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Zachara, John M. [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Liu, Chongxuan [Pacific Northwest National Laboratory, Richland, WA 99354 USA; School of Environmental Science and Engineering, Southern University of Science and Technology, Shenzhen 518055 People' s Republic of China

2017-07-13

Microbially mediated biogeochemical processes are catalyzed by enzymes that control the transformation of carbon, nitrogen, and other elements in environment. The dynamic linkage between enzymes and biogeochemical species transformation has, however, rarely been investigated because of the lack of analytical approaches to efficiently and reliably quantify enzymes and their dynamics in soils and sediments. Herein, we developed a signature peptide-based technique for sensitively quantifying dissimilatory and assimilatory enzymes using nitrate-reducing enzymes in a hyporheic zone sediment as an example. Moreover, the measured changes in enzyme concentration were found to correlate with the nitrate reduction rate in a way different from that inferred from biogeochemical models based on biomass or functional genes as surrogates for functional enzymes. This phenomenon has important implications for understanding and modeling the dynamics of microbial community functions and biogeochemical processes in environments. Our results also demonstrate the importance of enzyme quantification for the identification and interrogation of those biogeochemical processes with low metabolite concentrations as a result of faster enzyme-catalyzed consumption of metabolites than their production. The dynamic enzyme behaviors provide a basis for the development of enzyme-based models to describe the relationship between the microbial community and biogeochemical processes.

NRSA enzyme decomposition model data

Data.gov (United States)

U.S. Environmental Protection Agency — Microbial enzyme activities measured at more than 2000 US streams and rivers. These enzyme data were then used to predict organic matter decomposition and microbial...

Heavy enzymes--experimental and computational insights in enzyme dynamics.

Science.gov (United States)

Swiderek, Katarzyna; Ruiz-Pernía, J Javier; Moliner, Vicent; Tuñón, Iñaki

2014-08-01

The role of protein motions in the chemical step of enzyme-catalyzed reactions is the subject of an open debate in the scientific literature. The systematic use of isotopically substituted enzymes has been revealed as a useful tool to quantify the role of these motions. According to the Born-Oppenheimer approximation, changing the mass of the protein does not change the forces acting on the system but alters the frequencies of the protein motions, which in turn can affect the rate constant. Experimental and theoretical studies carried out in this field are presented in this article and discussed in the framework of Transition State Theory. Copyright © 2014 Elsevier Ltd. All rights reserved.

Consumer attitudes to enzymes in food production

DEFF Research Database (Denmark)

Søndergaard, Helle Alsted; Grunert, Klaus G.; Scholderer, Joachim

2005-01-01

The use of enzymes in food production has potential benefits for both food manufacturers and consumers. A central question is how consumers react to new ways of producing foods with enzymes. This study investigates the formation of consumer attitudes to different enzyme production methods in three...... European countries. Results show that consumers are most positive towards non-GM enzyme production methods. The enzyme production method is by far the most important factor for the formation of buying intentions compared to price and benefits. Results also show that environmental concern and attitudes...... to technological progress are the socio-political attitudes that have the highest predictive value regarding attitudes to enzyme production methods....

Immobilization of Enzymes in Polymer Supports.

Science.gov (United States)

Conlon, Hugh D.; Walt, David R.

1986-01-01

Two experiments in which an enzyme is immobilized onto a polymeric support are described. The experiments (which also demonstrate two different polymer preparations) involve: (1) entrapping an enzyme in an acrylamide polymer; and (2) reacting the amino groups on the enzyme's (esterase) lysine residues with an activated polymer. (JN)

Enzymic oxidation of carbon monoxide. II

Energy Technology Data Exchange (ETDEWEB)

Yagi, T

1959-01-01

An enzyme which catalyzes the oxidation of carbon monoxide into carbon dioxide was obtained in a cell free state from Desulfovibrio desulfuricans. The enzyme activity was assayed manometrically by measuring the rate of gas uptake under the atmosphere of carbon monoxide in the presence of benzyl-viologen as an oxidant. The optimum pH range was 7 to 8. The activity was slightly suppressed by illumination. The enzyme was more stable than hydrogenase or formate dehydrogenase against the heat treatment, suggesting that it is a different entity from these enzymes. In the absence of an added oxidant, the enzyme preparation produced hydrogen gas under the atmosphere of carbon monoxide. The phenomenon can be explained assuming the reductive decomposition of water. 17 references, 4 figures, 2 tables.

Production of cellulolytic enzymes from ascomycetes

DEFF Research Database (Denmark)

Hansen, Gustav Hammerich; Lübeck, Mette; Frisvad, Jens Christian

2015-01-01

Optimizing production of cellulose degrading enzymes is of great interest in order to increase the feasibility of constructing biorefinery facilities for a sustainable supply of energy and chemical products. The ascomycete phylum has a large potential for the production of cellulolytic enzymes....... Although numerous enzymatic profiles have already been unraveled, the research has been covering only a limited number of species and genera, thus leaving many ascomycetes to be analyzed. Such analysis requires choosing appropriate media and cultivation methods that ensure enzyme profiles with high...... specificities and activities. However, the choice of media, cultivation methods and enzyme assays highly affect the enzyme activity profile observed. This review provides an overview of enzymatic profiles for several ascomycetes covering phylogenetically distinct genera and species. The profiles of cellulose...

The genes and enzymes for the catabolism of galactitol, D-tagatose, and related carbohydrates in Klebsiella oxytoca M5a1 and other enteric bacteria display convergent evolution.

Science.gov (United States)

Shakeri-Garakani, A; Brinkkötter, A; Schmid, K; Turgut, S; Lengeler, J W

2004-07-01

Enteric bacteria (Enteriobacteriaceae) carry on their single chromosome about 4000 genes that all strains have in common (referred to here as "obligatory genes"), and up to 1300 "facultative" genes that vary from strain to strain and from species to species. In closely related species, obligatory and facultative genes are orthologous genes that are found at similar loci. We have analyzed a set of facultative genes involved in the degradation of the carbohydrates galactitol, D-tagatose, D-galactosamine and N-acetyl-galactosamine in various pathogenic and non-pathogenic strains of these bacteria. The four carbohydrates are transported into the cell by phosphotransferase (PTS) uptake systems, and are metabolized by closely related or even identical catabolic enzymes via pathways that share several intermediates. In about 60% of Escherichia coli strains the genes for galactitol degradation map to a gat operon at 46.8 min. In strains of Salmonella enterica, Klebsiella pneumoniae and K. oxytoca, the corresponding gat genes, although orthologous to their E. coli counterparts, are found at 70.7 min, clustered in a regulon together with three tag genes for the degradation of D-tagatose, an isomer of D-fructose. In contrast, in all the E. coli strains tested, this chromosomal site was found to be occupied by an aga/kba gene cluster for the degradation of D-galactosamine and N-acetyl-galactosamine. The aga/kba and the tag genes were paralogous either to the gat cluster or to the fru genes for degradation of D-fructose. Finally, in more then 90% of strains of both Klebsiella species, and in about 5% of the E. coli strains, two operons were found at 46.8 min that comprise paralogous genes for catabolism of the isomers D-arabinitol (genes atl or dal) and ribitol (genes rtl or rbt). In these strains gat genes were invariably absent from this location, and they were totally absent in S. enterica. These results strongly indicate that these various gene clusters and metabolic

Computational Biochemistry-Enzyme Mechanisms Explored.

Science.gov (United States)

Culka, Martin; Gisdon, Florian J; Ullmann, G Matthias

2017-01-01

Understanding enzyme mechanisms is a major task to achieve in order to comprehend how living cells work. Recent advances in biomolecular research provide huge amount of data on enzyme kinetics and structure. The analysis of diverse experimental results and their combination into an overall picture is, however, often challenging. Microscopic details of the enzymatic processes are often anticipated based on several hints from macroscopic experimental data. Computational biochemistry aims at creation of a computational model of an enzyme in order to explain microscopic details of the catalytic process and reproduce or predict macroscopic experimental findings. Results of such computations are in part complementary to experimental data and provide an explanation of a biochemical process at the microscopic level. In order to evaluate the mechanism of an enzyme, a structural model is constructed which can be analyzed by several theoretical approaches. Several simulation methods can and should be combined to get a reliable picture of the process of interest. Furthermore, abstract models of biological systems can be constructed combining computational and experimental data. In this review, we discuss structural computational models of enzymatic systems. We first discuss various models to simulate enzyme catalysis. Furthermore, we review various approaches how to characterize the enzyme mechanism both qualitatively and quantitatively using different modeling approaches. © 2017 Elsevier Inc. All rights reserved.

Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

Science.gov (United States)

Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

2014-01-01

The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

Cellulolytic enzyme compositions and uses thereof

Energy Technology Data Exchange (ETDEWEB)

Iyer, Prashant; Gaspar, Armindo Ribiero; Croonenberghs, James; Binder, Thomas P.

2017-07-25

The present invention relates enzyme composition comprising a cellulolytic preparation and an acetylxylan esterase (AXE); and the used of cellulolytic enzyme compositions for hydrolyzing acetylated cellulosic material. Finally the invention also relates to processes of producing fermentation products from acetylated cellulosic materials using a cellulolytic enzyme composition of the invention.

Strategies for enzyme saving during saccharification of pretreated lignocellulo-starch biomass: effect of enzyme dosage and detoxification chemicals

Directory of Open Access Journals (Sweden)

M.G. Mithra

2017-08-01

Full Text Available Two strategies leading to enzyme saving during saccharification of pretreated lignocellulo-starch biomass (LCSB was investigated which included reducing enzyme dosage by varying their levels in enzyme cocktails and enhancing the fermentable sugar yield in enzyme-reduced systems using detoxification chemicals. Time course release of reducing sugars (RS during 24–120 h was significantly higher when an enzyme cocktail containing full dose of cellulase (16 FPU/g cellulose along with half dose each of xylanase (1.5 mg protein/g hemicelluloses and Stargen (12.5 μl/g biomass was used to saccharify conventional dilute sulphuric acid (DSA pretreated biomass compared to a parallel system where only one-fourth the dose of the latter two enzymes was used. The reduction in RS content in the 120 h saccharified mash to the extent of 3–4 g/L compared to the system saccharified with full complement of the three enzymes could be overcome considerably by supplementing the system (half dose of two enzymes with detoxification chemical mix incorporating Tween 20, PEG 4000 and sodium borohydride. Microwave (MW-assisted DSA pretreated biomass on saccharification with enzyme cocktail having full dose of cellulase and half dose of Stargen along with detoxification chemicals gave significantly higher RS yield than DSA pretreated system saccharified using three enzymes. The study showed that xylanase could be eliminated during saccharification of MW-assisted DSA pretreated biomass without affecting RS yield when detoxification chemicals were also supplemented. The Saccharification Efficiency and Overall Conversion Efficiency were also high for the MW-assisted DSA pretreated biomass. Since whole slurry saccharifcation of pretreated biomass is essential to conserve fermentable sugars in LCSB saccharification, detoxification of soluble inhibitors is equally important as channelling out of insoluble lignin remaining in the residue. As one of the major factors contributing