
Sample records for operon bistable switch

  1. Bistable fluidic valve is electrically switched (United States)

    Fiet, O.; Salvinski, R. J.


    Bistable control valve is selectively switched by direct application of an electrical field to divert fluid from one output channel to another. Valve is inexpensive, has no moving parts, and operates on fluids which are relatively poor electrical conductors.

  2. A CW Gunn diode bistable switching element. (United States)

    Hurtado, M.; Rosenbaum, F. J.


    Experiments with a current-controlled bistable switching element using a CW Gunn diode are reported. Switching rates of the order of 10 MHz have been obtained. Switching is initiated by current pulses of short duration (5-10 ns). Rise times of the order of several nanoseconds could be obtained.

  3. Two Bistable Switches Govern M Phase Entry. (United States)

    Mochida, Satoru; Rata, Scott; Hino, Hirotsugu; Nagai, Takeharu; Novák, Béla


    The abrupt and irreversible transition from interphase to M phase is essential to separate DNA replication from chromosome segregation. This transition requires the switch-like phosphorylation of hundreds of proteins by the cyclin-dependent kinase 1 (Cdk1):cyclin B (CycB) complex. Previous studies have ascribed these switch-like phosphorylations to the auto-activation of Cdk1:CycB through the removal of inhibitory phosphorylations on Cdk1-Tyr15 [1, 2]. The positive feedback in Cdk1 activation creates a bistable switch that makes mitotic commitment irreversible [2-4]. Here, we surprisingly find that Cdk1 auto-activation is dispensable for irreversible, switch-like mitotic entry due to a second mechanism, whereby Cdk1:CycB inhibits its counteracting phosphatase (PP2A:B55). We show that the PP2A:B55-inhibiting Greatwall (Gwl)-endosulfine (ENSA) pathway is both necessary and sufficient for switch-like phosphorylations of mitotic substrates. Using purified components of the Gwl-ENSA pathway in a reconstituted system, we found a sharp Cdk1 threshold for phosphorylation of a luminescent mitotic substrate. The Cdk1 threshold to induce mitotic phosphorylation is distinctly higher than the Cdk1 threshold required to maintain these phosphorylations-evidence for bistability. A combination of mathematical modeling and biochemical reconstitution show that the bistable behavior of the Gwl-ENSA pathway emerges from its mutual antagonism with PP2A:B55. Our results demonstrate that two interlinked bistable mechanisms provide a robust solution for irreversible and switch-like mitotic entry. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Solid state bistable power switch (United States)

    Bartko, J.; Shulman, H.


    Tin and copper provide high current and switching time capabilities for high-current resettable fuses. They show the best performance for trip current and degree of reliability, and have low coefficients of thermal expansion.

  5. Bistable soliton states and switching in doubly inhomogeneously ...

    Indian Academy of Sciences (India)

    Dec. 2001 physics pp. 969–979. Bistable soliton states and switching in doubly inhomogeneously doped fiber couplers. AJIT KUMAR. Department of Physics, Indian Institute of Technology, Hauz Khas, New Delhi 110 016, India. Abstract. Switching between the bistable soliton states in a doubly and inhomogeneously doped.

  6. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

    Directory of Open Access Journals (Sweden)

    Orlando Díaz-Hernández


    Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  7. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG. (United States)

    Díaz-Hernández, Orlando; Santillán, Moisés


    In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  8. Dynamics and bistability in a reduced model of the lac operon (United States)

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.


    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  9. A genetic bistable switch utilizing nonlinear protein degradation. (United States)

    Huang, Daniel; Holtz, William J; Maharbiz, Michel M


    Bistability is a fundamental property in engineered and natural systems, conferring the ability to switch and retain states. Synthetic bistable switches in prokaryotes have mainly utilized transcriptional components in their construction. Using both transcriptional and enzymatic components, creating a hybrid system, allows for wider bistable parameter ranges in a circuit. In this paper, we demonstrate a tunable family of hybrid bistable switches in E. coli using both transcriptional components and an enzymatic component. The design contains two linked positive feedback loops. The first loop utilizes the lambda repressor, CI, and the second positive feedback loop incorporates the Lon protease found in Mesoplasma florum (mf-Lon). We experimentally tested for bistable behavior in exponential growth phase, and found that our hybrid bistable switch was able to retain its state in the absence of an input signal throughout 40 cycles of cell division. We also tested the transient behavior of our switch and found that switching speeds can be tuned by changing the expression rate of mf-Lon. To our knowledge, this work demonstrates the first use of dynamic expression of an orthogonal and heterologous protease to tune a nonlinear protein degradation circuit. The hybrid switch is potentially a more robust and tunable topology for use in prokaryotic systems.

  10. Genes contribute to the switching dynamics of bistable perception. (United States)

    Shannon, Robert W; Patrick, Christopher J; Jiang, Yi; Bernat, Edward; He, Sheng


    Ordinarily, the visual system provides an unambiguous representation of the world. However, at times alternative plausible interpretations of a given stimulus arise, resulting in a dynamic perceptual alternation of the differing interpretations, commonly referred to as bistable or rivalrous perception. Recent research suggests that common neural mechanisms may be involved in the dynamics of very different types of bistable phenomena. Further, evidence has emerged that genetic factors may be involved in determining the rate of switch for at least one form of bistable perception, known as binocular rivalry. The current study evaluated whether genetic factors contribute to the switching dynamics for distinctly different variants of bistable perception in the same participant sample. Switching rates were recorded for MZ and DZ twin participants in two different bistable perception tasks, binocular rivalry and the Necker Cube. Strong concordance in switching rates across both tasks was evident for MZ but not DZ twins, indicating that genetic factors indeed contribute to the dynamics of multiple forms of bistable perception.

  11. Design of a bistable switch to control cellular uptake. (United States)

    Oyarzún, Diego A; Chaves, Madalena


    Bistable switches are widely used in synthetic biology to trigger cellular functions in response to environmental signals. All bistable switches developed so far, however, control the expression of target genes without access to other layers of the cellular machinery. Here, we propose a bistable switch to control the rate at which cells take up a metabolite from the environment. An uptake switch provides a new interface to command metabolic activity from the extracellular space and has great potential as a building block in more complex circuits that coordinate pathway activity across cell cultures, allocate metabolic tasks among different strains or require cell-to-cell communication with metabolic signals. Inspired by uptake systems found in nature, we propose to couple metabolite import and utilization with a genetic circuit under feedback regulation. Using mathematical models and analysis, we determined the circuit architectures that produce bistability and obtained their design space for bistability in terms of experimentally tuneable parameters. We found an activation-repression architecture to be the most robust switch because it displays bistability for the largest range of design parameters and requires little fine-tuning of the promoters' response curves. Our analytic results are based on on-off approximations of promoter activity and are in excellent qualitative agreement with simulations of more realistic models. With further analysis and simulation, we established conditions to maximize the parameter design space and to produce bimodal phenotypes via hysteresis and cell-to-cell variability. Our results highlight how mathematical analysis can drive the discovery of new circuits for synthetic biology, as the proposed circuit has all the hallmarks of a toggle switch and stands as a promising design to control metabolic phenotypes across cell cultures. © 2015 The Author(s).

  12. Bistable switching in dual-frequency liquid crystals

    Energy Technology Data Exchange (ETDEWEB)

    Palto, S. P., E-mail:; Barnik, M I [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)


    Various bistable switching modes in nematic liquid crystals with frequency inversion of the sign of dielectric anisotropy are revealed and investigated. Switching between states with different helicoidal distributions of the director field of a liquid crystal, as well as between uniform and helicoidal states, is realized by dual-frequency waveforms of a driving voltage. A distinctive feature of the dual-frequency switching is that the uniform planar distribution of the director field may correspond to a thermodynamically equilibrium state, and the chirality of an LC is not a necessary condition for switching to a helicoidal state.

  13. A Precise Temperature-Responsive Bistable Switch Controlling Yersinia Virulence. (United States)

    Nuss, Aaron Mischa; Schuster, Franziska; Roselius, Louisa; Klein, Johannes; Bücker, René; Herbst, Katharina; Heroven, Ann Kathrin; Pisano, Fabio; Wittmann, Christoph; Münch, Richard; Müller, Johannes; Jahn, Dieter; Dersch, Petra


    Different biomolecules have been identified in bacterial pathogens that sense changes in temperature and trigger expression of virulence programs upon host entry. However, the dynamics and quantitative outcome of this response in individual cells of a population, and how this influences pathogenicity are unknown. Here, we address these questions using a thermosensing virulence regulator of an intestinal pathogen (RovA of Yersinia pseudotuberculosis) as a model. We reveal that this regulator is part of a novel thermoresponsive bistable switch, which leads to high- and low-invasive subpopulations within a narrow temperature range. The temperature range in which bistability is observed is defined by the degradation and synthesis rate of the regulator, and is further adjustable via a nutrient-responsive regulator. The thermoresponsive switch is also characterized by a hysteretic behavior in which activation and deactivation occurred on vastly different time scales. Mathematical modeling accurately mirrored the experimental behavior and predicted that the thermoresponsiveness of this sophisticated bistable switch is mainly determined by the thermo-triggered increase of RovA proteolysis. We further observed RovA ON and OFF subpopulations of Y. pseudotuberculosis in the Peyer's patches and caecum of infected mice, and that changes in the RovA ON/OFF cell ratio reduce tissue colonization and overall virulence. This points to a bet-hedging strategy in which the thermoresponsive bistable switch plays a key role in adapting the bacteria to the fluctuating conditions encountered as they pass through the host's intestinal epithelium and suggests novel strategies for the development of antimicrobial therapies.

  14. A Precise Temperature-Responsive Bistable Switch Controlling Yersinia Virulence.

    Directory of Open Access Journals (Sweden)

    Aaron Mischa Nuss


    Full Text Available Different biomolecules have been identified in bacterial pathogens that sense changes in temperature and trigger expression of virulence programs upon host entry. However, the dynamics and quantitative outcome of this response in individual cells of a population, and how this influences pathogenicity are unknown. Here, we address these questions using a thermosensing virulence regulator of an intestinal pathogen (RovA of Yersinia pseudotuberculosis as a model. We reveal that this regulator is part of a novel thermoresponsive bistable switch, which leads to high- and low-invasive subpopulations within a narrow temperature range. The temperature range in which bistability is observed is defined by the degradation and synthesis rate of the regulator, and is further adjustable via a nutrient-responsive regulator. The thermoresponsive switch is also characterized by a hysteretic behavior in which activation and deactivation occurred on vastly different time scales. Mathematical modeling accurately mirrored the experimental behavior and predicted that the thermoresponsiveness of this sophisticated bistable switch is mainly determined by the thermo-triggered increase of RovA proteolysis. We further observed RovA ON and OFF subpopulations of Y. pseudotuberculosis in the Peyer's patches and caecum of infected mice, and that changes in the RovA ON/OFF cell ratio reduce tissue colonization and overall virulence. This points to a bet-hedging strategy in which the thermoresponsive bistable switch plays a key role in adapting the bacteria to the fluctuating conditions encountered as they pass through the host's intestinal epithelium and suggests novel strategies for the development of antimicrobial therapies.

  15. Bistable switches control memory and plasticity in cellular differentiation (United States)

    Wang, Lei; Walker, Brandon L.; Iannaccone, Stephen; Bhatt, Devang; Kennedy, Patrick J.; Tse, William T.


    Development of stem and progenitor cells into specialized tissues in multicellular organisms involves a series of cell fate decisions. Cellular differentiation in higher organisms is generally considered irreversible, and the idea of developmental plasticity in postnatal tissues is controversial. Here, we show that inhibition of mitogen-activated protein kinase (MAPK) in a human bone marrow stromal cell-derived myogenic subclone suppresses their myogenic ability and converts them into satellite cell-like precursors that respond to osteogenic stimulation. Clonal analysis of the induced osteogenic response reveals ultrasensitivity and an “all-or-none” behavior, hallmarks of a bistable switch mechanism with stochastic noise. The response demonstrates cellular memory, which is contingent on the accumulation of an intracellular factor and can be erased by factor dilution through cell divisions or inhibition of protein synthesis. The effect of MAPK inhibition also exhibits memory and appears to be controlled by another bistable switch further upstream that determines cell fate. Once the memory associated with osteogenic differentiation is erased, the cells regain their myogenic ability. These results support a model of cell fate decision in which a network of bistable switches controls inducible production of lineage-specific differentiation factors. A competitive balance between these factors determines cell fate. Our work underscores the dynamic nature of cellular differentiation and explains mechanistically the dual properties of stability and plasticity associated with the process. PMID:19366677

  16. Atom-loss-induced quantum optical bi-stability switch

    International Nuclear Information System (INIS)

    Wu Bao-Jun; Cui Fu-Cheng


    We investigate the nonlinear dynamics of a system composed of a cigar-shaped Bose—Einstein condensate and an optical cavity with the two sides coupled dispersively. By adopting discrete-mode approximation for the condensate, taking atom loss as a necessary part of the model to analyze the evolution of the system, while using trial and error method to find out steady states of the system as a reference, numerical simulation demonstrates that with a constant pump, atom loss will trigger a quantum optical bi-stability switch, which predicts a new interesting phenomenon for experiments to verify

  17. Linear population allocation by bistable switches in response to transient stimulation. (United States)

    Srimani, Jaydeep K; Yao, Guang; Neu, John; Tanouchi, Yu; Lee, Tae Jun; You, Lingchong


    Many cellular decision processes, including proliferation, differentiation, and phenotypic switching, are controlled by bistable signaling networks. In response to transient or intermediate input signals, these networks allocate a population fraction to each of two distinct states (e.g. OFF and ON). While extensive studies have been carried out to analyze various bistable networks, they are primarily focused on responses of bistable networks to sustained input signals. In this work, we investigate the response characteristics of bistable networks to transient signals, using both theoretical analysis and numerical simulation. We find that bistable systems exhibit a common property: for input signals with short durations, the fraction of switching cells increases linearly with the signal duration, allowing the population to integrate transient signals to tune its response. We propose that this allocation algorithm can be an optimal response strategy for certain cellular decisions in which excessive switching results in lower population fitness.

  18. A Redox-Active Bistable Molecular Switch Mounted inside a Metal-Organic Framework. (United States)

    Chen, Qishui; Sun, Junling; Li, Peng; Hod, Idan; Moghadam, Peyman Z; Kean, Zachary S; Snurr, Randall Q; Hupp, Joseph T; Farha, Omar K; Stoddart, J Fraser


    We describe the incorporation of a bistable mechanically interlocked molecule (MIM) into a robust Zr-based metal-organic framework (MOF), NU-1000, by employing a post-synthetic functionalization protocol. On average, close to two bistable [2]catenanes can be incorporated per repeating unit of the hexagonal channels of NU-1000. The reversible redox-switching of the bistable [2]catenanes is retained inside the MOF, as evidenced by solid-state UV-vis-NIR reflectance spectroscopy and cyclic voltammetry. This research demonstrates that bistable MIMs are capable of exhibiting robust dynamics inside the nanopores of a MOF.

  19. Microscopic observation of zenithal bistable switching in nematic devices with different surface relief structures

    International Nuclear Information System (INIS)

    Uche, C; Elston, S J; Parry-Jones, L A


    Nematic liquid crystals have been shown to exhibit zenithal electro-optic bistability in devices containing sinusoidal and deformed sinusoidal gratings. Recently it has been shown that zenithal bistable states can also be supported at isolated edges of square gratings. In this paper, we present microscopic observations of bistability in cells containing sinusoidal gratings and long-pitch square gratings. We have also investigated a novel display based on square wells. High frame-rate video microscopy was used to obtain time-sequenced images when the devices were switched with monopolar pulses. These show that zenithal bistable switching can occur by two different processes: (i) domain growth (observed in cells containing sinusoidal gratings) and (ii) homogenous switching (observed in cells containing isolated edges

  20. Stable Amplification and High Current Drop Bistable Switching in Supercritical GaAs Tills

    DEFF Research Database (Denmark)

    Izadpanah, S.H; Jeppsson, B; Jeppesen, Palle


    Bistable switching with current drops of 40% and switching times of 100 ps are obtained in pulsed operation of 10¿m supercritically doped n+ nn+ GaAs Transferred Electron Devices (TEDs). When CW-operated the same devices exhibit a 5-17 GHz bandwidth for the stable negative resistance.......Bistable switching with current drops of 40% and switching times of 100 ps are obtained in pulsed operation of 10¿m supercritically doped n+ nn+ GaAs Transferred Electron Devices (TEDs). When CW-operated the same devices exhibit a 5-17 GHz bandwidth for the stable negative resistance....

  1. Bistable polarization switching in a continuous wave ruby laser (United States)

    Lawandy, N. M.; Afzal, R. Sohrab


    Bistability in the output power, polarization state, and mode volume of an argon-ion laser pumped single mode ruby laser at 6943 A has been observed. The laser operates in a radially confined mode which exhibits hysteresis and bistability only when the pump polarization is parallel to the c-axis.

  2. Focused Role of an Organic Small-Molecule PBD on Performance of the Bistable Resistive Switching. (United States)

    Li, Lei; Sun, Yanmei; Ai, Chunpeng; Lu, Junguo; Wen, Dianzhong; Bai, Xuduo


    An undoped organic small-molecule 2-(4-tert-butylphenyl)-5-(4-biphenylyl)-1,3,4-oxadiazole (PBD) and a kind of nanocomposite blending poly(methyl methacrylate) (PMMA) into PBD are employed to implement bistable resistive switching. For the bistable resistive switching indium tin oxide (ITO)/PBD/Al, its ON/OFF current ratio can touch 6. What is more, the ON/OFF current ratio, approaching to 10(4), is available due to the storage layer PBD:PMMA with the chemical composition 1:1 in the bistable resistive switching ITO/PBD:PMMA/Al. The capacity, data retention of more than 1 year and endurance performance (>10(4) cycles) of ITO/PBD:PMMA(1:1)/Al, exhibits better stability and reliability of the samples, which underpins the technique and application of organic nonvolatile memory.

  3. Delay induced stability switch, multitype bistability and chaos in an intraguild predation model. (United States)

    Shu, Hongying; Hu, Xi; Wang, Lin; Watmough, James


    In many predator-prey models, delay has a destabilizing effect and induces oscillations; while in many competition models, delay does not induce oscillations. By analyzing a rather simple delayed intraguild predation model, which combines both the predator-prey relation and competition, we show that delay in intraguild predation models promotes very complex dynamics. The delay can induce stability switches exhibiting a destabilizing role as well as a stabilizing role. It is shown that three types of bistability are possible: one stable equilibrium coexists with another stable equilibrium (node-node bistability); one stable equilibrium coexists with a stable periodic solution (node-cycle bistability); one stable periodic solution coexists with another stable periodic solution (cycle-cycle bistability). Numerical simulations suggest that delay can also induce chaos in intraguild predation models.

  4. A bistable switch in dynamic thiodepsipeptide folding and template-directed ligation. (United States)

    Mukherjee, Rakesh; Cohen-Luria, Rivka; Wagner, Nathaniel; Ashkenasy, Gonen


    Bistable reaction networks provide living cells with chemically controlled mechanisms for long-term memory storage. Such networks are also often switchable and can be flipped from one state to the other. We target here a major challenge in systems chemistry research, namely developing synthetic, non-enzymatic, networks that mimic such a complex function. Therefore, we describe a dynamic network that depending on initial thiodepsipeptide concentrations leads to one of two distinct steady states. This bistable system is readily switched by applying the appropriate stimuli. The relationship between the reaction network topology and its capacity to invoke bistability is then analyzed by control experiments and theory. We suggest that demonstrating bistable behavior using synthetic networks further highlights their possible role in early evolution, and may shine light on potential utility for novel applications, such as chemical memories. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Bulk chirality effect for symmetric bistable switching of liquid crystals on topologically self-patterned degenerate anchoring surface. (United States)

    Park, Min-Kyu; Joo, Kyung-Il; Kim, Hak-Rin


    We demonstrate a bistable switching liquid crystal (LC) mode utilizing a topologically self-structured dual-groove surface for degenerated easy axes of LC anchoring. In our study, the effect of the bulk elastic distortion of the LC directors on the bistable anchoring surface is theoretically analyzed for balanced bistable states based on a free energy diagram. By adjusting bulk LC chirality, we developed ideally symmetric and stable bistable anchoring and switching properties, which can be driven by a low in-plane pulsed field of about 0.7 V/µm. The fabricated device has a contrast ratio of 196:1.

  6. Switching between bistable states in a discrete nonlinear model with long-range dispersion

    DEFF Research Database (Denmark)

    Johansson, Magnus; Gaididei, Yuri B.; Christiansen, Peter Leth


    In the framework of a discrete nonlinear Schrodinger equation with long-range dispersion, we propose a general mechanism for obtaining a controlled switching between bistable localized excitations. We show that the application of a spatially symmetric kick leads to the excitation of an internal...

  7. Models of charge transport and transfer in molecular switch tunnel junctions of bistable catenanes and rotaxanes

    International Nuclear Information System (INIS)

    Flood, Amar H.; Wong, Eric W.; Stoddart, J. Fraser


    The processes by which charge transfer can occur play a foundational role in molecular electronics. Here we consider simplified models of the transfer processes that could be present in bistable molecular switch tunnel junction (MSTJ) devices during one complete cycle of the device from its low- to high- and back to low-conductance state. The bistable molecular switches, which are composed of a monolayer of either switchable catenanes or rotaxanes, exist in either a ground-state co-conformation or a metastable one in which the conduction properties of the two co-conformations, when measured at small biases (+0.1 V), are significantly different irrespective of whether transport is dominated by tunneling or hopping. The voltage-driven generation (±2 V) of molecule-based redox states, which are sufficiently long-lived to allow the relative mechanical movements necessary to switch between the two co-conformations, rely upon unequal charge transfer rates on to and/or off of the molecules. Surface-enhanced Raman spectroscopy has been used to image the ground state of the bistable rotaxane in MSTJ-like devices. Consideration of these models provide new ways of looking at molecular electronic devices that rely, not only on nanoscale charge-transport, but also upon the bustling world of molecular motion in mechanically interlocked bistable molecules

  8. On-Demand Final State Control of a Surface-Bound Bistable Single Molecule Switch. (United States)

    Garrido Torres, José A; Simpson, Grant J; Adams, Christopher J; Früchtl, Herbert A; Schaub, Renald


    Modern electronic devices perform their defined action because of the complete reliability of their individual active components (transistors, switches, diodes, and so forth). For instance, to encode basic computer units (bits) an electrical switch can be used. The reliability of the switch ensures that the desired outcome (the component's final state, 0 or 1) can be selected with certainty. No practical data storage device would otherwise exist. This reliability criterion will necessarily need to hold true for future molecular electronics to have the opportunity to emerge as a viable miniaturization alternative to our current silicon-based technology. Molecular electronics target the use of single-molecules to perform the actions of individual electronic components. On-demand final state control over a bistable unimolecular component has therefore been one of the main challenges in the past decade (1-5) but has yet to be achieved. In this Letter, we demonstrate how control of the final state of a surface-supported bistable single molecule switch can be realized. On the basis of the observations and deductions presented here, we further suggest an alternative strategy to achieve final state control in unimolecular bistable switches.

  9. Designing a stochastic genetic switch by coupling chaos and bistability

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Xiang [State Key Laboratory for Mesoscopic Physics and School of Physics, Peking University, Beijing 100871 (China); Ouyang, Qi [State Key Laboratory for Mesoscopic Physics and School of Physics, Peking University, Beijing 100871 (China); Center for Quantitative Biology, Peking University, Beijing 100871 (China); The Peking-Tsinghua Center for Life Sciences, Beijing 100871 (China); Wang, Hongli, E-mail: [State Key Laboratory for Mesoscopic Physics and School of Physics, Peking University, Beijing 100871 (China); Center for Quantitative Biology, Peking University, Beijing 100871 (China)


    In stem cell differentiation, a pluripotent stem cell becomes progressively specialized and generates specific cell types through a series of epigenetic processes. How cells can precisely determine their fate in a fluctuating environment is a currently unsolved problem. In this paper, we suggest an abstract gene regulatory network to describe mathematically the differentiation phenomenon featuring stochasticity, divergent cell fates, and robustness. The network consists of three functional motifs: an upstream chaotic motif, a buffering motif of incoherent feed forward loop capable of generating a pulse, and a downstream motif which is bistable. The dynamic behavior is typically a transient chaos with fractal basin boundaries. The trajectories take transiently chaotic journeys before divergently settling down to the bistable states. The ratio of the probability that the high state is achieved to the probability that the low state is reached can maintain a constant in a population of cells with varied molecular fluctuations. The ratio can be turned up or down when proper parameters are adjusted. The model suggests a possible mechanism for the robustness against fluctuations that is prominently featured in pluripotent cell differentiations and developmental phenomena.

  10. Designing a stochastic genetic switch by coupling chaos and bistability. (United States)

    Zhao, Xiang; Ouyang, Qi; Wang, Hongli


    In stem cell differentiation, a pluripotent stem cell becomes progressively specialized and generates specific cell types through a series of epigenetic processes. How cells can precisely determine their fate in a fluctuating environment is a currently unsolved problem. In this paper, we suggest an abstract gene regulatory network to describe mathematically the differentiation phenomenon featuring stochasticity, divergent cell fates, and robustness. The network consists of three functional motifs: an upstream chaotic motif, a buffering motif of incoherent feed forward loop capable of generating a pulse, and a downstream motif which is bistable. The dynamic behavior is typically a transient chaos with fractal basin boundaries. The trajectories take transiently chaotic journeys before divergently settling down to the bistable states. The ratio of the probability that the high state is achieved to the probability that the low state is reached can maintain a constant in a population of cells with varied molecular fluctuations. The ratio can be turned up or down when proper parameters are adjusted. The model suggests a possible mechanism for the robustness against fluctuations that is prominently featured in pluripotent cell differentiations and developmental phenomena.

  11. Brain activity dynamics in human parietal regions during spontaneous switches in bistable perception. (United States)

    Megumi, Fukuda; Bahrami, Bahador; Kanai, Ryota; Rees, Geraint


    The neural mechanisms underlying conscious visual perception have been extensively investigated using bistable perception paradigms. Previous functional magnetic resonance imaging (fMRI) and transcranial magnetic stimulation (TMS) studies suggest that the right anterior superior parietal (r-aSPL) and the right posterior superior parietal lobule (r-pSPL) have opposite roles in triggering perceptual reversals. It has been proposed that these two areas are part of a hierarchical network whose dynamics determine perceptual switches. However, how these two parietal regions interact with each other and with the rest of the brain during bistable perception is not known. Here, we investigated such a model by recording brain activity using fMRI while participants viewed a bistable structure-from-motion stimulus. Using dynamic causal modeling (DCM), we found that resolving such perceptual ambiguity was specifically associated with reciprocal interactions between these parietal regions and V5/MT. Strikingly, the strength of bottom-up coupling between V5/MT to r-pSPL and from r-pSPL to r-aSPL predicted individual mean dominance duration. Our findings are consistent with a hierarchical predictive coding model of parietal involvement in bistable perception and suggest that visual information processing underlying spontaneous perceptual switches can be described as changes in connectivity strength between parietal and visual cortical regions. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Stochastic stabilization of phenotypic States: the genetic bistable switch as a case study. (United States)

    Weber, Marc; Buceta, Javier


    We study by means of analytical calculation and stochastic simulations how intrinsic noise modifies the bifurcation diagram of gene regulatory processes that can be effectively described by the Langevin formalism. In a general context, our study raises the intriguing question of how biochemical fluctuations redesign the epigenetic landscape in differentiation processes. We have applied our findings to a general class of regulatory processes that includes the simplest case that displays a bistable behavior and hence phenotypic variability: the genetic auto-activating switch. Thus, we explain why and how the noise promotes the stability of the low-state phenotype of the switch and show that the bistable region is extended when increasing the intensity of the fluctuations. This phenomenology is found in a simple one-dimensional model of the genetic switch as well as in a more detailed model that takes into account the binding of the protein to the promoter region. Altogether, we prescribe the analytical means to understand and quantify the noise-induced modifications of the bifurcation points for a general class of regulatory processes where the genetic bistable switch is included.

  13. Reverse bistable effect in ferroelectric liquid crystal devices with ultra-fast switching at low driving voltage. (United States)

    Guo, Qi; Zhao, Xiaojin; Zhao, Huijie; Chigrinov, V G


    In this Letter, reverse bistable effect with deep-sub-millisecond switching time is first reported in ferroelectric liquid crystal (FLC) devices using a homogeneous photo-alignment technique. It is indicated by our experimental results that both the anchoring energy and the dielectric property of the FLC's alignment layer is critical for the existence of the reverse bistable effect. In addition, with the derived criteria of the reverse bistable effect, we quantitatively analyze the switching dynamics of the reverse bistable FLC and the transition condition between the traditional bistability and our presented reverse bistability. Moreover, the fabricated FLC device exhibits an ultra-fast switching of ∼160  μs and a high contrast ratio of 1000:1, both of which were measured at a low driving voltage of 11 V. The featured deep-sub-millisecond switching time is really advantageous for our presented reverse bistable FLC devices, which enables a significant quality improvement of the existing optical devices, as well as a wide range of new applications in photonics and display areas.

  14. Fast switching of bistable magnetic nanowires through collective spin reversal (United States)

    Vindigni, Alessandro; Rettori, Angelo; Bogani, Lapo; Caneschi, Andrea; Gatteschi, Dante; Sessoli, Roberta; Novak, Miguel A.


    The use of magnetic nanowires as memory units is made possible by the exponential divergence of the characteristic time for magnetization reversal at low temperature, but the slow relaxation makes the manipulation of the frozen magnetic states difficult. We suggest that finite-size segments can show a fast switching if collective reversal of the spins is taken into account. This mechanism gives rise at low temperatures to a scaling law for the dynamic susceptibility that has been experimentally observed for the dilute molecular chain Co(hfac)2NitPhOMe. These results suggest a possible way of engineering nanowires for fast switching of the magnetization.

  15. Coupled Reversible and Irreversible Bistable Switches Underlying TGFβ-induced Epithelial to Mesenchymal Transition (United States)

    Tian, Xiao-Jun; Zhang, Hang; Xing, Jianhua


    Epithelial to mesenchymal transition (EMT) plays an important role in embryonic development, tissue regeneration, and cancer metastasis. Whereas several feedback loops have been shown to regulate EMT, it remains elusive how they coordinately modulate EMT response to TGF-β treatment. We construct a mathematical model for the core regulatory network controlling TGF-β-induced EMT. Through deterministic analyses and stochastic simulations, we show that EMT is a sequential two-step program in which an epithelial cell first is converted to partial EMT then to the mesenchymal state, depending on the strength and duration of TGF-β stimulation. Mechanistically the system is governed by coupled reversible and irreversible bistable switches. The SNAIL1/miR-34 double-negative feedback loop is responsible for the reversible switch and regulates the initiation of EMT, whereas the ZEB/miR-200 feedback loop is accountable for the irreversible switch and controls the establishment of the mesenchymal state. Furthermore, an autocrine TGF-β/miR-200 feedback loop makes the second switch irreversible, modulating the maintenance of EMT. Such coupled bistable switches are robust to parameter variation and molecular noise. We provide a mechanistic explanation on multiple experimental observations. The model makes several explicit predictions on hysteretic dynamic behaviors, system response to pulsed stimulation, and various perturbations, which can be straightforwardly tested. PMID:23972859

  16. Confinement and diffusion modulate bistability and stochastic switching in a reaction network with positive feedback

    International Nuclear Information System (INIS)

    Mlynarczyk, Paul J.; Pullen, Robert H.; Abel, Steven M.


    Positive feedback is a common feature in signal transduction networks and can lead to phenomena such as bistability and signal propagation by domain growth. Physical features of the cellular environment, such as spatial confinement and the mobility of proteins, play important but inadequately understood roles in shaping the behavior of signaling networks. Here, we use stochastic, spatially resolved kinetic Monte Carlo simulations to explore a positive feedback network as a function of system size, system shape, and mobility of molecules. We show that these physical properties can markedly alter characteristics of bistability and stochastic switching when compared with well-mixed simulations. Notably, systems of equal volume but different shapes can exhibit qualitatively different behaviors under otherwise identical conditions. We show that stochastic switching to a state maintained by positive feedback occurs by cluster formation and growth. Additionally, the frequency at which switching occurs depends nontrivially on the diffusion coefficient, which can promote or suppress switching relative to the well-mixed limit. Taken together, the results provide a framework for understanding how confinement and protein mobility influence emergent features of the positive feedback network by modulating molecular concentrations, diffusion-influenced rate parameters, and spatiotemporal correlations between molecules

  17. The limiting dynamics of a bistable molecular switch with and without noise. (United States)

    Mackey, Michael C; Tyran-Kamińska, Marta


    We consider the dynamics of a population of organisms containing two mutually inhibitory gene regulatory networks, that can result in a bistable switch-like behaviour. We completely characterize their local and global dynamics in the absence of any noise, and then go on to consider the effects of either noise coming from bursting (transcription or translation), or Gaussian noise in molecular degradation rates when there is a dominant slow variable in the system. We show analytically how the steady state distribution in the population can range from a single unimodal distribution through a bimodal distribution and give the explicit analytic form for the invariant stationary density which is globally asymptotically stable. Rather remarkably, the behaviour of the stationary density with respect to the parameters characterizing the molecular behaviour of the bistable switch is qualitatively identical in the presence of noise coming from bursting as well as in the presence of Gaussian noise in the degradation rate. This implies that one cannot distinguish between either the dominant source or nature of noise based on the stationary molecular distribution in a population of cells. We finally show that the switch model with bursting but two dominant slow genes has an asymptotically stable stationary density.

  18. Bistable direction switching in an off-axis pumped continuous wave ruby laser (United States)

    Afzal, R. Sohrab; Lawandy, N. M.


    A report is presented of the observation of hysteretic bistable direction switching in a single-mode CW ruby laser system. This effect is only observed when the pump beam which is focused into the ruby rod is misaligned with respect to the rod end faces. At low pump powers, the ruby lases in a mode nearly collinear with the pump axis. At a higher pump power the ruby switches to a mode that is collinear with the rod end faces and preserves the original polarization. The effect is large enough to switch the beam by an angle equal to twice the diffraction angle. The observations show that under steady-state pumping, a CW ruby laser can exhibit bistable operation in its output direction and power. A calculation using the heat equation with two concentric cylinders with one as a heat source (pump laser) and the outer wall of the other held at 77 K, gives an increase in core temperature of about 0.01 K. Therefore, the increase in temperature is not large enough to change the index of refraction to account for such large macroscopic effects.

  19. Numerical analysis of intrinsic bistability and chromatic switching in Tm3+ single-doped systems under photon avalanche pumping scheme

    International Nuclear Information System (INIS)

    Li Li; Zhang Xinlu; Chen Lixue


    In this paper, we predict and numerically demonstrate the intrinsic intensity bistability, spectra bistability and chromatic switching of visible-infrared emission in Tm 3+ single-doped systems that are pumped by the photon avalanche scheme at 648 nm. Based on the coupled rate equation theory, the evolutions of the populations at various Tm 3+ energy levels, emission spectra and fluorescence intensity versus pump excitation are numerically investigated in detail. The results show that intrinsic optical bistability (IOB) associated with emission spectra and luminescence intensity takes place in the vicinity of the avalanche threshold (∼10 kW cm -2 ). When the pump excitation rises above the switching threshold (∼17.5 kW cm -2 ), the chromatic switching between the infrared (1716 nm) and the visible blue (452/469 nm) spectra can be performed. Moreover, the influences of system parameters on IOB and the origin of chromatic switching are discussed. These unique characteristics of Tm 3+ -doped systems would lead to the new possibility of the development of pump-controlled all-solid-state luminescence switches and optical bistability switches.

  20. A bistable switch and anatomical site control Vibrio cholerae virulence gene expression in the intestine.

    Directory of Open Access Journals (Sweden)

    Alex T Nielsen


    Full Text Available A fundamental, but unanswered question in host-pathogen interactions is the timing, localization and population distribution of virulence gene expression during infection. Here, microarray and in situ single cell expression methods were used to study Vibrio cholerae growth and virulence gene expression during infection of the rabbit ligated ileal loop model of cholera. Genes encoding the toxin-coregulated pilus (TCP and cholera toxin (CT were powerfully expressed early in the infectious process in bacteria adjacent to epithelial surfaces. Increased growth was found to co-localize with virulence gene expression. Significant heterogeneity in the expression of tcpA, the repeating subunit of TCP, was observed late in the infectious process. The expression of tcpA, studied in single cells in a homogeneous medium, demonstrated unimodal induction of tcpA after addition of bicarbonate, a chemical inducer of virulence gene expression. Striking bifurcation of the population occurred during entry into stationary phase: one subpopulation continued to express tcpA, whereas the expression declined in the other subpopulation. ctxA, encoding the A subunit of CT, and toxT, encoding the proximal master regulator of virulence gene expression also exhibited the bifurcation phenotype. The bifurcation phenotype was found to be reversible, epigenetic and to persist after removal of bicarbonate, features consistent with bistable switches. The bistable switch requires the positive-feedback circuit controlling ToxT expression and formation of the CRP-cAMP complex during entry into stationary phase. Key features of this bistable switch also were demonstrated in vivo, where striking heterogeneity in tcpA expression was observed in luminal fluid in later stages of the infection. When this fluid was diluted into artificial seawater, bacterial aggregates continued to express tcpA for prolonged periods of time. The bistable control of virulence gene expression points to a

  1. Bridging time scales in cellular decision making with a stochastic bistable switch

    Directory of Open Access Journals (Sweden)

    Waldherr Steffen


    Full Text Available Abstract Background Cellular transformations which involve a significant phenotypical change of the cell's state use bistable biochemical switches as underlying decision systems. Some of these transformations act over a very long time scale on the cell population level, up to the entire lifespan of the organism. Results In this work, we aim at linking cellular decisions taking place on a time scale of years to decades with the biochemical dynamics in signal transduction and gene regulation, occuring on a time scale of minutes to hours. We show that a stochastic bistable switch forms a viable biochemical mechanism to implement decision processes on long time scales. As a case study, the mechanism is applied to model the initiation of follicle growth in mammalian ovaries, where the physiological time scale of follicle pool depletion is on the order of the organism's lifespan. We construct a simple mathematical model for this process based on experimental evidence for the involved genetic mechanisms. Conclusions Despite the underlying stochasticity, the proposed mechanism turns out to yield reliable behavior in large populations of cells subject to the considered decision process. Our model explains how the physiological time constant may emerge from the intrinsic stochasticity of the underlying gene regulatory network. Apart from ovarian follicles, the proposed mechanism may also be of relevance for other physiological systems where cells take binary decisions over a long time scale.

  2. Coupling between feedback loops in autoregulatory networks affects bistability range, open-loop gain and switching times

    International Nuclear Information System (INIS)

    Tiwari, Abhinav; Igoshin, Oleg A


    Biochemical regulatory networks governing diverse cellular processes such as stress-response, differentiation and cell cycle often contain coupled feedback loops. We aim at understanding how features of feedback architecture, such as the number of loops, the sign of the loops and the type of their coupling, affect network dynamical performance. Specifically, we investigate how bistability range, maximum open-loop gain and switching times of a network with transcriptional positive feedback are affected by additive or multiplicative coupling with another positive- or negative-feedback loop. We show that a network's bistability range is positively correlated with its maximum open-loop gain and that both quantities depend on the sign of the feedback loops and the type of feedback coupling. Moreover, we find that the addition of positive feedback could decrease the bistability range if we control the basal level in the signal-response curves of the two systems. Furthermore, the addition of negative feedback has the capacity to increase the bistability range if its dissociation constant is much lower than that of the positive feedback. We also find that the addition of a positive feedback to a bistable network increases the robustness of its bistability range, whereas the addition of a negative feedback decreases it. Finally, we show that the switching time for a transition from a high to a low steady state increases with the effective fold change in gene regulation. In summary, we show that the effect of coupled feedback loops on the bistability range and switching times depends on the underlying mechanistic details. (paper)

  3. Relatively slow stochastic gene-state switching in the presence of positive feedback significantly broadens the region of bimodality through stabilizing the uninduced phenotypic state. (United States)

    Ge, Hao; Wu, Pingping; Qian, Hong; Xie, Xiaoliang Sunney


    Within an isogenic population, even in the same extracellular environment, individual cells can exhibit various phenotypic states. The exact role of stochastic gene-state switching regulating the transition among these phenotypic states in a single cell is not fully understood, especially in the presence of positive feedback. Recent high-precision single-cell measurements showed that, at least in bacteria, switching in gene states is slow relative to the typical rates of active transcription and translation. Hence using the lac operon as an archetype, in such a region of operon-state switching, we present a fluctuating-rate model for this classical gene regulation module, incorporating the more realistic operon-state switching mechanism that was recently elucidated. We found that the positive feedback mechanism induces bistability (referred to as deterministic bistability), and that the parameter range for its occurrence is significantly broadened by stochastic operon-state switching. We further show that in the absence of positive feedback, operon-state switching must be extremely slow to trigger bistability by itself. However, in the presence of positive feedback, which stabilizes the induced state, the relatively slow operon-state switching kinetics within the physiological region are sufficient to stabilize the uninduced state, together generating a broadened parameter region of bistability (referred to as stochastic bistability). We illustrate the opposite phenotype-transition rate dependence upon the operon-state switching rates in the two types of bistability, with the aid of a recently proposed rate formula for fluctuating-rate models. The rate formula also predicts a maximal transition rate in the intermediate region of operon-state switching, which is validated by numerical simulations in our model. Overall, our findings suggest a biological function of transcriptional "variations" among genetically identical cells, for the emergence of bistability and

  4. Interplay between Switching Driven by the Tunneling Current and Atomic Force of a Bistable Four-Atom Si Quantum Dot. (United States)

    Yamazaki, Shiro; Maeda, Keisuke; Sugimoto, Yoshiaki; Abe, Masayuki; Zobač, Vladimír; Pou, Pablo; Rodrigo, Lucia; Mutombo, Pingo; Pérez, Ruben; Jelínek, Pavel; Morita, Seizo


    We assemble bistable silicon quantum dots consisting of four buckled atoms (Si4-QD) using atom manipulation. We demonstrate two competing atom switching mechanisms, downward switching induced by tunneling current of scanning tunneling microscopy (STM) and opposite upward switching induced by atomic force of atomic force microscopy (AFM). Simultaneous application of competing current and force allows us to tune switching direction continuously. Assembly of the few-atom Si-QDs and controlling their states using versatile combined AFM/STM will contribute to further miniaturization of nanodevices.

  5. High-power subnanosecond operation of a bistable optically controlled semiconductor switch (BOSS)

    International Nuclear Information System (INIS)

    Stoudt, D.C.; Richardson, M.A.; Demske, D.L.; Roush, R.A.; Eure, K.W.


    Recent high-power, subnanosecond-switching results of the Bistable Optically controlled Semiconductor Switch (BOSS) are presented. The process of persistent photoconductivity followed by photo-quenching have been demonstrated at megawatt power levels in copper-compensated, silicon-doped, semi-insulating gallium arsenide. These processes allow a switch to be developed that can be closed by the application of one laser pulse and opened by the application of a second laser pulse with a wavelength equal to twice that of the first laser. Switch closure is primarily achieved by elevating electrons from a deep copper center which has been diffused into the material. The opening phase is a two-step process which relies initially on the absorption of the 2-μm laser causing electrons to be elevated from the valance band back into the copper center, and finally on the recombination of electrons in the conduction band with boles in the valance band. The second step requires a sufficient concentration of recombination centers (RC) in the material for opening to occur in the subnanosecond regime. These RC's are generated in the bulk GaAs material by fast-neutron irradiation (∼ 1 MeV) at a fluence of about 3 x 10 15 cm -2 . High-power switching results which demonstrate that the BOSS switch can be opened in the subnanosecond regime are presented for the first time. Neutron-irradiated BOSS devices have been opened against a rising electric field of about 20 kV/cm (10 kV) in a time less than one nanosecond. Kilovolt electrical pulses have been generated with a FWHM of roughly 250 picoseconds

  6. Beam-splitter switches based on zenithal bistable liquid-crystal gratings. (United States)

    Zografopoulos, Dimitrios C; Beccherelli, Romeo; Kriezis, Emmanouil E


    The tunable optical diffractive properties of zenithal bistable nematic liquid-crystal gratings are theoretically investigated. The liquid-crystal orientation is rigorously solved via a tensorial formulation of the Landau-de Gennes theory and the optical transmission properties of the gratings are investigated via full-wave finite-element frequency-domain simulations. It is demonstrated that by proper design the two stable states of the grating can provide nondiffracting and diffracting operation, the latter with equal power splitting among different diffraction orders. An electro-optic switching mechanism, based on dual-frequency nematic materials, and its temporal dynamics are further discussed. Such gratings provide a solution towards tunable beam-steering and beam-splitting components with extremely low power consumption.

  7. How to turn a genetic circuit into a synthetic tunable oscillator, or a bistable switch.

    Directory of Open Access Journals (Sweden)

    Lucia Marucci


    Full Text Available Systems and Synthetic Biology use computational models of biological pathways in order to study in silico the behaviour of biological pathways. Mathematical models allow to verify biological hypotheses and to predict new possible dynamical behaviours. Here we use the tools of non-linear analysis to understand how to change the dynamics of the genes composing a novel synthetic network recently constructed in the yeast Saccharomyces cerevisiae for In-vivo Reverse-engineering and Modelling Assessment (IRMA. Guided by previous theoretical results that make the dynamics of a biological network depend on its topological properties, through the use of simulation and continuation techniques, we found that the network can be easily turned into a robust and tunable synthetic oscillator or a bistable switch. Our results provide guidelines to properly re-engineering in vivo the network in order to tune its dynamics.

  8. Switching process between bistable positons of multiquantum flux tubes in a thin-film type I superconductor

    International Nuclear Information System (INIS)

    Parisi, J.; Huebener, R.P.; Muhlemeier, B.


    A superconducting memory device based on a bistable vortex position represents an interesting storage medium for future Josephson computers. In order to study the operational mode of such a single-flux quantum memory cell, we use as a model system multiquantum flux tubes in a thin-film type I superconductor (Pb). By employing high-resolution stroboscopic magnetooptical flux detection, we are able to globally visualize both spatial and temporal behavior of rapidly switching individual flux tubes. All experimental results agree reasonably well with theoretical model considerations of the energy balance during the elementary switching process

  9. Cell cycle commitment in budding yeast emerges from the cooperation of multiple bistable switches (United States)

    Zhang, Tongli; Schmierer, Bernhard; Novák, Béla


    The start-transition (START) in the G1 phase marks the point in the cell cycle at which a yeast cell initiates a new round of cell division. Once made, this decision is irreversible and the cell is committed to progressing through the entire cell cycle, irrespective of arrest signals such as pheromone. How commitment emerges from the underlying molecular interaction network is poorly understood. Here, we perform a dynamical systems analysis of an established cell cycle model, which has never been analysed from a commitment perspective. We show that the irreversibility of the START transition and subsequent commitment can be consistently explained in terms of the interplay of multiple bistable molecular switches. By applying an existing mathematical model to a novel problem and by expanding the model in a self-consistent manner, we achieve several goals: we bring together a large number of experimental findings into a coherent theoretical framework; we increase the scope and the applicability of the original model; we give a systems level explanation of how the START transition and the cell cycle commitment arise from the dynamical features of the underlying molecular interaction network; and we make clear, experimentally testable predictions. PMID:22645649

  10. Bistable optical response of a nanoparticle heterodimer : Mechanism, phase diagram, and switching time

    NARCIS (Netherlands)

    Nugroho, Bintoro; Iskandar, Alexander; Malyshev, V.A.; Knoester, Jasper


    We conduct a theoretical study of the bistable optical response of a nanoparticle heterodimer comprised of a closely spaced semiconductor quantum dot and a metal nanoparticle. The bistable nature of the response results from the interplay between the quantum dot's optical nonlinearity and its

  11. Influence of ZnO nanostructures in liquid crystal interfaces for bistable switching applications

    Energy Technology Data Exchange (ETDEWEB)

    Pal, Kaushik, E-mail: [School of Power and Mechanical Engineering, Wuhan University, 8 East Lake South Road, Wuhan 430072 (China); Zhan, Bihong, E-mail: [School of Power and Mechanical Engineering, Wuhan University, 8 East Lake South Road, Wuhan 430072 (China); Madhu Mohan, M.L.N. [Liquid Crystal Research Laboratory (LCRL), Bannari Amman Institute of Technology, Sathyamangalam 638 401 (India); Schirhagl, Romana [University Medical Center Groningen, Department of BioMedical Engineering, Ant. Deusinglaan 1, 9713 AV Groningen (Netherlands); Wang, Guoping, E-mail: [School of Power and Mechanical Engineering, Wuhan University, 8 East Lake South Road, Wuhan 430072 (China)


    constructed and compared. The switching times, the contrast ratio and spontaneous polarization of the nanostructures–HBLC composite film were carried out by systematic investigation. The sample preparation parameters, such as the curing time and curing intensity were optimized. The critical applied voltage to achieve the switching bi-stability of our device is only 4.5 V, which is approximately twice its threshold voltage for Freedericksz transition. This performance puts the hybrid structure at the top level in the state of the art in application oriented research in optics of liquid crystalline composite materials.

  12. Design methodology for all-optical bistable switches based on a plasmonic resonator sandwiched between dielectric waveguides

    International Nuclear Information System (INIS)

    Xiang, Yinxiao; Cai, Wei; Wang, Lei; Ying, Cuifeng; Zhang, Xinzheng; Xu, Jingjun


    We present a bistable device consisting of a Bragg grating resonator with a Kerr medium sandwiched between two dielectric slab waveguides. The resonator is situated in a nanometer-scaled metal–insulator–metal plasmonic waveguide. Due to the dimensional confinement from the dielectric waveguide to the nanoscaled plasmonic waveguide, electric fields are enhanced greatly, which will further reduce the threshold value. Moreover, a semi-analytic method, based on the impedance theory and the transfer matrix method, is developed to study the transmission and reflection spectra as well as the bistability loop of such a switch. Our method is fast and accurate, as confirmed by the finite-difference time-domain simulation. (invited paper)


    Directory of Open Access Journals (Sweden)

    E. I. BAIDA


    Full Text Available Purpose. Development of a mathematical model of an induction-dynamic drive of a switch with two coils, working with a bistable mechanism, which ensures the fixation of the instant-dynamic mechanism (IDM in trajectory extreme positions of the contact system. Methodology. The solution of the problems posed in the work was carried out using methods for calculating the electromagnetic field, finite elements, theoretical mechanics, and solving differential equations. Findings. The mathematical model of quick-driving actuator as part of instant dynamic and bistable mechanism was developed. It was based on electrical circuit’s electromagnetic equations and kinematic movements of the switching mechanism. Advantage of the given model is possibility of a breaker drive dynamic analysis basing on data of a contact pressure, pretravel and snatch gap. Initial data of the model formulation were outer circuit inductance, resistance of coils, which calculated on conductor cross-section and coils configuration. Initial conditions corresponded by Dirichlet conditions. Mathematical model equations system was calculated in cylindrical coordinate system. Problem was solved with the help ComsolMultiphysics system. Motion of the IDM movement part was modeled by deformation of a computational grid. Spring force and stress in a bistable mechanism construction were determined by initial data of a contact pressure, pretravel and snatch gap. Graphs by calculation data are shown, which allow to analyze of springing elements chose and make necessary adjustments on design stage and debugging construction. Operation parameters of mechanism work on IDM switch on and switch off stages were calculated. Value of movement, motion speed of armature breaker, currents of accelerating and retarding coils, summed electromagnetic and opposite force were figured. Originality. The mathematical model of quick-driving actuator as part of instant-dynamic and bistable mechanism was developed

  14. Temperature persistent bistability and threshold switching in a single barrier heterostructure hot-electron diode

    DEFF Research Database (Denmark)

    Stasch, R.; Hey, R.; Asche, M.


    Bistable current–voltage characteristics caused by competition of tunneling through and field-enhanced thermionic emission across a single barrier are investigated in an n–-GaAs/Al0.34Ga0.66As/n+-GaAs structure. The S-shaped part of the characteristic persists in the whole temperature regime...

  15. Convergent Transcription in the Butyrolactone Regulon in Streptomyces coelicolor Confers a Bistable Genetic Switch for Antibiotic Biosynthesis (United States)

    Chatterjee, Anushree; Drews, Laurie; Mehra, Sarika; Takano, Eriko; Kaznessis, Yiannis N.; Hu, Wei-Shou


    cis-encoded antisense RNAs (cis asRNA) have been reported to participate in gene expression regulation in both eukaryotic and prokaryotic organisms. Its presence in Streptomyces coelicolor has also been reported recently; however, its role has yet to be fully investigated. Using mathematical modeling we explore the role of cis asRNA produced as a result of convergent transcription in scbA-scbR genetic switch. scbA and scbR gene pair, encoding repressor–amplifier proteins respectively, mediates the synthesis of a signaling molecule, the γ-butyrolactone SCB1 and controls the onset of antibiotic production. Our model considers that transcriptional interference caused by convergent transcription of two opposing RNA polymerases results in fatal collision and transcriptional termination, which suppresses transcription efficiency. Additionally, convergent transcription causes sense and antisense interactions between complementary sequences from opposing strands, rendering the full length transcript inaccessible for translation. We evaluated the role of transcriptional interference and the antisense effect conferred by convergent transcription on the behavior of scbA-scbR system. Stability analysis showed that while transcriptional interference affects the system, it is asRNA that confers scbA-scbR system the characteristics of a bistable switch in response to the signaling molecule SCB1. With its critical role of regulating the onset of antibiotic synthesis the bistable behavior offers this two gene system the needed robustness to be a genetic switch. The convergent two gene system with potential of transcriptional interference is a frequent feature in various genomes. The possibility of asRNA regulation in other such gene-pairs is yet to be examined. PMID:21765930

  16. Bistability and Biofilm Formation in Bacillus subtilis (United States)

    Chai, Yunrong; Chu, Frances; Kolter, Roberto; Losick, Richard


    Summary Biofilms of Bacillus subtilis consist of long chains of cells that are held together in bundles by an extracellular matrix of exopolysaccharide and the protein TasA. The exopolysaccharide is produced by enzymes encoded by the epsA-O operon and the gene encoding TasA is located in the yqxM-sipW-tasA operon. Both operons are under the control of the repressor SinR. Derepression is mediated by the antirepressor SinI, which binds to SinR with a 1:1 stoichiometry. Paradoxically, in medium promoting derepression of the matrix operons, the overall concentration of SinR in the culture greatly exceeded that of SinI. We show that under biofilm-promoting conditions sinI, which is under the control of the response regulator Spo0A, was expressed only in a small subpopulation of cells, whereas sinR was expressed in almost all cells. Activation of Spo0A is known to be subject to a bistable switch, and we infer that SinI reaches levels sufficient to trigger matrix production only in the subpopulation of cells in which Spo0A is active. Additionally, evidence suggests that sinI is expressed at intermediate, but not low or high, levels of Spo0A activity, which may explain why certain nutritional conditions are more effective in promoting biofilm formation than others. PMID:18047568

  17. Switching waves dynamics in optical bistable cavity-free system at femtosecond laser pulse propagation in semiconductor under light diffraction (United States)

    Trofimov, Vyacheslav A.; Egorenkov, Vladimir A.; Loginova, Maria M.


    We consider a propagation of laser pulse in a semiconductor under the conditions of an occurrence of optical bistability, which appears due to a nonlinear absorption of the semiconductor. As a result, the domains of high concentration of free charged particles (electrons and ionized donors) occur if an intensity of the incident optical pulse is greater than certain intensity. As it is well-known, that an optical beam must undergo a diffraction on (or reflection from) the domains boundaries. Usually, the beam diffraction along a coordinate of the optical pulse propagation does not take into account by using the slowly varying envelope approximation for the laser pulse interaction with optical bistable element. Therefore, a reflection of the beam from the domains with abrupt boundary does not take into account under computer simulation of the laser pulse propagation. However, the optical beams, reflected from nonhomogeneities caused by the domains of high concentration of free-charged particles, can essentially influence on a formation of switching waves in a semiconductor. We illustrate this statement by computer simulation results provided on the base of nonlinear Schrödinger equation and a set of PDEs, which describe an evolution of the semiconductor characteristics (concentrations of free-charged particles and potential of an electric field strength), and taking into account the longitudinal and transverse diffraction effects.

  18. Terminator Operon Reporter: combining a transcription termination switch with reporter technology for improved gene synthesis and synthetic biology applications. (United States)

    Zampini, Massimiliano; Mur, Luis A J; Rees Stevens, Pauline; Pachebat, Justin A; Newbold, C James; Hayes, Finbarr; Kingston-Smith, Alison


    Synthetic biology is characterized by the development of novel and powerful DNA fabrication methods and by the application of engineering principles to biology. The current study describes Terminator Operon Reporter (TOR), a new gene assembly technology based on the conditional activation of a reporter gene in response to sequence errors occurring at the assembly stage of the synthetic element. These errors are monitored by a transcription terminator that is placed between the synthetic gene and reporter gene. Switching of this terminator between active and inactive states dictates the transcription status of the downstream reporter gene to provide a rapid and facile readout of the accuracy of synthetic assembly. Designed specifically and uniquely for the synthesis of protein coding genes in bacteria, TOR allows the rapid and cost-effective fabrication of synthetic constructs by employing oligonucleotides at the most basic purification level (desalted) and without the need for costly and time-consuming post-synthesis correction methods. Thus, TOR streamlines gene assembly approaches, which are central to the future development of synthetic biology.

  19. Bistability in a Metabolic Network Underpins the De Novo Evolution of Colony Switching in Pseudomonas fluorescens

    DEFF Research Database (Denmark)

    Gallie, Jenna; Libby, Eric; Bertels, Frederic


    Phenotype switching is commonly observed in nature. This prevalence has allowed the elucidation of a number of underlying molecular mechanisms. However, little is known about how phenotypic switches arise and function in their early evolutionary stages. The first opportunity to provide empirical ...

  20. Theoretical Insights into the Biophysics of Protein Bi-stability and Evolutionary Switches.

    Directory of Open Access Journals (Sweden)

    Tobias Sikosek


    Full Text Available Deciphering the effects of nonsynonymous mutations on protein structure is central to many areas of biomedical research and is of fundamental importance to the study of molecular evolution. Much of the investigation of protein evolution has focused on mutations that leave a protein's folded structure essentially unchanged. However, to evolve novel folds of proteins, mutations that lead to large conformational modifications have to be involved. Unraveling the basic biophysics of such mutations is a challenge to theory, especially when only one or two amino acid substitutions cause a large-scale conformational switch. Among the few such mutational switches identified experimentally, the one between the GA all-α and GB α+β folds is extensively characterized; but all-atom simulations using fully transferrable potentials have not been able to account for this striking switching behavior. Here we introduce an explicit-chain model that combines structure-based native biases for multiple alternative structures with a general physical atomic force field, and apply this construct to twelve mutants spanning the sequence variation between GA and GB. In agreement with experiment, we observe conformational switching from GA to GB upon a single L45Y substitution in the GA98 mutant. In line with the latent evolutionary potential concept, our model shows a gradual sequence-dependent change in fold preference in the mutants before this switch. Our analysis also indicates that a sharp GA/GB switch may arise from the orientation dependence of aromatic π-interactions. These findings provide physical insights toward rationalizing, predicting and designing evolutionary conformational switches.

  1. Bistable switching in supercritical n+-n-n+GaAs transferred electron devices

    DEFF Research Database (Denmark)

    Jøndrup, Peter; Jeppesen, Palle; Jeppson, Bert


    : 1) cathode-triggered traveling domain; 2) cathode-triggered accumulation layer; 3) anode-triggered domain. Relative current drops up to 40 percent, and switching times down to 60 ps are obtained in low-duty-cycle pulsed experiments with threshold currents around 400 mA. Optimum device parameters...

  2. Intrinsic Noise Profoundly Alters the Dynamics and Steady State of Morphogen-Controlled Bistable Genetic Switches.

    Directory of Open Access Journals (Sweden)

    Ruben Perez-Carrasco


    Full Text Available During tissue development, patterns of gene expression determine the spatial arrangement of cell types. In many cases, gradients of secreted signalling molecules-morphogens-guide this process by controlling downstream transcriptional networks. A mechanism commonly used in these networks to convert the continuous information provided by the gradient into discrete transitions between adjacent cell types is the genetic toggle switch, composed of cross-repressing transcriptional determinants. Previous analyses have emphasised the steady state output of these mechanisms. Here, we explore the dynamics of the toggle switch and use exact numerical simulations of the kinetic reactions, the corresponding Chemical Langevin Equation, and Minimum Action Path theory to establish a framework for studying the effect of gene expression noise on patterning time and boundary position. This provides insight into the time scale, gene expression trajectories and directionality of stochastic switching events between cell states. Taking gene expression noise into account predicts that the final boundary position of a morphogen-induced toggle switch, although robust to changes in the details of the noise, is distinct from that of the deterministic system. Moreover, the dramatic increase in patterning time close to the boundary predicted from the deterministic case is substantially reduced. The resulting stochastic switching introduces differences in patterning time along the morphogen gradient that result in a patterning wave propagating away from the morphogen source with a velocity determined by the intrinsic noise. The wave sharpens and slows as it advances and may never reach steady state in a biologically relevant time. This could explain experimentally observed dynamics of pattern formation. Together the analysis reveals the importance of dynamical transients for understanding morphogen-driven transcriptional networks and indicates that gene expression noise can

  3. Intrinsic Noise Profoundly Alters the Dynamics and Steady State of Morphogen-Controlled Bistable Genetic Switches (United States)

    Page, Karen M.


    During tissue development, patterns of gene expression determine the spatial arrangement of cell types. In many cases, gradients of secreted signalling molecules—morphogens—guide this process by controlling downstream transcriptional networks. A mechanism commonly used in these networks to convert the continuous information provided by the gradient into discrete transitions between adjacent cell types is the genetic toggle switch, composed of cross-repressing transcriptional determinants. Previous analyses have emphasised the steady state output of these mechanisms. Here, we explore the dynamics of the toggle switch and use exact numerical simulations of the kinetic reactions, the corresponding Chemical Langevin Equation, and Minimum Action Path theory to establish a framework for studying the effect of gene expression noise on patterning time and boundary position. This provides insight into the time scale, gene expression trajectories and directionality of stochastic switching events between cell states. Taking gene expression noise into account predicts that the final boundary position of a morphogen-induced toggle switch, although robust to changes in the details of the noise, is distinct from that of the deterministic system. Moreover, the dramatic increase in patterning time close to the boundary predicted from the deterministic case is substantially reduced. The resulting stochastic switching introduces differences in patterning time along the morphogen gradient that result in a patterning wave propagating away from the morphogen source with a velocity determined by the intrinsic noise. The wave sharpens and slows as it advances and may never reach steady state in a biologically relevant time. This could explain experimentally observed dynamics of pattern formation. Together the analysis reveals the importance of dynamical transients for understanding morphogen-driven transcriptional networks and indicates that gene expression noise can qualitatively

  4. What is refractive optical bistability

    International Nuclear Information System (INIS)

    Dzhehov, Tomislav


    The basic elements of the theory of refractive optical bistability, assuming mediums with linear absorption are given. Special attention is paid to bistable etalons of semiconductor materials an oxide glasses, since some of them are considered as promising components for optical bistability applications. The design optimization of such devices for minimum switching intensity is analyzed. Computer simulation of the transfer characteristic recording for two InSb etalons is presented. (author)

  5. MicroRNA-Mediated Positive Feedback Loop and Optimized Bistable Switch in a Cancer Network Involving miR-17-92 (United States)

    Li, Yichen; Li, Yumin; Zhang, Hui; Chen, Yong


    MicroRNAs (miRNAs) are small, noncoding RNAs that play an important role in many key biological processes, including development, cell differentiation, the cell cycle and apoptosis, as central post-transcriptional regulators of gene expression. Recent studies have shown that miRNAs can act as oncogenes and tumor suppressors depending on the context. The present work focuses on the physiological significance of miRNAs and their role in regulating the switching behavior. We illustrate an abstract model of the Myc/E2F/miR-17-92 network presented by Aguda et al. (2008), which is composed of coupling between the E2F/Myc positive feedback loops and the E2F/Myc/miR-17-92 negative feedback loop. By systematically analyzing the network in close association with plausible experimental parameters, we show that, in the presence of miRNAs, the system bistability emerges from the system, with a bistable switch and a one-way switch presented by Aguda et al. instead of a single one-way switch. Moreover, the miRNAs can optimize the switching process. The model produces a diverse array of response-signal behaviors in response to various potential regulating scenarios. The model predicts that this transition exists, one from cell death or the cancerous phenotype directly to cell quiescence, due to the existence of miRNAs. It was also found that the network involving miR-17-92 exhibits high noise sensitivity due to a positive feedback loop and also maintains resistance to noise from a negative feedback loop. PMID:22022595

  6. Ultra-Fast All-Optical Self-Aware Protection Switching Based on a Bistable Laser Diode

    DEFF Research Database (Denmark)

    An, Yi; Vukovic, Dragana; Lorences Riesgo, Abel


    We propose a novel concept of all-optical protection switching with link failure automatic awareness based on AOWFF. The scheme is experimentally demonstrated using a single MG-Y laser diode with a record switching time ~200 ps....

  7. Bistable microelectromechanical actuator (United States)

    Fleming, James G.


    A bistable microelectromechanical (MEM) actuator is formed on a substrate and includes a stressed membrane of generally rectangular shape that upon release assumes a curvilinear cross-sectional shape due to attachment at a midpoint to a resilient member and at opposing edges to a pair of elongate supports. The stressed membrane can be electrostatically switched between a pair of mechanical states having mirror-image symmetry, with the MEM actuator remaining in a quiescent state after a programming voltage is removed. The bistable MEM actuator according to various embodiments of the present invention can be used to form a nonvolatile memory element, an optical modulator (with a pair of mirrors supported above the membrane and moving in synchronism as the membrane is switched), a switchable mirror (with a single mirror supported above the membrane at the midpoint thereof) and a latching relay (with a pair of contacts that open and close as the membrane is switched). Arrays of bistable MEM actuators can be formed for applications including nonvolatile memories, optical displays and optical computing.

  8. Bistability of Cavity Magnon Polaritons (United States)

    Wang, Yi-Pu; Zhang, Guo-Qiang; Zhang, Dengke; Li, Tie-Fu; Hu, C.-M.; You, J. Q.


    We report the first observation of the magnon-polariton bistability in a cavity magnonics system consisting of cavity photons strongly interacting with the magnons in a small yttrium iron garnet (YIG) sphere. The bistable behaviors emerged as sharp frequency switchings of the cavity magnon polaritons (CMPs) and related to the transition between states with large and small numbers of polaritons. In our experiment, we align, respectively, the [100] and [110] crystallographic axes of the YIG sphere parallel to the static magnetic field and find very different bistable behaviors (e.g., clockwise and counter-clockwise hysteresis loops) in these two cases. The experimental results are well fitted and explained as being due to the Kerr nonlinearity with either a positive or negative coefficient. Moreover, when the magnetic field is tuned away from the anticrossing point of CMPs, we observe simultaneous bistability of both magnons and cavity photons by applying a drive field on the lower branch.

  9. A bistable mechanism for directional sensing

    International Nuclear Information System (INIS)

    Beta, C; Amselem, G; Bodenschatz, E


    We present a generic mechanism for directional sensing in eukaryotic cells that is based on bistable dynamics. As the key feature of this modeling approach, the velocity of trigger waves in the bistable sensing system changes its sign across cells that are exposed to an external chemoattractant gradient. This is achieved by combining a two-component activator/inhibitor system with a bistable switch that induces an identical symmetry breaking for arbitrary gradient input signals. A simple kinetic example is designed to illustrate the dynamics of a bistable directional sensing mechanism in numerical simulations

  10. Inhibitors Alter the Stochasticity of Regulatory Proteins to Force Cells to Switch to the Other State in the Bistable System. (United States)

    Jhang, Wun-Sin; Lo, Shih-Chiang; Yeh, Chen-Chao; Shu, Che-Chi


    The cellular behaviors under the control of genetic circuits are subject to stochastic fluctuations, or noise. The stochasticity in gene regulation, far from a nuisance, has been gradually appreciated for its unusual function in cellular activities. In this work, with Chemical Master Equation (CME), we discovered that the addition of inhibitors altered the stochasticity of regulatory proteins. For a bistable system of a mutually inhibitory network, such a change of noise led to the migration of cells in the bimodal distribution. We proposed that the consumption of regulatory protein caused by the addition of inhibitor is not the only reason for pushing cells to the specific state; the change of the intracellular stochasticity is also the main cause for the redistribution. For the level of the inhibitor capable of driving 99% of cells, if there is no consumption of regulatory protein, 88% of cells were guided to the specific state. It implied that cells were pushed, by the inhibitor, to the specific state due to the change of stochasticity.

  11. Bianthrone in a Single-Molecule Junction: Conductance Switching with a Bistable Molecule Facilitated by Image Charge Effects

    DEFF Research Database (Denmark)

    Bjørnholm, Thomas


    Bianthrone is a sterically hindered compound that exists in the form of two nonplanar isomers. Our experimental study of single-molecule junctions with bianthrone reveals persistent switching of electric conductance at low temperatures, which can be reasonably associated with molecular isomerizat...

  12. Interplay between switching driven by the tunneling current andatomic force of a bistable four-atom Si quantum dot

    Czech Academy of Sciences Publication Activity Database

    Yamazaki, S.; Maeda, K.; Sugimoto, Y.; Abe, M.; Zobač, Vladimír; Pou, P.; Rodrigo, L.; Mutombo, Pingo; Perez, R.; Jelínek, Pavel; Morita, S.


    Roč. 15, č. 7 (2015), 4356-4363 ISSN 1530-6984 R&D Projects: GA ČR(CZ) GA14-02079S Institutional support: RVO:68378271 Keywords : atomic manipulation * atomic switch * Si quantum dot * scanning tunneling microscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 13.779, year: 2015

  13. Bistable scattering in graphene-coated dielectric nanowires. (United States)

    Li, Rujiang; Wang, Huaping; Zheng, Bin; Dehdashti, Shahram; Li, Erping; Chen, Hongsheng


    In nonlinear plasmonics, the switching threshold of optical bistability is limited by the weak nonlinear responses from the conventional Kerr dielectric media. Considering the giant nonlinear susceptibility of graphene, here we develop a nonlinear scattering model under the mean field approximation and study the bistable scattering in graphene-coated dielectric nanowires based on the semi-analytical solutions. We find that the switching intensities of bistable scattering can be smaller than 1 MW cm -2 at the working frequency. To further decrease the switching intensities, we show that the most important factor that restricts the bistable scattering is the relaxation time of graphene. Our work not only reveals some general characteristics of graphene-based bistable scattering, but also provides a guidance to further applications of optical bistability in the high speed all-optical signal processing.

  14. Take it of leave it : Mechanisms underlying bacterial bistable regulatory networks

    NARCIS (Netherlands)

    Siebring, Jeroen; Sorg, Robin; Herber, Martijn; Kuipers, Oscar; Filloux, Alain A.M.


    Bistable switches occur in regulatory networks that can exist in two distinct stable states. Such networks allow distinct switching of individual cells. In bacteria these switches coexist with regulatory networks that respond gradually to environmental input. Bistable switches play key roles in high

  15. Feasibility and limitations of anti-fuses based on bistable non-volatile switches for power electronic applications (United States)

    Erlbacher, T.; Huerner, A.; Bauer, A. J.; Frey, L.


    Anti-fuse devices based on non-volatile memory cells and suitable for power electronic applications are demonstrated for the first time using silicon technology. These devices may be applied as stand alone devices or integrated using standard junction-isolation into application-specific and smart-power integrated circuits. The on-resistance of such devices can be permanently switched by nine orders of magnitude by triggering the anti-fuse with a positive voltage pulse. Extrapolation of measurement data and 2D TCAD process and device simulations indicate that 20 A anti-fuses with 10 mΩ can be reliably fabricated in 0.35 μm technology with a footprint of 2.5 mm2. Moreover, this concept offers distinguished added-values compared to existing mechanical relays, e.g. pre-test, temporary and permanent reset functions, gradual turn-on mode, non-volatility, and extendibility to high voltage capability.

  16. Reversibly Bistable Flexible Electronics

    KAUST Repository

    Alfaraj, Nasir


    Introducing the notion of transformational silicon electronics has paved the way for integrating various applications with silicon-based, modern, high-performance electronic circuits that are mechanically flexible and optically semitransparent. While maintaining large-scale production and prototyping rapidity, this flexible and translucent scheme demonstrates the potential to transform conventionally stiff electronic devices into thin and foldable ones without compromising long-term performance and reliability. In this work, we report on the fabrication and characterization of reversibly bistable flexible electronic switches that utilize flexible n-channel metal-oxide-semiconductor field-effect transistors. The transistors are fabricated initially on rigid (100) silicon substrates before they are peeled off. They can be used to control flexible batches of light-emitting diodes, demonstrating both the relative ease of scaling at minimum cost and maximum reliability and the feasibility of integration. The peeled-off silicon fabric is about 25 µm thick. The fabricated devices are transferred to a reversibly bistable flexible platform through which, for example, a flexible smartphone can be wrapped around a user’s wrist and can also be set back to its original mechanical position. Buckling and cyclic bending of such host platforms brings a completely new dimension to the development of flexible electronics, especially rollable displays.

  17. Steady state statistical correlations predict bistability in reaction motifs. (United States)

    Chakravarty, Suchana; Barik, Debashis


    Various cellular decision making processes are regulated by bistable switches that take graded input signals and convert them to binary all-or-none responses. Traditionally, a bistable switch generated by a positive feedback loop is characterized either by a hysteretic signal response curve with two distinct signaling thresholds or by characterizing the bimodality of the response distribution in the bistable region. To identify the intrinsic bistability of a feedback regulated network, here we propose that bistability can be determined by correlating higher order moments and cumulants (≥2) of the joint steady state distributions of two components connected in a positive feedback loop. We performed stochastic simulations of four feedback regulated models with intrinsic bistability and we show that for a bistable switch with variation of the signal dose, the steady state variance vs. covariance adopts a signatory cusp-shaped curve. Further, we find that the (n + 1)th order cross-cumulant vs. nth order cross-cumulant adopts a closed loop structure for at least n = 3. We also propose that our method is capable of identifying systems without intrinsic bistability even though the system may show bimodality in the marginal response distribution. The proposed method can be used to analyze single cell protein data measured at steady state from experiments such as flow cytometry.

  18. GABA shapes the dynamics of bistable perception. (United States)

    van Loon, Anouk M; Knapen, Tomas; Scholte, H Steven; St John-Saaltink, Elexa; Donner, Tobias H; Lamme, Victor A F


    Sometimes, perception fluctuates spontaneously between two distinct interpretations of a constant sensory input. These bistable perceptual phenomena provide a unique window into the neural mechanisms that create the contents of conscious perception. Models of bistable perception posit that mutual inhibition between stimulus-selective neural populations in visual cortex plays a key role in these spontaneous perceptual fluctuations. However, a direct link between neural inhibition and bistable perception has not yet been established experimentally. Here, we link perceptual dynamics in three distinct bistable visual illusions (binocular rivalry, motion-induced blindness, and structure from motion) to measurements of gamma-aminobutyric acid (GABA) concentrations in human visual cortex (as measured with magnetic resonance spectroscopy) and to pharmacological stimulation of the GABAA receptor by means of lorazepam. As predicted by a model of neural interactions underlying bistability, both higher GABA concentrations in visual cortex and lorazepam administration induced slower perceptual dynamics, as reflected in a reduced number of perceptual switches and a lengthening of percept durations. Thus, we show that GABA, the main inhibitory neurotransmitter, shapes the dynamics of bistable perception. These results pave the way for future studies into the competitive neural interactions across the visual cortical hierarchy that elicit conscious perception. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Controllable optical bistability in a three-mode optomechanical system with atom-cavity-mirror couplings (United States)

    Chen, Bin; Wang, Xiao-Fang; Yan, Jia-Kai; Zhu, Xiao-Fei; Jiang, Cheng


    We theoretically investigate the optical bistable behavior in a three-mode optomechanical system with atom-cavity-mirror couplings. The effects of the cavity-pump detuning and the pump power on the bistable behavior are discussed detailedly, the impacts of the atom-pump detuning and the atom-cavity coupling strength on the bistability of the system are also explored, and the influences of the cavity-resonator coupling strength and the cavity decay rate are also taken into consideration. The numerical results demonstrate that by tuning these parameters the bistable behavior of the system can be freely switched on or off, and the threshold of the pump power for the bistability as well as the bistable region width can also be effectively controlled. These results can find potential applications in optical bistable switch in the quantum information processing.

  20. Optical bistability in Er-Yb codoped phosphate glass microspheres at room temperature

    NARCIS (Netherlands)

    Warda, Jonathan M.; O'Shea, Danny G.; Shortt, Brian J.; Chormaic, Sile Nic


    We experimentally demonstrate optical bistability in Er(3+)-Yb(3+) phosphate glass microspheres at 295 K. Bistability is associated with both Er(3+) fluorescence and lasing behavior, and chromatic switching. The chromatic switching results from an intrinsic mechanism exploiting the thermal coupling

  1. Interlinked bistable mechanisms generate robust mitotic transitions. (United States)

    Hutter, Lukas H; Rata, Scott; Hochegger, Helfrid; Novák, Béla


    The transitions between phases of the cell cycle have evolved to be robust and switch-like, which ensures temporal separation of DNA replication, sister chromatid separation, and cell division. Mathematical models describing the biochemical interaction networks of cell cycle regulators attribute these properties to underlying bistable switches, which inherently generate robust, switch-like, and irreversible transitions between states. We have recently presented new mathematical models for two control systems that regulate crucial transitions in the cell cycle: mitotic entry and exit, 1 and the mitotic checkpoint. 2 Each of the two control systems is characterized by two interlinked bistable switches. In the case of mitotic checkpoint control, these switches are mutually activating, whereas in the case of the mitotic entry/exit network, the switches are mutually inhibiting. In this Perspective we describe the qualitative features of these regulatory motifs and show that having two interlinked bistable mechanisms further enhances robustness and irreversibility. We speculate that these network motifs also underlie other cell cycle transitions and cellular transitions between distinct biochemical states.

  2. Bistable Reflective Etalon (BRET)

    National Research Council Canada - National Science Library

    Shellenbarger, Zane


    This project designed, fabricated, and characterized normal-incidence etalon structures at 1550 nm wavelength operation for application, as bistable elements, to photonic analog-to-digital conversion...

  3. Controllable optical bistability and multistability in asymmetric double quantum wells via spontaneously generated coherence

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yuan; Deng, Li [Department of Applied Physics, East China Jiaotong University, Nanchang, 330013 (China); Chen, Aixi, E-mail: [Department of Applied Physics, East China Jiaotong University, Nanchang, 330013 (China); Institute for Quantum Computing, University of Waterloo, Ontario N2L 3G1 (Canada)


    We investigate the nonlinear optical phenomena of the optical bistability and multistability via spontaneously generated coherence in an asymmetric double quantum well structure coupled by a weak probe field and a controlling field. It is shown that the threshold and hysteresis cycle of the optical bistability can be conveniently controlled only by adjusting the intensity of the SGC or the controlling field. Moreover, switching between optical bistability and multistability can be achieved. These studies may have practical significance for the preparation of optical bistable switching device.

  4. Controllable optical bistability and multistability in asymmetric double quantum wells via spontaneously generated coherence

    International Nuclear Information System (INIS)

    Chen, Yuan; Deng, Li; Chen, Aixi


    We investigate the nonlinear optical phenomena of the optical bistability and multistability via spontaneously generated coherence in an asymmetric double quantum well structure coupled by a weak probe field and a controlling field. It is shown that the threshold and hysteresis cycle of the optical bistability can be conveniently controlled only by adjusting the intensity of the SGC or the controlling field. Moreover, switching between optical bistability and multistability can be achieved. These studies may have practical significance for the preparation of optical bistable switching device

  5. Hybrid optoelectronic device with multiple bistable outputs

    Energy Technology Data Exchange (ETDEWEB)

    Costazo-Caso, Pablo A; Jin Yiye; Gelh, Michael; Granieri, Sergio; Siahmakoun, Azad, E-mail:, E-mail:, E-mail: [Department of Physics and Optical Engineering, Rose-Hulman Institute of Technology, 5500 Wabash Avenue, Terre Haute, IN 47803 (United States)


    Optoelectronic circuits which exhibit optical and electrical bistability with hysteresis behavior are proposed and experimentally demonstrated. The systems are based on semiconductor optical amplifiers (SOA), bipolar junction transistors (BJT), PIN photodiodes (PD) and laser diodes externally modulated with integrated electro-absorption modulators (LD-EAM). The device operates based on two independent phenomena leading to both electrical bistability and optical bistability. The electrical bistability is due to the series connection of two p-i-n structures (SOA, BJT, PD or LD) in reverse bias. The optical bistability is consequence of the quantum confined Stark effect (QCSE) in the multi-quantum well (MQW) structure in the intrinsic region of the device. This effect produces the optical modulation of the transmitted light through the SOA (or reflected from the PD). Finally, because the optical transmission of the SOA (in reverse bias) and the reflected light from the PD are so small, a LD-EAM modulated by the voltage across these devices are employed to obtain a higher output optical power. Experiments show that the maximum switching frequency is in MHz range and the rise/fall times lower than 1 us. The temporal response is mainly limited by the electrical capacitance of the devices and the parasitic inductances of the connecting wires. The effects of these components can be reduced in current integration technologies.

  6. Organic bistable light-emitting devices (United States)

    Ma, Liping; Liu, Jie; Pyo, Seungmoon; Yang, Yang


    An organic bistable device, with a unique trilayer structure consisting of organic/metal/organic sandwiched between two outmost metal electrodes, has been invented. [Y. Yang, L. P. Ma, and J. Liu, U.S. Patent Pending, U.S. 01/17206 (2001)]. When the device is biased with voltages beyond a critical value (for example 3 V), the device suddenly switches from a high-impedance state to a low-impedance state, with a difference in injection current of more than 6 orders of magnitude. When the device is switched to the low-impedance state, it remains in that state even when the power is off. (This is called "nonvolatile" phenomenon in memory devices.) The high-impedance state can be recovered by applying a reverse bias; therefore, this bistable device is ideal for memory applications. In order to increase the data read-out rate of this type of memory device, a regular polymer light-emitting diode has been integrated with the organic bistable device, such that it can be read out optically. These features make the organic bistable light-emitting device a promising candidate for several applications, such as digital memories, opto-electronic books, and recordable papers.

  7. Optical bistability of optical fiber ring doped by Erbium and quantum dots

    International Nuclear Information System (INIS)

    Safari, S.; Tofighi, S.; Bahrampour, A.; Sajad, B.; Shahshahani, F.


    In this paper, theoretical analysis of the steady state behavior of the optical bistability in an optical fiber ring doped by Erbium and quantum dots is presented. The up and down switching power is calculated and the dependence of the switching power on different fiber ring parameters is investigated. The switching power for this type of optical bistability device is obtained much lower than the fiber ring which its half length is doped by Erbium ion.

  8. Bistable laser device with multiple coupled active vertical-cavity resonators (United States)

    Fischer, Arthur J.; Choquette, Kent D.; Chow, Weng W.


    A new class of bistable coupled-resonator vertical-cavity semiconductor laser devices has been developed. These bistable laser devices can be switched, either electrically or optically, between lasing and non-lasing states. A switching signal with a power of a fraction of a milliwatt can change the laser output of such a device by a factor of a hundred, thereby enabling a range of optical switching and data encoding applications.

  9. The tunable bistable and multistable memory effect in polymer nanowires

    International Nuclear Information System (INIS)

    Rahman, Atikur; Sanyal, Milan K


    Tunable bistable and multistable resistance switching in conducting polymer nanowires has been reported. These wires show reproducible switching transition under several READ-WRITE-ERASE cycles. The switching is observed at low temperature and the ON/OFF resistance ratio for the voltage biased switching transition was found to be more than 10 3 . Current biased measurements show lower ON/OFF ratio and some of the nanowires exhibit a multistable switching transition in current biased measurements. The threshold voltage for switching and the ON/OFF resistance ratio can be tuned by changing doping concentration of the nanowires

  10. A bistable model of cell polarity.

    Directory of Open Access Journals (Sweden)

    Matteo Semplice

    Full Text Available Ultrasensitivity, as described by Goldbeter and Koshland, has been considered for a long time as a way to realize bistable switches in biological systems. It is not as well recognized that when ultrasensitivity and reinforcing feedback loops are present in a spatially distributed system such as the cell plasmamembrane, they may induce bistability and spatial separation of the system into distinct signaling phases. Here we suggest that bistability of ultrasensitive signaling pathways in a diffusive environment provides a basic mechanism to realize cell membrane polarity. Cell membrane polarization is a fundamental process implicated in several basic biological phenomena, such as differentiation, proliferation, migration and morphogenesis of unicellular and multicellular organisms. We describe a simple, solvable model of cell membrane polarization based on the coupling of membrane diffusion with bistable enzymatic dynamics. The model can reproduce a broad range of symmetry-breaking events, such as those observed in eukaryotic directional sensing, the apico-basal polarization of epithelium cells, the polarization of budding and mating yeast, and the formation of Ras nanoclusters in several cell types.

  11. Bistable cholesteric liquid crystal light shutter with multielectrode driving. (United States)

    Li, Cheng-Chang; Tseng, Heng-Yi; Pai, Tsung-Wei; Wu, Yu-Ching; Hsu, Wen-Hao; Jau, Hung-Chang; Chen, Chun-Wei; Lin, Tsung-Hsien


    An electrically activated bistable light shutter that exploits polymer-stabilized cholesteric liquid crystal film was developed. Under double-sided three-terminal electrode driving, the device can be bistable and switched between focal conic and homeotropic textures with a uniform in-plane and vertical electrical field. The transparent state with a transmittance of 80% and the opaque/scattering state with a transmittance of 13% can be realized without any optical compensation film, and each can be simply switched to the other by applying a pulse voltage. Also, gray-scale selection can be performed by varying the applied voltage. The designed energy-saving bistable light shutter can be utilized to preserve privacy and control illumination and the flow of energy.

  12. Large-Scale Analysis of Network Bistability for Human Cancers (United States)

    Shiraishi, Tetsuya; Matsuyama, Shinako; Kitano, Hiroaki


    Protein–protein interaction and gene regulatory networks are likely to be locked in a state corresponding to a disease by the behavior of one or more bistable circuits exhibiting switch-like behavior. Sets of genes could be over-expressed or repressed when anomalies due to disease appear, and the circuits responsible for this over- or under-expression might persist for as long as the disease state continues. This paper shows how a large-scale analysis of network bistability for various human cancers can identify genes that can potentially serve as drug targets or diagnosis biomarkers. PMID:20628618

  13. On the functional relevance of frontal cortex for passive and voluntarily controlled bistable vision. (United States)

    de Graaf, Tom A; de Jong, Maartje C; Goebel, Rainer; van Ee, Raymond; Sack, Alexander T


    In bistable vision, one constant ambiguous stimulus leads to 2 alternating conscious percepts. This perceptual switching occurs spontaneously but can also be influenced through voluntary control. Neuroimaging studies have reported that frontal regions are activated during spontaneous perceptual switches, leading some researchers to suggest that frontal regions causally induce perceptual switches. But the opposite also seems possible: frontal activations may themselves be caused by spontaneous switches. Classically implicated in attentional processes, these same regions are also candidates for the origins of voluntary control over bistable vision. Here too, it remains unknown whether frontal cortex is actually functionally relevant. It is even possible that spontaneous perceptual switches and voluntarily induced switches are mediated by the same top-down mechanisms. To directly address these issues, we here induced "virtual lesions," with transcranial magnetic stimulation, in frontal, parietal, and 2 lower level visual cortices using an established ambiguous structure-from-motion stimulus. We found that dorsolateral prefrontal cortex was causally relevant for voluntary control over perceptual switches. In contrast, we failed to find any evidence for an active role of frontal cortex in passive bistable vision. Thus, it seems the same pathway used for willed top-down modulation of bistable vision is not used during passive bistable viewing.

  14. The unsaturated bistable stochastic resonance system. (United States)

    Zhao, Wenli; Wang, Juan; Wang, Linze


    We investigated the characteristics of the output saturation of the classical continuous bistable system (saturation bistable system) and its impact on stochastic resonance (SR). We further proposed a piecewise bistable SR system (unsaturated bistable system) and developed the expression of signal-to-noise ratio (SNR) using the adiabatic approximation theory. Compared with the saturation bistable system, the SNR is significantly improved in our unsaturated bistable SR system. The numerical simulation showed that the unsaturated bistable system performed better in extracting weak signals from strong background noise than the saturation bistable system.

  15. Controlling bistability by linear augmentation

    International Nuclear Information System (INIS)

    Sharma, Pooja Rani; Shrimali, Manish Dev; Prasad, Awadhesh; Feudel, Ulrike


    In many bistable oscillating systems only one of the attractors is desired to possessing certain system performance. We present a method to drive a bistable system to a desired target attractor by annihilating the other one. This shift from bistability to monostability is achieved by augmentation of the nonlinear oscillator with a linear control system. For a proper choice of the control function one of the attractors disappears at a critical coupling strength in an control-induced boundary crisis. This transition from bistability to monostability is demonstrated with two paradigmatic examples, the autonomous Chua oscillator and a neuronal system with a periodic input signal.

  16. Bistable Mechanisms for Space Applications. (United States)

    Zirbel, Shannon A; Tolman, Kyler A; Trease, Brian P; Howell, Larry L


    Compliant bistable mechanisms are monolithic devices with two stable equilibrium positions separated by an unstable equilibrium position. They show promise in space applications as nonexplosive release mechanisms in deployment systems, thereby eliminating friction and improving the reliability and precision of those mechanical devices. This paper presents both analytical and numerical models that are used to predict bistable behavior and can be used to create bistable mechanisms in materials not previously feasible for compliant mechanisms. Materials compatible with space applications are evaluated for use as bistable mechanisms and prototypes are fabricated in three different materials. Pin-puller and cutter release mechanisms are proposed as potential space applications.

  17. Distributed processing in bistable perception

    NARCIS (Netherlands)

    Knapen, T.H.J.


    A very incisive way of studying visual awareness and the mechanisms that underlie it, it to use bistable perception. In bistable perception, an observer's perceptual state alternates between one interpretation and its mutually exclusive counterpart while the stimulus remains the same. This gives us

  18. On the bistable zone of milling processes. (United States)

    Dombovari, Zoltan; Stepan, Gabor


    A modal-based model of milling machine tools subjected to time-periodic nonlinear cutting forces is introduced. The model describes the phenomenon of bistability for certain cutting parameters. In engineering, these parameter domains are referred to as unsafe zones, where steady-state milling may switch to chatter for certain perturbations. In mathematical terms, these are the parameter domains where the periodic solution of the corresponding nonlinear, time-periodic delay differential equation is linearly stable, but its domain of attraction is limited due to the existence of an unstable quasi-periodic solution emerging from a secondary Hopf bifurcation. A semi-numerical method is presented to identify the borders of these bistable zones by tracking the motion of the milling tool edges as they might leave the surface of the workpiece during the cutting operation. This requires the tracking of unstable quasi-periodic solutions and the checking of their grazing to a time-periodic switching surface in the infinite-dimensional phase space. As the parameters of the linear structural behaviour of the tool/machine tool system can be obtained by means of standard modal testing, the developed numerical algorithm provides efficient support for the design of milling processes with quick estimates of those parameter domains where chatter can still appear in spite of setting the parameters into linearly stable domains. © 2015 The Authors.

  19. Bistable near field and bistable transmittance in 2D composite slab consisting of nonlocal core-Kerr shell inclusions. (United States)

    Huang, Yang; Wu, Ya Min; Gao, Lei


    We carry out a theoretical study on optical bistability of near field intensity and transmittance in two-dimensional nonlinear composite slab. This kind of 2D composite is composed of nonlocal metal/Kerr-type dielectric core-shell inclusions randomly embedded in the host medium, and we derivate the nonlinear relation between the field intensity in the shell of inclusions and the incident field intensity with self-consistent mean field approximation. Numerical demonstration has been performed to show the viable parameter space for the bistable near field. We show that nonlocality can provide broader region in geometric parameter space for bistable near field as well as bistable transmittance of the nonlocal composite slab compared to local case. Furthermore, we investigate the bistable transmittance in wavelength spectrum, and find that besides the input intensity, the wavelength operation could as well make the transmittance jump from a high value to a low one. This kind of self-tunable nano-composite slab might have potential application in optical switching devices.

  20. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.


    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  1. Bistable resistive memory behavior in gelatin-CdTe quantum dot composite film (United States)

    Vallabhapurapu, Sreedevi; Rohom, Ashwini; Chaure, N. B.; Du, Shengzhi; Srinivasan, Ananthakrishnan


    Bistable memory behavior has been observed for the first time in gelatin type A thin film dispersed with functionalized CdTe quantum dots. The two terminal device with the polymer nanocomposite layer sandwiched between an indium tin oxide coated glass plate and an aluminium top electrode performs as a bistable resistive random access memory module. Butterfly shaped (O-shaped with a hysteresis in forward and reverse sweeps) current-voltage response is observed in this device. The conduction mechanism leading to the bistable electrical switching has been deduced to be a combination of ohmic and electron hopping.

  2. The Independent and Shared Mechanisms of Intrinsic Brain Dynamics: Insights From Bistable Perception

    Directory of Open Access Journals (Sweden)

    Teng Cao


    Full Text Available In bistable perception, constant input leads to alternating perception. The dynamics of the changing perception reflects the intrinsic dynamic properties of the “unconscious inferential” process in the brain. Under the same condition, individuals differ in how fast they experience the perceptual alternation. In this study, testing many forms of bistable perception in a large number of observers, we investigated the key question of whether there is a general and common mechanism or multiple and independent mechanisms that control the dynamics of the inferential brain. Bistable phenomena tested include binocular rivalry, vase-face, Necker cube, moving plaid, motion induced blindness, biological motion, spinning dancer, rotating cylinder, Lissajous-figure, rolling wheel, and translating diamond. Switching dynamics for each bistable percept was measured in 100 observers. Results show that the switching rates of subsets of bistable percept are highly correlated. The clustering of dynamic properties of some bistable phenomena but not an overall general control of switching dynamics implies that the brain’s inferential processes are both shared and independent – faster in constructing 3D structure from motion does not mean faster in integrating components into an objects.

  3. Evidence against the selfish operon theory. (United States)

    Pál, Csaba; Hurst, Laurence D


    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  4. Optimization of Bistable Viscoelastic Systems

    DEFF Research Database (Denmark)

    Jensen, Kristian Ejlebjærg; Szabo, Peter; Okkels, Fridolin


    driving pressure corresponding to the point of bistability, such that the effect is enhanced. The point of bistability is, however, not explicitly contained in the solution, so we opt for a heuristic approach based on the dissipation ratio between the asymmetric and unstable symmetric flow solutions. We...... find a design that significantly reduces the driving pressure required for bistability, and furthermore is in agreement with the approach followed by experimental researchers. Furthermore, by comparing the two asymmetric solutions, we succesfully apply the same approach to a problem with two fluids...

  5. Bistable amphoteric centers in semiconductors

    International Nuclear Information System (INIS)

    Nikitina, A. G.; Zuev, V. V.


    It is shown that, at thermodynamic equilibrium, the release of charge carriers from the localized states of bistable amphoteric centers into quasi-free states depends on the degree of compensation. This brings about different functional dependences of the concentration of free charge carriers on temperature. It is found that, in uncompensated semiconductors, the concentration of free charge carriers follows the same dependence in the case of bistable amphoteric centers and bistable amphoteric U - centers, although the distributions of charge carriers over the charge states and configurations are different for these types of centers. The results can be used for interpreting various experimental data insufficiently explained in the context of the traditional approach

  6. A hierarchical stochastic model for bistable perception.

    Directory of Open Access Journals (Sweden)

    Stefan Albert


    Full Text Available Viewing of ambiguous stimuli can lead to bistable perception alternating between the possible percepts. During continuous presentation of ambiguous stimuli, percept changes occur as single events, whereas during intermittent presentation of ambiguous stimuli, percept changes occur at more or less regular intervals either as single events or bursts. Response patterns can be highly variable and have been reported to show systematic differences between patients with schizophrenia and healthy controls. Existing models of bistable perception often use detailed assumptions and large parameter sets which make parameter estimation challenging. Here we propose a parsimonious stochastic model that provides a link between empirical data analysis of the observed response patterns and detailed models of underlying neuronal processes. Firstly, we use a Hidden Markov Model (HMM for the times between percept changes, which assumes one single state in continuous presentation and a stable and an unstable state in intermittent presentation. The HMM captures the observed differences between patients with schizophrenia and healthy controls, but remains descriptive. Therefore, we secondly propose a hierarchical Brownian model (HBM, which produces similar response patterns but also provides a relation to potential underlying mechanisms. The main idea is that neuronal activity is described as an activity difference between two competing neuronal populations reflected in Brownian motions with drift. This differential activity generates switching between the two conflicting percepts and between stable and unstable states with similar mechanisms on different neuronal levels. With only a small number of parameters, the HBM can be fitted closely to a high variety of response patterns and captures group differences between healthy controls and patients with schizophrenia. At the same time, it provides a link to mechanistic models of bistable perception, linking the group

  7. A hierarchical stochastic model for bistable perception. (United States)

    Albert, Stefan; Schmack, Katharina; Sterzer, Philipp; Schneider, Gaby


    Viewing of ambiguous stimuli can lead to bistable perception alternating between the possible percepts. During continuous presentation of ambiguous stimuli, percept changes occur as single events, whereas during intermittent presentation of ambiguous stimuli, percept changes occur at more or less regular intervals either as single events or bursts. Response patterns can be highly variable and have been reported to show systematic differences between patients with schizophrenia and healthy controls. Existing models of bistable perception often use detailed assumptions and large parameter sets which make parameter estimation challenging. Here we propose a parsimonious stochastic model that provides a link between empirical data analysis of the observed response patterns and detailed models of underlying neuronal processes. Firstly, we use a Hidden Markov Model (HMM) for the times between percept changes, which assumes one single state in continuous presentation and a stable and an unstable state in intermittent presentation. The HMM captures the observed differences between patients with schizophrenia and healthy controls, but remains descriptive. Therefore, we secondly propose a hierarchical Brownian model (HBM), which produces similar response patterns but also provides a relation to potential underlying mechanisms. The main idea is that neuronal activity is described as an activity difference between two competing neuronal populations reflected in Brownian motions with drift. This differential activity generates switching between the two conflicting percepts and between stable and unstable states with similar mechanisms on different neuronal levels. With only a small number of parameters, the HBM can be fitted closely to a high variety of response patterns and captures group differences between healthy controls and patients with schizophrenia. At the same time, it provides a link to mechanistic models of bistable perception, linking the group differences to

  8. Dynamic optical bistability in resonantly enhanced Raman generation

    International Nuclear Information System (INIS)

    Novikova, I.; Phillips, D.F.; Zibrov, A.S.; Andre, A.; Walsworth, R.L.


    We report observations of novel dynamic behavior in resonantly enhanced stimulated Raman scattering in Rb vapor. In particular, we demonstrate a dynamic hysteresis of the Raman scattered optical field in response to changes of the drive laser field intensity and/or frequency. This effect may be described as a dynamic form of optical bistability resulting from the formation and decay of atomic coherence. We have applied this phenomenon to the realization of an all-optical switch

  9. A Miniature Coupled Bistable Vibration Energy Harvester

    International Nuclear Information System (INIS)

    Zhu, D; Arthur, D C; Beeby, S P


    This paper reports the design and test of a miniature coupled bistable vibration energy harvester. Operation of a bistable structure largely depends on vibration amplitude rather than frequency, which makes it very promising for wideband vibration energy harvesting applications. A coupled bistable structure consists of a pair of mobile magnets that create two potential wells and thus the bistable phenomenon. It requires lower excitation to trigger bistable operation compared to conventional bistable structures. Based on previous research, this work focused on miniaturisation of the coupled bistable structure for energy harvesting application. The proposed bistable energy harvester is a combination of a Duffing's nonlinear structure and a linear assisting resonator. Experimental results show that the output spectrum of the miniature coupled bistable vibration energy harvester was the superposition of several spectra. It had a higher maximum output power and a much greater bandwidth compared to simply the Duffing's structure without the assisting resonator

  10. Temporal nonlocality in bistable perception (United States)

    Atmanspacher, Harald; Filk, Thomas


    A novel conceptual framework for theoretical psychology is presented and illustrated for the example of bistable perception. A basic formal feature of this framework is the non-commutativity of operations acting on mental states. A corresponding model for the bistable perception of ambiguous stimuli, the Necker-Zeno model, is sketched and some empirical evidence for it so far is described. It is discussed how a temporal nonlocality of mental states, predicted by the model, can be understood and tested.

  11. Single coil bistable, bidirectional micromechanical actuator (United States)

    Tabat, Ned; Guckel, Henry


    Micromechanical actuators capable of bidirectional and bistable operation can be formed on substrates using lithographic processing techniques. Bistable operation of the microactuator is obtained using a single coil and a magnetic core with a gap. A plunger having two magnetic heads is supported for back and forth linear movement with respect to the gap in the magnetic core, and is spring biased to a neutral position in which the two heads are on each side of the gap in the core. The single electrical coil is coupled to the core and is provided with electrical current to attract one of the heads toward the core by reluctance action to drive the plunger to a limit of travel in one direction. The current is then cut off and the plunger returns by spring action toward the gap, whereafter the current is reapplied to the coil to attract the other head of the plunger by reluctance action to drive the plunger to its other limit of travel. This process can be repeated at a time when switching of the actuator is required.

  12. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.


    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  13. Problem-Solving Test: Tryptophan Operon Mutants (United States)

    Szeberenyi, Jozsef


    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  14. The relative value of operon predictions

    NARCIS (Netherlands)

    Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

    For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

  15. Bistable minimum energy structures (BiMES) for binary robotics

    International Nuclear Information System (INIS)

    Follador, M; Conn, A T; Rossiter, J


    Bistable minimum energy structures (BiMES) are devices derived from the union of the concepts of dielectric elastomer minimum energy structures and bistable systems. This article presents this novel approach to active, elastic and bistable structures. BiMES are based on dielectric elastomer actuators (DEAs), which act as antagonists and provide the actuation for switching between the two equilibrium positions. A central elastic beam is the backbone of the structure and is buckled into the minimum energy configurations by the action of the two DEAs. The theory and the model of the device are presented, and also its fabrication process. BiMES are considered as fundamental units for more complex structures, which are presented and fabricated as proof of concept. Two different ways of combining the multiple units are proposed: a parallel configuration, to make a simple gripper, and a serial configuration, to generate a binary device. The possibility of using the bistable system as a continuous bender actuator, by modulating the actuation voltage of the two DEAs, was also investigated. (paper)

  16. Bistable output from a coupled-resonator vertical-cavity laser diode

    International Nuclear Information System (INIS)

    Fischer, A. J.; Choquette, K. D.; Chow, W. W.; Allerman, A. A.; Geib, K.


    We report a monolithic coupled-resonator vertical-cavity laser with an ion-implanted top cavity and a selectively oxidized bottom cavity which exhibits bistable behavior in the light output versus injection current. Large bistability regions over current ranges as wide as 18 mA have been observed with on/off contrast ratios of greater than 20 dB. The position and width of the bistability region can be varied by changing the bias to the top cavity. Switching between on and off states can be accomplished with changes as small as 250 μW to the electrical power applied to the top cavity. The bistable behavior is the response of the nonlinear susceptibility in the top cavity to the changes in the bottom intracavity laser intensity as the bottom cavity reaches the thermal rollover point

  17. Harnessing the bistable composite shells to design a tunable phononic band gap structure (United States)

    Li, Yi; Xu, Yanlong


    By proposing a system composed of an array of bistable composite shells immersed in air, we develop a new class of periodic structure to control the propagation of sound. Through numerical investigation, we find that the acoustic band gap of this system can be switched on and off by triggering the snap through deformation of the bistable composite shells. The shape of cross section and filling fraction of unit cell can be altered by different number of bistable composite shells, and they have strong impact on the position and width of the band gap. The proposed concept paves the way of using the bistable structures to design a new class of metamaterials that can be enable to manipulate sound.

  18. Electron transfer dynamics of bistable single-molecule junctions

    DEFF Research Database (Denmark)

    Danilov, A.V; Kubatkin, S.; Kafanov, S. G.


    We present transport measurements of single-molecule junctions bridged by a molecule with three benzene rings connected by two double bonds and with thiol end-groups that allow chemical binding to gold electrodes. The I-V curves show switching behavior between two distinct states. By statistical ...... analysis of the switching events, we show that a 300 meV mode mediates the transition between the two states. We propose that breaking and reformation of a S-H bond in the contact zone between molecule and electrode explains the observed bistability....

  19. Bistable dynamics of a levitated nanoparticle (Presentation Recording) (United States)

    Ricci, Francesco; Spasenovic, M.; Rica, Raúl A.; Novotny, Lukas; Quidant, Romain


    Bistable systems are ubiquitous in nature. Classical examples in chemistry and biology include relaxation kinetics in chemical reactions [1] and stochastic resonance processes such as neuron firing [2,3]. Likewise, bistable systems play a key role in signal processing and information handling at the nanoscale, giving rise to intriguing applications such as optical switches [4], coherent signal amplification [5,6] and weak forces detection [5]. The interest and applicability of bistable systems are intimately connected with the complexity of their dynamics, typically due to the presence of a large number of parameters and nonlinearities. Appropriate modeling is therefore challenging. Alternatively, the possibility to experimentally recreate bistable systems in a clean and controlled way has recently become very appealing, but elusive and complicated. With this aim, we combined optical tweezers with a novel active feedback-cooling scheme to develop a well-defined opto-mechanical platform reaching unprecedented performances in terms of Q-factor, frequency stability and force sensitivity [7,8]. Our experimental system consists of a single nanoparticle levitated in high vacuum with optical tweezers, which behaves as a non-linear (Duffing) oscillator under appropriate conditions. Here, we prove it to be an ideal tool for a deep study of bistability. We demonstrate bistability of the nanoparticle by noise activated switching between two oscillation states, discussing our results in terms of a double-well potential model. We also show the flexibility of our system in shaping the potential at will, in order to meet the conditions prescribed by any bistable system that could therefore then be simulated with our setup. References [1] T. Amemiya, T. Ohmori, M. Nakaiwa, T. Yamamoto, and T. Yamaguchi, "Modeling of Nonlinear Chemical Reaction Systems and Two-Parameter Stochastic Resonance," J. Biol. Phys. 25 (1999) 73 [2] F. Moss, L. M. Ward, and W. G. Sannita, "Stochastic

  20. A bistable electromagnetically actuated rotary gate microvalve

    International Nuclear Information System (INIS)

    Luharuka, Rajesh; Hesketh, Peter J


    Two types of rotary gate microvalves are developed for flow modulation in microfluidic systems. These microvalves have been tested for an open flow rate of up to 100 sccm and operate under a differential pressure of 6 psig with flow modulation of up to 100. The microvalve consists of a suspended gate that rotates in the plane of the chip to regulate flow through the orifice. The gate is suspended by a novel fully compliant in-plane rotary bistable micromechanism (IPRBM) that advantageously constrains the gate in all degrees of freedom except for in-plane rotational motion. Multiple inlet/outlet orifices provide flexibility of operating the microvalve in three different flow configurations. The rotary gate microvalve is switched with an external electromagnetic actuator. The suspended gate is made of a soft magnetic material and its electromagnetic actuation is based on the operating principle of a variable-reluctance stepper motor

  1. Unstable Modes and Order Parameters of Bistable Signaling Pathways at Saddle-Node Bifurcations: A Theoretical Study Based on Synergetics

    Directory of Open Access Journals (Sweden)

    Till D. Frank


    Full Text Available Mathematical modeling has become an indispensable part of systems biology which is a discipline that has become increasingly popular in recent years. In this context, our understanding of bistable signaling pathways in terms of mathematical modeling is of particular importance because such bistable components perform crucial functions in living cells. Bistable signaling pathways can act as switches or memory functions and can determine cell fate. In the present study, properties of mathematical models of bistable signaling pathways are examined from the perspective of synergetics, a theory of self-organization and pattern formation founded by Hermann Haken. At the heart of synergetics is the concept of so-called unstable modes or order parameters that determine the behavior of systems as a whole close to bifurcation points. How to determine these order parameters for bistable signaling pathways at saddle-node bifurcation points is shown. The procedure is outlined in general and an explicit example is worked out in detail.

  2. Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization (United States)

    Ray, J. Christian J; Igoshin, Oleg A.


    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

  3. Perceptual incongruence influences bistability and cortical activation

    NARCIS (Netherlands)

    Brouwer, G.J.; Tong, F.; Hagoort, P.; van Ee, R.


    We employed a parametric psychophysical design in combination with functional imaging to examine the influence of metric changes in perceptual incongruence on perceptual alternation rates and cortical responses. Subjects viewed a bistable stimulus defined by incongruent depth cues; bistability

  4. GABA shapes the dynamics of bistable perception

    NARCIS (Netherlands)

    van Loon, A.M.; Knapen, T.; Scholte, H.S.; St. John-Saaltink, E.; Donner, T.H.; Lamme, V.A.F.


    Sometimes, perception fluctuates spontaneously between two distinct interpretations of a constant sensory input. These bistable perceptual phenomena provide a unique window into the neural mechanisms that create the contents of conscious perception. Models of bistable perception posit that mutual

  5. Detecting uber-operons in prokaryotic genomes. (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying


    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database:, the first of its kind.

  6. Optical bistability without the rotating wave approximation

    Energy Technology Data Exchange (ETDEWEB)

    Sharaby, Yasser A., E-mail: [Physics Department, Faculty of Applied Sciences, Suez Canal University, Suez (Egypt); Joshi, Amitabh, E-mail: ajoshi@eiu.ed [Department of Physics, Eastern Illinois University, Charleston, IL 61920 (United States); Hassan, Shoukry S., E-mail: [Mathematics Department, College of Science, University of Bahrain, P.O. Box 32038 (Bahrain)


    Optical bistability for two-level atomic system in a ring cavity is investigated outside the rotating wave approximation (RWA) using non-autonomous Maxwell-Bloch equations with Fourier decomposition up to first harmonic. The first harmonic output field component exhibits reversed or closed loop bistability simultaneously with the usual (anti-clockwise) bistability in the fundamental field component.

  7. Optical bistability without the rotating wave approximation

    International Nuclear Information System (INIS)

    Sharaby, Yasser A.; Joshi, Amitabh; Hassan, Shoukry S.


    Optical bistability for two-level atomic system in a ring cavity is investigated outside the rotating wave approximation (RWA) using non-autonomous Maxwell-Bloch equations with Fourier decomposition up to first harmonic. The first harmonic output field component exhibits reversed or closed loop bistability simultaneously with the usual (anti-clockwise) bistability in the fundamental field component.

  8. Multichannel all–optical switch based on a thin slab of resonant two–level emitters

    Directory of Open Access Journals (Sweden)

    Malikov Ramil


    Full Text Available We discuss the possibility of using a thin layer of inhomogeneously broadened resonant emitters as a multichannel all–optical switch. Switching time from the lower stable branch of the system's bistable characteristics to the upper one and vice versa, which determines the speed of operation of a bistable device, is studied.

  9. Control of optical bistability and third-order nonlinearity via tunneling induced quantum interference in triangular quantum dot molecules

    International Nuclear Information System (INIS)

    Tian, Si-Cong; Tong, Cun-Zhu; Zhang, Jin-Long; Shan, Xiao-Nan; Fu, Xi-Hong; Zeng, Yu-Gang; Qin, Li; Ning, Yong-Qiang; Wan, Ren-Gang


    The optical bistability of a triangular quantum dot molecules embedded inside a unidirectional ring cavity is studied. The type, the threshold and the hysteresis loop of the optical bistability curves can be modified by the tunneling parameters, as well as the probe laser field. The linear and nonlinear susceptibilities of the medium are also studied to interpret the corresponding results. The physical interpretation is that the tunneling can induce the quantum interference, which modifies the linear and the nonlinear response of the medium. As a consequence, the characteristics of the optical bistability are changed. The scheme proposed here can be utilized for optimizing and controlling the optical switching process

  10. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik


    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

  11. High-resolution bistable nematic liquid crystal device realized on orientational surface patterns

    International Nuclear Information System (INIS)

    Kim, Jong-Hyun; Yoneya, Makoto; Yokoyama, Hiroshi


    The four-fold symmetry of a checkerboard-like surface alignment consisted of square domains arrived at the macroscopic orientational bistability of nematic liquid crystals. Switching between the two orientations took place with an appropriate electric field. Here the threshold field of bistable switching decreased as temperature increased, and the light could heat only the selected region in the cell including a light-absorbing medium. Irradiating the laser concurrently with an electric field, we addressed a selected region in the alignment pattern without the disturbance of neighboring regions. Extending this process, we realized an extremely fine bistable device of nematic liquid crystal with a pixel size down to about 2 μm

  12. Bistable microvalve and microcatheter system (United States)

    Seward, Kirk Patrick


    A bistable microvalve of shape memory material is operatively connected to a microcatheter. The bistable microvalve includes a tip that can be closed off until it is in the desired position. Once it is in position it can opened and closed. The system uses heat and pressure to open and close the microvalve. The shape memory material will change stiffness and shape when heated above a transition temperature. The shape memory material is adapted to move from a first shape to a second shape, either open or closed, where it can perform a desired function.

  13. Optical bistability controlling light with light

    CERN Document Server

    Gibbs, Hyatt


    Optical Bistability: Controlling Light with Light focuses on optical bistability in nonlinear optical systems. Emphasis is on passive (non-laser) systems that exhibit reversible bistability with input intensity as the hysteresis variable, along with the physics and the potential applications of such systems for nonlinear optical signal processing. This book consists of seven chapters and begins with a historical overview of optical bistability in lasers and passive systems. The next chapter describes steady-state theories of optical bistability, including the Bonifacio-Lugiato model, as we

  14. Optical bistability and limiting in polymer dispersed liquid crystal

    Energy Technology Data Exchange (ETDEWEB)

    Yshino, K.; Tagawa, A.; Sadohara, Y.; Ozaki, M. (Osaka University, Osaka (Japan). Faculty of Engineering); Munezawa, T. (Ajinomoto Co. Inc., Tokyo (Japan)); Nomura, Y. (Takiron Co. Ltd., Osaka (Japan))


    The linear electro-optical effect of polymer dispersed liquid crystal (PDLC) and the nonlinear optical response of electrically feedbacked PDLC were studied. Electro-optical limiting and bistability were observed in PDLCs with negative and positive feedback, respectively. In the PDLC film with positive feedback gain, an optical hysteresis loop shifted toward a high intensity region with decreasing magnitude of the feedback gain. The switching between high and low transmission states in an optical bistable region was realized by controlling incident light, and the on-off switching by superimposing light pulse on incident light for an extremely short period (several hundreds {mu}s). As the light pulse was strong, the minimum pulse width required for switching was as short as 500 {mu}s or less. The on-off switching was also realized by shutting out the incident light for a period equivalent to the pulse width. Slower response times of the PDLC film required longer minimum pulse widths. 12 refs., 11 figs.

  15. Flexible Bistable Cholesteric Reflective Displays (United States)

    Yang, Deng-Ke


    Cholesteric liquid crystals (ChLCs) exhibit two stable states at zero field condition-the reflecting planar state and the nonreflecting focal conic state. ChLCs are an excellent candidate for inexpensive and rugged electronic books and papers. This paper will review the display cell structure,materials and drive schemes for flexible bistable cholesteric (Ch) reflective displays.

  16. Bi-stable optical actuator (United States)

    Holdener, Fred R.; Boyd, Robert D.


    The present invention is a bi-stable optical actuator device that is depowered in both stable positions. A bearing is used to transfer motion and smoothly transition from one state to another. The optical actuator device may be maintained in a stable position either by gravity or a restraining device.

  17. Investigation of bistable perception with the "silhouette spinner": sit still, spin the dancer with your will. (United States)

    Liu, Chao-Hsuan; Tzeng, Ovid J L; Hung, Daisy L; Tseng, Philip; Juan, Chi-Hung


    Many studies have used static and non-biologically related stimuli to investigate bistable perception and found that the percept is usually dominated by their intrinsic nature with some influence of voluntary control from the viewer. Here we used a dynamic stimulus of a rotating human body, the silhouette spinner illusion, to investigate how the viewers' intentions may affect their percepts. In two experiments, we manipulated observer intention (active or passive), fixation position (body or feet), and spinning velocity (fast, medium, or slow). Our results showed that the normalized alternating rate between two bistable percepts was greater when (1) participants actively attempted to switch percepts, (2) when participants fixated at the spinner's feet rather than the body, inducing as many as 25 switches of the bistable percepts within 1 min, and (3) when they watched the spinner at high velocity. These results suggest that a dynamic biologically-bistable percept can be quickly alternated by the viewers' intention. Furthermore, the higher alternating rate in the feet condition compared to the body condition suggests a role for biological meaningfulness in determining bistable percepts, where 'biologically plausible' interpretations are favored by the visual system. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Method of bistable optical information storage using antiferroelectric phase PLZT ceramics (United States)

    Land, Cecil E.


    A method for bistable storage of binary optical information includes an antiferroelectric (AFE) lead lanthanum zirconate titanate (PLZT) layer having a stable antiferroelectric first phase and a ferroelectric (FE) second phase obtained by applying a switching electric field across the surface of the device. Optical information is stored by illuminating selected portions of the layer to photoactivate an FE to AFE transition in those portions. Erasure of the stored information is obtained by reapplying the switching field.

  19. Chiroptical Molecular Switches 1; Principles and Syntheses.

    NARCIS (Netherlands)

    Lange, Ben de; Jager, Wolter F.; Feringa, Bernard


    The concept and the synthesis of the basic molecules for a chiroptical molecular switch are described. This molecular switch is based on photochemical interconversion of two bistable forms of chiral sterically overcrowded olefins. A large variety of these alkenes with different properties have been

  20. Controlling steady-state and dynamical properties of atomic optical bistability

    CERN Document Server

    Joshi, Amitabh


    This book provides a comprehensive introduction to the theoretical and experimental studies of atomic optical bistability and multistability, and their dynamical properties in systems with two- and three-level inhomogeneously-broadened atoms inside an optical cavity. By making use of the modified linear absorption and dispersion, as well as the greatly enhanced nonlinearity in the three-level electromagnetically induced transparency system, the optical bistablity and efficient all-optical switching can be achieved at relatively low laser powers, which can be well controlled and manipulated. Un

  1. Thiol-modified MoS2 nanosheets as a functional layer for electrical bistable devices (United States)

    Li, Guan; Tan, Fenxue; Lv, Bokun; Wu, Mengying; Wang, Ruiqi; Lu, Yue; Li, Xu; Li, Zhiqiang; Teng, Feng


    Molybdenum disulfide nanosheets have been synthesized by one-pot method using 1-ODT as sulfur source and surfactant. The structure, morphology and optical properties of samples were investigated by XRD, FTIR, Abs spectrum and TEM patterns. The XRD pattern indicated that the as-obtained MoS2 belong to hexagonal system. The as-obtained MoS2 nanosheets blending with PVK could be used to fabricate an electrically bistable devices through a simple spin-coating method and the device exhibited an obvious electrical bistability properties. The charge transport mechanism of the device was discussed based on the filamentary switching models.

  2. REMap: Operon Map of M. tuberculosis (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu


    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  3. Optical bistabilities of higher harmonics: Inhomogeneous and transverse effects

    Energy Technology Data Exchange (ETDEWEB)

    Hassan, S.S., E-mail: [Department of Mathematics, College of Science, University of Bahrain, P.O. Box 32038 (Bahrain); Manchester Metropolitan University, Dept. of Computing, Maths. and Digital Technology, Manchester M1 5GD (United Kingdom); Sharaby, Y.A., E-mail: [Department of Physics, Faculty of Science, Suez Canal University, Suez (Egypt); Ali, M.F.M., E-mail: [Department of Mathematics: Faculty of Science, Ain Shams University, Cairo (Egypt); Joshi, A., E-mail: [Department of Physics, Eastern Illinois University, Charleston, IL 61920 (United States)


    The steady state behavior of optical bistable system in a ring cavity with transverse field variations and inhomogeneousely broadened two-level atoms is investigated outside the rotating wave approximation (RWA). Analytical and numerical investigation is presented for different cases of transverse field variations with Lorentzian or Gaussian line widths. When both (transverse and inhomogeneous) features taken into account, the first harmonic output field component outside the RWA exhibits a one-way switching down processes (butterfly OB) or reversed (clockwise) OB behavior, depending on the atomic linewidth shape.

  4. Optical bistabilities of higher harmonics: Inhomogeneous and transverse effects

    International Nuclear Information System (INIS)

    Hassan, S.S.; Sharaby, Y.A.; Ali, M.F.M.; Joshi, A.


    The steady state behavior of optical bistable system in a ring cavity with transverse field variations and inhomogeneousely broadened two-level atoms is investigated outside the rotating wave approximation (RWA). Analytical and numerical investigation is presented for different cases of transverse field variations with Lorentzian or Gaussian line widths. When both (transverse and inhomogeneous) features taken into account, the first harmonic output field component outside the RWA exhibits a one-way switching down processes (butterfly OB) or reversed (clockwise) OB behavior, depending on the atomic linewidth shape.

  5. Bistability in a laser with injected signal

    International Nuclear Information System (INIS)

    Dorobantu, I.A.; Vlad, V.I.; Ursu, I.


    A unified description of bistability is given in free running lasers, optical bistable devices, ring lasers and lasers with an injected signal (LIS). A general review of laser instabilities is also presented in the frame of the theory of elementary catastrophes, emphasizing the apparence of higher order catastrophes in the case of a LIS suggesting thus a possibility to devise from first principles the whole hierarchy of laser instabilities. Experimental results on the bistability in the polarisation of LIS are also discussed. (authors)

  6. Controlling the optical bistability and transmission coefficient in a four-level atomic medium

    International Nuclear Information System (INIS)

    Asadpour, Seyyed Hossein; Eslami-Majd, Abdullah


    A novel four level atomic configuration is proposed for controlling the optical bistability and transmission coefficient with application on all-optical switching. Two circularly polarized components from a weak linearly-polarized probe beam are interacted separately by two transitions of this medium. A coherent coupling field has derived another atomic transition. It is demonstrated that the transmission coefficient of two orthogonally polarized beams at different frequencies can be achieved by adjusting the magnitude of the external magnetic field. It is found that the threshold of the optical bistability can be controlled by magnitude of the external magnetic field. Also, it is shown that optical bistability can be converted to optical multistability by switching the two orthogonally polarized beams. - Highlights: ► An inverted Y-type four level atomic system is proposed. ► Transmission coefficient can be controlled by a novel interesting parameter. ► Optical bistability and multistability can be achieved via external magnetic field. ► It is shown that our proposed model is suitable for all optical switching application.

  7. A broadband electromagnetic energy harvester with a coupled bistable structure

    International Nuclear Information System (INIS)

    Zhu, D; Beeby, S P


    This paper investigates a broadband electromagnetic energy harvester with a coupled bistable structure. Both analytical model and experimental results showed that the coupled bistable structure requires lower excitation force to trigger bistable operation than conventional bistable structures. A compact electromagnetic vibration energy harvester with a coupled bistable structure was implemented and tested. It was excited under white noise vibrations. Experimental results showed that the coupled bistable energy harvester can achieve bistable operation with lower excitation amplitude and generate more output power than both conventional bistable and linear energy harvesters under white noise excitation

  8. Bistable diverter valve in microfluidics

    Czech Academy of Sciences Publication Activity Database

    Tesař, Václav; Bandulasena, H.C.H.


    Roč. 50, č. 5 (2011), s. 1225-1233 ISSN 0723-4864 R&D Projects: GA ČR GA101/07/1499; GA AV ČR IAA200760705 Institutional research plan: CEZ:AV0Z20760514 Keywords : fluidics * bistable diverter valves * pressure-driven microfluidics Subject RIV: BK - Fluid Dynamics Impact factor: 1.735, year: 2011

  9. Brain networks underlying bistable perception. (United States)

    Baker, Daniel H; Karapanagiotidis, Theodoros; Coggan, David D; Wailes-Newson, Kirstie; Smallwood, Jonathan


    Bistable stimuli, such as the Necker Cube, demonstrate that experience can change in the absence of changes in the environment. Such phenomena can be used to assess stimulus-independent aspects of conscious experience. The current study used resting state functional magnetic resonance imaging (rs-fMRI) to index stimulus-independent changes in neural activity to understand the neural architecture that determines dominance durations during bistable perception (using binocular rivalry and Necker cube stimuli). Anterior regions of the Superior Parietal Lobule (SPL) exhibited robust connectivity with regions of primary sensorimotor cortex. The strength of this region's connectivity with the striatum predicted shorter dominance durations during binocular rivalry, whereas its connectivity to pre-motor cortex predicted longer dominance durations for the Necker Cube. Posterior regions of the SPL, on the other hand, were coupled to associative cortex in the temporal and frontal lobes. The posterior SPL's connectivity to the temporal lobe predicted longer dominance during binocular rivalry. In conjunction with prior work, these data suggest that the anterior SPL contributes to perceptual rivalry through the inhibition of incongruent bottom up information, whereas the posterior SPL influences rivalry by supporting the current interpretation of a bistable stimulus. Our data suggests that the functional connectivity of the SPL with regions of sensory, motor, and associative cortex allows it to regulate the interpretation of the environment that forms the focus of conscious attention at a specific moment in time. Copyright © 2015. Published by Elsevier Inc.

  10. All-optical bistable logic control based on coupled Tamm plasmons. (United States)

    Zhang, Wei Li; Jiang, Yao; Zhu, Ye Yu; Wang, Fen; Rao, Yun Jiang


    A method for realizing low-threshold all-optical bistable logic control is proposed based on Tamm plasmons (TPs), which are formed in an asymmetric dielectric Bragg reflector (DBR)-metal-DBR (ADMD) structure with a layer of Kerr medium embedded. The ADMD structure supports two TPs due to coupling of trapped modes at each metal-DBR interface, generating two dips in the structure's reflection spectrum. Thus, control (i.e., pump) and controlled (i.e., probe) light with wavelengths close to the two dips, respectively, can be imported. It is verified theoretically that, thanks to the enhanced Kerr nonlinearity related to excitation of high-quality TP, bistable switching at very low injection intensity can be initiated by strength or direction variation of the pump. Meanwhile, the probe changes correspondingly with the pump. Thus, all-optical bistable logic operation of the probe can be controlled by the pump.

  11. Low-threshold optical bistability with multilayer graphene-covering Otto configuration

    International Nuclear Information System (INIS)

    Wang, Hengliang; Wu, Jipeng; Xiang, Yuanjiang; Wen, Shuangchun; Guo, Jun; Jiang, Leyong


    In this paper, we propose a modified Otto configuration to realize tunable and low-threshold optical bistability at terahertz frequencies by attaching multilayer graphene sheets to a nonlinear substrate interface. Our work demonstrates that the threshold of optical bistability can be markedly reduced (three orders of magnitude) by covering the nonlinear substrate with multilayer graphene sheets, due to strong local field enhancement with the excitation of surface plasmons. We present the influences of the Fermi energy of graphene, the incident angle, the thickness of air gap and the relaxation time of graphene on the hysteresis phenomenon and give a way to optimize the surface plasmon resonance, which will enable us to further lower the minimal power requirements for realizing optical bistability due to the strong interaction of light with graphene sheets. These results are promising for realization of terahertz optical switches, optical modulators and logical devices. (paper)

  12. Bistable enhanced total reflection in Kretschmann configuration containing a saturable gain medium. (United States)

    Zhou, Haichun; Guo, Jie; Xu, Kun; Li, Zhe; Tang, Junqi; Man, Shiqing


    The reflection of a TM-polarized light beam from a Kretschmann configuration with a saturable gain medium is investigated theoretically. Here, the dielectric constant of the gain medium is described by a classical Lorentzian oscillator model. When surface plasmon polaritons are effectively excited in this structure, it is demonstrated that the curves of enhanced total reflection (ETR) show different shaped hysteresis loops associated with optical bistability owing to gain saturation effect. The effects of the angle of incidence, the thickness of metal film, and the value of small-signal gain on bistable ETR are discussed in detail in a homogeneously broadened (HB) gain medium at line center. Analogous results can also be obtained in an inhomogeneously broadened (inHB) gain medium, while the two switch thresholds and the width of optical bistability hysteresis in an inHB gain medium are significantly different from those in a HB gain medium.

  13. Bifurcation properties of nematic liquid crystals exposed to an electric field: Switchability, bistability, and multistability

    KAUST Repository

    Cummings, L. J.


    Bistable liquid crystal displays (LCDs) offer the potential for considerable power savings compared with conventional (monostable) LCDs. The existence of two (or more) stable field-free states that are optically distinct means that contrast can be maintained in a display without an externally applied electric field. An applied field is required only to switch the device from one state to the other, as needed. In this paper we examine the basic physical principles involved in generating multiple stable states and the switching between these states. We consider a two-dimensional geometry in which variable surface anchoring conditions are used to control the steady-state solutions and explore how different anchoring conditions can influence the number and type of solutions and whether or not switching is possible between the states. We find a wide range of possible behaviors, including bistability, tristability, and tetrastability, and investigate how the solution landscape changes as the boundary conditions are tuned. © 2013 American Physical Society.

  14. Towards an optimal model for a bistable nematic liquid crystal display device

    KAUST Repository

    Cummings, L. J.


    Bistable liquid crystal displays offer the potential for considerable power savings compared with conventional (monostable) LCDs. The existence of two stable field-free states that are optically distinct means that contrast can be maintained in a display without an externally applied electric field. An applied field is required only to switch the device from one state to the other, as needed. In this paper we examine a theoretical model of a possible bistable device, originally proposed by Cummings and Richardson (Euro J Appl Math 17:435-463 2006), and explore means by which it may be optimized, in terms of optical contrast, manufacturing considerations, switching field strength, and switching times. The compromises inherent in these conflicting design criteria are discussed. © 2013 Springer Science+Business Media Dordrecht.

  15. Revisiting the Lissajous figure as a tool to study bistable perception. (United States)

    Weilnhammer, V A; Ludwig, K; Sterzer, P; Hesselmann, G


    During bistable vision perception spontaneously "switches" between two mutually exclusive percepts despite constant sensory input. The endogenous nature of these perceptual transitions has motivated extensive research aimed at the underlying mechanisms, since spontaneous perceptual transitions of bistable stimuli should in principle allow for a dissociation of processes related to sensory stimulation from those related to conscious perception. However, transitions from one conscious percept to another are often not instantaneous, and participants usually report a considerable amount of mixed or unclear percepts. This feature of bistable vision makes it difficult to isolate transition-related visual processes. Here, we revisited an ambiguous depth-from-motion stimulus which was first introduced to experimental psychology more than 80 years ago. This rotating Lissajous figure might prove useful in complementing other bistable stimuli, since its perceptual transitions only occur at critical stimulus configurations and are virtually instantaneous, thus facilitating the construction of a perceptually equivalent replay condition. We found that three parameters of the Lissajous figure - complexity, line width, and rotational speed - differentially modulated its perceptual dominance durations and transition probabilities, thus providing experimenters with a versatile tool to study the perceptual dynamics of bistable vision. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. A novel bistable energy harvesting concept

    International Nuclear Information System (INIS)

    Scarselli, G; Nicassio, F; Pinto, F; Ciampa, F; Iervolino, O; Meo, M


    Bistable energy harvesting has become a major field of research due to some unique features for converting mechanical energy into electrical power. When properly loaded, bistable structures snap-through from one stable configuration to another, causing large strains and consequently power generation. Moreover, bistable structures can harvest energy across a broad-frequency bandwidth due to their nonlinear characteristics. Despite the fact that snap-through may be triggered regardless of the form or frequency of exciting vibration, the external force must reach a specific snap-through activation threshold value to trigger the transition from one stable state to another. This aspect is a limiting factor for realistic vibration energy harvesting application with bistable devices. This paper presents a novel power harvesting concept for bistable composites based on a ‘lever effect’ aimed at minimising the activation force to cause the snap through by choosing properly the bistable structures’ constraints. The concept was demonstrated with the help of numerical simulation and experimental testing. The results showed that the actuation force is one order of magnitude smaller (3%–6%) than the activation force of conventionally constrained bistable devices. In addition, it was shown that the output voltage was higher than the conventional configuration, leading to a significant increase in power generation. This novel concept could lead to a new generation of more efficient bistable energy harvesters for realistic vibration environments. (paper)

  17. Diversity and functional properties of bistable pigments. (United States)

    Tsukamoto, Hisao; Terakita, Akihisa


    Rhodopsin and related opsin-based pigments, which are photosensitive membrane proteins, have been extensively studied using a wide variety of techniques, with rhodopsin being the most understood G protein-coupled receptor (GPCR). Animals use various opsin-based pigments for vision and a wide variety of non-visual functions. Many functionally varied pigments are roughly divided into two kinds, based on their photoreaction: bistable and monostable pigments. Bistable pigments are thermally stable before and after photo-activation, but monostable pigments are stable only before activation. Here, we review the diversity of bistable pigments and their molecular characteristics. We also discuss the mechanisms underlying different molecular characteristics of bistable and monostable pigments. In addition, the potential of bistable pigments as a GPCR model is proposed.

  18. Design of a Clap Activated Switch

    Directory of Open Access Journals (Sweden)

    Seyi Stephen OLOKEDE


    Full Text Available This paper presents the design of a clap activated switch device that will serve well in different phono-controlled applications, providing inexpensive key and at the same time flee from false triggering.This involves the design of various sages consisting of the pickup transducer, low frequency, audio low power and low noise amplifier, timer, bistable and switches. It also consists of special network components to prevent false triggering and ensure desired performance objectives. A decade counter IC serves the bistable function instead of flip-flop, special transistor and edge triggering network for low audio frequency.

  19. Bistable four-wave mixing response in a semiconductor quantum dot coupled to a photonic crystal nanocavity. (United States)

    Li, Jian-Bo; Xiao, Si; Liang, Shan; He, Meng-Dong; Luo, Jian-Hua; Kim, Nam-Chol; Chen, Li-Qun


    We perform a theoretical study of the bistable four-wave mixing (FWM) response in a coupled system comprised of a semiconductor quantum dot (SQD) and a photonic crystal (PC) nanocavity in which the SQD is embedded. It is shown that the shape of the FWM spectrum can switch among single-peaked, double-peaked, triple-peaked, and four-peaked arising from the vacuum Rabi splitting and the exciton-nanocavity coupling. Especially, we map out bistability phase diagrams within a parameter subspace of the system, and find that it is easy to turn on or off the bistable FWM response by only adjusting the excitation frequency or the pumping intensity. Our results offer a feasible means for measuring the SQD-PC nanocavity coupling strength and open a new avenue to design optical switches and memories.

  20. Induced high-order resonance linewidth shrinking with multiple coupled resonators in silicon-organic hybrid slotted two-dimensional photonic crystals for reduced optical switching power in bistable devices (United States)

    Hoang, Thu Trang; Ngo, Quang Minh; Vu, Dinh Lam; Le, Khai Q.; Nguyen, Truong Khang; Nguyen, Hieu P. T.


    Shrinking the linewidth of resonances induced by multiple coupled resonators is comprehensively analyzed using the coupled-mode theory (CMT) in time. Two types of coupled resonators under investigation are coupled resonator optical waveguides (CROWs) and side-coupled resonators with waveguide (SCREW). We examine the main parameters influencing on the spectral response such as the number of resonators (n) and the phase shift (φ) between two adjacent resonators. For the CROWs geometry consisting of n coupled resonators, we observe the quality (Q) factor of the right- and left-most resonant lineshapes increases n times larger than that of a single resonator. For the SCREW geometry, relying on the phase shift, sharp, and asymmetric resonant lineshape of the high Q factor a narrow linewidth of the spectral response could be achieved. We employ the finite-difference time-domain (FDTD) method to design and simulate two proposed resonators for practical applications. The proposed coupled resonators in silicon-on-insulator (SOI) slotted two-dimensional (2-D) photonic crystals (PhCs) filled and covered with a low refractive index organic material. Slotted PhC waveguides and cavities are designed to enhance the electromagnetic intensity and to confine the light into small cross-sectional area with low refractive index so that efficient optical devices could be achieved. A good agreement between the theoretical CMT analysis and the FDTD simulation is shown as an evidence for our accurate investigation. All-optical switches based on the CROWs in the SOI slotted 2-D PhC waveguide that are filled and covered by a nonlinear organic cladding to overcome the limitations of its well-known intrinsic properties are also presented. From the calculations, we introduce a dependency of the normalized linewidth of the right-most resonance and its switching power of the all-optical switches on number of resonator, n. This result might provide a guideline for all-optical signal processing on

  1. Bistable Si dopants in the GaAs (1 1 0) surface

    International Nuclear Information System (INIS)

    Smakman, E P; Koenraad, P M


    In this review, recent work is discussed on bistable Si dopants in the GaAs (1 1 0) surface, studied by scanning tunneling microscopy (STM). The bistability arises because the dopant atom can switch between a positive and a negative charge state, which are associated with two different lattice configurations. Manipulation of the Si atom charge configuration is achieved by tuning the local band bending with the STM tip. Furthermore, illuminating the sample with a laser also influences the charge state, allowing the operation of the dopant atom as an optical switch. The switching dynamics without illumination is investigated in detail as a function of temperature, lateral tip position, and applied tunneling conditions. A physical model is presented that independently describes the thermal and quantum tunneling contributions to the switching frequency and charge state occupation of a single Si atom. The basic functionality of a memory cell is demonstrated employing a single bistable Si dopant as the active element, using the STM tip as a gate to write and read the information. (topical review)

  2. Revisiting bistability in the lysis/lysogeny circuit of bacteriophage lambda.

    Directory of Open Access Journals (Sweden)

    Michael Bednarz

    Full Text Available The lysis/lysogeny switch of bacteriophage lambda serves as a paradigm for binary cell fate decision, long-term maintenance of cellular state and stimulus-triggered switching between states. In the literature, the system is often referred to as "bistable." However, it remains unclear whether this term provides an accurate description or is instead a misnomer. Here we address this question directly. We first quantify transcriptional regulation governing lysogenic maintenance using a single-cell fluorescence reporter. We then use the single-cell data to derive a stochastic theoretical model for the underlying regulatory network. We use the model to predict the steady states of the system and then validate these predictions experimentally. Specifically, a regime of bistability, and the resulting hysteretic behavior, are observed. Beyond the steady states, the theoretical model successfully predicts the kinetics of switching from lysogeny to lysis. Our results show how the physics-inspired concept of bistability can be reliably used to describe cellular phenotype, and how an experimentally-calibrated theoretical model can have accurate predictive power for cell-state switching.

  3. A broadband electromagnetic energy harvester with a coupled bistable structure


    Zhu, Dibin; Beeby, Steve


    This paper investigates a broadband electromagnetic energy harvester with a coupled bistable structure. Both analytical model and experimental results showed that the coupled bistable structure requires lower excitation force to trigger bistable operation than conventional bistable structures. A compact electromagnetic vibration energy harvester with a coupled bistable structure was implemented and tested. It was excited under white noise vibrations. Experimental results showed that the coupl...

  4. The interplay of multiple feedback loops with post-translational kinetics results in bistability of mycobacterial stress response

    International Nuclear Information System (INIS)

    Tiwari, Abhinav; Igoshin, Oleg A; Balázsi, Gábor; Gennaro, Maria Laura


    Bacterial persistence is the phenomenon in which a genetically identical fraction of a bacterial population can survive exposure to stress by reduction or cessation of growth. Persistence in mycobacteria has been recently linked to a stress-response network, consisting of the MprA/MprB two-component system and alternative sigma factor σ E . This network contains multiple positive transcriptional feedback loops which may give rise to bistability, making it a good candidate for controlling the mycobacterial persistence switch. To analyze the possibility of bistability, we develop a method that involves decoupling of the network into transcriptional and post-translational interaction modules. As a result we reduce the dimensionality of the dynamical system and independently analyze input–output relations in the two modules to formulate a necessary condition for bistability in terms of their logarithmic gains. We show that neither the positive autoregulation in the MprA/MprB network nor the σ E -mediated transcriptional feedback is sufficient to induce bistability in a biochemically realistic parameter range. Nonetheless, inclusion of the post-translational regulation of σ E by RseA increases the effective cooperativity of the system, resulting in bistability that is robust to parameter variation. We predict that overexpression or deletion of RseA, the key element controlling the ultrasensitive response, can eliminate bistability

  5. Transcriptional delay stabilizes bistable gene networks. (United States)

    Gupta, Chinmaya; López, José Manuel; Ott, William; Josić, Krešimir; Bennett, Matthew R


    Transcriptional delay can significantly impact the dynamics of gene networks. Here we examine how such delay affects bistable systems. We investigate several stochastic models of bistable gene networks and find that increasing delay dramatically increases the mean residence times near stable states. To explain this, we introduce a non-Markovian, analytically tractable reduced model. The model shows that stabilization is the consequence of an increased number of failed transitions between stable states. Each of the bistable systems that we simulate behaves in this manner.

  6. Lake Restoration in Terms of Ecological Resilience: a Numerical Study of Biomanipulations under Bistable Conditions

    Directory of Open Access Journals (Sweden)

    Takashi Amemiya


    Full Text Available An abstract version of the comprehensive aquatic simulation model (CASM is found to exhibit bistability under intermediate loading of nutrient input, supporting the alternative-stable-states theory and field observations for shallow lakes. Our simulations of biomanipulations under the bistable conditions reveal that a reduction in the abundance of zooplanktivorous fish cannot switch the system from a turbid to a clear state. Rather, a direct reduction of phytoplankton and detritus was found to be most effective to make this switch in the present model. These results imply that multiple manipulations may be effective for practical restorations of lakes. We discuss the present results of biomanipulations in terms of ecological resilience in multivariable systems or natural systems.

  7. Evolution of the bi-stable wake of a square-back automotive shape (United States)

    Pavia, Giancarlo; Passmore, Martin; Sardu, Costantino


    Square-back shapes are popular in the automotive market for their high level of practicality. These geometries, however, are usually characterised by high drag and their wake dynamics present aspects, such as the coexistence of a long-time bi-stable behaviour and short-time global fluctuating modes that are not fully understood. In the present paper, the unsteady behaviour of the wake of a generic square-back car geometry is characterised with an emphasis on identifying the causal relationship between the different dynamic modes in the wake. The study is experimental, consisting of balance, pressure, and stereoscopic PIV measurements. Applying wavelet and cross-wavelet transforms to the balance data, a quasi-steady correlation is demonstrated between the forces and bi-stable modes. This is investigated by applying proper orthogonal decomposition to the pressure and velocity data sets and a new structure is proposed for each bi-stable state, consisting of a hairpin vortex that originates from one of the two model's vertical trailing edges and bends towards the opposite side as it merges into a single streamwise vortex downstream. The wake pumping motion is also identified and for the first time linked with the motion of the bi-stable vortical structure in the streamwise direction, resulting in out-of-phase pressure variations between the two vertical halves of the model base. A phase-averaged low-order model is also proposed that provides a comprehensive description of the mechanisms of the switch between the bi-stable states. It is demonstrated that, during the switch, the wake becomes laterally symmetric and, at this point, the level of interaction between the recirculating structures and the base reaches a minimum, yielding, for this geometry, a 7% reduction of the base drag compared to the time-averaged result.

  8. Possible hysteresis loops of resonatorless optical bistability

    International Nuclear Information System (INIS)

    Nguyen Ba An; Le Thi Cat Tuong.


    We qualitatively show that hysteresis loops of intrinsic optical bistability phenomena without any additional feedback may be of various shapes including those of a butterfly and a three-winged bow. (author). 15 refs, 4 figs

  9. Space charge effects and electronic bistability

    International Nuclear Information System (INIS)

    Ruffini, A.; Strumia, F.; Tommasi, O.


    The excitation of metastable states in an atomic beam apparatus by means of electron collision is a widespread technique. The authors have observed a large bistable behaviour in apparatus designed to provide an intense and collimated beam of metastable helium by excitation with orthogonally impinging electrons. This bistable behaviour largely affects the efficiency of the apparatus and is therefore worth of being carefully investigated. The apparatus has an electrode configuration equivalent to that of a tetrode valve with large intergrid distances. The bistability consists in a hysteresis cycle in the curve of the anode current vs. grid voltage. Experimental measurements, supported by a simple theoretical model and by numerical simulation, stress out the crucial role played by space charge effects for the onset of bistability. A comparison with previous observations of this phenomenon is given. Spontaneous current oscillations with various shapes have been recorded in one of the two curves of the hysteresis cycle

  10. Multiple Bistability in Quinonoid-Bridged Diiron(II) Complexes: Influence of Bridge Symmetry on Bistable Properties. (United States)

    van der Meer, Margarethe; Rechkemmer, Yvonne; Breitgoff, Frauke D; Marx, Raphael; Neugebauer, Petr; Frank, Uta; van Slageren, Joris; Sarkar, Biprajit


    Quinonoid bridges are well-suited for generating dinuclear assemblies that might display various bistable properties. In this contribution we present two diiron(II) complexes where the iron(II) centers are either bridged by the doubly deprotonated form of a symmetrically substituted quinonoid bridge, 2,5-bis[4-(isopropyl)anilino]-1,4-benzoquinone (H 2 L2') with a [O,N,O,N] donor set, or with the doubly deprotonated form of an unsymmetrically substituted quinonoid bridge, 2-[4-(isopropyl)anilino]-5-hydroxy-1,4-benzoquinone (H 2 L5') with a [O,O,O,N] donor set. Both complexes display temperature-induced spin crossover (SCO). The nature of the SCO is strongly dependent on the bridging ligand, with only the complex with the [O,O,O,N] donor set displaying a prominent hysteresis loop of about 55 K. Importantly, only the latter complex also shows a pronounced light-induced spin state change. Furthermore, both complexes can be oxidized to the mixed-valent iron(II)-iron(III) form, and the nature of the bridge determines the Robin and Day classification of these forms. Both complexes have been probed by a battery of electrochemical, spectroscopic, and magnetic methods, and this combined approach is used to shed light on the electronic structures of the complexes and on bistability. The results presented here thus show the potential of using the relatively new class of unsymmetrically substituted bridging quinonoid ligands for generating intriguing bistable properties and for performing site-specific magnetic switching.

  11. Origami Mechanics: Bistability and Isometries (United States)

    Adda-Bedia, Mokhtar; Lechenault, Frederic; Morphogenesis; multiscale phenomena Team


    Origami structures are usually seen as assemblies of rigid faces articulated around creases with hinge-like behaviour. Their deployment and degrees of freedom are purely kinematic, resulting only from the geometry of the crease network. However, in real folded structures, the base material can deform outside the creases. In such situations, face bending competes with crease actuation in a morphogenetic way. In order to rationalise this interplay, we investigate the mechanical behaviour of an infinite sheet on which one or more straight creases meet at a single vertex. We find that these structures generically exhibit bistability, in the sense that they can snap through from one metastable configuration to another. Furthermore, we uncover a new class of isometry of the plane, which corresponds to metastable states of a creased sheet for which the hoop stress vanishes, an instability mechanism that is also responsible for the wrinkling of thin plates.

  12. Optical bistability and multistability driven by external magnetic field in a dielectric slab doped with nanodiamond nitrogen vacancy centres (United States)

    Nasehi, R.; Norouzi, F.


    The theoretical investigation of controlling the optical bistability (OB) and optical multistability (OM) in a dielectric medium doped with nanodiamond nitrogen vacancy centres under optical excitation are reported. The shape of the OB curve from dielectric slab can be tuned by changing the external magnetic field and polarization of the control beam. The effect of the intensity of the control laser field and the frequency detuning of probe laser field on the OB and OM behaviour are also discussed in this paper. The results obtained can be used for realizing an all-optical bistable switching or development of nanoelectronic devices.

  13. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N


    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  14. Stochastic simulations of the tetracycline operon (United States)


    Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

  15. Non-symmetric bi-stable flow around the Ahmed body

    International Nuclear Information System (INIS)

    Meile, W.; Ladinek, T.; Brenn, G.; Reppenhagen, A.; Fuchs, A.


    Highlights: • The non-symmetric bi-stable flow around the Ahmed body is investigated experimentally. • Bi-stability, described for symmetric flow by Cadot and co-workers, was found in nonsymmetric flow also. • The flow field randomly switches between two states. • The flow is subject to a spanwise instability identified by Cadot and co-workers for symmetric flow. • Aerodynamic forces fluctuate strongly due to the bi-stability. - Abstract: The flow around the Ahmed body at varying Reynolds numbers under yawing conditions is investigated experimentally. The body geometry belongs to a regime subject to spanwise flow instability identified in symmetric flow by Cadot and co-workers (Grandemange et al., 2013b). Our experiments cover the two slant angles 25° and 35° and Reynolds numbers up to 2.784 × 10"6. Special emphasis lies on the aerodynamics under side wind influence. For the 35° slant angle, forces and moments change significantly with the yawing angle in the range 10° ≤ |β| ≤ 15°. The lift and the pitching moment exhibit strong fluctuations due to bi-stable flow around a critical angle β of ±12.5°, where the pitching moment changes sign. Time series of the forces and moments are studied and explained by PIV measurements in the flow field near the rear of the body.

  16. Parallel replica dynamics method for bistable stochastic reaction networks: Simulation and sensitivity analysis (United States)

    Wang, Ting; Plecháč, Petr


    Stochastic reaction networks that exhibit bistable behavior are common in systems biology, materials science, and catalysis. Sampling of stationary distributions is crucial for understanding and characterizing the long-time dynamics of bistable stochastic dynamical systems. However, simulations are often hindered by the insufficient sampling of rare transitions between the two metastable regions. In this paper, we apply the parallel replica method for a continuous time Markov chain in order to improve sampling of the stationary distribution in bistable stochastic reaction networks. The proposed method uses parallel computing to accelerate the sampling of rare transitions. Furthermore, it can be combined with the path-space information bounds for parametric sensitivity analysis. With the proposed methodology, we study three bistable biological networks: the Schlögl model, the genetic switch network, and the enzymatic futile cycle network. We demonstrate the algorithmic speedup achieved in these numerical benchmarks. More significant acceleration is expected when multi-core or graphics processing unit computer architectures and programming tools such as CUDA are employed.

  17. Energy landscape and dynamics of brain activity during human bistable perception. (United States)

    Watanabe, Takamitsu; Masuda, Naoki; Megumi, Fukuda; Kanai, Ryota; Rees, Geraint


    Individual differences in the structure of parietal and prefrontal cortex predict the stability of bistable visual perception. However, the mechanisms linking such individual differences in brain structures to behaviour remain elusive. Here we demonstrate a systematic relationship between the dynamics of brain activity, cortical structure and behaviour underpinning bistable perception. Using fMRI in humans, we find that the activity dynamics during bistable perception are well described as fluctuating between three spatially distributed energy minimums: visual-area-dominant, frontal-area-dominant and intermediate states. Transitions between these energy minimums predicted behaviour, with participants whose brain activity tend to reflect the visual-area-dominant state exhibiting more stable perception and those whose activity transits to frontal-area-dominant states reporting more frequent perceptual switches. Critically, these brain activity dynamics are correlated with individual differences in grey matter volume of the corresponding brain areas. Thus, individual differences in the large-scale dynamics of brain activity link focal brain structure with bistable perception.

  18. Parallel replica dynamics method for bistable stochastic reaction networks: Simulation and sensitivity analysis. (United States)

    Wang, Ting; Plecháč, Petr


    Stochastic reaction networks that exhibit bistable behavior are common in systems biology, materials science, and catalysis. Sampling of stationary distributions is crucial for understanding and characterizing the long-time dynamics of bistable stochastic dynamical systems. However, simulations are often hindered by the insufficient sampling of rare transitions between the two metastable regions. In this paper, we apply the parallel replica method for a continuous time Markov chain in order to improve sampling of the stationary distribution in bistable stochastic reaction networks. The proposed method uses parallel computing to accelerate the sampling of rare transitions. Furthermore, it can be combined with the path-space information bounds for parametric sensitivity analysis. With the proposed methodology, we study three bistable biological networks: the Schlögl model, the genetic switch network, and the enzymatic futile cycle network. We demonstrate the algorithmic speedup achieved in these numerical benchmarks. More significant acceleration is expected when multi-core or graphics processing unit computer architectures and programming tools such as CUDA are employed.

  19. An analytical approach to bistable biological circuit discrimination using real algebraic geometry. (United States)

    Siegal-Gaskins, Dan; Franco, Elisa; Zhou, Tiffany; Murray, Richard M


    Biomolecular circuits with two distinct and stable steady states have been identified as essential components in a wide range of biological networks, with a variety of mechanisms and topologies giving rise to their important bistable property. Understanding the differences between circuit implementations is an important question, particularly for the synthetic biologist faced with determining which bistable circuit design out of many is best for their specific application. In this work we explore the applicability of Sturm's theorem--a tool from nineteenth-century real algebraic geometry--to comparing 'functionally equivalent' bistable circuits without the need for numerical simulation. We first consider two genetic toggle variants and two different positive feedback circuits, and show how specific topological properties present in each type of circuit can serve to increase the size of the regions of parameter space in which they function as switches. We then demonstrate that a single competitive monomeric activator added to a purely monomeric (and otherwise monostable) mutual repressor circuit is sufficient for bistability. Finally, we compare our approach with the Routh-Hurwitz method and derive consistent, yet more powerful, parametric conditions. The predictive power and ease of use of Sturm's theorem demonstrated in this work suggest that algebraic geometric techniques may be underused in biomolecular circuit analysis.

  20. Synaptic Bistability Due to Nucleation and Evaporation of Receptor Clusters

    KAUST Repository

    Burlakov, V. M.


    We introduce a bistability mechanism for long-term synaptic plasticity based on switching between two metastable states that contain significantly different numbers of synaptic receptors. One state is characterized by a two-dimensional gas of mobile interacting receptors and is stabilized against clustering by a high nucleation barrier. The other state contains a receptor gas in equilibrium with a large cluster of immobile receptors, which is stabilized by the turnover rate of receptors into and out of the synapse. Transitions between the two states can be initiated by either an increase (potentiation) or a decrease (depotentiation) of the net receptor flux into the synapse. This changes the saturation level of the receptor gas and triggers nucleation or evaporation of receptor clusters. © 2012 American Physical Society.

  1. Oscillatory bistability of real-space transfer in semiconductor heterostructures (United States)

    Do˙ttling, R.; Scho˙ll, E.


    Charge transport parallel to the layers of a modulation-doped GaAs/AlxGa1-xAs heterostructure is studied theoretically. The heating of electrons by the applied electric field leads to real-space transfer of electrons from the GaAs into the adjacent AlxGa1-xAs layer. For sufficiently large dc bias, spontaneous periodic 100-GHz current oscillations, and bistability and hysteretic switching transitions between oscillatory and stationary states are predicted. We present a detailed investigation of complex bifurcation scenarios as a function of the bias voltage U0 and the load resistance RL. For large RL subcritical Hopf bifurcations and global bifurcations of limit cycles are displayed.

  2. Teaching the Big Ideas of Biology with Operon Models (United States)

    Cooper, Robert A.


    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  3. Bubbling and bistability in two parameter discrete systems

    Indian Academy of Sciences (India)

    The birth of X *. · is concurrent with the ... for bistability viz. a½, and the higher order bistability points a¾, etc. are marked. The quadrilateral marked as ... The characteristics of 2 parameter 1-d maps that exhibit bubbling/bistability related to their ...

  4. Manually operatable on-chip bistable pneumatic microstructures for microfluidic manipulations. (United States)

    Chen, Arnold; Pan, Tingrui


    Bistable microvalves are of particular interest because of their distinct nature of requiring energy consumption only during the transition between the open and closed states. This characteristic can be highly advantageous in reducing the number of external inputs and the complexity of control circuitries since microfluidic devices as contemporary lab-on-a-chip platforms are transferring from research settings to low-resource environments with high integrability and a small form factor. In this paper, we first present manually operatable, on-chip bistable pneumatic microstructures (BPMs) for microfluidic manipulation. The structural design and operation of the BPM devices can be readily integrated into any pneumatically powered microfluidic network consisting of pneumatic and fluidic channels. It is mainly composed of a vacuum activation chamber (VAC) and a pressure release chamber (PRC), of which users have direct control through finger pressing to switch either to the bistable vacuum state (VS) or the atmospheric state (AS). We have integrated multiple BPM devices into a 4-to-1 microfluidic multiplexor to demonstrate on-chip digital flow switching from different sources. Furthermore, we have shown its clinical relevance in a point-of-care diagnostic chip that processes blood samples to identify the distinct blood types (A/B/O) on-chip.

  5. Perceptual incongruence influences bistability and cortical activation.

    Directory of Open Access Journals (Sweden)

    Gijs Joost Brouwer

    Full Text Available We employed a parametric psychophysical design in combination with functional imaging to examine the influence of metric changes in perceptual incongruence on perceptual alternation rates and cortical responses. Subjects viewed a bistable stimulus defined by incongruent depth cues; bistability resulted from incongruence between binocular disparity and monocular perspective cues that specify different slants (slant rivalry. Psychophysical results revealed that perceptual alternation rates were positively correlated with the degree of perceived incongruence. Functional imaging revealed systematic increases in activity that paralleled the psychophysical results within anterior intraparietal sulcus, prior to the onset of perceptual alternations. We suggest that this cortical activity predicts the frequency of subsequent alternations, implying a putative causal role for these areas in initiating bistable perception. In contrast, areas implicated in form and depth processing (LOC and V3A were sensitive to the degree of slant, but failed to show increases in activity when these cues were in conflict.

  6. Longitudinal magnetic bistability of electroplated wires

    International Nuclear Information System (INIS)

    Kurlyandskaya, G.V.; Garcia-Miquel, H.; Vazquez, M.; Svalov, A.V.; Vas'kovskiy, V.O.


    Fe 20 Ni 74 Co 6 and Fe 20 Ni 64 Co 16 1 μm thick magnetic tubes electroplated onto Cu 98 Be 2 conductive wire have been investigated in as-deposited state, after heat treatment under longitudinal magnetic field for 1 h at 330 deg. C, and after rf-sputtering deposition of the additional 2 μm Fe 19 Ni 81 layer. Heat treatments and an additional layer deposition modify the shape of hysteresis loops. Magnetically bistable behaviour, observed after the field annealing at a temperature of 330 deg. C, is studied as a function of the length of the samples. This is the first report by our knowledge on the bistable behaviour of the electroplated wires. The bistability of these wires is promising for applications such as tagging or pulse generator applications

  7. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli. (United States)

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira


    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  8. Emergence of switch-like behavior in a large family of simple biochemical networks.

    Directory of Open Access Journals (Sweden)

    Dan Siegal-Gaskins


    Full Text Available Bistability plays a central role in the gene regulatory networks (GRNs controlling many essential biological functions, including cellular differentiation and cell cycle control. However, establishing the network topologies that can exhibit bistability remains a challenge, in part due to the exceedingly large variety of GRNs that exist for even a small number of components. We begin to address this problem by employing chemical reaction network theory in a comprehensive in silico survey to determine the capacity for bistability of more than 40,000 simple networks that can be formed by two transcription factor-coding genes and their associated proteins (assuming only the most elementary biochemical processes. We find that there exist reaction rate constants leading to bistability in ∼90% of these GRN models, including several circuits that do not contain any of the TF cooperativity commonly associated with bistable systems, and the majority of which could only be identified as bistable through an original subnetwork-based analysis. A topological sorting of the two-gene family of networks based on the presence or absence of biochemical reactions reveals eleven minimal bistable networks (i.e., bistable networks that do not contain within them a smaller bistable subnetwork. The large number of previously unknown bistable network topologies suggests that the capacity for switch-like behavior in GRNs arises with relative ease and is not easily lost through network evolution. To highlight the relevance of the systematic application of CRNT to bistable network identification in real biological systems, we integrated publicly available protein-protein interaction, protein-DNA interaction, and gene expression data from Saccharomyces cerevisiae, and identified several GRNs predicted to behave in a bistable fashion.

  9. Ground-state kinetics of bistable redox-active donor-acceptor mechanically interlocked molecules. (United States)

    Fahrenbach, Albert C; Bruns, Carson J; Li, Hao; Trabolsi, Ali; Coskun, Ali; Stoddart, J Fraser


    The ability to design and confer control over the kinetics of theprocesses involved in the mechanisms of artificial molecular machines is at the heart of the challenge to create ones that can carry out useful work on their environment, just as Nature is wont to do. As one of the more promising forerunners of prototypical artificial molecular machines, chemists have developed bistable redox-active donor-acceptor mechanically interlocked molecules (MIMs) over the past couple of decades. These bistable MIMs generally come in the form of [2]rotaxanes, molecular compounds that constitute a ring mechanically interlocked around a dumbbell-shaped component, or [2]catenanes, which are composed of two mechanically interlocked rings. As a result of their interlocked nature, bistable MIMs possess the inherent propensity to express controllable intramolecular, large-amplitude, and reversible motions in response to redox stimuli. In this Account, we rationalize the kinetic behavior in the ground state for a large assortment of these types of bistable MIMs, including both rotaxanes and catenanes. These structures have proven useful in a variety of applications ranging from drug delivery to molecular electronic devices. These bistable donor-acceptor MIMs can switch between two different isomeric states. The favored isomer, known as the ground-state co-conformation (GSCC) is in equilibrium with the less favored metastable state co-conformation (MSCC). The forward (kf) and backward (kb) rate constants associated with this ground-state equilibrium are intimately connected to each other through the ground-state distribution constant, KGS. Knowing the rate constants that govern the kinetics and bring about the equilibration between the MSCC and GSCC, allows researchers to understand the operation of these bistable MIMs in a device setting and apply them toward the construction of artificial molecular machines. The three biggest influences on the ground-state rate constants arise from

  10. Fractionation of parietal function in bistable perception probed with concurrent TMS-EEG. (United States)

    Schauer, Georg; Chang, Acer; Schwartzman, David; Rae, Charlotte L; Iriye, Heather; Seth, Anil K; Kanai, Ryota


    When visual input has conflicting interpretations, conscious perception can alternate spontaneously between these possible interpretations. This is called bistable perception. Previous neuroimaging studies have indicated the involvement of two right parietal areas in resolving perceptual ambiguity (ant-SPLr and post-SPLr). Transcranial magnetic stimulation (TMS) studies that selectively interfered with the normal function of these regions suggest that they play opposing roles in this type of perceptual switch. In the present study, we investigated this fractionation of parietal function by use of combined TMS with electroencephalography (EEG). Specifically, while participants viewed either a bistable stimulus, a replay stimulus, or resting-state fixation, we applied single pulse TMS to either location independently while simultaneously recording EEG. Combined with participant's individual structural magnetic resonance imaging (MRI) scans, this dataset allows for complex analyses of the effect of TMS on neural time series data, which may further elucidate the causal role of the parietal cortex in ambiguous perception.

  11. Balancing bistable perception during self-motion. (United States)

    van Elk, Michiel; Blanke, Olaf


    In two experiments we investigated whether bistable visual perception is influenced by passive own body displacements due to vestibular stimulation. For this we passively rotated our participants around the vertical (yaw) axis while observing different rotating bistable stimuli (bodily or non-bodily) with different ambiguous motion directions. Based on previous work on multimodal effects on bistable perception, we hypothesized that vestibular stimulation should alter bistable perception and that the effects should differ for bodily versus non-bodily stimuli. In the first experiment, it was found that the rotation bias (i.e., the difference between the percentage of time that a CW or CCW rotation was perceived) was selectively modulated by vestibular stimulation: the perceived duration of the bodily stimuli was longer for the rotation direction congruent with the subject's own body rotation, whereas the opposite was true for the non-bodily stimulus (Necker cube). The results found in the second experiment extend the findings from the first experiment and show that these vestibular effects on bistable perception only occur when the axis of rotation of the bodily stimulus matches the axis of passive own body rotation. These findings indicate that the effect of vestibular stimulation on the rotation bias depends on the stimulus that is presented and the rotation axis of the stimulus. Although most studies on vestibular processing have traditionally focused on multisensory signal integration for posture, balance, and heading direction, the present data show that vestibular self-motion influences the perception of bistable bodily stimuli revealing the importance of vestibular mechanisms for visual consciousness.

  12. Bistable Microvalve For Use With Microcatheter System (United States)

    Seward, Kirk Patrick


    A bistable microvalve of shape memory material is operatively connected to a microcatheter. The bistable microvalve includes a tip that can be closed off until it is in the desired position. Once it is in position it can be opened and closed. The system uses heat and pressure to open and close the microvalve. The shape memory material will change stiffness and shape when heated above a transition temperature. The shape memory material is adapted to move from a first shape to a second shape, either open or closed, where it can perform a desired function.

  13. Unidirectional Transition Waves in Bistable Lattices. (United States)

    Nadkarni, Neel; Arrieta, Andres F; Chong, Christopher; Kochmann, Dennis M; Daraio, Chiara


    We present a model system for strongly nonlinear transition waves generated in a periodic lattice of bistable members connected by magnetic links. The asymmetry of the on-site energy wells created by the bistable members produces a mechanical diode that supports only unidirectional transition wave propagation with constant wave velocity. We theoretically justify the cause of the unidirectionality of the transition wave and confirm these predictions by experiments and simulations. We further identify how the wave velocity and profile are uniquely linked to the double-well energy landscape, which serves as a blueprint for transition wave control.

  14. Bistable Topological Insulator with Exciton-Polaritons (United States)

    Kartashov, Yaroslav V.; Skryabin, Dmitry V.


    The functionality of many nonlinear and quantum optical devices relies on the effect of optical bistability. Using microcavity exciton-polaritons in a honeycomb arrangement of microcavity pillars, we report the resonance response and bistability of topological edge states. A balance between the pump, loss, and nonlinearity ensures a broad range of dynamical stability and controls the distribution of power between counterpropagating states on the opposite edges of the honeycomb lattice stripe. Tuning energy and polarization of the pump photons, while keeping their momentum constant, we demonstrate control of the propagation direction of the dominant edge state. Our results facilitate the development of practical applications of topological photonics.

  15. Bistable firing properties of soleus motor units in unrestrained rats

    DEFF Research Database (Denmark)

    EKEN, T.; KIEHN, O.


    of the motoneuron pool by stimulation of la afferents, or inhibition by stimulation of skin afferents. The shifts were not related to gross limb movements. This phenomenon is referred to as a bistable firing pattern. Bistable firing also occurred spontaneously during quiet standing. Typically the firing frequency...... was unchanged or only phasically influenced. These results demonstrate for the first time a bistable firing pattern during postural activity in the intact animal. The firing pattern closely resembles the bistable behaviour described in spinal motoneurons in reduced preparations, where it is due to the presence...... of a plateau potential. This suggests that the bistable firing is unexplained by plateau potentials also in the intact animal....

  16. Neuromechanistic Model of Auditory Bistability.

    Directory of Open Access Journals (Sweden)

    James Rankin


    Full Text Available Sequences of higher frequency A and lower frequency B tones repeating in an ABA- triplet pattern are widely used to study auditory streaming. One may experience either an integrated percept, a single ABA-ABA- stream, or a segregated percept, separate but simultaneous streams A-A-A-A- and -B---B--. During minutes-long presentations, subjects may report irregular alternations between these interpretations. We combine neuromechanistic modeling and psychoacoustic experiments to study these persistent alternations and to characterize the effects of manipulating stimulus parameters. Unlike many phenomenological models with abstract, percept-specific competition and fixed inputs, our network model comprises neuronal units with sensory feature dependent inputs that mimic the pulsatile-like A1 responses to tones in the ABA- triplets. It embodies a neuronal computation for percept competition thought to occur beyond primary auditory cortex (A1. Mutual inhibition, adaptation and noise are implemented. We include slow NDMA recurrent excitation for local temporal memory that enables linkage across sound gaps from one triplet to the next. Percepts in our model are identified in the firing patterns of the neuronal units. We predict with the model that manipulations of the frequency difference between tones A and B should affect the dominance durations of the stronger percept, the one dominant a larger fraction of time, more than those of the weaker percept-a property that has been previously established and generalized across several visual bistable paradigms. We confirm the qualitative prediction with our psychoacoustic experiments and use the behavioral data to further constrain and improve the model, achieving quantitative agreement between experimental and modeling results. Our work and model provide a platform that can be extended to consider other stimulus conditions, including the effects of context and volition.

  17. Laser activated superconducting switch

    International Nuclear Information System (INIS)

    Wolf, A.A.


    A superconducting switch or bistable device is described consisting of a superconductor in a cryogen maintaining a temperature just below the transition temperature, having a window of the proper optical frequency band for passing a laser beam which may impinge on the superconductor when desired. The frequency of the laser is equal to or greater than the optical absorption frequency of the superconducting material and is consistent with the ratio of the gap energy of the switch material to Planck's constant, to cause depairing of electrons, and thereby normalize the superconductor. Some embodiments comprise first and second superconducting metals. Other embodiments feature the two superconducting metals separated by a thin film insulator through which the superconducting electrons tunnel during superconductivity

  18. Optically coupled cavities for wavelength switching

    Energy Technology Data Exchange (ETDEWEB)

    Costazo-Caso, Pablo A; Granieri, Sergio; Siahmakoun, Azad, E-mail:, E-mail:, E-mail: [Department of Physics and Optical Engineering, Rose-Hulman Institute of Technology, 5500 Wabash Avenue, Terre Haute, IN 47803 (United States)


    An optical bistable device which presents hysteresis behavior is proposed and experimentally demonstrated. The system finds applications in wavelength switching, pulse reshaping and optical bistability. It is based on two optically coupled cavities named master and slave. Each cavity includes a semiconductor optical amplifier (SOA), acting as the gain medium of the laser, and two pair of fiber Bragg gratings (FBG) which define the lasing wavelength (being different in each cavity). Finally, a variable optical coupler (VOC) is employed to couple both cavities. Experimental characterization of the system performance is made analyzing the effects of the coupling coefficient between the two cavities and the driving current in each SOA. The properties of the hysteretic bistable curve and switching can be controlled by adjusting these parameters and the loss in the cavities. By selecting the output wavelength ({lambda}{sub 1} or {lambda}{sub 2}) with an external filter it is possible to choose either the invert or non-invert switched signal. Experiments were developed employing both optical discrete components and a photonic integrated circuit. They show that for 8 m-long cavities the maximum switching frequency is about 500 KHz, and for 4 m-long cavities a minimum rise-time about 21 ns was measured. The switching time can be reduced by shortening the cavity lengths and using photonic integrated circuits.

  19. Multi-Valued Spin Switch in a Semiconductor Microcavity (United States)

    Paraïso, T. K.; Wouters, M.; Léger, Y.; Morier-Genoud, F.; Deveaudhyphen; Plédran, B.


    In this work, we report on the first realization of multi-valued spin switching in the solid-state. We investigate the physics of spinor bistability with microcavity polaritons in a trap. Spinor interactions lead to special bistability regimes with decoupled thresholds for spin-up and spin-down polaritons. This allows us to establish state-of-the-art spin switching operations. We evidence polarization hysteresis and determine appropriate conditions to achieve spin multistability. For a given excitation condition, three stable spin states coexist for the system. These results open new pathways for the development of innovative spin-based logic gates and memory devices.

  20. Transcriptome dynamics-based operon prediction in prokaryotes. (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario


    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  1. ProOpDB: Prokaryotic Operon DataBase. (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique


    The Prokaryotic Operon DataBase (ProOpDB, constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  2. Plasmon-modulated bistable four-wave mixing signals from a metal nanoparticle-monolayer MoS2 nanoresonator hybrid system (United States)

    Li, Jian-Bo; Tan, Xiao-Long; Ma, Jin-Hong; Xu, Si-Qin; Kuang, Zhi-Wei; Liang, Shan; Xiao, Si; He, Meng-Dong; Kim, Nam-Chol; Luo, Jian-Hua; Chen, Li-Qun


    We present a study for the impact of exciton-phonon and exciton-plasmon interactions on bistable four-wave mixing (FWM) signals in a metal nanoparticle (MNP)-monolayer MoS2 nanoresonator hybrid system. Via tracing the FWM response we predict that, depending on the excitation conditions and the system parameters, such a system exhibits ‘U-shaped’ bistable FWM signals. We also map out bistability phase diagrams within the system’s parameter space. Especially, we show that compared with the exciton-phonon interaction, a strong exciton-plasmon interaction plays a dominant role in the generation of optical bistability, and the bistable region will be greatly broadened by shortening the distance between the MNP and the monolayer MoS2 nanoresonator. In the weak exciton-plasmon coupling regime, the impact of exciton-phonon interaction on optical bistability will become obvious. The scheme proposed may be used for building optical switches and logic-gate devices for optical computing and quantum information processing.

  3. Plasmon-modulated bistable four-wave mixing signals from a metal nanoparticle-monolayer MoS2 nanoresonator hybrid system. (United States)

    Li, Jian-Bo; Tan, Xiao-Long; Ma, Jin-Hong; Xu, Si-Qin; Kuang, Zhi-Wei; Liang, Shan; Xiao, Si; He, Meng-Dong; Kim, Nam-Chol; Luo, Jian-Hua; Chen, Li-Qun


    We present a study for the impact of exciton-phonon and exciton-plasmon interactions on bistable four-wave mixing (FWM) signals in a metal nanoparticle (MNP)-monolayer MoS 2 nanoresonator hybrid system. Via tracing the FWM response we predict that, depending on the excitation conditions and the system parameters, such a system exhibits 'U-shaped' bistable FWM signals. We also map out bistability phase diagrams within the system's parameter space. Especially, we show that compared with the exciton-phonon interaction, a strong exciton-plasmon interaction plays a dominant role in the generation of optical bistability, and the bistable region will be greatly broadened by shortening the distance between the MNP and the monolayer MoS 2 nanoresonator. In the weak exciton-plasmon coupling regime, the impact of exciton-phonon interaction on optical bistability will become obvious. The scheme proposed may be used for building optical switches and logic-gate devices for optical computing and quantum information processing.

  4. Functionally rigid bistable [2]rotaxanes

    DEFF Research Database (Denmark)

    Nygaard, Sune; Leung, Ken C-F; Aprahamian, Ivan


    defines an unambiguous distance of 1.5 nm over which the ring moves between the MPTTF and NP units. The degenerate NP/NP [2]rotaxane was used to investigate the shuttling barrier by dynamic 1H NMR spectroscopy for the movement of the CBPQT4+ ring across the new rigid spacer. It is evident from...... better control over the position of the ring component in the ground state but also for control over the location of the CBPQT4+ ring during solution-state switching experiments, triggered either chemically (1H NMR) or electrochemically (cyclic voltammetry). In this instance, the use of the rigid spacer......Two-station [2]rotaxanes in the shape of a degenerate naphthalene (NP) shuttle and a nondegenerate monopyrrolotetrathiafulvalene (MPTTF)/NP redox-controllable switch have been synthesized and characterized in solution. Their dumbbell-shaped components are composed of polyether chains interrupted...

  5. Metastable and bistable defects in silicon

    International Nuclear Information System (INIS)

    Mukashev, Bulat N; Abdullin, Kh A; Gorelkinskii, Yurii V


    Existing data on the properties and structure of metastable and bistable defects in silicon are analyzed. Primary radiation-induced defects (vacancies, self-interstitial atoms, and Frenkel pairs), complexes of oxygen, carbon, hydrogen, and other impurity atoms and defects with negative correlation energy are considered. (reviews of topical problems)

  6. High-Speed and Low-Energy Flip-Flop Operation of Asymmetric Active-Multimode Interferometer Bi-Stable Laser Diodes

    DEFF Research Database (Denmark)

    Jiang, Haisong; Chaen, Yutaka; Hagio, Takuma


    High-speed (121/25 ps rise/fall time) and low-switching energy (7.1 and 3.4 fJ) alloptical flip-flop operation of single-wavelength high-mesa asymmetric active-MMI bi-stable laser diodes is demonstrated for the first time using 25 ps long switching pulses.......High-speed (121/25 ps rise/fall time) and low-switching energy (7.1 and 3.4 fJ) alloptical flip-flop operation of single-wavelength high-mesa asymmetric active-MMI bi-stable laser diodes is demonstrated for the first time using 25 ps long switching pulses....

  7. Metazoan operons accelerate recovery from growth arrested states (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.


    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  8. Triggered Snap-Through of Bistable Shells (United States)

    Cai, Yijie; Huang, Shicheng; Trase, Ian; Hu, Nan; Chen, Zi

    Elastic bistable shells are common structures in nature and engineering, such as the lobes of the Venus flytrap or the surface of a toy jumping poppers. Despite their ubiquity, the parameters that control the bistability of such structures are not well understood. In this study, we explore how the geometrical features of radially symmetric elastic shells affect the shape and potential energy of a shell's stable states, and how to tune certain parameters in order to generate a snap-through transition from a convex semi-stable state to concave stable state. We fabricated a series of elastic shells with varying geometric parameters out of silicone rubber and measured the resulting potential energy in the semi-stable state. Finite element simulations were also conducted in order to determine the deformation and stress in the shells during snap-through. It was found that the energy of the semi-stable state is controlled by only two geometric parameters and a dimensionless ratio. We also noted two distinct transitions during snap-through, one between monostability and semi-bistability (the state a popper toy is in before it snaps-through and jumps), and a second transition between semi-bistability and true bistability. This work shows that it is possible to use a set of simple parameters to tailor the energy landscape of an elastic shell in order to generate complex trigger motions for their potential use in smart applications. Z.C. acknowledge support from Society in Science-Branco Weiss Fellowship, administered by ETH Zurich.

  9. The combination of positive and negative feedback loops confers exquisite flexibility to biochemical switches

    International Nuclear Information System (INIS)

    Pfeuty, Benjamin; Kaneko, Kunihiko


    A wide range of cellular processes require molecular regulatory pathways to convert a graded signal into a discrete response. One prevalent switching mechanism relies on the coexistence of two stable states (bistability) caused by positive feedback regulations. Intriguingly, positive feedback is often supplemented with negative feedback, raising the question of whether and how these two types of feedback can cooperate to control discrete cellular responses. To address this issue, we formulate a canonical model of a protein–protein interaction network and analyze the dynamics of a prototypical two-component circuit. The appropriate combination of negative and positive feedback loops can bring a bistable circuit close to the oscillatory regime. Notably, sharply activated negative feedback can give rise to a bistable regime wherein two stable fixed points coexist and may collide pairwise with two saddle points. This specific type of bistability is found to allow for separate and flexible control of switch-on and switch-off events, for example (i) to combine fast and reversible transitions, (ii) to enable transient switching responses and (iii) to display tunable noise-induced transition rates. Finally, we discuss the relevance of such bistable switching behavior, and the circuit topologies considered, to specific biological processes such as adaptive metabolic responses, stochastic fate decisions and cell-cycle transitions. Taken together, our results suggest an efficient mechanism by which positive and negative feedback loops cooperate to drive the flexible and multifaceted switching behaviors arising in biological systems

  10. Generalized nematohydrodynamic boundary conditions with application to bistable twisted nematic liquid-crystal displays

    KAUST Repository

    Fang, Angbo


    Parallel to the highly successful Ericksen-Leslie hydrodynamic theory for the bulk behavior of nematic liquid crystals (NLCs), we derive a set of coupled hydrodynamic boundary conditions to describe the NLC dynamics near NLC-solid interfaces. In our boundary conditions, translational flux (flow slippage) and rotational flux (surface director relaxation) are coupled according to the Onsager variational principle of least energy dissipation. The application of our boundary conditions to the truly bistable π -twist NLC cell reveals a complete picture of the dynamic switching processes. It is found that the thus far overlooked translation-rotation dissipative coupling at solid surfaces can accelerate surface director relaxation and enhance the flow rate. This can be utilized to improve the performance of electro-optical nematic devices by lowering the required switching voltages and reducing the switching times. © 2008 The American Physical Society.

  11. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten


    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  12. Ground-state thermodynamics of bistable redox-active donor-acceptor mechanically interlocked molecules. (United States)

    Fahrenbach, Albert C; Bruns, Carson J; Cao, Dennis; Stoddart, J Fraser


    Fashioned through billions of years of evolution, biological molecular machines, such as ATP synthase, myosin, and kinesin, use the intricate relative motions of their components to drive some of life's most essential processes. Having control over the motions in molecules is imperative for life to function, and many chemists have designed, synthesized, and investigated artificial molecular systems that also express controllable motions within molecules. Using bistable mechanically interlocked molecules (MIMs), based on donor-acceptor recognition motifs, we have sought to imitate the sophisticated nanoscale machines present in living systems. In this Account, we analyze the thermodynamic characteristics of a series of redox-switchable [2]rotaxanes and [2]catenanes. Control and understanding of the relative intramolecular movements of components in MIMs have been vital in the development of a variety of applications of these compounds ranging from molecular electronic devices to drug delivery systems. These bistable donor-acceptor MIMs undergo redox-activated switching between two isomeric states. Under ambient conditions, the dominant translational isomer, the ground-state coconformation (GSCC), is in equilibrium with the less favored translational isomer, the metastable-state coconformation (MSCC). By manipulating the redox state of the recognition site associated with the GSCC, we can stimulate the relative movements of the components in these bistable MIMs. The thermodynamic parameters of model host-guest complexes provide a good starting point to rationalize the ratio of GSCC to MSCC at equilibrium. The bistable [2]rotaxanes show a strong correlation between the relative free energies of model complexes and the ground-state distribution constants (K(GS)). This relationship does not always hold for bistable [2]catenanes, most likely because of the additional steric and electronic constraints present when the two rings are mechanically interlocked with each other

  13. Bistable perception modeled as competing stochastic integrations at two levels. (United States)

    Gigante, Guido; Mattia, Maurizio; Braun, Jochen; Del Giudice, Paolo


    We propose a novel explanation for bistable perception, namely, the collective dynamics of multiple neural populations that are individually meta-stable. Distributed representations of sensory input and of perceptual state build gradually through noise-driven transitions in these populations, until the competition between alternative representations is resolved by a threshold mechanism. The perpetual repetition of this collective race to threshold renders perception bistable. This collective dynamics - which is largely uncoupled from the time-scales that govern individual populations or neurons - explains many hitherto puzzling observations about bistable perception: the wide range of mean alternation rates exhibited by bistable phenomena, the consistent variability of successive dominance periods, and the stabilizing effect of past perceptual states. It also predicts a number of previously unsuspected relationships between observable quantities characterizing bistable perception. We conclude that bistable perception reflects the collective nature of neural decision making rather than properties of individual populations or neurons.

  14. Optical bistability in erbium-doped yttrium aluminum garnet crystal combined with a laser diode. (United States)

    Maeda, Y


    Optical bistability was observed in a simple structure of an injection laser diode combined with an erbium-doped yttrium aluminum garnet crystal. Since a hysteresis characteristic exists in the relationship between the wavelength and the injection current of a laser diode, an optical memory function capable of holding the output status is confirmed. In addition, an optical signal inversion was caused by the decrease of transmission of the erbium-doped yttrium aluminum garnet crystal against the red shift (principally mode hopping) of the laser diode. It is suggested that the switching time of this phenomenon is the time necessary for a mode hopping by current injection.

  15. Modeling bistable cell-fate choices in the Drosophila eye: qualitative and quantitative perspectives (United States)

    Graham, Thomas G. W.; Tabei, S. M. Ali; Dinner, Aaron R.; Rebay, Ilaria


    A major goal of developmental biology is to understand the molecular mechanisms whereby genetic signaling networks establish and maintain distinct cell types within multicellular organisms. Here, we review cell-fate decisions in the developing eye of Drosophila melanogaster and the experimental results that have revealed the topology of the underlying signaling circuitries. We then propose that switch-like network motifs based on positive feedback play a central role in cell-fate choice, and discuss how mathematical modeling can be used to understand and predict the bistable or multistable behavior of such networks. PMID:20570936

  16. Memristic Characteristics from Bistable to Tristable Memory with Controllable Charge Trap Carbon Nanotubes. (United States)

    Li, Lei; Wen, Dianzhong


    The incorporation of the one-dimensional carbon nanomaterial carbon nanotubes (CNTs) in poly(methyl methacrylate) (PMMA) was found to successfully develop a resistive switching. It implements memristic characteristics which shift from bistable to tristable memory. The localized current pathways in the organic nanocomposite layers for each intermediate resistive state (IRS) are attributed to the trapping mechanism consistent with the fluorescent measurements. Multi-bit organic memories have attracted considerable interest, which provide an effective way to increase the memory density per unit cell area. This study will be useful for the development and tuning of multi-bit storable organic nanocomposite memory device systems.

  17. Memristic Characteristics from Bistable to Tristable Memory with Controllable Charge Trap Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Lei Li


    Full Text Available The incorporation of the one-dimensional carbon nanomaterial carbon nanotubes (CNTs in poly(methyl methacrylate (PMMA was found to successfully develop a resistive switching. It implements memristic characteristics which shift from bistable to tristable memory. The localized current pathways in the organic nanocomposite layers for each intermediate resistive state (IRS are attributed to the trapping mechanism consistent with the fluorescent measurements. Multi-bit organic memories have attracted considerable interest, which provide an effective way to increase the memory density per unit cell area. This study will be useful for the development and tuning of multi-bit storable organic nanocomposite memory device systems.

  18. Switching dynamics of TaOx-based threshold switching devices (United States)

    Goodwill, Jonathan M.; Gala, Darshil K.; Bain, James A.; Skowronski, Marek


    Bi-stable volatile switching devices are being used as access devices in solid-state memory arrays and as the active part of compact oscillators. Such structures exhibit two stable states of resistance and switch between them at a critical value of voltage or current. A typical resistance transient under a constant amplitude voltage pulse starts with a slow decrease followed by a rapid drop and leveling off at a low steady state value. This behavior prompted the interpretation of initial delay and fast transition as due to two different processes. Here, we show that the entire transient including incubation time, transition time, and the final resistance values in TaOx-based switching can be explained by one process, namely, Joule heating with the rapid transition due to the thermal runaway. The time, which is required for the device in the conducting state to relax back to the stable high resistance one, is also consistent with the proposed mechanism.

  19. Optical bistability and multistability in polaritonic materials doped with nanoparticles

    International Nuclear Information System (INIS)

    Wang, Zhiping; Yu, Benli


    We investigate the optical bistability and multistability in polaritonic materials doped with nanoparticles inside an optical ring cavity. It is found that the optical bistability and multistability can be easily controlled by adjusting the corresponding parameters of the system properly. The effect of the dipole–dipole interaction has also been included in the formulation, which leads to interesting phenomena. Our scheme opens up the possibility of controling the optical bistability and multistability in polaritonic materials doped with nanoparticles. (letter)

  20. A steady state analysis indicates that negative feedback regulation of PTP1B by Akt elicits bistability in insulin-stimulated GLUT4 translocation

    Directory of Open Access Journals (Sweden)

    Giri Lopamudra


    Full Text Available Abstract Background The phenomenon of switch-like response to graded input signal is the theme involved in various signaling pathways in living systems. Positive feedback loops or double negative feedback loops embedded with nonlinearity exhibit these switch-like bistable responses. Such feedback regulations exist in insulin signaling pathway as well. Methods In the current manuscript, a steady state analysis of the metabolic insulin-signaling pathway is presented. The threshold concentration of insulin required for glucose transporter GLUT4 translocation was studied with variation in system parameters and component concentrations. The dose response curves of GLUT4 translocation at various concentration of insulin obtained by steady state analysis were quantified in-terms of half saturation constant. Results We show that, insulin-stimulated GLUT4 translocation can operate as a bistable switch, which ensures that GLUT4 settles between two discrete, but mutually exclusive stable steady states. The threshold concentration of insulin required for GLUT4 translocation changes with variation in system parameters and component concentrations, thus providing insights into possible pathological conditions. Conclusion A steady state analysis indicates that negative feedback regulation of phosphatase PTP1B by Akt elicits bistability in insulin-stimulated GLUT4 translocation. The threshold concentration of insulin required for GLUT4 translocation and the corresponding bistable response at different system parameters and component concentrations was compared with reported experimental observations on specific defects in regulation of the system.

  1. Durable bistable auxetics made of rigid solids (United States)

    Shang, Xiao; Liu, Lu; Rafsanjani, Ahmad; Pasini, Damiano


    Bistable Auxetic Metamaterials (BAMs) are a class of monolithic perforated periodic structures with negative Poisson's ratio. Under tension, a BAM can expand and reach a second state of equilibrium through a globally large shape transformation that is ensured by the flexibility of its elastomeric base material. However, if made from a rigid polymer, or metal, BAM ceases to function due to the inevitable rupture of its ligaments. The goal of this work is to extend the unique functionality of the original kirigami architecture of BAM to a rigid solid base material. We use experiments and numerical simulations to assess performance, bistability and durability of rigid BAMs at 10,000 cycles. Geometric maps are presented to elucidate the role of the main descriptors of BAM architecture. The proposed design enables the realization of BAM from a large palette of materials, including elastic-perfectly plastic materials and potentially brittle materials.

  2. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides. (United States)

    Narang, Atul; Oehler, Stefan


    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  3. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis. (United States)

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale


    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  4. Bistable (latching) solenoid actuated propellant isolation valve (United States)

    Wichmann, H.; Deboi, H. H.


    The design, fabrication, assembly and test of a development configuration bistable (latching) solenoid actuated propellant isolation valve suitable for the control hydrazine and liquid fluorine to an 800 pound thrust rocket engine is described. The valve features a balanced poppet, utilizing metal bellows, a hard poppet/seat interface and a flexure support system for the internal moving components. This support system eliminates sliding surfaces, thereby rendering the valve free of self generated particles.

  5. Dynamics of unidirectionally coupled bistable Henon maps

    International Nuclear Information System (INIS)

    Sausedo-Solorio, J.M.; Pisarchik, A.N.


    We study dynamics of two bistable Henon maps coupled in a master-slave configuration. In the case of coexistence of two periodic orbits, the slave map evolves into the master map state after transients, which duration determines synchronization time and obeys a -1/2 power law with respect to the coupling strength. This scaling law is almost independent of the map parameter. In the case of coexistence of chaotic and periodic attractors, very complex dynamics is observed, including the emergence of new attractors as the coupling strength is increased. The attractor of the master map always exists in the slave map independently of the coupling strength. For a high coupling strength, complete synchronization can be achieved only for the attractor similar to that of the master map. -- Highlights: → We study dynamics of two bistable Henon maps coupled in a master-slave configuration. → Synchronization time for periodic orbits obeys a -1/2 power law with respect to coupling. → For a high coupling strength, the slave map remains bistable. → Complete synchronization can be achieved only when both maps stay at the same attractor.

  6. Sequence and features of the tryptophan operon of Vibrio parahemolyticus. (United States)

    Crawford, I P; Han, C Y; Silverman, M


    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  7. Bubbling and bistability in two parameter discrete systems


    Ambika, G.; Sujatha, N. V.


    We present a graphical analysis of the mechanisms underlying the occurrences of bubbling sequences and bistability regions in the bifurcation scenario of a special class of one dimensional two parameter maps. The main result of the analysis is that whether it is bubbling or bistability is decided by the sign of the third derivative at the inflection point of the map function.

  8. Multistability in Bistable Ferroelectric Materials toward Adaptive Applications

    NARCIS (Netherlands)

    Ghosh, Anirban; Koster, Gertjan; Rijnders, Augustinus J.H.M.


    Traditionally thermodynamically bistable ferroic materials are used for nonvolatile operations based on logic gates (e.g., in the form of field effect transistors). But, this inherent bistability in these class of materials limits their applicability for adaptive operations. Emulating biological

  9. Amplification without inversion, fast light and optical bistability in a duplicated two-level system

    International Nuclear Information System (INIS)

    Ebrahimi Zohravi, Lida; Vafafard, Azar; Mahmoudi, Mohammad


    The optical properties of a weak probe field in a duplicated two-level system are investigated in multi-photon resonance (MPR) condition and beyond it. It is shown that by changing the relative phase of applied fields, the absorption switches to the amplification without inversion in MPR condition. By applying the Floquet decomposition to the equations of motion beyond MPR condition, it is shown that the phase-dependent behavior is valid only in MPR condition. Moreover, it is demonstrated that the group velocity of light pulse can be controlled by the intensity of the applied fields and the gain-assisted superluminal light propagation (fast light) is obtained in this system. In addition, the optical bistability (OB) behavior of the system is studied beyond MPR condition. We apply an indirect incoherent pumping field to the system and it is found that the group velocity and OB behavior of the system can be controlled by the incoherent pumping rate. - Highlights: • We studied the optical properties of DTL system under MPR condition and beyond it. • By changing the relative phase, the absorption switches to the amplification without inversion in MPR condition. • The gain-assisted superluminal light propagation (fast light) is obtained in this system. • The optical bistability (OB) behavior of the system is studied beyond MPR condition. • The incoherent pumping rate has a major role in controlling the group velocity and OB behavior of the system

  10. Bistability and hysteresis of the 'Secteur' differentiation are controlled by a two-gene locus in Nectria haematococca

    Directory of Open Access Journals (Sweden)

    Daboussi Marie-Josée


    Full Text Available Abstract Background Bistability and hysteresis are increasingly recognized as major properties of regulatory networks governing numerous biological phenomena, such as differentiation and cell cycle progression. The full scope of the underlying molecular mechanisms leading to bistability and hysteresis remains elusive. Nectria haemaotcocca, a saprophytic or pathogenic fungus with sexual reproduction, exhibits a bistable morphological modification characterized by a reduced growth rate and an intense pigmentation. Bistability is triggered by the presence or absence of σ, a cytoplasmic determinant. This determinant spreads in an infectious manner in the hyphae of the growing margin, insuring hysteresis of the differentiation. Results Seven mutants specifically affected in the generation of σ were selected through two different screening strategies. The s1 and s2 mutations completely abolish the generation of σ and of its morphological expression, the Secteur. The remaining five mutations promote its constitutive generation, which determines an intense pigmentation but not growth alteration. The seven mutations map at the same locus, Ses (for 'Secteur-specific'. The s2 mutant was obtained by an insertional mutagenesis strategy, which permitted the cloning of the Ses locus. Sequence and transcription analysis reveals that Ses is composed of two closely linked genes, SesA, mutated in the s1 and s2 mutant strains, and SesB, mutated in the s* mutant strains. SesB shares sequence similarity with animal and fungal putative proteins, with potential esterase/lipase/thioesterase activity, whereas SesA is similar to proteins of unknown function present only in the filamentous fungi Fusarium graminearum and Podospora anserina. Conclusions The cloning of Ses provides evidence that a system encoded by two linked genes directs a bistable and hysteretic switch in a eukaryote. Atypical regulatory relations between the two proteins may account for the hysteresis

  11. Bistability and hysteresis of the 'Secteur' differentiation are controlled by a two-gene locus in Nectria haematococca (United States)

    Graziani, Stéphane; Silar, Philippe; Daboussi, Marie-Josée


    Background Bistability and hysteresis are increasingly recognized as major properties of regulatory networks governing numerous biological phenomena, such as differentiation and cell cycle progression. The full scope of the underlying molecular mechanisms leading to bistability and hysteresis remains elusive. Nectria haemaotcocca, a saprophytic or pathogenic fungus with sexual reproduction, exhibits a bistable morphological modification characterized by a reduced growth rate and an intense pigmentation. Bistability is triggered by the presence or absence of σ, a cytoplasmic determinant. This determinant spreads in an infectious manner in the hyphae of the growing margin, insuring hysteresis of the differentiation. Results Seven mutants specifically affected in the generation of σ were selected through two different screening strategies. The s1 and s2 mutations completely abolish the generation of σ and of its morphological expression, the Secteur. The remaining five mutations promote its constitutive generation, which determines an intense pigmentation but not growth alteration. The seven mutations map at the same locus, Ses (for 'Secteur-specific'). The s2 mutant was obtained by an insertional mutagenesis strategy, which permitted the cloning of the Ses locus. Sequence and transcription analysis reveals that Ses is composed of two closely linked genes, SesA, mutated in the s1 and s2 mutant strains, and SesB, mutated in the s* mutant strains. SesB shares sequence similarity with animal and fungal putative proteins, with potential esterase/lipase/thioesterase activity, whereas SesA is similar to proteins of unknown function present only in the filamentous fungi Fusarium graminearum and Podospora anserina. Conclusions The cloning of Ses provides evidence that a system encoded by two linked genes directs a bistable and hysteretic switch in a eukaryote. Atypical regulatory relations between the two proteins may account for the hysteresis of Secteur differentiation

  12. Optical bistability using quantum interference in V-type atoms

    International Nuclear Information System (INIS)

    Anton, M A; Calderon, Oscar G


    The behaviour of a V-type three-level atomic system in a ring cavity driven by a coherent field is studied. We consider a V configuration under conditions such that interference between decay channels is important. We find that when quantum interference is taken into account, optical bistability can be realized with a considerable decrease in the threshold intensity and the cooperative parameter. On the other hand, we also include the finite bandwidth of the driving field and study its role in the optical bistable response. It is found that at certain linewidths of the driving field optical bistability is obtained even if the system satisfies the trapping condition and the threshold intensity can be controlled. Furthermore, a change from the optical bistability due to quantum interference to the usual bistable behaviour based on saturation occurs as the driving field linewidth increases

  13. Organic bistable memory devices based on MoO3 nanoparticle embedded Alq3 structures (United States)

    Abhijith, T.; Kumar, T. V. Arun; Reddy, V. S.


    Organic bistable memory devices were fabricated by embedding a thin layer of molybdenum trioxide (MoO3) between two tris-(8-hydroxyquinoline)aluminum (Alq3) layers. The device exhibited excellent switching characteristics with an ON/OFF current ratio of 1.15 × 103 at a read voltage of 1 V. The device showed repeatable write-erase capability and good stability in both the conductance states. These conductance states are non-volatile in nature and can be obtained by applying appropriate voltage pulses. The effect of MoO3 layer thickness and its location in the Alq3 matrix on characteristics of the memory device was investigated. The field emission scanning electron microscopy (FE-SEM) images of the MoO3 layer revealed the presence of isolated nanoparticles. Based on the experimental results, a mechanism has been proposed for explaining the conductance switching of fabricated devices.

  14. Simulating the room-temperature dynamic motion of a ferromagnetic vortex in a bistable potential (United States)

    Haber, E.; Badea, R.; Berezovsky, J.


    The ability to precisely and reliably control the dynamics of ferromagnetic (FM) vortices could lead to novel nonvolatile memory devices and logic gates. Intrinsic and fabricated defects in the FM material can pin vortices and complicate the dynamics. Here, we simulated switching a vortex between bistable pinning sites using magnetic field pulses. The dynamic motion was modeled with the Thiele equation for a massless, rigid vortex subject to room-temperature thermal noise. The dynamics were explored both when the system was at zero temperature and at room-temperature. The probability of switching for different pulses was calculated, and the major features are explained using the basins of attraction map of the two pinning sites.

  15. Dynamics and control of twisting bi-stable structures (United States)

    Arrieta, Andres F.; van Gemmeren, Valentin; Anderson, Aaron J.; Weaver, Paul M.


    Compliance-based morphing structures have the potential to offer large shape adaptation, high stiffness and low weight, while reducing complexity, friction, and scalability problems of mechanism based systems. A promising class of structure that enables these characteristics are multi-stable structures given their ability to exhibit large deflections and rotations without the expensive need for continuous actuation, with the latter only required intermittently. Furthermore, multi-stable structures exhibit inherently fast response due to the snap-through instability governing changes between stable states, enabling rapid configuration switching between the discrete number of programmed shapes of the structure. In this paper, the design and utilisation of the inherent nonlinear dynamics of bi-stable twisting I-beam structures for actuation with low strain piezoelectric materials is presented. The I-beam structure consists of three compliant components assembled into a monolithic single element, free of moving parts, and showing large deflections between two stable states. Finite element analysis is utilised to uncover the distribution of strain across the width of the flange, guiding the choice of positioning for piezoelectric actuators. In addition, the actuation authority is maximised by calculating the generalised coupling coefficient for different positions of the piezoelectric actuators. The results obtained are employed to tailor and test I-beam designs exhibiting desired large deflection between stable states, while still enabling the activation of snap-through with the low strain piezoelectric actuators. To this end, the dynamic response of the I-beams to piezoelectric excitation is investigated, revealing that resonant excitations are insufficient to dynamically trigger snap-through. A novel bang-bang control strategy, which exploits the nonlinear dynamics of the structure successfully triggers both single and constant snap-through between the stable states

  16. Electrical bistabilities and memory mechanisms of nonvolatile organic bistable devices based on exfoliated muscovite-type mica nanoparticle/poly(methylmethacrylate) nanocomposites (United States)

    Lim, Won Gyu; Lee, Dea Uk; Na, Han Gil; Kim, Hyoun Woo; Kim, Tae Whan


    Organic bistable devices (OBDs) with exfoliated mica nanoparticles (NPs) embedded into an insulating poly(methylmethacrylate) (PMMA) layer were fabricated by using a spin-coating method. Current-voltage (I-V) curves for the Al/PMMA/exfoliated mica NP/PMMA/indium-tin-oxide/glass devices at 300 K showed a clockwise current hysteresis behavior due to the existence of the exfoliated muscovite-type mica NPs, which is an essential feature for bistable devices. Write-read-erase-read data showed that the OBDs had rewritable nonvolatile memories and an endurance number of ON/OFF switching for the OBDs of 102 cycles. An ON/OFF ratio of 1 × 103 was maintained for retention times larger than 1 × 104 s. The memory mechanisms of the fabricated OBDs were described by using the trapping and the tunneling processes within a PMMA active layer containing exfoliated muscovite-type mica NPs on the basis of the energy band diagram and the I-V curves.

  17. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes. (United States)

    Lawrence, J


    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  18. Evolution and Biophysics of the Escherichia coli lac Operon (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor


    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  19. Deployable structures using bistable reeled composites (United States)

    Daton-Lovett, Andrew J.; Compton-Bishop, Quentin M.; Curry, Richard G.


    This paper describes an innovative, patented use of composite materials developed by RolaTube Technology Ltd. to make smart deployable structures. Bi-stable reeled composites (BRCs) can alternate between two stable forms; that of a strong, rigid structure and that of a compact coil of flat-wound material. Bi-stability arises as a result of the manipulation of Poisson's ratio and isotropy in the various layers of the material. BRCs are made of fiber- reinforced composite materials, most often with a thermoplastic matrix. A range of fibers and polymer matrices can be used according to the requirements of the operating environment. Samples of a BRC structure were constructed using layers of unidirectional, fiber-reinforced thermoplastic sheet with the layers at different angles. The whole assembly was then consolidated under conditions of elevated temperature and pressure. The properties of the BRC are described and the result of a series of experiments performed on the sample to determine the tensile strength of the BRC structure are reported. A full analysis using finite element methods is being undertaken in collaboration with the University of Cambridge, England. The first commercial use has been to fabricate boom and drive mechanisms for the remote inspection of industrial plant.

  20. Ca++ dependent bistability induced by serotonin in spinal motoneurons

    DEFF Research Database (Denmark)

    Hounsgaard, J.; Kiehn, O.


    The plateau potential, responsible for the bistable state of spinal motoneurons, recently described in the decerebrate cat, was suggested to depend on serotonin (Hounsgaard et al. 1984). In an in vitro preparation of the spinal cord of the turtle we now show that serotonin, applied directly...... to the bath, transforms the intrinsic response properties of motoneurons, uncovering a plateau potential and voltage sensitive bistability. The changes induced by serotonin were blocked by Mn++, while the plateau potential and the bistability remained after application of tetrodotoxin. We conclude...... that serotonin controls the expression of a Ca++ dependent plateau potential in motoneurons....

  1. Bistable responses in bacterial genetic networks: Designs and dynamical consequences (United States)

    Tiwari, Abhinav; Ray, J. Christian J.; Narula, Jatin; Igoshin, Oleg A.


    A key property of living cells is their ability to react to stimuli with specific biochemical responses. These responses can be understood through the dynamics of underlying biochemical and genetic networks. Evolutionary design principles have been well studied in networks that display graded responses, with a continuous relationship between input signal and system output. Alternatively, biochemical networks can exhibit bistable responses so that over a range of signals the network possesses two stable steady states. In this review, we discuss several conceptual examples illustrating network designs that can result in a bistable response of the biochemical network. Next, we examine manifestations of these designs in bacterial master-regulatory genetic circuits. In particular, we discuss mechanisms and dynamic consequences of bistability in three circuits: two-component systems, sigma-factor networks, and a multistep phosphorelay. Analyzing these examples allows us to expand our knowledge of evolutionary design principles for networks with bistable responses. PMID:21385588

  2. Bistable luminescence of trivalent rare-earth ions in crystals

    International Nuclear Information System (INIS)

    Sole, Jose Garcia; Ramirez O, Maria de la; Rodenas, Airan; Jaque, Daniel; Bausa, Luisa; Bettinelli, Marco; Speghini, Adolfo; Cavalli, Enrico; Ivleva, Lioudmila


    In this work, we have examined three new bistable systems based on the luminescence of three different crystals activated with trivalent rare earth ions. We have focussed our attention on Yb 3+ ions activators, for which the most relevant results are obtained. The first crystal, Sr 0.6 Ba 0.4 Nb 2 O 6 , is a ferroelectric material with a relatively low phase transition temperature (∼370 K), which provides bistability in the luminescence of Yb 3+ ions due to the thermal hysteresis associated with phase transition. The second crystal, LiNbO 3 , provides an intrinsic bistability in the luminescence of Yb 3+ ions, which is driven by changes in the excitation intensity. In the third crystal, NdPO 4 , a new mechanism of excitation intensity driven bistability is obtained when activated with Yb 3+ ions, due to a interplay between the Nd 3+ ↔Yb 3+ energy transfer and back transfer processes

  3. Bifurcation of transition paths induced by coupled bistable systems. (United States)

    Tian, Chengzhe; Mitarai, Namiko


    We discuss the transition paths in a coupled bistable system consisting of interacting multiple identical bistable motifs. We propose a simple model of coupled bistable gene circuits as an example and show that its transition paths are bifurcating. We then derive a criterion to predict the bifurcation of transition paths in a generalized coupled bistable system. We confirm the validity of the theory for the example system by numerical simulation. We also demonstrate in the example system that, if the steady states of individual gene circuits are not changed by the coupling, the bifurcation pattern is not dependent on the number of gene circuits. We further show that the transition rate exponentially decreases with the number of gene circuits when the transition path does not bifurcate, while a bifurcation facilitates the transition by lowering the quasi-potential energy barrier.

  4. Spectroscopic and Theoretical Identification of Two Thermal Isomerization Pathways for Bistable Chiral Overcrowded Alkenes. (United States)

    Kistemaker, Jos C M; Pizzolato, Stefano F; van Leeuwen, Thomas; Pijper, Thomas C; Feringa, Ben L


    Chiroptical molecular switches play an important role in responsive materials and dynamic molecular systems. Here we present the synthesis of four chiral overcrowded alkenes and the experimental and computational study of their photochemical and thermal behavior. By irradiation with UV light, metastable diastereoisomers with opposite helicity were generated through high yielding E-Z isomerizations. Kinetic studies on metastable 1-4 using CD spectroscopy and HPLC analysis revealed two pathways at higher temperatures for the thermal isomerization, namely a thermal E-Z isomerization (TEZI) and a thermal helix inversion (THI). These processes were also studied computationally whereby a new strategy was developed for calculating the TEZI barrier for second-generation overcrowded alkenes. To demonstrate that these overcrowded alkenes can be employed as bistable switches, photochromic cycling was performed, which showed that the alkenes display good selectivity and fatigue resistance over multiple irradiation cycles. In particular, switch 3 displayed the best performance in forward and backward photoswitching, while 1 excelled in thermal stability of the photogenerated metastable form. Overall, the alkenes studied showed a remarkable and unprecedented combination of switching properties including dynamic helicity, reversibility, selectivity, fatigue resistance, and thermal stability. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Interaction of multiarmed spirals in bistable media. (United States)

    He, Ya-feng; Ai, Bao-quan; Liu, Fu-cheng


    We study the interaction of both dense and sparse multiarmed spirals in bistable media modeled by equations of the FitzHugh-Nagumo type. A dense one-armed spiral is characterized by its fixed tip. For dense multiarmed spirals, when the initial distance between tips is less than a critical value, the arms collide, connect, and disconnect continuously as the spirals rotate. The continuous reconstruction between the front and the back drives the tips to corotate along a rough circle and to meander zigzaggedly. The rotation frequency of tip, the frequency of zigzagged displacement, the frequency of spiral, the oscillation frequency of media, and the number of arms satisfy certain relations as long as the control parameters of the model are fixed. When the initial distance between tips is larger than the critical value, the behaviors of individual arms within either dense or sparse multiarmed spirals are identical to that of corresponding one-armed spirals.

  6. Lattice stretching bistability and dynamic heterogeneity

    DEFF Research Database (Denmark)

    Christiansen, Peter Leth; Savin, A. V.; Zolotaryuk, A. V.


    A simple one-dimensional lattice model is suggested to describe the experimentally observed plateau in force-stretching diagrams for some macromolecules. This chain model involves the nearest-neighbor interaction of a Morse-like potential (required to have a saturation branch) and a harmonic second......-neighbor coupling. Under an external stretching applied to the chain ends, the intersite Morse-like potential results in the appearance of a double-well potential within each chain monomer, whereas the interaction between the second neighbors provides a homogeneous bistable (degenerate) ground state, at least...... stretched bonds with a double-well potential. This case allows us to explain the existence of a plateau in the force-extension diagram for DNA and α-helix protein. Finally, the soliton dynamics are studied in detail....

  7. Cops or Robbers — a Bistable Society (United States)

    Kułakowski, K.

    The norm game described by Axelrod in 1985 was recently treated with the master equation formalism. Here we discuss the equations, where (i) those who break the norm cannot punish and those who punish cannot break the norm, (ii) the tendency to punish is suppressed if the majority breaks the norm. The second mechanism is new. For some values of the parameters the solution shows the saddle-point bifurcation. Then, two stable solutions are possible, where the majority breaks the norm or the majority punishes. This means, that the norm breaking can be discontinuous, when measured in the social scale. The bistable character is reproduced also with new computer simulations on the Erdös-Rényi directed network.

  8. Asymmetric Effects on Escape Rates of Bistable System

    International Nuclear Information System (INIS)

    Wang Canjun; Mei Dongcheng; Dai Zucheng


    The asymmetric effects on the escape rates from the stable states x ± in the bistable system are analyzed. The results indicate that the multiplicative noise and the additive noise always enhance the particle escape from stable states x ± of bistable. However, the asymmetric parameter r enhances the particle escape from stable state x + , and holds back the particle escape from stable state x - . (general)

  9. Analytic descriptions of stochastic bistable systems under force ramp. (United States)

    Friddle, Raymond W


    Solving the two-state master equation with time-dependent rates, the ubiquitous driven bistable system, is a long-standing problem that does not permit a complete solution for all driving rates. Here we show an accurate approximation to this problem by considering the system in the control parameter regime. The results are immediately applicable to a diverse range of bistable systems including single-molecule mechanics.

  10. BRIEF COMMUNICATION: Electrothermal bistability tuning in a large displacement micro actuator (United States)

    Gerson, Y.; Krylov, S.; Ilic, B.


    We report on an approach allowing simple yet efficient tuning of the bistability properties in large displacement micro actuators. The devices fabricated from silicon on insulator (SOI) wafers using a deep reactive ion etching (DRIE)-based process incorporate elastic suspension realized as a pair of beams initially curved in-plane and are operated electrostatically by a comb-drive transducer. The curvature of beam and therefore the stability characteristics of the suspension are controlled by passing a current through the suspension and resistive heating the beam material. Experimental results, which are in good agreement with the finite elements model predictions, demonstrate the feasibility of the suggested approach and show that the application of a small tuning current increases the device deflection from 42 to 56 µm, allows adjustment of the critical snap-through and snap-back voltages and makes it possible the control of latching without an additional electrode. The approach can be efficiently implemented in electrical and optical switches and threshold inertial and mass sensors where the use of long displacement actuators with an adjustable bistability range is beneficial.

  11. Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae. (United States)

    Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S


    Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

  12. Does visual attention drive the dynamics of bistable perception? (United States)

    Dieter, Kevin C; Brascamp, Jan; Tadin, Duje; Blake, Randolph


    How does attention interact with incoming sensory information to determine what we perceive? One domain in which this question has received serious consideration is that of bistable perception: a captivating class of phenomena that involves fluctuating visual experience in the face of physically unchanging sensory input. Here, some investigations have yielded support for the idea that attention alone determines what is seen, while others have implicated entirely attention-independent processes in driving alternations during bistable perception. We review the body of literature addressing this divide and conclude that in fact both sides are correct-depending on the form of bistable perception being considered. Converging evidence suggests that visual attention is required for alternations in the type of bistable perception called binocular rivalry, while alternations during other types of bistable perception appear to continue without requiring attention. We discuss some implications of this differential effect of attention for our understanding of the mechanisms underlying bistable perception, and examine how these mechanisms operate during our everyday visual experiences.

  13. The stochastic behavior of a molecular switching circuit with feedback

    Directory of Open Access Journals (Sweden)

    Smith Eric


    Full Text Available Abstract Background Using a statistical physics approach, we study the stochastic switching behavior of a model circuit of multisite phosphorylation and dephosphorylation with feedback. The circuit consists of a kinase and phosphatase acting on multiple sites of a substrate that, contingent on its modification state, catalyzes its own phosphorylation and, in a symmetric scenario, dephosphorylation. The symmetric case is viewed as a cartoon of conflicting feedback that could result from antagonistic pathways impinging on the state of a shared component. Results Multisite phosphorylation is sufficient for bistable behavior under feedback even when catalysis is linear in substrate concentration, which is the case we consider. We compute the phase diagram, fluctuation spectrum and large-deviation properties related to switch memory within a statistical mechanics framework. Bistability occurs as either a first-order or second-order non-equilibrium phase transition, depending on the network symmetries and the ratio of phosphatase to kinase numbers. In the second-order case, the circuit never leaves the bistable regime upon increasing the number of substrate molecules at constant kinase to phosphatase ratio. Conclusion The number of substrate molecules is a key parameter controlling both the onset of the bistable regime, fluctuation intensity, and the residence time in a switched state. The relevance of the concept of memory depends on the degree of switch symmetry, as memory presupposes information to be remembered, which is highest for equal residence times in the switched states. Reviewers This article was reviewed by Artem Novozhilov (nominated by Eugene Koonin, Sergei Maslov, and Ned Wingreen.

  14. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans. (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti


    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  15. CONDOP: an R package for CONdition-Dependent Operon Predictions. (United States)

    Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario


    The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  16. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly (United States)

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.


    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  17. Decision making in noisy bistable systems with time-dependent asymmetry (United States)

    Nené, Nuno R.; Zaikin, Alexey


    Our work draws special attention to the importance of the effects of time-dependent parameters on decision making in bistable systems. Here, we extend previous studies of the mechanism known as speed-dependent cellular decision making in genetic circuits by performing an analytical treatment of the canonical supercritical pitchfork bifurcation problem with an additional time-dependent asymmetry and control parameter. This model has an analogous behavior to the genetic switch. In the presence of transient asymmetries and fluctuations, slow passage through the critical region in both systems increases substantially the probability of specific decision outcomes. We also study the relevance for attractor selection of reaching maximum values for the external asymmetry before and after the critical region. Overall, maximum asymmetries should be reached at an instant where the position of the critical point allows for compensation of the detrimental effects of noise in retaining memory of the transient asymmetries.

  18. Air-stable memory array of bistable rectifying diodes based on ferroelectric-semiconductor polymer blends (United States)

    Kumar, Manasvi; Sharifi Dehsari, Hamed; Anwar, Saleem; Asadi, Kamal


    Organic bistable diodes based on phase-separated blends of ferroelectric and semiconducting polymers have emerged as promising candidates for non-volatile information storage for low-cost solution processable electronics. One of the bottlenecks impeding upscaling is stability and reliable operation of the array in air. Here, we present a memory array fabricated with an air-stable amine-based semiconducting polymer. Memory diode fabrication and full electrical characterizations were carried out in atmospheric conditions (23 °C and 45% relative humidity). The memory diodes showed on/off ratios greater than 100 and further exhibited robust and stable performance upon continuous write-read-erase-read cycles. Moreover, we demonstrate a 4-bit memory array that is free from cross-talk with a shelf-life of several months. Demonstration of the stability and reliable air operation further strengthens the feasibility of the resistance switching in ferroelectric memory diodes for low-cost applications.

  19. Exchange bias and bistable magneto-resistance states in amorphous TbFeCo thin films

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiaopu, E-mail:; Ma, Chung T.; Poon, S. Joseph, E-mail: [Department of Physics, University of Virginia, Charlottesville, Virginia 22904 (United States); Lu, Jiwei [Department of Materials Science and Engineering, University of Virginia, Charlottesville, Virginia 22904 (United States); Devaraj, Arun [Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States); Spurgeon, Steven R.; Comes, Ryan B. [Physical and Computational Sciences Directorate, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)


    Amorphous TbFeCo thin films sputter deposited at room temperature on thermally oxidized Si substrate are found to exhibit strong perpendicular magnetic anisotropy. Atom probe tomography, scanning transmission electron microscopy, and energy dispersive X-ray spectroscopy mapping have revealed two nanoscale amorphous phases with different Tb atomic percentages distributed within the amorphous film. Exchange bias accompanied by bistable magneto-resistance states has been uncovered near room temperature by magnetization and magneto-transport measurements. The exchange anisotropy originates from the exchange interaction between the ferrimagnetic and ferromagnetic components corresponding to the two amorphous phases. This study provides a platform for exchange bias and magneto-resistance switching using single-layer amorphous ferrimagnetic thin films that require no epitaxial growth.

  20. Order reconstruction phenomena and temperature-driven dynamics in a 3D zenithally bistable device

    KAUST Repository

    Raisch, A.


    We model the zenithally bistable device (ZBD) in three dimensions (3D), within the Landau-de Gennes theory, and find three stable static states in 3D without an applied field: the vertically aligned nematic (VAN) state, the hybrid aligned nematic (HAN) state and a third, high-tilt state, which we call the THAN state, with an interior and a surface defect. We recover the order reconstruction (OR) phenomenon around the defects in the HAN and THAN states and the 3D THAN and HAN solutions exhibit stable biaxial cylinders connecting defects on opposite faces of the ZBD device. We demonstrate a two-way temperature-driven switching between high-tilt and low-tilt states through controlled heating and cooling procedures in two dimensions (2D), with no applied fields. © CopyrightEPLA, 2014.

  1. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail:, E-mail: [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)


    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  2. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma


    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  3. Bistable energy harvesting enhancement with an auxiliary linear oscillator (United States)

    Harne, R. L.; Thota, M.; Wang, K. W.


    Recent work has indicated that linear vibrational energy harvesters with an appended degree-of-freedom (DOF) may be advantageous for introducing new dynamic forms to extend the operational bandwidth. Given the additional interest in bistable harvester designs, which exhibit a propitious snap through effect from one stable state to the other, it is a logical extension to explore the influence of an added DOF to a bistable system. However, bistable snap through is not a resonant phenomenon, which tempers the presumption that the dynamics induced by an additional DOF on bistable designs would inherently be beneficial as for linear systems. This paper presents two analytical formulations to assess the fundamental and superharmonic steady-state dynamics of an excited bistable energy harvester to which is attached an auxiliary linear oscillator. From an energy harvesting perspective, the model predicts that the additional linear DOF uniformly amplifies the bistable harvester response magnitude and generated power for excitation frequencies less than the attachment’s resonance while improved power density spans a bandwidth below this frequency. Analyses predict bandwidths having co-existent responses composed of a unique proportion of fundamental and superharmonic dynamics. Experiments validate key analytical predictions and observe the ability for the coupled system to develop an advantageous multi-harmonic interwell response when the initial conditions are insufficient for continuous high-energy orbit at the excitation frequency. Overall, the addition of an auxiliary linear oscillator to a bistable harvester is found to be an effective means of enhancing the energy harvesting performance and robustness.

  4. Interaction of bistable glass-coated microwires in different positional relationship

    Energy Technology Data Exchange (ETDEWEB)

    Rodionova, V., E-mail: [Magnetism Department, Faculty of Physics, M.V. Lomonosov Moscow State University, 119991 Moscow (Russian Federation); Immanuel Kant Baltic Federal University, 236041 Kaliningrad (Russian Federation); Kudinov, N. [Magnetism Department, Faculty of Physics, M.V. Lomonosov Moscow State University, 119991 Moscow (Russian Federation); Zhukov, A. [Departamento Fisica de Materiales, Facultad Quimicas, UPV/EHU, 20018 San Sebastian (Spain); IKERBASQUE, Basque Foundation for Science, 48011 Bilbao (Spain); Perov, N. [Magnetism Department, Faculty of Physics, M.V. Lomonosov Moscow State University, 119991 Moscow (Russian Federation)


    The amorphous ferromagnetic glass-coated microwires with positive magnetostriction constant of the metallic core possess the bistable magnetization reversal and the fast domain wall propagation along the microwire axis. These properties and also the magnetization processes in the systems of the microwires are of interest in the magnetic sensing technology, encoding systems and smart composite applications. In this work we present the results of the experimental investigation, simulations and theoretical estimations of the hysteresis process in the systems of the magnetically bistable microwires with different length and positional relationship between them. The location of the short microwires near the long microwire affects the switching fields (external coaxial magnetic field applied for starting of the domain wall propagation along the microwire axis) and the hysteresis process. The changes of these properties are not directly proportional to the value of the shorter microwire shift along the longer one. When the short microwire was placed in the middle of the long one and when the one end of the long microwire coincided with the end of the short one, the two-steps hysteresis loops were observed for both sample orientations: before and after sample rotation on 180 Degree-Sign . When the short microwire was placed close to the end of the long microwire (but did not coincide with it) we observed at first the two-steps hysteresis loop and single step behavior for one branch of the hysteresis loop after sample rotation. Moreover, changing of the orientation of the samples results in the shift of the switching field of the shorter microwire when its end was located near the end or coincided with the end of the longer one. This uncommon hysteresis behavior was explained and illustrated using results of the simulations. The values of microwires interaction were also estimated.

  5. Interaction of bistable glass-coated microwires in different positional relationship

    International Nuclear Information System (INIS)

    Rodionova, V.; Kudinov, N.; Zhukov, A.; Perov, N.


    The amorphous ferromagnetic glass-coated microwires with positive magnetostriction constant of the metallic core possess the bistable magnetization reversal and the fast domain wall propagation along the microwire axis. These properties and also the magnetization processes in the systems of the microwires are of interest in the magnetic sensing technology, encoding systems and smart composite applications. In this work we present the results of the experimental investigation, simulations and theoretical estimations of the hysteresis process in the systems of the magnetically bistable microwires with different length and positional relationship between them. The location of the short microwires near the long microwire affects the switching fields (external coaxial magnetic field applied for starting of the domain wall propagation along the microwire axis) and the hysteresis process. The changes of these properties are not directly proportional to the value of the shorter microwire shift along the longer one. When the short microwire was placed in the middle of the long one and when the one end of the long microwire coincided with the end of the short one, the two-steps hysteresis loops were observed for both sample orientations: before and after sample rotation on 180°. When the short microwire was placed close to the end of the long microwire (but did not coincide with it) we observed at first the two-steps hysteresis loop and single step behavior for one branch of the hysteresis loop after sample rotation. Moreover, changing of the orientation of the samples results in the shift of the switching field of the shorter microwire when its end was located near the end or coincided with the end of the longer one. This uncommon hysteresis behavior was explained and illustrated using results of the simulations. The values of microwires interaction were also estimated.

  6. Pivotal role of hMT+ in long-range disambiguation of interhemispheric bistable surface motion. (United States)

    Duarte, João Valente; Costa, Gabriel Nascimento; Martins, Ricardo; Castelo-Branco, Miguel


    It remains an open question whether long-range disambiguation of ambiguous surface motion can be achieved in early visual cortex or instead in higher level regions, which concerns object/surface segmentation/integration mechanisms. We used a bistable moving stimulus that can be perceived as a pattern comprehending both visual hemi-fields moving coherently downward or as two widely segregated nonoverlapping component objects (in each visual hemi-field) moving separately inward. This paradigm requires long-range integration across the vertical meridian leading to interhemispheric binding. Our fMRI study (n = 30) revealed a close relation between activity in hMT+ and perceptual switches involving interhemispheric segregation/integration of motion signals, crucially under nonlocal conditions where components do not overlap and belong to distinct hemispheres. Higher signal changes were found in hMT+ in response to spatially segregated component (incoherent) percepts than to pattern (coherent) percepts. This did not occur in early visual cortex, unlike apparent motion, which does not entail surface segmentation. We also identified a role for top-down mechanisms in state transitions. Deconvolution analysis of switch-related changes revealed prefrontal, insula, and cingulate areas, with the right superior parietal lobule (SPL) being particularly involved. We observed that directed influences could emerge either from left or right hMT+ during bistable motion integration/segregation. SPL also exhibited significant directed functional connectivity with hMT+, during perceptual state maintenance (Granger causality analysis). Our results suggest that long-range interhemispheric binding of ambiguous motion representations mainly reflect bottom-up processes from hMT+ during perceptual state maintenance. In contrast, state transitions maybe influenced by high-level regions such as the SPL. Hum Brain Mapp 38:4882-4897, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley

  7. Key Players in the Genetic Switch of Bacteriophage TP901-1

    DEFF Research Database (Denmark)

    Alsing, Anne; Pedersen, Margit; Sneppen, Kim


    the bistable genetic switch of bacteriophage TP901-1 through experiments and statistical mechanical modeling. We examine the activity of the lysogenic promoter Pr at different concentrations of the phage repressor, CI, and compare the effect of CI on Pr in the presence or absence of the phage-encoded MOR...

  8. Bistable behaviour of biexciton population in a dense exciton-biexciton system in semiconductors

    International Nuclear Information System (INIS)

    Nguyen Ba An.


    The steady state bistable behaviour of biexciton population in a dense exciton-biexciton semiconductor is considered. The intrinsic optical feedback is provided by the recombination mechanism. The exciton-biexciton and biexciton-biexciton interactions play the role of non-linearity responsible for biexciton bistability to occur. The conditions leading to the effect of bistability are obtained and two-parameter phase transition diagrams are drawn for both intensity and frequency bistable phenomena. (author)

  9. Optical bistability induced by quantum coherence in a negative index atomic medium

    International Nuclear Information System (INIS)

    Zhang Hong-Jun; Sun Hui; Li Jin-Ping; Yin Bao-Yin; Guo Hong-Ju


    Bistability behaviors in an optical ring cavity filled with a dense V-type four-level atomic medium are theoretically investigated. It is found that the optical bistability can appear in the negative refraction frequency band, while both the bistability and multi-stability can occur in the positive refraction frequency bands. Therefore, optical bistability can be realized from conventional material to negative index material due to quantum coherence in our scheme. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

  10. Evaluation of bistable systems versus matched filters in detecting bipolar pulse signals


    Duan, Fabing; Abbott, Derek; Gao, Qisheng


    This paper presents a thorough evaluation of a bistable system versus a matched filter in detecting bipolar pulse signals. The detectability of the bistable system can be optimized by adding noise, i.e. the stochastic resonance (SR) phenomenon. This SR effect is also demonstrated by approximate statistical detection theory of the bistable system and corresponding numerical simulations. Furthermore, the performance comparison results between the bistable system and the matched filter show that...

  11. Negative differential electrolyte resistance in a solid-state nanopore resulting from electroosmotic flow bistability. (United States)

    Luo, Long; Holden, Deric A; White, Henry S


    A solid-state nanopore separating two aqueous solutions containing different concentrations of KCl is demonstrated to exhibit negative differential resistance (NDR) when a constant pressure is applied across the nanopore. NDR refers to a decrease in electrical current when the voltage applied across the nanopore is increased. NDR results from the interdependence of solution flow (electroosmotic and pressure-engendered) with the distributions of K+ and Cl- within the nanopore. A switch from a high-conductivity state to a low-conductivity state occurs over a very narrow voltage window (flow, yielding a true bistability in fluid flow and electrical current at a critical applied voltage, i.e., the NDR "switching potential". Solution pH and Ca2+ were separately employed as chemical stimuli to investigate the dependence of the NDR on the surface charge density. The NDR switching potential is remarkably sensitive to the surface charge density, and thus to pH and the presence of Ca2+, suggesting possible applications in chemical sensing.

  12. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.


    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  13. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P


    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  14. Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.


    Stewart, V; Yanofsky, C


    We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

  15. Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

    NARCIS (Netherlands)

    Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena


    Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

  16. Quinonoid metal complexes: toward molecular switches. (United States)

    Dei, Andrea; Gatteschi, Dante; Sangregorio, Claudio; Sorace, Lorenzo


    The peculiar redox-active character of quinonoid metal complexes makes them extremely appealing to design materials of potential technological interest. We show here how the tuning of the properties of these systems can be pursued by using appropriate molecular synthetic techniques. In particular, we focus our attention on metal polyoxolene complexes exhibiting intramolecular electron transfer processes involving either the ligand and the metal ion or the two dioxolene moieties of a properly designed ligand thus inducing electronic bistability. The transition between the two metastable electronic states can be induced by different external stimuli such as temperature, pressure, light, or pH suggesting the use of these systems for molecular switches.

  17. Bistability of mangrove forests and competition with freshwater plants (United States)

    Jiang, Jiang; Fuller, Douglas O; Teh, Su Yean; Zhai, Lu; Koh, Hock Lye; DeAngelis, Donald L.; Sternberg, L.D.S.L.


    Halophytic communities such as mangrove forests and buttonwood hammocks tend to border freshwater plant communities as sharp ecotones. Most studies attribute this purely to underlying physical templates, such as groundwater salinity gradients caused by tidal flux and topography. However, a few recent studies hypothesize that self-reinforcing feedback between vegetation and vadose zone salinity are also involved and create a bistable situation in which either halophytic dominated habitat or freshwater plant communities may dominate as alternative stable states. Here, we revisit the bistability hypothesis and demonstrate the mechanisms that result in bistability. We demonstrate with remote sensing imagery the sharp boundaries between freshwater hardwood hammock communities in southern Florida and halophytic communities such as buttonwood hammocks and mangroves. We further document from the literature how transpiration of mangroves and freshwater plants respond differently to vadose zone salinity, thus altering the salinity through feedback. Using mathematical models, we show how the self-reinforcing feedback, together with physical template, controls the ecotones between halophytic and freshwater communities. Regions of bistability along environmental gradients of salinity have the potential for large-scale vegetation shifts following pulse disturbances such as hurricane tidal surges in Florida, or tsunamis in other regions. The size of the region of bistability can be large for low-lying coastal habitat due to the saline water table, which extends inland due to salinity intrusion. We suggest coupling ecological and hydrologic processes as a framework for future studies.

  18. Fundamental role of bistability in optimal homeostatic control (United States)

    Wang, Guanyu


    Bistability is a fundamental phenomenon in nature and has a number of fine properties. However, these properties are consequences of bistability at the physiological level, which do not explain why it had to emerge during evolution. Using optimal homeostasis as the first principle and Pontryagin's Maximum Principle as the optimization approach, I find that bistability emerges as an indispensable control mechanism. Because the mathematical model is general and the result is independent of parameters, it is likely that most biological systems use bistability to control homeostasis. Glucose homeostasis represents a good example. It turns out that bistability is the only solution to a dilemma in glucose homeostasis: high insulin efficiency is required for rapid plasma glucose clearance, whereas an insulin sparing state is required to guarantee the brain's safety during fasting. This new perspective can illuminate studies on the twin epidemics of obesity and diabetes and the corresponding intervening strategies. For example, overnutrition and sedentary lifestyle may represent sudden environmental changes that cause the lose of optimality, which may contribute to the marked rise of obesity and diabetes in our generation.

  19. Dynamic control of a bistable wing under aerodynamic loading

    International Nuclear Information System (INIS)

    Bilgen, Onur; Arrieta, Andres F; Friswell, Michael I; Hagedorn, Peter


    The aerodynamic evaluation of a dynamic control technique applied to a bistable unsymmetrical cross-ply composite plate with surface bonded piezoelectric actuators is presented. The plate is clamped on one end to form a low-aspect-ratio wing. A previously proposed dynamic control method, utilizing bending resonance in different stable equilibrium positions, is used to induce snap-through between the two equilibrium states. Compared to quasi-static actuation, driving the bistable plate near resonance using surface bonded piezoelectric materials requires, theoretically, a lower peak excitation voltage to achieve snap-through. First, a set of extensive wind tunnel experiments are conducted on the passive bistable wing to understand the change in the dynamic behavior under various aerodynamic conditions. The passive wing demonstrated sufficient bending stiffness to sustain its shape under aerodynamic loading while preserving the desired bistable behavior. Next, by the use of the resonant control technique, the plate is turned into an effectively monostable structure, or alternatively, both stable equilibrium positions can be reached actively from the other stable equilibrium. Dynamic forward and reverse snap-through is demonstrated in the wind tunnel which shows both the effectiveness of the piezoelectric actuation as well as the load carrying capability of both states of the bistable wing. (paper)

  20. Oscillations in the bistable regime of neuronal networks. (United States)

    Roxin, Alex; Compte, Albert


    Bistability between attracting fixed points in neuronal networks has been hypothesized to underlie persistent activity observed in several cortical areas during working memory tasks. In network models this kind of bistability arises due to strong recurrent excitation, sufficient to generate a state of high activity created in a saddle-node (SN) bifurcation. On the other hand, canonical network models of excitatory and inhibitory neurons (E-I networks) robustly produce oscillatory states via a Hopf (H) bifurcation due to the E-I loop. This mechanism for generating oscillations has been invoked to explain the emergence of brain rhythms in the β to γ bands. Although both bistability and oscillatory activity have been intensively studied in network models, there has not been much focus on the coincidence of the two. Here we show that when oscillations emerge in E-I networks in the bistable regime, their phenomenology can be explained to a large extent by considering coincident SN and H bifurcations, known as a codimension two Takens-Bogdanov bifurcation. In particular, we find that such oscillations are not composed of a stable limit cycle, but rather are due to noise-driven oscillatory fluctuations. Furthermore, oscillations in the bistable regime can, in principle, have arbitrarily low frequency.

  1. Non-resonant energy harvesting via an adaptive bistable potential

    International Nuclear Information System (INIS)

    Hosseinloo, Ashkan Haji; Turitsyn, Konstantin


    Narrow bandwidth and easy detuning, inefficiency in broadband and non-stationary excitations, and difficulties in matching a linear harvester’s resonance frequency to low-frequency excitations at small scales, have convinced researchers to investigate nonlinear, and in particular bistable, energy harvesters in recent years. However, bistable harvesters suffer from co-existing low and high energy orbits, and sensitivity to initial conditions, and have recently been proven inefficient when subjected to many real-world random and non-stationary excitations. Here, we propose a novel non-resonant buy-low-sell-high strategy that can significantly improve the harvester’s effectiveness at low frequencies in a much more robust fashion. This strategy could be realized by a passive adaptive bistable system. Simulation results confirm the high effectiveness of the adaptive bistable system following a buy-low-sell-high logic when subjected to harmonic and random non-stationary walking excitations compared to its conventional bistable and linear counterparts. (paper)

  2. Chaos in a new bistable rotating electromechanical system

    International Nuclear Information System (INIS)

    Tsapla Fotsa, R.; Woafo, P.


    Highlights: • A new electromechanical system with rotating arm and bistable potential energy is studied. • The bistability is generated by the interaction of three permanent magnets, one fixed at the end of the arm and two other fixed at equal distance relative to the central position of the arm. • It exhibits dissipative and Hamiltonian chaos. • Such a bistable electromechanical system can be used as the actuation part of chaotic sieves and mixers. - Abstract: A device consisting of an induction motor activating a rotating rigid arm is designed and comprises a bistable potential due to the presence of three permanent magnets. Its mathematical equations are established and the numerical results both in the absence and in the presence of magnets are compared. The generation of chaotic behavior is achieved using two different external excitations: sinewave and square wave. In the presence of magnets, the system presents periodic and dissipative chaotic dynamics. Approximating the global potential energy to a bistable quartic potential, the Melnikov method is used to derive the conditions for the appearance of Hamiltonian chaos. Such a device can be used for industrial and domestic applications for mixing and sieving activities.

  3. Frontoparietal cortex mediates perceptual transitions in bistable perception. (United States)

    Weilnhammer, Veith A; Ludwig, Karin; Hesselmann, Guido; Sterzer, Philipp


    During bistable vision, perception oscillates between two mutually exclusive percepts despite constant sensory input. Greater BOLD responses in frontoparietal cortex have been shown to be associated with endogenous perceptual transitions compared with "replay" transitions designed to closely match bistability in both perceptual quality and timing. It has remained controversial, however, whether this enhanced activity reflects causal influences of these regions on processing at the sensory level or, alternatively, an effect of stimulus differences that result in, for example, longer durations of perceptual transitions in bistable perception compared with replay conditions. Using a rotating Lissajous figure in an fMRI experiment on 15 human participants, we controlled for potential confounds of differences in transition duration and confirmed previous findings of greater activity in frontoparietal areas for transitions during bistable perception. In addition, we applied dynamic causal modeling to identify the neural model that best explains the observed BOLD signals in terms of effective connectivity. We found that enhanced activity for perceptual transitions is associated with a modulation of top-down connectivity from frontal to visual cortex, thus arguing for a crucial role of frontoparietal cortex in perceptual transitions during bistable perception.

  4. Numerical and experimental study of bistable plates for morphing structures (United States)

    Nicassio, F.; Scarselli, G.; Avanzini, G.; Del Core, G.


    This study is concerned with the activation energy threshold of bistable composite plates in order to tailor a bistable system for specific aeronautical applications. The aim is to explore potential configurations of the bistable plates and their dynamic behavior for designing novel morphing structure suitable for aerodynamic surfaces and, as a possible further application, for power harvesters. Bistable laminates have two stable mechanical shapes that can withstand aerodynamic loads without additional constraint forces or locking mechanisms. This kind of structures, when properly loaded, snap-through from one stable configuration to another, causing large strains that can also be used for power harvesting scopes. The transition between the stable states of the composite laminate can be triggered, in principle, simply by aerodynamic loads (pilot, disturbance or passive inputs) without the need of servo-activated control systems. Both numerical simulations based on Finite Element models and experimental testing based on different activating forcing spectra are used to validate this concept. The results show that dynamic activation of bistable plates depend on different parameters that need to be carefully managed for their use as aircraft passive wing flaps.

  5. A bistable mechanism for chord extension morphing rotors (United States)

    Johnson, Terrence; Frecker, Mary; Gandhi, Farhan


    Research efforts have shown that helicopter rotor blade morphing is an effective means to improve flight performance. Previous example of rotor blade morphing include using smart-materials for trailing deflection and rotor blade twist and tip twist, the development of a comfortable airfoil using compliant mechanisms, the use of a Gurney flap for air-flow deflection and centrifugal force actuated device to increase the span of the blade. In this paper we explore the use of a bistable mechanism for rotor morphing, specifically, blade chord extension using a bistable arc. Increasing the chord of the rotor blade is expected to generate more lift-load and improve helicopter performance. Bistable or "snap through" mechanisms have multiple stable equilibrium states and are a novel way to achieve large actuation output stroke. Bistable mechanisms do not require energy input to maintain a stable equilibrium state as both states do not require locking. In this work, we introduce a methodology for the design of bistable arcs for chord morphing using the finite element analysis and pseudo-rigid body model, to study the effect of different arc types, applied loads and rigidity on arc performance.

  6. Sequence analysis of the Legionella micdadei groELS operon

    DEFF Research Database (Denmark)

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie


    shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

  7. Rapid customised operon assembly by yeast recombinational cloning. (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R


    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  8. Eucaryotic operon genes can define highly conserved syntenies

    Czech Academy of Sciences Publication Activity Database

    Trachtulec, Zdeněk


    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  9. The derivation of a bistable criterion for double V-beam mechanisms

    International Nuclear Information System (INIS)

    Wu, Cho-Chun; Chen, Rongshun; Lin, Meng-Ju


    This study presents the theoretical derivation of the discriminant D as a structural and material criterion for determining whether bistability can occur in micromechanically bistable mechanisms. When D < 0, the mechanism displays bistable behavior if an appropriate force is applied to push the bistable mechanism, whereas when D > 0, bistable behavior cannot occur. The proposed V-beam bistable mechanism was successfully fabricated with various beam lengths and tilted angles. The experiments conducted in this study validated the theoretical study of bistability. A comparison of the theoretical solutions and experimental results shows good agreement. Results further show that to design a bistable V-beam mechanism, the tilted angle should be larger for the same beam length, whereas the beam length should be longer for the same tilted angle. The developed discriminant D can be used to predict if a bistable mechanism can achieve bistable behavior based on structural sizes and material properties. Consequently, researchers can reduce trial-and-error experiments when designing a bistable mechanism. A V-beam with a larger tilted angle of up to 5° was successfully fabricated to act as a bistable mechanism, compared to a 3.5° tilted angle in existing studies. Consequently, the proposed method has the advantages of shorter beam lengths and smaller device areas. (paper)

  10. Noise-induced polarization switching in complex networks (United States)

    Haerter, Jan O.; Díaz-Guilera, Albert; Serrano, M. Ángeles


    The combination of bistability and noise is ubiquitous in complex systems, from biology to social interactions, and has important implications for their functioning and resilience. Here we use a simple three-state dynamical process, in which nodes go from one pole to another through an intermediate state, to show that noise can induce polarization switching in bistable systems if dynamical correlations are significant. In large, fully connected networks, where dynamical correlations can be neglected, increasing noise yields a collapse of bistability to an unpolarized configuration where the three possible states of the nodes are equally likely. In contrast, increased noise induces abrupt and irreversible polarization switching in sparsely connected networks. In multiplexes, where each layer can have a different polarization tendency, one layer is dominant and progressively imposes its polarization state on the other, offsetting or promoting the ability of noise to switch its polarization. Overall, we show that the interplay of noise and dynamical correlations can yield discontinuous transitions between extremes, which cannot be explained by a simple mean-field description.

  11. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases. (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh


    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  12. Optical Bistability in Graded Core-Shell Granular Composites

    International Nuclear Information System (INIS)

    Wu Ya-Min; Chen Guo-Qing; Xue Si-Zhong; Zhu Zhuo-Wei; Ma Chao-Qun


    The intrinsic optical bistability (OB) of graded core-shell granular composites is investigated. The coated particles are made of cores with gradient dielectric function in c (r) = A(r/a) k and nonlinear shells. In view of the exponential distribution of the core dielectric constant, the potential functions of each region are obtained by solving the Maxwell equations, and the mathematical expressions of electric field in the shells and cores are determined. Numerical study reveals that the optical bistable threshold and the threshold width of the composite medium are dependent on the shell thickness, core dielectric exponent, and power function coefficient. The optical bistable width increases with the decreasing shell thickness and the power exponent and with the increasing power function coefficient

  13. Exciter switch (United States)

    Mcpeak, W. L.


    A new exciter switch assembly has been installed at the three DSN 64-m deep space stations. This assembly provides for switching Block III and Block IV exciters to either the high-power or 20-kW transmitters in either dual-carrier or single-carrier mode. In the dual-carrier mode, it provides for balancing the two drive signals from a single control panel located in the transmitter local control and remote control consoles. In addition to the improved switching capabilities, extensive monitoring of both the exciter switch assembly and Transmitter Subsystem is provided by the exciter switch monitor and display assemblies.

  14. Excitonic bistabilities, instabilities and chaos in laser-pumped semiconductor

    International Nuclear Information System (INIS)

    Nguyen Ba An; Nguyen Trung Dan; Hoang Xuan Nguyen


    The Hurwitz criteria are used for a stability analysis of the steady state excitonic optical bistability curves in a semiconductor pumped by an external laser resonant with the exciton level. Besides the middle branch of the bistability curves which is unstable in the sense of the linear stability theory, we have found other domains of instability in the upper and lower branches of the steady state curves. Numerical results show that a possible route to chaos in the photon-exciton system is period-doubling self-oscillation process. The influence of the presence of free carriers that coexist with the excitons is also discussed. (author). 16 refs, 6 figs

  15. An Optically Driven Bistable Janus Rotor with Patterned Metal Coatings. (United States)

    Zong, Yiwu; Liu, Jing; Liu, Rui; Guo, Honglian; Yang, Mingcheng; Li, Zhiyuan; Chen, Ke


    Bistable rotation is realized for a gold-coated Janus colloidal particle in an infrared optical trap. The metal coating on the Janus particles are patterned by sputtering gold on a monolayer of closely packed polystyrene particles. The Janus particle is observed to stably rotate in an optical trap. Both the direction and the rate of rotation can be experimentally controlled. Numerical calculations reveal that the bistable rotation is the result of spontaneous symmetry breaking induced by the uneven curvature of the coating patterns on the Janus sphere. Our results thus provide a simple method to construct large quantities of fully functional rotary motors for nano- or microdevices.

  16. Excitonic optical bistability in n-type doped semiconductors

    International Nuclear Information System (INIS)

    Nguyen Ba An; Le Thi Cat Tuong


    A resonant monochromatic pump laser generates coherent excitons in an n-type doped semiconductor. Both exciton-exciton and exciton-donor interactions come into play. The former interaction can give rise to the appearance of optical bistability which is heavily influenced by the latter one. When optical bistability occurs at a fixed laser frequency both its holding intensity and hysteresis loop size are shown to decrease with increasing donor concentration. Two possibilities are suggested for experimentally determining one of the two parameters of the system - the exciton-donor coupling constant and the donor concentration, if the other parameter is known beforehand. (author). 36 refs, 2 figs

  17. The Necker-Zeno model for bistable perception. (United States)

    Atmanspacher, Harald; Filk, Thomas


    A novel conceptual framework for theoretical psychology is presented and illustrated for the example of bistable perception. A basic formal feature of this framework is the non-commutativity of operations acting on mental states. A corresponding model for the bistable perception of ambiguous stimuli, the Necker-Zeno model, is sketched and some empirical evidence for it so far is described. It is discussed how a temporal non-locality of mental states, predicted by the model, can be understood and tested. © 2013 Cognitive Science Society, Inc.


    International Nuclear Information System (INIS)

    Gazol, Adriana; Kim, Jongsoo


    We numerically study the volume density probability distribution function (n-PDF) and the column density probability distribution function (Σ-PDF) resulting from thermally bistable turbulent flows. We analyze three-dimensional hydrodynamic models in periodic boxes of 100 pc by side, where turbulence is driven in the Fourier space at a wavenumber corresponding to 50 pc. At low densities (n ∼ –3 ), the n-PDF is well described by a lognormal distribution for an average local Mach number ranging from ∼0.2 to ∼5.5. As a consequence of the nonlinear development of thermal instability (TI), the logarithmic variance of the distribution of the diffuse gas increases with M faster than in the well-known isothermal case. The average local Mach number for the dense gas (n ∼> 7.1 cm –3 ) goes from ∼1.1 to ∼16.9 and the shape of the high-density zone of the n-PDF changes from a power law at low Mach numbers to a lognormal at high M values. In the latter case, the width of the distribution is smaller than in the isothermal case and grows slower with M. At high column densities, the Σ-PDF is well described by a lognormal for all of the Mach numbers we consider and, due to the presence of TI, the width of the distribution is systematically larger than in the isothermal case but follows a qualitatively similar behavior as M increases. Although a relationship between the width of the distribution and M can be found for each one of the cases mentioned above, these relations are different from those of the isothermal case.

  19. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae. (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P


    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  20. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef


    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  1. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions. (United States)

    Burbank, Lindsey P; Van Horn, Christopher R


    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  2. Electrical bistabilities and memory stabilities of nonvolatile bistable devices fabricated utilizing C60 molecules embedded in a polymethyl methacrylate layer

    International Nuclear Information System (INIS)

    Cho, Sung Hwan; Lee, Dong Ik; Jung, Jae Hun; Kim, Tae Whan


    Current-voltage (I-V) measurements on Al/fullerene (C 60 ) molecules embedded in polymethyl methacrylate/Al devices at 300 K showed a current bistability due to the existence of the C 60 molecules. The on/off ratio of the current bistability for the memory devices was as large as 10 3 . The retention time of the devices was above 2.5 x 10 4 s at room temperature, and cycling endurance tests on these devices indicated that the ON and OFF currents showed no degradation until 50 000 cycles. Carrier transport mechanisms for the nonvolatile bistable devices are described on the basis of the I-V experimental and fitting results.

  3. Alpha Power Predicts Persistence of Bistable Perception

    NARCIS (Netherlands)

    Piantoni, Giovanni; Romeijn, Nico; Gomez-Herrero, German; Van Der Werf, Ysbrand D; Van Someren, Eus J W


    Perception is strongly affected by the intrinsic state of the brain, which controls the propensity to either maintain a particular perceptual interpretation or switch to another. To understand the mechanisms underlying the spontaneous drive of the brain to explore alternative interpretations of

  4. Active Molecular Plasmonics: Controlling Plasmon Resonances with Molecular Switches

    KAUST Repository

    Zheng, Yue Bing


    A gold nanodisk array, coated with bistable, redox-controllable [2]rotaxane molecules, when exposed to chemical oxidants and reductants, undergoes switching of its plasmonic properties reversibly. By contrast, (i) bare gold nanodisks and (ii) disks coated with a redox-active, but mechanically inert, control compound do not display surface-plasmon-based switching. Along with calculations based on time-dependent density functional theory, these experimental observations suggest that the nanoscale movements within surface-bound “molecular machines” can be used as the active components in plasmonic devices.

  5. Active Molecular Plasmonics: Controlling Plasmon Resonances with Molecular Switches

    KAUST Repository

    Zheng, Yue Bing; Yang, Ying-Wei; Jensen, Lasse; Fang, Lei; Juluri, Bala Krishna; Flood, Amar H.; Weiss, Paul S.; Stoddart, J. Fraser; Huang, Tony Jun


    A gold nanodisk array, coated with bistable, redox-controllable [2]rotaxane molecules, when exposed to chemical oxidants and reductants, undergoes switching of its plasmonic properties reversibly. By contrast, (i) bare gold nanodisks and (ii) disks coated with a redox-active, but mechanically inert, control compound do not display surface-plasmon-based switching. Along with calculations based on time-dependent density functional theory, these experimental observations suggest that the nanoscale movements within surface-bound “molecular machines” can be used as the active components in plasmonic devices.

  6. Bistable flow spectral analysis. Repercussions on jet pumps

    International Nuclear Information System (INIS)

    Gavilan Moreno, C.J.


    Highlights: → The most important thing in this paper, is the spectral characterization of the bistable flow in a Nuclear Power Plant. → This paper goes deeper in the effect of the bistable flow over the jet pump and the induced vibrations. → The jet pump frequencies are very close to natural jet pump frequencies, in the 3rd and 6th mode. - Abstract: There have been many attempts at characterizing and predicting bistable flow in boiling water reactors (BWRs). Nevertheless, in most cases the results have only managed to develop models that analytically reproduce the phenomenon (). Modeling has been forensic in all cases, while the capacity of the model focus on determining the exclusion areas on the recirculation flow map. The bistability process is known by its effects given there is no clear definition of its causal process. In the 1980s, Hitachi technicians () managed to reproduce bistable flow in the laboratory by means of pipe geometry, similar to that which is found in recirculation loops. The result was that the low flow pattern is formed by the appearance of a quasi stationary, helicoidal vortex in the recirculation collector's branches. This vortex creates greater frictional losses than regions without vortices, at the same discharge pressure. Neither the behavior nor the dynamics of these vortices were characterized in this paper. The aim of this paper is to characterize these vortices in such a way as to enable them to provide their own frequencies and their later effect on the jet pumps. The methodology used in this study is similar to the one used previously when analyzing the bistable flow in tube arrays with cross flow (). The method employed makes use of the power spectral density function. What differs is the field of application. We will analyze a Loop B with a bistable flow and compare the high and low flow situations. The same analysis will also be carried out on the loop that has not developed the bistable flow (Loop A) at the same moments

  7. Two optical bistability domains in composites of metal nanoparticles with nonlinear dielectric core

    Energy Technology Data Exchange (ETDEWEB)

    Shewamare, Sisay, E-mail: [Department of Physics, Addis Ababa University, P.O. Box 1176, Addis Ababa (Ethiopia); Mal' nev, V.N., E-mail: [Department of Physics, Addis Ababa University, P.O. Box 1176, Addis Ababa (Ethiopia)


    It is shown that the local field in metal spherical particles with a dielectric core in an external varying electric field has two maxima at two different frequencies. The second maximum becomes more important with an increment in the metal fraction. Due to the nonlinear dielectric function of the core, the composite of these inclusions may have two optically induced bistability domains at different frequencies. At rather high metal fraction, two bistability domains merge and form one entire bistability domain. The parameters of these domains are studied numerically. The paper focuses on the second bistability domain, which has not been discussed in the literature so far. This domain exists in a comparatively narrow frequency range and its onset fields are lower than those of the first bistability domain. The lowest bistability onset fields are obtained in the entire domain. This peculiarity of the optical induced bistability in the metal composite with small dielectric cores can be attractive for possible applications.

  8. Two optical bistability domains in composites of metal nanoparticles with nonlinear dielectric core

    International Nuclear Information System (INIS)

    Shewamare, Sisay; Mal'nev, V.N.


    It is shown that the local field in metal spherical particles with a dielectric core in an external varying electric field has two maxima at two different frequencies. The second maximum becomes more important with an increment in the metal fraction. Due to the nonlinear dielectric function of the core, the composite of these inclusions may have two optically induced bistability domains at different frequencies. At rather high metal fraction, two bistability domains merge and form one entire bistability domain. The parameters of these domains are studied numerically. The paper focuses on the second bistability domain, which has not been discussed in the literature so far. This domain exists in a comparatively narrow frequency range and its onset fields are lower than those of the first bistability domain. The lowest bistability onset fields are obtained in the entire domain. This peculiarity of the optical induced bistability in the metal composite with small dielectric cores can be attractive for possible applications.

  9. Robust network topologies for generating switch-like cellular responses.

    Directory of Open Access Journals (Sweden)

    Najaf A Shah


    Full Text Available Signaling networks that convert graded stimuli into binary, all-or-none cellular responses are critical in processes ranging from cell-cycle control to lineage commitment. To exhaustively enumerate topologies that exhibit this switch-like behavior, we simulated all possible two- and three-component networks on random parameter sets, and assessed the resulting response profiles for both steepness (ultrasensitivity and extent of memory (bistability. Simulations were used to study purely enzymatic networks, purely transcriptional networks, and hybrid enzymatic/transcriptional networks, and the topologies in each class were rank ordered by parametric robustness (i.e., the percentage of applied parameter sets exhibiting ultrasensitivity or bistability. Results reveal that the distribution of network robustness is highly skewed, with the most robust topologies clustering into a small number of motifs. Hybrid networks are the most robust in generating ultrasensitivity (up to 28% and bistability (up to 18%; strikingly, a purely transcriptional framework is the most fragile in generating either ultrasensitive (up to 3% or bistable (up to 1% responses. The disparity in robustness among the network classes is due in part to zero-order ultrasensitivity, an enzyme-specific phenomenon, which repeatedly emerges as a particularly robust mechanism for generating nonlinearity and can act as a building block for switch-like responses. We also highlight experimentally studied examples of topologies enabling switching behavior, in both native and synthetic systems, that rank highly in our simulations. This unbiased approach for identifying topologies capable of a given response may be useful in discovering new natural motifs and in designing robust synthetic gene networks.

  10. EDITORIAL: Molecular switches at surfaces Molecular switches at surfaces (United States)

    Weinelt, Martin; von Oppen, Felix


    electron-vibration coupling in transport through single moleculesKatharina J Franke and Jose Ignacio Pascual Vibrational heating in single-molecule switches: an energy-dependent density-of-states approachT Brumme, R Gutierrez and G Cuniberti Reversible switching of single tin phthalocyanine molecules on the InAs(111)A surfaceC Nacci, K Kanisawa and S Fölsch Tuning the interaction between carbon nanotubes and dipole switches: the influence of the change of the nanotube-spiropyran distanceP Bluemmel, A Setaro, C Maity, S Hecht and S Reich Carbon nanotubes as substrates for molecular spiropyran-based switchesE Malic, A Setaro, P Bluemmel, Carlos F Sanz-Navarro, Pablo Ordejón, S Reich and A Knorr Ultrafast dynamics of dithienylethenes differently linked to the surface of TiO2 nanoparticlesLars Dworak, Marc Zastrow, Gehad Zeyat, Karola Rück-Braun and Josef Wachtveitl Switching the electronic properties of Co-octaethylporphyrin molecules on oxygen-covered Ni films by NO adsorptionC F Hermanns, M Bernien, A Krüger, J Miguel and W Kuch STM-switching of organic molecules on semiconductor surfaces: an above threshold density matrix model for 1,5 cyclooctadiene on Si(100)K Zenichowski, Ch Nacci, S Fölsch, J Dokić, T Klamroth and P Saalfrank A switch based on self-assembled thymineFatih Kalkan, Michael Mehlhorn and Karina Morgenstern The growth and electronic structure of azobenzene-based functional molecules on layered crystalsJ Iwicki, E Ludwig, J Buck, M Kalläne, F Köhler, R Herges, L Kipp and K Rossnagel Voltage-dependent conductance states of a single-molecule junctionY F Wang, N Néel, J Kröger, H Vázquez, M Brandbyge, B Wang and R Berndt Molecules with multiple switching units on a Au(111) surface: self-organization and single-molecule manipulationJohannes Mielke, Sofia Selvanathan, Maike Peters, Jutta Schwarz, Stefan Hecht and Leonhard Grill Preparing and regulating a bi-stable molecular switch by atomic manipulationS Sakulsermsuk, R E Palmer and P A Sloan Mixed self

  11. Multistable decision switches for flexible control of epigenetic differentiation.

    Directory of Open Access Journals (Sweden)

    Raúl Guantes


    Full Text Available It is now recognized that molecular circuits with positive feedback can induce two different gene expression states (bistability under the very same cellular conditions. Whether, and how, cells make use of the coexistence of a larger number of stable states (multistability is however largely unknown. Here, we first examine how autoregulation, a common attribute of genetic master regulators, facilitates multistability in two-component circuits. A systematic exploration of these modules' parameter space reveals two classes of molecular switches, involving transitions in bistable (progression switches or multistable (decision switches regimes. We demonstrate the potential of decision switches for multifaceted stimulus processing, including strength, duration, and flexible discrimination. These tasks enhance response specificity, help to store short-term memories of recent signaling events, stabilize transient gene expression, and enable stochastic fate commitment. The relevance of these circuits is further supported by biological data, because we find them in numerous developmental scenarios. Indeed, many of the presented information-processing features of decision switches could ultimately demonstrate a more flexible control of epigenetic differentiation.

  12. Pattern formation in the bistable Gray-Scott model

    DEFF Research Database (Denmark)

    Mazin, W.; Rasmussen, K.E.; Mosekilde, Erik


    The paper presents a computer simulation study of a variety of far-from-equilibrium phenomena that can arise in a bistable chemical reaction-diffusion system which also displays Turing and Hopf instabilities. The Turing bifurcation curve and the wave number for the patterns of maximum linear grow...

  13. Dynamics of a bistable Miura-origami structure (United States)

    Fang, Hongbin; Li, Suyi; Ji, Huimin; Wang, K. W.


    Origami-inspired structures and materials have shown extraordinary properties and performances originating from the intricate geometries of folding. However, current state of the art studies have mostly focused on static and quasistatic characteristics. This research performs a comprehensive experimental and analytical study on the dynamics of origami folding through investigating a stacked Miura-Ori (SMO) structure with intrinsic bistability. We fabricate and experimentally investigated a bistable SMO prototype with rigid facets and flexible crease lines. Under harmonic base excitation, the SMO exhibits both intrawell and interwell oscillations. Spectrum analyses reveal that the dominant nonlinearities of SMO are quadratic and cubic, which generate rich dynamics including subharmonic and chaotic oscillations. The identified nonlinearities indicate that a third-order polynomial can be employed to approximate the measured force-displacement relationship. Such an approximation is validated via numerical study by qualitatively reproducing the phenomena observed in the experiments. The dynamic characteristics of the bistable SMO resemble those of a Helmholtz-Duffing oscillator (HDO); this suggests the possibility of applying the established tools and insights of HDO to predict origami dynamics. We also show that the bistability of SMO can be programmed within a large design space via tailoring the crease stiffness and initial stress-free configurations. The results of this research offer a wealth of fundamental insights into the dynamics of origami folding, and provide a solid foundation for developing foldable and deployable structures and materials with embedded dynamic functionalities.

  14. Dynamics of a bistable Miura-origami structure. (United States)

    Fang, Hongbin; Li, Suyi; Ji, Huimin; Wang, K W


    Origami-inspired structures and materials have shown extraordinary properties and performances originating from the intricate geometries of folding. However, current state of the art studies have mostly focused on static and quasistatic characteristics. This research performs a comprehensive experimental and analytical study on the dynamics of origami folding through investigating a stacked Miura-Ori (SMO) structure with intrinsic bistability. We fabricate and experimentally investigated a bistable SMO prototype with rigid facets and flexible crease lines. Under harmonic base excitation, the SMO exhibits both intrawell and interwell oscillations. Spectrum analyses reveal that the dominant nonlinearities of SMO are quadratic and cubic, which generate rich dynamics including subharmonic and chaotic oscillations. The identified nonlinearities indicate that a third-order polynomial can be employed to approximate the measured force-displacement relationship. Such an approximation is validated via numerical study by qualitatively reproducing the phenomena observed in the experiments. The dynamic characteristics of the bistable SMO resemble those of a Helmholtz-Duffing oscillator (HDO); this suggests the possibility of applying the established tools and insights of HDO to predict origami dynamics. We also show that the bistability of SMO can be programmed within a large design space via tailoring the crease stiffness and initial stress-free configurations. The results of this research offer a wealth of fundamental insights into the dynamics of origami folding, and provide a solid foundation for developing foldable and deployable structures and materials with embedded dynamic functionalities.

  15. Reversal Negativity and Bistable Stimuli: Attention, Awareness, or Something Else? (United States)

    Intaite, Monika; Koivisto, Mika; Ruksenas, Osvaldas; Revonsuo, Antti


    Ambiguous (or bistable) figures are visual stimuli that have two mutually exclusive perceptual interpretations that spontaneously alternate with each other. Perceptual reversals, as compared with non-reversals, typically elicit a negative difference called reversal negativity (RN), peaking around 250 ms from stimulus onset. The cognitive…

  16. Kerr nonlinearity and plasmonic bistability in graphene nanoribbons

    DEFF Research Database (Denmark)

    Christensen, Thomas; Yan, Wei; Jauho, Antti-Pekka


    due to field enhancement, and the total nonlinearity is significantly affected by the field inhomogeneity of the plasmonic excitation. Finally, we discuss the emergence of a plasmonic bistability which exists for energies red-shifted relative to the linear resonance. Our results offer insights...

  17. Drag force actuated bistable microswitches for flow sensing

    NARCIS (Netherlands)

    Kuipers, W.J.; van Baar, J.J.J.; Dijkstra, Marcel; Wiegerink, Remco J.; Lammerink, Theodorus S.J.; de Boer, J.H.; Krijnen, Gijsbertus J.M.


    This paper presents bistable microswitches with Au contacts with the aim to combine them with artificial hairs for flow sensing. The Au contacts are applied on both ends of a silicon nitride beam, suspended by a torsional bar at its center. The beam is provided with electrodes for electrostatic

  18. Phenomenological approach to bistable behavior of Josephson junctions

    International Nuclear Information System (INIS)

    Nishi, K.; Nara, S.; Hamanaka, K.


    The interaction of unbiased Josephson junction with external electromagnetic field in the presence of externally applied uniform magnetic field is theoretically examined by means of phenomenological treatment. It is proposed that an irradiated junction with suitably chosen parameters shows a bistable behavior of voltage across the junction as a function of the radiation intensity

  19. Structural characterization of the Salmonella typhimurium LT2 umu operon

    International Nuclear Information System (INIS)

    Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.


    The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

  20. Elucidation of Operon Structures across Closely Related Bacterial Genomes (United States)

    Li, Guojun


    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  1. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon. (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio


    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  2. Bistable Perception in Normal Aging: Perceptual Reversibility and its Relation to Cognition (United States)

    Díaz-Santos, Mirella; Mauro, Samantha; Cao, Bo; Yazdanbakhsh, Arash; Neargarder, Sandy; Cronin-Golomb, Alice


    The effects of age on the ability to resolve perceptual ambiguity are unknown, though it depends on fronto-parietal attentional networks known to change with age. We presented the bistable Necker cube to 24 middle-aged and older adults (OA; 56–78 years) and 20 younger adults (YA; 18–24 years) under passive-viewing and volitional control conditions: Hold one cube percept and Switch between cube percepts. During passive viewing, OA had longer dominance durations (time spent on each percept) than YA. In the Hold condition, OA were less able than YA to increase dominance durations. In the Switch condition, OA and YA did not differ in performance. Dominance durations in either condition correlated with performance on tests of executive function mediated by the frontal lobes. Eye movements (fixation deviations) did not differ between groups. These results suggest that OA’s reduced ability to hold a percept may arise from reduced selective attention. The lack of correlation of performance between Hold and executive-function measures suggests at least a partial segregation of underlying mechanisms. PMID:27116194

  3. Charge Carrier Transport Mechanism Based on Stable Low Voltage Organic Bistable Memory Device. (United States)

    Ramana, V V; Moodley, M K; Kumar, A B V Kiran; Kannan, V


    A solution processed two terminal organic bistable memory device was fabricated utilizing films of polymethyl methacrylate PMMA/ZnO/PMMA on top of ITO coated glass. Electrical characterization of the device structure showed that the two terminal device exhibited favorable switching characteristics with an ON/OFF ratio greater than 1 x 10(4) when the voltage was swept between - 2 V and +3 V. The device maintained its state after removal of the bias voltage. The device did not show degradation after a 1-h retention test at 120 degrees C. The memory functionality was consistent even after fifty cycles of operation. The charge transport switching mechanism is discussed on the basis of carrier transport mechanism and our analysis of the data shows that the charge carrier trans- port mechanism of the device during the writing process can be explained by thermionic emission (TE) and space-charge-limited-current (SCLC) mechanism models while erasing process could be explained by the FN tunneling mechanism. This demonstration provides a class of memory devices with the potential for low-cost, low-power consumption applications, such as a digital memory cell.

  4. Prevalence of transcription promoters within archaeal operons and coding sequences. (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S


    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  5. Supra-transmission and bistability in nonlinear media with a photonic and electronic forbidden band gap; Supratransmission et bistabilite nonlineaire dans les milieux a bandes interdites photoniques et electroniques

    Energy Technology Data Exchange (ETDEWEB)

    Chevriaux, D


    We study wave scattering in different nonlinear media possessing a natural forbidden band gap. In particular, we show the existence of a bistable behavior in media governed by the sine-Gordon equation (short pendular chain, Josephson junction array, quantum Hall bilayer), or the nonlinear Schroedinger equation (Kerr and Bragg media), in discrete and continuous models. These different media are submitted to periodic boundary conditions with a frequency in the forbidden band gap and an amplitude that determines their stability states. Indeed, for a sufficient amplitude (supra-transmission), the medium switches from reflector to transmitter, hence allowing the output signal to jump from evanescent to large values. We give a complete analytical description of the bistability that allows to understand the different stationary states observed and to predict the switch of one state to the other. (author)

  6. Pseudospark switches

    International Nuclear Information System (INIS)

    Billault, P.; Riege, H.; Gulik, M. van; Boggasch, E.; Frank, K.


    The pseudospark discharge is bound to a geometrical structure which is particularly well suited for switching high currents and voltages at high power levels. This type of discharge offers the potential for improvement in essentially all areas of switching operation: peak current and current density, current rise, stand-off voltage, reverse current capability, cathode life, and forward drop. The first pseudospark switch was built at CERN at 1981. Since then, the basic switching characteristics of pseudospark chambers have been studied in detail. The main feature of a pseudospark switch is the confinement of the discharge plasma to the device axis. The current transition to the hollow electrodes is spread over a rather large surface area. Another essential feature is the easy and precise triggering of the pseudospark switch from the interior of the hollow electrodes, relatively far from the main discharge gap. Nanosecond delay and jitter values can be achieved with trigger energies of less than 0.1 mJ, although cathode heating is not required. Pseudospark gaps may cover a wide range of high-voltage, high-current, and high-pulse-power switching at repetition rates of many kilohertz. This report reviews the basic researh on pseudospark switches which has been going on at CERN. So far, applications have been developed in the range of thyratron-like medium-power switches at typically 20 to 40 kV and 0.5 to 10 kA. High-current pseudospark switches have been built for a high-power 20 kJ pulse generator which is being used for long-term tests of plasma lenses developed for the future CERN Antiproton Collector (ACOL). The high-current switches have operated for several hundred thousand shots, with 20 to 50 ns jitter at 16 kV charging voltage and more than 100 kA peak current amplitude. (orig.)

  7. The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

    International Nuclear Information System (INIS)

    Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.


    Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

  8. Phase-locked 3D3C-MRV measurements in a bi-stable fluidic oscillator (United States)

    Wassermann, Florian; Hecker, Daniel; Jung, Bernd; Markl, Michael; Seifert, Avi; Grundmann, Sven


    In this work, the phase-resolved internal flow of a bi-stable fluidic oscillator was measured using phase-locked three-dimensional three-components magnetic resonance velocimetry (3D3C-MRV), also termed as 4D-MRV. A bi-stable fluidic oscillator converts a continuous inlet-mass flow into a jet alternating between two outlet channels and, as a consequence provides an unsteady, periodic flow. This actuator can therefore be used as flow-control actuator. Since data acquisition in a 3D volume takes up to several minutes, only a small portion of the data is acquired in each flow cycle for every time point of the flow cycle. The acquisition of the entire data set is segmented over many cycles of the periodic flow. This procedure allows to measure phase-averaged 3D3C velocity fields with a certain temporal resolution. However, the procedure requires triggering to the periodic nature of the flow. Triggering the MR scanner precisely on each flow cycle is one of the key issues discussed in this manuscript. The 4D-MRV data are compared to data measured using phase-locked laser Doppler anemometry and good agreement between the results is found. The validated 4D-MRV data is analyzed and the fluid-mechanic features and processes inside the fluidic oscillator are investigated and described, providing a detailed description of the internal jet-switching mechanism.

  9. A quintuple quantum dot system for electrical and optical control of multi/bistability in a telecommunication window

    International Nuclear Information System (INIS)

    Mehmannavaz, Mohammad Reza; Sattari, Hamed


    We propose a model for a quintuple coupled quantum dot system based on a GaAs/AlGaAs heterostructure. Then, we analyze the optical bistability (OB) and optical multistability (OM) behaviours and transition between the regimes at a wavelength of λ=1.550 μm. We take the benefit of consecutive and parallel interdot tunnelling and an incoherent pumping field for electrical and even optical control of the processes. It is shown that OB, OM and transition between them can be accomplished and controlled by adjusting the rate of the inter-dot tunnellings (electrical bias), probe wavelength detuning and rate of the optical incoherent pumping field. By proper choice of the controlling parameters, the bistable hysteresis loop becomes narrower, which makes it easier for the cavity field to reach saturation. We interpret the OB and OM behaviours by discussing the absorption of the active medium. We also investigate switching time between the two stable states when the output field jumps from a lower branch to an upper branch. Such a controllable OB/OM and transition between them in multiple QD molecules at a wavelength of 1.550 μm, may provide some new possibilities for technological applications in optoelectronics, solid-state quantum information science and systems dealing with signal processing. (letter)

  10. Exact modelling of the optical bistability in ferroelectics via two-wave mixing: A system with full nonlinearity (United States)

    Khushaini, Muhammad Asif A.; Ibrahim, Abdel-Baset M. A.; Choudhury, P. K.


    In this paper, we provide a complete mathematical model of the phenomenon of optical bistability (OB) resulting from the degenerate two-wave mixing (TWM) process of laser beams interacting with a single nonlinear layer of ferroelectric material. Starting with the electromagnetic wave equation for optical wave propagating in nonlinear media, a nonlinear coupled wave (CW) system with both self-phase modulation (SPM) and cross-phase modulation (XPM) sources of nonlinearity are derived. The complete CW system with full nonlinearity is solved numerically and a comparison between both the cases of with and without SPM at various combinations of design parameters is given. Furthermore, to provide a reliable theoretical model for the OB via TWM process, the results obtained theoretically are compared with the available experimental data. We found that the nonlinear system without SPM fails to predict the bistable response at lower combinations of the input parameters. However, at relatively higher values, the solution without SPM shows a reduction in the switching contrast and period in the OB response. A comparison with the experimental results shows better agreement with the system with full nonlinearity.

  11. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization (United States)

    Igoshin, Oleg


    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  12. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy


    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  13. Resistive switching memories in MoS{sub 2} nanosphere assemblies

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Xiao-Yong, E-mail:, E-mail:, E-mail: [School of Physics Science and Technology, Yangzhou University, Yangzhou 225002 (China); State Key Laboratory of Bioelectronics and School of Electronic Science and Engineering, Southeast University, Nanjing 210096 (China); School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore, Singapore 639798 (Singapore); Yin, Zong-You [School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore, Singapore 639798 (Singapore); Xu, Chun-Xiang, E-mail:, E-mail:, E-mail:; Dai, Jun [State Key Laboratory of Bioelectronics and School of Electronic Science and Engineering, Southeast University, Nanjing 210096 (China); Hu, Jing-Guo, E-mail:, E-mail:, E-mail: [School of Physics Science and Technology, Yangzhou University, Yangzhou 225002 (China)


    A resistive switching memory device consisting of reduced graphene oxide and indium tin oxide as top/bottom two electrodes, separated by dielectric MoS{sub 2} nanosphere assemblies as the active interlayer, was fabricated. This device exhibits the rewritable nonvolatile resistive switching with low SET/RESET voltage (∼2 V), high ON/OFF resistance ratio (∼10{sup 4}), and superior electrical bistability, introducing a potential application in data storage field. The resistance switching mechanism was analyzed in the assumptive model of the electron tunneling across the polarized potential barriers.

  14. Controlling the optical bistability and multistability in a two-level pumped-probe system

    International Nuclear Information System (INIS)

    Mahmoudi, Mohammad; Sahrai, Mostafa; Masoumeh Mousavi, Seyede


    We study the behavior of the optical bistability (OB) and multistability (OM) in a two-level pumped-probe atomic system by means of a unidirectional ring cavity. We show that the optical bistability in a two-level atomic system can be controlled by adjusting the intensity of the pump field and the detuning between two fields. We find that applying the pumping field decreases the threshold of the optical bistability.

  15. Bistability and self-oscillations effects in a polariton-laser semiconductor microcavity

    International Nuclear Information System (INIS)

    Cotta, E A; Matinaga, F M


    We report an experimental observation of polaritonic optical bistability of the laser emission in a planar semiconductor microcavity with a 100 0 A GaAs single quantum well in the strong-coupling regime. The bistability curves show crossings that indicate a competition between a Kerr-like effect induced by the polariton population and thermal effects. Associated with the bistability, laser-like emission occurs at the bare cavity mode

  16. Modeling bistable behaviors in morphing structures through finite element simulations. (United States)

    Guo, Qiaohang; Zheng, Huang; Chen, Wenzhe; Chen, Zi


    Bistable structures, exemplified by the Venus flytrap and slap bracelets, can transit between different configurations upon certain external stimulation. Here we study, through three-dimensional finite element simulations, the bistable behaviors in elastic plates in the absence of terminate loads, but with pre-strains in one (or both) of the two composite layers. Both the scenarios with and without a given geometric mis-orientation angle are investigated, the results of which are consistent with recent theoretical and experimental studies. This work can open ample venues for programmable designs of plant/shell structures with large deformations, with applications in designing bio-inspired robotics for biomedical research and morphing/deployable structures in aerospace engineering.

  17. Coupling-induced oscillations in nonhomogeneous, overdamped, bistable systems

    International Nuclear Information System (INIS)

    Hernandez, Mayra; In, Visarath; Longhini, Patrick; Palacios, Antonio; Bulsara, Adi; Kho, Andy


    Coupling-induced oscillations in a homogeneous network of overdamped bistable systems have been previously studied both theoretically and experimentally for a system of N (odd) elements, unidirectionally coupled in a ring topology. In this work, we extend the analysis of this system to include a network of nonhomogeneous elements with respect to the parameter that controls the topology of the potential function and the bistability of each element. In particular, we quantify the effects of the nonhomogeneity on the onset of oscillations and the response of the network to external (assumed to be constant and very small) perturbations, using our (recently developed) coupled core fluxgate magnetometer as a representative system. The potential applications of this work include signal detection and characterization for a large class of sensor systems

  18. Coupling-induced oscillations in nonhomogeneous, overdamped, bistable systems

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, Mayra [Nonlinear Dynamical Systems Group, Department of Mathematics and Statistics, San Diego State University, San Diego, CA 92182 (United States)], E-mail:; In, Visarath [Space and Naval Warfare Systems Center, Code 71730, 53560 Hull Street, San Diego, CA 92152-5001 (United States)], E-mail:; Longhini, Patrick [Space and Naval Warfare Systems Center, Code 71730, 53560 Hull Street, San Diego, CA 92152-5001 (United States)], E-mail:; Palacios, Antonio [Nonlinear Dynamical Systems Group, Department of Mathematics and Statistics, San Diego State University, San Diego, CA 92182 (United States)], E-mail:; Bulsara, Adi [Space and Naval Warfare Systems Center, Code 71730, 53560 Hull Street, San Diego, CA 92152-5001 (United States)], E-mail:; Kho, Andy [Space and Naval Warfare Systems Center, Code 71730, 53560 Hull Street, San Diego, CA 92152-5001 (United States)], E-mail:


    Coupling-induced oscillations in a homogeneous network of overdamped bistable systems have been previously studied both theoretically and experimentally for a system of N (odd) elements, unidirectionally coupled in a ring topology. In this work, we extend the analysis of this system to include a network of nonhomogeneous elements with respect to the parameter that controls the topology of the potential function and the bistability of each element. In particular, we quantify the effects of the nonhomogeneity on the onset of oscillations and the response of the network to external (assumed to be constant and very small) perturbations, using our (recently developed) coupled core fluxgate magnetometer as a representative system. The potential applications of this work include signal detection and characterization for a large class of sensor systems.

  19. A minimal model of burst-noise induced bistability.

    Directory of Open Access Journals (Sweden)

    Johannes Falk

    Full Text Available We investigate the influence of intrinsic noise on stable states of a one-dimensional dynamical system that shows in its deterministic version a saddle-node bifurcation between monostable and bistable behaviour. The system is a modified version of the Schlögl model, which is a chemical reaction system with only one type of molecule. The strength of the intrinsic noise is varied without changing the deterministic description by introducing bursts in the autocatalytic production step. We study the transitions between monostable and bistable behavior in this system by evaluating the number of maxima of the stationary probability distribution. We find that changing the size of bursts can destroy and even induce saddle-node bifurcations. This means that a bursty production of molecules can qualitatively change the dynamics of a chemical reaction system even when the deterministic description remains unchanged.

  20. Mathematical modeling of Myosin induced bistability of Lamellipodial fragments. (United States)

    Hirsch, S; Manhart, A; Schmeiser, C


    For various cell types and for lamellipodial fragments on flat surfaces, externally induced and spontaneous transitions between symmetric nonmoving states and polarized migration have been observed. This behavior is indicative of bistability of the cytoskeleton dynamics. In this work, the Filament Based Lamellipodium Model (FBLM), a two-dimensional, anisotropic, two-phase continuum model for the dynamics of the actin filament network in lamellipodia, is extended by a new description of actin-myosin interaction. For appropriately chosen parameter values, the resulting model has bistable dynamics with stable states showing the qualitative features observed in experiments. This is demonstrated by numerical simulations and by an analysis of a strongly simplified version of the FBLM with rigid filaments and planar lamellipodia at the cell front and rear.

  1. Waterbomb base: a symmetric single-vertex bistable origami mechanism

    International Nuclear Information System (INIS)

    Hanna, Brandon H; Lund, Jason M; Magleby, Spencer P; Howell, Larry L; Lang, Robert J


    The origami waterbomb base is a single-vertex bistable origami mechanism that has unique properties which may prove useful in a variety of applications. It also shows promise as a test bed for smart materials and actuation because of its straightforward geometry and multiple phases of motion, ranging from simple to more complex. This study develops a quantitative understanding of the symmetric waterbomb base's kinetic behavior. This is done by completing kinematic and potential energy analyses to understand and predict bistable behavior. A physical prototype is constructed and tested to validate the results of the analyses. Finite element and virtual work analyses based on the prototype are used to explore the locations of the stable equilibrium positions and the force–deflection response. The model results are verified through comparisons to measurements on a physical prototype. The resulting models describe waterbomb base behavior and provide an engineering tool for application development. (paper)

  2. Novel piezoelectric bistable oscillator architecture for wideband vibration energy harvesting

    International Nuclear Information System (INIS)

    Liu, W Q; Badel, A; Formosa, F; Wu, Y P; Agbossou, A


    Bistable vibration energy harvesters are attracting more and more interest because of their capability to scavenge energy over a large frequency band. The bistable effect is usually based on magnetic interaction or buckled beams. This paper presents a novel architecture based on amplified piezoelectric structures. This buckled spring–mass architecture allows the energy of the dynamic mass to be converted into electrical energy in the piezoelectric materials as efficiently as possible. Modeling and design are performed and a normalized expression of the harvester behavior is given. Chirp and band-limited noise excitations are used to evaluate the proposed harvester’s performances. Simulation and experimental results are in good agreement. A method of using a spectrum plot for investigating the interwell motion is presented. The effect of the electric load impedance matching strategy is also studied. Results and comparisons with the literature show that the proposed device combines a large bandwidth and a high power density. (paper)

  3. Bistable dark solitons of a cubic-quintic Helmholtz equation

    International Nuclear Information System (INIS)

    Christian, J. M.; McDonald, G. S.; Chamorro-Posada, P.


    We provide a report on exact analytical bistable dark spatial solitons of a nonlinear Helmholtz equation with a cubic-quintic refractive-index model. Our analysis begins with an investigation of the modulational instability characteristics of Helmholtz plane waves. We then derive a dark soliton by mapping the desired asymptotic form onto a uniform background field and obtain a more general solution by deploying rotational invariance laws in the laboratory frame. The geometry of the new soliton is explored in detail, and a range of new physical predictions is uncovered. Particular attention is paid to the unified phenomena of arbitrary-angle off-axis propagation and nondegenerate bistability. Crucially, the corresponding solution of paraxial theory emerges in a simultaneous multiple limit. We conclude with a set of computer simulations that examine the role of Helmholtz dark solitons as robust attractors.

  4. Internal optical bistability of quasi-two-dimensional semiconductor nanoheterostructures (United States)

    Derevyanchuk, Oleksandr V.; Kramar, Natalia K.; Kramar, Valeriy M.


    We represent the results of numerical computations of the frequency and temperature domains of possible realization of internal optical bistability in flat quasi-two-dimensional semiconductor nanoheterostructures with a single quantum well (i.e., nanofilms). Particular computations have been made for a nanofilm of layered semiconductor PbI2 embedded in dielectric medium, i.e. ethylene-methacrylic acid (E-MAA) copolymer. It is shown that an increase in the nanofilm's thickness leads to a long-wave shift of the frequency range of the manifestation the phenomenon of bistability, to increase the size of the hysteresis loop, as well as to the expansion of the temperature interval at which the realization of this phenomenon is possible.

  5. Modeling Bistable Composite Laminates for Piezoelectric Morphing Structures


    Darryl V. Murray; Oliver J. Myers


    A sequential modeling effort for bistable composite laminates for piezoelectric morphing structures is presented. Thin unsymmetric carbon fiber composite laminates are examined for use of morphing structures using piezoelectric actuation. When cooling from the elevated cure temperature to room temperature, these unsymmetric composite laminates will deform. These postcure room temperature deformation shapes can be used as morphing structures. Applying a force to these deformed laminates will c...

  6. Spatial effect on stochastic dynamics of bistable evolutionary games

    International Nuclear Information System (INIS)

    So, Kohaku H Z; Ohtsuki, Hisashi; Kato, Takeo


    We consider the lifetimes of metastable states in bistable evolutionary games (coordination games), and examine how they are affected by spatial structure. A semiclassical approximation based on a path integral method is applied to stochastic evolutionary game dynamics with and without spatial structure, and the lifetimes of the metastable states are evaluated. It is shown that the population dependence of the lifetimes is qualitatively different in these two models. Our result indicates that spatial structure can accelerate the transitions between metastable states. (paper)

  7. Stochastic dynamics of a delayed bistable system with multiplicative noise

    Energy Technology Data Exchange (ETDEWEB)

    Dung, Nguyen Tien, E-mail:, E-mail: [Department of Mathematics, FPT University, No 8 Ton That Thuyet, My Dinh, Tu Liem, Hanoi (Viet Nam)


    In this paper we investigate the properties of a delayed bistable system under the effect of multiplicative noise. We first prove the existence and uniqueness of the positive solution and show that its moments are uniformly bounded. Then, we study stochastic dynamics of the solution in long time, the lower and upper bounds for the paths and an estimate for the average value are provided.

  8. Traveling waves in the discrete fast buffered bistable system. (United States)

    Tsai, Je-Chiang; Sneyd, James


    We study the existence and uniqueness of traveling wave solutions of the discrete buffered bistable equation. Buffered excitable systems are used to model, among other things, the propagation of waves of increased calcium concentration, and discrete models are often used to describe the propagation of such waves across multiple cells. We derive necessary conditions for the existence of waves, and, under some restrictive technical assumptions, we derive sufficient conditions. When the wave exists it is unique and stable.

  9. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing. (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L


    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  10. Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants. (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan


    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  11. Bistable flapping of flexible flyers in oscillatory flow (United States)

    Huang, Yangyang; Kanso, Eva


    Biological and bio-inspired flyers move by shape actuation. The direct control of shape variables for locomotory purposes is well studied. Less is known about indirect shape actuation via the fluid medium. Here, we consider a flexible Λ-flyer in oscillatory flow that is free to flap and rotate around its fixed apex. We study its motion in the context of the inviscid vortex sheet model. We first analyze symmetric flapping about the vertical axis of gravity. We find that there is a finite value of the flexibility that maximizes both the flapping amplitude and elastic energy storage. Our results show that rather than resonance, the flyer relies on fluidic effects to optimize these two quantities. We then perturb the flyer away from the vertical and analyze its stability. Four distinct types of rolling behavior are identified: mono-stable, bistable, bistable oscillatory rotations and chaotic dynamics. We categorize these types of behavior in terms of the flyer's and flow parameters. In particular, the transition from mono-stable to bistable behavior occurs at a constant value of the product of the flow amplitude and acceleration. This product can be interpreted as the ratio of fluidic drag to gravity, confirming the fluid role in this transition.

  12. Interplay of bistable kinetics of gene expression during cellular growth

    International Nuclear Information System (INIS)

    Zhdanov, Vladimir P


    In cells, the bistable kinetics of gene expression can be observed on the level of (i) one gene with positive feedback between protein and mRNA production, (ii) two genes with negative mutual feedback between protein and mRNA production, or (iii) in more complex cases. We analyse the interplay of two genes of type (ii) governed by a gene of type (i) during cellular growth. In particular, using kinetic Monte Carlo simulations, we show that in the case where gene 1, operating in the bistable regime, regulates mutually inhibiting genes 2 and 3, also operating in the bistable regime, the latter genes may eventually be trapped either to the state with high transcriptional activity of gene 2 and low activity of gene 3 or to the state with high transcriptional activity of gene 3 and low activity of gene 2. The probability to get to one of these states depends on the values of the model parameters. If genes 2 and 3 are kinetically equivalent, the probability is equal to 0.5. Thus, our model illustrates how different intracellular states can be chosen at random with predetermined probabilities. This type of kinetics of gene expression may be behind complex processes occurring in cells, e.g., behind the choice of the fate by stem cells

  13. Brain mechanisms for simple perception and bistable perception. (United States)

    Wang, Megan; Arteaga, Daniel; He, Biyu J


    When faced with ambiguous sensory inputs, subjective perception alternates between the different interpretations in a stochastic manner. Such multistable perception phenomena have intrigued scientists and laymen alike for over a century. Despite rigorous investigations, the underlying mechanisms of multistable perception remain elusive. Recent studies using multivariate pattern analysis revealed that activity patterns in posterior visual areas correlate with fluctuating percepts. However, increasing evidence suggests that vision--and perception at large--is an active inferential process involving hierarchical brain systems. We applied searchlight multivariate pattern analysis to functional magnetic resonance imaging signals across the human brain to decode perceptual content during bistable perception and simple unambiguous perception. Although perceptually reflective activity patterns during simple perception localized predominantly to posterior visual regions, bistable perception involved additionally many higher-order frontoparietal and temporal regions. Moreover, compared with simple perception, both top-down and bottom-up influences were dramatically enhanced during bistable perception. We further studied the intermittent presentation of ambiguous images--a condition that is known to elicit perceptual memory. Compared with continuous presentation, intermittent presentation recruited even more higher-order regions and was accompanied by further strengthened top-down influences but relatively weakened bottom-up influences. Taken together, these results strongly support an active top-down inferential process in perception.

  14. Low threshold optical bistability and superluminal light propagation using a dielectric slab via inter-dot tunneling

    International Nuclear Information System (INIS)

    Taherzadeh, S; Nasehi, R; Mahmoudi, Mohammad


    The optical bistability (OB) behavior of a dielectric slab doped with quantum dot (QD) molecules is investigated in the presence of the inter-dot tunneling effect. It is shown that the threshold point of OB reduces by increasing inter-dot tunneling as well as by reducing the slab thickness. It is worth noting that the threshold of OB in a slab doped with QD molecules is smaller, by at least one order of magnitude, in respect to free QD molecules. We find that the inter-dot tunneling induces a negative group delay to the reflected pulse and it propagates in the superluminal region. Such simple control can be used in all optical switching. (paper)

  15. Extensively Reversible Thermal Transformations of a Bistable, Fluorescence-Switchable Molecular Solid: Entry into Functional Molecular Phase-Change Materials. (United States)

    Srujana, P; Radhakrishnan, T P


    Functional phase-change materials (PCMs) are conspicuously absent among molecular materials in which the various attributes of inorganic solids have been realized. While organic PCMs are primarily limited to thermal storage systems, the amorphous-crystalline transformation of materials like Ge-Sb-Te find use in advanced applications such as information storage. Reversible amorphous-crystalline transformations in molecular solids require a subtle balance between robust supramolecular assembly and flexible structural elements. We report novel diaminodicyanoquinodimethanes that achieve this transformation by interlinked helical assemblies coupled with conformationally flexible alkoxyalkyl chains. They exhibit highly reversible thermal transformations between bistable (crystalline/amorphous) forms, along with a prominent switching of the fluorescence emission energy and intensity. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Experimental chaotic quantification in bistable vortex induced vibration systems (United States)

    Huynh, B. H.; Tjahjowidodo, T.


    The study of energy harvesting by means of vortex induced vibration systems has been initiated a few years ago and it is considered to be potential as a low water current energy source. The energy harvester is realized by exposing an elastically supported blunt structure under water flow. However, it is realized that the system will only perform at a limited operating range (water flow) that is attributed to the resonance phenomenon that occurs only at a frequency that corresponds to the fluid flow. An introduction of nonlinear elements seems to be a prominent solution to overcome the problem. Among many nonlinear elements, a bistable spring is known to be able to improve the harvested power by a vortex induced vibrations (VIV) based energy converter at the low velocity water flows. However, it is also observed that chaotic vibrations will occur at different operating ranges that will erratically diminish the harvested power and cause a difficulty in controlling the system that is due to the unpredictability in motions of the VIV structure. In order to design a bistable VIV energy converter with improved harvested power and minimum negative effect of chaotic vibrations, the bifurcation map of the system for varying governing parameters is highly on demand. In this study, chaotic vibrations of a VIV energy converter enhanced by a bistable stiffness element are quantified in a wide range of the governing parameters, i.e. damping and bistable gap. Chaotic vibrations of the bistable VIV energy converter are simulated by utilization of a wake oscillator model and quantified based on the calculation of the Lyapunov exponent. Ultimately, a series of experiments of the system in a water tunnel, facilitated by a computer-based force-feedback testing platform, is carried out to validate the existence of chaotic responses. The main challenge in dealing with experimental data is in distinguishing chaotic response from noise-contaminated periodic responses as noise will smear

  17. REMap: Operon map of M. tuberculosis based on RNA sequence data. (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu


    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae. (United States)

    Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio


    Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

  19. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector. (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong


    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  20. Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

    DEFF Research Database (Denmark)

    Danielsen, S; Kilstrup, M; Barilla, K


    . A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

  1. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

  2. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit


    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

  3. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli. (United States)

    Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A


    HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

  4. Wavelength switching dynamics of two-colour semiconductor lasers with optical injection and feedback

    International Nuclear Information System (INIS)

    Osborne, S; Heinricht, P; Brandonisio, N; Amann, A; O’Brien, S


    The wavelength switching dynamics of two-colour semiconductor lasers with optical injection and feedback are presented. These devices incorporate slotted regions etched into the laser ridge waveguide for tailoring the output spectrum. Experimental measurements are presented demonstrating that optical injection in one or both modes of these devices can induce wavelength bistability. Measured switching dynamics with modulated optical injection are shown to be in excellent agreement with numerical simulations based on a simple rate equation model. We also demonstrate experimentally that time-delayed optical feedback can induce wavelength bistability for short external cavity lengths. Numerical simulations indicate that this two-colour optical feedback system can provide fast optical memory functionality based on injected optical pulses without the need for an external holding beam. (paper)

  5. Stochastic amplification and signaling in enzymatic futile cycles through noise-induced bistability with oscillations (United States)

    Samoilov, Michael; Plyasunov, Sergey; Arkin, Adam P.


    Stochastic effects in biomolecular systems have now been recognized as a major physiologically and evolutionarily important factor in the development and function of many living organisms. Nevertheless, they are often thought of as providing only moderate refinements to the behaviors otherwise predicted by the classical deterministic system description. In this work we show by using both analytical and numerical investigation that at least in one ubiquitous class of (bio)chemical-reaction mechanisms, enzymatic futile cycles, the external noise may induce a bistable oscillatory (dynamic switching) behavior that is both quantitatively and qualitatively different from what is predicted or possible deterministically. We further demonstrate that the noise required to produce these distinct properties can itself be caused by a set of auxiliary chemical reactions, making it feasible for biological systems of sufficient complexity to generate such behavior internally. This new stochastic dynamics then serves to confer additional functional modalities on the enzymatic futile cycle mechanism that include stochastic amplification and signaling, the characteristics of which could be controlled by both the type and parameters of the driving noise. Hence, such noise-induced phenomena may, among other roles, potentially offer a novel type of control mechanism in pathways that contain these cycles and the like units. In particular, observations of endogenous or externally driven noise-induced dynamics in regulatory networks may thus provide additional insight into their topology, structure, and kinetics. network motif | signal transduction | chemical reaction | synthetic biology | systems biology

  6. A Bistable Circuit Involving SCARECROW-RETINOBLASTOMA Integrates Cues to Inform Asymmetric Stem Cell Division (United States)

    Cruz-Ramírez, Alfredo; Díaz-Triviño, Sara; Blilou, Ikram; Grieneisen, Verônica A.; Sozzani, Rosangela; Zamioudis, Christos; Miskolczi, Pál; Nieuwland, Jeroen; Benjamins, René; Dhonukshe, Pankaj; Caballero-Pérez, Juan; Horvath, Beatrix; Long, Yuchen; Mähönen, Ari Pekka; Zhang, Hongtao; Xu, Jian; Murray, James A.H.; Benfey, Philip N.; Bako, Laszlo; Marée, Athanasius F.M.; Scheres, Ben


    SUMMARY In plants, where cells cannot migrate, asymmetric cell divisions (ACDs) must be confined to the appropriate spatial context. We investigate tissue-generating asymmetric divisions in a stem cell daughter within the Arabidopsis root. Spatial restriction of these divisions requires physical binding of the stem cell regulator SCARECROW (SCR) by the RETINOBLASTOMA-RELATED (RBR) protein. In the stem cell niche, SCR activity is counteracted by phosphorylation of RBR through a cyclinD6;1-CDK complex. This cyclin is itself under transcriptional control of SCR and its partner SHORT ROOT (SHR), creating a robust bistable circuit with either high or low SHR-SCR complex activity. Auxin biases this circuit by promoting CYCD6;1 transcription. Mathematical modeling shows that ACDs are only switched on after integration of radial and longitudinal information, determined by SHR and auxin distribution, respectively. Coupling of cell-cycle progression to protein degradation resets the circuit, resulting in a “flip flop” that constrains asymmetric cell division to the stem cell region. PMID:22921914

  7. Direct design of an energy landscape with bistable DNA origami mechanisms. (United States)

    Zhou, Lifeng; Marras, Alexander E; Su, Hai-Jun; Castro, Carlos E


    Structural DNA nanotechnology provides a feasible technique for the design and fabrication of complex geometries even exhibiting controllable dynamic behavior. Recently we have demonstrated the possibility of implementing macroscopic engineering design approaches to construct DNA origami mechanisms (DOM) with programmable motion and tunable flexibility. Here, we implement the design of compliant DNA origami mechanisms to extend from prescribing motion to prescribing an energy landscape. Compliant mechanisms facilitate motion via deformation of components with tunable stiffness resulting in well-defined mechanical energy stored in the structure. We design, fabricate, and characterize a DNA origami nanostructure with an energy landscape defined by two stable states (local energy minima) separated by a designed energy barrier. This nanostructure is a four-bar bistable mechanism with two undeformed states. Traversing between those states requires deformation, and hence mechanical energy storage, in a compliant arm of the linkage. The energy barrier for switching between two states was obtained from the conformational distribution based on a Boltzmann probability function and closely follows a predictive mechanical model. Furthermore, we demonstrated the ability to actuate the mechanism into one stable state via additional DNA inputs and then release the actuation via DNA strand displacement. This controllable multistate system establishes a foundation for direct design of energy landscapes that regulate conformational dynamics similar to biomolecular complexes.

  8. Configurational rearrangements of bistable centers in covalent semiconductors - phase transitions of the second type

    International Nuclear Information System (INIS)

    Ivanyukovich, V.A.; Karas', V.I.; Lomako, V.M.


    A new radiation configurational-bistable defect diffring from the known similar defects by the fact that it possessestemperature inversion of states is detected in gallium arsenide. Configurational-bistable rearrangements are shown to be considered as phase transitions of the second type

  9. Bistable traveling waves for a competitive-cooperative system with nonlocal delays (United States)

    Tian, Yanling; Zhao, Xiao-Qiang


    This paper is devoted to the study of bistable traveling waves for a competitive-cooperative reaction and diffusion system with nonlocal time delays. The existence of bistable waves is established by appealing to the theory of monotone semiflows and the finite-delay approximations. Then the global stability of such traveling waves is obtained via a squeezing technique and a dynamical systems approach.

  10. Topical Meeting on Optical Bistability Held at Rochester, New York on 15-17 June 1983. (United States)



  11. Effects of Transverse Magnetic Anisotropy on Current-Induced Spin Switching


    Misiorny, Maciej; Barnaś, Józef


    Spin-polarized transport through bistable magnetic adatoms or single-molecule magnets (SMMs), which exhibit both uniaxial and transverse magnetic anisotropy, is considered theoretically. The main focus is on the impact of transverse anisotropy on transport characteristics and the adatom's/SMM's spin. In particular, we analyze the role of quantum tunneling of magnetization (QTM) in the mechanism of the current-induced spin switching, and show that the QTM phenomenon becomes revealed as resonan...

  12. External field induced switching of tunneling current in the coupled quantum dots


    Mantsevich, V. N.; Maslova, N. S.; Arseyev, P. I.


    We investigated the tunneling current peculiarities in the system of two coupled by means of the external field quantum dots (QDs) weakly connected to the electrodes in the presence of Coulomb correlations. It was found that tuning of the external field frequency induces fast multiple tunneling current switching and leads to the negative tunneling conductivity. Special role of multi-electrons states was demonstrated. Moreover we revealed conditions for bistable behavior of the tunneling curre...

  13. Optical bistability via quantum interference from incoherent pumping and spontaneous emission

    International Nuclear Information System (INIS)

    Sahrai, M.; Asadpour, S.H.; Sadighi-Bonabi, R.


    We theoretically investigate the optical bistability (OB) in a V-type three-level atomic system confined in a unidirectional ring cavity via incoherent pumping field. It is shown that the threshold of optical bistability can be controlled by the rate of an incoherent pumping field and by interference mechanism arising from the spontaneous emission and incoherent pumping field. We demonstrate that the optical bistability converts to optical multi-stability (OM) by the quantum interference mechanism. - Highlights: → We modulate the optical bistability (OB) in a four-level N-type atomic system. → The threshold of optical bistability can be controlled by the quantum interferences. → OB converts to optical multi-stability (OM) by the quantum interferences. → We discuss the effect of an incoherent pumping field on reduction of OB threshold.

  14. A review of the recent research on vibration energy harvesting via bistable systems

    International Nuclear Information System (INIS)

    Harne, R L; Wang, K W


    The investigation of the conversion of vibrational energy into electrical power has become a major field of research. In recent years, bistable energy harvesting devices have attracted significant attention due to some of their unique features. Through a snap-through action, bistable systems transition from one stable state to the other, which could cause large amplitude motion and dramatically increase power generation. Due to their nonlinear characteristics, such devices may be effective across a broad-frequency bandwidth. Consequently, a rapid engagement of research has been undertaken to understand bistable electromechanical dynamics and to utilize the insight for the development of improved designs. This paper reviews, consolidates, and reports on the major efforts and findings documented in the literature. A common analytical framework for bistable electromechanical dynamics is presented, the principal results are provided, the wide variety of bistable energy harvesters are described, and some remaining challenges and proposed solutions are summarized. (topical review)

  15. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter


    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  16. Switching Phenomena (United States)

    Stanley, H. E.; Buldyrev, S. V.; Franzese, G.; Havlin, S.; Mallamace, F.; Mazza, M. G.; Kumar, P.; Plerou, V.; Preis, T.; Stokely, K.; Xu, L.

    One challenge of biology, medicine, and economics is that the systems treated by these serious scientific disciplines can suddenly "switch" from one behavior to another, even though they possess no perfect metronome in time. As if by magic, out of nothing but randomness one finds remarkably fine-tuned processes in time. The past century has, philosophically, been concerned with placing aside the human tendency to see the universe as a fine-tuned machine. Here we will address the challenge of uncovering how, through randomness (albeit, as we shall see, strongly correlated randomness), one can arrive at some of the many temporal patterns in physics, economics, and medicine and even begin to characterize the switching phenomena that enable a system to pass from one state to another. We discuss some applications of correlated randomness to understanding switching phenomena in various fields. Specifically, we present evidence from experiments and from computer simulations supporting the hypothesis that water's anomalies are related to a switching point (which is not unlike the "tipping point" immortalized by Malcolm Gladwell), and that the bubbles in economic phenomena that occur on all scales are not "outliers" (another Gladwell immortalization).

  17. A Bistable Switch and Anatomical Site Control Vibrio cholerae Virulence Gene Expression in the Intestine

    DEFF Research Database (Denmark)

    Nielsen, Alex Toftgaard; Dolganov, N. A.; Rasmussen, Thomas


    A fundamental, but unanswered question in host-pathogen interactions is the timing, localization and population distribution of virulence gene expression during infection. Here, microarray and in situ single cell expression methods were used to study Vibrio cholerae growth and virulence gene...... expression during infection of the rabbit ligated ileal loop model of cholera. Genes encoding the toxin-coregulated pilus (TCP) and cholera toxin (CT) were powerfully expressed early in the infectious process in bacteria adjacent to epithelial surfaces. Increased growth was found to co......, a chemical inducer of virulence gene expression. Striking bifurcation of the population occurred during entry into stationary phase: one subpopulation continued to express tcpA, whereas the expression declined in the other subpopulation. ctxA, encoding the A subunit of CT, and toxT, encoding the proximal...

  18. Asymmetric bistable reflection and polarization switching in a magnetic nonlinear multilayer structure

    DEFF Research Database (Denmark)

    Tuz, Vladimir R.; Novitsky, Denis V.; Prosvirnin, Sergey L.


    Optical properties of one-dimensional photonic structures consisting of Kerr-type nonlinear and magnetic layers under the action of an external static magnetic field in the Faraday geometry are investigated. The structure is a periodic arrangement of alternating nonlinear and magnetic layers (a o...

  19. Single motor–variable stiffness actuator using bistable switching mechanisms for independent motion and stiffness control

    NARCIS (Netherlands)

    Groothuis, Stefan; Carloni, Raffaella; Stramigioli, Stefano

    This paper presents a proof of concept of a variable stiffness actuator (VSA) that uses only one (high power) input motor. In general, VSAs use two (high power) motors to be able to control both the output position and the output stiffness, which possibly results in a heavy, and bulky system. In

  20. Processing and Low Voltage Switching of Organic Ferroelectric Phase-Separated Bistable Diodes

    NARCIS (Netherlands)

    Li, Mengyuan; Stingelin, Natalie; Michels, Jasper J.; Spijkman, Mark-Jan; Asadi, Kamal; Beerends, Rene; Biscarini, Fabio; Blom, Paul W. M.; de Leeuw, Dago M.


    The processing of solution-based binary blends of the ferroelectric random copolymer poly(vinylidene fluoride-trifluoroethylene) P(VDF-TrFE) and the semiconducting polymer poly(9,9-dioctylfluorenyl-2,7-diyl) (PFO) applied by spin-coating and wire-bar coating is investigated. By systematic variation

  1. Processing and low voltage switching of organic ferroelectric phase-separated bistable diodes

    NARCIS (Netherlands)

    Li, M.; Stingelin, N.; Michels, J.J.; Spijkman, M.-J.; Asadi, K.; Beerends, R.; Biscarini, F.; Blom, P.W.M.; Leeuw, D.M. de


    The processing of solution-based binary blends of the ferroelectric random copolymer poly(vinylidene fluoride-trifluoroethylene) P(VDF-TrFE) and the semiconducting polymer poly(9,9-dioctylfluorenyl-2,7-diyl) (PFO) applied by spin-coating and wire-bar coating is investigated. By systematic variation

  2. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani


    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  3. An insight into the regulation of mce4 operon of Mycobacterium tuberculosis. (United States)

    Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula


    The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis. (United States)

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L


    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  5. Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm. (United States)

    Harwani, Dharmesh


    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

  6. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  7. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal


    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  8. Stochastic resonance in bistable systems driven by harmonic noise

    International Nuclear Information System (INIS)

    Neiman, A.; Schimansky-Geier, L.


    We study stochastic resonance in a bistable system which is excited simultaneously by white and harmonic noise which we understand as the signal. In our case the spectral line of the signal has a finite width as it occurs in many real situations. Using techniques of cumulant analysis as well as computer simulations we find that the effect of stochastic resonance is preserved in the case of harmonic noise excitation. Moreover we show that the width of the spectral line of the signal at the output can be decreased via stochastic resonance. The last could be of importance in the practical using of the stochastic resonance

  9. Bistability By Self-Reflection In A Saturable Absorber (United States)

    Roso-Franco, Luis


    Propagation of laser light through a saturable absorber is theoretically studied. Computed steady state solutions of the Maxwell equations describing the unidimensional propagation of a plane monochromatic wave without introducing the slowly-varying envelope approximation are presented showing how saturation effects can influence the absorption of the field. At a certain range of refractive index and extintion coefficients, computed solutions display a very susprising behaviour, and a self-reflected wave appears inside the absorber. This can be useful for a new kind of biestable device, similar to a standard bistable cavity but with the back mirror self-induced by the light.

  10. Application of the Asymptotic Taylor Expansion Method to Bistable Potentials

    Directory of Open Access Journals (Sweden)

    Okan Ozer


    Full Text Available A recent method called asymptotic Taylor expansion (ATEM is applied to determine the analytical expression for eigenfunctions and numerical results for eigenvalues of the Schrödinger equation for the bistable potentials. Optimal truncation of the Taylor series gives a best possible analytical expression for eigenfunctions and numerical results for eigenvalues. It is shown that the results are obtained by a simple algorithm constructed for a computer system using symbolic or numerical calculation. It is observed that ATEM produces excellent results consistent with the existing literature.

  11. Bistable Helmholtz solitons in cubic-quintic materials

    International Nuclear Information System (INIS)

    Christian, J. M.; McDonald, G. S.; Chamorro-Posada, P.


    We propose a nonlinear Helmholtz equation for modeling the evolution of broad optical beams in media with a cubic-quintic intensity-dependent refractive index. This type of nonlinearity is appropriate for some semiconductor materials, glasses, and polymers. Exact analytical soliton solutions are presented that describe self-trapped nonparaxial beams propagating at any angle with respect to the reference direction. These spatially symmetric solutions are, to the best of our knowledge, the first bistable Helmholtz solitons to be derived. Accompanying conservation laws (both integral and particular forms) are also reported. Numerical simulations investigate the stability of the solitons, which appear to be remarkably robust against perturbations

  12. Entire solutions for bistable lattice differential equations with obstacles

    CERN Document Server

    Hoffman, Aaron; Vleck, E S Van


    The authors consider scalar lattice differential equations posed on square lattices in two space dimensions. Under certain natural conditions they show that wave-like solutions exist when obstacles (characterized by "holes") are present in the lattice. Their work generalizes to the discrete spatial setting the results obtained in Berestycki, Hamel, and Matuno (2009) for the propagation of waves around obstacles in continuous spatial domains. The analysis hinges upon the development of sub and super-solutions for a class of discrete bistable reaction-diffusion problems and on a generalization of a classical result due to Aronson and Weinberger that concerns the spreading of localized disturbances.

  13. Noticeable positive Doppler effect on optical bistability in an N-type active Raman gain atomic system

    International Nuclear Information System (INIS)

    Chang Zeng-Guang; Zhang Jing-Tao; Niu Yue-Ping; Gong Shang-Qing


    We theoretically investigate the Doppler effect on optical bistability in an N-type active Raman gain atomic system inside an optical ring cavity. It is shown that the Doppler effect can greatly enhance the dispersion and thus create the bistable behaviour or greatly increase the bistable region, which has been known as the positive Doppler effect on optical bistability. In addition, we find that a positive Doppler effect can change optical bistability from the hybrid dispersion-gain type to a dispersive type

  14. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)


    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  15. Ab initio investigation of the switching behavior of the dithiole-benzene nano-molecular wire

    International Nuclear Information System (INIS)

    Darvish Ganji, M.; Rungger, I.


    We report a first-principle study of electrical transport and switching behavior in a single molecular conductor consisting of a dithiole-benzene sandwiched between two Au( 100) electrodes. Ab initio total energy calculations reveal dithiole-benzene molecules on a gold surface, contacted by a monoatomic gold scanning tunneling microscope tip to have two classes of low energy conformations with differing symmetries. Lateral motion of the tip or excitation of the molecule cause it 10 change from one conformation class to the other and to switch between a strongly and a weakly conducting state. Thus, surprisingly. despite their apparent simplicity, these Au-dithiole-benzene -Au nano wires are shown to be electrically bi-stable switches, the smallest two-terminal molecular switches to date. The projected density of states and transmission coefficients are analyzed, and it suggests that the variation of the coupling between the molecule and the electrodes with external bias leads to switching behavior

  16. VO{sub 2}-like thermo-optical switching effect in one-dimensional nonlinear defective photonic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Juan, E-mail:, E-mail:; Zhang, Rongjun [Key Laboratory of Specialty Fiber Optics and Optical Access Networks, School of Communication and Information Engineering, Shanghai University, Shanghai 200072 (China); Wang, Yang, E-mail:, E-mail: [Key Laboratory of High Power Laser Materials, Shanghai Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Shanghai 201800 (China)


    A new approach to achieve VO{sub 2}-like thermo-optical switching in a one-dimensional photonic crystal by the combination of thermo-optical and optical Kerr effects was proposed and numerically demonstrated in this study. The switching temperature and the hysteresis width can be tuned in a wide temperature range. Steep transition, high optical contrast, and low pumping power can be achieved at the same time. This kind of one-dimensional photonic crystal-based bistable switch will be low-cost, easy-to-fabricate, and versatile in practical applications compared with traditional VO{sub 2}-type one.

  17. Ancient origin of the tryptophan operon and the dynamics of evolutionary change. (United States)

    Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A


    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  18. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change† (United States)

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.


    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  19. Bistability and displacement fluctuations in a quantum nanomechanical oscillator (United States)

    Avriller, R.; Murr, B.; Pistolesi, F.


    Remarkable features have been predicted for the mechanical fluctuations at the bistability transition of a classical oscillator coupled capacitively to a quantum dot [Micchi et al., Phys. Rev. Lett. 115, 206802 (2015), 10.1103/PhysRevLett.115.206802]. These results have been obtained in the regime ℏ ω0≪kBT ≪ℏ Γ , where ω0, T , and Γ are the mechanical resonating frequency, the temperature, and the tunneling rate, respectively. A similar behavior could be expected in the quantum regime of ℏ Γ ≪kBT ≪ℏ ω0 . We thus calculate the energy- and displacement-fluctuation spectra and study their behavior as a function of the electromechanical coupling constant when the system enters the Frank-Condon regime. We find that in analogy with the classical case, the energy-fluctuation spectrum and the displacement spectrum widths show a maximum for values of the coupling constant at which a mechanical bistability is established.

  20. Control and characterization of a bistable laminate generated with piezoelectricity (United States)

    Lee, Andrew J.; Moosavian, Amin; Inman, Daniel J.


    Extensive research has been conducted on utilizing smart materials such as piezoelectric and shape memory alloy actuators to induce snap through of bistable structures for morphing applications. However, there has only been limited success in initiating snap through from both stable states due to the lack of actuation authority. A novel solution in the form of a piezoelectrically generated bistable laminate consisting of only macro fiber composites (MFC), allowing complete configuration control without any external assistance, is explored in detail here. Specifically, this paper presents the full analytical, computational, and experimental results of the laminate’s design, geometry, bifurcation behavior, and snap through capability. By bonding two actuated MFCs in a [0MFC/90MFC]T layup and releasing the voltage post cure, piezoelectric strain anisotropy and the resulting in-plane residual stresses yield two statically stable states that are cylindrically shaped. The analytical model uses the Rayleigh-Ritz minimization of total potential energy and finite element analysis is implemented in MSC Nastran. The [0MFC/90MFC]T laminate is then manufactured and experimentally characterized for model validation. This paper demonstrates the adaptive laminate’s unassisted forward and reverse snap through capability enabled by the efficiencies gained from simultaneously being the actuator and the primary structure.

  1. A new concept for active bistable twisting structures (United States)

    Schultz, Marc R.


    A novel type of morphing structure capable of a large change in shape with a small energy input is discussed in this paper. The considered structures consist of two curved shells that are joined in a specific manner to form a bistable airfoil-like structure. The two stable shapes have a difference in axial twist, and the structure may be transformed between the stable shapes by a simple snap-through action. The benefit of a bistable structure of this type is that, if the stable shapes are operational shapes, power is needed only to transform the structure from one shape to another. The discussed structures could be used in aerodynamic applications such as morphing wings, or as aerodynamic control surfaces. The investigation discussed in this paper considers both experiment and finite-element analysis. Several graphite-epoxy composite and one steel device were created as proof-of-concept models. To demonstrate active control of these structures, piezocomposite actuators were applied to one of the composite structures and used to transform the structure between stable shapes. The analysis was used to compare the predicted shapes with the experimental shapes, and to study how changes to the geometric input values affected the shape and operational characteristics of the structures. The predicted shapes showed excellent agreement with the experimental shapes, and the results of the parametric study suggest that the shapes and the snap-through characteristics can be easily tailored to meet specific needs.

  2. A Reliable Bistable Board Implementation through I/O Redundancy

    International Nuclear Information System (INIS)

    Kim, Min Gyu; Chung, Tae Hyok; Lee, Youn Sang; Kim, Tae Hee; Song, Seung Hwan


    Nuclear power plant safety systems and related equipment used in the design, including an accident in all driving conditions that must be proven In addition, the safety-related equipment that is derived according to the digitization of the safety equipment is the most important factors. Therefore, it is necessary to prove that the device was satisfied the requirements for a given performance for safety-related digital equipment for the life of the installation. These proven is done through the process, design verification of the equipment, production management, such as installation and maintenance. Among other things, it is most important to implement of the performance and reliability features the safety-related equipment in the design phase. In this paper, Bistable Board implemented to generate a ESF sign-on signal throughout the signal processing of input signal from sensors. Also, for the reliable signal input and output, I/O Module that implements the redundancy increases the reliability of the Bistable Board , to verify the performance of safety-related equipment

  3. Model-based design of bistable cell factories for metabolic engineering. (United States)

    Srinivasan, Shyam; Cluett, William R; Mahadevan, Radhakrishnan


    Metabolism can exhibit dynamic phenomena like bistability due to the presence of regulatory motifs like the positive feedback loop. As cell factories, microorganisms with bistable metabolism can have a high and a low product flux at the two stable steady states, respectively. The exclusion of metabolic regulation and network dynamics limits the ability of pseudo-steady state stoichiometric models to detect the presence of bistability, and reliably assess the outcomes of design perturbations to metabolic networks. Using kinetic models of metabolism, we assess the change in the bistable characteristics of the network, and suggest designs based on perturbations to the positive feedback loop to enable the network to produce at its theoretical maximum rate. We show that the most optimal production design in parameter space, for a small bistable metabolic network, may exist at the boundary of the bistable region separating it from the monostable region of low product fluxes. The results of our analysis can be broadly applied to other bistable metabolic networks with similar positive feedback network topologies. This can complement existing model-based design strategies by providing a smaller number of feasible designs that need to be tested in vivo. Supplementary data are available at Bioinformatics online.

  4. Cooperativity Leads to Temporally-Correlated Fluctuations in the Bacteriophage Lambda Genetic Switch

    Directory of Open Access Journals (Sweden)

    Jacob Quinn Shenker


    Full Text Available Cooperative interactions are widespread in biochemical networks, providing the nonlinear response that underlies behavior such as ultrasensitivity and robust switching. We introduce a temporal correlation function—the conditional activity—to study the behavior of these phenomena. Applying it to the bistable genetic switch in bacteriophage lambda, we find that cooperative binding between binding sites on the prophage DNA lead to non-Markovian behavior, as quantified by the conditional activity. Previously, the conditional activity has been used to predict allosteric pathways in proteins; here, we show that it identifies the rare unbinding events which underlie induction from lysogeny to lysis.

  5. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)


    [Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

  6. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  7. Bistability Analysis of Excitatory-Inhibitory Neural Networks in Limited-Sustained-Activity Regime

    International Nuclear Information System (INIS)

    Ni Yun; Wu Liang; Wu Dan; Zhu Shiqun


    Bistable behavior of neuronal complex networks is investigated in the limited-sustained-activity regime when the network is composed of excitatory and inhibitory neurons. The standard stability analysis is performed on the two metastable states separately. Both theoretical analysis and numerical simulations show consistently that the difference between time scales of excitatory and inhibitory populations can influence the dynamical behaviors of the neuronal networks dramatically, leading to the transition from bistable behaviors with memory effects to the collapse of bistable behaviors. These results may suggest one possible neuronal information processing by only tuning time scales. (interdisciplinary physics and related areas of science and technology)

  8. Optical nonlinearity and bistability in the bound exciton energy range of CdS

    International Nuclear Information System (INIS)

    Hoenig, T.; Gutowski, J.


    Under high excitation conditions thick CdS samples show pronounced broad-band nonlinear transmission in the bound exciton region and up to a wavelength of about 515 nm at cryo-temperatures. This behavior is only explainable in a model based on impurity neutralization and bound exciton creation. The suitability of these nonlinearities to yield optical bistability will be shown. Bistable operation is investigated in dependence of crystal thickness, impurity concentration, excitation density, wavelength, and temperature. A strong correlation to acceptor-bound exciton generation is obtained, and the explanation of this bistable operation fits well with that of the above mentioned transmission behavior. (author)

  9. Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria


    Riyanti, Eny Ida; Rogers, Peter L


    Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

  10. Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.


    Chung, T; Resnik, E; Stueland, C; LaPorte, D C


    Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

  11. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon


    Goh, Yong Jun; Klaenhammer, Todd R


    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  12. Solving a discrete model of the lac operon using Z3 (United States)

    Gutierrez, Natalia A.


    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  13. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions (United States)

    Römling, Ute; Galperin, Michael Y.


    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  14. A metric for characterizing the bistability of molecular quantum-dot cellular automata

    International Nuclear Information System (INIS)

    Lu Yuhui; Lent, Craig S


    Much of molecular electronics involves trying to use molecules as (a) wires, (b) diodes or (c) field-effect transistors. In each case the criterion for determining good performance is well known: for wires it is conductance, for diodes it is conductance asymmetry, while for transistors it is high transconductance. Candidate molecules can be screened in terms of these criteria by calculating molecular conductivity in forward and reverse directions, and in the presence of a gating field. Hence so much theoretical work has focused on understanding molecular conductance. In contrast a molecule used as a quantum-dot cellular automata (QCA) cell conducts no current at all. The keys to QCA functionality are (a) charge localization, (b) bistable charge switching within the cell and (c) electric field coupling between one molecular cell and its neighbor. The combination of these effects can be examined using the cell-cell response function which relates the polarization of one cell to the induced polarization of a neighboring cell. The response function can be obtained by calculating the molecular electronic structure with ab initio quantum chemistry techniques. We present an analysis of molecular QCA performance that can be applied to any candidate molecule. From the full quantum chemistry, all-electron ab initio calculations we extract parameters for a reduced-state model which reproduces the cell-cell response function very well. Techniques from electron transfer theory are used to derive analytical models of the response function and can be employed on molecules too large for full ab initio treatment. A metric is derived which characterizes molecular QCA performance the way transconductance characterizes transistor performance. This metric can be assessed from absorption measurements of the electron transfer band or quantum chemistry calculations of appropriate sophistication

  15. Theoretical and experimental study of stochastic effects on polarization rotation in a vectorial bistable laser

    International Nuclear Information System (INIS)

    Singh, Kamal P.; Ropars, Guy; Brunel, Marc; Le Floch, Albert


    We investigate the two-dimensional optical rotor of a weakly modulated vectorial bistable laser submitted to a single or multiple stochastic perturbations. In the Langevin-type equation of the rotor the role of an even or odd input forcing function on the system dynamics is isolated. Through these two inputs of optical and magnetic natures we verify that the stochastic resonance exists only when the periodic modulation acts on the even parity optical input. When two mutually correlated noises are simultaneously submitted to the input functions of opposite parities, we find a critical regime of the noise interplay whereby one stable state becomes noise-free. In this case, the residence time of the light vector in the noise-free state diverges which leads to a collapse of the output signal-to-noise ratio. But, in this critical regime also obtained when one noise drives both the even and odd functions, if the system symmetry is broken through an independent lever control, we can recover the switching cycle due to a new response mechanism, namely, the dual stochastic response, with a specific output signal-to-noise ratio expression. Both the theoretical analysis and the experiment show that the signal-to-noise ratio now displays a robust behavior for a large range of the input noise amplitude, and a plateau with respect to the input signal amplitude. Furthermore, we isolate an original signature of this synchronization mechanism in the residence-time distribution leading to a broadband forcing frequency range. These noise interplay effects in a double well potential are of generic nature and could be found in other nonlinear systems

  16. A novel optic bistable device with very low threshold intensity using photorefractive films (United States)

    Wang, Sean X.; Sun, Yuankun; Trivedi, Sudhir B.; Li, Guifang


    Brimrose Corporation of America reports the successful completion of the SBIR Phase I research in low-threshold intensity optical bistable devices using photorefractive nonlinearity. A thin photorefractive film optical bistable device was proposed in the Phase I proposal. The feasibility of this device was theoretically investigated. The theoretical feasibility study formulates the materials requirements in such a kind of configuration for Phase II research. In addition, we have proposed and investigated another configuration of optical bistable devices that do not require advanced photorefractive materials, namely, the self-pumped phase conjugator. We have successfully demonstrated a low-threshold optical bistable operation in a KNSBN:CU crystal. To the best of our knowledge, the threshold of 650 mW/sq. cm is the lowest of its kind to be achieved so far.

  17. Innovative Energy Harvester Design Using Bistable Mechanism With Compensational Springs In Gravity Field

    International Nuclear Information System (INIS)

    Vysotskyi, Bogdan; Parrain, Fabien; Lefeuvre, Elie; Aubry, Denis; Gaucher, Philippe


    The purpose of the presented work is to introduce the novel design of electrostatic energy harvester using bistable mechanism with compensational springs in gravity field capable of providing the output of several μW under the excitation of extremely small amplitude (up to 0.2g) and low frequency (10-100Hz). Presented energy harvester uses the bistable hysteresis modification to achieve low-frequency low-amplitude sensibility. It was demonstrated with finite element modelling (FEM) that hysteresis width produced by bistability is changing with a constant linear coefficient as a function of a compensational spring stiffness and thus a device sensitivity could be adjusted to the minimum point for the amplitude of external excitation. Further, highly non-linear bistable double curved beam mechanism assures the high sensitivity in frequencial domain due to the non-defined bandwidth. The equivalent circuit technique is used for simulating the device performance. (paper)

  18. Geometric and potential dynamics interpretation of the optic ring resonator bistability (United States)

    Chiangga, S.; Chittha, T.; Frank, T. D.


    The optical bistability is a fundamental nonlinear feature of the ring resonator. A geometric and potential dynamics interpretation of the bistability is given. Accordingly, the bistability of the nonlinear system is shown to be a consequence of geometric laws of vector calculus describing the resonator ring. In contrast, the so-called transcendental relations that have been obtained in the literature in order to describe the optical wave are interpreted in terms of potential dynamical systems. The proposed novel interpretation provides new insights into the nature of the ring resonator optical bistability. The fundamental work by Rukhlenko, Premaratne and Agrawal (2010) as well as a more recent study by Chiangga, Pitakwongsaporn, Frank and Yupapin (2013) are considered.

  19. Optical bistability in the oscillation of an inhomogeneously broadened quasi-three-level laser

    International Nuclear Information System (INIS)

    Liu, Junhai; Tian, Xueping


    A theoretical modeling analysis is presented to study the optical bistability exhibited in the oscillation of an inhomogeneously broadened quasi-three-level laser. All the major characteristics of optical bistability depend on two normalized parameters, f and x a , which are defined by f = I sat,a /I sat,m and x a = 2α a0 p a /δ and are related to measurable properties of the laser medium. In comparison with the case of a homogeneously broadened laser, the essential condition for the occurrence of such bistability, f a /(x a + 1), turns out to be the same, whereas the intensities at the up- and down-thresholds are substantially increased and the bistability range is reduced. (paper)

  20. Angular dependence of the exchange bias for the bistable state

    Energy Technology Data Exchange (ETDEWEB)

    Bai, Yuhao [College of Physics and Electronic Information, Shanxi Normal University, Linfen 041004 (China); Research College of materials science, Shanxi Normal University, Linfen 041004 (China); Xu, Xiaohong, E-mail: [Research College of materials science, Shanxi Normal University, Linfen 041004 (China); Key Laboratory of Magnetic Molecules and Magnetic Information Materials, Ministry of Education, Shanxi Normal University, Linfen 041004 (China)


    The angular dependence of the exchange bias (ADEB) has been investigated in detail when the exchange-coupled ferromagnetic (FM)/antiferromagnetic (AFM) bilayer is in the bistable state. Complete and incomplete jump phenomena were found at the intrinsic easy and hard axes, when they pass through two special positions making the angular deviation of 58.2826° and 121.7174° from the easy axis of the uniaxial anisotropy, respectively. The combination of these different types of the jump phenomena at the intrinsic easy and hard axes yields five distinct types of the ADEB. The physical condition for each type of ADEB is established. Additionally, the extreme value problem of the exchange bias field and coercivity are also discussed, which is an important technological issue in the design of the magnetoresistive and spintronic devices. These results enable us to make a comprehensive understanding of the experimental ADEB curves.

  1. Controllable optical bistability and multistability in a graphene monolayer system

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Duo, E-mail: [School of Electrical and Electronic Engineering, Wuhan Polytechnic University, Wuhan 430023 (China); Sun, Zhaoyu [School of Electrical and Electronic Engineering, Wuhan Polytechnic University, Wuhan 430023 (China); Ding, Chunling [School of Physics and Electronics, Henan University, Kaifeng 475004 (China); Yu, Rong [School of Science, Hubei Province Key Laboratory of Intelligent Robot, Wuhan Institute of Technology, Wuhan 430073 (China); Yang, Xiaoxue [Wuhan National Laboratory for Optoelectronics and School of Physics, Huazhong University of Science and Technology, Wuhan 430074 (China)


    We theoretically investigate the behavior of optical bistability (OB) and optical multistability (OM) in a graphene monolayer system driven by an elliptically polarized control field and a right-hand circularly polarized probe field. Our numerical results show that it is easy to realize the transition from OB to OM or vice versa by adjusting the frequency detunings of the probe field and the control field, as well as the polarization-dependent phase difference between the two components of the control laser field. The influences of the intensity of the control field and the cooperation parameter on the OB behavior are also discussed in detail. These results may provide some new possibilities for technological applications in optoelectronics and solid-state quantum information science.

  2. Coherent-feedback-induced controllable optical bistability and photon blockade

    International Nuclear Information System (INIS)

    Liu, Yu-Long; Liu, Zhong-Peng; Zhang, Jing


    It is well known that some nonlinear phenomena such as strong photon blockade are difficult to observe in optomechanical systems with current experimental technology. Here we present a coherent feedback control strategy in which a linear cavity is coherently controlled by an optomechanical controller in a feedback manner. The coherent feedback loop transfers quantum nonlinearity from the controller to the controlled cavity causing destructive quantum interference to occur, and making it possible to observe strong nonlinear effects. With the help of the coherent feedback loop, large and tunable bistability and strong photon blockade of the cavity modes can be achieved even in the optomechanical weak coupling regime. Additionally, the coherent feedback loop leads to two-photon and multiphoton tunnelings for the controlled linear cavity, which are also typical quantum nonlinear phenomena. We hope that our work can give new perspectives on engineering nonlinear interactions in quantum systems. (paper)

  3. A predictive coding account of bistable perception - a model-based fMRI study.

    Directory of Open Access Journals (Sweden)

    Veith Weilnhammer


    Full Text Available In bistable vision, subjective perception wavers between two interpretations of a constant ambiguous stimulus. This dissociation between conscious perception and sensory stimulation has motivated various empirical studies on the neural correlates of bistable perception, but the neurocomputational mechanism behind endogenous perceptual transitions has remained elusive. Here, we recurred to a generic Bayesian framework of predictive coding and devised a model that casts endogenous perceptual transitions as a consequence of prediction errors emerging from residual evidence for the suppressed percept. Data simulations revealed close similarities between the model's predictions and key temporal characteristics of perceptual bistability, indicating that the model was able to reproduce bistable perception. Fitting the predictive coding model to behavioural data from an fMRI-experiment on bistable perception, we found a correlation across participants between the model parameter encoding perceptual stabilization and the behaviourally measured frequency of perceptual transitions, corroborating that the model successfully accounted for participants' perception. Formal model comparison with established models of bistable perception based on mutual inhibition and adaptation, noise or a combination of adaptation and noise was used for the validation of the predictive coding model against the established models. Most importantly, model-based analyses of the fMRI data revealed that prediction error time-courses derived from the predictive coding model correlated with neural signal time-courses in bilateral inferior frontal gyri and anterior insulae. Voxel-wise model selection indicated a superiority of the predictive coding model over conventional analysis approaches in explaining neural activity in these frontal areas, suggesting that frontal cortex encodes prediction errors that mediate endogenous perceptual transitions in bistable perception. Taken together

  4. Optical bistability of a thin film of resonant atoms in a phase-sensitive thermostate

    International Nuclear Information System (INIS)

    Basharov, A.M.


    It is shown theoretically that when a thin film of two-level atoms interacting with a resonant coherent electromagnetic wave is additionally illuminated with a squeezed field, a bistable transmission/reflection regime for coherent waves is obtained. This regime depends strongly on the phase difference between the coherent and the squeezed fields. New regimes, including a bistable regime, for the interaction of a coherent field with a film of resonant atoms are predicted based on this phenomenon. 14 refs., 5 figs

  5. Optical bistability in a single-sided cavity coupled to a quantum channel (United States)

    Payravi, M.; Solookinejad, Gh; Jabbari, M.; Nafar, M.; Ahmadi Sangachin, E.


    In this paper, we discuss the long wavelength optical reflection and bistable behavior of an InGaN/GaN quantum dot nanostructure coupled to a single-sided cavity. It is found that due to the presence of a strong coupling field, the reflection coefficient can be controlled at long wavelength, which is essential for adjusting the threshold of reflected optical bistability. Moreover, the phase shift features of the reflection pulse inside an electromagnetically induced transparency window are also discussed.

  6. Bistability of heat transfer of a viscous liquid under conditions of flow channel

    International Nuclear Information System (INIS)

    Melkikh, A.V.; Seleznev, V.D.


    The heat exchange model for a viscous liquid flowing under the pressure drop effect in a tube, surrounded by the medium with a lower temperature, is considered. It is shown that the system bistable behavior is possible by availability of the liquid viscosity exponential dependence on the temperature and by negligible dissipative heat release. The transitions between cold and hot flows in this case should proceed by a jump. The liquid and channel parameters, whereby the bistability may be observed, are determined [ru

  7. Heat dissipation and information flow for delayed bistable Langevin systems near coherence resonance. (United States)

    Xiao, Tiejun


    In this paper, stochastic thermodynamics of delayed bistable Langevin systems near coherence resonance is discussed. We calculate the heat dissipation rate and the information flow of a delayed bistable Langevin system under various noise intensities. Both the heat dissipation rate and the information flow are found to be bell-shaped functions of the noise intensity, which implies that coherence resonance manifests itself in the thermodynamic properties.

  8. A predictive coding account of bistable perception - a model-based fMRI study. (United States)

    Weilnhammer, Veith; Stuke, Heiner; Hesselmann, Guido; Sterzer, Philipp; Schmack, Katharina


    In bistable vision, subjective perception wavers between two interpretations of a constant ambiguous stimulus. This dissociation between conscious perception and sensory stimulation has motivated various empirical studies on the neural correlates of bistable perception, but the neurocomputational mechanism behind endogenous perceptual transitions has remained elusive. Here, we recurred to a generic Bayesian framework of predictive coding and devised a model that casts endogenous perceptual transitions as a consequence of prediction errors emerging from residual evidence for the suppressed percept. Data simulations revealed close similarities between the model's predictions and key temporal characteristics of perceptual bistability, indicating that the model was able to reproduce bistable perception. Fitting the predictive coding model to behavioural data from an fMRI-experiment on bistable perception, we found a correlation across participants between the model parameter encoding perceptual stabilization and the behaviourally measured frequency of perceptual transitions, corroborating that the model successfully accounted for participants' perception. Formal model comparison with established models of bistable perception based on mutual inhibition and adaptation, noise or a combination of adaptation and noise was used for the validation of the predictive coding model against the established models. Most importantly, model-based analyses of the fMRI data revealed that prediction error time-courses derived from the predictive coding model correlated with neural signal time-courses in bilateral inferior frontal gyri and anterior insulae. Voxel-wise model selection indicated a superiority of the predictive coding model over conventional analysis approaches in explaining neural activity in these frontal areas, suggesting that frontal cortex encodes prediction errors that mediate endogenous perceptual transitions in bistable perception. Taken together, our current work

  9. Micromagnetic simulation of energy consumption and excited eigenmodes in elliptical nanomagnetic switches

    International Nuclear Information System (INIS)

    Carlotti, G.; Madami, M.; Gubbiotti, G.; Tacchi, S.


    Sub-200 nm patterned magnetic dots are key elements for the design of magnetic switches, memory cells or elementary units of nanomagnetic logic circuits. In this paper, we analyse by micromagnetic simulations the magnetization reversal, the dissipated energy and the excited spin eigenmodes in bistable magnetic switches, consisting of elliptical nanodots with 100×60 nm lateral dimensions. Two different strategies for reversal are considered and the relative results compared: (i) the irreversible switching obtained by the application of an external field along the easy axis, in the direction opposite to the initial magnetization; (ii) the precessional switching accomplished by the application of a short magnetic field pulse, oriented perpendicular to the initial magnetization direction. The obtained results are discussed in terms of deviation from the macrospin behavior, energy dissipation and characteristics of the spectrum of spin eigenmodes excited during the magnetization reversal process

  10. Evidence for distinct mechanisms underlying attentional priming and sensory memory for bistable perception. (United States)

    Brinkhuis, M A B; Kristjánsson, Á; Brascamp, J W


    Attentional selection in visual search paradigms and perceptual selection in bistable perception paradigms show functional similarities. For example, both are sensitive to trial history: They are biased toward previously selected targets or interpretations. We investigated whether priming by target selection in visual search and sensory memory for bistable perception are related. We did this by presenting two trial types to observers. We presented either ambiguous spheres that rotated over a central axis and could be perceived as rotating in one of two directions, or search displays in which the unambiguously rotating target and distractor spheres closely resembled the two possible interpretations of the ambiguous stimulus. We interleaved both trial types within experiments, to see whether priming by target selection during search trials would affect the perceptual outcome of bistable perception and, conversely, whether sensory memory during bistable perception would affect target selection times during search. Whereas we found intertrial repetition effects among consecutive search trials and among consecutive bistable trials, we did not find cross-paradigm effects. Thus, even though we could ascertain that our experiments robustly elicited processes of both search priming and sensory memory for bistable perception, these same experiments revealed no interaction between the two.

  11. Cell individuality: the bistable gene expression of the type III secretion system in Dickeya dadantii 3937. (United States)

    Zeng, Quan; Laiosa, Michael D; Steeber, Douglas A; Biddle, Eulandria M; Peng, Quan; Yang, Ching-Hong


    Dickeya dadantii 3937 is a gram-negative phytopathogenic bacterium that expresses genes encoding a type III secretion system (T3SS) in a bistable pattern when cultured in a homogeneous minimal media. In this work, we further characterized the bistable gene expression of T3SS at the single-cell level. We demonstrated that bistable expression of the HrpL-regulon genes, such as hrpA and hrpN, is controlled by the same regulatory mechanism. We also showed that the expression level of the T3SS master regulatory gene hrpL plays an important role in the development of the bistable expression of hrpA. A high expression level of hrpL is required but unable to guarantee the high-state expression of hrpA in a cell. In addition, bistable expression patterns of T3SS genes in other gram-negative pathogens of the Enterobacteriaceae and Pseudomonadaceae families were also described in this study. This suggests that the T3SS bistability might be a conserved population behavior in several gram-negative bacterial pathogens.

  12. Investigation of a bistable dual-stage vibration isolator under harmonic excitation

    International Nuclear Information System (INIS)

    Yang, Kai; Huang, Hai; Harne, R L; Wang, K W


    This study explores the steady-state performance of a dual-stage vibration isolator, which is configured by a bistable oscillator and a linear oscillator. The potential force of the bistable stage comprises negative linear and positive cubic nonlinear stiffnesses such that the two restoring force contributions may counterbalance to minimize dynamic force transmission. By applying a first-order harmonic balance, it is predicted that the bistable dual-stage isolator may significantly outperform an equivalent pure linear dual-stage isolator. This conclusion is verified through a series of numerical investigations. Following a parametric study, design guidelines are detailed to achieve performance improvements. Then, the ‘valley’ response, which is the special phenomenon of the bistable dual-stage isolator due to the counterbalance of the negative linear and positive nonlinear potential forces, is revealed and quantitatively explained. Numerical studies demonstrate the role of initial conditions, and it is shown that the likelihood of beneficial single periodic valley and intra-well responses for isolation purposes can be increased by greater bistable stage damping. Finally, a bistable dual-stage isolator prototype is developed and tested, and the numerical and experimental results verify the theoretical predictions. (paper)

  13. Magnetic-field induced bistability in a quasi-one-dimensional semiconductor microcavity

    International Nuclear Information System (INIS)

    Zhang, Chuanyi; Zhang, Weifeng


    We theoretically study the magnetic-field induced bistability in a quasi-one-dimensional semiconductor microcavity. A critical magnetic field is obtained, and the bistability appears if a magnetic field is greater than the critical value. For a positive energy detuning of the pump from the bare exciton polaritons, one bistability loop first emerges, then it divides into two loops, and finally one of them vanishes with the increasing magnetic field. This phenomenon originates from the magnetic-field modulated interactions for opposite spins. In the variational process, there are two important effects: one is a logic gate with a small variation of the excitation laser, and the other is a spin texture like skyrmion and this texture is periodic if the energy detuning varies periodically in real space, which is useful for designing the spin-dependent optoelectronic devices. - Highlights: • We study the bistability induced by a magnetic field in a microcavity. • One bistability loop can divide into two, and then the two loops return to one. • A spin texture like skyrmion and logic gate arise in the variation of bistability loop

  14. Induction of the mar operon by miscellaneous groceries. (United States)

    Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P


    To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

  15. The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis (United States)

    Kessler, Peter S.; Blank, Carrine; Leigh, John A.


    Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

  16. Power requirements reducing of FBG based all-optical switching (United States)

    Scholtz, Ľubomír.; Solanská, Michaela; Ladányi, Libor; Müllerová, Jarmila


    Although Fiber Bragg gratings (FBGs) are well known devices, their using as all-optical switching elements has been still examined. Current research is focused on optimization of their properties for their using in future all-optical networks. The main problem are high switching intensities needed for achieving the changes of the transmission state. Over several years switching intensities have been reduced from hundreds of GW/cm2 to tens of MW/cm2 by selecting appropriate gratings and signal parameters or using suitable materials. Two principal nonlinear effects with similar power requirements can result in the bistable transmission/reflection of an input optical pulse. In the self-phase modulation (SPM) regime switching is achieved by the intense probe pulse itself. Using cross-phase modulation (XPM) a strong pump alters the FBG refractive index experienced by a weak probe pulse. As a result of this the detuning of the probe pulse from the center of the photonic band gap occurs. Using of XPM the effect of modulation instability is reduced. Modulation instability which is the main SPM degradation mechanism. We focused on nonlinear FBGs based on chalcogenide glasses which are very often used in various applications. Thanks to high nonlinear parameters chalcogenide glasses are suitable candidates for reducing switching intensities of nonlinear FBGs.

  17. The effect of magnetic field on bistability in 1D photonic crystal doped by magnetized plasma and coupled nonlinear defects

    International Nuclear Information System (INIS)

    Mehdian, H.; Mohammadzahery, Z.; Hasanbeigi, A.


    In this work, we study the defect mode and bistability behavior of 1-D photonic band gap structure with magnetized plasma and coupled nonlinear defects. The transfer matrix method has been employed to investigate the magnetic field effect on defect mode frequency and bistability threshold. The obtained results show that the frequency of defect mode and bistability threshold can be altered, without changing the structure of the photonic multilayer. Therefore, the bistability behavior of the subjected structure in the presence of magnetized plasma can be utilized in manufacturing wide frequency range devices

  18. Influence of Fano interference and incoherent processes on optical bistability in a four-level quantum dot nanostructure

    International Nuclear Information System (INIS)

    Hossein Asadpour, Seyyed; Solookinejad, G; Panahi, M; Ahmadi Sangachin, E


    Role of Fano interference and incoherent pumping field on optical bistability in a four-level designed InGaN/GaN quantum dot nanostructure embedded in a unidirectional ring cavity are analyzed. It is found that intensity threshold of optical bistability can be manipulated by Fano interference. It is shown that incoherent pumping fields make the threshold of optical bistability behave differently by Fano interference. Moreover, in the presence of Fano interference the medium becomes phase-dependent. Therefore, the relative phase of applied fields can affect the behaviors of optical bistability and intensity threshold can be controlled easily. (paper)

  19. Ultra-fast all-optical plasmonic switching in near infra-red spectrum using a Kerr nonlinear ring resonator (United States)

    Nurmohammadi, Tofiq; Abbasian, Karim; Yadipour, Reza


    In this paper, an all-optical plasmonic switch based on metal-insulator-metal (MIM) nanoplasmonic waveguide with a Kerr nonlinear ring resonator is introduced and studied. Two-dimensional simulations utilizing the finite-difference time-domain algorithm are used to demonstrate an apparent optical bistability and significant switching mechanisms (in enabled-low condition: T(ON/OFF) =21.9 and in enabled-high condition: T(ON/OFF) =24.9) of the signal light arisen by altering the pump-light intensity. The proposed all-optical switching demonstrates femtosecond-scale feedback time (90 fs) and then ultra-fast switching can be achieved. The offered all-optical switch may recognize potential significant applications in integrated optical circuits.

  20. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)



    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  1. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa. (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia


    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  2. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis. (United States)

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo


    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  3. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes. (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L


    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  4. Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS. (United States)

    Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh


    Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

  5. Switched on!

    CERN Multimedia


    Like a star arriving on stage, impatiently followed by each member of CERN personnel and by millions of eyes around the world, the first beam of protons has circulated in the LHC. After years in the making and months of increasing anticipation, today the work of hundreds of people has borne fruit. WELL DONE to all! Successfully steered around the 27 kilometres of the world’s most powerful particle accelerator at 10:28 this morning, this first beam of protons circulating in the ring marks a key moment in the transition from over two decades of preparation to a new era of scientific discovery. "It’s a fantastic moment," said the LHC project leader Lyn Evans, "we can now look forward to a new era of understanding about the origins and evolution of the universe". Starting up a major new particle accelerator takes much more than flipping a switch. Thousands of individual elements have to work in harmony, timings have to be synchronize...

  6. Conditional bistability, a generic cellular mnemonic mechanism for robust and flexible working memory computations. (United States)

    Rodriguez, Guillaume; Sarazin, Matthieu; Clemente, Alexandra; Holden, Stephanie; Paz, Jeanne T; Delord, Bruno


    Persistent neural activity, the substrate of working memory, is thought to emerge from synaptic reverberation within recurrent networks. However, reverberation models do not robustly explain fundamental dynamics of persistent activity, including high-spiking irregularity, large intertrial variability, and state transitions. While cellular bistability may contribute to persistent activity, its rigidity appears incompatible with persistent activity labile characteristics. Here, we unravel in a cellular model a form of spike-mediated conditional bistability that is robust, generic and provides a rich repertoire of mnemonic computations. Under asynchronous synaptic inputs of the awakened state, conditional bistability generates spiking/bursting episodes, accounting for the irregularity, variability and state transitions characterizing persistent activity. This mechanism has likely been overlooked because of the sub-threshold input it requires and we predict how to assess it experimentally. Our results suggest a reexamination of the role of intrinsic properties in the collective network dynamics responsible for flexible working memory. SIGNIFICANCE STATEMENT This study unravels a novel form of intrinsic neuronal property, i.e. conditional bistability. We show that, thanks of its conditional character, conditional bistability favors the emergence of flexible and robust forms of persistent activity in PFC neural networks, in opposition to previously studied classical forms of absolute bistability. Specifically, we demonstrate for the first time that conditional bistability 1) is a generic biophysical spike-dependent mechanism of layer V pyramidal neurons in the PFC and that 2) it accounts for essential neurodynamical features for the organisation and flexibility of PFC persistent activity (the large irregularity and intertrial variability of the discharge and its organization under discrete stable states), which remain unexplained in a robust fashion by current models

  7. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald


    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  8. Digital switched hydraulics (United States)

    Pan, Min; Plummer, Andrew


    This paper reviews recent developments in digital switched hydraulics particularly the switched inertance hydraulic systems (SIHSs). The performance of SIHSs is presented in brief with a discussion of several possible configurations and control strategies. The soft switching technology and high-speed switching valve design techniques are discussed. Challenges and recommendations are given based on the current research achievements.

  9. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  10. The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution. (United States)

    Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús


    Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.


    NARCIS (Netherlands)


    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  12. All-polymer bistable resistive memory device based on nanoscale phase-separated PCBM-ferroelectric blends

    KAUST Repository

    Khan, Yasser


    All polymer nonvolatile bistable memory devices are fabricated from blends of ferroelectric poly(vinylidenefluoride-trifluoroethylene (P(VDF-TrFE)) and n-type semiconducting [6,6]-phenyl-C61-butyric acid methyl ester (PCBM). The nanoscale phase separated films consist of PCBM domains that extend from bottom to top electrode, surrounded by a ferroelectric P(VDF-TrFE) matrix. Highly conducting poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) polymer electrodes are used to engineer band offsets at the interfaces. The devices display resistive switching behavior due to modulation of this injection barrier. With careful optimization of the solvent and processing conditions, it is possible to spin cast very smooth blend films (Rrms ≈ 7.94 nm) and with good reproducibility. The devices exhibit high Ion/I off ratios (≈3 × 103), low read voltages (≈5 V), excellent dielectric response at high frequencies (Ïμr ≈ 8.3 at 1 MHz), and excellent retention characteristics up to 10 000 s. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Modeling reveals bistability and low-pass filtering in the network module determining blood stem cell fate.

    Directory of Open Access Journals (Sweden)

    Jatin Narula


    Full Text Available Combinatorial regulation of gene expression is ubiquitous in eukaryotes with multiple inputs converging on regulatory control elements. The dynamic properties of these elements determine the functionality of genetic networks regulating differentiation and development. Here we propose a method to quantitatively characterize the regulatory output of distant enhancers with a biophysical approach that recursively determines free energies of protein-protein and protein-DNA interactions from experimental analysis of transcriptional reporter libraries. We apply this method to model the Scl-Gata2-Fli1 triad-a network module important for cell fate specification of hematopoietic stem cells. We show that this triad module is inherently bistable with irreversible transitions in response to physiologically relevant signals such as Notch, Bmp4 and Gata1 and we use the model to predict the sensitivity of the network to mutations. We also show that the triad acts as a low-pass filter by switching between steady states only in response to signals that persist for longer than a minimum duration threshold. We have found that the auto-regulation loops connecting the slow-degrading Scl to Gata2 and Fli1 are crucial for this low-pass filtering property. Taken together our analysis not only reveals new insights into hematopoietic stem cell regulatory network functionality but also provides a novel and widely applicable strategy to incorporate experimental measurements into dynamical network models.

  14. Rac1 and RhoA: Networks, loops and bistability. (United States)

    Nguyen, Lan K; Kholodenko, Boris N; von Kriegsheim, Alex


    Cell migration requires a precise temporal and spatial coordination of several processes which allow the cell to efficiently move. The extension and retraction of membrane protrusion, as well as adhesion are controlled by the Rho-family small GTPases. Two members of the family, Rac1 and RhoA, can show opposite behaviors and spatial localisations, with RhoA being active toward the rear of the cell and regulating its retraction during migration, whereas Rac1 is active toward the front of the cell. In addition to the spatial segregation, RhoA and Rac1 activity at the leading edge of the cells has an element of temporal segregation, with RhoA and Rac1 activities peaking at separate points during the migratory cycle of protrusion and retraction. Elements of this separation have been explained by the presence of 2 mutually inhibitory feedbacks, where Rac1 inhibits RhoA and RhoA in turn can inhibit Rac1. Recently, it was shown that Rac1 and RhoA activity and downstream signaling respond in a bistable manner to perturbations of this network.

  15. Hindrances to bistable front propagation: application to Wolbachia invasion. (United States)

    Nadin, Grégoire; Strugarek, Martin; Vauchelet, Nicolas


    We study the biological situation when an invading population propagates and replaces an existing population with different characteristics. For instance, this may occur in the presence of a vertically transmitted infection causing a cytoplasmic effect similar to the Allee effect (e.g. Wolbachia in Aedes mosquitoes): the invading dynamics we model is bistable. We aim at quantifying the propagules (what does it take for an invasion to start?) and the invasive power (how far can an invading front go, and what can stop it?). We rigorously show that a heterogeneous environment inducing a strong enough population gradient can stop an invading front, which will converge in this case to a stable front. We characterize the critical population jump, and also prove the existence of unstable fronts above the stable (blocking) fronts. Being above the maximal unstable front enables an invading front to clear the obstacle and propagate further. We are particularly interested in the case of artificial Wolbachia infection, used as a tool to fight arboviruses.

  16. Nonlinear response and bistability of driven ion acoustic waves (United States)

    Akbari-Moghanjoughi, M.


    The hydrodynamic model is used to obtain a generalized pseudoforce equation through which the nonlinear response of periodically driven ion acoustic waves is studied in an electron-ion plasma with isothermal and adiabatic ion fluids. The pseudotime series, corresponding to different driving frequencies, indicates that nonlinearity effects appear more strongly for smaller frequency values. The existence of extra harmonic resonances in the nonlinear amplitude spectrum is a clear indication of the interaction of an external force with harmonic components of the nonlinear ion acoustic waves. It is shown that many plasma parameters significantly and differently affect the nonlinear resonance spectrum of ion acoustic excitations. A heuristic but accurate model for the foldover effect is used which quite satisfactorily predicts the bistability of driven plasma oscillations. It is remarked that the characteristic resonance peak of isothermal ion plasma oscillations appears at lower frequencies but is stronger compared to that of adiabatic ions. Comparison of the exact numerical results for fully nonlinear and approximate (weakly nonlinear) models indicates that a weakly nonlinear model exaggerates the hysteresis and jump phenomenon for higher values of the external force amplitude.

  17. Maximizing direct current power delivery from bistable vibration energy harvesting beams subjected to realistic base excitations (United States)

    Dai, Quanqi; Harne, Ryan L.


    Effective development of vibration energy harvesters is required to convert ambient kinetic energy into useful electrical energy as power supply for sensors, for example in structural health monitoring applications. Energy harvesting structures exhibiting bistable nonlinearities have previously been shown to generate large alternating current (AC) power when excited so as to undergo snap-through responses between stable equilibria. Yet, most microelectronics in sensors require rectified voltages and hence direct current (DC) power. While researchers have studied DC power generation from bistable energy harvesters subjected to harmonic excitations, there remain important questions as to the promise of such harvester platforms when the excitations are more realistic and include both harmonic and random components. To close this knowledge gap, this research computationally and experimentally studies the DC power delivery from bistable energy harvesters subjected to such realistic excitation combinations as those found in practice. Based on the results, it is found that the ability for bistable energy harvesters to generate peak DC power is significantly reduced by introducing sufficient amount of stochastic excitations into an otherwise harmonic input. On the other hand, the elimination of a low amplitude, coexistent response regime by way of the additive noise promotes power delivery if the device was not originally excited to snap-through. The outcomes of this research indicate the necessity for comprehensive studies about the sensitivities of DC power generation from bistable energy harvester to practical excitation scenarios prior to their optimal deployment in applications.

  18. Bistability induces episodic spike communication by inhibitory neurons in neuronal networks. (United States)

    Kazantsev, V B; Asatryan, S Yu


    Bistability is one of the important features of nonlinear dynamical systems. In neurodynamics, bistability has been found in basic Hodgkin-Huxley equations describing the cell membrane dynamics. When the neuron is clamped near its threshold, the stable rest potential may coexist with the stable limit cycle describing periodic spiking. However, this effect is often neglected in network computations where the neurons are typically reduced to threshold firing units (e.g., integrate-and-fire models). We found that the bistability may induce spike communication by inhibitory coupled neurons in the spiking network. The communication is realized in the form of episodic discharges with synchronous (correlated) spikes during the episodes. A spiking phase map is constructed to describe the synchronization and to estimate basic spike phase locking modes.

  19. A computational role for bistability and traveling waves in motor cortex

    Directory of Open Access Journals (Sweden)

    Stewart eHeitmann


    Full Text Available Adaptive changes in behavior require rapid changes in brain states yet the brain must also remain stable. We investigated two neural mechanisms for evoking rapid transitions between spatiotemporal synchronization patterns of beta oscillations (13--30Hz in motor cortex. Cortex was modeled as a sheet of neural oscillators that were spatially coupled using a center-surround connection topology. Manipulating the inhibitory surround was found to evoke reliable transitions between synchronous oscillation patterns and traveling waves. These transitions modulated the simulated local field potential in agreement with physiological observations in humans. Intermediate levels of surround inhibition were also found to produce bistable coupling topologies that supported both waves and synchrony. State-dependent perturbation between bistable states produced very rapid transitions but were less reliable. We surmise that motor cortex may thus employ state-dependent computation to achieve very rapid changes between bistable motor states when the demand for speed exceeds the demand for accuracy.

  20. Dynamic and energetic characteristics of a bistable piezoelectric vibration energy harvester with an elastic magnifier (United States)

    Wang, Guangqing; Liao, Wei-Hsin; Yang, Binqiang; Wang, Xuebao; Xu, Wentan; Li, Xiuling


    Bistable piezoelectric energy harvesters are being increasingly seen as an alternative to batteries in low-power devices. However, their energy harvesting characteristics are limited. To enhance these, we use a configuration including an elastic magnifier to amplify base excitation and provide sufficient kinetic energy to overcome potential well barriers, thus leading to large-amplitude bistable motion. We derive the distributed parameter mathematical model of this configuration by using Hamilton's principle. We then investigate the nonlinear dynamic behaviors and energetic characteristics and analyze the bifurcation for the equilibrium solution of the model. The simulations and experiments show high electromechanical responses and energy generation characteristics of the proposed system over a broad frequency band. The results suggest that, compared with a typical bistable piezoelectric energy harvester, the proposed energy harvester system with an elastic magnifier can provide higher output over a broader frequency band at lower excitation levels by adjusting the system's mass and stiffness ratios.

  1. Experimental Analysis of a Coupled Energy Harvesting System with Monostable and Bistable Configuration

    International Nuclear Information System (INIS)

    Hoffmann, D; Folkmer, B; Manoli, Y


    In this paper we present experimental results from an energy harvesting system with two coupled energy harvesters. The energy conversion mechanism of the two coupled energy harvesters is based on the electromagnetic principle. The coupling is generated by two magnets in a repulsive arrangement. In this manner a bistable configuration can be obtained if the gap between the magnets is sufficiently small. We demonstrate that the total power output can be increased in comparison to a linear reference system, if specific conditions are fulfilled. In this respect, the highest power output occurs in the nonlinear region of a monostable system configuration, mostly near the transition to a bistable configuration. On the other hand, the results also indicate, that a bistable operating mode does not necessarily enhance the power output of the coupled system

  2. Orientational transitions in ferromagnetic liquid crystals with bistable coupling between colloidal particles and the matrix

    Energy Technology Data Exchange (ETDEWEB)

    Zakhlevnykh, A. N., E-mail:; Petrov, D. A. [Perm State National Research University (Russian Federation)


    We study the orientational response of a ferromagnetic liquid crystal that is induced by magnetic and electric fields. A modified form of the energy of the orientational interaction between magnetic impurity particles and the liquid crystal matrix that leads to bistable coupling is considered. It is shown that apart from magnetic impurity segregation, first-order orientational transitions can be due to the bistability of the potential of the orientational coupling between the director and the magnetization. The ranges of material parameters that lead to optical bistability are determined. The possibility of first-order orientational transitions is analyzed for the optical phase difference between the ordinary and extraordinary light rays transmitted through a ferronematic cell. It is shown that an electric field applied in the given geometry considerably enhances the magneto-orientational response of the ferronematic.

  3. Dynamics of interface in three-dimensional anisotropic bistable reaction-diffusion system

    International Nuclear Information System (INIS)

    He Zhizhu; Liu, Jing


    This paper presents a theoretical investigation of dynamics of interface (wave front) in three-dimensional (3D) reaction-diffusion (RD) system for bistable media with anisotropy constructed by means of anisotropic surface tension. An equation of motion for the wave front is derived to carry out stability analysis of transverse perturbations, which discloses mechanism of pattern formation such as labyrinthine in 3D bistable media. Particularly, the effects of anisotropy on wave propagation are studied. It was found that, sufficiently strong anisotropy can induce dynamical instabilities and lead to breakup of the wave front. With the fast-inhibitor limit, the bistable system can further be described by a variational dynamics so that the boundary integral method is adopted to study the dynamics of wave fronts.

  4. Large Out-of-Plane Displacement Bistable Electromagnetic Microswitch on a Single Wafer. (United States)

    Miao, Xiaodan; Dai, Xuhan; Huang, Yi; Ding, Guifu; Zhao, Xiaolin


    This paper presents a bistable microswitch fully batch-fabricated on a single glass wafer, comprising of a microactuator, a signal transformer, a microspring and a permanent magnet. The bistable mechanism of the microswitch with large displacement of 160 μm depends on the balance of the magnetic force and elastic force. Both the magnetic force and elastic force were optimized by finite-element simulation to predict the reliable of the device. The prototype was fabricated and characterized. By utilizing thick laminated photoresist sacrificial layer, the large displacement was obtained to ensure the insulation of the microswitch. The testing results show that the microswitch realized the bistable mechanism at a 3-5 V input voltage and closed in 0.96 ms, which verified the simulation.

  5. Bistable out-of-plane stress-mismatched thermally actuated bilayer devices with large deflection

    International Nuclear Information System (INIS)

    Goessling, B A; Lucas, T M; Moiseeva, E V; Aebersold, J W; Harnett, C K


    In this paper, we explore microfabricated bistable actuators released as thin films from a silicon wafer. The actuators are based on a serpentine design where two cantilevers are coupled at the tips by a thin-film bar. These devices are parameterized by two lengths: cantilever length and the length of the coupling bar. These two dimensions are systematically varied to study the effect of design parameters on bistability. The three-dimensional devices have extremely large deflection (hundreds of microns rather than tens of microns for most planar microactuators of similar size) and are thermally actuated out of the plane of the wafer by applying a bias across either the left or right side of the serpentine. The bistability of these devices is evaluated using electron and optical microscopy. Potential applications include non-volatile mechanical memory, optical shutters, and reconfigurable antenna elements

  6. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus. (United States)

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O


    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail:

  7. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.


    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  8. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility. (United States)

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M


    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  9. The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

    NARCIS (Netherlands)

    Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.


    The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

  10. clpC operon regulates cell architecture and sporulation in Bacillus anthracis. (United States)

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra


    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  11. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

    Czech Academy of Sciences Publication Activity Database

    Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav


    Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

  12. Decreases in average bacterial community rRNA operon copy number during succession. (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R


    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  13. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš


    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  14. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.


    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  15. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.


    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  16. Propensity for Bistability of Bursting and Silence in the Leech Heart Interneuron

    Directory of Open Access Journals (Sweden)

    Tatiana Dashevskiy


    Full Text Available The coexistence of neuronal activity regimes has been reported under normal and pathological conditions. Such multistability could enhance the flexibility of the nervous system and has many implications for motor control, memory, and decision making. Multistability is commonly promoted by neuromodulation targeting specific membrane ionic currents. Here, we investigated how modulation of different ionic currents could affect the neuronal propensity for bistability. We considered a leech heart interneuron model. It exhibits bistability of bursting and silence in a narrow range of the leak current parameters, conductance (gleak and reversal potential (Eleak. We assessed the propensity for bistability of the model by using bifurcation diagrams. On the diagram (gleak, Eleak, we mapped bursting and silent regimes. For the canonical value of Eleak we determined the range of gleak which supported the bistability. We use this range as an index of propensity for bistability. We investigated how this index was affected by alterations of ionic currents. We systematically changed their conductances, one at a time, and built corresponding bifurcation diagrams in parameter planes of the maximal conductance of a given current and the leak conductance. We found that conductance of only one current substantially affected the index of propensity; the increase of the maximal conductance of the hyperpolarization-activated cationic current increased the propensity index. The second conductance with the strongest effect was the conductance of the low-threshold fast Ca2+ current; its reduction increased the propensity index although the effect was about two times smaller in magnitude. Analyzing the model with both changes applied simultaneously, we found that the diagram (gleak, Eleak showed a progressively expanded area of bistability of bursting and silence.

  17. Latching micro optical switch (United States)

    Garcia, Ernest J; Polosky, Marc A


    An optical switch reliably maintains its on or off state even when subjected to environments where the switch is bumped or otherwise moved. In addition, the optical switch maintains its on or off state indefinitely without requiring external power. External power is used only to transition the switch from one state to the other. The optical switch is configured with a fixed optical fiber and a movable optical fiber. The movable optical fiber is guided by various actuators in conjunction with a latching mechanism that configure the switch in one position that corresponds to the on state and in another position that corresponds to the off state.

  18. Tuning the resistive switching memory in a metal–ferroelectric–semiconductor capacitor by field effect structure

    Energy Technology Data Exchange (ETDEWEB)

    Wang, S.Y., E-mail: [College of Physics and Electronic Information Science, Tianjin Normal University, Tianjin 300074 (China); Guo, F.; Wang, X. [College of Physics and Electronic Information Science, Tianjin Normal University, Tianjin 300074 (China); Liu, W.F., E-mail: [Department of Applied Physics, Faculty of Science, Tianjin University, Weijin Road, Nankai District, Tianjin 300072 (China); Gao, J., E-mail: [Department of Physics, the University of Hong Kong, Pokfulam Road (Hong Kong)


    Highlights: • Bistable or tristable electrically conducting state is observed. • Coefficient can be tuned in situ by modulating carrier's density. • The RS effects may be of significance for multi-source controlled memory devices. - Abstract: Resistive switching (RS) effects based on a correlation between ferroelectric polarization and conductivity might become of particular interest for nonvolatile memory applications, because they are not subjected to the scaling restrictions. Here we report on RS behaviors modulated by a reversal of ferroelectric polarization in heterostructures comprising of a ferroelectric layer and a semiconducting manganite film. It is found that electrically conducting state is bistable or even tristable; and via the polarization flipping, a maximum resistive switching coefficient (R{sub max}/R{sub min}) is found to be larger than 3000 with bias of 6 V in Ag/BaTiO{sub 3}/La{sub 0.8}Ca{sub 0.2}MnO{sub 3} at room temperature. More importantly, employing field-effect structure with ferroelectric PMN-PT as substrate, we found that the resistive switching behaviors can be tuned in situ by modulating the concentration of carriers in the semiconducting manganite layer. Possible mechanisms are discussed on the basis of the interplay of bound ferroelectric charges, charged defects in ferroelectric layer and mobile carriers in manganite thin films. The giant RS effects observed here may be of significance for memory devices by combing electronic conduction with magnetic, spintronic, and optical functionalities.

  19. Breaking an epigenetic chromatin switch: curious features of hysteresis in Saccharomyces cerevisiae telomeric silencing.

    Directory of Open Access Journals (Sweden)

    Vijayalakshmi H Nagaraj

    Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.

  20. Transitions in genetic toggle switches driven by dynamic disorder in rate coefficients

    International Nuclear Information System (INIS)

    Chen, Hang; Thill, Peter; Cao, Jianshu


    In biochemical systems, intrinsic noise may drive the system switch from one stable state to another. We investigate how kinetic switching between stable states in a bistable network is influenced by dynamic disorder, i.e., fluctuations in the rate coefficients. Using the geometric minimum action method, we first investigate the optimal transition paths and the corresponding minimum actions based on a genetic toggle switch model in which reaction coefficients draw from a discrete probability distribution. For the continuous probability distribution of the rate coefficient, we then consider two models of dynamic disorder in which reaction coefficients undergo different stochastic processes with the same stationary distribution. In one, the kinetic parameters follow a discrete Markov process and in the other they follow continuous Langevin dynamics. We find that regulation of the parameters modulating the dynamic disorder, as has been demonstrated to occur through allosteric control in bistable networks in the immune system, can be crucial in shaping the statistics of optimal transition paths, transition probabilities, and the stationary probability distribution of the network.

  1. Transitions in genetic toggle switches driven by dynamic disorder in rate coefficients

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Hang, E-mail:; Thill, Peter; Cao, Jianshu [Department of Chemistry, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)


    In biochemical systems, intrinsic noise may drive the system switch from one stable state to another. We investigate how kinetic switching between stable states in a bistable network is influenced by dynamic disorder, i.e., fluctuations in the rate coefficients. Using the geometric minimum action method, we first investigate the optimal transition paths and the corresponding minimum actions based on a genetic toggle switch model in which reaction coefficients draw from a discrete probability distribution. For the continuous probability distribution of the rate coefficient, we then consider two models of dynamic disorder in which reaction coefficients undergo different stochastic processes with the same stationary distribution. In one, the kinetic parameters follow a discrete Markov process and in the other they follow continuous Langevin dynamics. We find that regulation of the parameters modulating the dynamic disorder, as has been demonstrated to occur through allosteric control in bistable networks in the immune system, can be crucial in shaping the statistics of optimal transition paths, transition probabilities, and the stationary probability distribution of the network.

  2. Remnants of semiclassical bistability in the few-photon regime of cavity QED. (United States)

    Kerckhoff, Joseph; Armen, Michael A; Mabuchi, Hideo


    Broadband homodyne detection of the light transmitted by a Fabry-Perot cavity containing a strongly-coupled (133)Cs atom is used to probe the dynamic optical response in a regime where semiclassical theory predicts bistability but strong quantum corrections should apply. While quantum fluctuations destabilize true equilibrium bistability, our observations confirm the existence of metastable states with finite lifetimes and a hysteretic response is apparent when the optical drive is modulated on comparable timescales. Our experiment elucidates remnant semiclassical behavior in the attojoule (~10 photon) regime of single-atom cavity QED, of potential significance for ultra-low power photonic signal processing. © 2011 Optical Society of America

  3. A silicon-nanowire memory driven by optical gradient force induced bistability

    Energy Technology Data Exchange (ETDEWEB)

    Dong, B. [School of Electrical and Electronic Engineering, Nanyang Technological University, Singapore 639798 (Singapore); Institute of Microelectronics, A*STAR (Agency for Science, Technology and Research), Singapore 117685 (Singapore); Cai, H., E-mail:; Gu, Y. D.; Kwong, D. L. [Institute of Microelectronics, A*STAR (Agency for Science, Technology and Research), Singapore 117685 (Singapore); Chin, L. K.; Ng, G. I.; Ser, W. [School of Electrical and Electronic Engineering, Nanyang Technological University, Singapore 639798 (Singapore); Huang, J. G. [School of Electrical and Electronic Engineering, Nanyang Technological University, Singapore 639798 (Singapore); Institute of Microelectronics, A*STAR (Agency for Science, Technology and Research), Singapore 117685 (Singapore); School of Mechanical Engineering, Xi' an Jiaotong University, Xi' an 710049 (China); Yang, Z. C. [School of Electronics Engineering and Computer Science, Peking University, Beijing 100871 (China); Liu, A. Q., E-mail: [School of Electrical and Electronic Engineering, Nanyang Technological University, Singapore 639798 (Singapore); School of Electronics Engineering and Computer Science, Peking University, Beijing 100871 (China)


    In this paper, a bistable optical-driven silicon-nanowire memory is demonstrated, which employs ring resonator to generate optical gradient force over a doubly clamped silicon-nanowire. Two stable deformation positions of a doubly clamped silicon-nanowire represent two memory states (“0” and “1”) and can be set/reset by modulating the light intensity (<3 mW) based on the optical force induced bistability. The time response of the optical-driven memory is less than 250 ns. It has applications in the fields of all optical communication, quantum computing, and optomechanical circuits.

  4. Bistability of self-modulation oscillations in an autonomous solid-state ring laser

    International Nuclear Information System (INIS)

    Dudetskii, V Yu


    Bistable self-modulation regimes of generation for a ring YAG : Nd chip laser with the counterpropagating waves asymmetrically coupled via backward scattering are simulated numerically. Two branches of bistable self-modulation regimes of generation are found in the domain of the parametric resonance between the selfmodulation and relaxation oscillations. The self-modulation regimes observed in earlier experiments pertain to only one of the branches. Possible reasons for such a discrepancy are considered, related to the influence of technical and natural noise on the dynamics of solid-state ring lasers. (control of laser radiation parameters)

  5. Toward Singlet-Triplet Bistable Nonalternant Kekulé Hydrocarbons: Azulene-to-Naphthalene Rearrangement. (United States)

    Das, Soumyajit; Wu, Jishan


    Recent developments of open-shell singlet diradicaloids motivated the search for stable singlet-triplet bistable nonalternant polycyclic hydrocarbons. During the synthesis of this type of molecule, such as the dibenzo-cyclohepta[def]fluorene 3, an unexpected azulene-to-naphthalene rearrangement was observed at room temperature, which resulted in new nonalternant hydrocarbons 8a/8b with a closed-shell singlet ground state. These studies provided insight into the unique chemistry of azulene and challenges for the synthesis of singlet-triplet bistable polycyclic hydrocarbons.

  6. Chimeralike states in networks of bistable time-delayed feedback oscillators coupled via the mean field. (United States)

    Ponomarenko, V I; Kulminskiy, D D; Prokhorov, M D


    We study the collective dynamics of oscillators in a network of identical bistable time-delayed feedback systems globally coupled via the mean field. The influence of delay and inertial properties of the mean field on the collective behavior of globally coupled oscillators is investigated. A variety of oscillation regimes in the network results from the presence of bistable states with substantially different frequencies in coupled oscillators. In the physical experiment and numerical simulation we demonstrate the existence of chimeralike states, in which some of the oscillators in the network exhibit synchronous oscillations, while all other oscillators remain asynchronous.

  7. Optically levitated nanoparticle as a model system for stochastic bistable dynamics. (United States)

    Ricci, F; Rica, R A; Spasenović, M; Gieseler, J; Rondin, L; Novotny, L; Quidant, R


    Nano-mechanical resonators have gained an increasing importance in nanotechnology owing to their contributions to both fundamental and applied science. Yet, their small dimensions and mass raises some challenges as their dynamics gets dominated by nonlinearities that degrade their performance, for instance in sensing applications. Here, we report on the precise control of the nonlinear and stochastic bistable dynamics of a levitated nanoparticle in high vacuum. We demonstrate how it can lead to efficient signal amplification schemes, including stochastic resonance. This work contributes to showing the use of levitated nanoparticles as a model system for stochastic bistable dynamics, with applications to a wide variety of fields.

  8. Study on non-linear bistable dynamics model based EEG signal discrimination analysis method. (United States)

    Ying, Xiaoguo; Lin, Han; Hui, Guohua


    Electroencephalogram (EEG) is the recording of electrical activity along the scalp. EEG measures voltage fluctuations generating from ionic current flows within the neurons of the brain. EEG signal is looked as one of the most important factors that will be focused in the next 20 years. In this paper, EEG signal discrimination based on non-linear bistable dynamical model was proposed. EEG signals were processed by non-linear bistable dynamical model, and features of EEG signals were characterized by coherence index. Experimental results showed that the proposed method could properly extract the features of different EEG signals.

  9. Bistable dynamics underlying excitability of ion homeostasis in neuron models.

    Directory of Open Access Journals (Sweden)

    Niklas Hübel


    Full Text Available When neurons fire action potentials, dissipation of free energy is usually not directly considered, because the change in free energy is often negligible compared to the immense reservoir stored in neural transmembrane ion gradients and the long-term energy requirements are met through chemical energy, i.e., metabolism. However, these gradients can temporarily nearly vanish in neurological diseases, such as migraine and stroke, and in traumatic brain injury from concussions to severe injuries. We study biophysical neuron models based on the Hodgkin-Huxley (HH formalism extended to include time-dependent ion concentrations inside and outside the cell and metabolic energy-driven pumps. We reveal the basic mechanism of a state of free energy-starvation (FES with bifurcation analyses showing that ion dynamics is for a large range of pump rates bistable without contact to an ion bath. This is interpreted as a threshold reduction of a new fundamental mechanism of ionic excitability that causes a long-lasting but transient FES as observed in pathological states. We can in particular conclude that a coupling of extracellular ion concentrations to a large glial-vascular bath can take a role as an inhibitory mechanism crucial in ion homeostasis, while the Na⁺/K⁺ pumps alone are insufficient to recover from FES. Our results provide the missing link between the HH formalism and activator-inhibitor models that have been successfully used for modeling migraine phenotypes, and therefore will allow us to validate the hypothesis that migraine symptoms are explained by disturbed function in ion channel subunits, Na⁺/K⁺ pumps, and other proteins that regulate ion homeostasis.

  10. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress. (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula


    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  11. Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Sun Yuan


    Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

  12. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.


    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  13. Voltage-induced switching with magnetoresistance signature in magnetic nano-filaments

    International Nuclear Information System (INIS)

    Sokolov, A; Sabirianov, I; Sabirianov, R; Doudin, B


    Large hysteretic resistance changes are reported on sub-100 nm diameter metallic nanowires including thin dielectric junctions. Bi-stable 50% switching in a double junction geometry is modeled in terms of an occupation-driven metal-insulator transition in one of the two junctions, using the generalized Poisson expressions of Oka and Nagaosa (2005 Phys. Rev. Lett. 95 266403). It illustrates how a band bending scheme can be generalized for strongly correlated electron systems. The magnetic constituents of the nanowires provide a magnetoresistive signature of the two resistance states, confirming our model and enabling a four states device application.

  14. Field-Controlled Electrical Switch with Liquid Metal. (United States)

    Wissman, James; Dickey, Michael D; Majidi, Carmel


    When immersed in an electrolyte, droplets of Ga-based liquid metal (LM) alloy can be manipulated in ways not possible with conventional electrocapillarity or electrowetting. This study demonstrates how LM electrochemistry can be exploited to coalesce and separate droplets under moderate voltages of ~1-10 V. This novel approach to droplet interaction can be explained with a theory that accounts for oxidation and reduction as well as fluidic instabilities. Based on simulations and experimental analysis, this study finds that droplet separation is governed by a unique limit-point instability that arises from gradients in bipolar electrochemical reactions that lead to gradients in interfacial tension. The LM coalescence and separation are used to create a field-programmable electrical switch. As with conventional relays or flip-flop latch circuits, the system can transition between bistable (separated or coalesced) states, making it useful for memory storage, logic, and shape-programmable circuitry using entirely liquids instead of solid-state materials.

  15. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria


    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

  16. UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

    International Nuclear Information System (INIS)

    Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.


    UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

  17. A Strategy for Magnifying Vibration in High-Energy Orbits of a Bistable Oscillator at Low Excitation Levels

    International Nuclear Information System (INIS)

    Wang Guang-Qing; Liao Wei-Hsin


    This work focuses on how to maintain a high-energy orbit motion of a bistable oscillator when subjected to a low level excitation. An elastic magnifier (EM) positioned between the base and the bistable oscillator is used to magnify the base vibration displacement to significantly enhance the output characteristics of the bistable oscillator. The dimensionless electromechanical equations of the bistable oscillator with an EM are derived, and the effects of the mass and stiffness ratios between the EM and the bistable oscillator on the output displacement are studied. It is shown that the jump phenomenon occurs at a lower excitation level with increasing the mass and stiffness ratios. With the comparison of the displacement trajectories and the phase portraits obtained from experiments, it is validated that the bistable oscillator with an EM can effectively oscillate in a high-energy orbit and can generate a superior output vibration at a low excitation level as compared with the bistable oscillator without an EM. (paper)

  18. On bistable states retention in ferroelectric Langmuir-Blodgett films (United States)

    Geivandov, A. R.; Palto, S. P.; Yudin, S. G.; Fridkin, V. M.; Blinov, L. M.; Ducharme, S.


    A new insight into the nature of ferroelectricity is emerging from the study of ultra-thin ferroelectric films prepared of poly(vinylidene fluoride with trifluoroethylene) copolymer using Langmuir-Blodgett (LB) technique. Unique properties of these films indicate the existence of two-dimensional ferroelectricity. The retention of two polarized states in ferroelectric polymer LB films is studied using nonlinear dielectric spectroscopy. The technique is based on phase sensitive measurements of nonlinear dielectric spectroscopy. The amplitude of the current response at the 2nd harmonic of the applied voltage is proportional to the magnitude of the remnant polarization, while its phase gives the sign. We have found that 10 - 20 mm thick LB films can show fast switching time and long retention of the two polarized states. Nevertheless, LB films show a pronounced asymmetry in switching to the opposite states. Possible mechanisms of such behavior are discussed.

  19. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance. (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan


    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

  20. First-passage time in a bistable potential with colored noise

    International Nuclear Information System (INIS)

    Ramirez-Piscina, L.; Maria Sancho, J.; Javier de la Rubia, F.; Lindenberg, K.; Tsironis, G.P.


    A precise digital simulation of a bistable system under the effect of colored noise is carried out. A set of data for the mean first-passage time is obtained. The results are interpreted and compared with presently available theories, which are revisited following a new insight. Discrepancies that have been discussed in the literature are understood within our framework