On-Demand Final State Control of a Surface-Bound Bistable Single Molecule Switch.

Science.gov (United States)

Garrido Torres, José A; Simpson, Grant J; Adams, Christopher J; Früchtl, Herbert A; Schaub, Renald

2018-04-12

Modern electronic devices perform their defined action because of the complete reliability of their individual active components (transistors, switches, diodes, and so forth). For instance, to encode basic computer units (bits) an electrical switch can be used. The reliability of the switch ensures that the desired outcome (the component's final state, 0 or 1) can be selected with certainty. No practical data storage device would otherwise exist. This reliability criterion will necessarily need to hold true for future molecular electronics to have the opportunity to emerge as a viable miniaturization alternative to our current silicon-based technology. Molecular electronics target the use of single-molecules to perform the actions of individual electronic components. On-demand final state control over a bistable unimolecular component has therefore been one of the main challenges in the past decade (1-5) but has yet to be achieved. In this Letter, we demonstrate how control of the final state of a surface-supported bistable single molecule switch can be realized. On the basis of the observations and deductions presented here, we further suggest an alternative strategy to achieve final state control in unimolecular bistable switches.

Stochastic stabilization of phenotypic States: the genetic bistable switch as a case study.

Science.gov (United States)

Weber, Marc; Buceta, Javier

2013-01-01

We study by means of analytical calculation and stochastic simulations how intrinsic noise modifies the bifurcation diagram of gene regulatory processes that can be effectively described by the Langevin formalism. In a general context, our study raises the intriguing question of how biochemical fluctuations redesign the epigenetic landscape in differentiation processes. We have applied our findings to a general class of regulatory processes that includes the simplest case that displays a bistable behavior and hence phenotypic variability: the genetic auto-activating switch. Thus, we explain why and how the noise promotes the stability of the low-state phenotype of the switch and show that the bistable region is extended when increasing the intensity of the fluctuations. This phenomenology is found in a simple one-dimensional model of the genetic switch as well as in a more detailed model that takes into account the binding of the protein to the promoter region. Altogether, we prescribe the analytical means to understand and quantify the noise-induced modifications of the bifurcation points for a general class of regulatory processes where the genetic bistable switch is included.

Bulk chirality effect for symmetric bistable switching of liquid crystals on topologically self-patterned degenerate anchoring surface.

Science.gov (United States)

Park, Min-Kyu; Joo, Kyung-Il; Kim, Hak-Rin

2017-06-26

We demonstrate a bistable switching liquid crystal (LC) mode utilizing a topologically self-structured dual-groove surface for degenerated easy axes of LC anchoring. In our study, the effect of the bulk elastic distortion of the LC directors on the bistable anchoring surface is theoretically analyzed for balanced bistable states based on a free energy diagram. By adjusting bulk LC chirality, we developed ideally symmetric and stable bistable anchoring and switching properties, which can be driven by a low in-plane pulsed field of about 0.7 V/µm. The fabricated device has a contrast ratio of 196:1.

Focused Role of an Organic Small-Molecule PBD on Performance of the Bistable Resistive Switching.

Science.gov (United States)

Li, Lei; Sun, Yanmei; Ai, Chunpeng; Lu, Junguo; Wen, Dianzhong; Bai, Xuduo

2015-12-01

An undoped organic small-molecule 2-(4-tert-butylphenyl)-5-(4-biphenylyl)-1,3,4-oxadiazole (PBD) and a kind of nanocomposite blending poly(methyl methacrylate) (PMMA) into PBD are employed to implement bistable resistive switching. For the bistable resistive switching indium tin oxide (ITO)/PBD/Al, its ON/OFF current ratio can touch 6. What is more, the ON/OFF current ratio, approaching to 10(4), is available due to the storage layer PBD:PMMA with the chemical composition 1:1 in the bistable resistive switching ITO/PBD:PMMA/Al. The capacity, data retention of more than 1 year and endurance performance (>10(4) cycles) of ITO/PBD:PMMA(1:1)/Al, exhibits better stability and reliability of the samples, which underpins the technique and application of organic nonvolatile memory.

A bistable switch in dynamic thiodepsipeptide folding and template-directed ligation.

Science.gov (United States)

Mukherjee, Rakesh; Cohen-Luria, Rivka; Wagner, Nathaniel; Ashkenasy, Gonen

2015-10-12

Bistable reaction networks provide living cells with chemically controlled mechanisms for long-term memory storage. Such networks are also often switchable and can be flipped from one state to the other. We target here a major challenge in systems chemistry research, namely developing synthetic, non-enzymatic, networks that mimic such a complex function. Therefore, we describe a dynamic network that depending on initial thiodepsipeptide concentrations leads to one of two distinct steady states. This bistable system is readily switched by applying the appropriate stimuli. The relationship between the reaction network topology and its capacity to invoke bistability is then analyzed by control experiments and theory. We suggest that demonstrating bistable behavior using synthetic networks further highlights their possible role in early evolution, and may shine light on potential utility for novel applications, such as chemical memories. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Numerical analysis of intrinsic bistability and chromatic switching in Tm3+ single-doped systems under photon avalanche pumping scheme

International Nuclear Information System (INIS)

Li Li; Zhang Xinlu; Chen Lixue

2008-01-01

In this paper, we predict and numerically demonstrate the intrinsic intensity bistability, spectra bistability and chromatic switching of visible-infrared emission in Tm 3+ single-doped systems that are pumped by the photon avalanche scheme at 648 nm. Based on the coupled rate equation theory, the evolutions of the populations at various Tm 3+ energy levels, emission spectra and fluorescence intensity versus pump excitation are numerically investigated in detail. The results show that intrinsic optical bistability (IOB) associated with emission spectra and luminescence intensity takes place in the vicinity of the avalanche threshold (∼10 kW cm -2 ). When the pump excitation rises above the switching threshold (∼17.5 kW cm -2 ), the chromatic switching between the infrared (1716 nm) and the visible blue (452/469 nm) spectra can be performed. Moreover, the influences of system parameters on IOB and the origin of chromatic switching are discussed. These unique characteristics of Tm 3+ -doped systems would lead to the new possibility of the development of pump-controlled all-solid-state luminescence switches and optical bistability switches.

Coupling between feedback loops in autoregulatory networks affects bistability range, open-loop gain and switching times

International Nuclear Information System (INIS)

Tiwari, Abhinav; Igoshin, Oleg A

2012-01-01

Biochemical regulatory networks governing diverse cellular processes such as stress-response, differentiation and cell cycle often contain coupled feedback loops. We aim at understanding how features of feedback architecture, such as the number of loops, the sign of the loops and the type of their coupling, affect network dynamical performance. Specifically, we investigate how bistability range, maximum open-loop gain and switching times of a network with transcriptional positive feedback are affected by additive or multiplicative coupling with another positive- or negative-feedback loop. We show that a network's bistability range is positively correlated with its maximum open-loop gain and that both quantities depend on the sign of the feedback loops and the type of feedback coupling. Moreover, we find that the addition of positive feedback could decrease the bistability range if we control the basal level in the signal-response curves of the two systems. Furthermore, the addition of negative feedback has the capacity to increase the bistability range if its dissociation constant is much lower than that of the positive feedback. We also find that the addition of a positive feedback to a bistable network increases the robustness of its bistability range, whereas the addition of a negative feedback decreases it. Finally, we show that the switching time for a transition from a high to a low steady state increases with the effective fold change in gene regulation. In summary, we show that the effect of coupled feedback loops on the bistability range and switching times depends on the underlying mechanistic details. (paper)

Delay induced stability switch, multitype bistability and chaos in an intraguild predation model.

Science.gov (United States)

Shu, Hongying; Hu, Xi; Wang, Lin; Watmough, James

2015-12-01

In many predator-prey models, delay has a destabilizing effect and induces oscillations; while in many competition models, delay does not induce oscillations. By analyzing a rather simple delayed intraguild predation model, which combines both the predator-prey relation and competition, we show that delay in intraguild predation models promotes very complex dynamics. The delay can induce stability switches exhibiting a destabilizing role as well as a stabilizing role. It is shown that three types of bistability are possible: one stable equilibrium coexists with another stable equilibrium (node-node bistability); one stable equilibrium coexists with a stable periodic solution (node-cycle bistability); one stable periodic solution coexists with another stable periodic solution (cycle-cycle bistability). Numerical simulations suggest that delay can also induce chaos in intraguild predation models.

Bistability and Biofilm Formation in Bacillus subtilis

Science.gov (United States)

Chai, Yunrong; Chu, Frances; Kolter, Roberto; Losick, Richard

2008-01-01

Summary Biofilms of Bacillus subtilis consist of long chains of cells that are held together in bundles by an extracellular matrix of exopolysaccharide and the protein TasA. The exopolysaccharide is produced by enzymes encoded by the epsA-O operon and the gene encoding TasA is located in the yqxM-sipW-tasA operon. Both operons are under the control of the repressor SinR. Derepression is mediated by the antirepressor SinI, which binds to SinR with a 1:1 stoichiometry. Paradoxically, in medium promoting derepression of the matrix operons, the overall concentration of SinR in the culture greatly exceeded that of SinI. We show that under biofilm-promoting conditions sinI, which is under the control of the response regulator Spo0A, was expressed only in a small subpopulation of cells, whereas sinR was expressed in almost all cells. Activation of Spo0A is known to be subject to a bistable switch, and we infer that SinI reaches levels sufficient to trigger matrix production only in the subpopulation of cells in which Spo0A is active. Additionally, evidence suggests that sinI is expressed at intermediate, but not low or high, levels of Spo0A activity, which may explain why certain nutritional conditions are more effective in promoting biofilm formation than others. PMID:18047568

Models of charge transport and transfer in molecular switch tunnel junctions of bistable catenanes and rotaxanes

International Nuclear Information System (INIS)

Flood, Amar H.; Wong, Eric W.; Stoddart, J. Fraser

2006-01-01

The processes by which charge transfer can occur play a foundational role in molecular electronics. Here we consider simplified models of the transfer processes that could be present in bistable molecular switch tunnel junction (MSTJ) devices during one complete cycle of the device from its low- to high- and back to low-conductance state. The bistable molecular switches, which are composed of a monolayer of either switchable catenanes or rotaxanes, exist in either a ground-state co-conformation or a metastable one in which the conduction properties of the two co-conformations, when measured at small biases (+0.1 V), are significantly different irrespective of whether transport is dominated by tunneling or hopping. The voltage-driven generation (±2 V) of molecule-based redox states, which are sufficiently long-lived to allow the relative mechanical movements necessary to switch between the two co-conformations, rely upon unequal charge transfer rates on to and/or off of the molecules. Surface-enhanced Raman spectroscopy has been used to image the ground state of the bistable rotaxane in MSTJ-like devices. Consideration of these models provide new ways of looking at molecular electronic devices that rely, not only on nanoscale charge-transport, but also upon the bustling world of molecular motion in mechanically interlocked bistable molecules

Brain activity dynamics in human parietal regions during spontaneous switches in bistable perception.

Science.gov (United States)

Megumi, Fukuda; Bahrami, Bahador; Kanai, Ryota; Rees, Geraint

2015-02-15

The neural mechanisms underlying conscious visual perception have been extensively investigated using bistable perception paradigms. Previous functional magnetic resonance imaging (fMRI) and transcranial magnetic stimulation (TMS) studies suggest that the right anterior superior parietal (r-aSPL) and the right posterior superior parietal lobule (r-pSPL) have opposite roles in triggering perceptual reversals. It has been proposed that these two areas are part of a hierarchical network whose dynamics determine perceptual switches. However, how these two parietal regions interact with each other and with the rest of the brain during bistable perception is not known. Here, we investigated such a model by recording brain activity using fMRI while participants viewed a bistable structure-from-motion stimulus. Using dynamic causal modeling (DCM), we found that resolving such perceptual ambiguity was specifically associated with reciprocal interactions between these parietal regions and V5/MT. Strikingly, the strength of bottom-up coupling between V5/MT to r-pSPL and from r-pSPL to r-aSPL predicted individual mean dominance duration. Our findings are consistent with a hierarchical predictive coding model of parietal involvement in bistable perception and suggest that visual information processing underlying spontaneous perceptual switches can be described as changes in connectivity strength between parietal and visual cortical regions. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Bistable direction switching in an off-axis pumped continuous wave ruby laser

Science.gov (United States)

Afzal, R. Sohrab; Lawandy, N. M.

1988-01-01

A report is presented of the observation of hysteretic bistable direction switching in a single-mode CW ruby laser system. This effect is only observed when the pump beam which is focused into the ruby rod is misaligned with respect to the rod end faces. At low pump powers, the ruby lases in a mode nearly collinear with the pump axis. At a higher pump power the ruby switches to a mode that is collinear with the rod end faces and preserves the original polarization. The effect is large enough to switch the beam by an angle equal to twice the diffraction angle. The observations show that under steady-state pumping, a CW ruby laser can exhibit bistable operation in its output direction and power. A calculation using the heat equation with two concentric cylinders with one as a heat source (pump laser) and the outer wall of the other held at 77 K, gives an increase in core temperature of about 0.01 K. Therefore, the increase in temperature is not large enough to change the index of refraction to account for such large macroscopic effects.

Coupled Reversible and Irreversible Bistable Switches Underlying TGFβ-induced Epithelial to Mesenchymal Transition

Science.gov (United States)

Tian, Xiao-Jun; Zhang, Hang; Xing, Jianhua

2013-01-01

Epithelial to mesenchymal transition (EMT) plays an important role in embryonic development, tissue regeneration, and cancer metastasis. Whereas several feedback loops have been shown to regulate EMT, it remains elusive how they coordinately modulate EMT response to TGF-β treatment. We construct a mathematical model for the core regulatory network controlling TGF-β-induced EMT. Through deterministic analyses and stochastic simulations, we show that EMT is a sequential two-step program in which an epithelial cell first is converted to partial EMT then to the mesenchymal state, depending on the strength and duration of TGF-β stimulation. Mechanistically the system is governed by coupled reversible and irreversible bistable switches. The SNAIL1/miR-34 double-negative feedback loop is responsible for the reversible switch and regulates the initiation of EMT, whereas the ZEB/miR-200 feedback loop is accountable for the irreversible switch and controls the establishment of the mesenchymal state. Furthermore, an autocrine TGF-β/miR-200 feedback loop makes the second switch irreversible, modulating the maintenance of EMT. Such coupled bistable switches are robust to parameter variation and molecular noise. We provide a mechanistic explanation on multiple experimental observations. The model makes several explicit predictions on hysteretic dynamic behaviors, system response to pulsed stimulation, and various perturbations, which can be straightforwardly tested. PMID:23972859

Bistable scattering in graphene-coated dielectric nanowires.

Science.gov (United States)

Li, Rujiang; Wang, Huaping; Zheng, Bin; Dehdashti, Shahram; Li, Erping; Chen, Hongsheng

2017-06-22

In nonlinear plasmonics, the switching threshold of optical bistability is limited by the weak nonlinear responses from the conventional Kerr dielectric media. Considering the giant nonlinear susceptibility of graphene, here we develop a nonlinear scattering model under the mean field approximation and study the bistable scattering in graphene-coated dielectric nanowires based on the semi-analytical solutions. We find that the switching intensities of bistable scattering can be smaller than 1 MW cm -2 at the working frequency. To further decrease the switching intensities, we show that the most important factor that restricts the bistable scattering is the relaxation time of graphene. Our work not only reveals some general characteristics of graphene-based bistable scattering, but also provides a guidance to further applications of optical bistability in the high speed all-optical signal processing.

Atom-loss-induced quantum optical bi-stability switch

International Nuclear Information System (INIS)

Wu Bao-Jun; Cui Fu-Cheng

2012-01-01

We investigate the nonlinear dynamics of a system composed of a cigar-shaped Bose—Einstein condensate and an optical cavity with the two sides coupled dispersively. By adopting discrete-mode approximation for the condensate, taking atom loss as a necessary part of the model to analyze the evolution of the system, while using trial and error method to find out steady states of the system as a reference, numerical simulation demonstrates that with a constant pump, atom loss will trigger a quantum optical bi-stability switch, which predicts a new interesting phenomenon for experiments to verify

Switching between bistable states in a discrete nonlinear model with long-range dispersion

DEFF Research Database (Denmark)

Johansson, Magnus; Gaididei, Yuri B.; Christiansen, Peter Leth

1998-01-01

In the framework of a discrete nonlinear Schrodinger equation with long-range dispersion, we propose a general mechanism for obtaining a controlled switching between bistable localized excitations. We show that the application of a spatially symmetric kick leads to the excitation of an internal...

The limiting dynamics of a bistable molecular switch with and without noise.

Science.gov (United States)

Mackey, Michael C; Tyran-Kamińska, Marta

2016-08-01

We consider the dynamics of a population of organisms containing two mutually inhibitory gene regulatory networks, that can result in a bistable switch-like behaviour. We completely characterize their local and global dynamics in the absence of any noise, and then go on to consider the effects of either noise coming from bursting (transcription or translation), or Gaussian noise in molecular degradation rates when there is a dominant slow variable in the system. We show analytically how the steady state distribution in the population can range from a single unimodal distribution through a bimodal distribution and give the explicit analytic form for the invariant stationary density which is globally asymptotically stable. Rather remarkably, the behaviour of the stationary density with respect to the parameters characterizing the molecular behaviour of the bistable switch is qualitatively identical in the presence of noise coming from bursting as well as in the presence of Gaussian noise in the degradation rate. This implies that one cannot distinguish between either the dominant source or nature of noise based on the stationary molecular distribution in a population of cells. We finally show that the switch model with bursting but two dominant slow genes has an asymptotically stable stationary density.

Confinement and diffusion modulate bistability and stochastic switching in a reaction network with positive feedback

International Nuclear Information System (INIS)

Mlynarczyk, Paul J.; Pullen, Robert H.; Abel, Steven M.

2016-01-01

Positive feedback is a common feature in signal transduction networks and can lead to phenomena such as bistability and signal propagation by domain growth. Physical features of the cellular environment, such as spatial confinement and the mobility of proteins, play important but inadequately understood roles in shaping the behavior of signaling networks. Here, we use stochastic, spatially resolved kinetic Monte Carlo simulations to explore a positive feedback network as a function of system size, system shape, and mobility of molecules. We show that these physical properties can markedly alter characteristics of bistability and stochastic switching when compared with well-mixed simulations. Notably, systems of equal volume but different shapes can exhibit qualitatively different behaviors under otherwise identical conditions. We show that stochastic switching to a state maintained by positive feedback occurs by cluster formation and growth. Additionally, the frequency at which switching occurs depends nontrivially on the diffusion coefficient, which can promote or suppress switching relative to the well-mixed limit. Taken together, the results provide a framework for understanding how confinement and protein mobility influence emergent features of the positive feedback network by modulating molecular concentrations, diffusion-influenced rate parameters, and spatiotemporal correlations between molecules

Bistable microelectromechanical actuator

Science.gov (United States)

Fleming, James G.

1999-01-01

A bistable microelectromechanical (MEM) actuator is formed on a substrate and includes a stressed membrane of generally rectangular shape that upon release assumes a curvilinear cross-sectional shape due to attachment at a midpoint to a resilient member and at opposing edges to a pair of elongate supports. The stressed membrane can be electrostatically switched between a pair of mechanical states having mirror-image symmetry, with the MEM actuator remaining in a quiescent state after a programming voltage is removed. The bistable MEM actuator according to various embodiments of the present invention can be used to form a nonvolatile memory element, an optical modulator (with a pair of mirrors supported above the membrane and moving in synchronism as the membrane is switched), a switchable mirror (with a single mirror supported above the membrane at the midpoint thereof) and a latching relay (with a pair of contacts that open and close as the membrane is switched). Arrays of bistable MEM actuators can be formed for applications including nonvolatile memories, optical displays and optical computing.

A bistable switch and anatomical site control Vibrio cholerae virulence gene expression in the intestine.

Directory of Open Access Journals (Sweden)

Alex T Nielsen

2010-09-01

Full Text Available A fundamental, but unanswered question in host-pathogen interactions is the timing, localization and population distribution of virulence gene expression during infection. Here, microarray and in situ single cell expression methods were used to study Vibrio cholerae growth and virulence gene expression during infection of the rabbit ligated ileal loop model of cholera. Genes encoding the toxin-coregulated pilus (TCP and cholera toxin (CT were powerfully expressed early in the infectious process in bacteria adjacent to epithelial surfaces. Increased growth was found to co-localize with virulence gene expression. Significant heterogeneity in the expression of tcpA, the repeating subunit of TCP, was observed late in the infectious process. The expression of tcpA, studied in single cells in a homogeneous medium, demonstrated unimodal induction of tcpA after addition of bicarbonate, a chemical inducer of virulence gene expression. Striking bifurcation of the population occurred during entry into stationary phase: one subpopulation continued to express tcpA, whereas the expression declined in the other subpopulation. ctxA, encoding the A subunit of CT, and toxT, encoding the proximal master regulator of virulence gene expression also exhibited the bifurcation phenotype. The bifurcation phenotype was found to be reversible, epigenetic and to persist after removal of bicarbonate, features consistent with bistable switches. The bistable switch requires the positive-feedback circuit controlling ToxT expression and formation of the CRP-cAMP complex during entry into stationary phase. Key features of this bistable switch also were demonstrated in vivo, where striking heterogeneity in tcpA expression was observed in luminal fluid in later stages of the infection. When this fluid was diluted into artificial seawater, bacterial aggregates continued to express tcpA for prolonged periods of time. The bistable control of virulence gene expression points to a

Take it of leave it : Mechanisms underlying bacterial bistable regulatory networks

NARCIS (Netherlands)

Siebring, Jeroen; Sorg, Robin; Herber, Martijn; Kuipers, Oscar; Filloux, Alain A.M.

2012-01-01

Bistable switches occur in regulatory networks that can exist in two distinct stable states. Such networks allow distinct switching of individual cells. In bacteria these switches coexist with regulatory networks that respond gradually to environmental input. Bistable switches play key roles in high

What is refractive optical bistability

International Nuclear Information System (INIS)

Dzhehov, Tomislav

1993-01-01

The basic elements of the theory of refractive optical bistability, assuming mediums with linear absorption are given. Special attention is paid to bistable etalons of semiconductor materials an oxide glasses, since some of them are considered as promising components for optical bistability applications. The design optimization of such devices for minimum switching intensity is analyzed. Computer simulation of the transfer characteristic recording for two InSb etalons is presented. (author)

Steady state statistical correlations predict bistability in reaction motifs.

Science.gov (United States)

Chakravarty, Suchana; Barik, Debashis

2017-03-28

Various cellular decision making processes are regulated by bistable switches that take graded input signals and convert them to binary all-or-none responses. Traditionally, a bistable switch generated by a positive feedback loop is characterized either by a hysteretic signal response curve with two distinct signaling thresholds or by characterizing the bimodality of the response distribution in the bistable region. To identify the intrinsic bistability of a feedback regulated network, here we propose that bistability can be determined by correlating higher order moments and cumulants (≥2) of the joint steady state distributions of two components connected in a positive feedback loop. We performed stochastic simulations of four feedback regulated models with intrinsic bistability and we show that for a bistable switch with variation of the signal dose, the steady state variance vs. covariance adopts a signatory cusp-shaped curve. Further, we find that the (n + 1)th order cross-cumulant vs. nth order cross-cumulant adopts a closed loop structure for at least n = 3. We also propose that our method is capable of identifying systems without intrinsic bistability even though the system may show bimodality in the marginal response distribution. The proposed method can be used to analyze single cell protein data measured at steady state from experiments such as flow cytometry.

MATHEMATICAL MODEL OF A QUICK-DRIVING ACTUATOR OF AN AUTOMATIC SWITCH WITH AN INSTANT-DYNAMIC AND BISTABLE MECHANISM

Directory of Open Access Journals (Sweden)

E. I. BAIDA

2018-05-01

Full Text Available Purpose. Development of a mathematical model of an induction-dynamic drive of a switch with two coils, working with a bistable mechanism, which ensures the fixation of the instant-dynamic mechanism (IDM in trajectory extreme positions of the contact system. Methodology. The solution of the problems posed in the work was carried out using methods for calculating the electromagnetic field, finite elements, theoretical mechanics, and solving differential equations. Findings. The mathematical model of quick-driving actuator as part of instant dynamic and bistable mechanism was developed. It was based on electrical circuit’s electromagnetic equations and kinematic movements of the switching mechanism. Advantage of the given model is possibility of a breaker drive dynamic analysis basing on data of a contact pressure, pretravel and snatch gap. Initial data of the model formulation were outer circuit inductance, resistance of coils, which calculated on conductor cross-section and coils configuration. Initial conditions corresponded by Dirichlet conditions. Mathematical model equations system was calculated in cylindrical coordinate system. Problem was solved with the help ComsolMultiphysics system. Motion of the IDM movement part was modeled by deformation of a computational grid. Spring force and stress in a bistable mechanism construction were determined by initial data of a contact pressure, pretravel and snatch gap. Graphs by calculation data are shown, which allow to analyze of springing elements chose and make necessary adjustments on design stage and debugging construction. Operation parameters of mechanism work on IDM switch on and switch off stages were calculated. Value of movement, motion speed of armature breaker, currents of accelerating and retarding coils, summed electromagnetic and opposite force were figured. Originality. The mathematical model of quick-driving actuator as part of instant-dynamic and bistable mechanism was developed

Interlinked bistable mechanisms generate robust mitotic transitions.

Science.gov (United States)

Hutter, Lukas H; Rata, Scott; Hochegger, Helfrid; Novák, Béla

2017-10-18

The transitions between phases of the cell cycle have evolved to be robust and switch-like, which ensures temporal separation of DNA replication, sister chromatid separation, and cell division. Mathematical models describing the biochemical interaction networks of cell cycle regulators attribute these properties to underlying bistable switches, which inherently generate robust, switch-like, and irreversible transitions between states. We have recently presented new mathematical models for two control systems that regulate crucial transitions in the cell cycle: mitotic entry and exit, 1 and the mitotic checkpoint. 2 Each of the two control systems is characterized by two interlinked bistable switches. In the case of mitotic checkpoint control, these switches are mutually activating, whereas in the case of the mitotic entry/exit network, the switches are mutually inhibiting. In this Perspective we describe the qualitative features of these regulatory motifs and show that having two interlinked bistable mechanisms further enhances robustness and irreversibility. We speculate that these network motifs also underlie other cell cycle transitions and cellular transitions between distinct biochemical states.

Design methodology for all-optical bistable switches based on a plasmonic resonator sandwiched between dielectric waveguides

International Nuclear Information System (INIS)

Xiang, Yinxiao; Cai, Wei; Wang, Lei; Ying, Cuifeng; Zhang, Xinzheng; Xu, Jingjun

2014-01-01

We present a bistable device consisting of a Bragg grating resonator with a Kerr medium sandwiched between two dielectric slab waveguides. The resonator is situated in a nanometer-scaled metal–insulator–metal plasmonic waveguide. Due to the dimensional confinement from the dielectric waveguide to the nanoscaled plasmonic waveguide, electric fields are enhanced greatly, which will further reduce the threshold value. Moreover, a semi-analytic method, based on the impedance theory and the transfer matrix method, is developed to study the transmission and reflection spectra as well as the bistability loop of such a switch. Our method is fast and accurate, as confirmed by the finite-difference time-domain simulation. (invited paper)

Interplay between Switching Driven by the Tunneling Current and Atomic Force of a Bistable Four-Atom Si Quantum Dot.

Science.gov (United States)

Yamazaki, Shiro; Maeda, Keisuke; Sugimoto, Yoshiaki; Abe, Masayuki; Zobač, Vladimír; Pou, Pablo; Rodrigo, Lucia; Mutombo, Pingo; Pérez, Ruben; Jelínek, Pavel; Morita, Seizo

2015-07-08

We assemble bistable silicon quantum dots consisting of four buckled atoms (Si4-QD) using atom manipulation. We demonstrate two competing atom switching mechanisms, downward switching induced by tunneling current of scanning tunneling microscopy (STM) and opposite upward switching induced by atomic force of atomic force microscopy (AFM). Simultaneous application of competing current and force allows us to tune switching direction continuously. Assembly of the few-atom Si-QDs and controlling their states using versatile combined AFM/STM will contribute to further miniaturization of nanodevices.

Bridging time scales in cellular decision making with a stochastic bistable switch

Directory of Open Access Journals (Sweden)

Waldherr Steffen

2010-08-01

Full Text Available Abstract Background Cellular transformations which involve a significant phenotypical change of the cell's state use bistable biochemical switches as underlying decision systems. Some of these transformations act over a very long time scale on the cell population level, up to the entire lifespan of the organism. Results In this work, we aim at linking cellular decisions taking place on a time scale of years to decades with the biochemical dynamics in signal transduction and gene regulation, occuring on a time scale of minutes to hours. We show that a stochastic bistable switch forms a viable biochemical mechanism to implement decision processes on long time scales. As a case study, the mechanism is applied to model the initiation of follicle growth in mammalian ovaries, where the physiological time scale of follicle pool depletion is on the order of the organism's lifespan. We construct a simple mathematical model for this process based on experimental evidence for the involved genetic mechanisms. Conclusions Despite the underlying stochasticity, the proposed mechanism turns out to yield reliable behavior in large populations of cells subject to the considered decision process. Our model explains how the physiological time constant may emerge from the intrinsic stochasticity of the underlying gene regulatory network. Apart from ovarian follicles, the proposed mechanism may also be of relevance for other physiological systems where cells take binary decisions over a long time scale.

A bistable mechanism for directional sensing

International Nuclear Information System (INIS)

Beta, C; Amselem, G; Bodenschatz, E

2008-01-01

We present a generic mechanism for directional sensing in eukaryotic cells that is based on bistable dynamics. As the key feature of this modeling approach, the velocity of trigger waves in the bistable sensing system changes its sign across cells that are exposed to an external chemoattractant gradient. This is achieved by combining a two-component activator/inhibitor system with a bistable switch that induces an identical symmetry breaking for arbitrary gradient input signals. A simple kinetic example is designed to illustrate the dynamics of a bistable directional sensing mechanism in numerical simulations

Beam-splitter switches based on zenithal bistable liquid-crystal gratings.

Science.gov (United States)

Zografopoulos, Dimitrios C; Beccherelli, Romeo; Kriezis, Emmanouil E

2014-10-01

The tunable optical diffractive properties of zenithal bistable nematic liquid-crystal gratings are theoretically investigated. The liquid-crystal orientation is rigorously solved via a tensorial formulation of the Landau-de Gennes theory and the optical transmission properties of the gratings are investigated via full-wave finite-element frequency-domain simulations. It is demonstrated that by proper design the two stable states of the grating can provide nondiffracting and diffracting operation, the latter with equal power splitting among different diffraction orders. An electro-optic switching mechanism, based on dual-frequency nematic materials, and its temporal dynamics are further discussed. Such gratings provide a solution towards tunable beam-steering and beam-splitting components with extremely low power consumption.

Switching process between bistable positons of multiquantum flux tubes in a thin-film type I superconductor

International Nuclear Information System (INIS)

Parisi, J.; Huebener, R.P.; Muhlemeier, B.

1983-01-01

A superconducting memory device based on a bistable vortex position represents an interesting storage medium for future Josephson computers. In order to study the operational mode of such a single-flux quantum memory cell, we use as a model system multiquantum flux tubes in a thin-film type I superconductor (Pb). By employing high-resolution stroboscopic magnetooptical flux detection, we are able to globally visualize both spatial and temporal behavior of rapidly switching individual flux tubes. All experimental results agree reasonably well with theoretical model considerations of the energy balance during the elementary switching process

Bistable laser device with multiple coupled active vertical-cavity resonators

Science.gov (United States)

Fischer, Arthur J.; Choquette, Kent D.; Chow, Weng W.

2003-08-19

A new class of bistable coupled-resonator vertical-cavity semiconductor laser devices has been developed. These bistable laser devices can be switched, either electrically or optically, between lasing and non-lasing states. A switching signal with a power of a fraction of a milliwatt can change the laser output of such a device by a factor of a hundred, thereby enabling a range of optical switching and data encoding applications.

Organic bistable light-emitting devices

Science.gov (United States)

Ma, Liping; Liu, Jie; Pyo, Seungmoon; Yang, Yang

2002-01-01

An organic bistable device, with a unique trilayer structure consisting of organic/metal/organic sandwiched between two outmost metal electrodes, has been invented. [Y. Yang, L. P. Ma, and J. Liu, U.S. Patent Pending, U.S. 01/17206 (2001)]. When the device is biased with voltages beyond a critical value (for example 3 V), the device suddenly switches from a high-impedance state to a low-impedance state, with a difference in injection current of more than 6 orders of magnitude. When the device is switched to the low-impedance state, it remains in that state even when the power is off. (This is called "nonvolatile" phenomenon in memory devices.) The high-impedance state can be recovered by applying a reverse bias; therefore, this bistable device is ideal for memory applications. In order to increase the data read-out rate of this type of memory device, a regular polymer light-emitting diode has been integrated with the organic bistable device, such that it can be read out optically. These features make the organic bistable light-emitting device a promising candidate for several applications, such as digital memories, opto-electronic books, and recordable papers.

Optical bistability in Er-Yb codoped phosphate glass microspheres at room temperature

NARCIS (Netherlands)

Warda, Jonathan M.; O'Shea, Danny G.; Shortt, Brian J.; Chormaic, Sile Nic

2007-01-01

We experimentally demonstrate optical bistability in Er(3+)-Yb(3+) phosphate glass microspheres at 295 K. Bistability is associated with both Er(3+) fluorescence and lasing behavior, and chromatic switching. The chromatic switching results from an intrinsic mechanism exploiting the thermal coupling

On the functional relevance of frontal cortex for passive and voluntarily controlled bistable vision.

Science.gov (United States)

de Graaf, Tom A; de Jong, Maartje C; Goebel, Rainer; van Ee, Raymond; Sack, Alexander T

2011-10-01

In bistable vision, one constant ambiguous stimulus leads to 2 alternating conscious percepts. This perceptual switching occurs spontaneously but can also be influenced through voluntary control. Neuroimaging studies have reported that frontal regions are activated during spontaneous perceptual switches, leading some researchers to suggest that frontal regions causally induce perceptual switches. But the opposite also seems possible: frontal activations may themselves be caused by spontaneous switches. Classically implicated in attentional processes, these same regions are also candidates for the origins of voluntary control over bistable vision. Here too, it remains unknown whether frontal cortex is actually functionally relevant. It is even possible that spontaneous perceptual switches and voluntarily induced switches are mediated by the same top-down mechanisms. To directly address these issues, we here induced "virtual lesions," with transcranial magnetic stimulation, in frontal, parietal, and 2 lower level visual cortices using an established ambiguous structure-from-motion stimulus. We found that dorsolateral prefrontal cortex was causally relevant for voluntary control over perceptual switches. In contrast, we failed to find any evidence for an active role of frontal cortex in passive bistable vision. Thus, it seems the same pathway used for willed top-down modulation of bistable vision is not used during passive bistable viewing.

Bistable polarization switching in a continuous wave ruby laser

Science.gov (United States)

Lawandy, N. M.; Afzal, R. Sohrab

1988-01-01

Bistability in the output power, polarization state, and mode volume of an argon-ion laser pumped single mode ruby laser at 6943 A has been observed. The laser operates in a radially confined mode which exhibits hysteresis and bistability only when the pump polarization is parallel to the c-axis.

Controllable optical bistability and multistability in asymmetric double quantum wells via spontaneously generated coherence

Energy Technology Data Exchange (ETDEWEB)

Chen, Yuan; Deng, Li [Department of Applied Physics, East China Jiaotong University, Nanchang, 330013 (China); Chen, Aixi, E-mail: aixichen@ecjtu.jx.cn [Department of Applied Physics, East China Jiaotong University, Nanchang, 330013 (China); Institute for Quantum Computing, University of Waterloo, Ontario N2L 3G1 (Canada)

2015-02-15

We investigate the nonlinear optical phenomena of the optical bistability and multistability via spontaneously generated coherence in an asymmetric double quantum well structure coupled by a weak probe field and a controlling field. It is shown that the threshold and hysteresis cycle of the optical bistability can be conveniently controlled only by adjusting the intensity of the SGC or the controlling field. Moreover, switching between optical bistability and multistability can be achieved. These studies may have practical significance for the preparation of optical bistable switching device.

Controllable optical bistability and multistability in asymmetric double quantum wells via spontaneously generated coherence

International Nuclear Information System (INIS)

Chen, Yuan; Deng, Li; Chen, Aixi

2015-01-01

We investigate the nonlinear optical phenomena of the optical bistability and multistability via spontaneously generated coherence in an asymmetric double quantum well structure coupled by a weak probe field and a controlling field. It is shown that the threshold and hysteresis cycle of the optical bistability can be conveniently controlled only by adjusting the intensity of the SGC or the controlling field. Moreover, switching between optical bistability and multistability can be achieved. These studies may have practical significance for the preparation of optical bistable switching device

Bistable cholesteric liquid crystal light shutter with multielectrode driving.

Science.gov (United States)

Li, Cheng-Chang; Tseng, Heng-Yi; Pai, Tsung-Wei; Wu, Yu-Ching; Hsu, Wen-Hao; Jau, Hung-Chang; Chen, Chun-Wei; Lin, Tsung-Hsien

2014-08-01

An electrically activated bistable light shutter that exploits polymer-stabilized cholesteric liquid crystal film was developed. Under double-sided three-terminal electrode driving, the device can be bistable and switched between focal conic and homeotropic textures with a uniform in-plane and vertical electrical field. The transparent state with a transmittance of 80% and the opaque/scattering state with a transmittance of 13% can be realized without any optical compensation film, and each can be simply switched to the other by applying a pulse voltage. Also, gray-scale selection can be performed by varying the applied voltage. The designed energy-saving bistable light shutter can be utilized to preserve privacy and control illumination and the flow of energy.

MicroRNA-Mediated Positive Feedback Loop and Optimized Bistable Switch in a Cancer Network Involving miR-17-92

Science.gov (United States)

Li, Yichen; Li, Yumin; Zhang, Hui; Chen, Yong

2011-01-01

MicroRNAs (miRNAs) are small, noncoding RNAs that play an important role in many key biological processes, including development, cell differentiation, the cell cycle and apoptosis, as central post-transcriptional regulators of gene expression. Recent studies have shown that miRNAs can act as oncogenes and tumor suppressors depending on the context. The present work focuses on the physiological significance of miRNAs and their role in regulating the switching behavior. We illustrate an abstract model of the Myc/E2F/miR-17-92 network presented by Aguda et al. (2008), which is composed of coupling between the E2F/Myc positive feedback loops and the E2F/Myc/miR-17-92 negative feedback loop. By systematically analyzing the network in close association with plausible experimental parameters, we show that, in the presence of miRNAs, the system bistability emerges from the system, with a bistable switch and a one-way switch presented by Aguda et al. instead of a single one-way switch. Moreover, the miRNAs can optimize the switching process. The model produces a diverse array of response-signal behaviors in response to various potential regulating scenarios. The model predicts that this transition exists, one from cell death or the cancerous phenotype directly to cell quiescence, due to the existence of miRNAs. It was also found that the network involving miR-17-92 exhibits high noise sensitivity due to a positive feedback loop and also maintains resistance to noise from a negative feedback loop. PMID:22022595

Controllable optical bistability in a three-mode optomechanical system with atom-cavity-mirror couplings

Science.gov (United States)

Chen, Bin; Wang, Xiao-Fang; Yan, Jia-Kai; Zhu, Xiao-Fei; Jiang, Cheng

2018-01-01

We theoretically investigate the optical bistable behavior in a three-mode optomechanical system with atom-cavity-mirror couplings. The effects of the cavity-pump detuning and the pump power on the bistable behavior are discussed detailedly, the impacts of the atom-pump detuning and the atom-cavity coupling strength on the bistability of the system are also explored, and the influences of the cavity-resonator coupling strength and the cavity decay rate are also taken into consideration. The numerical results demonstrate that by tuning these parameters the bistable behavior of the system can be freely switched on or off, and the threshold of the pump power for the bistability as well as the bistable region width can also be effectively controlled. These results can find potential applications in optical bistable switch in the quantum information processing.

High-power subnanosecond operation of a bistable optically controlled semiconductor switch (BOSS)

International Nuclear Information System (INIS)

Stoudt, D.C.; Richardson, M.A.; Demske, D.L.; Roush, R.A.; Eure, K.W.

1994-01-01

Recent high-power, subnanosecond-switching results of the Bistable Optically controlled Semiconductor Switch (BOSS) are presented. The process of persistent photoconductivity followed by photo-quenching have been demonstrated at megawatt power levels in copper-compensated, silicon-doped, semi-insulating gallium arsenide. These processes allow a switch to be developed that can be closed by the application of one laser pulse and opened by the application of a second laser pulse with a wavelength equal to twice that of the first laser. Switch closure is primarily achieved by elevating electrons from a deep copper center which has been diffused into the material. The opening phase is a two-step process which relies initially on the absorption of the 2-μm laser causing electrons to be elevated from the valance band back into the copper center, and finally on the recombination of electrons in the conduction band with boles in the valance band. The second step requires a sufficient concentration of recombination centers (RC) in the material for opening to occur in the subnanosecond regime. These RC's are generated in the bulk GaAs material by fast-neutron irradiation (∼ 1 MeV) at a fluence of about 3 x 10 15 cm -2 . High-power switching results which demonstrate that the BOSS switch can be opened in the subnanosecond regime are presented for the first time. Neutron-irradiated BOSS devices have been opened against a rising electric field of about 20 kV/cm (10 kV) in a time less than one nanosecond. Kilovolt electrical pulses have been generated with a FWHM of roughly 250 picoseconds

The Independent and Shared Mechanisms of Intrinsic Brain Dynamics: Insights From Bistable Perception

Directory of Open Access Journals (Sweden)

Teng Cao

2018-04-01

Full Text Available In bistable perception, constant input leads to alternating perception. The dynamics of the changing perception reflects the intrinsic dynamic properties of the “unconscious inferential” process in the brain. Under the same condition, individuals differ in how fast they experience the perceptual alternation. In this study, testing many forms of bistable perception in a large number of observers, we investigated the key question of whether there is a general and common mechanism or multiple and independent mechanisms that control the dynamics of the inferential brain. Bistable phenomena tested include binocular rivalry, vase-face, Necker cube, moving plaid, motion induced blindness, biological motion, spinning dancer, rotating cylinder, Lissajous-figure, rolling wheel, and translating diamond. Switching dynamics for each bistable percept was measured in 100 observers. Results show that the switching rates of subsets of bistable percept are highly correlated. The clustering of dynamic properties of some bistable phenomena but not an overall general control of switching dynamics implies that the brain’s inferential processes are both shared and independent – faster in constructing 3D structure from motion does not mean faster in integrating components into an objects.

Optical bistability of optical fiber ring doped by Erbium and quantum dots

International Nuclear Information System (INIS)

Safari, S.; Tofighi, S.; Bahrampour, A.; Sajad, B.; Shahshahani, F.

2012-01-01

In this paper, theoretical analysis of the steady state behavior of the optical bistability in an optical fiber ring doped by Erbium and quantum dots is presented. The up and down switching power is calculated and the dependence of the switching power on different fiber ring parameters is investigated. The switching power for this type of optical bistability device is obtained much lower than the fiber ring which its half length is doped by Erbium ion.

Revisiting bistability in the lysis/lysogeny circuit of bacteriophage lambda.

Directory of Open Access Journals (Sweden)

Michael Bednarz

Full Text Available The lysis/lysogeny switch of bacteriophage lambda serves as a paradigm for binary cell fate decision, long-term maintenance of cellular state and stimulus-triggered switching between states. In the literature, the system is often referred to as "bistable." However, it remains unclear whether this term provides an accurate description or is instead a misnomer. Here we address this question directly. We first quantify transcriptional regulation governing lysogenic maintenance using a single-cell fluorescence reporter. We then use the single-cell data to derive a stochastic theoretical model for the underlying regulatory network. We use the model to predict the steady states of the system and then validate these predictions experimentally. Specifically, a regime of bistability, and the resulting hysteretic behavior, are observed. Beyond the steady states, the theoretical model successfully predicts the kinetics of switching from lysogeny to lysis. Our results show how the physics-inspired concept of bistability can be reliably used to describe cellular phenotype, and how an experimentally-calibrated theoretical model can have accurate predictive power for cell-state switching.

Bistability of Cavity Magnon Polaritons

Science.gov (United States)

Wang, Yi-Pu; Zhang, Guo-Qiang; Zhang, Dengke; Li, Tie-Fu; Hu, C.-M.; You, J. Q.

2018-01-01

We report the first observation of the magnon-polariton bistability in a cavity magnonics system consisting of cavity photons strongly interacting with the magnons in a small yttrium iron garnet (YIG) sphere. The bistable behaviors emerged as sharp frequency switchings of the cavity magnon polaritons (CMPs) and related to the transition between states with large and small numbers of polaritons. In our experiment, we align, respectively, the [100] and [110] crystallographic axes of the YIG sphere parallel to the static magnetic field and find very different bistable behaviors (e.g., clockwise and counter-clockwise hysteresis loops) in these two cases. The experimental results are well fitted and explained as being due to the Kerr nonlinearity with either a positive or negative coefficient. Moreover, when the magnetic field is tuned away from the anticrossing point of CMPs, we observe simultaneous bistability of both magnons and cavity photons by applying a drive field on the lower branch.

Bistable dynamics of a levitated nanoparticle (Presentation Recording)

Science.gov (United States)

Ricci, Francesco; Spasenovic, M.; Rica, Raúl A.; Novotny, Lukas; Quidant, Romain

2015-08-01

Bistable systems are ubiquitous in nature. Classical examples in chemistry and biology include relaxation kinetics in chemical reactions [1] and stochastic resonance processes such as neuron firing [2,3]. Likewise, bistable systems play a key role in signal processing and information handling at the nanoscale, giving rise to intriguing applications such as optical switches [4], coherent signal amplification [5,6] and weak forces detection [5]. The interest and applicability of bistable systems are intimately connected with the complexity of their dynamics, typically due to the presence of a large number of parameters and nonlinearities. Appropriate modeling is therefore challenging. Alternatively, the possibility to experimentally recreate bistable systems in a clean and controlled way has recently become very appealing, but elusive and complicated. With this aim, we combined optical tweezers with a novel active feedback-cooling scheme to develop a well-defined opto-mechanical platform reaching unprecedented performances in terms of Q-factor, frequency stability and force sensitivity [7,8]. Our experimental system consists of a single nanoparticle levitated in high vacuum with optical tweezers, which behaves as a non-linear (Duffing) oscillator under appropriate conditions. Here, we prove it to be an ideal tool for a deep study of bistability. We demonstrate bistability of the nanoparticle by noise activated switching between two oscillation states, discussing our results in terms of a double-well potential model. We also show the flexibility of our system in shaping the potential at will, in order to meet the conditions prescribed by any bistable system that could therefore then be simulated with our setup. References [1] T. Amemiya, T. Ohmori, M. Nakaiwa, T. Yamamoto, and T. Yamaguchi, "Modeling of Nonlinear Chemical Reaction Systems and Two-Parameter Stochastic Resonance," J. Biol. Phys. 25 (1999) 73 [2] F. Moss, L. M. Ward, and W. G. Sannita, "Stochastic

Bistable near field and bistable transmittance in 2D composite slab consisting of nonlocal core-Kerr shell inclusions.

Science.gov (United States)

Huang, Yang; Wu, Ya Min; Gao, Lei

2017-01-23

We carry out a theoretical study on optical bistability of near field intensity and transmittance in two-dimensional nonlinear composite slab. This kind of 2D composite is composed of nonlocal metal/Kerr-type dielectric core-shell inclusions randomly embedded in the host medium, and we derivate the nonlinear relation between the field intensity in the shell of inclusions and the incident field intensity with self-consistent mean field approximation. Numerical demonstration has been performed to show the viable parameter space for the bistable near field. We show that nonlocality can provide broader region in geometric parameter space for bistable near field as well as bistable transmittance of the nonlocal composite slab compared to local case. Furthermore, we investigate the bistable transmittance in wavelength spectrum, and find that besides the input intensity, the wavelength operation could as well make the transmittance jump from a high value to a low one. This kind of self-tunable nano-composite slab might have potential application in optical switching devices.

High-resolution bistable nematic liquid crystal device realized on orientational surface patterns

International Nuclear Information System (INIS)

Kim, Jong-Hyun; Yoneya, Makoto; Yokoyama, Hiroshi

2003-01-01

The four-fold symmetry of a checkerboard-like surface alignment consisted of square domains arrived at the macroscopic orientational bistability of nematic liquid crystals. Switching between the two orientations took place with an appropriate electric field. Here the threshold field of bistable switching decreased as temperature increased, and the light could heat only the selected region in the cell including a light-absorbing medium. Irradiating the laser concurrently with an electric field, we addressed a selected region in the alignment pattern without the disturbance of neighboring regions. Extending this process, we realized an extremely fine bistable device of nematic liquid crystal with a pixel size down to about 2 μm

Convergent Transcription in the Butyrolactone Regulon in Streptomyces coelicolor Confers a Bistable Genetic Switch for Antibiotic Biosynthesis

Science.gov (United States)

Chatterjee, Anushree; Drews, Laurie; Mehra, Sarika; Takano, Eriko; Kaznessis, Yiannis N.; Hu, Wei-Shou

2011-01-01

cis-encoded antisense RNAs (cis asRNA) have been reported to participate in gene expression regulation in both eukaryotic and prokaryotic organisms. Its presence in Streptomyces coelicolor has also been reported recently; however, its role has yet to be fully investigated. Using mathematical modeling we explore the role of cis asRNA produced as a result of convergent transcription in scbA-scbR genetic switch. scbA and scbR gene pair, encoding repressor–amplifier proteins respectively, mediates the synthesis of a signaling molecule, the γ-butyrolactone SCB1 and controls the onset of antibiotic production. Our model considers that transcriptional interference caused by convergent transcription of two opposing RNA polymerases results in fatal collision and transcriptional termination, which suppresses transcription efficiency. Additionally, convergent transcription causes sense and antisense interactions between complementary sequences from opposing strands, rendering the full length transcript inaccessible for translation. We evaluated the role of transcriptional interference and the antisense effect conferred by convergent transcription on the behavior of scbA-scbR system. Stability analysis showed that while transcriptional interference affects the system, it is asRNA that confers scbA-scbR system the characteristics of a bistable switch in response to the signaling molecule SCB1. With its critical role of regulating the onset of antibiotic synthesis the bistable behavior offers this two gene system the needed robustness to be a genetic switch. The convergent two gene system with potential of transcriptional interference is a frequent feature in various genomes. The possibility of asRNA regulation in other such gene-pairs is yet to be examined. PMID:21765930

Controlling the optical bistability and transmission coefficient in a four-level atomic medium

International Nuclear Information System (INIS)

Asadpour, Seyyed Hossein; Eslami-Majd, Abdullah

2012-01-01

A novel four level atomic configuration is proposed for controlling the optical bistability and transmission coefficient with application on all-optical switching. Two circularly polarized components from a weak linearly-polarized probe beam are interacted separately by two transitions of this medium. A coherent coupling field has derived another atomic transition. It is demonstrated that the transmission coefficient of two orthogonally polarized beams at different frequencies can be achieved by adjusting the magnitude of the external magnetic field. It is found that the threshold of the optical bistability can be controlled by magnitude of the external magnetic field. Also, it is shown that optical bistability can be converted to optical multistability by switching the two orthogonally polarized beams. - Highlights: ► An inverted Y-type four level atomic system is proposed. ► Transmission coefficient can be controlled by a novel interesting parameter. ► Optical bistability and multistability can be achieved via external magnetic field. ► It is shown that our proposed model is suitable for all optical switching application.

Optical bistability and limiting in polymer dispersed liquid crystal

Energy Technology Data Exchange (ETDEWEB)

Yshino, K.; Tagawa, A.; Sadohara, Y.; Ozaki, M. (Osaka University, Osaka (Japan). Faculty of Engineering); Munezawa, T. (Ajinomoto Co. Inc., Tokyo (Japan)); Nomura, Y. (Takiron Co. Ltd., Osaka (Japan))

1991-04-15

The linear electro-optical effect of polymer dispersed liquid crystal (PDLC) and the nonlinear optical response of electrically feedbacked PDLC were studied. Electro-optical limiting and bistability were observed in PDLCs with negative and positive feedback, respectively. In the PDLC film with positive feedback gain, an optical hysteresis loop shifted toward a high intensity region with decreasing magnitude of the feedback gain. The switching between high and low transmission states in an optical bistable region was realized by controlling incident light, and the on-off switching by superimposing light pulse on incident light for an extremely short period (several hundreds {mu}s). As the light pulse was strong, the minimum pulse width required for switching was as short as 500 {mu}s or less. The on-off switching was also realized by shutting out the incident light for a period equivalent to the pulse width. Slower response times of the PDLC film required longer minimum pulse widths. 12 refs., 11 figs.

A bistable model of cell polarity.

Directory of Open Access Journals (Sweden)

Matteo Semplice

Full Text Available Ultrasensitivity, as described by Goldbeter and Koshland, has been considered for a long time as a way to realize bistable switches in biological systems. It is not as well recognized that when ultrasensitivity and reinforcing feedback loops are present in a spatially distributed system such as the cell plasmamembrane, they may induce bistability and spatial separation of the system into distinct signaling phases. Here we suggest that bistability of ultrasensitive signaling pathways in a diffusive environment provides a basic mechanism to realize cell membrane polarity. Cell membrane polarization is a fundamental process implicated in several basic biological phenomena, such as differentiation, proliferation, migration and morphogenesis of unicellular and multicellular organisms. We describe a simple, solvable model of cell membrane polarization based on the coupling of membrane diffusion with bistable enzymatic dynamics. The model can reproduce a broad range of symmetry-breaking events, such as those observed in eukaryotic directional sensing, the apico-basal polarization of epithelium cells, the polarization of budding and mating yeast, and the formation of Ras nanoclusters in several cell types.

GABA shapes the dynamics of bistable perception.

Science.gov (United States)

van Loon, Anouk M; Knapen, Tomas; Scholte, H Steven; St John-Saaltink, Elexa; Donner, Tobias H; Lamme, Victor A F

2013-05-06

Sometimes, perception fluctuates spontaneously between two distinct interpretations of a constant sensory input. These bistable perceptual phenomena provide a unique window into the neural mechanisms that create the contents of conscious perception. Models of bistable perception posit that mutual inhibition between stimulus-selective neural populations in visual cortex plays a key role in these spontaneous perceptual fluctuations. However, a direct link between neural inhibition and bistable perception has not yet been established experimentally. Here, we link perceptual dynamics in three distinct bistable visual illusions (binocular rivalry, motion-induced blindness, and structure from motion) to measurements of gamma-aminobutyric acid (GABA) concentrations in human visual cortex (as measured with magnetic resonance spectroscopy) and to pharmacological stimulation of the GABAA receptor by means of lorazepam. As predicted by a model of neural interactions underlying bistability, both higher GABA concentrations in visual cortex and lorazepam administration induced slower perceptual dynamics, as reflected in a reduced number of perceptual switches and a lengthening of percept durations. Thus, we show that GABA, the main inhibitory neurotransmitter, shapes the dynamics of bistable perception. These results pave the way for future studies into the competitive neural interactions across the visual cortical hierarchy that elicit conscious perception. Copyright © 2013 Elsevier Ltd. All rights reserved.

Bistable Si dopants in the GaAs (1 1 0) surface

International Nuclear Information System (INIS)

Smakman, E P; Koenraad, P M

2015-01-01

In this review, recent work is discussed on bistable Si dopants in the GaAs (1 1 0) surface, studied by scanning tunneling microscopy (STM). The bistability arises because the dopant atom can switch between a positive and a negative charge state, which are associated with two different lattice configurations. Manipulation of the Si atom charge configuration is achieved by tuning the local band bending with the STM tip. Furthermore, illuminating the sample with a laser also influences the charge state, allowing the operation of the dopant atom as an optical switch. The switching dynamics without illumination is investigated in detail as a function of temperature, lateral tip position, and applied tunneling conditions. A physical model is presented that independently describes the thermal and quantum tunneling contributions to the switching frequency and charge state occupation of a single Si atom. The basic functionality of a memory cell is demonstrated employing a single bistable Si dopant as the active element, using the STM tip as a gate to write and read the information. (topical review)

High-Speed and Low-Energy Flip-Flop Operation of Asymmetric Active-Multimode Interferometer Bi-Stable Laser Diodes

DEFF Research Database (Denmark)

Jiang, Haisong; Chaen, Yutaka; Hagio, Takuma

2011-01-01

High-speed (121/25 ps rise/fall time) and low-switching energy (7.1 and 3.4 fJ) alloptical flip-flop operation of single-wavelength high-mesa asymmetric active-MMI bi-stable laser diodes is demonstrated for the first time using 25 ps long switching pulses.......High-speed (121/25 ps rise/fall time) and low-switching energy (7.1 and 3.4 fJ) alloptical flip-flop operation of single-wavelength high-mesa asymmetric active-MMI bi-stable laser diodes is demonstrated for the first time using 25 ps long switching pulses....

Towards an optimal model for a bistable nematic liquid crystal display device

KAUST Repository

Cummings, L. J.

2013-03-13

Bistable liquid crystal displays offer the potential for considerable power savings compared with conventional (monostable) LCDs. The existence of two stable field-free states that are optically distinct means that contrast can be maintained in a display without an externally applied electric field. An applied field is required only to switch the device from one state to the other, as needed. In this paper we examine a theoretical model of a possible bistable device, originally proposed by Cummings and Richardson (Euro J Appl Math 17:435-463 2006), and explore means by which it may be optimized, in terms of optical contrast, manufacturing considerations, switching field strength, and switching times. The compromises inherent in these conflicting design criteria are discussed. © 2013 Springer Science+Business Media Dordrecht.

Bistable output from a coupled-resonator vertical-cavity laser diode

International Nuclear Information System (INIS)

Fischer, A. J.; Choquette, K. D.; Chow, W. W.; Allerman, A. A.; Geib, K.

2000-01-01

We report a monolithic coupled-resonator vertical-cavity laser with an ion-implanted top cavity and a selectively oxidized bottom cavity which exhibits bistable behavior in the light output versus injection current. Large bistability regions over current ranges as wide as 18 mA have been observed with on/off contrast ratios of greater than 20 dB. The position and width of the bistability region can be varied by changing the bias to the top cavity. Switching between on and off states can be accomplished with changes as small as 250 μW to the electrical power applied to the top cavity. The bistable behavior is the response of the nonlinear susceptibility in the top cavity to the changes in the bottom intracavity laser intensity as the bottom cavity reaches the thermal rollover point

Bistable optical response of a nanoparticle heterodimer : Mechanism, phase diagram, and switching time

NARCIS (Netherlands)

Nugroho, Bintoro; Iskandar, Alexander; Malyshev, V.A.; Knoester, Jasper

2013-01-01

We conduct a theoretical study of the bistable optical response of a nanoparticle heterodimer comprised of a closely spaced semiconductor quantum dot and a metal nanoparticle. The bistable nature of the response results from the interplay between the quantum dot's optical nonlinearity and its

The tunable bistable and multistable memory effect in polymer nanowires

International Nuclear Information System (INIS)

Rahman, Atikur; Sanyal, Milan K

2008-01-01

Tunable bistable and multistable resistance switching in conducting polymer nanowires has been reported. These wires show reproducible switching transition under several READ-WRITE-ERASE cycles. The switching is observed at low temperature and the ON/OFF resistance ratio for the voltage biased switching transition was found to be more than 10 3 . Current biased measurements show lower ON/OFF ratio and some of the nanowires exhibit a multistable switching transition in current biased measurements. The threshold voltage for switching and the ON/OFF resistance ratio can be tuned by changing doping concentration of the nanowires

Hybrid optoelectronic device with multiple bistable outputs

Energy Technology Data Exchange (ETDEWEB)

Costazo-Caso, Pablo A; Jin Yiye; Gelh, Michael; Granieri, Sergio; Siahmakoun, Azad, E-mail: pcostanzo@ing.unlp.edu.are, E-mail: granieri@rose-hulma.edu, E-mail: siahmako@rose-hulma.edu [Department of Physics and Optical Engineering, Rose-Hulman Institute of Technology, 5500 Wabash Avenue, Terre Haute, IN 47803 (United States)

2011-01-01

Optoelectronic circuits which exhibit optical and electrical bistability with hysteresis behavior are proposed and experimentally demonstrated. The systems are based on semiconductor optical amplifiers (SOA), bipolar junction transistors (BJT), PIN photodiodes (PD) and laser diodes externally modulated with integrated electro-absorption modulators (LD-EAM). The device operates based on two independent phenomena leading to both electrical bistability and optical bistability. The electrical bistability is due to the series connection of two p-i-n structures (SOA, BJT, PD or LD) in reverse bias. The optical bistability is consequence of the quantum confined Stark effect (QCSE) in the multi-quantum well (MQW) structure in the intrinsic region of the device. This effect produces the optical modulation of the transmitted light through the SOA (or reflected from the PD). Finally, because the optical transmission of the SOA (in reverse bias) and the reflected light from the PD are so small, a LD-EAM modulated by the voltage across these devices are employed to obtain a higher output optical power. Experiments show that the maximum switching frequency is in MHz range and the rise/fall times lower than 1 us. The temporal response is mainly limited by the electrical capacitance of the devices and the parasitic inductances of the connecting wires. The effects of these components can be reduced in current integration technologies.

Bistable resistive memory behavior in gelatin-CdTe quantum dot composite film

Science.gov (United States)

Vallabhapurapu, Sreedevi; Rohom, Ashwini; Chaure, N. B.; Du, Shengzhi; Srinivasan, Ananthakrishnan

2018-05-01

Bistable memory behavior has been observed for the first time in gelatin type A thin film dispersed with functionalized CdTe quantum dots. The two terminal device with the polymer nanocomposite layer sandwiched between an indium tin oxide coated glass plate and an aluminium top electrode performs as a bistable resistive random access memory module. Butterfly shaped (O-shaped with a hysteresis in forward and reverse sweeps) current-voltage response is observed in this device. The conduction mechanism leading to the bistable electrical switching has been deduced to be a combination of ohmic and electron hopping.

Harnessing the bistable composite shells to design a tunable phononic band gap structure

Science.gov (United States)

Li, Yi; Xu, Yanlong

2018-02-01

By proposing a system composed of an array of bistable composite shells immersed in air, we develop a new class of periodic structure to control the propagation of sound. Through numerical investigation, we find that the acoustic band gap of this system can be switched on and off by triggering the snap through deformation of the bistable composite shells. The shape of cross section and filling fraction of unit cell can be altered by different number of bistable composite shells, and they have strong impact on the position and width of the band gap. The proposed concept paves the way of using the bistable structures to design a new class of metamaterials that can be enable to manipulate sound.

Controlling steady-state and dynamical properties of atomic optical bistability

CERN Document Server

Joshi, Amitabh

2012-01-01

This book provides a comprehensive introduction to the theoretical and experimental studies of atomic optical bistability and multistability, and their dynamical properties in systems with two- and three-level inhomogeneously-broadened atoms inside an optical cavity. By making use of the modified linear absorption and dispersion, as well as the greatly enhanced nonlinearity in the three-level electromagnetically induced transparency system, the optical bistablity and efficient all-optical switching can be achieved at relatively low laser powers, which can be well controlled and manipulated. Un

How to turn a genetic circuit into a synthetic tunable oscillator, or a bistable switch.

Directory of Open Access Journals (Sweden)

Lucia Marucci

2009-12-01

Full Text Available Systems and Synthetic Biology use computational models of biological pathways in order to study in silico the behaviour of biological pathways. Mathematical models allow to verify biological hypotheses and to predict new possible dynamical behaviours. Here we use the tools of non-linear analysis to understand how to change the dynamics of the genes composing a novel synthetic network recently constructed in the yeast Saccharomyces cerevisiae for In-vivo Reverse-engineering and Modelling Assessment (IRMA. Guided by previous theoretical results that make the dynamics of a biological network depend on its topological properties, through the use of simulation and continuation techniques, we found that the network can be easily turned into a robust and tunable synthetic oscillator or a bistable switch. Our results provide guidelines to properly re-engineering in vivo the network in order to tune its dynamics.

Investigation of bistable perception with the "silhouette spinner": sit still, spin the dancer with your will.

Science.gov (United States)

Liu, Chao-Hsuan; Tzeng, Ovid J L; Hung, Daisy L; Tseng, Philip; Juan, Chi-Hung

2012-05-01

Many studies have used static and non-biologically related stimuli to investigate bistable perception and found that the percept is usually dominated by their intrinsic nature with some influence of voluntary control from the viewer. Here we used a dynamic stimulus of a rotating human body, the silhouette spinner illusion, to investigate how the viewers' intentions may affect their percepts. In two experiments, we manipulated observer intention (active or passive), fixation position (body or feet), and spinning velocity (fast, medium, or slow). Our results showed that the normalized alternating rate between two bistable percepts was greater when (1) participants actively attempted to switch percepts, (2) when participants fixated at the spinner's feet rather than the body, inducing as many as 25 switches of the bistable percepts within 1 min, and (3) when they watched the spinner at high velocity. These results suggest that a dynamic biologically-bistable percept can be quickly alternated by the viewers' intention. Furthermore, the higher alternating rate in the feet condition compared to the body condition suggests a role for biological meaningfulness in determining bistable percepts, where 'biologically plausible' interpretations are favored by the visual system. Copyright © 2012 Elsevier Ltd. All rights reserved.

Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

Science.gov (United States)

Ray, J. Christian J; Igoshin, Oleg A.

2012-01-01

Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

Bistable minimum energy structures (BiMES) for binary robotics

International Nuclear Information System (INIS)

Follador, M; Conn, A T; Rossiter, J

2015-01-01

Bistable minimum energy structures (BiMES) are devices derived from the union of the concepts of dielectric elastomer minimum energy structures and bistable systems. This article presents this novel approach to active, elastic and bistable structures. BiMES are based on dielectric elastomer actuators (DEAs), which act as antagonists and provide the actuation for switching between the two equilibrium positions. A central elastic beam is the backbone of the structure and is buckled into the minimum energy configurations by the action of the two DEAs. The theory and the model of the device are presented, and also its fabrication process. BiMES are considered as fundamental units for more complex structures, which are presented and fabricated as proof of concept. Two different ways of combining the multiple units are proposed: a parallel configuration, to make a simple gripper, and a serial configuration, to generate a binary device. The possibility of using the bistable system as a continuous bender actuator, by modulating the actuation voltage of the two DEAs, was also investigated. (paper)

Large-Scale Analysis of Network Bistability for Human Cancers

Science.gov (United States)

Shiraishi, Tetsuya; Matsuyama, Shinako; Kitano, Hiroaki

2010-01-01

Protein–protein interaction and gene regulatory networks are likely to be locked in a state corresponding to a disease by the behavior of one or more bistable circuits exhibiting switch-like behavior. Sets of genes could be over-expressed or repressed when anomalies due to disease appear, and the circuits responsible for this over- or under-expression might persist for as long as the disease state continues. This paper shows how a large-scale analysis of network bistability for various human cancers can identify genes that can potentially serve as drug targets or diagnosis biomarkers. PMID:20628618

Bistable four-wave mixing response in a semiconductor quantum dot coupled to a photonic crystal nanocavity.

Science.gov (United States)

Li, Jian-Bo; Xiao, Si; Liang, Shan; He, Meng-Dong; Luo, Jian-Hua; Kim, Nam-Chol; Chen, Li-Qun

2017-10-16

We perform a theoretical study of the bistable four-wave mixing (FWM) response in a coupled system comprised of a semiconductor quantum dot (SQD) and a photonic crystal (PC) nanocavity in which the SQD is embedded. It is shown that the shape of the FWM spectrum can switch among single-peaked, double-peaked, triple-peaked, and four-peaked arising from the vacuum Rabi splitting and the exciton-nanocavity coupling. Especially, we map out bistability phase diagrams within a parameter subspace of the system, and find that it is easy to turn on or off the bistable FWM response by only adjusting the excitation frequency or the pumping intensity. Our results offer a feasible means for measuring the SQD-PC nanocavity coupling strength and open a new avenue to design optical switches and memories.

Energy landscape and dynamics of brain activity during human bistable perception.

Science.gov (United States)

Watanabe, Takamitsu; Masuda, Naoki; Megumi, Fukuda; Kanai, Ryota; Rees, Geraint

2014-08-28

Individual differences in the structure of parietal and prefrontal cortex predict the stability of bistable visual perception. However, the mechanisms linking such individual differences in brain structures to behaviour remain elusive. Here we demonstrate a systematic relationship between the dynamics of brain activity, cortical structure and behaviour underpinning bistable perception. Using fMRI in humans, we find that the activity dynamics during bistable perception are well described as fluctuating between three spatially distributed energy minimums: visual-area-dominant, frontal-area-dominant and intermediate states. Transitions between these energy minimums predicted behaviour, with participants whose brain activity tend to reflect the visual-area-dominant state exhibiting more stable perception and those whose activity transits to frontal-area-dominant states reporting more frequent perceptual switches. Critically, these brain activity dynamics are correlated with individual differences in grey matter volume of the corresponding brain areas. Thus, individual differences in the large-scale dynamics of brain activity link focal brain structure with bistable perception.

Manually operatable on-chip bistable pneumatic microstructures for microfluidic manipulations.

Science.gov (United States)

Chen, Arnold; Pan, Tingrui

2014-09-07

Bistable microvalves are of particular interest because of their distinct nature of requiring energy consumption only during the transition between the open and closed states. This characteristic can be highly advantageous in reducing the number of external inputs and the complexity of control circuitries since microfluidic devices as contemporary lab-on-a-chip platforms are transferring from research settings to low-resource environments with high integrability and a small form factor. In this paper, we first present manually operatable, on-chip bistable pneumatic microstructures (BPMs) for microfluidic manipulation. The structural design and operation of the BPM devices can be readily integrated into any pneumatically powered microfluidic network consisting of pneumatic and fluidic channels. It is mainly composed of a vacuum activation chamber (VAC) and a pressure release chamber (PRC), of which users have direct control through finger pressing to switch either to the bistable vacuum state (VS) or the atmospheric state (AS). We have integrated multiple BPM devices into a 4-to-1 microfluidic multiplexor to demonstrate on-chip digital flow switching from different sources. Furthermore, we have shown its clinical relevance in a point-of-care diagnostic chip that processes blood samples to identify the distinct blood types (A/B/O) on-chip.

Optically coupled cavities for wavelength switching

Energy Technology Data Exchange (ETDEWEB)

Costazo-Caso, Pablo A; Granieri, Sergio; Siahmakoun, Azad, E-mail: pcostanzo@ing.unlp.edu.ar, E-mail: granieri@rose-hulman.edu, E-mail: siahmako@rose-hulman.edu [Department of Physics and Optical Engineering, Rose-Hulman Institute of Technology, 5500 Wabash Avenue, Terre Haute, IN 47803 (United States)

2011-01-01

An optical bistable device which presents hysteresis behavior is proposed and experimentally demonstrated. The system finds applications in wavelength switching, pulse reshaping and optical bistability. It is based on two optically coupled cavities named master and slave. Each cavity includes a semiconductor optical amplifier (SOA), acting as the gain medium of the laser, and two pair of fiber Bragg gratings (FBG) which define the lasing wavelength (being different in each cavity). Finally, a variable optical coupler (VOC) is employed to couple both cavities. Experimental characterization of the system performance is made analyzing the effects of the coupling coefficient between the two cavities and the driving current in each SOA. The properties of the hysteretic bistable curve and switching can be controlled by adjusting these parameters and the loss in the cavities. By selecting the output wavelength ({lambda}{sub 1} or {lambda}{sub 2}) with an external filter it is possible to choose either the invert or non-invert switched signal. Experiments were developed employing both optical discrete components and a photonic integrated circuit. They show that for 8 m-long cavities the maximum switching frequency is about 500 KHz, and for 4 m-long cavities a minimum rise-time about 21 ns was measured. The switching time can be reduced by shortening the cavity lengths and using photonic integrated circuits.

Electron transfer dynamics of bistable single-molecule junctions

DEFF Research Database (Denmark)

Danilov, A.V; Kubatkin, S.; Kafanov, S. G.

2006-01-01

We present transport measurements of single-molecule junctions bridged by a molecule with three benzene rings connected by two double bonds and with thiol end-groups that allow chemical binding to gold electrodes. The I-V curves show switching behavior between two distinct states. By statistical ...... analysis of the switching events, we show that a 300 meV mode mediates the transition between the two states. We propose that breaking and reformation of a S-H bond in the contact zone between molecule and electrode explains the observed bistability....

Design of a Clap Activated Switch

Directory of Open Access Journals (Sweden)

Seyi Stephen OLOKEDE

2008-12-01

Full Text Available This paper presents the design of a clap activated switch device that will serve well in different phono-controlled applications, providing inexpensive key and at the same time flee from false triggering.This involves the design of various sages consisting of the pickup transducer, low frequency, audio low power and low noise amplifier, timer, bistable and switches. It also consists of special network components to prevent false triggering and ensure desired performance objectives. A decade counter IC serves the bistable function instead of flip-flop, special transistor and edge triggering network for low audio frequency.

The combination of positive and negative feedback loops confers exquisite flexibility to biochemical switches

International Nuclear Information System (INIS)

Pfeuty, Benjamin; Kaneko, Kunihiko

2009-01-01

A wide range of cellular processes require molecular regulatory pathways to convert a graded signal into a discrete response. One prevalent switching mechanism relies on the coexistence of two stable states (bistability) caused by positive feedback regulations. Intriguingly, positive feedback is often supplemented with negative feedback, raising the question of whether and how these two types of feedback can cooperate to control discrete cellular responses. To address this issue, we formulate a canonical model of a protein–protein interaction network and analyze the dynamics of a prototypical two-component circuit. The appropriate combination of negative and positive feedback loops can bring a bistable circuit close to the oscillatory regime. Notably, sharply activated negative feedback can give rise to a bistable regime wherein two stable fixed points coexist and may collide pairwise with two saddle points. This specific type of bistability is found to allow for separate and flexible control of switch-on and switch-off events, for example (i) to combine fast and reversible transitions, (ii) to enable transient switching responses and (iii) to display tunable noise-induced transition rates. Finally, we discuss the relevance of such bistable switching behavior, and the circuit topologies considered, to specific biological processes such as adaptive metabolic responses, stochastic fate decisions and cell-cycle transitions. Taken together, our results suggest an efficient mechanism by which positive and negative feedback loops cooperate to drive the flexible and multifaceted switching behaviors arising in biological systems

Noise-induced polarization switching in complex networks

Science.gov (United States)

Haerter, Jan O.; Díaz-Guilera, Albert; Serrano, M. Ángeles

2017-04-01

The combination of bistability and noise is ubiquitous in complex systems, from biology to social interactions, and has important implications for their functioning and resilience. Here we use a simple three-state dynamical process, in which nodes go from one pole to another through an intermediate state, to show that noise can induce polarization switching in bistable systems if dynamical correlations are significant. In large, fully connected networks, where dynamical correlations can be neglected, increasing noise yields a collapse of bistability to an unpolarized configuration where the three possible states of the nodes are equally likely. In contrast, increased noise induces abrupt and irreversible polarization switching in sparsely connected networks. In multiplexes, where each layer can have a different polarization tendency, one layer is dominant and progressively imposes its polarization state on the other, offsetting or promoting the ability of noise to switch its polarization. Overall, we show that the interplay of noise and dynamical correlations can yield discontinuous transitions between extremes, which cannot be explained by a simple mean-field description.

All-optical bistable logic control based on coupled Tamm plasmons.

Science.gov (United States)

Zhang, Wei Li; Jiang, Yao; Zhu, Ye Yu; Wang, Fen; Rao, Yun Jiang

2013-10-15

A method for realizing low-threshold all-optical bistable logic control is proposed based on Tamm plasmons (TPs), which are formed in an asymmetric dielectric Bragg reflector (DBR)-metal-DBR (ADMD) structure with a layer of Kerr medium embedded. The ADMD structure supports two TPs due to coupling of trapped modes at each metal-DBR interface, generating two dips in the structure's reflection spectrum. Thus, control (i.e., pump) and controlled (i.e., probe) light with wavelengths close to the two dips, respectively, can be imported. It is verified theoretically that, thanks to the enhanced Kerr nonlinearity related to excitation of high-quality TP, bistable switching at very low injection intensity can be initiated by strength or direction variation of the pump. Meanwhile, the probe changes correspondingly with the pump. Thus, all-optical bistable logic operation of the probe can be controlled by the pump.

Low-threshold optical bistability with multilayer graphene-covering Otto configuration

International Nuclear Information System (INIS)

Wang, Hengliang; Wu, Jipeng; Xiang, Yuanjiang; Wen, Shuangchun; Guo, Jun; Jiang, Leyong

2016-01-01

In this paper, we propose a modified Otto configuration to realize tunable and low-threshold optical bistability at terahertz frequencies by attaching multilayer graphene sheets to a nonlinear substrate interface. Our work demonstrates that the threshold of optical bistability can be markedly reduced (three orders of magnitude) by covering the nonlinear substrate with multilayer graphene sheets, due to strong local field enhancement with the excitation of surface plasmons. We present the influences of the Fermi energy of graphene, the incident angle, the thickness of air gap and the relaxation time of graphene on the hysteresis phenomenon and give a way to optimize the surface plasmon resonance, which will enable us to further lower the minimal power requirements for realizing optical bistability due to the strong interaction of light with graphene sheets. These results are promising for realization of terahertz optical switches, optical modulators and logical devices. (paper)

Lake Restoration in Terms of Ecological Resilience: a Numerical Study of Biomanipulations under Bistable Conditions

Directory of Open Access Journals (Sweden)

Takashi Amemiya

2005-12-01

Full Text Available An abstract version of the comprehensive aquatic simulation model (CASM is found to exhibit bistability under intermediate loading of nutrient input, supporting the alternative-stable-states theory and field observations for shallow lakes. Our simulations of biomanipulations under the bistable conditions reveal that a reduction in the abundance of zooplanktivorous fish cannot switch the system from a turbid to a clear state. Rather, a direct reduction of phytoplankton and detritus was found to be most effective to make this switch in the present model. These results imply that multiple manipulations may be effective for practical restorations of lakes. We discuss the present results of biomanipulations in terms of ecological resilience in multivariable systems or natural systems.

Multichannel all–optical switch based on a thin slab of resonant two–level emitters

Directory of Open Access Journals (Sweden)

Malikov Ramil

2017-01-01

Full Text Available We discuss the possibility of using a thin layer of inhomogeneously broadened resonant emitters as a multichannel all–optical switch. Switching time from the lower stable branch of the system's bistable characteristics to the upper one and vice versa, which determines the speed of operation of a bistable device, is studied.

Revisiting the Lissajous figure as a tool to study bistable perception.

Science.gov (United States)

Weilnhammer, V A; Ludwig, K; Sterzer, P; Hesselmann, G

2014-05-01

During bistable vision perception spontaneously "switches" between two mutually exclusive percepts despite constant sensory input. The endogenous nature of these perceptual transitions has motivated extensive research aimed at the underlying mechanisms, since spontaneous perceptual transitions of bistable stimuli should in principle allow for a dissociation of processes related to sensory stimulation from those related to conscious perception. However, transitions from one conscious percept to another are often not instantaneous, and participants usually report a considerable amount of mixed or unclear percepts. This feature of bistable vision makes it difficult to isolate transition-related visual processes. Here, we revisited an ambiguous depth-from-motion stimulus which was first introduced to experimental psychology more than 80 years ago. This rotating Lissajous figure might prove useful in complementing other bistable stimuli, since its perceptual transitions only occur at critical stimulus configurations and are virtually instantaneous, thus facilitating the construction of a perceptually equivalent replay condition. We found that three parameters of the Lissajous figure - complexity, line width, and rotational speed - differentially modulated its perceptual dominance durations and transition probabilities, thus providing experimenters with a versatile tool to study the perceptual dynamics of bistable vision. Copyright © 2014 Elsevier B.V. All rights reserved.

Evolution of the bi-stable wake of a square-back automotive shape

Science.gov (United States)

Pavia, Giancarlo; Passmore, Martin; Sardu, Costantino

2018-01-01

Square-back shapes are popular in the automotive market for their high level of practicality. These geometries, however, are usually characterised by high drag and their wake dynamics present aspects, such as the coexistence of a long-time bi-stable behaviour and short-time global fluctuating modes that are not fully understood. In the present paper, the unsteady behaviour of the wake of a generic square-back car geometry is characterised with an emphasis on identifying the causal relationship between the different dynamic modes in the wake. The study is experimental, consisting of balance, pressure, and stereoscopic PIV measurements. Applying wavelet and cross-wavelet transforms to the balance data, a quasi-steady correlation is demonstrated between the forces and bi-stable modes. This is investigated by applying proper orthogonal decomposition to the pressure and velocity data sets and a new structure is proposed for each bi-stable state, consisting of a hairpin vortex that originates from one of the two model's vertical trailing edges and bends towards the opposite side as it merges into a single streamwise vortex downstream. The wake pumping motion is also identified and for the first time linked with the motion of the bi-stable vortical structure in the streamwise direction, resulting in out-of-phase pressure variations between the two vertical halves of the model base. A phase-averaged low-order model is also proposed that provides a comprehensive description of the mechanisms of the switch between the bi-stable states. It is demonstrated that, during the switch, the wake becomes laterally symmetric and, at this point, the level of interaction between the recirculating structures and the base reaches a minimum, yielding, for this geometry, a 7% reduction of the base drag compared to the time-averaged result.

Influence of ZnO nanostructures in liquid crystal interfaces for bistable switching applications

Energy Technology Data Exchange (ETDEWEB)

Pal, Kaushik, E-mail: kaushikpal@whu.edu.cn [School of Power and Mechanical Engineering, Wuhan University, 8 East Lake South Road, Wuhan 430072 (China); Zhan, Bihong, E-mail: bihong_zhan@whu.edu.cn [School of Power and Mechanical Engineering, Wuhan University, 8 East Lake South Road, Wuhan 430072 (China); Madhu Mohan, M.L.N. [Liquid Crystal Research Laboratory (LCRL), Bannari Amman Institute of Technology, Sathyamangalam 638 401 (India); Schirhagl, Romana [University Medical Center Groningen, Department of BioMedical Engineering, Ant. Deusinglaan 1, 9713 AV Groningen (Netherlands); Wang, Guoping, E-mail: guopingwang@whu.edu.cn [School of Power and Mechanical Engineering, Wuhan University, 8 East Lake South Road, Wuhan 430072 (China)

2015-12-01

constructed and compared. The switching times, the contrast ratio and spontaneous polarization of the nanostructures–HBLC composite film were carried out by systematic investigation. The sample preparation parameters, such as the curing time and curing intensity were optimized. The critical applied voltage to achieve the switching bi-stability of our device is only 4.5 V, which is approximately twice its threshold voltage for Freedericksz transition. This performance puts the hybrid structure at the top level in the state of the art in application oriented research in optics of liquid crystalline composite materials.

Designing a stochastic genetic switch by coupling chaos and bistability.

Science.gov (United States)

Zhao, Xiang; Ouyang, Qi; Wang, Hongli

2015-11-01

In stem cell differentiation, a pluripotent stem cell becomes progressively specialized and generates specific cell types through a series of epigenetic processes. How cells can precisely determine their fate in a fluctuating environment is a currently unsolved problem. In this paper, we suggest an abstract gene regulatory network to describe mathematically the differentiation phenomenon featuring stochasticity, divergent cell fates, and robustness. The network consists of three functional motifs: an upstream chaotic motif, a buffering motif of incoherent feed forward loop capable of generating a pulse, and a downstream motif which is bistable. The dynamic behavior is typically a transient chaos with fractal basin boundaries. The trajectories take transiently chaotic journeys before divergently settling down to the bistable states. The ratio of the probability that the high state is achieved to the probability that the low state is reached can maintain a constant in a population of cells with varied molecular fluctuations. The ratio can be turned up or down when proper parameters are adjusted. The model suggests a possible mechanism for the robustness against fluctuations that is prominently featured in pluripotent cell differentiations and developmental phenomena.

Designing a stochastic genetic switch by coupling chaos and bistability

Energy Technology Data Exchange (ETDEWEB)

Zhao, Xiang [State Key Laboratory for Mesoscopic Physics and School of Physics, Peking University, Beijing 100871 (China); Ouyang, Qi [State Key Laboratory for Mesoscopic Physics and School of Physics, Peking University, Beijing 100871 (China); Center for Quantitative Biology, Peking University, Beijing 100871 (China); The Peking-Tsinghua Center for Life Sciences, Beijing 100871 (China); Wang, Hongli, E-mail: hlwang@pku.edu.cn [State Key Laboratory for Mesoscopic Physics and School of Physics, Peking University, Beijing 100871 (China); Center for Quantitative Biology, Peking University, Beijing 100871 (China)

2015-11-15

In stem cell differentiation, a pluripotent stem cell becomes progressively specialized and generates specific cell types through a series of epigenetic processes. How cells can precisely determine their fate in a fluctuating environment is a currently unsolved problem. In this paper, we suggest an abstract gene regulatory network to describe mathematically the differentiation phenomenon featuring stochasticity, divergent cell fates, and robustness. The network consists of three functional motifs: an upstream chaotic motif, a buffering motif of incoherent feed forward loop capable of generating a pulse, and a downstream motif which is bistable. The dynamic behavior is typically a transient chaos with fractal basin boundaries. The trajectories take transiently chaotic journeys before divergently settling down to the bistable states. The ratio of the probability that the high state is achieved to the probability that the low state is reached can maintain a constant in a population of cells with varied molecular fluctuations. The ratio can be turned up or down when proper parameters are adjusted. The model suggests a possible mechanism for the robustness against fluctuations that is prominently featured in pluripotent cell differentiations and developmental phenomena.

Switching waves dynamics in optical bistable cavity-free system at femtosecond laser pulse propagation in semiconductor under light diffraction

Science.gov (United States)

Trofimov, Vyacheslav A.; Egorenkov, Vladimir A.; Loginova, Maria M.

2018-02-01

We consider a propagation of laser pulse in a semiconductor under the conditions of an occurrence of optical bistability, which appears due to a nonlinear absorption of the semiconductor. As a result, the domains of high concentration of free charged particles (electrons and ionized donors) occur if an intensity of the incident optical pulse is greater than certain intensity. As it is well-known, that an optical beam must undergo a diffraction on (or reflection from) the domains boundaries. Usually, the beam diffraction along a coordinate of the optical pulse propagation does not take into account by using the slowly varying envelope approximation for the laser pulse interaction with optical bistable element. Therefore, a reflection of the beam from the domains with abrupt boundary does not take into account under computer simulation of the laser pulse propagation. However, the optical beams, reflected from nonhomogeneities caused by the domains of high concentration of free-charged particles, can essentially influence on a formation of switching waves in a semiconductor. We illustrate this statement by computer simulation results provided on the base of nonlinear Schrödinger equation and a set of PDEs, which describe an evolution of the semiconductor characteristics (concentrations of free-charged particles and potential of an electric field strength), and taking into account the longitudinal and transverse diffraction effects.

Parallel replica dynamics method for bistable stochastic reaction networks: Simulation and sensitivity analysis

Science.gov (United States)

Wang, Ting; Plecháč, Petr

2017-12-01

Stochastic reaction networks that exhibit bistable behavior are common in systems biology, materials science, and catalysis. Sampling of stationary distributions is crucial for understanding and characterizing the long-time dynamics of bistable stochastic dynamical systems. However, simulations are often hindered by the insufficient sampling of rare transitions between the two metastable regions. In this paper, we apply the parallel replica method for a continuous time Markov chain in order to improve sampling of the stationary distribution in bistable stochastic reaction networks. The proposed method uses parallel computing to accelerate the sampling of rare transitions. Furthermore, it can be combined with the path-space information bounds for parametric sensitivity analysis. With the proposed methodology, we study three bistable biological networks: the Schlögl model, the genetic switch network, and the enzymatic futile cycle network. We demonstrate the algorithmic speedup achieved in these numerical benchmarks. More significant acceleration is expected when multi-core or graphics processing unit computer architectures and programming tools such as CUDA are employed.

Parallel replica dynamics method for bistable stochastic reaction networks: Simulation and sensitivity analysis.

Science.gov (United States)

Wang, Ting; Plecháč, Petr

2017-12-21

Stochastic reaction networks that exhibit bistable behavior are common in systems biology, materials science, and catalysis. Sampling of stationary distributions is crucial for understanding and characterizing the long-time dynamics of bistable stochastic dynamical systems. However, simulations are often hindered by the insufficient sampling of rare transitions between the two metastable regions. In this paper, we apply the parallel replica method for a continuous time Markov chain in order to improve sampling of the stationary distribution in bistable stochastic reaction networks. The proposed method uses parallel computing to accelerate the sampling of rare transitions. Furthermore, it can be combined with the path-space information bounds for parametric sensitivity analysis. With the proposed methodology, we study three bistable biological networks: the Schlögl model, the genetic switch network, and the enzymatic futile cycle network. We demonstrate the algorithmic speedup achieved in these numerical benchmarks. More significant acceleration is expected when multi-core or graphics processing unit computer architectures and programming tools such as CUDA are employed.

Method of bistable optical information storage using antiferroelectric phase PLZT ceramics

Science.gov (United States)

Land, Cecil E.

1990-01-01

A method for bistable storage of binary optical information includes an antiferroelectric (AFE) lead lanthanum zirconate titanate (PLZT) layer having a stable antiferroelectric first phase and a ferroelectric (FE) second phase obtained by applying a switching electric field across the surface of the device. Optical information is stored by illuminating selected portions of the layer to photoactivate an FE to AFE transition in those portions. Erasure of the stored information is obtained by reapplying the switching field.

Solid state bistable power switch

Science.gov (United States)

Bartko, J.; Shulman, H.

1970-01-01

Tin and copper provide high current and switching time capabilities for high-current resettable fuses. They show the best performance for trip current and degree of reliability, and have low coefficients of thermal expansion.

Multiple Bistability in Quinonoid-Bridged Diiron(II) Complexes: Influence of Bridge Symmetry on Bistable Properties.

Science.gov (United States)

van der Meer, Margarethe; Rechkemmer, Yvonne; Breitgoff, Frauke D; Marx, Raphael; Neugebauer, Petr; Frank, Uta; van Slageren, Joris; Sarkar, Biprajit

2016-11-21

Quinonoid bridges are well-suited for generating dinuclear assemblies that might display various bistable properties. In this contribution we present two diiron(II) complexes where the iron(II) centers are either bridged by the doubly deprotonated form of a symmetrically substituted quinonoid bridge, 2,5-bis[4-(isopropyl)anilino]-1,4-benzoquinone (H 2 L2') with a [O,N,O,N] donor set, or with the doubly deprotonated form of an unsymmetrically substituted quinonoid bridge, 2-[4-(isopropyl)anilino]-5-hydroxy-1,4-benzoquinone (H 2 L5') with a [O,O,O,N] donor set. Both complexes display temperature-induced spin crossover (SCO). The nature of the SCO is strongly dependent on the bridging ligand, with only the complex with the [O,O,O,N] donor set displaying a prominent hysteresis loop of about 55 K. Importantly, only the latter complex also shows a pronounced light-induced spin state change. Furthermore, both complexes can be oxidized to the mixed-valent iron(II)-iron(III) form, and the nature of the bridge determines the Robin and Day classification of these forms. Both complexes have been probed by a battery of electrochemical, spectroscopic, and magnetic methods, and this combined approach is used to shed light on the electronic structures of the complexes and on bistability. The results presented here thus show the potential of using the relatively new class of unsymmetrically substituted bridging quinonoid ligands for generating intriguing bistable properties and for performing site-specific magnetic switching.

Chiroptical Molecular Switches 1; Principles and Syntheses.

NARCIS (Netherlands)

Lange, Ben de; Jager, Wolter F.; Feringa, Bernard

1992-01-01

The concept and the synthesis of the basic molecules for a chiroptical molecular switch are described. This molecular switch is based on photochemical interconversion of two bistable forms of chiral sterically overcrowded olefins. A large variety of these alkenes with different properties have been

Cell cycle commitment in budding yeast emerges from the cooperation of multiple bistable switches

Science.gov (United States)

Zhang, Tongli; Schmierer, Bernhard; Novák, Béla

2011-01-01

The start-transition (START) in the G1 phase marks the point in the cell cycle at which a yeast cell initiates a new round of cell division. Once made, this decision is irreversible and the cell is committed to progressing through the entire cell cycle, irrespective of arrest signals such as pheromone. How commitment emerges from the underlying molecular interaction network is poorly understood. Here, we perform a dynamical systems analysis of an established cell cycle model, which has never been analysed from a commitment perspective. We show that the irreversibility of the START transition and subsequent commitment can be consistently explained in terms of the interplay of multiple bistable molecular switches. By applying an existing mathematical model to a novel problem and by expanding the model in a self-consistent manner, we achieve several goals: we bring together a large number of experimental findings into a coherent theoretical framework; we increase the scope and the applicability of the original model; we give a systems level explanation of how the START transition and the cell cycle commitment arise from the dynamical features of the underlying molecular interaction network; and we make clear, experimentally testable predictions. PMID:22645649

Plasmon-modulated bistable four-wave mixing signals from a metal nanoparticle-monolayer MoS2 nanoresonator hybrid system

Science.gov (United States)

Li, Jian-Bo; Tan, Xiao-Long; Ma, Jin-Hong; Xu, Si-Qin; Kuang, Zhi-Wei; Liang, Shan; Xiao, Si; He, Meng-Dong; Kim, Nam-Chol; Luo, Jian-Hua; Chen, Li-Qun

2018-06-01

We present a study for the impact of exciton-phonon and exciton-plasmon interactions on bistable four-wave mixing (FWM) signals in a metal nanoparticle (MNP)-monolayer MoS2 nanoresonator hybrid system. Via tracing the FWM response we predict that, depending on the excitation conditions and the system parameters, such a system exhibits ‘U-shaped’ bistable FWM signals. We also map out bistability phase diagrams within the system’s parameter space. Especially, we show that compared with the exciton-phonon interaction, a strong exciton-plasmon interaction plays a dominant role in the generation of optical bistability, and the bistable region will be greatly broadened by shortening the distance between the MNP and the monolayer MoS2 nanoresonator. In the weak exciton-plasmon coupling regime, the impact of exciton-phonon interaction on optical bistability will become obvious. The scheme proposed may be used for building optical switches and logic-gate devices for optical computing and quantum information processing.

Plasmon-modulated bistable four-wave mixing signals from a metal nanoparticle-monolayer MoS2 nanoresonator hybrid system.

Science.gov (United States)

Li, Jian-Bo; Tan, Xiao-Long; Ma, Jin-Hong; Xu, Si-Qin; Kuang, Zhi-Wei; Liang, Shan; Xiao, Si; He, Meng-Dong; Kim, Nam-Chol; Luo, Jian-Hua; Chen, Li-Qun

2018-06-22

We present a study for the impact of exciton-phonon and exciton-plasmon interactions on bistable four-wave mixing (FWM) signals in a metal nanoparticle (MNP)-monolayer MoS 2 nanoresonator hybrid system. Via tracing the FWM response we predict that, depending on the excitation conditions and the system parameters, such a system exhibits 'U-shaped' bistable FWM signals. We also map out bistability phase diagrams within the system's parameter space. Especially, we show that compared with the exciton-phonon interaction, a strong exciton-plasmon interaction plays a dominant role in the generation of optical bistability, and the bistable region will be greatly broadened by shortening the distance between the MNP and the monolayer MoS 2 nanoresonator. In the weak exciton-plasmon coupling regime, the impact of exciton-phonon interaction on optical bistability will become obvious. The scheme proposed may be used for building optical switches and logic-gate devices for optical computing and quantum information processing.

The stochastic behavior of a molecular switching circuit with feedback

Directory of Open Access Journals (Sweden)

Smith Eric

2007-05-01

Full Text Available Abstract Background Using a statistical physics approach, we study the stochastic switching behavior of a model circuit of multisite phosphorylation and dephosphorylation with feedback. The circuit consists of a kinase and phosphatase acting on multiple sites of a substrate that, contingent on its modification state, catalyzes its own phosphorylation and, in a symmetric scenario, dephosphorylation. The symmetric case is viewed as a cartoon of conflicting feedback that could result from antagonistic pathways impinging on the state of a shared component. Results Multisite phosphorylation is sufficient for bistable behavior under feedback even when catalysis is linear in substrate concentration, which is the case we consider. We compute the phase diagram, fluctuation spectrum and large-deviation properties related to switch memory within a statistical mechanics framework. Bistability occurs as either a first-order or second-order non-equilibrium phase transition, depending on the network symmetries and the ratio of phosphatase to kinase numbers. In the second-order case, the circuit never leaves the bistable regime upon increasing the number of substrate molecules at constant kinase to phosphatase ratio. Conclusion The number of substrate molecules is a key parameter controlling both the onset of the bistable regime, fluctuation intensity, and the residence time in a switched state. The relevance of the concept of memory depends on the degree of switch symmetry, as memory presupposes information to be remembered, which is highest for equal residence times in the switched states. Reviewers This article was reviewed by Artem Novozhilov (nominated by Eugene Koonin, Sergei Maslov, and Ned Wingreen.

Multi-Valued Spin Switch in a Semiconductor Microcavity

Science.gov (United States)

Paraïso, T. K.; Wouters, M.; Léger, Y.; Morier-Genoud, F.; Deveaudhyphen; Plédran, B.

2011-12-01

In this work, we report on the first realization of multi-valued spin switching in the solid-state. We investigate the physics of spinor bistability with microcavity polaritons in a trap. Spinor interactions lead to special bistability regimes with decoupled thresholds for spin-up and spin-down polaritons. This allows us to establish state-of-the-art spin switching operations. We evidence polarization hysteresis and determine appropriate conditions to achieve spin multistability. For a given excitation condition, three stable spin states coexist for the system. These results open new pathways for the development of innovative spin-based logic gates and memory devices.

Bifurcation properties of nematic liquid crystals exposed to an electric field: Switchability, bistability, and multistability

KAUST Repository

Cummings, L. J.

2013-07-01

Bistable liquid crystal displays (LCDs) offer the potential for considerable power savings compared with conventional (monostable) LCDs. The existence of two (or more) stable field-free states that are optically distinct means that contrast can be maintained in a display without an externally applied electric field. An applied field is required only to switch the device from one state to the other, as needed. In this paper we examine the basic physical principles involved in generating multiple stable states and the switching between these states. We consider a two-dimensional geometry in which variable surface anchoring conditions are used to control the steady-state solutions and explore how different anchoring conditions can influence the number and type of solutions and whether or not switching is possible between the states. We find a wide range of possible behaviors, including bistability, tristability, and tetrastability, and investigate how the solution landscape changes as the boundary conditions are tuned. © 2013 American Physical Society.

Non-symmetric bi-stable flow around the Ahmed body

International Nuclear Information System (INIS)

Meile, W.; Ladinek, T.; Brenn, G.; Reppenhagen, A.; Fuchs, A.

2016-01-01

Highlights: • The non-symmetric bi-stable flow around the Ahmed body is investigated experimentally. • Bi-stability, described for symmetric flow by Cadot and co-workers, was found in nonsymmetric flow also. • The flow field randomly switches between two states. • The flow is subject to a spanwise instability identified by Cadot and co-workers for symmetric flow. • Aerodynamic forces fluctuate strongly due to the bi-stability. - Abstract: The flow around the Ahmed body at varying Reynolds numbers under yawing conditions is investigated experimentally. The body geometry belongs to a regime subject to spanwise flow instability identified in symmetric flow by Cadot and co-workers (Grandemange et al., 2013b). Our experiments cover the two slant angles 25° and 35° and Reynolds numbers up to 2.784 × 10"6. Special emphasis lies on the aerodynamics under side wind influence. For the 35° slant angle, forces and moments change significantly with the yawing angle in the range 10° ≤ |β| ≤ 15°. The lift and the pitching moment exhibit strong fluctuations due to bi-stable flow around a critical angle β of ±12.5°, where the pitching moment changes sign. Time series of the forces and moments are studied and explained by PIV measurements in the flow field near the rear of the body.

On the bistable zone of milling processes.

Science.gov (United States)

Dombovari, Zoltan; Stepan, Gabor

2015-09-28

A modal-based model of milling machine tools subjected to time-periodic nonlinear cutting forces is introduced. The model describes the phenomenon of bistability for certain cutting parameters. In engineering, these parameter domains are referred to as unsafe zones, where steady-state milling may switch to chatter for certain perturbations. In mathematical terms, these are the parameter domains where the periodic solution of the corresponding nonlinear, time-periodic delay differential equation is linearly stable, but its domain of attraction is limited due to the existence of an unstable quasi-periodic solution emerging from a secondary Hopf bifurcation. A semi-numerical method is presented to identify the borders of these bistable zones by tracking the motion of the milling tool edges as they might leave the surface of the workpiece during the cutting operation. This requires the tracking of unstable quasi-periodic solutions and the checking of their grazing to a time-periodic switching surface in the infinite-dimensional phase space. As the parameters of the linear structural behaviour of the tool/machine tool system can be obtained by means of standard modal testing, the developed numerical algorithm provides efficient support for the design of milling processes with quick estimates of those parameter domains where chatter can still appear in spite of setting the parameters into linearly stable domains. © 2015 The Authors.

The Life-cycle of Operons

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

2005-11-18

Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

Reversibly Bistable Flexible Electronics

KAUST Repository

Alfaraj, Nasir

2015-05-01

Introducing the notion of transformational silicon electronics has paved the way for integrating various applications with silicon-based, modern, high-performance electronic circuits that are mechanically flexible and optically semitransparent. While maintaining large-scale production and prototyping rapidity, this flexible and translucent scheme demonstrates the potential to transform conventionally stiff electronic devices into thin and foldable ones without compromising long-term performance and reliability. In this work, we report on the fabrication and characterization of reversibly bistable flexible electronic switches that utilize flexible n-channel metal-oxide-semiconductor field-effect transistors. The transistors are fabricated initially on rigid (100) silicon substrates before they are peeled off. They can be used to control flexible batches of light-emitting diodes, demonstrating both the relative ease of scaling at minimum cost and maximum reliability and the feasibility of integration. The peeled-off silicon fabric is about 25 µm thick. The fabricated devices are transferred to a reversibly bistable flexible platform through which, for example, a flexible smartphone can be wrapped around a user’s wrist and can also be set back to its original mechanical position. Buckling and cyclic bending of such host platforms brings a completely new dimension to the development of flexible electronics, especially rollable displays.

Bistable enhanced total reflection in Kretschmann configuration containing a saturable gain medium.

Science.gov (United States)

Zhou, Haichun; Guo, Jie; Xu, Kun; Li, Zhe; Tang, Junqi; Man, Shiqing

2018-03-05

The reflection of a TM-polarized light beam from a Kretschmann configuration with a saturable gain medium is investigated theoretically. Here, the dielectric constant of the gain medium is described by a classical Lorentzian oscillator model. When surface plasmon polaritons are effectively excited in this structure, it is demonstrated that the curves of enhanced total reflection (ETR) show different shaped hysteresis loops associated with optical bistability owing to gain saturation effect. The effects of the angle of incidence, the thickness of metal film, and the value of small-signal gain on bistable ETR are discussed in detail in a homogeneously broadened (HB) gain medium at line center. Analogous results can also be obtained in an inhomogeneously broadened (inHB) gain medium, while the two switch thresholds and the width of optical bistability hysteresis in an inHB gain medium are significantly different from those in a HB gain medium.

Single coil bistable, bidirectional micromechanical actuator

Science.gov (United States)

Tabat, Ned; Guckel, Henry

1998-09-15

Micromechanical actuators capable of bidirectional and bistable operation can be formed on substrates using lithographic processing techniques. Bistable operation of the microactuator is obtained using a single coil and a magnetic core with a gap. A plunger having two magnetic heads is supported for back and forth linear movement with respect to the gap in the magnetic core, and is spring biased to a neutral position in which the two heads are on each side of the gap in the core. The single electrical coil is coupled to the core and is provided with electrical current to attract one of the heads toward the core by reluctance action to drive the plunger to a limit of travel in one direction. The current is then cut off and the plunger returns by spring action toward the gap, whereafter the current is reapplied to the coil to attract the other head of the plunger by reluctance action to drive the plunger to its other limit of travel. This process can be repeated at a time when switching of the actuator is required.

The unsaturated bistable stochastic resonance system.

Science.gov (United States)

Zhao, Wenli; Wang, Juan; Wang, Linze

2013-09-01

We investigated the characteristics of the output saturation of the classical continuous bistable system (saturation bistable system) and its impact on stochastic resonance (SR). We further proposed a piecewise bistable SR system (unsaturated bistable system) and developed the expression of signal-to-noise ratio (SNR) using the adiabatic approximation theory. Compared with the saturation bistable system, the SNR is significantly improved in our unsaturated bistable SR system. The numerical simulation showed that the unsaturated bistable system performed better in extracting weak signals from strong background noise than the saturation bistable system.

The Life-cycle of Operons

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

2007-03-15

Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

Control of optical bistability and third-order nonlinearity via tunneling induced quantum interference in triangular quantum dot molecules

International Nuclear Information System (INIS)

Tian, Si-Cong; Tong, Cun-Zhu; Zhang, Jin-Long; Shan, Xiao-Nan; Fu, Xi-Hong; Zeng, Yu-Gang; Qin, Li; Ning, Yong-Qiang; Wan, Ren-Gang

2015-01-01

The optical bistability of a triangular quantum dot molecules embedded inside a unidirectional ring cavity is studied. The type, the threshold and the hysteresis loop of the optical bistability curves can be modified by the tunneling parameters, as well as the probe laser field. The linear and nonlinear susceptibilities of the medium are also studied to interpret the corresponding results. The physical interpretation is that the tunneling can induce the quantum interference, which modifies the linear and the nonlinear response of the medium. As a consequence, the characteristics of the optical bistability are changed. The scheme proposed here can be utilized for optimizing and controlling the optical switching process

Dynamic optical bistability in resonantly enhanced Raman generation

International Nuclear Information System (INIS)

Novikova, I.; Phillips, D.F.; Zibrov, A.S.; Andre, A.; Walsworth, R.L.

2004-01-01

We report observations of novel dynamic behavior in resonantly enhanced stimulated Raman scattering in Rb vapor. In particular, we demonstrate a dynamic hysteresis of the Raman scattered optical field in response to changes of the drive laser field intensity and/or frequency. This effect may be described as a dynamic form of optical bistability resulting from the formation and decay of atomic coherence. We have applied this phenomenon to the realization of an all-optical switch

Electrical bistabilities and memory mechanisms of nonvolatile organic bistable devices based on exfoliated muscovite-type mica nanoparticle/poly(methylmethacrylate) nanocomposites

Science.gov (United States)

Lim, Won Gyu; Lee, Dea Uk; Na, Han Gil; Kim, Hyoun Woo; Kim, Tae Whan

2018-02-01

Organic bistable devices (OBDs) with exfoliated mica nanoparticles (NPs) embedded into an insulating poly(methylmethacrylate) (PMMA) layer were fabricated by using a spin-coating method. Current-voltage (I-V) curves for the Al/PMMA/exfoliated mica NP/PMMA/indium-tin-oxide/glass devices at 300 K showed a clockwise current hysteresis behavior due to the existence of the exfoliated muscovite-type mica NPs, which is an essential feature for bistable devices. Write-read-erase-read data showed that the OBDs had rewritable nonvolatile memories and an endurance number of ON/OFF switching for the OBDs of 102 cycles. An ON/OFF ratio of 1 × 103 was maintained for retention times larger than 1 × 104 s. The memory mechanisms of the fabricated OBDs were described by using the trapping and the tunneling processes within a PMMA active layer containing exfoliated muscovite-type mica NPs on the basis of the energy band diagram and the I-V curves.

Thiol-modified MoS2 nanosheets as a functional layer for electrical bistable devices

Science.gov (United States)

Li, Guan; Tan, Fenxue; Lv, Bokun; Wu, Mengying; Wang, Ruiqi; Lu, Yue; Li, Xu; Li, Zhiqiang; Teng, Feng

2018-01-01

Molybdenum disulfide nanosheets have been synthesized by one-pot method using 1-ODT as sulfur source and surfactant. The structure, morphology and optical properties of samples were investigated by XRD, FTIR, Abs spectrum and TEM patterns. The XRD pattern indicated that the as-obtained MoS2 belong to hexagonal system. The as-obtained MoS2 nanosheets blending with PVK could be used to fabricate an electrically bistable devices through a simple spin-coating method and the device exhibited an obvious electrical bistability properties. The charge transport mechanism of the device was discussed based on the filamentary switching models.

Unstable Modes and Order Parameters of Bistable Signaling Pathways at Saddle-Node Bifurcations: A Theoretical Study Based on Synergetics

Directory of Open Access Journals (Sweden)

Till D. Frank

2016-01-01

Full Text Available Mathematical modeling has become an indispensable part of systems biology which is a discipline that has become increasingly popular in recent years. In this context, our understanding of bistable signaling pathways in terms of mathematical modeling is of particular importance because such bistable components perform crucial functions in living cells. Bistable signaling pathways can act as switches or memory functions and can determine cell fate. In the present study, properties of mathematical models of bistable signaling pathways are examined from the perspective of synergetics, a theory of self-organization and pattern formation founded by Hermann Haken. At the heart of synergetics is the concept of so-called unstable modes or order parameters that determine the behavior of systems as a whole close to bifurcation points. How to determine these order parameters for bistable signaling pathways at saddle-node bifurcation points is shown. The procedure is outlined in general and an explicit example is worked out in detail.

Multistable decision switches for flexible control of epigenetic differentiation.

Directory of Open Access Journals (Sweden)

Raúl Guantes

2008-11-01

Full Text Available It is now recognized that molecular circuits with positive feedback can induce two different gene expression states (bistability under the very same cellular conditions. Whether, and how, cells make use of the coexistence of a larger number of stable states (multistability is however largely unknown. Here, we first examine how autoregulation, a common attribute of genetic master regulators, facilitates multistability in two-component circuits. A systematic exploration of these modules' parameter space reveals two classes of molecular switches, involving transitions in bistable (progression switches or multistable (decision switches regimes. We demonstrate the potential of decision switches for multifaceted stimulus processing, including strength, duration, and flexible discrimination. These tasks enhance response specificity, help to store short-term memories of recent signaling events, stabilize transient gene expression, and enable stochastic fate commitment. The relevance of these circuits is further supported by biological data, because we find them in numerous developmental scenarios. Indeed, many of the presented information-processing features of decision switches could ultimately demonstrate a more flexible control of epigenetic differentiation.

An analytical approach to bistable biological circuit discrimination using real algebraic geometry.

Science.gov (United States)

Siegal-Gaskins, Dan; Franco, Elisa; Zhou, Tiffany; Murray, Richard M

2015-07-06

Biomolecular circuits with two distinct and stable steady states have been identified as essential components in a wide range of biological networks, with a variety of mechanisms and topologies giving rise to their important bistable property. Understanding the differences between circuit implementations is an important question, particularly for the synthetic biologist faced with determining which bistable circuit design out of many is best for their specific application. In this work we explore the applicability of Sturm's theorem--a tool from nineteenth-century real algebraic geometry--to comparing 'functionally equivalent' bistable circuits without the need for numerical simulation. We first consider two genetic toggle variants and two different positive feedback circuits, and show how specific topological properties present in each type of circuit can serve to increase the size of the regions of parameter space in which they function as switches. We then demonstrate that a single competitive monomeric activator added to a purely monomeric (and otherwise monostable) mutual repressor circuit is sufficient for bistability. Finally, we compare our approach with the Routh-Hurwitz method and derive consistent, yet more powerful, parametric conditions. The predictive power and ease of use of Sturm's theorem demonstrated in this work suggest that algebraic geometric techniques may be underused in biomolecular circuit analysis.

Robust network topologies for generating switch-like cellular responses.

Directory of Open Access Journals (Sweden)

Najaf A Shah

2011-06-01

Full Text Available Signaling networks that convert graded stimuli into binary, all-or-none cellular responses are critical in processes ranging from cell-cycle control to lineage commitment. To exhaustively enumerate topologies that exhibit this switch-like behavior, we simulated all possible two- and three-component networks on random parameter sets, and assessed the resulting response profiles for both steepness (ultrasensitivity and extent of memory (bistability. Simulations were used to study purely enzymatic networks, purely transcriptional networks, and hybrid enzymatic/transcriptional networks, and the topologies in each class were rank ordered by parametric robustness (i.e., the percentage of applied parameter sets exhibiting ultrasensitivity or bistability. Results reveal that the distribution of network robustness is highly skewed, with the most robust topologies clustering into a small number of motifs. Hybrid networks are the most robust in generating ultrasensitivity (up to 28% and bistability (up to 18%; strikingly, a purely transcriptional framework is the most fragile in generating either ultrasensitive (up to 3% or bistable (up to 1% responses. The disparity in robustness among the network classes is due in part to zero-order ultrasensitivity, an enzyme-specific phenomenon, which repeatedly emerges as a particularly robust mechanism for generating nonlinearity and can act as a building block for switch-like responses. We also highlight experimentally studied examples of topologies enabling switching behavior, in both native and synthetic systems, that rank highly in our simulations. This unbiased approach for identifying topologies capable of a given response may be useful in discovering new natural motifs and in designing robust synthetic gene networks.

A steady state analysis indicates that negative feedback regulation of PTP1B by Akt elicits bistability in insulin-stimulated GLUT4 translocation

Directory of Open Access Journals (Sweden)

Giri Lopamudra

2004-08-01

Full Text Available Abstract Background The phenomenon of switch-like response to graded input signal is the theme involved in various signaling pathways in living systems. Positive feedback loops or double negative feedback loops embedded with nonlinearity exhibit these switch-like bistable responses. Such feedback regulations exist in insulin signaling pathway as well. Methods In the current manuscript, a steady state analysis of the metabolic insulin-signaling pathway is presented. The threshold concentration of insulin required for glucose transporter GLUT4 translocation was studied with variation in system parameters and component concentrations. The dose response curves of GLUT4 translocation at various concentration of insulin obtained by steady state analysis were quantified in-terms of half saturation constant. Results We show that, insulin-stimulated GLUT4 translocation can operate as a bistable switch, which ensures that GLUT4 settles between two discrete, but mutually exclusive stable steady states. The threshold concentration of insulin required for GLUT4 translocation changes with variation in system parameters and component concentrations, thus providing insights into possible pathological conditions. Conclusion A steady state analysis indicates that negative feedback regulation of phosphatase PTP1B by Akt elicits bistability in insulin-stimulated GLUT4 translocation. The threshold concentration of insulin required for GLUT4 translocation and the corresponding bistable response at different system parameters and component concentrations was compared with reported experimental observations on specific defects in regulation of the system.

Detecting uber-operons in prokaryotic genomes.

Science.gov (United States)

Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

2006-01-01

We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

Optical bistability controlling light with light

CERN Document Server

Gibbs, Hyatt

1985-01-01

Optical Bistability: Controlling Light with Light focuses on optical bistability in nonlinear optical systems. Emphasis is on passive (non-laser) systems that exhibit reversible bistability with input intensity as the hysteresis variable, along with the physics and the potential applications of such systems for nonlinear optical signal processing. This book consists of seven chapters and begins with a historical overview of optical bistability in lasers and passive systems. The next chapter describes steady-state theories of optical bistability, including the Bonifacio-Lugiato model, as we

The interplay of multiple feedback loops with post-translational kinetics results in bistability of mycobacterial stress response

International Nuclear Information System (INIS)

Tiwari, Abhinav; Igoshin, Oleg A; Balázsi, Gábor; Gennaro, Maria Laura

2010-01-01

Bacterial persistence is the phenomenon in which a genetically identical fraction of a bacterial population can survive exposure to stress by reduction or cessation of growth. Persistence in mycobacteria has been recently linked to a stress-response network, consisting of the MprA/MprB two-component system and alternative sigma factor σ E . This network contains multiple positive transcriptional feedback loops which may give rise to bistability, making it a good candidate for controlling the mycobacterial persistence switch. To analyze the possibility of bistability, we develop a method that involves decoupling of the network into transcriptional and post-translational interaction modules. As a result we reduce the dimensionality of the dynamical system and independently analyze input–output relations in the two modules to formulate a necessary condition for bistability in terms of their logarithmic gains. We show that neither the positive autoregulation in the MprA/MprB network nor the σ E -mediated transcriptional feedback is sufficient to induce bistability in a biochemically realistic parameter range. Nonetheless, inclusion of the post-translational regulation of σ E by RseA increases the effective cooperativity of the system, resulting in bistability that is robust to parameter variation. We predict that overexpression or deletion of RseA, the key element controlling the ultrasensitive response, can eliminate bistability

A Miniature Coupled Bistable Vibration Energy Harvester

International Nuclear Information System (INIS)

Zhu, D; Arthur, D C; Beeby, S P

2014-01-01

This paper reports the design and test of a miniature coupled bistable vibration energy harvester. Operation of a bistable structure largely depends on vibration amplitude rather than frequency, which makes it very promising for wideband vibration energy harvesting applications. A coupled bistable structure consists of a pair of mobile magnets that create two potential wells and thus the bistable phenomenon. It requires lower excitation to trigger bistable operation compared to conventional bistable structures. Based on previous research, this work focused on miniaturisation of the coupled bistable structure for energy harvesting application. The proposed bistable energy harvester is a combination of a Duffing's nonlinear structure and a linear assisting resonator. Experimental results show that the output spectrum of the miniature coupled bistable vibration energy harvester was the superposition of several spectra. It had a higher maximum output power and a much greater bandwidth compared to simply the Duffing's structure without the assisting resonator

Optical bistabilities of higher harmonics: Inhomogeneous and transverse effects

Energy Technology Data Exchange (ETDEWEB)

Hassan, S.S., E-mail: Shoukryhassan@hotmail.com [Department of Mathematics, College of Science, University of Bahrain, P.O. Box 32038 (Bahrain); Manchester Metropolitan University, Dept. of Computing, Maths. and Digital Technology, Manchester M1 5GD (United Kingdom); Sharaby, Y.A., E-mail: Yasser_Sharaby@hotmail.com [Department of Physics, Faculty of Science, Suez Canal University, Suez (Egypt); Ali, M.F.M., E-mail: dr.mona.fathy@hotmail.com [Department of Mathematics: Faculty of Science, Ain Shams University, Cairo (Egypt); Joshi, A., E-mail: ajoshi@eiu.edu [Department of Physics, Eastern Illinois University, Charleston, IL 61920 (United States)

2012-10-15

The steady state behavior of optical bistable system in a ring cavity with transverse field variations and inhomogeneousely broadened two-level atoms is investigated outside the rotating wave approximation (RWA). Analytical and numerical investigation is presented for different cases of transverse field variations with Lorentzian or Gaussian line widths. When both (transverse and inhomogeneous) features taken into account, the first harmonic output field component outside the RWA exhibits a one-way switching down processes (butterfly OB) or reversed (clockwise) OB behavior, depending on the atomic linewidth shape.

Optical bistabilities of higher harmonics: Inhomogeneous and transverse effects

International Nuclear Information System (INIS)

Hassan, S.S.; Sharaby, Y.A.; Ali, M.F.M.; Joshi, A.

2012-01-01

The steady state behavior of optical bistable system in a ring cavity with transverse field variations and inhomogeneousely broadened two-level atoms is investigated outside the rotating wave approximation (RWA). Analytical and numerical investigation is presented for different cases of transverse field variations with Lorentzian or Gaussian line widths. When both (transverse and inhomogeneous) features taken into account, the first harmonic output field component outside the RWA exhibits a one-way switching down processes (butterfly OB) or reversed (clockwise) OB behavior, depending on the atomic linewidth shape.

Evidence against the selfish operon theory.

Science.gov (United States)

Pál, Csaba; Hurst, Laurence D

2004-06-01

According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

Temperature persistent bistability and threshold switching in a single barrier heterostructure hot-electron diode

DEFF Research Database (Denmark)

Stasch, R.; Hey, R.; Asche, M.

1996-01-01

Bistable current–voltage characteristics caused by competition of tunneling through and field-enhanced thermionic emission across a single barrier are investigated in an n–-GaAs/Al0.34Ga0.66As/n+-GaAs structure. The S-shaped part of the characteristic persists in the whole temperature regime...

Controlling bistability by linear augmentation

International Nuclear Information System (INIS)

Sharma, Pooja Rani; Shrimali, Manish Dev; Prasad, Awadhesh; Feudel, Ulrike

2013-01-01

In many bistable oscillating systems only one of the attractors is desired to possessing certain system performance. We present a method to drive a bistable system to a desired target attractor by annihilating the other one. This shift from bistability to monostability is achieved by augmentation of the nonlinear oscillator with a linear control system. For a proper choice of the control function one of the attractors disappears at a critical coupling strength in an control-induced boundary crisis. This transition from bistability to monostability is demonstrated with two paradigmatic examples, the autonomous Chua oscillator and a neuronal system with a periodic input signal.

Bistable Mechanisms for Space Applications.

Science.gov (United States)

Zirbel, Shannon A; Tolman, Kyler A; Trease, Brian P; Howell, Larry L

2016-01-01

Compliant bistable mechanisms are monolithic devices with two stable equilibrium positions separated by an unstable equilibrium position. They show promise in space applications as nonexplosive release mechanisms in deployment systems, thereby eliminating friction and improving the reliability and precision of those mechanical devices. This paper presents both analytical and numerical models that are used to predict bistable behavior and can be used to create bistable mechanisms in materials not previously feasible for compliant mechanisms. Materials compatible with space applications are evaluated for use as bistable mechanisms and prototypes are fabricated in three different materials. Pin-puller and cutter release mechanisms are proposed as potential space applications.

A novel bistable energy harvesting concept

International Nuclear Information System (INIS)

Scarselli, G; Nicassio, F; Pinto, F; Ciampa, F; Iervolino, O; Meo, M

2016-01-01

Bistable energy harvesting has become a major field of research due to some unique features for converting mechanical energy into electrical power. When properly loaded, bistable structures snap-through from one stable configuration to another, causing large strains and consequently power generation. Moreover, bistable structures can harvest energy across a broad-frequency bandwidth due to their nonlinear characteristics. Despite the fact that snap-through may be triggered regardless of the form or frequency of exciting vibration, the external force must reach a specific snap-through activation threshold value to trigger the transition from one stable state to another. This aspect is a limiting factor for realistic vibration energy harvesting application with bistable devices. This paper presents a novel power harvesting concept for bistable composites based on a ‘lever effect’ aimed at minimising the activation force to cause the snap through by choosing properly the bistable structures’ constraints. The concept was demonstrated with the help of numerical simulation and experimental testing. The results showed that the actuation force is one order of magnitude smaller (3%–6%) than the activation force of conventionally constrained bistable devices. In addition, it was shown that the output voltage was higher than the conventional configuration, leading to a significant increase in power generation. This novel concept could lead to a new generation of more efficient bistable energy harvesters for realistic vibration environments. (paper)

REMap: Operon Map of M. tuberculosis

Science.gov (United States)

Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

2016-01-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

Terminator Operon Reporter: combining a transcription termination switch with reporter technology for improved gene synthesis and synthetic biology applications.

Science.gov (United States)

Zampini, Massimiliano; Mur, Luis A J; Rees Stevens, Pauline; Pachebat, Justin A; Newbold, C James; Hayes, Finbarr; Kingston-Smith, Alison

2016-05-25

Synthetic biology is characterized by the development of novel and powerful DNA fabrication methods and by the application of engineering principles to biology. The current study describes Terminator Operon Reporter (TOR), a new gene assembly technology based on the conditional activation of a reporter gene in response to sequence errors occurring at the assembly stage of the synthetic element. These errors are monitored by a transcription terminator that is placed between the synthetic gene and reporter gene. Switching of this terminator between active and inactive states dictates the transcription status of the downstream reporter gene to provide a rapid and facile readout of the accuracy of synthetic assembly. Designed specifically and uniquely for the synthesis of protein coding genes in bacteria, TOR allows the rapid and cost-effective fabrication of synthetic constructs by employing oligonucleotides at the most basic purification level (desalted) and without the need for costly and time-consuming post-synthesis correction methods. Thus, TOR streamlines gene assembly approaches, which are central to the future development of synthetic biology.

ProOpDB: Prokaryotic Operon DataBase.

Science.gov (United States)

Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

2012-01-01

The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

Optical bistability and multistability driven by external magnetic field in a dielectric slab doped with nanodiamond nitrogen vacancy centres

Science.gov (United States)

Nasehi, R.; Norouzi, F.

2016-08-01

The theoretical investigation of controlling the optical bistability (OB) and optical multistability (OM) in a dielectric medium doped with nanodiamond nitrogen vacancy centres under optical excitation are reported. The shape of the OB curve from dielectric slab can be tuned by changing the external magnetic field and polarization of the control beam. The effect of the intensity of the control laser field and the frequency detuning of probe laser field on the OB and OM behaviour are also discussed in this paper. The results obtained can be used for realizing an all-optical bistable switching or development of nanoelectronic devices.

The relative value of operon predictions

NARCIS (Netherlands)

Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

A hierarchical stochastic model for bistable perception.

Directory of Open Access Journals (Sweden)

Stefan Albert

2017-11-01

Full Text Available Viewing of ambiguous stimuli can lead to bistable perception alternating between the possible percepts. During continuous presentation of ambiguous stimuli, percept changes occur as single events, whereas during intermittent presentation of ambiguous stimuli, percept changes occur at more or less regular intervals either as single events or bursts. Response patterns can be highly variable and have been reported to show systematic differences between patients with schizophrenia and healthy controls. Existing models of bistable perception often use detailed assumptions and large parameter sets which make parameter estimation challenging. Here we propose a parsimonious stochastic model that provides a link between empirical data analysis of the observed response patterns and detailed models of underlying neuronal processes. Firstly, we use a Hidden Markov Model (HMM for the times between percept changes, which assumes one single state in continuous presentation and a stable and an unstable state in intermittent presentation. The HMM captures the observed differences between patients with schizophrenia and healthy controls, but remains descriptive. Therefore, we secondly propose a hierarchical Brownian model (HBM, which produces similar response patterns but also provides a relation to potential underlying mechanisms. The main idea is that neuronal activity is described as an activity difference between two competing neuronal populations reflected in Brownian motions with drift. This differential activity generates switching between the two conflicting percepts and between stable and unstable states with similar mechanisms on different neuronal levels. With only a small number of parameters, the HBM can be fitted closely to a high variety of response patterns and captures group differences between healthy controls and patients with schizophrenia. At the same time, it provides a link to mechanistic models of bistable perception, linking the group

A hierarchical stochastic model for bistable perception.

Science.gov (United States)

Albert, Stefan; Schmack, Katharina; Sterzer, Philipp; Schneider, Gaby

2017-11-01

Viewing of ambiguous stimuli can lead to bistable perception alternating between the possible percepts. During continuous presentation of ambiguous stimuli, percept changes occur as single events, whereas during intermittent presentation of ambiguous stimuli, percept changes occur at more or less regular intervals either as single events or bursts. Response patterns can be highly variable and have been reported to show systematic differences between patients with schizophrenia and healthy controls. Existing models of bistable perception often use detailed assumptions and large parameter sets which make parameter estimation challenging. Here we propose a parsimonious stochastic model that provides a link between empirical data analysis of the observed response patterns and detailed models of underlying neuronal processes. Firstly, we use a Hidden Markov Model (HMM) for the times between percept changes, which assumes one single state in continuous presentation and a stable and an unstable state in intermittent presentation. The HMM captures the observed differences between patients with schizophrenia and healthy controls, but remains descriptive. Therefore, we secondly propose a hierarchical Brownian model (HBM), which produces similar response patterns but also provides a relation to potential underlying mechanisms. The main idea is that neuronal activity is described as an activity difference between two competing neuronal populations reflected in Brownian motions with drift. This differential activity generates switching between the two conflicting percepts and between stable and unstable states with similar mechanisms on different neuronal levels. With only a small number of parameters, the HBM can be fitted closely to a high variety of response patterns and captures group differences between healthy controls and patients with schizophrenia. At the same time, it provides a link to mechanistic models of bistable perception, linking the group differences to

Transcriptome dynamics-based operon prediction in prokaryotes.

Science.gov (United States)

Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

2014-05-16

Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

International Nuclear Information System (INIS)

Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

1993-01-01

Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

Switching dynamics of TaOx-based threshold switching devices

Science.gov (United States)

Goodwill, Jonathan M.; Gala, Darshil K.; Bain, James A.; Skowronski, Marek

2018-03-01

Bi-stable volatile switching devices are being used as access devices in solid-state memory arrays and as the active part of compact oscillators. Such structures exhibit two stable states of resistance and switch between them at a critical value of voltage or current. A typical resistance transient under a constant amplitude voltage pulse starts with a slow decrease followed by a rapid drop and leveling off at a low steady state value. This behavior prompted the interpretation of initial delay and fast transition as due to two different processes. Here, we show that the entire transient including incubation time, transition time, and the final resistance values in TaOx-based switching can be explained by one process, namely, Joule heating with the rapid transition due to the thermal runaway. The time, which is required for the device in the conducting state to relax back to the stable high resistance one, is also consistent with the proposed mechanism.

Optimization of Bistable Viscoelastic Systems

DEFF Research Database (Denmark)

Jensen, Kristian Ejlebjærg; Szabo, Peter; Okkels, Fridolin

2014-01-01

driving pressure corresponding to the point of bistability, such that the effect is enhanced. The point of bistability is, however, not explicitly contained in the solution, so we opt for a heuristic approach based on the dissipation ratio between the asymmetric and unstable symmetric flow solutions. We...... find a design that significantly reduces the driving pressure required for bistability, and furthermore is in agreement with the approach followed by experimental researchers. Furthermore, by comparing the two asymmetric solutions, we succesfully apply the same approach to a problem with two fluids...

A broadband electromagnetic energy harvester with a coupled bistable structure

International Nuclear Information System (INIS)

Zhu, D; Beeby, S P

2013-01-01

This paper investigates a broadband electromagnetic energy harvester with a coupled bistable structure. Both analytical model and experimental results showed that the coupled bistable structure requires lower excitation force to trigger bistable operation than conventional bistable structures. A compact electromagnetic vibration energy harvester with a coupled bistable structure was implemented and tested. It was excited under white noise vibrations. Experimental results showed that the coupled bistable energy harvester can achieve bistable operation with lower excitation amplitude and generate more output power than both conventional bistable and linear energy harvesters under white noise excitation

Generalized nematohydrodynamic boundary conditions with application to bistable twisted nematic liquid-crystal displays

KAUST Repository

Fang, Angbo

2008-12-08

Parallel to the highly successful Ericksen-Leslie hydrodynamic theory for the bulk behavior of nematic liquid crystals (NLCs), we derive a set of coupled hydrodynamic boundary conditions to describe the NLC dynamics near NLC-solid interfaces. In our boundary conditions, translational flux (flow slippage) and rotational flux (surface director relaxation) are coupled according to the Onsager variational principle of least energy dissipation. The application of our boundary conditions to the truly bistable π -twist NLC cell reveals a complete picture of the dynamic switching processes. It is found that the thus far overlooked translation-rotation dissipative coupling at solid surfaces can accelerate surface director relaxation and enhance the flow rate. This can be utilized to improve the performance of electro-optical nematic devices by lowering the required switching voltages and reducing the switching times. © 2008 The American Physical Society.

Fractionation of parietal function in bistable perception probed with concurrent TMS-EEG.

Science.gov (United States)

Schauer, Georg; Chang, Acer; Schwartzman, David; Rae, Charlotte L; Iriye, Heather; Seth, Anil K; Kanai, Ryota

2016-08-16

When visual input has conflicting interpretations, conscious perception can alternate spontaneously between these possible interpretations. This is called bistable perception. Previous neuroimaging studies have indicated the involvement of two right parietal areas in resolving perceptual ambiguity (ant-SPLr and post-SPLr). Transcranial magnetic stimulation (TMS) studies that selectively interfered with the normal function of these regions suggest that they play opposing roles in this type of perceptual switch. In the present study, we investigated this fractionation of parietal function by use of combined TMS with electroencephalography (EEG). Specifically, while participants viewed either a bistable stimulus, a replay stimulus, or resting-state fixation, we applied single pulse TMS to either location independently while simultaneously recording EEG. Combined with participant's individual structural magnetic resonance imaging (MRI) scans, this dataset allows for complex analyses of the effect of TMS on neural time series data, which may further elucidate the causal role of the parietal cortex in ambiguous perception.

Emergence of switch-like behavior in a large family of simple biochemical networks.

Directory of Open Access Journals (Sweden)

Dan Siegal-Gaskins

2011-05-01

Full Text Available Bistability plays a central role in the gene regulatory networks (GRNs controlling many essential biological functions, including cellular differentiation and cell cycle control. However, establishing the network topologies that can exhibit bistability remains a challenge, in part due to the exceedingly large variety of GRNs that exist for even a small number of components. We begin to address this problem by employing chemical reaction network theory in a comprehensive in silico survey to determine the capacity for bistability of more than 40,000 simple networks that can be formed by two transcription factor-coding genes and their associated proteins (assuming only the most elementary biochemical processes. We find that there exist reaction rate constants leading to bistability in ∼90% of these GRN models, including several circuits that do not contain any of the TF cooperativity commonly associated with bistable systems, and the majority of which could only be identified as bistable through an original subnetwork-based analysis. A topological sorting of the two-gene family of networks based on the presence or absence of biochemical reactions reveals eleven minimal bistable networks (i.e., bistable networks that do not contain within them a smaller bistable subnetwork. The large number of previously unknown bistable network topologies suggests that the capacity for switch-like behavior in GRNs arises with relative ease and is not easily lost through network evolution. To highlight the relevance of the systematic application of CRNT to bistable network identification in real biological systems, we integrated publicly available protein-protein interaction, protein-DNA interaction, and gene expression data from Saccharomyces cerevisiae, and identified several GRNs predicted to behave in a bistable fashion.

Diversity and functional properties of bistable pigments.

Science.gov (United States)

Tsukamoto, Hisao; Terakita, Akihisa

2010-11-01

Rhodopsin and related opsin-based pigments, which are photosensitive membrane proteins, have been extensively studied using a wide variety of techniques, with rhodopsin being the most understood G protein-coupled receptor (GPCR). Animals use various opsin-based pigments for vision and a wide variety of non-visual functions. Many functionally varied pigments are roughly divided into two kinds, based on their photoreaction: bistable and monostable pigments. Bistable pigments are thermally stable before and after photo-activation, but monostable pigments are stable only before activation. Here, we review the diversity of bistable pigments and their molecular characteristics. We also discuss the mechanisms underlying different molecular characteristics of bistable and monostable pigments. In addition, the potential of bistable pigments as a GPCR model is proposed.

Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

Science.gov (United States)

Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

2013-07-01

Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Wavelength switching dynamics of two-colour semiconductor lasers with optical injection and feedback

International Nuclear Information System (INIS)

Osborne, S; Heinricht, P; Brandonisio, N; Amann, A; O’Brien, S

2012-01-01

The wavelength switching dynamics of two-colour semiconductor lasers with optical injection and feedback are presented. These devices incorporate slotted regions etched into the laser ridge waveguide for tailoring the output spectrum. Experimental measurements are presented demonstrating that optical injection in one or both modes of these devices can induce wavelength bistability. Measured switching dynamics with modulated optical injection are shown to be in excellent agreement with numerical simulations based on a simple rate equation model. We also demonstrate experimentally that time-delayed optical feedback can induce wavelength bistability for short external cavity lengths. Numerical simulations indicate that this two-colour optical feedback system can provide fast optical memory functionality based on injected optical pulses without the need for an external holding beam. (paper)

Problem-Solving Test: Tryptophan Operon Mutants

Science.gov (United States)

Szeberenyi, Jozsef

2010-01-01

This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

Distributed processing in bistable perception

NARCIS (Netherlands)

Knapen, T.H.J.

2007-01-01

A very incisive way of studying visual awareness and the mechanisms that underlie it, it to use bistable perception. In bistable perception, an observer's perceptual state alternates between one interpretation and its mutually exclusive counterpart while the stimulus remains the same. This gives us

Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

Science.gov (United States)

Narang, Atul; Oehler, Stefan

2017-05-01

The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

Oscillatory bistability of real-space transfer in semiconductor heterostructures

Science.gov (United States)

Do˙ttling, R.; Scho˙ll, E.

1992-01-01

Charge transport parallel to the layers of a modulation-doped GaAs/AlxGa1-xAs heterostructure is studied theoretically. The heating of electrons by the applied electric field leads to real-space transfer of electrons from the GaAs into the adjacent AlxGa1-xAs layer. For sufficiently large dc bias, spontaneous periodic 100-GHz current oscillations, and bistability and hysteretic switching transitions between oscillatory and stationary states are predicted. We present a detailed investigation of complex bifurcation scenarios as a function of the bias voltage U0 and the load resistance RL. For large RL subcritical Hopf bifurcations and global bifurcations of limit cycles are displayed.

BRIEF COMMUNICATION: Electrothermal bistability tuning in a large displacement micro actuator

Science.gov (United States)

Gerson, Y.; Krylov, S.; Ilic, B.

2010-11-01

We report on an approach allowing simple yet efficient tuning of the bistability properties in large displacement micro actuators. The devices fabricated from silicon on insulator (SOI) wafers using a deep reactive ion etching (DRIE)-based process incorporate elastic suspension realized as a pair of beams initially curved in-plane and are operated electrostatically by a comb-drive transducer. The curvature of beam and therefore the stability characteristics of the suspension are controlled by passing a current through the suspension and resistive heating the beam material. Experimental results, which are in good agreement with the finite elements model predictions, demonstrate the feasibility of the suggested approach and show that the application of a small tuning current increases the device deflection from 42 to 56 µm, allows adjustment of the critical snap-through and snap-back voltages and makes it possible the control of latching without an additional electrode. The approach can be efficiently implemented in electrical and optical switches and threshold inertial and mass sensors where the use of long displacement actuators with an adjustable bistability range is beneficial.

Resistive switching memories in MoS{sub 2} nanosphere assemblies

Energy Technology Data Exchange (ETDEWEB)

Xu, Xiao-Yong, E-mail: xxxy@yzu.edu.cn, E-mail: xcxseu@seu.edu.cn, E-mail: jghu@yzu.edu.cn [School of Physics Science and Technology, Yangzhou University, Yangzhou 225002 (China); State Key Laboratory of Bioelectronics and School of Electronic Science and Engineering, Southeast University, Nanjing 210096 (China); School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore, Singapore 639798 (Singapore); Yin, Zong-You [School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore, Singapore 639798 (Singapore); Xu, Chun-Xiang, E-mail: xxxy@yzu.edu.cn, E-mail: xcxseu@seu.edu.cn, E-mail: jghu@yzu.edu.cn; Dai, Jun [State Key Laboratory of Bioelectronics and School of Electronic Science and Engineering, Southeast University, Nanjing 210096 (China); Hu, Jing-Guo, E-mail: xxxy@yzu.edu.cn, E-mail: xcxseu@seu.edu.cn, E-mail: jghu@yzu.edu.cn [School of Physics Science and Technology, Yangzhou University, Yangzhou 225002 (China)

2014-01-20

A resistive switching memory device consisting of reduced graphene oxide and indium tin oxide as top/bottom two electrodes, separated by dielectric MoS{sub 2} nanosphere assemblies as the active interlayer, was fabricated. This device exhibits the rewritable nonvolatile resistive switching with low SET/RESET voltage (∼2 V), high ON/OFF resistance ratio (∼10{sup 4}), and superior electrical bistability, introducing a potential application in data storage field. The resistance switching mechanism was analyzed in the assumptive model of the electron tunneling across the polarized potential barriers.

Optical bistability without the rotating wave approximation

Energy Technology Data Exchange (ETDEWEB)

Sharaby, Yasser A., E-mail: Yasser_Sharaby@hotmail.co [Physics Department, Faculty of Applied Sciences, Suez Canal University, Suez (Egypt); Joshi, Amitabh, E-mail: ajoshi@eiu.ed [Department of Physics, Eastern Illinois University, Charleston, IL 61920 (United States); Hassan, Shoukry S., E-mail: Shoukryhassan@hotmail.co [Mathematics Department, College of Science, University of Bahrain, P.O. Box 32038 (Bahrain)

2010-04-26

Optical bistability for two-level atomic system in a ring cavity is investigated outside the rotating wave approximation (RWA) using non-autonomous Maxwell-Bloch equations with Fourier decomposition up to first harmonic. The first harmonic output field component exhibits reversed or closed loop bistability simultaneously with the usual (anti-clockwise) bistability in the fundamental field component.

Optical bistability without the rotating wave approximation

International Nuclear Information System (INIS)

Sharaby, Yasser A.; Joshi, Amitabh; Hassan, Shoukry S.

2010-01-01

Optical bistability for two-level atomic system in a ring cavity is investigated outside the rotating wave approximation (RWA) using non-autonomous Maxwell-Bloch equations with Fourier decomposition up to first harmonic. The first harmonic output field component exhibits reversed or closed loop bistability simultaneously with the usual (anti-clockwise) bistability in the fundamental field component.

Simulating the room-temperature dynamic motion of a ferromagnetic vortex in a bistable potential

Science.gov (United States)

Haber, E.; Badea, R.; Berezovsky, J.

2018-05-01

The ability to precisely and reliably control the dynamics of ferromagnetic (FM) vortices could lead to novel nonvolatile memory devices and logic gates. Intrinsic and fabricated defects in the FM material can pin vortices and complicate the dynamics. Here, we simulated switching a vortex between bistable pinning sites using magnetic field pulses. The dynamic motion was modeled with the Thiele equation for a massless, rigid vortex subject to room-temperature thermal noise. The dynamics were explored both when the system was at zero temperature and at room-temperature. The probability of switching for different pulses was calculated, and the major features are explained using the basins of attraction map of the two pinning sites.

Ground-state kinetics of bistable redox-active donor-acceptor mechanically interlocked molecules.

Science.gov (United States)

Fahrenbach, Albert C; Bruns, Carson J; Li, Hao; Trabolsi, Ali; Coskun, Ali; Stoddart, J Fraser

2014-02-18

The ability to design and confer control over the kinetics of theprocesses involved in the mechanisms of artificial molecular machines is at the heart of the challenge to create ones that can carry out useful work on their environment, just as Nature is wont to do. As one of the more promising forerunners of prototypical artificial molecular machines, chemists have developed bistable redox-active donor-acceptor mechanically interlocked molecules (MIMs) over the past couple of decades. These bistable MIMs generally come in the form of [2]rotaxanes, molecular compounds that constitute a ring mechanically interlocked around a dumbbell-shaped component, or [2]catenanes, which are composed of two mechanically interlocked rings. As a result of their interlocked nature, bistable MIMs possess the inherent propensity to express controllable intramolecular, large-amplitude, and reversible motions in response to redox stimuli. In this Account, we rationalize the kinetic behavior in the ground state for a large assortment of these types of bistable MIMs, including both rotaxanes and catenanes. These structures have proven useful in a variety of applications ranging from drug delivery to molecular electronic devices. These bistable donor-acceptor MIMs can switch between two different isomeric states. The favored isomer, known as the ground-state co-conformation (GSCC) is in equilibrium with the less favored metastable state co-conformation (MSCC). The forward (kf) and backward (kb) rate constants associated with this ground-state equilibrium are intimately connected to each other through the ground-state distribution constant, KGS. Knowing the rate constants that govern the kinetics and bring about the equilibration between the MSCC and GSCC, allows researchers to understand the operation of these bistable MIMs in a device setting and apply them toward the construction of artificial molecular machines. The three biggest influences on the ground-state rate constants arise from

Transcriptional delay stabilizes bistable gene networks.

Science.gov (United States)

Gupta, Chinmaya; López, José Manuel; Ott, William; Josić, Krešimir; Bennett, Matthew R

2013-08-02

Transcriptional delay can significantly impact the dynamics of gene networks. Here we examine how such delay affects bistable systems. We investigate several stochastic models of bistable gene networks and find that increasing delay dramatically increases the mean residence times near stable states. To explain this, we introduce a non-Markovian, analytically tractable reduced model. The model shows that stabilization is the consequence of an increased number of failed transitions between stable states. Each of the bistable systems that we simulate behaves in this manner.

Bubbling and bistability in two parameter discrete systems

Indian Academy of Sciences (India)

The birth of X *. · is concurrent with the ... for bistability viz. a½, and the higher order bistability points a¾, etc. are marked. The quadrilateral marked as ... The characteristics of 2 parameter 1-d maps that exhibit bubbling/bistability related to their ...

Bistable amphoteric centers in semiconductors

International Nuclear Information System (INIS)

Nikitina, A. G.; Zuev, V. V.

2008-01-01

It is shown that, at thermodynamic equilibrium, the release of charge carriers from the localized states of bistable amphoteric centers into quasi-free states depends on the degree of compensation. This brings about different functional dependences of the concentration of free charge carriers on temperature. It is found that, in uncompensated semiconductors, the concentration of free charge carriers follows the same dependence in the case of bistable amphoteric centers and bistable amphoteric U - centers, although the distributions of charge carriers over the charge states and configurations are different for these types of centers. The results can be used for interpreting various experimental data insufficiently explained in the context of the traditional approach

Transitions in genetic toggle switches driven by dynamic disorder in rate coefficients

International Nuclear Information System (INIS)

Chen, Hang; Thill, Peter; Cao, Jianshu

2016-01-01

In biochemical systems, intrinsic noise may drive the system switch from one stable state to another. We investigate how kinetic switching between stable states in a bistable network is influenced by dynamic disorder, i.e., fluctuations in the rate coefficients. Using the geometric minimum action method, we first investigate the optimal transition paths and the corresponding minimum actions based on a genetic toggle switch model in which reaction coefficients draw from a discrete probability distribution. For the continuous probability distribution of the rate coefficient, we then consider two models of dynamic disorder in which reaction coefficients undergo different stochastic processes with the same stationary distribution. In one, the kinetic parameters follow a discrete Markov process and in the other they follow continuous Langevin dynamics. We find that regulation of the parameters modulating the dynamic disorder, as has been demonstrated to occur through allosteric control in bistable networks in the immune system, can be crucial in shaping the statistics of optimal transition paths, transition probabilities, and the stationary probability distribution of the network.

Transitions in genetic toggle switches driven by dynamic disorder in rate coefficients

Energy Technology Data Exchange (ETDEWEB)

Chen, Hang, E-mail: hangchen@mit.edu; Thill, Peter; Cao, Jianshu [Department of Chemistry, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

2016-05-07

In biochemical systems, intrinsic noise may drive the system switch from one stable state to another. We investigate how kinetic switching between stable states in a bistable network is influenced by dynamic disorder, i.e., fluctuations in the rate coefficients. Using the geometric minimum action method, we first investigate the optimal transition paths and the corresponding minimum actions based on a genetic toggle switch model in which reaction coefficients draw from a discrete probability distribution. For the continuous probability distribution of the rate coefficient, we then consider two models of dynamic disorder in which reaction coefficients undergo different stochastic processes with the same stationary distribution. In one, the kinetic parameters follow a discrete Markov process and in the other they follow continuous Langevin dynamics. We find that regulation of the parameters modulating the dynamic disorder, as has been demonstrated to occur through allosteric control in bistable networks in the immune system, can be crucial in shaping the statistics of optimal transition paths, transition probabilities, and the stationary probability distribution of the network.

A broadband electromagnetic energy harvester with a coupled bistable structure

OpenAIRE

Zhu, Dibin; Beeby, Steve

2013-01-01

This paper investigates a broadband electromagnetic energy harvester with a coupled bistable structure. Both analytical model and experimental results showed that the coupled bistable structure requires lower excitation force to trigger bistable operation than conventional bistable structures. A compact electromagnetic vibration energy harvester with a coupled bistable structure was implemented and tested. It was excited under white noise vibrations. Experimental results showed that the coupl...

Ground-state thermodynamics of bistable redox-active donor-acceptor mechanically interlocked molecules.

Science.gov (United States)

Fahrenbach, Albert C; Bruns, Carson J; Cao, Dennis; Stoddart, J Fraser

2012-09-18

Fashioned through billions of years of evolution, biological molecular machines, such as ATP synthase, myosin, and kinesin, use the intricate relative motions of their components to drive some of life's most essential processes. Having control over the motions in molecules is imperative for life to function, and many chemists have designed, synthesized, and investigated artificial molecular systems that also express controllable motions within molecules. Using bistable mechanically interlocked molecules (MIMs), based on donor-acceptor recognition motifs, we have sought to imitate the sophisticated nanoscale machines present in living systems. In this Account, we analyze the thermodynamic characteristics of a series of redox-switchable [2]rotaxanes and [2]catenanes. Control and understanding of the relative intramolecular movements of components in MIMs have been vital in the development of a variety of applications of these compounds ranging from molecular electronic devices to drug delivery systems. These bistable donor-acceptor MIMs undergo redox-activated switching between two isomeric states. Under ambient conditions, the dominant translational isomer, the ground-state coconformation (GSCC), is in equilibrium with the less favored translational isomer, the metastable-state coconformation (MSCC). By manipulating the redox state of the recognition site associated with the GSCC, we can stimulate the relative movements of the components in these bistable MIMs. The thermodynamic parameters of model host-guest complexes provide a good starting point to rationalize the ratio of GSCC to MSCC at equilibrium. The bistable [2]rotaxanes show a strong correlation between the relative free energies of model complexes and the ground-state distribution constants (K(GS)). This relationship does not always hold for bistable [2]catenanes, most likely because of the additional steric and electronic constraints present when the two rings are mechanically interlocked with each other

Laser activated superconducting switch

International Nuclear Information System (INIS)

Wolf, A.A.

1976-01-01

A superconducting switch or bistable device is described consisting of a superconductor in a cryogen maintaining a temperature just below the transition temperature, having a window of the proper optical frequency band for passing a laser beam which may impinge on the superconductor when desired. The frequency of the laser is equal to or greater than the optical absorption frequency of the superconducting material and is consistent with the ratio of the gap energy of the switch material to Planck's constant, to cause depairing of electrons, and thereby normalize the superconductor. Some embodiments comprise first and second superconducting metals. Other embodiments feature the two superconducting metals separated by a thin film insulator through which the superconducting electrons tunnel during superconductivity

The derivation of a bistable criterion for double V-beam mechanisms

International Nuclear Information System (INIS)

Wu, Cho-Chun; Chen, Rongshun; Lin, Meng-Ju

2013-01-01

This study presents the theoretical derivation of the discriminant D as a structural and material criterion for determining whether bistability can occur in micromechanically bistable mechanisms. When D < 0, the mechanism displays bistable behavior if an appropriate force is applied to push the bistable mechanism, whereas when D > 0, bistable behavior cannot occur. The proposed V-beam bistable mechanism was successfully fabricated with various beam lengths and tilted angles. The experiments conducted in this study validated the theoretical study of bistability. A comparison of the theoretical solutions and experimental results shows good agreement. Results further show that to design a bistable V-beam mechanism, the tilted angle should be larger for the same beam length, whereas the beam length should be longer for the same tilted angle. The developed discriminant D can be used to predict if a bistable mechanism can achieve bistable behavior based on structural sizes and material properties. Consequently, researchers can reduce trial-and-error experiments when designing a bistable mechanism. A V-beam with a larger tilted angle of up to 5° was successfully fabricated to act as a bistable mechanism, compared to a 3.5° tilted angle in existing studies. Consequently, the proposed method has the advantages of shorter beam lengths and smaller device areas. (paper)

Stochastic simulations of the tetracycline operon

Science.gov (United States)

2011-01-01

Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

Stochastic simulations of the tetracycline operon

Directory of Open Access Journals (Sweden)

Kaznessis Yiannis N

2011-01-01

Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

Balancing bistable perception during self-motion.

Science.gov (United States)

van Elk, Michiel; Blanke, Olaf

2012-10-01

In two experiments we investigated whether bistable visual perception is influenced by passive own body displacements due to vestibular stimulation. For this we passively rotated our participants around the vertical (yaw) axis while observing different rotating bistable stimuli (bodily or non-bodily) with different ambiguous motion directions. Based on previous work on multimodal effects on bistable perception, we hypothesized that vestibular stimulation should alter bistable perception and that the effects should differ for bodily versus non-bodily stimuli. In the first experiment, it was found that the rotation bias (i.e., the difference between the percentage of time that a CW or CCW rotation was perceived) was selectively modulated by vestibular stimulation: the perceived duration of the bodily stimuli was longer for the rotation direction congruent with the subject's own body rotation, whereas the opposite was true for the non-bodily stimulus (Necker cube). The results found in the second experiment extend the findings from the first experiment and show that these vestibular effects on bistable perception only occur when the axis of rotation of the bodily stimulus matches the axis of passive own body rotation. These findings indicate that the effect of vestibular stimulation on the rotation bias depends on the stimulus that is presented and the rotation axis of the stimulus. Although most studies on vestibular processing have traditionally focused on multisensory signal integration for posture, balance, and heading direction, the present data show that vestibular self-motion influences the perception of bistable bodily stimuli revealing the importance of vestibular mechanisms for visual consciousness.

Active Molecular Plasmonics: Controlling Plasmon Resonances with Molecular Switches

KAUST Repository

Zheng, Yue Bing

2009-02-11

A gold nanodisk array, coated with bistable, redox-controllable [2]rotaxane molecules, when exposed to chemical oxidants and reductants, undergoes switching of its plasmonic properties reversibly. By contrast, (i) bare gold nanodisks and (ii) disks coated with a redox-active, but mechanically inert, control compound do not display surface-plasmon-based switching. Along with calculations based on time-dependent density functional theory, these experimental observations suggest that the nanoscale movements within surface-bound “molecular machines” can be used as the active components in plasmonic devices.

Active Molecular Plasmonics: Controlling Plasmon Resonances with Molecular Switches

KAUST Repository

Zheng, Yue Bing; Yang, Ying-Wei; Jensen, Lasse; Fang, Lei; Juluri, Bala Krishna; Flood, Amar H.; Weiss, Paul S.; Stoddart, J. Fraser; Huang, Tony Jun

2009-01-01

A gold nanodisk array, coated with bistable, redox-controllable [2]rotaxane molecules, when exposed to chemical oxidants and reductants, undergoes switching of its plasmonic properties reversibly. By contrast, (i) bare gold nanodisks and (ii) disks coated with a redox-active, but mechanically inert, control compound do not display surface-plasmon-based switching. Along with calculations based on time-dependent density functional theory, these experimental observations suggest that the nanoscale movements within surface-bound “molecular machines” can be used as the active components in plasmonic devices.

Space charge effects and electronic bistability

International Nuclear Information System (INIS)

Ruffini, A.; Strumia, F.; Tommasi, O.

1996-01-01

The excitation of metastable states in an atomic beam apparatus by means of electron collision is a widespread technique. The authors have observed a large bistable behaviour in apparatus designed to provide an intense and collimated beam of metastable helium by excitation with orthogonally impinging electrons. This bistable behaviour largely affects the efficiency of the apparatus and is therefore worth of being carefully investigated. The apparatus has an electrode configuration equivalent to that of a tetrode valve with large intergrid distances. The bistability consists in a hysteresis cycle in the curve of the anode current vs. grid voltage. Experimental measurements, supported by a simple theoretical model and by numerical simulation, stress out the crucial role played by space charge effects for the onset of bistability. A comparison with previous observations of this phenomenon is given. Spontaneous current oscillations with various shapes have been recorded in one of the two curves of the hysteresis cycle

Modeling bistable cell-fate choices in the Drosophila eye: qualitative and quantitative perspectives

Science.gov (United States)

Graham, Thomas G. W.; Tabei, S. M. Ali; Dinner, Aaron R.; Rebay, Ilaria

2010-01-01

A major goal of developmental biology is to understand the molecular mechanisms whereby genetic signaling networks establish and maintain distinct cell types within multicellular organisms. Here, we review cell-fate decisions in the developing eye of Drosophila melanogaster and the experimental results that have revealed the topology of the underlying signaling circuitries. We then propose that switch-like network motifs based on positive feedback play a central role in cell-fate choice, and discuss how mathematical modeling can be used to understand and predict the bistable or multistable behavior of such networks. PMID:20570936

Bistability in a laser with injected signal

International Nuclear Information System (INIS)

Dorobantu, I.A.; Vlad, V.I.; Ursu, I.

1987-04-01

A unified description of bistability is given in free running lasers, optical bistable devices, ring lasers and lasers with an injected signal (LIS). A general review of laser instabilities is also presented in the frame of the theory of elementary catastrophes, emphasizing the apparence of higher order catastrophes in the case of a LIS suggesting thus a possibility to devise from first principles the whole hierarchy of laser instabilities. Experimental results on the bistability in the polarisation of LIS are also discussed. (authors)

Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

Science.gov (United States)

Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

2015-01-01

Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

Metazoan operons accelerate recovery from growth arrested states

Science.gov (United States)

Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

2011-01-01

Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

Negative differential electrolyte resistance in a solid-state nanopore resulting from electroosmotic flow bistability.

Science.gov (United States)

Luo, Long; Holden, Deric A; White, Henry S

2014-03-25

A solid-state nanopore separating two aqueous solutions containing different concentrations of KCl is demonstrated to exhibit negative differential resistance (NDR) when a constant pressure is applied across the nanopore. NDR refers to a decrease in electrical current when the voltage applied across the nanopore is increased. NDR results from the interdependence of solution flow (electroosmotic and pressure-engendered) with the distributions of K+ and Cl- within the nanopore. A switch from a high-conductivity state to a low-conductivity state occurs over a very narrow voltage window (flow, yielding a true bistability in fluid flow and electrical current at a critical applied voltage, i.e., the NDR "switching potential". Solution pH and Ca2+ were separately employed as chemical stimuli to investigate the dependence of the NDR on the surface charge density. The NDR switching potential is remarkably sensitive to the surface charge density, and thus to pH and the presence of Ca2+, suggesting possible applications in chemical sensing.

Interaction of bistable glass-coated microwires in different positional relationship

Energy Technology Data Exchange (ETDEWEB)

Rodionova, V., E-mail: rodionova@magn.ru [Magnetism Department, Faculty of Physics, M.V. Lomonosov Moscow State University, 119991 Moscow (Russian Federation); Immanuel Kant Baltic Federal University, 236041 Kaliningrad (Russian Federation); Kudinov, N. [Magnetism Department, Faculty of Physics, M.V. Lomonosov Moscow State University, 119991 Moscow (Russian Federation); Zhukov, A. [Departamento Fisica de Materiales, Facultad Quimicas, UPV/EHU, 20018 San Sebastian (Spain); IKERBASQUE, Basque Foundation for Science, 48011 Bilbao (Spain); Perov, N. [Magnetism Department, Faculty of Physics, M.V. Lomonosov Moscow State University, 119991 Moscow (Russian Federation)

2012-05-01

The amorphous ferromagnetic glass-coated microwires with positive magnetostriction constant of the metallic core possess the bistable magnetization reversal and the fast domain wall propagation along the microwire axis. These properties and also the magnetization processes in the systems of the microwires are of interest in the magnetic sensing technology, encoding systems and smart composite applications. In this work we present the results of the experimental investigation, simulations and theoretical estimations of the hysteresis process in the systems of the magnetically bistable microwires with different length and positional relationship between them. The location of the short microwires near the long microwire affects the switching fields (external coaxial magnetic field applied for starting of the domain wall propagation along the microwire axis) and the hysteresis process. The changes of these properties are not directly proportional to the value of the shorter microwire shift along the longer one. When the short microwire was placed in the middle of the long one and when the one end of the long microwire coincided with the end of the short one, the two-steps hysteresis loops were observed for both sample orientations: before and after sample rotation on 180 Degree-Sign . When the short microwire was placed close to the end of the long microwire (but did not coincide with it) we observed at first the two-steps hysteresis loop and single step behavior for one branch of the hysteresis loop after sample rotation. Moreover, changing of the orientation of the samples results in the shift of the switching field of the shorter microwire when its end was located near the end or coincided with the end of the longer one. This uncommon hysteresis behavior was explained and illustrated using results of the simulations. The values of microwires interaction were also estimated.

Interaction of bistable glass-coated microwires in different positional relationship

International Nuclear Information System (INIS)

Rodionova, V.; Kudinov, N.; Zhukov, A.; Perov, N.

2012-01-01

The amorphous ferromagnetic glass-coated microwires with positive magnetostriction constant of the metallic core possess the bistable magnetization reversal and the fast domain wall propagation along the microwire axis. These properties and also the magnetization processes in the systems of the microwires are of interest in the magnetic sensing technology, encoding systems and smart composite applications. In this work we present the results of the experimental investigation, simulations and theoretical estimations of the hysteresis process in the systems of the magnetically bistable microwires with different length and positional relationship between them. The location of the short microwires near the long microwire affects the switching fields (external coaxial magnetic field applied for starting of the domain wall propagation along the microwire axis) and the hysteresis process. The changes of these properties are not directly proportional to the value of the shorter microwire shift along the longer one. When the short microwire was placed in the middle of the long one and when the one end of the long microwire coincided with the end of the short one, the two-steps hysteresis loops were observed for both sample orientations: before and after sample rotation on 180°. When the short microwire was placed close to the end of the long microwire (but did not coincide with it) we observed at first the two-steps hysteresis loop and single step behavior for one branch of the hysteresis loop after sample rotation. Moreover, changing of the orientation of the samples results in the shift of the switching field of the shorter microwire when its end was located near the end or coincided with the end of the longer one. This uncommon hysteresis behavior was explained and illustrated using results of the simulations. The values of microwires interaction were also estimated.

Does visual attention drive the dynamics of bistable perception?

Science.gov (United States)

Dieter, Kevin C; Brascamp, Jan; Tadin, Duje; Blake, Randolph

2016-10-01

How does attention interact with incoming sensory information to determine what we perceive? One domain in which this question has received serious consideration is that of bistable perception: a captivating class of phenomena that involves fluctuating visual experience in the face of physically unchanging sensory input. Here, some investigations have yielded support for the idea that attention alone determines what is seen, while others have implicated entirely attention-independent processes in driving alternations during bistable perception. We review the body of literature addressing this divide and conclude that in fact both sides are correct-depending on the form of bistable perception being considered. Converging evidence suggests that visual attention is required for alternations in the type of bistable perception called binocular rivalry, while alternations during other types of bistable perception appear to continue without requiring attention. We discuss some implications of this differential effect of attention for our understanding of the mechanisms underlying bistable perception, and examine how these mechanisms operate during our everyday visual experiences.

Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

Science.gov (United States)

Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

2015-05-25

Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

Supra-transmission and bistability in nonlinear media with a photonic and electronic forbidden band gap; Supratransmission et bistabilite nonlineaire dans les milieux a bandes interdites photoniques et electroniques

Energy Technology Data Exchange (ETDEWEB)

Chevriaux, D

2007-06-15

We study wave scattering in different nonlinear media possessing a natural forbidden band gap. In particular, we show the existence of a bistable behavior in media governed by the sine-Gordon equation (short pendular chain, Josephson junction array, quantum Hall bilayer), or the nonlinear Schroedinger equation (Kerr and Bragg media), in discrete and continuous models. These different media are submitted to periodic boundary conditions with a frequency in the forbidden band gap and an amplitude that determines their stability states. Indeed, for a sufficient amplitude (supra-transmission), the medium switches from reflector to transmitter, hence allowing the output signal to jump from evanescent to large values. We give a complete analytical description of the bistability that allows to understand the different stationary states observed and to predict the switch of one state to the other. (author)

Perceptual incongruence influences bistability and cortical activation

NARCIS (Netherlands)

Brouwer, G.J.; Tong, F.; Hagoort, P.; van Ee, R.

2009-01-01

We employed a parametric psychophysical design in combination with functional imaging to examine the influence of metric changes in perceptual incongruence on perceptual alternation rates and cortical responses. Subjects viewed a bistable stimulus defined by incongruent depth cues; bistability

GABA shapes the dynamics of bistable perception

NARCIS (Netherlands)

van Loon, A.M.; Knapen, T.; Scholte, H.S.; St. John-Saaltink, E.; Donner, T.H.; Lamme, V.A.F.

2013-01-01

Sometimes, perception fluctuates spontaneously between two distinct interpretations of a constant sensory input. These bistable perceptual phenomena provide a unique window into the neural mechanisms that create the contents of conscious perception. Models of bistable perception posit that mutual

Key Players in the Genetic Switch of Bacteriophage TP901-1

DEFF Research Database (Denmark)

Alsing, Anne; Pedersen, Margit; Sneppen, Kim

2011-01-01

the bistable genetic switch of bacteriophage TP901-1 through experiments and statistical mechanical modeling. We examine the activity of the lysogenic promoter Pr at different concentrations of the phage repressor, CI, and compare the effect of CI on Pr in the presence or absence of the phage-encoded MOR...

Amplification without inversion, fast light and optical bistability in a duplicated two-level system

International Nuclear Information System (INIS)

Ebrahimi Zohravi, Lida; Vafafard, Azar; Mahmoudi, Mohammad

2014-01-01

The optical properties of a weak probe field in a duplicated two-level system are investigated in multi-photon resonance (MPR) condition and beyond it. It is shown that by changing the relative phase of applied fields, the absorption switches to the amplification without inversion in MPR condition. By applying the Floquet decomposition to the equations of motion beyond MPR condition, it is shown that the phase-dependent behavior is valid only in MPR condition. Moreover, it is demonstrated that the group velocity of light pulse can be controlled by the intensity of the applied fields and the gain-assisted superluminal light propagation (fast light) is obtained in this system. In addition, the optical bistability (OB) behavior of the system is studied beyond MPR condition. We apply an indirect incoherent pumping field to the system and it is found that the group velocity and OB behavior of the system can be controlled by the incoherent pumping rate. - Highlights: • We studied the optical properties of DTL system under MPR condition and beyond it. • By changing the relative phase, the absorption switches to the amplification without inversion in MPR condition. • The gain-assisted superluminal light propagation (fast light) is obtained in this system. • The optical bistability (OB) behavior of the system is studied beyond MPR condition. • The incoherent pumping rate has a major role in controlling the group velocity and OB behavior of the system

Bistability and hysteresis of the 'Secteur' differentiation are controlled by a two-gene locus in Nectria haematococca

Directory of Open Access Journals (Sweden)

Daboussi Marie-Josée

2004-08-01

Full Text Available Abstract Background Bistability and hysteresis are increasingly recognized as major properties of regulatory networks governing numerous biological phenomena, such as differentiation and cell cycle progression. The full scope of the underlying molecular mechanisms leading to bistability and hysteresis remains elusive. Nectria haemaotcocca, a saprophytic or pathogenic fungus with sexual reproduction, exhibits a bistable morphological modification characterized by a reduced growth rate and an intense pigmentation. Bistability is triggered by the presence or absence of σ, a cytoplasmic determinant. This determinant spreads in an infectious manner in the hyphae of the growing margin, insuring hysteresis of the differentiation. Results Seven mutants specifically affected in the generation of σ were selected through two different screening strategies. The s1 and s2 mutations completely abolish the generation of σ and of its morphological expression, the Secteur. The remaining five mutations promote its constitutive generation, which determines an intense pigmentation but not growth alteration. The seven mutations map at the same locus, Ses (for 'Secteur-specific'. The s2 mutant was obtained by an insertional mutagenesis strategy, which permitted the cloning of the Ses locus. Sequence and transcription analysis reveals that Ses is composed of two closely linked genes, SesA, mutated in the s1 and s2 mutant strains, and SesB, mutated in the s* mutant strains. SesB shares sequence similarity with animal and fungal putative proteins, with potential esterase/lipase/thioesterase activity, whereas SesA is similar to proteins of unknown function present only in the filamentous fungi Fusarium graminearum and Podospora anserina. Conclusions The cloning of Ses provides evidence that a system encoded by two linked genes directs a bistable and hysteretic switch in a eukaryote. Atypical regulatory relations between the two proteins may account for the hysteresis

Bistability and hysteresis of the 'Secteur' differentiation are controlled by a two-gene locus in Nectria haematococca

Science.gov (United States)

Graziani, Stéphane; Silar, Philippe; Daboussi, Marie-Josée

2004-01-01

Background Bistability and hysteresis are increasingly recognized as major properties of regulatory networks governing numerous biological phenomena, such as differentiation and cell cycle progression. The full scope of the underlying molecular mechanisms leading to bistability and hysteresis remains elusive. Nectria haemaotcocca, a saprophytic or pathogenic fungus with sexual reproduction, exhibits a bistable morphological modification characterized by a reduced growth rate and an intense pigmentation. Bistability is triggered by the presence or absence of σ, a cytoplasmic determinant. This determinant spreads in an infectious manner in the hyphae of the growing margin, insuring hysteresis of the differentiation. Results Seven mutants specifically affected in the generation of σ were selected through two different screening strategies. The s1 and s2 mutations completely abolish the generation of σ and of its morphological expression, the Secteur. The remaining five mutations promote its constitutive generation, which determines an intense pigmentation but not growth alteration. The seven mutations map at the same locus, Ses (for 'Secteur-specific'). The s2 mutant was obtained by an insertional mutagenesis strategy, which permitted the cloning of the Ses locus. Sequence and transcription analysis reveals that Ses is composed of two closely linked genes, SesA, mutated in the s1 and s2 mutant strains, and SesB, mutated in the s* mutant strains. SesB shares sequence similarity with animal and fungal putative proteins, with potential esterase/lipase/thioesterase activity, whereas SesA is similar to proteins of unknown function present only in the filamentous fungi Fusarium graminearum and Podospora anserina. Conclusions The cloning of Ses provides evidence that a system encoded by two linked genes directs a bistable and hysteretic switch in a eukaryote. Atypical regulatory relations between the two proteins may account for the hysteresis of Secteur differentiation

Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

Science.gov (United States)

Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

2016-04-01

Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

Theoretical Insights into the Biophysics of Protein Bi-stability and Evolutionary Switches.

Directory of Open Access Journals (Sweden)

Tobias Sikosek

2016-06-01

Full Text Available Deciphering the effects of nonsynonymous mutations on protein structure is central to many areas of biomedical research and is of fundamental importance to the study of molecular evolution. Much of the investigation of protein evolution has focused on mutations that leave a protein's folded structure essentially unchanged. However, to evolve novel folds of proteins, mutations that lead to large conformational modifications have to be involved. Unraveling the basic biophysics of such mutations is a challenge to theory, especially when only one or two amino acid substitutions cause a large-scale conformational switch. Among the few such mutational switches identified experimentally, the one between the GA all-α and GB α+β folds is extensively characterized; but all-atom simulations using fully transferrable potentials have not been able to account for this striking switching behavior. Here we introduce an explicit-chain model that combines structure-based native biases for multiple alternative structures with a general physical atomic force field, and apply this construct to twelve mutants spanning the sequence variation between GA and GB. In agreement with experiment, we observe conformational switching from GA to GB upon a single L45Y substitution in the GA98 mutant. In line with the latent evolutionary potential concept, our model shows a gradual sequence-dependent change in fold preference in the mutants before this switch. Our analysis also indicates that a sharp GA/GB switch may arise from the orientation dependence of aromatic π-interactions. These findings provide physical insights toward rationalizing, predicting and designing evolutionary conformational switches.

A bistable electromagnetically actuated rotary gate microvalve

International Nuclear Information System (INIS)

Luharuka, Rajesh; Hesketh, Peter J

2008-01-01

Two types of rotary gate microvalves are developed for flow modulation in microfluidic systems. These microvalves have been tested for an open flow rate of up to 100 sccm and operate under a differential pressure of 6 psig with flow modulation of up to 100. The microvalve consists of a suspended gate that rotates in the plane of the chip to regulate flow through the orifice. The gate is suspended by a novel fully compliant in-plane rotary bistable micromechanism (IPRBM) that advantageously constrains the gate in all degrees of freedom except for in-plane rotational motion. Multiple inlet/outlet orifices provide flexibility of operating the microvalve in three different flow configurations. The rotary gate microvalve is switched with an external electromagnetic actuator. The suspended gate is made of a soft magnetic material and its electromagnetic actuation is based on the operating principle of a variable-reluctance stepper motor

Temporal nonlocality in bistable perception

Science.gov (United States)

Atmanspacher, Harald; Filk, Thomas

2012-12-01

A novel conceptual framework for theoretical psychology is presented and illustrated for the example of bistable perception. A basic formal feature of this framework is the non-commutativity of operations acting on mental states. A corresponding model for the bistable perception of ambiguous stimuli, the Necker-Zeno model, is sketched and some empirical evidence for it so far is described. It is discussed how a temporal nonlocality of mental states, predicted by the model, can be understood and tested.

Optical bistability using quantum interference in V-type atoms

International Nuclear Information System (INIS)

Anton, M A; Calderon, Oscar G

2002-01-01

The behaviour of a V-type three-level atomic system in a ring cavity driven by a coherent field is studied. We consider a V configuration under conditions such that interference between decay channels is important. We find that when quantum interference is taken into account, optical bistability can be realized with a considerable decrease in the threshold intensity and the cooperative parameter. On the other hand, we also include the finite bandwidth of the driving field and study its role in the optical bistable response. It is found that at certain linewidths of the driving field optical bistability is obtained even if the system satisfies the trapping condition and the threshold intensity can be controlled. Furthermore, a change from the optical bistability due to quantum interference to the usual bistable behaviour based on saturation occurs as the driving field linewidth increases

Fundamental role of bistability in optimal homeostatic control

Science.gov (United States)

Wang, Guanyu

2013-03-01

Bistability is a fundamental phenomenon in nature and has a number of fine properties. However, these properties are consequences of bistability at the physiological level, which do not explain why it had to emerge during evolution. Using optimal homeostasis as the first principle and Pontryagin's Maximum Principle as the optimization approach, I find that bistability emerges as an indispensable control mechanism. Because the mathematical model is general and the result is independent of parameters, it is likely that most biological systems use bistability to control homeostasis. Glucose homeostasis represents a good example. It turns out that bistability is the only solution to a dilemma in glucose homeostasis: high insulin efficiency is required for rapid plasma glucose clearance, whereas an insulin sparing state is required to guarantee the brain's safety during fasting. This new perspective can illuminate studies on the twin epidemics of obesity and diabetes and the corresponding intervening strategies. For example, overnutrition and sedentary lifestyle may represent sudden environmental changes that cause the lose of optimality, which may contribute to the marked rise of obesity and diabetes in our generation.

Bistable perception modeled as competing stochastic integrations at two levels.

Science.gov (United States)

Gigante, Guido; Mattia, Maurizio; Braun, Jochen; Del Giudice, Paolo

2009-07-01

We propose a novel explanation for bistable perception, namely, the collective dynamics of multiple neural populations that are individually meta-stable. Distributed representations of sensory input and of perceptual state build gradually through noise-driven transitions in these populations, until the competition between alternative representations is resolved by a threshold mechanism. The perpetual repetition of this collective race to threshold renders perception bistable. This collective dynamics - which is largely uncoupled from the time-scales that govern individual populations or neurons - explains many hitherto puzzling observations about bistable perception: the wide range of mean alternation rates exhibited by bistable phenomena, the consistent variability of successive dominance periods, and the stabilizing effect of past perceptual states. It also predicts a number of previously unsuspected relationships between observable quantities characterizing bistable perception. We conclude that bistable perception reflects the collective nature of neural decision making rather than properties of individual populations or neurons.

Fast switching of bistable magnetic nanowires through collective spin reversal

Science.gov (United States)

Vindigni, Alessandro; Rettori, Angelo; Bogani, Lapo; Caneschi, Andrea; Gatteschi, Dante; Sessoli, Roberta; Novak, Miguel A.

2005-08-01

The use of magnetic nanowires as memory units is made possible by the exponential divergence of the characteristic time for magnetization reversal at low temperature, but the slow relaxation makes the manipulation of the frozen magnetic states difficult. We suggest that finite-size segments can show a fast switching if collective reversal of the spins is taken into account. This mechanism gives rise at low temperatures to a scaling law for the dynamic susceptibility that has been experimentally observed for the dilute molecular chain Co(hfac)2NitPhOMe. These results suggest a possible way of engineering nanowires for fast switching of the magnetization.

Memristic Characteristics from Bistable to Tristable Memory with Controllable Charge Trap Carbon Nanotubes.

Science.gov (United States)

Li, Lei; Wen, Dianzhong

2018-02-17

The incorporation of the one-dimensional carbon nanomaterial carbon nanotubes (CNTs) in poly(methyl methacrylate) (PMMA) was found to successfully develop a resistive switching. It implements memristic characteristics which shift from bistable to tristable memory. The localized current pathways in the organic nanocomposite layers for each intermediate resistive state (IRS) are attributed to the trapping mechanism consistent with the fluorescent measurements. Multi-bit organic memories have attracted considerable interest, which provide an effective way to increase the memory density per unit cell area. This study will be useful for the development and tuning of multi-bit storable organic nanocomposite memory device systems.

Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

Science.gov (United States)

Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

2016-01-01

The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

Bistable firing properties of soleus motor units in unrestrained rats

DEFF Research Database (Denmark)

EKEN, T.; KIEHN, O.

1989-01-01

of the motoneuron pool by stimulation of la afferents, or inhibition by stimulation of skin afferents. The shifts were not related to gross limb movements. This phenomenon is referred to as a bistable firing pattern. Bistable firing also occurred spontaneously during quiet standing. Typically the firing frequency...... was unchanged or only phasically influenced. These results demonstrate for the first time a bistable firing pattern during postural activity in the intact animal. The firing pattern closely resembles the bistable behaviour described in spinal motoneurons in reduced preparations, where it is due to the presence...... of a plateau potential. This suggests that the bistable firing is unexplained by plateau potentials also in the intact animal....

Triggered Snap-Through of Bistable Shells

Science.gov (United States)

Cai, Yijie; Huang, Shicheng; Trase, Ian; Hu, Nan; Chen, Zi

Elastic bistable shells are common structures in nature and engineering, such as the lobes of the Venus flytrap or the surface of a toy jumping poppers. Despite their ubiquity, the parameters that control the bistability of such structures are not well understood. In this study, we explore how the geometrical features of radially symmetric elastic shells affect the shape and potential energy of a shell's stable states, and how to tune certain parameters in order to generate a snap-through transition from a convex semi-stable state to concave stable state. We fabricated a series of elastic shells with varying geometric parameters out of silicone rubber and measured the resulting potential energy in the semi-stable state. Finite element simulations were also conducted in order to determine the deformation and stress in the shells during snap-through. It was found that the energy of the semi-stable state is controlled by only two geometric parameters and a dimensionless ratio. We also noted two distinct transitions during snap-through, one between monostability and semi-bistability (the state a popper toy is in before it snaps-through and jumps), and a second transition between semi-bistability and true bistability. This work shows that it is possible to use a set of simple parameters to tailor the energy landscape of an elastic shell in order to generate complex trigger motions for their potential use in smart applications. Z.C. acknowledge support from Society in Science-Branco Weiss Fellowship, administered by ETH Zurich.

Longitudinal magnetic bistability of electroplated wires

International Nuclear Information System (INIS)

Kurlyandskaya, G.V.; Garcia-Miquel, H.; Vazquez, M.; Svalov, A.V.; Vas'kovskiy, V.O.

2002-01-01

Fe 20 Ni 74 Co 6 and Fe 20 Ni 64 Co 16 1 μm thick magnetic tubes electroplated onto Cu 98 Be 2 conductive wire have been investigated in as-deposited state, after heat treatment under longitudinal magnetic field for 1 h at 330 deg. C, and after rf-sputtering deposition of the additional 2 μm Fe 19 Ni 81 layer. Heat treatments and an additional layer deposition modify the shape of hysteresis loops. Magnetically bistable behaviour, observed after the field annealing at a temperature of 330 deg. C, is studied as a function of the length of the samples. This is the first report by our knowledge on the bistable behaviour of the electroplated wires. The bistability of these wires is promising for applications such as tagging or pulse generator applications

Synaptic Bistability Due to Nucleation and Evaporation of Receptor Clusters

KAUST Repository

Burlakov, V. M.

2012-01-10

We introduce a bistability mechanism for long-term synaptic plasticity based on switching between two metastable states that contain significantly different numbers of synaptic receptors. One state is characterized by a two-dimensional gas of mobile interacting receptors and is stabilized against clustering by a high nucleation barrier. The other state contains a receptor gas in equilibrium with a large cluster of immobile receptors, which is stabilized by the turnover rate of receptors into and out of the synapse. Transitions between the two states can be initiated by either an increase (potentiation) or a decrease (depotentiation) of the net receptor flux into the synapse. This changes the saturation level of the receptor gas and triggers nucleation or evaporation of receptor clusters. © 2012 American Physical Society.

Teaching the Big Ideas of Biology with Operon Models

Science.gov (United States)

Cooper, Robert A.

2015-01-01

This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

Bistable flow spectral analysis. Repercussions on jet pumps

International Nuclear Information System (INIS)

Gavilan Moreno, C.J.

2011-01-01

Highlights: → The most important thing in this paper, is the spectral characterization of the bistable flow in a Nuclear Power Plant. → This paper goes deeper in the effect of the bistable flow over the jet pump and the induced vibrations. → The jet pump frequencies are very close to natural jet pump frequencies, in the 3rd and 6th mode. - Abstract: There have been many attempts at characterizing and predicting bistable flow in boiling water reactors (BWRs). Nevertheless, in most cases the results have only managed to develop models that analytically reproduce the phenomenon (). Modeling has been forensic in all cases, while the capacity of the model focus on determining the exclusion areas on the recirculation flow map. The bistability process is known by its effects given there is no clear definition of its causal process. In the 1980s, Hitachi technicians () managed to reproduce bistable flow in the laboratory by means of pipe geometry, similar to that which is found in recirculation loops. The result was that the low flow pattern is formed by the appearance of a quasi stationary, helicoidal vortex in the recirculation collector's branches. This vortex creates greater frictional losses than regions without vortices, at the same discharge pressure. Neither the behavior nor the dynamics of these vortices were characterized in this paper. The aim of this paper is to characterize these vortices in such a way as to enable them to provide their own frequencies and their later effect on the jet pumps. The methodology used in this study is similar to the one used previously when analyzing the bistable flow in tube arrays with cross flow (). The method employed makes use of the power spectral density function. What differs is the field of application. We will analyze a Loop B with a bistable flow and compare the high and low flow situations. The same analysis will also be carried out on the loop that has not developed the bistable flow (Loop A) at the same moments

Non-resonant energy harvesting via an adaptive bistable potential

International Nuclear Information System (INIS)

Hosseinloo, Ashkan Haji; Turitsyn, Konstantin

2016-01-01

Narrow bandwidth and easy detuning, inefficiency in broadband and non-stationary excitations, and difficulties in matching a linear harvester’s resonance frequency to low-frequency excitations at small scales, have convinced researchers to investigate nonlinear, and in particular bistable, energy harvesters in recent years. However, bistable harvesters suffer from co-existing low and high energy orbits, and sensitivity to initial conditions, and have recently been proven inefficient when subjected to many real-world random and non-stationary excitations. Here, we propose a novel non-resonant buy-low-sell-high strategy that can significantly improve the harvester’s effectiveness at low frequencies in a much more robust fashion. This strategy could be realized by a passive adaptive bistable system. Simulation results confirm the high effectiveness of the adaptive bistable system following a buy-low-sell-high logic when subjected to harmonic and random non-stationary walking excitations compared to its conventional bistable and linear counterparts. (paper)

Chaos in a new bistable rotating electromechanical system

International Nuclear Information System (INIS)

Tsapla Fotsa, R.; Woafo, P.

2016-01-01

Highlights: • A new electromechanical system with rotating arm and bistable potential energy is studied. • The bistability is generated by the interaction of three permanent magnets, one fixed at the end of the arm and two other fixed at equal distance relative to the central position of the arm. • It exhibits dissipative and Hamiltonian chaos. • Such a bistable electromechanical system can be used as the actuation part of chaotic sieves and mixers. - Abstract: A device consisting of an induction motor activating a rotating rigid arm is designed and comprises a bistable potential due to the presence of three permanent magnets. Its mathematical equations are established and the numerical results both in the absence and in the presence of magnets are compared. The generation of chaotic behavior is achieved using two different external excitations: sinewave and square wave. In the presence of magnets, the system presents periodic and dissipative chaotic dynamics. Approximating the global potential energy to a bistable quartic potential, the Melnikov method is used to derive the conditions for the appearance of Hamiltonian chaos. Such a device can be used for industrial and domestic applications for mixing and sieving activities.

Frontoparietal cortex mediates perceptual transitions in bistable perception.

Science.gov (United States)

Weilnhammer, Veith A; Ludwig, Karin; Hesselmann, Guido; Sterzer, Philipp

2013-10-02

During bistable vision, perception oscillates between two mutually exclusive percepts despite constant sensory input. Greater BOLD responses in frontoparietal cortex have been shown to be associated with endogenous perceptual transitions compared with "replay" transitions designed to closely match bistability in both perceptual quality and timing. It has remained controversial, however, whether this enhanced activity reflects causal influences of these regions on processing at the sensory level or, alternatively, an effect of stimulus differences that result in, for example, longer durations of perceptual transitions in bistable perception compared with replay conditions. Using a rotating Lissajous figure in an fMRI experiment on 15 human participants, we controlled for potential confounds of differences in transition duration and confirmed previous findings of greater activity in frontoparietal areas for transitions during bistable perception. In addition, we applied dynamic causal modeling to identify the neural model that best explains the observed BOLD signals in terms of effective connectivity. We found that enhanced activity for perceptual transitions is associated with a modulation of top-down connectivity from frontal to visual cortex, thus arguing for a crucial role of frontoparietal cortex in perceptual transitions during bistable perception.

A bistable mechanism for chord extension morphing rotors

Science.gov (United States)

Johnson, Terrence; Frecker, Mary; Gandhi, Farhan

2009-03-01

Research efforts have shown that helicopter rotor blade morphing is an effective means to improve flight performance. Previous example of rotor blade morphing include using smart-materials for trailing deflection and rotor blade twist and tip twist, the development of a comfortable airfoil using compliant mechanisms, the use of a Gurney flap for air-flow deflection and centrifugal force actuated device to increase the span of the blade. In this paper we explore the use of a bistable mechanism for rotor morphing, specifically, blade chord extension using a bistable arc. Increasing the chord of the rotor blade is expected to generate more lift-load and improve helicopter performance. Bistable or "snap through" mechanisms have multiple stable equilibrium states and are a novel way to achieve large actuation output stroke. Bistable mechanisms do not require energy input to maintain a stable equilibrium state as both states do not require locking. In this work, we introduce a methodology for the design of bistable arcs for chord morphing using the finite element analysis and pseudo-rigid body model, to study the effect of different arc types, applied loads and rigidity on arc performance.

Bistable microvalve and microcatheter system

Science.gov (United States)

Seward, Kirk Patrick

2003-05-20

A bistable microvalve of shape memory material is operatively connected to a microcatheter. The bistable microvalve includes a tip that can be closed off until it is in the desired position. Once it is in position it can opened and closed. The system uses heat and pressure to open and close the microvalve. The shape memory material will change stiffness and shape when heated above a transition temperature. The shape memory material is adapted to move from a first shape to a second shape, either open or closed, where it can perform a desired function.

Model-based design of bistable cell factories for metabolic engineering.

Science.gov (United States)

Srinivasan, Shyam; Cluett, William R; Mahadevan, Radhakrishnan

2018-04-15

Metabolism can exhibit dynamic phenomena like bistability due to the presence of regulatory motifs like the positive feedback loop. As cell factories, microorganisms with bistable metabolism can have a high and a low product flux at the two stable steady states, respectively. The exclusion of metabolic regulation and network dynamics limits the ability of pseudo-steady state stoichiometric models to detect the presence of bistability, and reliably assess the outcomes of design perturbations to metabolic networks. Using kinetic models of metabolism, we assess the change in the bistable characteristics of the network, and suggest designs based on perturbations to the positive feedback loop to enable the network to produce at its theoretical maximum rate. We show that the most optimal production design in parameter space, for a small bistable metabolic network, may exist at the boundary of the bistable region separating it from the monostable region of low product fluxes. The results of our analysis can be broadly applied to other bistable metabolic networks with similar positive feedback network topologies. This can complement existing model-based design strategies by providing a smaller number of feasible designs that need to be tested in vivo. http://lmse.biozone.utoronto.ca/downloads/. krishna.mahadevan@utoronto.ca. Supplementary data are available at Bioinformatics online.

Bistable Reflective Etalon (BRET)

National Research Council Canada - National Science Library

Shellenbarger, Zane

2003-01-01

This project designed, fabricated, and characterized normal-incidence etalon structures at 1550 nm wavelength operation for application, as bistable elements, to photonic analog-to-digital conversion...

Multistability in Bistable Ferroelectric Materials toward Adaptive Applications

NARCIS (Netherlands)

Ghosh, Anirban; Koster, Gertjan; Rijnders, Augustinus J.H.M.

2016-01-01

Traditionally thermodynamically bistable ferroic materials are used for nonvolatile operations based on logic gates (e.g., in the form of field effect transistors). But, this inherent bistability in these class of materials limits their applicability for adaptive operations. Emulating biological

Bistable energy harvesting enhancement with an auxiliary linear oscillator

Science.gov (United States)

Harne, R. L.; Thota, M.; Wang, K. W.

2013-12-01

Recent work has indicated that linear vibrational energy harvesters with an appended degree-of-freedom (DOF) may be advantageous for introducing new dynamic forms to extend the operational bandwidth. Given the additional interest in bistable harvester designs, which exhibit a propitious snap through effect from one stable state to the other, it is a logical extension to explore the influence of an added DOF to a bistable system. However, bistable snap through is not a resonant phenomenon, which tempers the presumption that the dynamics induced by an additional DOF on bistable designs would inherently be beneficial as for linear systems. This paper presents two analytical formulations to assess the fundamental and superharmonic steady-state dynamics of an excited bistable energy harvester to which is attached an auxiliary linear oscillator. From an energy harvesting perspective, the model predicts that the additional linear DOF uniformly amplifies the bistable harvester response magnitude and generated power for excitation frequencies less than the attachment’s resonance while improved power density spans a bandwidth below this frequency. Analyses predict bandwidths having co-existent responses composed of a unique proportion of fundamental and superharmonic dynamics. Experiments validate key analytical predictions and observe the ability for the coupled system to develop an advantageous multi-harmonic interwell response when the initial conditions are insufficient for continuous high-energy orbit at the excitation frequency. Overall, the addition of an auxiliary linear oscillator to a bistable harvester is found to be an effective means of enhancing the energy harvesting performance and robustness.

Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

2005-04-12

Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

Electrical bistabilities and memory stabilities of nonvolatile bistable devices fabricated utilizing C60 molecules embedded in a polymethyl methacrylate layer

International Nuclear Information System (INIS)

Cho, Sung Hwan; Lee, Dong Ik; Jung, Jae Hun; Kim, Tae Whan

2009-01-01

Current-voltage (I-V) measurements on Al/fullerene (C 60 ) molecules embedded in polymethyl methacrylate/Al devices at 300 K showed a current bistability due to the existence of the C 60 molecules. The on/off ratio of the current bistability for the memory devices was as large as 10 3 . The retention time of the devices was above 2.5 x 10 4 s at room temperature, and cycling endurance tests on these devices indicated that the ON and OFF currents showed no degradation until 50 000 cycles. Carrier transport mechanisms for the nonvolatile bistable devices are described on the basis of the I-V experimental and fitting results.

Oscillations in the bistable regime of neuronal networks.

Science.gov (United States)

Roxin, Alex; Compte, Albert

2016-07-01

Bistability between attracting fixed points in neuronal networks has been hypothesized to underlie persistent activity observed in several cortical areas during working memory tasks. In network models this kind of bistability arises due to strong recurrent excitation, sufficient to generate a state of high activity created in a saddle-node (SN) bifurcation. On the other hand, canonical network models of excitatory and inhibitory neurons (E-I networks) robustly produce oscillatory states via a Hopf (H) bifurcation due to the E-I loop. This mechanism for generating oscillations has been invoked to explain the emergence of brain rhythms in the β to γ bands. Although both bistability and oscillatory activity have been intensively studied in network models, there has not been much focus on the coincidence of the two. Here we show that when oscillations emerge in E-I networks in the bistable regime, their phenomenology can be explained to a large extent by considering coincident SN and H bifurcations, known as a codimension two Takens-Bogdanov bifurcation. In particular, we find that such oscillations are not composed of a stable limit cycle, but rather are due to noise-driven oscillatory fluctuations. Furthermore, oscillations in the bistable regime can, in principle, have arbitrarily low frequency.

Memristic Characteristics from Bistable to Tristable Memory with Controllable Charge Trap Carbon Nanotubes

Directory of Open Access Journals (Sweden)

Lei Li

2018-02-01

Full Text Available The incorporation of the one-dimensional carbon nanomaterial carbon nanotubes (CNTs in poly(methyl methacrylate (PMMA was found to successfully develop a resistive switching. It implements memristic characteristics which shift from bistable to tristable memory. The localized current pathways in the organic nanocomposite layers for each intermediate resistive state (IRS are attributed to the trapping mechanism consistent with the fluorescent measurements. Multi-bit organic memories have attracted considerable interest, which provide an effective way to increase the memory density per unit cell area. This study will be useful for the development and tuning of multi-bit storable organic nanocomposite memory device systems.

Organic bistable memory devices based on MoO3 nanoparticle embedded Alq3 structures

Science.gov (United States)

Abhijith, T.; Kumar, T. V. Arun; Reddy, V. S.

2017-03-01

Organic bistable memory devices were fabricated by embedding a thin layer of molybdenum trioxide (MoO3) between two tris-(8-hydroxyquinoline)aluminum (Alq3) layers. The device exhibited excellent switching characteristics with an ON/OFF current ratio of 1.15 × 103 at a read voltage of 1 V. The device showed repeatable write-erase capability and good stability in both the conductance states. These conductance states are non-volatile in nature and can be obtained by applying appropriate voltage pulses. The effect of MoO3 layer thickness and its location in the Alq3 matrix on characteristics of the memory device was investigated. The field emission scanning electron microscopy (FE-SEM) images of the MoO3 layer revealed the presence of isolated nanoparticles. Based on the experimental results, a mechanism has been proposed for explaining the conductance switching of fabricated devices.

Spectroscopic and Theoretical Identification of Two Thermal Isomerization Pathways for Bistable Chiral Overcrowded Alkenes.

Science.gov (United States)

Kistemaker, Jos C M; Pizzolato, Stefano F; van Leeuwen, Thomas; Pijper, Thomas C; Feringa, Ben L

2016-09-12

Chiroptical molecular switches play an important role in responsive materials and dynamic molecular systems. Here we present the synthesis of four chiral overcrowded alkenes and the experimental and computational study of their photochemical and thermal behavior. By irradiation with UV light, metastable diastereoisomers with opposite helicity were generated through high yielding E-Z isomerizations. Kinetic studies on metastable 1-4 using CD spectroscopy and HPLC analysis revealed two pathways at higher temperatures for the thermal isomerization, namely a thermal E-Z isomerization (TEZI) and a thermal helix inversion (THI). These processes were also studied computationally whereby a new strategy was developed for calculating the TEZI barrier for second-generation overcrowded alkenes. To demonstrate that these overcrowded alkenes can be employed as bistable switches, photochromic cycling was performed, which showed that the alkenes display good selectivity and fatigue resistance over multiple irradiation cycles. In particular, switch 3 displayed the best performance in forward and backward photoswitching, while 1 excelled in thermal stability of the photogenerated metastable form. Overall, the alkenes studied showed a remarkable and unprecedented combination of switching properties including dynamic helicity, reversibility, selectivity, fatigue resistance, and thermal stability. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

Science.gov (United States)

Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

2017-01-01

Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

VO{sub 2}-like thermo-optical switching effect in one-dimensional nonlinear defective photonic crystals

Energy Technology Data Exchange (ETDEWEB)

Zhang, Juan, E-mail: juanzhang@staff.shu.edu.cn, E-mail: ywang@siom.ac.cn; Zhang, Rongjun [Key Laboratory of Specialty Fiber Optics and Optical Access Networks, School of Communication and Information Engineering, Shanghai University, Shanghai 200072 (China); Wang, Yang, E-mail: juanzhang@staff.shu.edu.cn, E-mail: ywang@siom.ac.cn [Key Laboratory of High Power Laser Materials, Shanghai Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Shanghai 201800 (China)

2015-06-07

A new approach to achieve VO{sub 2}-like thermo-optical switching in a one-dimensional photonic crystal by the combination of thermo-optical and optical Kerr effects was proposed and numerically demonstrated in this study. The switching temperature and the hysteresis width can be tuned in a wide temperature range. Steep transition, high optical contrast, and low pumping power can be achieved at the same time. This kind of one-dimensional photonic crystal-based bistable switch will be low-cost, easy-to-fabricate, and versatile in practical applications compared with traditional VO{sub 2}-type one.

The binary response of the GAL/MEL genetic switch of Saccharomyces cerevisiae is critically dependent on Gal80p-Gal4p interaction.

Science.gov (United States)

Das Adhikari, Akshay Kumar; Bhat, Paike Jayadeva

2016-09-01

Studies on the Saccharomyces cerevisiae GAL/MEL genetic switch have revealed that its bistability is dependent on ultrasensitivity that can be altered or abolished by disabling different combinations of nested feedback loops. In contrast, we have previously demonstrated that weakening of the interaction between Gal80p and Gal4p alone is sufficient to abolish the ultrasensitivity (Das Adhikari et al. 2014). Here, we demonstrate that altering the epistatic interaction between Gal80p and Gal4p also abolishes the bistability, and the switch response to galactose becomes graded instead of binary. However, the GAL/MEL switch of wild-type and epistatically altered strains responded in a graded fashion to melibiose. The properties of the epistatically altered strain resemble Kluyveromyces lactis, which separated from the Saccharomyces lineage 100 mya before whole-genome duplication (WGD). Based on the results reported here, we propose that epistatic interactions played a crucial role in the evolution of the fine regulation of S. cerevisiae GAL/MEL switch following WGD. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Optical bistability via quantum interference from incoherent pumping and spontaneous emission

International Nuclear Information System (INIS)

Sahrai, M.; Asadpour, S.H.; Sadighi-Bonabi, R.

2011-01-01

We theoretically investigate the optical bistability (OB) in a V-type three-level atomic system confined in a unidirectional ring cavity via incoherent pumping field. It is shown that the threshold of optical bistability can be controlled by the rate of an incoherent pumping field and by interference mechanism arising from the spontaneous emission and incoherent pumping field. We demonstrate that the optical bistability converts to optical multi-stability (OM) by the quantum interference mechanism. - Highlights: → We modulate the optical bistability (OB) in a four-level N-type atomic system. → The threshold of optical bistability can be controlled by the quantum interferences. → OB converts to optical multi-stability (OM) by the quantum interferences. → We discuss the effect of an incoherent pumping field on reduction of OB threshold.

Evaluation of bistable systems versus matched filters in detecting bipolar pulse signals

OpenAIRE

Duan, Fabing; Abbott, Derek; Gao, Qisheng

2004-01-01

This paper presents a thorough evaluation of a bistable system versus a matched filter in detecting bipolar pulse signals. The detectability of the bistable system can be optimized by adding noise, i.e. the stochastic resonance (SR) phenomenon. This SR effect is also demonstrated by approximate statistical detection theory of the bistable system and corresponding numerical simulations. Furthermore, the performance comparison results between the bistable system and the matched filter show that...

Bifurcation of transition paths induced by coupled bistable systems.

Science.gov (United States)

Tian, Chengzhe; Mitarai, Namiko

2016-06-07

We discuss the transition paths in a coupled bistable system consisting of interacting multiple identical bistable motifs. We propose a simple model of coupled bistable gene circuits as an example and show that its transition paths are bifurcating. We then derive a criterion to predict the bifurcation of transition paths in a generalized coupled bistable system. We confirm the validity of the theory for the example system by numerical simulation. We also demonstrate in the example system that, if the steady states of individual gene circuits are not changed by the coupling, the bifurcation pattern is not dependent on the number of gene circuits. We further show that the transition rate exponentially decreases with the number of gene circuits when the transition path does not bifurcate, while a bifurcation facilitates the transition by lowering the quasi-potential energy barrier.

The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

Science.gov (United States)

Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

2011-11-01

HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

Magnetic-field induced bistability in a quasi-one-dimensional semiconductor microcavity

International Nuclear Information System (INIS)

Zhang, Chuanyi; Zhang, Weifeng

2015-01-01

We theoretically study the magnetic-field induced bistability in a quasi-one-dimensional semiconductor microcavity. A critical magnetic field is obtained, and the bistability appears if a magnetic field is greater than the critical value. For a positive energy detuning of the pump from the bare exciton polaritons, one bistability loop first emerges, then it divides into two loops, and finally one of them vanishes with the increasing magnetic field. This phenomenon originates from the magnetic-field modulated interactions for opposite spins. In the variational process, there are two important effects: one is a logic gate with a small variation of the excitation laser, and the other is a spin texture like skyrmion and this texture is periodic if the energy detuning varies periodically in real space, which is useful for designing the spin-dependent optoelectronic devices. - Highlights: • We study the bistability induced by a magnetic field in a microcavity. • One bistability loop can divide into two, and then the two loops return to one. • A spin texture like skyrmion and logic gate arise in the variation of bistability loop

Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

Science.gov (United States)

Crawford, I P; Han, C Y; Silverman, M

1991-01-01

The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

Bistable Perception in Normal Aging: Perceptual Reversibility and its Relation to Cognition

Science.gov (United States)

Díaz-Santos, Mirella; Mauro, Samantha; Cao, Bo; Yazdanbakhsh, Arash; Neargarder, Sandy; Cronin-Golomb, Alice

2017-01-01

The effects of age on the ability to resolve perceptual ambiguity are unknown, though it depends on fronto-parietal attentional networks known to change with age. We presented the bistable Necker cube to 24 middle-aged and older adults (OA; 56–78 years) and 20 younger adults (YA; 18–24 years) under passive-viewing and volitional control conditions: Hold one cube percept and Switch between cube percepts. During passive viewing, OA had longer dominance durations (time spent on each percept) than YA. In the Hold condition, OA were less able than YA to increase dominance durations. In the Switch condition, OA and YA did not differ in performance. Dominance durations in either condition correlated with performance on tests of executive function mediated by the frontal lobes. Eye movements (fixation deviations) did not differ between groups. These results suggest that OA’s reduced ability to hold a percept may arise from reduced selective attention. The lack of correlation of performance between Hold and executive-function measures suggests at least a partial segregation of underlying mechanisms. PMID:27116194

Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

Science.gov (United States)

Lawrence, J

1999-12-01

The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

Ultra-fast all-optical plasmonic switching in near infra-red spectrum using a Kerr nonlinear ring resonator

Science.gov (United States)

Nurmohammadi, Tofiq; Abbasian, Karim; Yadipour, Reza

2018-03-01

In this paper, an all-optical plasmonic switch based on metal-insulator-metal (MIM) nanoplasmonic waveguide with a Kerr nonlinear ring resonator is introduced and studied. Two-dimensional simulations utilizing the finite-difference time-domain algorithm are used to demonstrate an apparent optical bistability and significant switching mechanisms (in enabled-low condition: T(ON/OFF) =21.9 and in enabled-high condition: T(ON/OFF) =24.9) of the signal light arisen by altering the pump-light intensity. The proposed all-optical switching demonstrates femtosecond-scale feedback time (90 fs) and then ultra-fast switching can be achieved. The offered all-optical switch may recognize potential significant applications in integrated optical circuits.

Optical bistability in erbium-doped yttrium aluminum garnet crystal combined with a laser diode.

Science.gov (United States)

Maeda, Y

1994-01-10

Optical bistability was observed in a simple structure of an injection laser diode combined with an erbium-doped yttrium aluminum garnet crystal. Since a hysteresis characteristic exists in the relationship between the wavelength and the injection current of a laser diode, an optical memory function capable of holding the output status is confirmed. In addition, an optical signal inversion was caused by the decrease of transmission of the erbium-doped yttrium aluminum garnet crystal against the red shift (principally mode hopping) of the laser diode. It is suggested that the switching time of this phenomenon is the time necessary for a mode hopping by current injection.

Evolution and Biophysics of the Escherichia coli lac Operon

Science.gov (United States)

Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

2011-03-01

To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

Effect of oxide insertion layer on resistance switching properties of copper phthalocyanine

Science.gov (United States)

Joshi, Nikhil G.; Pandya, Nirav C.; Joshi, U. S.

2013-02-01

Organic memory device showing resistance switching properties is a next-generation of the electrical memory unit. We have investigated the bistable resistance switching in current-voltage (I-V) characteristics of organic diode based on copper phthalocyanine (CuPc) film sandwiched between aluminum (Al) electrodes. Pronounced hysteresis in the I-V curves revealed a resistance switching with on-off ratio of the order of 85%. In order to control the charge injection in the CuPc, nanoscale indium oxide buffer layer was inserted to form Al/CuPc/In2O3/Al device. Analysis of I-V measurements revealed space charge limited switching conduction at the Al/CuPc interface. The traps in the organic layer and charge blocking by oxide insertion layer have been used to explain the absence of resistance switching in the oxide buffer layered memory device cell. Present study offer potential applications for CuPc organic semiconductor in low power non volatile resistive switching memory and logic circuits.

Two optical bistability domains in composites of metal nanoparticles with nonlinear dielectric core

Energy Technology Data Exchange (ETDEWEB)

Shewamare, Sisay, E-mail: sisayshewa20@yahoo.com [Department of Physics, Addis Ababa University, P.O. Box 1176, Addis Ababa (Ethiopia); Mal' nev, V.N., E-mail: vadimnmalnev@yahoo.com [Department of Physics, Addis Ababa University, P.O. Box 1176, Addis Ababa (Ethiopia)

2012-12-15

It is shown that the local field in metal spherical particles with a dielectric core in an external varying electric field has two maxima at two different frequencies. The second maximum becomes more important with an increment in the metal fraction. Due to the nonlinear dielectric function of the core, the composite of these inclusions may have two optically induced bistability domains at different frequencies. At rather high metal fraction, two bistability domains merge and form one entire bistability domain. The parameters of these domains are studied numerically. The paper focuses on the second bistability domain, which has not been discussed in the literature so far. This domain exists in a comparatively narrow frequency range and its onset fields are lower than those of the first bistability domain. The lowest bistability onset fields are obtained in the entire domain. This peculiarity of the optical induced bistability in the metal composite with small dielectric cores can be attractive for possible applications.

Two optical bistability domains in composites of metal nanoparticles with nonlinear dielectric core

International Nuclear Information System (INIS)

Shewamare, Sisay; Mal'nev, V.N.

2012-01-01

It is shown that the local field in metal spherical particles with a dielectric core in an external varying electric field has two maxima at two different frequencies. The second maximum becomes more important with an increment in the metal fraction. Due to the nonlinear dielectric function of the core, the composite of these inclusions may have two optically induced bistability domains at different frequencies. At rather high metal fraction, two bistability domains merge and form one entire bistability domain. The parameters of these domains are studied numerically. The paper focuses on the second bistability domain, which has not been discussed in the literature so far. This domain exists in a comparatively narrow frequency range and its onset fields are lower than those of the first bistability domain. The lowest bistability onset fields are obtained in the entire domain. This peculiarity of the optical induced bistability in the metal composite with small dielectric cores can be attractive for possible applications.

Optical bistability induced by quantum coherence in a negative index atomic medium

International Nuclear Information System (INIS)

Zhang Hong-Jun; Sun Hui; Li Jin-Ping; Yin Bao-Yin; Guo Hong-Ju

2013-01-01

Bistability behaviors in an optical ring cavity filled with a dense V-type four-level atomic medium are theoretically investigated. It is found that the optical bistability can appear in the negative refraction frequency band, while both the bistability and multi-stability can occur in the positive refraction frequency bands. Therefore, optical bistability can be realized from conventional material to negative index material due to quantum coherence in our scheme. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

NARCIS (Netherlands)

Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

2013-01-01

Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

Optical bistability and multistability in polaritonic materials doped with nanoparticles

International Nuclear Information System (INIS)

Wang, Zhiping; Yu, Benli

2014-01-01

We investigate the optical bistability and multistability in polaritonic materials doped with nanoparticles inside an optical ring cavity. It is found that the optical bistability and multistability can be easily controlled by adjusting the corresponding parameters of the system properly. The effect of the dipole–dipole interaction has also been included in the formulation, which leads to interesting phenomena. Our scheme opens up the possibility of controling the optical bistability and multistability in polaritonic materials doped with nanoparticles. (letter)

Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

Science.gov (United States)

Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

2014-07-08

We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

Ca++ dependent bistability induced by serotonin in spinal motoneurons

DEFF Research Database (Denmark)

Hounsgaard, J.; Kiehn, O.

1985-01-01

The plateau potential, responsible for the bistable state of spinal motoneurons, recently described in the decerebrate cat, was suggested to depend on serotonin (Hounsgaard et al. 1984). In an in vitro preparation of the spinal cord of the turtle we now show that serotonin, applied directly...... to the bath, transforms the intrinsic response properties of motoneurons, uncovering a plateau potential and voltage sensitive bistability. The changes induced by serotonin were blocked by Mn++, while the plateau potential and the bistability remained after application of tetrodotoxin. We conclude...... that serotonin controls the expression of a Ca++ dependent plateau potential in motoneurons....

Dynamic control of a bistable wing under aerodynamic loading

International Nuclear Information System (INIS)

Bilgen, Onur; Arrieta, Andres F; Friswell, Michael I; Hagedorn, Peter

2013-01-01

The aerodynamic evaluation of a dynamic control technique applied to a bistable unsymmetrical cross-ply composite plate with surface bonded piezoelectric actuators is presented. The plate is clamped on one end to form a low-aspect-ratio wing. A previously proposed dynamic control method, utilizing bending resonance in different stable equilibrium positions, is used to induce snap-through between the two equilibrium states. Compared to quasi-static actuation, driving the bistable plate near resonance using surface bonded piezoelectric materials requires, theoretically, a lower peak excitation voltage to achieve snap-through. First, a set of extensive wind tunnel experiments are conducted on the passive bistable wing to understand the change in the dynamic behavior under various aerodynamic conditions. The passive wing demonstrated sufficient bending stiffness to sustain its shape under aerodynamic loading while preserving the desired bistable behavior. Next, by the use of the resonant control technique, the plate is turned into an effectively monostable structure, or alternatively, both stable equilibrium positions can be reached actively from the other stable equilibrium. Dynamic forward and reverse snap-through is demonstrated in the wind tunnel which shows both the effectiveness of the piezoelectric actuation as well as the load carrying capability of both states of the bistable wing. (paper)

Investigation of a bistable dual-stage vibration isolator under harmonic excitation

International Nuclear Information System (INIS)

Yang, Kai; Huang, Hai; Harne, R L; Wang, K W

2014-01-01

This study explores the steady-state performance of a dual-stage vibration isolator, which is configured by a bistable oscillator and a linear oscillator. The potential force of the bistable stage comprises negative linear and positive cubic nonlinear stiffnesses such that the two restoring force contributions may counterbalance to minimize dynamic force transmission. By applying a first-order harmonic balance, it is predicted that the bistable dual-stage isolator may significantly outperform an equivalent pure linear dual-stage isolator. This conclusion is verified through a series of numerical investigations. Following a parametric study, design guidelines are detailed to achieve performance improvements. Then, the ‘valley’ response, which is the special phenomenon of the bistable dual-stage isolator due to the counterbalance of the negative linear and positive nonlinear potential forces, is revealed and quantitatively explained. Numerical studies demonstrate the role of initial conditions, and it is shown that the likelihood of beneficial single periodic valley and intra-well responses for isolation purposes can be increased by greater bistable stage damping. Finally, a bistable dual-stage isolator prototype is developed and tested, and the numerical and experimental results verify the theoretical predictions. (paper)

Bistable behaviour of biexciton population in a dense exciton-biexciton system in semiconductors

International Nuclear Information System (INIS)

Nguyen Ba An.

1986-05-01

The steady state bistable behaviour of biexciton population in a dense exciton-biexciton semiconductor is considered. The intrinsic optical feedback is provided by the recombination mechanism. The exciton-biexciton and biexciton-biexciton interactions play the role of non-linearity responsible for biexciton bistability to occur. The conditions leading to the effect of bistability are obtained and two-parameter phase transition diagrams are drawn for both intensity and frequency bistable phenomena. (author)

Bubbling and bistability in two parameter discrete systems

OpenAIRE

Ambika, G.; Sujatha, N. V.

2000-01-01

We present a graphical analysis of the mechanisms underlying the occurrences of bubbling sequences and bistability regions in the bifurcation scenario of a special class of one dimensional two parameter maps. The main result of the analysis is that whether it is bubbling or bistability is decided by the sign of the third derivative at the inflection point of the map function.

Bistable luminescence of trivalent rare-earth ions in crystals

International Nuclear Information System (INIS)

Sole, Jose Garcia; Ramirez O, Maria de la; Rodenas, Airan; Jaque, Daniel; Bausa, Luisa; Bettinelli, Marco; Speghini, Adolfo; Cavalli, Enrico; Ivleva, Lioudmila

2006-01-01

In this work, we have examined three new bistable systems based on the luminescence of three different crystals activated with trivalent rare earth ions. We have focussed our attention on Yb 3+ ions activators, for which the most relevant results are obtained. The first crystal, Sr 0.6 Ba 0.4 Nb 2 O 6 , is a ferroelectric material with a relatively low phase transition temperature (∼370 K), which provides bistability in the luminescence of Yb 3+ ions due to the thermal hysteresis associated with phase transition. The second crystal, LiNbO 3 , provides an intrinsic bistability in the luminescence of Yb 3+ ions, which is driven by changes in the excitation intensity. In the third crystal, NdPO 4 , a new mechanism of excitation intensity driven bistability is obtained when activated with Yb 3+ ions, due to a interplay between the Nd 3+ ↔Yb 3+ energy transfer and back transfer processes

Controllable optical bistability in photonic-crystal one-atom laser

International Nuclear Information System (INIS)

Guo Xiaoyong; Lue Shuchen

2009-01-01

We investigate the property of optical bistability in a photonic-crystal one-atom laser when nonlinear microcavity is present. The physical system consists of a coherently driven two-level light emitter strongly coupled to a high-quality microcavity which is embedded within a photonic crystal and another coherent probing field which has incident into the microcavity. In our case, the microcavity is fabricated by nonlinear material and placed as an impurity in photonic crystal. This study reveals that such a system can exhibit optical bistability. The dependence of threshold value and hysteresis loop on the photonic band gap of the photonic crystal, driving field Rabi frequency and dephasing processes, are studied. Our results clearly illustrate the ability to control optical bistability through suitable photonic-crystal architectures and external coherent driving field, and this study suggests that in a photonic-crystal nonlinear microcavity, the one-atom laser acts as an effective controllable bistable device in the design of all-light digital computing systems in the near future.

Optical Bistability in Graded Core-Shell Granular Composites

International Nuclear Information System (INIS)

Wu Ya-Min; Chen Guo-Qing; Xue Si-Zhong; Zhu Zhuo-Wei; Ma Chao-Qun

2012-01-01

The intrinsic optical bistability (OB) of graded core-shell granular composites is investigated. The coated particles are made of cores with gradient dielectric function in c (r) = A(r/a) k and nonlinear shells. In view of the exponential distribution of the core dielectric constant, the potential functions of each region are obtained by solving the Maxwell equations, and the mathematical expressions of electric field in the shells and cores are determined. Numerical study reveals that the optical bistable threshold and the threshold width of the composite medium are dependent on the shell thickness, core dielectric exponent, and power function coefficient. The optical bistable width increases with the decreasing shell thickness and the power exponent and with the increasing power function coefficient

Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

Directory of Open Access Journals (Sweden)

Gogarten J Peter

2008-01-01

Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

Effects of Transverse Magnetic Anisotropy on Current-Induced Spin Switching

OpenAIRE

Misiorny, Maciej; Barnaś, Józef

2013-01-01

Spin-polarized transport through bistable magnetic adatoms or single-molecule magnets (SMMs), which exhibit both uniaxial and transverse magnetic anisotropy, is considered theoretically. The main focus is on the impact of transverse anisotropy on transport characteristics and the adatom's/SMM's spin. In particular, we analyze the role of quantum tunneling of magnetization (QTM) in the mechanism of the current-induced spin switching, and show that the QTM phenomenon becomes revealed as resonan...

Unidirectional Transition Waves in Bistable Lattices.

Science.gov (United States)

Nadkarni, Neel; Arrieta, Andres F; Chong, Christopher; Kochmann, Dennis M; Daraio, Chiara

2016-06-17

We present a model system for strongly nonlinear transition waves generated in a periodic lattice of bistable members connected by magnetic links. The asymmetry of the on-site energy wells created by the bistable members produces a mechanical diode that supports only unidirectional transition wave propagation with constant wave velocity. We theoretically justify the cause of the unidirectionality of the transition wave and confirm these predictions by experiments and simulations. We further identify how the wave velocity and profile are uniquely linked to the double-well energy landscape, which serves as a blueprint for transition wave control.

Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

Science.gov (United States)

Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

2006-03-01

Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

Bistability and self-oscillations effects in a polariton-laser semiconductor microcavity

International Nuclear Information System (INIS)

Cotta, E A; Matinaga, F M

2007-01-01

We report an experimental observation of polaritonic optical bistability of the laser emission in a planar semiconductor microcavity with a 100 0 A GaAs single quantum well in the strong-coupling regime. The bistability curves show crossings that indicate a competition between a Kerr-like effect induced by the polariton population and thermal effects. Associated with the bistability, laser-like emission occurs at the bare cavity mode

Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

Science.gov (United States)

Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

2017-01-01

The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

Geometric and potential dynamics interpretation of the optic ring resonator bistability

Science.gov (United States)

Chiangga, S.; Chittha, T.; Frank, T. D.

2015-07-01

The optical bistability is a fundamental nonlinear feature of the ring resonator. A geometric and potential dynamics interpretation of the bistability is given. Accordingly, the bistability of the nonlinear system is shown to be a consequence of geometric laws of vector calculus describing the resonator ring. In contrast, the so-called transcendental relations that have been obtained in the literature in order to describe the optical wave are interpreted in terms of potential dynamical systems. The proposed novel interpretation provides new insights into the nature of the ring resonator optical bistability. The fundamental work by Rukhlenko, Premaratne and Agrawal (2010) as well as a more recent study by Chiangga, Pitakwongsaporn, Frank and Yupapin (2013) are considered.

Asymmetric Effects on Escape Rates of Bistable System

International Nuclear Information System (INIS)

Wang Canjun; Mei Dongcheng; Dai Zucheng

2011-01-01

The asymmetric effects on the escape rates from the stable states x ± in the bistable system are analyzed. The results indicate that the multiplicative noise and the additive noise always enhance the particle escape from stable states x ± of bistable. However, the asymmetric parameter r enhances the particle escape from stable state x + , and holds back the particle escape from stable state x - . (general)

Numerical and experimental study of bistable plates for morphing structures

Science.gov (United States)

Nicassio, F.; Scarselli, G.; Avanzini, G.; Del Core, G.

2017-04-01

This study is concerned with the activation energy threshold of bistable composite plates in order to tailor a bistable system for specific aeronautical applications. The aim is to explore potential configurations of the bistable plates and their dynamic behavior for designing novel morphing structure suitable for aerodynamic surfaces and, as a possible further application, for power harvesters. Bistable laminates have two stable mechanical shapes that can withstand aerodynamic loads without additional constraint forces or locking mechanisms. This kind of structures, when properly loaded, snap-through from one stable configuration to another, causing large strains that can also be used for power harvesting scopes. The transition between the stable states of the composite laminate can be triggered, in principle, simply by aerodynamic loads (pilot, disturbance or passive inputs) without the need of servo-activated control systems. Both numerical simulations based on Finite Element models and experimental testing based on different activating forcing spectra are used to validate this concept. The results show that dynamic activation of bistable plates depend on different parameters that need to be carefully managed for their use as aircraft passive wing flaps.

Pivotal role of hMT+ in long-range disambiguation of interhemispheric bistable surface motion.

Science.gov (United States)

Duarte, João Valente; Costa, Gabriel Nascimento; Martins, Ricardo; Castelo-Branco, Miguel

2017-10-01

It remains an open question whether long-range disambiguation of ambiguous surface motion can be achieved in early visual cortex or instead in higher level regions, which concerns object/surface segmentation/integration mechanisms. We used a bistable moving stimulus that can be perceived as a pattern comprehending both visual hemi-fields moving coherently downward or as two widely segregated nonoverlapping component objects (in each visual hemi-field) moving separately inward. This paradigm requires long-range integration across the vertical meridian leading to interhemispheric binding. Our fMRI study (n = 30) revealed a close relation between activity in hMT+ and perceptual switches involving interhemispheric segregation/integration of motion signals, crucially under nonlocal conditions where components do not overlap and belong to distinct hemispheres. Higher signal changes were found in hMT+ in response to spatially segregated component (incoherent) percepts than to pattern (coherent) percepts. This did not occur in early visual cortex, unlike apparent motion, which does not entail surface segmentation. We also identified a role for top-down mechanisms in state transitions. Deconvolution analysis of switch-related changes revealed prefrontal, insula, and cingulate areas, with the right superior parietal lobule (SPL) being particularly involved. We observed that directed influences could emerge either from left or right hMT+ during bistable motion integration/segregation. SPL also exhibited significant directed functional connectivity with hMT+, during perceptual state maintenance (Granger causality analysis). Our results suggest that long-range interhemispheric binding of ambiguous motion representations mainly reflect bottom-up processes from hMT+ during perceptual state maintenance. In contrast, state transitions maybe influenced by high-level regions such as the SPL. Hum Brain Mapp 38:4882-4897, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley

REMap: Operon map of M. tuberculosis based on RNA sequence data.

Science.gov (United States)

Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

2016-07-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

Science.gov (United States)

Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

2012-01-01

During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

The Genomic Pattern of tDNA Operon Expression in E. coli.

Directory of Open Access Journals (Sweden)

2005-06-01

Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

Perceptual incongruence influences bistability and cortical activation.

Directory of Open Access Journals (Sweden)

Gijs Joost Brouwer

Full Text Available We employed a parametric psychophysical design in combination with functional imaging to examine the influence of metric changes in perceptual incongruence on perceptual alternation rates and cortical responses. Subjects viewed a bistable stimulus defined by incongruent depth cues; bistability resulted from incongruence between binocular disparity and monocular perspective cues that specify different slants (slant rivalry. Psychophysical results revealed that perceptual alternation rates were positively correlated with the degree of perceived incongruence. Functional imaging revealed systematic increases in activity that paralleled the psychophysical results within anterior intraparietal sulcus, prior to the onset of perceptual alternations. We suggest that this cortical activity predicts the frequency of subsequent alternations, implying a putative causal role for these areas in initiating bistable perception. In contrast, areas implicated in form and depth processing (LOC and V3A were sensitive to the degree of slant, but failed to show increases in activity when these cues were in conflict.

Solving a discrete model of the lac operon using Z3

Science.gov (United States)

Gutierrez, Natalia A.

2014-05-01

A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

Exchange bias and bistable magneto-resistance states in amorphous TbFeCo thin films

Energy Technology Data Exchange (ETDEWEB)

Li, Xiaopu, E-mail: xl6ba@virginia.edu; Ma, Chung T.; Poon, S. Joseph, E-mail: sjp9x@virginia.edu [Department of Physics, University of Virginia, Charlottesville, Virginia 22904 (United States); Lu, Jiwei [Department of Materials Science and Engineering, University of Virginia, Charlottesville, Virginia 22904 (United States); Devaraj, Arun [Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States); Spurgeon, Steven R.; Comes, Ryan B. [Physical and Computational Sciences Directorate, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

2016-01-04

Amorphous TbFeCo thin films sputter deposited at room temperature on thermally oxidized Si substrate are found to exhibit strong perpendicular magnetic anisotropy. Atom probe tomography, scanning transmission electron microscopy, and energy dispersive X-ray spectroscopy mapping have revealed two nanoscale amorphous phases with different Tb atomic percentages distributed within the amorphous film. Exchange bias accompanied by bistable magneto-resistance states has been uncovered near room temperature by magnetization and magneto-transport measurements. The exchange anisotropy originates from the exchange interaction between the ferrimagnetic and ferromagnetic components corresponding to the two amorphous phases. This study provides a platform for exchange bias and magneto-resistance switching using single-layer amorphous ferrimagnetic thin films that require no epitaxial growth.

The Necker-Zeno model for bistable perception.

Science.gov (United States)

Atmanspacher, Harald; Filk, Thomas

2013-10-01

A novel conceptual framework for theoretical psychology is presented and illustrated for the example of bistable perception. A basic formal feature of this framework is the non-commutativity of operations acting on mental states. A corresponding model for the bistable perception of ambiguous stimuli, the Necker-Zeno model, is sketched and some empirical evidence for it so far is described. It is discussed how a temporal non-locality of mental states, predicted by the model, can be understood and tested. © 2013 Cognitive Science Society, Inc.

Ultra-Fast All-Optical Self-Aware Protection Switching Based on a Bistable Laser Diode

DEFF Research Database (Denmark)

An, Yi; Vukovic, Dragana; Lorences Riesgo, Abel

2014-01-01

We propose a novel concept of all-optical protection switching with link failure automatic awareness based on AOWFF. The scheme is experimentally demonstrated using a single MG-Y laser diode with a record switching time ~200 ps....

Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

2003-01-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

2003-09-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

Decision making in noisy bistable systems with time-dependent asymmetry

Science.gov (United States)

Nené, Nuno R.; Zaikin, Alexey

2013-01-01

Our work draws special attention to the importance of the effects of time-dependent parameters on decision making in bistable systems. Here, we extend previous studies of the mechanism known as speed-dependent cellular decision making in genetic circuits by performing an analytical treatment of the canonical supercritical pitchfork bifurcation problem with an additional time-dependent asymmetry and control parameter. This model has an analogous behavior to the genetic switch. In the presence of transient asymmetries and fluctuations, slow passage through the critical region in both systems increases substantially the probability of specific decision outcomes. We also study the relevance for attractor selection of reaching maximum values for the external asymmetry before and after the critical region. Overall, maximum asymmetries should be reached at an instant where the position of the critical point allows for compensation of the detrimental effects of noise in retaining memory of the transient asymmetries.

Bistable Topological Insulator with Exciton-Polaritons

Science.gov (United States)

Kartashov, Yaroslav V.; Skryabin, Dmitry V.

2017-12-01

The functionality of many nonlinear and quantum optical devices relies on the effect of optical bistability. Using microcavity exciton-polaritons in a honeycomb arrangement of microcavity pillars, we report the resonance response and bistability of topological edge states. A balance between the pump, loss, and nonlinearity ensures a broad range of dynamical stability and controls the distribution of power between counterpropagating states on the opposite edges of the honeycomb lattice stripe. Tuning energy and polarization of the pump photons, while keeping their momentum constant, we demonstrate control of the propagation direction of the dominant edge state. Our results facilitate the development of practical applications of topological photonics.

Dynamics of a bistable Miura-origami structure

Science.gov (United States)

Fang, Hongbin; Li, Suyi; Ji, Huimin; Wang, K. W.

2017-05-01

Origami-inspired structures and materials have shown extraordinary properties and performances originating from the intricate geometries of folding. However, current state of the art studies have mostly focused on static and quasistatic characteristics. This research performs a comprehensive experimental and analytical study on the dynamics of origami folding through investigating a stacked Miura-Ori (SMO) structure with intrinsic bistability. We fabricate and experimentally investigated a bistable SMO prototype with rigid facets and flexible crease lines. Under harmonic base excitation, the SMO exhibits both intrawell and interwell oscillations. Spectrum analyses reveal that the dominant nonlinearities of SMO are quadratic and cubic, which generate rich dynamics including subharmonic and chaotic oscillations. The identified nonlinearities indicate that a third-order polynomial can be employed to approximate the measured force-displacement relationship. Such an approximation is validated via numerical study by qualitatively reproducing the phenomena observed in the experiments. The dynamic characteristics of the bistable SMO resemble those of a Helmholtz-Duffing oscillator (HDO); this suggests the possibility of applying the established tools and insights of HDO to predict origami dynamics. We also show that the bistability of SMO can be programmed within a large design space via tailoring the crease stiffness and initial stress-free configurations. The results of this research offer a wealth of fundamental insights into the dynamics of origami folding, and provide a solid foundation for developing foldable and deployable structures and materials with embedded dynamic functionalities.

Dynamics of a bistable Miura-origami structure.

Science.gov (United States)

Fang, Hongbin; Li, Suyi; Ji, Huimin; Wang, K W

2017-05-01

Origami-inspired structures and materials have shown extraordinary properties and performances originating from the intricate geometries of folding. However, current state of the art studies have mostly focused on static and quasistatic characteristics. This research performs a comprehensive experimental and analytical study on the dynamics of origami folding through investigating a stacked Miura-Ori (SMO) structure with intrinsic bistability. We fabricate and experimentally investigated a bistable SMO prototype with rigid facets and flexible crease lines. Under harmonic base excitation, the SMO exhibits both intrawell and interwell oscillations. Spectrum analyses reveal that the dominant nonlinearities of SMO are quadratic and cubic, which generate rich dynamics including subharmonic and chaotic oscillations. The identified nonlinearities indicate that a third-order polynomial can be employed to approximate the measured force-displacement relationship. Such an approximation is validated via numerical study by qualitatively reproducing the phenomena observed in the experiments. The dynamic characteristics of the bistable SMO resemble those of a Helmholtz-Duffing oscillator (HDO); this suggests the possibility of applying the established tools and insights of HDO to predict origami dynamics. We also show that the bistability of SMO can be programmed within a large design space via tailoring the crease stiffness and initial stress-free configurations. The results of this research offer a wealth of fundamental insights into the dynamics of origami folding, and provide a solid foundation for developing foldable and deployable structures and materials with embedded dynamic functionalities.

Cooperativity Leads to Temporally-Correlated Fluctuations in the Bacteriophage Lambda Genetic Switch

Directory of Open Access Journals (Sweden)

Jacob Quinn Shenker

2015-04-01

Full Text Available Cooperative interactions are widespread in biochemical networks, providing the nonlinear response that underlies behavior such as ultrasensitivity and robust switching. We introduce a temporal correlation function—the conditional activity—to study the behavior of these phenomena. Applying it to the bistable genetic switch in bacteriophage lambda, we find that cooperative binding between binding sites on the prophage DNA lead to non-Markovian behavior, as quantified by the conditional activity. Previously, the conditional activity has been used to predict allosteric pathways in proteins; here, we show that it identifies the rare unbinding events which underlie induction from lysogeny to lysis.

Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

Science.gov (United States)

García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

2017-09-01

Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Micromagnetic simulation of energy consumption and excited eigenmodes in elliptical nanomagnetic switches

International Nuclear Information System (INIS)

Carlotti, G.; Madami, M.; Gubbiotti, G.; Tacchi, S.

2014-01-01

Sub-200 nm patterned magnetic dots are key elements for the design of magnetic switches, memory cells or elementary units of nanomagnetic logic circuits. In this paper, we analyse by micromagnetic simulations the magnetization reversal, the dissipated energy and the excited spin eigenmodes in bistable magnetic switches, consisting of elliptical nanodots with 100×60 nm lateral dimensions. Two different strategies for reversal are considered and the relative results compared: (i) the irreversible switching obtained by the application of an external field along the easy axis, in the direction opposite to the initial magnetization; (ii) the precessional switching accomplished by the application of a short magnetic field pulse, oriented perpendicular to the initial magnetization direction. The obtained results are discussed in terms of deviation from the macrospin behavior, energy dissipation and characteristics of the spectrum of spin eigenmodes excited during the magnetization reversal process

Bistability of mangrove forests and competition with freshwater plants

Science.gov (United States)

Jiang, Jiang; Fuller, Douglas O; Teh, Su Yean; Zhai, Lu; Koh, Hock Lye; DeAngelis, Donald L.; Sternberg, L.D.S.L.

2015-01-01

Halophytic communities such as mangrove forests and buttonwood hammocks tend to border freshwater plant communities as sharp ecotones. Most studies attribute this purely to underlying physical templates, such as groundwater salinity gradients caused by tidal flux and topography. However, a few recent studies hypothesize that self-reinforcing feedback between vegetation and vadose zone salinity are also involved and create a bistable situation in which either halophytic dominated habitat or freshwater plant communities may dominate as alternative stable states. Here, we revisit the bistability hypothesis and demonstrate the mechanisms that result in bistability. We demonstrate with remote sensing imagery the sharp boundaries between freshwater hardwood hammock communities in southern Florida and halophytic communities such as buttonwood hammocks and mangroves. We further document from the literature how transpiration of mangroves and freshwater plants respond differently to vadose zone salinity, thus altering the salinity through feedback. Using mathematical models, we show how the self-reinforcing feedback, together with physical template, controls the ecotones between halophytic and freshwater communities. Regions of bistability along environmental gradients of salinity have the potential for large-scale vegetation shifts following pulse disturbances such as hurricane tidal surges in Florida, or tsunamis in other regions. The size of the region of bistability can be large for low-lying coastal habitat due to the saline water table, which extends inland due to salinity intrusion. We suggest coupling ecological and hydrologic processes as a framework for future studies.

Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

Science.gov (United States)

Igoshin, Oleg

2011-03-01

Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

Rapid customised operon assembly by yeast recombinational cloning.

Science.gov (United States)

Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

2017-06-01

We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

Bistable responses in bacterial genetic networks: Designs and dynamical consequences

Science.gov (United States)

Tiwari, Abhinav; Ray, J. Christian J.; Narula, Jatin; Igoshin, Oleg A.

2011-01-01

A key property of living cells is their ability to react to stimuli with specific biochemical responses. These responses can be understood through the dynamics of underlying biochemical and genetic networks. Evolutionary design principles have been well studied in networks that display graded responses, with a continuous relationship between input signal and system output. Alternatively, biochemical networks can exhibit bistable responses so that over a range of signals the network possesses two stable steady states. In this review, we discuss several conceptual examples illustrating network designs that can result in a bistable response of the biochemical network. Next, we examine manifestations of these designs in bacterial master-regulatory genetic circuits. In particular, we discuss mechanisms and dynamic consequences of bistability in three circuits: two-component systems, sigma-factor networks, and a multistep phosphorelay. Analyzing these examples allows us to expand our knowledge of evolutionary design principles for networks with bistable responses. PMID:21385588

Bi-stable optical actuator

Science.gov (United States)

Holdener, Fred R.; Boyd, Robert D.

2000-01-01

The present invention is a bi-stable optical actuator device that is depowered in both stable positions. A bearing is used to transfer motion and smoothly transition from one state to another. The optical actuator device may be maintained in a stable position either by gravity or a restraining device.

Exact modelling of the optical bistability in ferroelectics via two-wave mixing: A system with full nonlinearity

Science.gov (United States)

Khushaini, Muhammad Asif A.; Ibrahim, Abdel-Baset M. A.; Choudhury, P. K.

2018-05-01

In this paper, we provide a complete mathematical model of the phenomenon of optical bistability (OB) resulting from the degenerate two-wave mixing (TWM) process of laser beams interacting with a single nonlinear layer of ferroelectric material. Starting with the electromagnetic wave equation for optical wave propagating in nonlinear media, a nonlinear coupled wave (CW) system with both self-phase modulation (SPM) and cross-phase modulation (XPM) sources of nonlinearity are derived. The complete CW system with full nonlinearity is solved numerically and a comparison between both the cases of with and without SPM at various combinations of design parameters is given. Furthermore, to provide a reliable theoretical model for the OB via TWM process, the results obtained theoretically are compared with the available experimental data. We found that the nonlinear system without SPM fails to predict the bistable response at lower combinations of the input parameters. However, at relatively higher values, the solution without SPM shows a reduction in the switching contrast and period in the OB response. A comparison with the experimental results shows better agreement with the system with full nonlinearity.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

Science.gov (United States)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

Brain networks underlying bistable perception.

Science.gov (United States)

Baker, Daniel H; Karapanagiotidis, Theodoros; Coggan, David D; Wailes-Newson, Kirstie; Smallwood, Jonathan

2015-10-01

Bistable stimuli, such as the Necker Cube, demonstrate that experience can change in the absence of changes in the environment. Such phenomena can be used to assess stimulus-independent aspects of conscious experience. The current study used resting state functional magnetic resonance imaging (rs-fMRI) to index stimulus-independent changes in neural activity to understand the neural architecture that determines dominance durations during bistable perception (using binocular rivalry and Necker cube stimuli). Anterior regions of the Superior Parietal Lobule (SPL) exhibited robust connectivity with regions of primary sensorimotor cortex. The strength of this region's connectivity with the striatum predicted shorter dominance durations during binocular rivalry, whereas its connectivity to pre-motor cortex predicted longer dominance durations for the Necker Cube. Posterior regions of the SPL, on the other hand, were coupled to associative cortex in the temporal and frontal lobes. The posterior SPL's connectivity to the temporal lobe predicted longer dominance during binocular rivalry. In conjunction with prior work, these data suggest that the anterior SPL contributes to perceptual rivalry through the inhibition of incongruent bottom up information, whereas the posterior SPL influences rivalry by supporting the current interpretation of a bistable stimulus. Our data suggests that the functional connectivity of the SPL with regions of sensory, motor, and associative cortex allows it to regulate the interpretation of the environment that forms the focus of conscious attention at a specific moment in time. Copyright © 2015. Published by Elsevier Inc.

Quinonoid metal complexes: toward molecular switches.

Science.gov (United States)

Dei, Andrea; Gatteschi, Dante; Sangregorio, Claudio; Sorace, Lorenzo

2004-11-01

The peculiar redox-active character of quinonoid metal complexes makes them extremely appealing to design materials of potential technological interest. We show here how the tuning of the properties of these systems can be pursued by using appropriate molecular synthetic techniques. In particular, we focus our attention on metal polyoxolene complexes exhibiting intramolecular electron transfer processes involving either the ligand and the metal ion or the two dioxolene moieties of a properly designed ligand thus inducing electronic bistability. The transition between the two metastable electronic states can be induced by different external stimuli such as temperature, pressure, light, or pH suggesting the use of these systems for molecular switches.

Analytic descriptions of stochastic bistable systems under force ramp.

Science.gov (United States)

Friddle, Raymond W

2016-05-01

Solving the two-state master equation with time-dependent rates, the ubiquitous driven bistable system, is a long-standing problem that does not permit a complete solution for all driving rates. Here we show an accurate approximation to this problem by considering the system in the control parameter regime. The results are immediately applicable to a diverse range of bistable systems including single-molecule mechanics.

Bistable Microvalve For Use With Microcatheter System

Science.gov (United States)

Seward, Kirk Patrick

2003-12-16

A bistable microvalve of shape memory material is operatively connected to a microcatheter. The bistable microvalve includes a tip that can be closed off until it is in the desired position. Once it is in position it can be opened and closed. The system uses heat and pressure to open and close the microvalve. The shape memory material will change stiffness and shape when heated above a transition temperature. The shape memory material is adapted to move from a first shape to a second shape, either open or closed, where it can perform a desired function.

Noticeable positive Doppler effect on optical bistability in an N-type active Raman gain atomic system

International Nuclear Information System (INIS)

Chang Zeng-Guang; Zhang Jing-Tao; Niu Yue-Ping; Gong Shang-Qing

2012-01-01

We theoretically investigate the Doppler effect on optical bistability in an N-type active Raman gain atomic system inside an optical ring cavity. It is shown that the Doppler effect can greatly enhance the dispersion and thus create the bistable behaviour or greatly increase the bistable region, which has been known as the positive Doppler effect on optical bistability. In addition, we find that a positive Doppler effect can change optical bistability from the hybrid dispersion-gain type to a dispersive type

External field induced switching of tunneling current in the coupled quantum dots

OpenAIRE

Mantsevich, V. N.; Maslova, N. S.; Arseyev, P. I.

2014-01-01

We investigated the tunneling current peculiarities in the system of two coupled by means of the external field quantum dots (QDs) weakly connected to the electrodes in the presence of Coulomb correlations. It was found that tuning of the external field frequency induces fast multiple tunneling current switching and leads to the negative tunneling conductivity. Special role of multi-electrons states was demonstrated. Moreover we revealed conditions for bistable behavior of the tunneling curre...

Phase-locked 3D3C-MRV measurements in a bi-stable fluidic oscillator

Science.gov (United States)

Wassermann, Florian; Hecker, Daniel; Jung, Bernd; Markl, Michael; Seifert, Avi; Grundmann, Sven

2013-03-01

In this work, the phase-resolved internal flow of a bi-stable fluidic oscillator was measured using phase-locked three-dimensional three-components magnetic resonance velocimetry (3D3C-MRV), also termed as 4D-MRV. A bi-stable fluidic oscillator converts a continuous inlet-mass flow into a jet alternating between two outlet channels and, as a consequence provides an unsteady, periodic flow. This actuator can therefore be used as flow-control actuator. Since data acquisition in a 3D volume takes up to several minutes, only a small portion of the data is acquired in each flow cycle for every time point of the flow cycle. The acquisition of the entire data set is segmented over many cycles of the periodic flow. This procedure allows to measure phase-averaged 3D3C velocity fields with a certain temporal resolution. However, the procedure requires triggering to the periodic nature of the flow. Triggering the MR scanner precisely on each flow cycle is one of the key issues discussed in this manuscript. The 4D-MRV data are compared to data measured using phase-locked laser Doppler anemometry and good agreement between the results is found. The validated 4D-MRV data is analyzed and the fluid-mechanic features and processes inside the fluidic oscillator are investigated and described, providing a detailed description of the internal jet-switching mechanism.

Evidence for distinct mechanisms underlying attentional priming and sensory memory for bistable perception.

Science.gov (United States)

Brinkhuis, M A B; Kristjánsson, Á; Brascamp, J W

2015-08-01

Attentional selection in visual search paradigms and perceptual selection in bistable perception paradigms show functional similarities. For example, both are sensitive to trial history: They are biased toward previously selected targets or interpretations. We investigated whether priming by target selection in visual search and sensory memory for bistable perception are related. We did this by presenting two trial types to observers. We presented either ambiguous spheres that rotated over a central axis and could be perceived as rotating in one of two directions, or search displays in which the unambiguously rotating target and distractor spheres closely resembled the two possible interpretations of the ambiguous stimulus. We interleaved both trial types within experiments, to see whether priming by target selection during search trials would affect the perceptual outcome of bistable perception and, conversely, whether sensory memory during bistable perception would affect target selection times during search. Whereas we found intertrial repetition effects among consecutive search trials and among consecutive bistable trials, we did not find cross-paradigm effects. Thus, even though we could ascertain that our experiments robustly elicited processes of both search priming and sensory memory for bistable perception, these same experiments revealed no interaction between the two.

Ab initio investigation of the switching behavior of the dithiole-benzene nano-molecular wire

International Nuclear Information System (INIS)

Darvish Ganji, M.; Rungger, I.

2008-01-01

We report a first-principle study of electrical transport and switching behavior in a single molecular conductor consisting of a dithiole-benzene sandwiched between two Au( 100) electrodes. Ab initio total energy calculations reveal dithiole-benzene molecules on a gold surface, contacted by a monoatomic gold scanning tunneling microscope tip to have two classes of low energy conformations with differing symmetries. Lateral motion of the tip or excitation of the molecule cause it 10 change from one conformation class to the other and to switch between a strongly and a weakly conducting state. Thus, surprisingly. despite their apparent simplicity, these Au-dithiole-benzene -Au nano wires are shown to be electrically bi-stable switches, the smallest two-terminal molecular switches to date. The projected density of states and transmission coefficients are analyzed, and it suggests that the variation of the coupling between the molecule and the electrodes with external bias leads to switching behavior

An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

Science.gov (United States)

Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

2013-07-01

The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Charge Carrier Transport Mechanism Based on Stable Low Voltage Organic Bistable Memory Device.

Science.gov (United States)

Ramana, V V; Moodley, M K; Kumar, A B V Kiran; Kannan, V

2015-05-01

A solution processed two terminal organic bistable memory device was fabricated utilizing films of polymethyl methacrylate PMMA/ZnO/PMMA on top of ITO coated glass. Electrical characterization of the device structure showed that the two terminal device exhibited favorable switching characteristics with an ON/OFF ratio greater than 1 x 10(4) when the voltage was swept between - 2 V and +3 V. The device maintained its state after removal of the bias voltage. The device did not show degradation after a 1-h retention test at 120 degrees C. The memory functionality was consistent even after fifty cycles of operation. The charge transport switching mechanism is discussed on the basis of carrier transport mechanism and our analysis of the data shows that the charge carrier trans- port mechanism of the device during the writing process can be explained by thermionic emission (TE) and space-charge-limited-current (SCLC) mechanism models while erasing process could be explained by the FN tunneling mechanism. This demonstration provides a class of memory devices with the potential for low-cost, low-power consumption applications, such as a digital memory cell.

Breaking an epigenetic chromatin switch: curious features of hysteresis in Saccharomyces cerevisiae telomeric silencing.

Directory of Open Access Journals (Sweden)

Vijayalakshmi H Nagaraj

Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.

Dynamics of unidirectionally coupled bistable Henon maps

International Nuclear Information System (INIS)

Sausedo-Solorio, J.M.; Pisarchik, A.N.

2011-01-01

We study dynamics of two bistable Henon maps coupled in a master-slave configuration. In the case of coexistence of two periodic orbits, the slave map evolves into the master map state after transients, which duration determines synchronization time and obeys a -1/2 power law with respect to the coupling strength. This scaling law is almost independent of the map parameter. In the case of coexistence of chaotic and periodic attractors, very complex dynamics is observed, including the emergence of new attractors as the coupling strength is increased. The attractor of the master map always exists in the slave map independently of the coupling strength. For a high coupling strength, complete synchronization can be achieved only for the attractor similar to that of the master map. -- Highlights: → We study dynamics of two bistable Henon maps coupled in a master-slave configuration. → Synchronization time for periodic orbits obeys a -1/2 power law with respect to coupling. → For a high coupling strength, the slave map remains bistable. → Complete synchronization can be achieved only when both maps stay at the same attractor.

A review of the recent research on vibration energy harvesting via bistable systems

International Nuclear Information System (INIS)

Harne, R L; Wang, K W

2013-01-01

The investigation of the conversion of vibrational energy into electrical power has become a major field of research. In recent years, bistable energy harvesting devices have attracted significant attention due to some of their unique features. Through a snap-through action, bistable systems transition from one stable state to the other, which could cause large amplitude motion and dramatically increase power generation. Due to their nonlinear characteristics, such devices may be effective across a broad-frequency bandwidth. Consequently, a rapid engagement of research has been undertaken to understand bistable electromechanical dynamics and to utilize the insight for the development of improved designs. This paper reviews, consolidates, and reports on the major efforts and findings documented in the literature. A common analytical framework for bistable electromechanical dynamics is presented, the principal results are provided, the wide variety of bistable energy harvesters are described, and some remaining challenges and proposed solutions are summarized. (topical review)

CONDOP: an R package for CONdition-Dependent Operon Predictions.

Science.gov (United States)

Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

2016-10-15

The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Controlling the optical bistability and multistability in a two-level pumped-probe system

International Nuclear Information System (INIS)

Mahmoudi, Mohammad; Sahrai, Mostafa; Masoumeh Mousavi, Seyede

2010-01-01

We study the behavior of the optical bistability (OB) and multistability (OM) in a two-level pumped-probe atomic system by means of a unidirectional ring cavity. We show that the optical bistability in a two-level atomic system can be controlled by adjusting the intensity of the pump field and the detuning between two fields. We find that applying the pumping field decreases the threshold of the optical bistability.

A predictive coding account of bistable perception - a model-based fMRI study.

Science.gov (United States)

Weilnhammer, Veith; Stuke, Heiner; Hesselmann, Guido; Sterzer, Philipp; Schmack, Katharina

2017-05-01

In bistable vision, subjective perception wavers between two interpretations of a constant ambiguous stimulus. This dissociation between conscious perception and sensory stimulation has motivated various empirical studies on the neural correlates of bistable perception, but the neurocomputational mechanism behind endogenous perceptual transitions has remained elusive. Here, we recurred to a generic Bayesian framework of predictive coding and devised a model that casts endogenous perceptual transitions as a consequence of prediction errors emerging from residual evidence for the suppressed percept. Data simulations revealed close similarities between the model's predictions and key temporal characteristics of perceptual bistability, indicating that the model was able to reproduce bistable perception. Fitting the predictive coding model to behavioural data from an fMRI-experiment on bistable perception, we found a correlation across participants between the model parameter encoding perceptual stabilization and the behaviourally measured frequency of perceptual transitions, corroborating that the model successfully accounted for participants' perception. Formal model comparison with established models of bistable perception based on mutual inhibition and adaptation, noise or a combination of adaptation and noise was used for the validation of the predictive coding model against the established models. Most importantly, model-based analyses of the fMRI data revealed that prediction error time-courses derived from the predictive coding model correlated with neural signal time-courses in bilateral inferior frontal gyri and anterior insulae. Voxel-wise model selection indicated a superiority of the predictive coding model over conventional analysis approaches in explaining neural activity in these frontal areas, suggesting that frontal cortex encodes prediction errors that mediate endogenous perceptual transitions in bistable perception. Taken together, our current work

A predictive coding account of bistable perception - a model-based fMRI study.

Directory of Open Access Journals (Sweden)

Veith Weilnhammer

2017-05-01

Full Text Available In bistable vision, subjective perception wavers between two interpretations of a constant ambiguous stimulus. This dissociation between conscious perception and sensory stimulation has motivated various empirical studies on the neural correlates of bistable perception, but the neurocomputational mechanism behind endogenous perceptual transitions has remained elusive. Here, we recurred to a generic Bayesian framework of predictive coding and devised a model that casts endogenous perceptual transitions as a consequence of prediction errors emerging from residual evidence for the suppressed percept. Data simulations revealed close similarities between the model's predictions and key temporal characteristics of perceptual bistability, indicating that the model was able to reproduce bistable perception. Fitting the predictive coding model to behavioural data from an fMRI-experiment on bistable perception, we found a correlation across participants between the model parameter encoding perceptual stabilization and the behaviourally measured frequency of perceptual transitions, corroborating that the model successfully accounted for participants' perception. Formal model comparison with established models of bistable perception based on mutual inhibition and adaptation, noise or a combination of adaptation and noise was used for the validation of the predictive coding model against the established models. Most importantly, model-based analyses of the fMRI data revealed that prediction error time-courses derived from the predictive coding model correlated with neural signal time-courses in bilateral inferior frontal gyri and anterior insulae. Voxel-wise model selection indicated a superiority of the predictive coding model over conventional analysis approaches in explaining neural activity in these frontal areas, suggesting that frontal cortex encodes prediction errors that mediate endogenous perceptual transitions in bistable perception. Taken together

Optical bistability in the oscillation of an inhomogeneously broadened quasi-three-level laser

International Nuclear Information System (INIS)

Liu, Junhai; Tian, Xueping

2013-01-01

A theoretical modeling analysis is presented to study the optical bistability exhibited in the oscillation of an inhomogeneously broadened quasi-three-level laser. All the major characteristics of optical bistability depend on two normalized parameters, f and x a , which are defined by f = I sat,a /I sat,m and x a = 2α a0 p a /δ and are related to measurable properties of the laser medium. In comparison with the case of a homogeneously broadened laser, the essential condition for the occurrence of such bistability, f a /(x a + 1), turns out to be the same, whereas the intensities at the up- and down-thresholds are substantially increased and the bistability range is reduced. (paper)

Low threshold optical bistability and superluminal light propagation using a dielectric slab via inter-dot tunneling

International Nuclear Information System (INIS)

Taherzadeh, S; Nasehi, R; Mahmoudi, Mohammad

2015-01-01

The optical bistability (OB) behavior of a dielectric slab doped with quantum dot (QD) molecules is investigated in the presence of the inter-dot tunneling effect. It is shown that the threshold point of OB reduces by increasing inter-dot tunneling as well as by reducing the slab thickness. It is worth noting that the threshold of OB in a slab doped with QD molecules is smaller, by at least one order of magnitude, in respect to free QD molecules. We find that the inter-dot tunneling induces a negative group delay to the reflected pulse and it propagates in the superluminal region. Such simple control can be used in all optical switching. (paper)

Power requirements reducing of FBG based all-optical switching

Science.gov (United States)

Scholtz, Ľubomír.; Solanská, Michaela; Ladányi, Libor; Müllerová, Jarmila

2017-12-01

Although Fiber Bragg gratings (FBGs) are well known devices, their using as all-optical switching elements has been still examined. Current research is focused on optimization of their properties for their using in future all-optical networks. The main problem are high switching intensities needed for achieving the changes of the transmission state. Over several years switching intensities have been reduced from hundreds of GW/cm2 to tens of MW/cm2 by selecting appropriate gratings and signal parameters or using suitable materials. Two principal nonlinear effects with similar power requirements can result in the bistable transmission/reflection of an input optical pulse. In the self-phase modulation (SPM) regime switching is achieved by the intense probe pulse itself. Using cross-phase modulation (XPM) a strong pump alters the FBG refractive index experienced by a weak probe pulse. As a result of this the detuning of the probe pulse from the center of the photonic band gap occurs. Using of XPM the effect of modulation instability is reduced. Modulation instability which is the main SPM degradation mechanism. We focused on nonlinear FBGs based on chalcogenide glasses which are very often used in various applications. Thanks to high nonlinear parameters chalcogenide glasses are suitable candidates for reducing switching intensities of nonlinear FBGs.

The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

Science.gov (United States)

Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

2012-01-01

Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

Tuning the resistive switching memory in a metal–ferroelectric–semiconductor capacitor by field effect structure

Energy Technology Data Exchange (ETDEWEB)

Wang, S.Y., E-mail: shouyu.wang@yahoo.com [College of Physics and Electronic Information Science, Tianjin Normal University, Tianjin 300074 (China); Guo, F.; Wang, X. [College of Physics and Electronic Information Science, Tianjin Normal University, Tianjin 300074 (China); Liu, W.F., E-mail: wfliu@tju.edu.cn [Department of Applied Physics, Faculty of Science, Tianjin University, Weijin Road, Nankai District, Tianjin 300072 (China); Gao, J., E-mail: jugao@hku.hk [Department of Physics, the University of Hong Kong, Pokfulam Road (Hong Kong)

2015-11-30

Highlights: • Bistable or tristable electrically conducting state is observed. • Coefficient can be tuned in situ by modulating carrier's density. • The RS effects may be of significance for multi-source controlled memory devices. - Abstract: Resistive switching (RS) effects based on a correlation between ferroelectric polarization and conductivity might become of particular interest for nonvolatile memory applications, because they are not subjected to the scaling restrictions. Here we report on RS behaviors modulated by a reversal of ferroelectric polarization in heterostructures comprising of a ferroelectric layer and a semiconducting manganite film. It is found that electrically conducting state is bistable or even tristable; and via the polarization flipping, a maximum resistive switching coefficient (R{sub max}/R{sub min}) is found to be larger than 3000 with bias of 6 V in Ag/BaTiO{sub 3}/La{sub 0.8}Ca{sub 0.2}MnO{sub 3} at room temperature. More importantly, employing field-effect structure with ferroelectric PMN-PT as substrate, we found that the resistive switching behaviors can be tuned in situ by modulating the concentration of carriers in the semiconducting manganite layer. Possible mechanisms are discussed on the basis of the interplay of bound ferroelectric charges, charged defects in ferroelectric layer and mobile carriers in manganite thin films. The giant RS effects observed here may be of significance for memory devices by combing electronic conduction with magnetic, spintronic, and optical functionalities.

The pyrimidine operon pyrRPB-carA from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Schallert, J.; Andersen, Birgit

2001-01-01

The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

Order reconstruction phenomena and temperature-driven dynamics in a 3D zenithally bistable device

KAUST Repository

Raisch, A.

2014-07-01

We model the zenithally bistable device (ZBD) in three dimensions (3D), within the Landau-de Gennes theory, and find three stable static states in 3D without an applied field: the vertically aligned nematic (VAN) state, the hybrid aligned nematic (HAN) state and a third, high-tilt state, which we call the THAN state, with an interior and a surface defect. We recover the order reconstruction (OR) phenomenon around the defects in the HAN and THAN states and the 3D THAN and HAN solutions exhibit stable biaxial cylinders connecting defects on opposite faces of the ZBD device. We demonstrate a two-way temperature-driven switching between high-tilt and low-tilt states through controlled heating and cooling procedures in two dimensions (2D), with no applied fields. © CopyrightEPLA, 2014.

Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

DEFF Research Database (Denmark)

Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

1994-01-01

Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

A quintuple quantum dot system for electrical and optical control of multi/bistability in a telecommunication window

International Nuclear Information System (INIS)

Mehmannavaz, Mohammad Reza; Sattari, Hamed

2015-01-01

We propose a model for a quintuple coupled quantum dot system based on a GaAs/AlGaAs heterostructure. Then, we analyze the optical bistability (OB) and optical multistability (OM) behaviours and transition between the regimes at a wavelength of λ=1.550 μm. We take the benefit of consecutive and parallel interdot tunnelling and an incoherent pumping field for electrical and even optical control of the processes. It is shown that OB, OM and transition between them can be accomplished and controlled by adjusting the rate of the inter-dot tunnellings (electrical bias), probe wavelength detuning and rate of the optical incoherent pumping field. By proper choice of the controlling parameters, the bistable hysteresis loop becomes narrower, which makes it easier for the cavity field to reach saturation. We interpret the OB and OM behaviours by discussing the absorption of the active medium. We also investigate switching time between the two stable states when the output field jumps from a lower branch to an upper branch. Such a controllable OB/OM and transition between them in multiple QD molecules at a wavelength of 1.550 μm, may provide some new possibilities for technological applications in optoelectronics, solid-state quantum information science and systems dealing with signal processing. (letter)

N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-09-01

Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

A Strategy for Magnifying Vibration in High-Energy Orbits of a Bistable Oscillator at Low Excitation Levels

International Nuclear Information System (INIS)

Wang Guang-Qing; Liao Wei-Hsin

2015-01-01

This work focuses on how to maintain a high-energy orbit motion of a bistable oscillator when subjected to a low level excitation. An elastic magnifier (EM) positioned between the base and the bistable oscillator is used to magnify the base vibration displacement to significantly enhance the output characteristics of the bistable oscillator. The dimensionless electromechanical equations of the bistable oscillator with an EM are derived, and the effects of the mass and stiffness ratios between the EM and the bistable oscillator on the output displacement are studied. It is shown that the jump phenomenon occurs at a lower excitation level with increasing the mass and stiffness ratios. With the comparison of the displacement trajectories and the phase portraits obtained from experiments, it is validated that the bistable oscillator with an EM can effectively oscillate in a high-energy orbit and can generate a superior output vibration at a low excitation level as compared with the bistable oscillator without an EM. (paper)

Bistable switching in supercritical n+-n-n+GaAs transferred electron devices

DEFF Research Database (Denmark)

Jøndrup, Peter; Jeppesen, Palle; Jeppson, Bert

1976-01-01

: 1) cathode-triggered traveling domain; 2) cathode-triggered accumulation layer; 3) anode-triggered domain. Relative current drops up to 40 percent, and switching times down to 60 ps are obtained in low-duty-cycle pulsed experiments with threshold currents around 400 mA. Optimum device parameters...

A novel optic bistable device with very low threshold intensity using photorefractive films

Science.gov (United States)

Wang, Sean X.; Sun, Yuankun; Trivedi, Sudhir B.; Li, Guifang

1994-08-01

Brimrose Corporation of America reports the successful completion of the SBIR Phase I research in low-threshold intensity optical bistable devices using photorefractive nonlinearity. A thin photorefractive film optical bistable device was proposed in the Phase I proposal. The feasibility of this device was theoretically investigated. The theoretical feasibility study formulates the materials requirements in such a kind of configuration for Phase II research. In addition, we have proposed and investigated another configuration of optical bistable devices that do not require advanced photorefractive materials, namely, the self-pumped phase conjugator. We have successfully demonstrated a low-threshold optical bistable operation in a KNSBN:CU crystal. To the best of our knowledge, the threshold of 650 mW/sq. cm is the lowest of its kind to be achieved so far.

Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

Science.gov (United States)

Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

2016-01-01

Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

NARCIS (Netherlands)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

The post-transcriptional operon

DEFF Research Database (Denmark)

Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

2011-01-01

model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

Connectionist interpretation of the association between cognitive dissonance and attention switching.

Science.gov (United States)

Matsumoto, Takao

2014-12-01

A novel connectionist model accounting for cognitive dissonance is described, in which the concepts of self and attention switching are considered. The model is composed of a unit corresponding to self, a bistable pair comprising two units relevant to two dissonant cognitions, and links whose weights correspond to cognitive evaluations. The model makes it possible to use mathematical formulas to represent the cognitive-dissonance process. Analysis reveals that the model fits experimental data of major paradigms in cognitive dissonance theory. The model shows that attention switching, which is produced by internal and external stimuli, causes building-up of cognitive dissonance and retardation of its reduction. The psychological phenomenon of selective exposure is interpreted on the basis of the operation of the model. Copyright © 2014 Elsevier Ltd. All rights reserved.

Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

OpenAIRE

Stewart, V; Yanofsky, C

1986-01-01

We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

Directory of Open Access Journals (Sweden)

Juliana Teixeira de Magalhães

2005-06-01

Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

Propensity for Bistability of Bursting and Silence in the Leech Heart Interneuron

Directory of Open Access Journals (Sweden)

Tatiana Dashevskiy

2018-02-01

Full Text Available The coexistence of neuronal activity regimes has been reported under normal and pathological conditions. Such multistability could enhance the flexibility of the nervous system and has many implications for motor control, memory, and decision making. Multistability is commonly promoted by neuromodulation targeting specific membrane ionic currents. Here, we investigated how modulation of different ionic currents could affect the neuronal propensity for bistability. We considered a leech heart interneuron model. It exhibits bistability of bursting and silence in a narrow range of the leak current parameters, conductance (gleak and reversal potential (Eleak. We assessed the propensity for bistability of the model by using bifurcation diagrams. On the diagram (gleak, Eleak, we mapped bursting and silent regimes. For the canonical value of Eleak we determined the range of gleak which supported the bistability. We use this range as an index of propensity for bistability. We investigated how this index was affected by alterations of ionic currents. We systematically changed their conductances, one at a time, and built corresponding bifurcation diagrams in parameter planes of the maximal conductance of a given current and the leak conductance. We found that conductance of only one current substantially affected the index of propensity; the increase of the maximal conductance of the hyperpolarization-activated cationic current increased the propensity index. The second conductance with the strongest effect was the conductance of the low-threshold fast Ca2+ current; its reduction increased the propensity index although the effect was about two times smaller in magnitude. Analyzing the model with both changes applied simultaneously, we found that the diagram (gleak, Eleak showed a progressively expanded area of bistability of bursting and silence.

Bistable traveling waves for a competitive-cooperative system with nonlocal delays

Science.gov (United States)

Tian, Yanling; Zhao, Xiao-Qiang

2018-04-01

This paper is devoted to the study of bistable traveling waves for a competitive-cooperative reaction and diffusion system with nonlocal time delays. The existence of bistable waves is established by appealing to the theory of monotone semiflows and the finite-delay approximations. Then the global stability of such traveling waves is obtained via a squeezing technique and a dynamical systems approach.

Bistability induces episodic spike communication by inhibitory neurons in neuronal networks.

Science.gov (United States)

Kazantsev, V B; Asatryan, S Yu

2011-09-01

Bistability is one of the important features of nonlinear dynamical systems. In neurodynamics, bistability has been found in basic Hodgkin-Huxley equations describing the cell membrane dynamics. When the neuron is clamped near its threshold, the stable rest potential may coexist with the stable limit cycle describing periodic spiking. However, this effect is often neglected in network computations where the neurons are typically reduced to threshold firing units (e.g., integrate-and-fire models). We found that the bistability may induce spike communication by inhibitory coupled neurons in the spiking network. The communication is realized in the form of episodic discharges with synchronous (correlated) spikes during the episodes. A spiking phase map is constructed to describe the synchronization and to estimate basic spike phase locking modes.

Dynamics of interface in three-dimensional anisotropic bistable reaction-diffusion system

International Nuclear Information System (INIS)

He Zhizhu; Liu, Jing

2010-01-01

This paper presents a theoretical investigation of dynamics of interface (wave front) in three-dimensional (3D) reaction-diffusion (RD) system for bistable media with anisotropy constructed by means of anisotropic surface tension. An equation of motion for the wave front is derived to carry out stability analysis of transverse perturbations, which discloses mechanism of pattern formation such as labyrinthine in 3D bistable media. Particularly, the effects of anisotropy on wave propagation are studied. It was found that, sufficiently strong anisotropy can induce dynamical instabilities and lead to breakup of the wave front. With the fast-inhibitor limit, the bistable system can further be described by a variational dynamics so that the boundary integral method is adopted to study the dynamics of wave fronts.

Excitonic optical bistability in n-type doped semiconductors

International Nuclear Information System (INIS)

Nguyen Ba An; Le Thi Cat Tuong

1991-07-01

A resonant monochromatic pump laser generates coherent excitons in an n-type doped semiconductor. Both exciton-exciton and exciton-donor interactions come into play. The former interaction can give rise to the appearance of optical bistability which is heavily influenced by the latter one. When optical bistability occurs at a fixed laser frequency both its holding intensity and hysteresis loop size are shown to decrease with increasing donor concentration. Two possibilities are suggested for experimentally determining one of the two parameters of the system - the exciton-donor coupling constant and the donor concentration, if the other parameter is known beforehand. (author). 36 refs, 2 figs

Bistability Analysis of Excitatory-Inhibitory Neural Networks in Limited-Sustained-Activity Regime

International Nuclear Information System (INIS)

Ni Yun; Wu Liang; Wu Dan; Zhu Shiqun

2011-01-01

Bistable behavior of neuronal complex networks is investigated in the limited-sustained-activity regime when the network is composed of excitatory and inhibitory neurons. The standard stability analysis is performed on the two metastable states separately. Both theoretical analysis and numerical simulations show consistently that the difference between time scales of excitatory and inhibitory populations can influence the dynamical behaviors of the neuronal networks dramatically, leading to the transition from bistable behaviors with memory effects to the collapse of bistable behaviors. These results may suggest one possible neuronal information processing by only tuning time scales. (interdisciplinary physics and related areas of science and technology)

Nonvolatile conductive filaments resistive switching behaviors in Ag/GaO{sub x} /Nb:SrTiO{sub 3}/Ag structure

Energy Technology Data Exchange (ETDEWEB)

Li, P.G. [Beijing University of Posts and Telecommunications, State Key Laboratory of Information Photonics and Optical Communication, Beijing (China); Zhejiang Sci-Tech University, Center for Optoelectronics Materials and Devices, Hangzhou (China); Zhi, Y.S.; An, Y.H.; Guo, D.Y.; Tang, W.H.; Xiao, J.H. [Beijing University of Posts and Telecommunications, State Key Laboratory of Information Photonics and Optical Communication, Beijing (China); Wang, P.C. [Zhejiang Sci-Tech University, Center for Optoelectronics Materials and Devices, Hangzhou (China); Sun, Z.B. [Chinese Academy of Sciences, Key Laboratory of Electronics and Information Technology for Space Systems, National Space Science Center, Beijing (China); Li, L.H. [State University of New York at Potsdam, Department of Physics, Potsdam, NY (United States)

2016-07-15

Ag/GaO{sub x} /NSTO/Ag structures were fabricated, and the electrical properties measurement results show that the device behaviors a unipolar resistance switching characteristic with bi-stable resistance ratio of three orders. In the positive voltage region, the dominant conducting mechanism of high resistance state obeys Poole-Frenkel emission rules, while in the negative region, that obeys space-charge-limited current mechanism. Both the I-V curves of ON and OFF states and temperature-dependent variation resistances indicate that the unipolar resistance switching behavior can be explained by the formation/rupture of conductive filaments, which composed of oxygen vacancies. The stable switching results demonstrated that the structure can be applied in resistance random access memory devices. (orig.)

Flexible Bistable Cholesteric Reflective Displays

Science.gov (United States)

Yang, Deng-Ke

2006-03-01

Cholesteric liquid crystals (ChLCs) exhibit two stable states at zero field condition-the reflecting planar state and the nonreflecting focal conic state. ChLCs are an excellent candidate for inexpensive and rugged electronic books and papers. This paper will review the display cell structure,materials and drive schemes for flexible bistable cholesteric (Ch) reflective displays.

Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

Directory of Open Access Journals (Sweden)

Dharmesh Harwani

2014-12-01

Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

Science.gov (United States)

Harwani, Dharmesh

2014-01-01

Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

Bistability in a Metabolic Network Underpins the De Novo Evolution of Colony Switching in Pseudomonas fluorescens

DEFF Research Database (Denmark)

Gallie, Jenna; Libby, Eric; Bertels, Frederic

2015-01-01

Phenotype switching is commonly observed in nature. This prevalence has allowed the elucidation of a number of underlying molecular mechanisms. However, little is known about how phenotypic switches arise and function in their early evolutionary stages. The first opportunity to provide empirical ...

Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

Science.gov (United States)

Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

2016-01-01

Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

Cell individuality: the bistable gene expression of the type III secretion system in Dickeya dadantii 3937.

Science.gov (United States)

Zeng, Quan; Laiosa, Michael D; Steeber, Douglas A; Biddle, Eulandria M; Peng, Quan; Yang, Ching-Hong

2012-01-01

Dickeya dadantii 3937 is a gram-negative phytopathogenic bacterium that expresses genes encoding a type III secretion system (T3SS) in a bistable pattern when cultured in a homogeneous minimal media. In this work, we further characterized the bistable gene expression of T3SS at the single-cell level. We demonstrated that bistable expression of the HrpL-regulon genes, such as hrpA and hrpN, is controlled by the same regulatory mechanism. We also showed that the expression level of the T3SS master regulatory gene hrpL plays an important role in the development of the bistable expression of hrpA. A high expression level of hrpL is required but unable to guarantee the high-state expression of hrpA in a cell. In addition, bistable expression patterns of T3SS genes in other gram-negative pathogens of the Enterobacteriaceae and Pseudomonadaceae families were also described in this study. This suggests that the T3SS bistability might be a conserved population behavior in several gram-negative bacterial pathogens.

Innovative Energy Harvester Design Using Bistable Mechanism With Compensational Springs In Gravity Field

International Nuclear Information System (INIS)

Vysotskyi, Bogdan; Parrain, Fabien; Lefeuvre, Elie; Aubry, Denis; Gaucher, Philippe

2016-01-01

The purpose of the presented work is to introduce the novel design of electrostatic energy harvester using bistable mechanism with compensational springs in gravity field capable of providing the output of several μW under the excitation of extremely small amplitude (up to 0.2g) and low frequency (10-100Hz). Presented energy harvester uses the bistable hysteresis modification to achieve low-frequency low-amplitude sensibility. It was demonstrated with finite element modelling (FEM) that hysteresis width produced by bistability is changing with a constant linear coefficient as a function of a compensational spring stiffness and thus a device sensitivity could be adjusted to the minimum point for the amplitude of external excitation. Further, highly non-linear bistable double curved beam mechanism assures the high sensitivity in frequencial domain due to the non-defined bandwidth. The equivalent circuit technique is used for simulating the device performance. (paper)

Conditional bistability, a generic cellular mnemonic mechanism for robust and flexible working memory computations.

Science.gov (United States)

Rodriguez, Guillaume; Sarazin, Matthieu; Clemente, Alexandra; Holden, Stephanie; Paz, Jeanne T; Delord, Bruno

2018-04-30

Persistent neural activity, the substrate of working memory, is thought to emerge from synaptic reverberation within recurrent networks. However, reverberation models do not robustly explain fundamental dynamics of persistent activity, including high-spiking irregularity, large intertrial variability, and state transitions. While cellular bistability may contribute to persistent activity, its rigidity appears incompatible with persistent activity labile characteristics. Here, we unravel in a cellular model a form of spike-mediated conditional bistability that is robust, generic and provides a rich repertoire of mnemonic computations. Under asynchronous synaptic inputs of the awakened state, conditional bistability generates spiking/bursting episodes, accounting for the irregularity, variability and state transitions characterizing persistent activity. This mechanism has likely been overlooked because of the sub-threshold input it requires and we predict how to assess it experimentally. Our results suggest a reexamination of the role of intrinsic properties in the collective network dynamics responsible for flexible working memory. SIGNIFICANCE STATEMENT This study unravels a novel form of intrinsic neuronal property, i.e. conditional bistability. We show that, thanks of its conditional character, conditional bistability favors the emergence of flexible and robust forms of persistent activity in PFC neural networks, in opposition to previously studied classical forms of absolute bistability. Specifically, we demonstrate for the first time that conditional bistability 1) is a generic biophysical spike-dependent mechanism of layer V pyramidal neurons in the PFC and that 2) it accounts for essential neurodynamical features for the organisation and flexibility of PFC persistent activity (the large irregularity and intertrial variability of the discharge and its organization under discrete stable states), which remain unexplained in a robust fashion by current models

Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

Directory of Open Access Journals (Sweden)

Catherine E Dana

Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

Possible hysteresis loops of resonatorless optical bistability

International Nuclear Information System (INIS)

Nguyen Ba An; Le Thi Cat Tuong.

1990-05-01

We qualitatively show that hysteresis loops of intrinsic optical bistability phenomena without any additional feedback may be of various shapes including those of a butterfly and a three-winged bow. (author). 15 refs, 4 figs

Optical nonlinearity and bistability in the bound exciton energy range of CdS

International Nuclear Information System (INIS)

Hoenig, T.; Gutowski, J.

1988-01-01

Under high excitation conditions thick CdS samples show pronounced broad-band nonlinear transmission in the bound exciton region and up to a wavelength of about 515 nm at cryo-temperatures. This behavior is only explainable in a model based on impurity neutralization and bound exciton creation. The suitability of these nonlinearities to yield optical bistability will be shown. Bistable operation is investigated in dependence of crystal thickness, impurity concentration, excitation density, wavelength, and temperature. A strong correlation to acceptor-bound exciton generation is obtained, and the explanation of this bistable operation fits well with that of the above mentioned transmission behavior. (author)

Voltage-induced switching with magnetoresistance signature in magnetic nano-filaments

International Nuclear Information System (INIS)

Sokolov, A; Sabirianov, I; Sabirianov, R; Doudin, B

2009-01-01

Large hysteretic resistance changes are reported on sub-100 nm diameter metallic nanowires including thin dielectric junctions. Bi-stable 50% switching in a double junction geometry is modeled in terms of an occupation-driven metal-insulator transition in one of the two junctions, using the generalized Poisson expressions of Oka and Nagaosa (2005 Phys. Rev. Lett. 95 266403). It illustrates how a band bending scheme can be generalized for strongly correlated electron systems. The magnetic constituents of the nanowires provide a magnetoresistive signature of the two resistance states, confirming our model and enabling a four states device application.

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

Dynamics and control of twisting bi-stable structures

Science.gov (United States)

Arrieta, Andres F.; van Gemmeren, Valentin; Anderson, Aaron J.; Weaver, Paul M.

2018-02-01

Compliance-based morphing structures have the potential to offer large shape adaptation, high stiffness and low weight, while reducing complexity, friction, and scalability problems of mechanism based systems. A promising class of structure that enables these characteristics are multi-stable structures given their ability to exhibit large deflections and rotations without the expensive need for continuous actuation, with the latter only required intermittently. Furthermore, multi-stable structures exhibit inherently fast response due to the snap-through instability governing changes between stable states, enabling rapid configuration switching between the discrete number of programmed shapes of the structure. In this paper, the design and utilisation of the inherent nonlinear dynamics of bi-stable twisting I-beam structures for actuation with low strain piezoelectric materials is presented. The I-beam structure consists of three compliant components assembled into a monolithic single element, free of moving parts, and showing large deflections between two stable states. Finite element analysis is utilised to uncover the distribution of strain across the width of the flange, guiding the choice of positioning for piezoelectric actuators. In addition, the actuation authority is maximised by calculating the generalised coupling coefficient for different positions of the piezoelectric actuators. The results obtained are employed to tailor and test I-beam designs exhibiting desired large deflection between stable states, while still enabling the activation of snap-through with the low strain piezoelectric actuators. To this end, the dynamic response of the I-beams to piezoelectric excitation is investigated, revealing that resonant excitations are insufficient to dynamically trigger snap-through. A novel bang-bang control strategy, which exploits the nonlinear dynamics of the structure successfully triggers both single and constant snap-through between the stable states

Flexible Bistable Smectic-A Liquid Crystal Device Using Photolithography and Photoinduced Phase Separation

Directory of Open Access Journals (Sweden)

Yang Lu

2012-01-01

Full Text Available A flexible bistable smectic-A liquid crystal (SmA LC device using pixel-isolated mode was demonstrated, in which SmA LC molecules were isolated in pixels by vertical polymer wall and horizontal polymer layer. The above microstructure was achieved by using ultraviolet (UV photolithography and photoinduced phase separation. The polymer wall was fabricated by photolithography, and then the SmA LC was encapsulated in pixels between polymer wall through UV-induced phase separation, in which the polymer wall acts as supporting structure from mechanical pressure and maintains the cell gap from bending, and the polymer layer acts as adhesive for tight attachment of two substrates. The results demonstrated that all the intrinsic bistable properties of the SmA LC are preserved, and good electrooptical characteristics such as high contrast ratio and excellent stability of the bistable states were characterized. This kind of SmA bistable flexible display has high potential to be used as electronic paper, smart switchable reflective windows, and so forth.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

Bistable flapping of flexible flyers in oscillatory flow

Science.gov (United States)

Huang, Yangyang; Kanso, Eva

2016-11-01

Biological and bio-inspired flyers move by shape actuation. The direct control of shape variables for locomotory purposes is well studied. Less is known about indirect shape actuation via the fluid medium. Here, we consider a flexible Λ-flyer in oscillatory flow that is free to flap and rotate around its fixed apex. We study its motion in the context of the inviscid vortex sheet model. We first analyze symmetric flapping about the vertical axis of gravity. We find that there is a finite value of the flexibility that maximizes both the flapping amplitude and elastic energy storage. Our results show that rather than resonance, the flyer relies on fluidic effects to optimize these two quantities. We then perturb the flyer away from the vertical and analyze its stability. Four distinct types of rolling behavior are identified: mono-stable, bistable, bistable oscillatory rotations and chaotic dynamics. We categorize these types of behavior in terms of the flyer's and flow parameters. In particular, the transition from mono-stable to bistable behavior occurs at a constant value of the product of the flow amplitude and acceleration. This product can be interpreted as the ratio of fluidic drag to gravity, confirming the fluid role in this transition.

Brain mechanisms for simple perception and bistable perception.

Science.gov (United States)

Wang, Megan; Arteaga, Daniel; He, Biyu J

2013-08-27

When faced with ambiguous sensory inputs, subjective perception alternates between the different interpretations in a stochastic manner. Such multistable perception phenomena have intrigued scientists and laymen alike for over a century. Despite rigorous investigations, the underlying mechanisms of multistable perception remain elusive. Recent studies using multivariate pattern analysis revealed that activity patterns in posterior visual areas correlate with fluctuating percepts. However, increasing evidence suggests that vision--and perception at large--is an active inferential process involving hierarchical brain systems. We applied searchlight multivariate pattern analysis to functional magnetic resonance imaging signals across the human brain to decode perceptual content during bistable perception and simple unambiguous perception. Although perceptually reflective activity patterns during simple perception localized predominantly to posterior visual regions, bistable perception involved additionally many higher-order frontoparietal and temporal regions. Moreover, compared with simple perception, both top-down and bottom-up influences were dramatically enhanced during bistable perception. We further studied the intermittent presentation of ambiguous images--a condition that is known to elicit perceptual memory. Compared with continuous presentation, intermittent presentation recruited even more higher-order regions and was accompanied by further strengthened top-down influences but relatively weakened bottom-up influences. Taken together, these results strongly support an active top-down inferential process in perception.

Metastable and bistable defects in silicon

International Nuclear Information System (INIS)

Mukashev, Bulat N; Abdullin, Kh A; Gorelkinskii, Yurii V

2000-01-01

Existing data on the properties and structure of metastable and bistable defects in silicon are analyzed. Primary radiation-induced defects (vacancies, self-interstitial atoms, and Frenkel pairs), complexes of oxygen, carbon, hydrogen, and other impurity atoms and defects with negative correlation energy are considered. (reviews of topical problems)

Intrinsic Noise Profoundly Alters the Dynamics and Steady State of Morphogen-Controlled Bistable Genetic Switches.

Directory of Open Access Journals (Sweden)

Ruben Perez-Carrasco

2016-10-01

Full Text Available During tissue development, patterns of gene expression determine the spatial arrangement of cell types. In many cases, gradients of secreted signalling molecules-morphogens-guide this process by controlling downstream transcriptional networks. A mechanism commonly used in these networks to convert the continuous information provided by the gradient into discrete transitions between adjacent cell types is the genetic toggle switch, composed of cross-repressing transcriptional determinants. Previous analyses have emphasised the steady state output of these mechanisms. Here, we explore the dynamics of the toggle switch and use exact numerical simulations of the kinetic reactions, the corresponding Chemical Langevin Equation, and Minimum Action Path theory to establish a framework for studying the effect of gene expression noise on patterning time and boundary position. This provides insight into the time scale, gene expression trajectories and directionality of stochastic switching events between cell states. Taking gene expression noise into account predicts that the final boundary position of a morphogen-induced toggle switch, although robust to changes in the details of the noise, is distinct from that of the deterministic system. Moreover, the dramatic increase in patterning time close to the boundary predicted from the deterministic case is substantially reduced. The resulting stochastic switching introduces differences in patterning time along the morphogen gradient that result in a patterning wave propagating away from the morphogen source with a velocity determined by the intrinsic noise. The wave sharpens and slows as it advances and may never reach steady state in a biologically relevant time. This could explain experimentally observed dynamics of pattern formation. Together the analysis reveals the importance of dynamical transients for understanding morphogen-driven transcriptional networks and indicates that gene expression noise can

Intrinsic Noise Profoundly Alters the Dynamics and Steady State of Morphogen-Controlled Bistable Genetic Switches

Science.gov (United States)

Page, Karen M.

2016-01-01

During tissue development, patterns of gene expression determine the spatial arrangement of cell types. In many cases, gradients of secreted signalling molecules—morphogens—guide this process by controlling downstream transcriptional networks. A mechanism commonly used in these networks to convert the continuous information provided by the gradient into discrete transitions between adjacent cell types is the genetic toggle switch, composed of cross-repressing transcriptional determinants. Previous analyses have emphasised the steady state output of these mechanisms. Here, we explore the dynamics of the toggle switch and use exact numerical simulations of the kinetic reactions, the corresponding Chemical Langevin Equation, and Minimum Action Path theory to establish a framework for studying the effect of gene expression noise on patterning time and boundary position. This provides insight into the time scale, gene expression trajectories and directionality of stochastic switching events between cell states. Taking gene expression noise into account predicts that the final boundary position of a morphogen-induced toggle switch, although robust to changes in the details of the noise, is distinct from that of the deterministic system. Moreover, the dramatic increase in patterning time close to the boundary predicted from the deterministic case is substantially reduced. The resulting stochastic switching introduces differences in patterning time along the morphogen gradient that result in a patterning wave propagating away from the morphogen source with a velocity determined by the intrinsic noise. The wave sharpens and slows as it advances and may never reach steady state in a biologically relevant time. This could explain experimentally observed dynamics of pattern formation. Together the analysis reveals the importance of dynamical transients for understanding morphogen-driven transcriptional networks and indicates that gene expression noise can qualitatively

Large Out-of-Plane Displacement Bistable Electromagnetic Microswitch on a Single Wafer.

Science.gov (United States)

Miao, Xiaodan; Dai, Xuhan; Huang, Yi; Ding, Guifu; Zhao, Xiaolin

2016-05-05

This paper presents a bistable microswitch fully batch-fabricated on a single glass wafer, comprising of a microactuator, a signal transformer, a microspring and a permanent magnet. The bistable mechanism of the microswitch with large displacement of 160 μm depends on the balance of the magnetic force and elastic force. Both the magnetic force and elastic force were optimized by finite-element simulation to predict the reliable of the device. The prototype was fabricated and characterized. By utilizing thick laminated photoresist sacrificial layer, the large displacement was obtained to ensure the insulation of the microswitch. The testing results show that the microswitch realized the bistable mechanism at a 3-5 V input voltage and closed in 0.96 ms, which verified the simulation.

Configurational rearrangements of bistable centers in covalent semiconductors - phase transitions of the second type

International Nuclear Information System (INIS)

Ivanyukovich, V.A.; Karas', V.I.; Lomako, V.M.

1989-01-01

A new radiation configurational-bistable defect diffring from the known similar defects by the fact that it possessestemperature inversion of states is detected in gallium arsenide. Configurational-bistable rearrangements are shown to be considered as phase transitions of the second type

UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

International Nuclear Information System (INIS)

Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

1994-01-01

UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

Bistable diverter valve in microfluidics

Czech Academy of Sciences Publication Activity Database

Tesař, Václav; Bandulasena, H.C.H.

2011-01-01

Roč. 50, č. 5 (2011), s. 1225-1233 ISSN 0723-4864 R&D Projects: GA ČR GA101/07/1499; GA AV ČR IAA200760705 Institutional research plan: CEZ:AV0Z20760514 Keywords : fluidics * bistable diverter valves * pressure-driven microfluidics Subject RIV: BK - Fluid Dynamics Impact factor: 1.735, year: 2011 http://www.springerlink.com/content/x4907p1908151522/

Experimental chaotic quantification in bistable vortex induced vibration systems

Science.gov (United States)

Huynh, B. H.; Tjahjowidodo, T.

2017-02-01

The study of energy harvesting by means of vortex induced vibration systems has been initiated a few years ago and it is considered to be potential as a low water current energy source. The energy harvester is realized by exposing an elastically supported blunt structure under water flow. However, it is realized that the system will only perform at a limited operating range (water flow) that is attributed to the resonance phenomenon that occurs only at a frequency that corresponds to the fluid flow. An introduction of nonlinear elements seems to be a prominent solution to overcome the problem. Among many nonlinear elements, a bistable spring is known to be able to improve the harvested power by a vortex induced vibrations (VIV) based energy converter at the low velocity water flows. However, it is also observed that chaotic vibrations will occur at different operating ranges that will erratically diminish the harvested power and cause a difficulty in controlling the system that is due to the unpredictability in motions of the VIV structure. In order to design a bistable VIV energy converter with improved harvested power and minimum negative effect of chaotic vibrations, the bifurcation map of the system for varying governing parameters is highly on demand. In this study, chaotic vibrations of a VIV energy converter enhanced by a bistable stiffness element are quantified in a wide range of the governing parameters, i.e. damping and bistable gap. Chaotic vibrations of the bistable VIV energy converter are simulated by utilization of a wake oscillator model and quantified based on the calculation of the Lyapunov exponent. Ultimately, a series of experiments of the system in a water tunnel, facilitated by a computer-based force-feedback testing platform, is carried out to validate the existence of chaotic responses. The main challenge in dealing with experimental data is in distinguishing chaotic response from noise-contaminated periodic responses as noise will smear

Air-stable memory array of bistable rectifying diodes based on ferroelectric-semiconductor polymer blends

Science.gov (United States)

Kumar, Manasvi; Sharifi Dehsari, Hamed; Anwar, Saleem; Asadi, Kamal

2018-03-01

Organic bistable diodes based on phase-separated blends of ferroelectric and semiconducting polymers have emerged as promising candidates for non-volatile information storage for low-cost solution processable electronics. One of the bottlenecks impeding upscaling is stability and reliable operation of the array in air. Here, we present a memory array fabricated with an air-stable amine-based semiconducting polymer. Memory diode fabrication and full electrical characterizations were carried out in atmospheric conditions (23 °C and 45% relative humidity). The memory diodes showed on/off ratios greater than 100 and further exhibited robust and stable performance upon continuous write-read-erase-read cycles. Moreover, we demonstrate a 4-bit memory array that is free from cross-talk with a shelf-life of several months. Demonstration of the stability and reliable air operation further strengthens the feasibility of the resistance switching in ferroelectric memory diodes for low-cost applications.

Cop-like operon: Structure and organization in species of the Lactobacillale order

Directory of Open Access Journals (Sweden)

ANGÉLICA REYES

2006-01-01

Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

Excitonic bistabilities, instabilities and chaos in laser-pumped semiconductor

International Nuclear Information System (INIS)

Nguyen Ba An; Nguyen Trung Dan; Hoang Xuan Nguyen

1992-07-01

The Hurwitz criteria are used for a stability analysis of the steady state excitonic optical bistability curves in a semiconductor pumped by an external laser resonant with the exciton level. Besides the middle branch of the bistability curves which is unstable in the sense of the linear stability theory, we have found other domains of instability in the upper and lower branches of the steady state curves. Numerical results show that a possible route to chaos in the photon-exciton system is period-doubling self-oscillation process. The influence of the presence of free carriers that coexist with the excitons is also discussed. (author). 16 refs, 6 figs

Influence of Fano interference and incoherent processes on optical bistability in a four-level quantum dot nanostructure

International Nuclear Information System (INIS)

Hossein Asadpour, Seyyed; Solookinejad, G; Panahi, M; Ahmadi Sangachin, E

2016-01-01

Role of Fano interference and incoherent pumping field on optical bistability in a four-level designed InGaN/GaN quantum dot nanostructure embedded in a unidirectional ring cavity are analyzed. It is found that intensity threshold of optical bistability can be manipulated by Fano interference. It is shown that incoherent pumping fields make the threshold of optical bistability behave differently by Fano interference. Moreover, in the presence of Fano interference the medium becomes phase-dependent. Therefore, the relative phase of applied fields can affect the behaviors of optical bistability and intensity threshold can be controlled easily. (paper)

Elucidation of Operon Structures across Closely Related Bacterial Genomes

Science.gov (United States)

Li, Guojun

2014-01-01

About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

Extensively Reversible Thermal Transformations of a Bistable, Fluorescence-Switchable Molecular Solid: Entry into Functional Molecular Phase-Change Materials.

Science.gov (United States)

Srujana, P; Radhakrishnan, T P

2015-06-15

Functional phase-change materials (PCMs) are conspicuously absent among molecular materials in which the various attributes of inorganic solids have been realized. While organic PCMs are primarily limited to thermal storage systems, the amorphous-crystalline transformation of materials like Ge-Sb-Te find use in advanced applications such as information storage. Reversible amorphous-crystalline transformations in molecular solids require a subtle balance between robust supramolecular assembly and flexible structural elements. We report novel diaminodicyanoquinodimethanes that achieve this transformation by interlinked helical assemblies coupled with conformationally flexible alkoxyalkyl chains. They exhibit highly reversible thermal transformations between bistable (crystalline/amorphous) forms, along with a prominent switching of the fluorescence emission energy and intensity. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Durable bistable auxetics made of rigid solids

Science.gov (United States)

Shang, Xiao; Liu, Lu; Rafsanjani, Ahmad; Pasini, Damiano

2018-02-01

Bistable Auxetic Metamaterials (BAMs) are a class of monolithic perforated periodic structures with negative Poisson's ratio. Under tension, a BAM can expand and reach a second state of equilibrium through a globally large shape transformation that is ensured by the flexibility of its elastomeric base material. However, if made from a rigid polymer, or metal, BAM ceases to function due to the inevitable rupture of its ligaments. The goal of this work is to extend the unique functionality of the original kirigami architecture of BAM to a rigid solid base material. We use experiments and numerical simulations to assess performance, bistability and durability of rigid BAMs at 10,000 cycles. Geometric maps are presented to elucidate the role of the main descriptors of BAM architecture. The proposed design enables the realization of BAM from a large palette of materials, including elastic-perfectly plastic materials and potentially brittle materials.

Nonlinear Raman spectroscopy of liquid crystals: orientational alignment and switching behaviour in a ferroelectric liquid crystal mixture

Science.gov (United States)

Grofcsik, Andras

Picosecond inverse Raman spectroscopy has been employed to probe the alignment behaviour and switching characteristics of a 6 mum thick ferroelectric liquid crystal based on a host mixture of fluorinated phenyl biphenylcarboxylates and a chiral dopant. Optical bistability is observed in the Raman signal on application of dc electric fields of opposite polarity. For particular polarities of the applied field, the Raman signals display a cos4theta dependence on the angle of rotation around the beam direction. Reorientational rate constants of 300 mus and 590 mus are observed for the aromatic core at the high-voltage limit for the rise and decay of the 1600 cm-1 Raman signal on application of a switching ac electric field.

The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

Science.gov (United States)

Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

2015-03-17

Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

Science.gov (United States)

Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

2014-01-01

The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

Effects of Transverse Magnetic Anisotropy on Current-Induced Spin Switching

Science.gov (United States)

Misiorny, Maciej; Barnaś, Józef

2013-07-01

Spin-polarized transport through bistable magnetic adatoms or single-molecule magnets (SMMs), which exhibit both uniaxial and transverse magnetic anisotropy, is considered theoretically. The main focus is on the impact of transverse anisotropy on transport characteristics and the adatom’s or SMM’s spin. In particular, we analyze the role of quantum tunneling of magnetization (QTM) in the mechanism of the current-induced spin switching, and show that the QTM phenomenon becomes revealed as resonant peaks in the average values of the molecule’s spin and in the charge current. These features appear at some resonant fields and are observable when at least one of the electrodes is ferromagnetic.

Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

Science.gov (United States)

Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

2011-10-01

Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

Coupling-induced oscillations in nonhomogeneous, overdamped, bistable systems

International Nuclear Information System (INIS)

Hernandez, Mayra; In, Visarath; Longhini, Patrick; Palacios, Antonio; Bulsara, Adi; Kho, Andy

2008-01-01

Coupling-induced oscillations in a homogeneous network of overdamped bistable systems have been previously studied both theoretically and experimentally for a system of N (odd) elements, unidirectionally coupled in a ring topology. In this work, we extend the analysis of this system to include a network of nonhomogeneous elements with respect to the parameter that controls the topology of the potential function and the bistability of each element. In particular, we quantify the effects of the nonhomogeneity on the onset of oscillations and the response of the network to external (assumed to be constant and very small) perturbations, using our (recently developed) coupled core fluxgate magnetometer as a representative system. The potential applications of this work include signal detection and characterization for a large class of sensor systems

Coupling-induced oscillations in nonhomogeneous, overdamped, bistable systems

Energy Technology Data Exchange (ETDEWEB)

Hernandez, Mayra [Nonlinear Dynamical Systems Group, Department of Mathematics and Statistics, San Diego State University, San Diego, CA 92182 (United States)], E-mail: mayra.alina@yahoo.com; In, Visarath [Space and Naval Warfare Systems Center, Code 71730, 53560 Hull Street, San Diego, CA 92152-5001 (United States)], E-mail: visarath.in@navy.mil; Longhini, Patrick [Space and Naval Warfare Systems Center, Code 71730, 53560 Hull Street, San Diego, CA 92152-5001 (United States)], E-mail: longhini@navy.mil; Palacios, Antonio [Nonlinear Dynamical Systems Group, Department of Mathematics and Statistics, San Diego State University, San Diego, CA 92182 (United States)], E-mail: palacios@euler.sdsu.edu; Bulsara, Adi [Space and Naval Warfare Systems Center, Code 71730, 53560 Hull Street, San Diego, CA 92152-5001 (United States)], E-mail: bulsara@spawar.navy.mil; Kho, Andy [Space and Naval Warfare Systems Center, Code 71730, 53560 Hull Street, San Diego, CA 92152-5001 (United States)], E-mail: kho@spawar.navy.mil

2008-06-09

Coupling-induced oscillations in a homogeneous network of overdamped bistable systems have been previously studied both theoretically and experimentally for a system of N (odd) elements, unidirectionally coupled in a ring topology. In this work, we extend the analysis of this system to include a network of nonhomogeneous elements with respect to the parameter that controls the topology of the potential function and the bistability of each element. In particular, we quantify the effects of the nonhomogeneity on the onset of oscillations and the response of the network to external (assumed to be constant and very small) perturbations, using our (recently developed) coupled core fluxgate magnetometer as a representative system. The potential applications of this work include signal detection and characterization for a large class of sensor systems.

A computational role for bistability and traveling waves in motor cortex

Directory of Open Access Journals (Sweden)

Stewart eHeitmann

2012-09-01

Full Text Available Adaptive changes in behavior require rapid changes in brain states yet the brain must also remain stable. We investigated two neural mechanisms for evoking rapid transitions between spatiotemporal synchronization patterns of beta oscillations (13--30Hz in motor cortex. Cortex was modeled as a sheet of neural oscillators that were spatially coupled using a center-surround connection topology. Manipulating the inhibitory surround was found to evoke reliable transitions between synchronous oscillation patterns and traveling waves. These transitions modulated the simulated local field potential in agreement with physiological observations in humans. Intermediate levels of surround inhibition were also found to produce bistable coupling topologies that supported both waves and synchrony. State-dependent perturbation between bistable states produced very rapid transitions but were less reliable. We surmise that motor cortex may thus employ state-dependent computation to achieve very rapid changes between bistable motor states when the demand for speed exceeds the demand for accuracy.

Internal optical bistability of quasi-two-dimensional semiconductor nanoheterostructures

Science.gov (United States)

Derevyanchuk, Oleksandr V.; Kramar, Natalia K.; Kramar, Valeriy M.

2018-01-01

We represent the results of numerical computations of the frequency and temperature domains of possible realization of internal optical bistability in flat quasi-two-dimensional semiconductor nanoheterostructures with a single quantum well (i.e., nanofilms). Particular computations have been made for a nanofilm of layered semiconductor PbI2 embedded in dielectric medium, i.e. ethylene-methacrylic acid (E-MAA) copolymer. It is shown that an increase in the nanofilm's thickness leads to a long-wave shift of the frequency range of the manifestation the phenomenon of bistability, to increase the size of the hysteresis loop, as well as to the expansion of the temperature interval at which the realization of this phenomenon is possible.

Interplay of Multisensory Processing, Attention, and Consciousness as Revealed by Bistable Figures

Directory of Open Access Journals (Sweden)

Su-Ling Yeh

2011-10-01

Full Text Available We examined the novel crossmodal semantic congruency effect on bistable figures in which a static stimulus gives rise to two competing percepts that alternate over time. Participants viewed the bistable figure “my wife or my mother-in-law” while listening to the voice of an old woman or a young lady speaking in an unfamiliar language. They had to report whether they saw the old woman, the young lady, or a mixed percept. Robust crossmodal semantic congruency effects in the measures of the first percept and the predominance duration were observed. The possibilities that the participants simply responded to, and/or that they fixed at the location in favor of, the percept congruent with the sound that they happened to hear were ruled out. When the participants were instructed to maintain their attention to a specific view, a strong top-down modulation on the perception of bistable figure was observed, although the audiovisual semantic congruency effect still remained. These results thus demonstrate that top-down attention (ie,, selection and/or voluntary control modulates the audiovisual semantic congruency effect. As the alternating percepts in bistable figures indicate competition for conscious perception, this study has important implications for the multifaceted interactions between multisensory processing, attention, and consciousness.

Dynamic model of gene regulation for the lac operon

International Nuclear Information System (INIS)

Angelova, Maia; Ben-Halim, Asma

2011-01-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

Dynamic model of gene regulation for the lac operon

Energy Technology Data Exchange (ETDEWEB)

Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

2011-03-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

A Bistable Circuit Involving SCARECROW-RETINOBLASTOMA Integrates Cues to Inform Asymmetric Stem Cell Division

Science.gov (United States)

Cruz-Ramírez, Alfredo; Díaz-Triviño, Sara; Blilou, Ikram; Grieneisen, Verônica A.; Sozzani, Rosangela; Zamioudis, Christos; Miskolczi, Pál; Nieuwland, Jeroen; Benjamins, René; Dhonukshe, Pankaj; Caballero-Pérez, Juan; Horvath, Beatrix; Long, Yuchen; Mähönen, Ari Pekka; Zhang, Hongtao; Xu, Jian; Murray, James A.H.; Benfey, Philip N.; Bako, Laszlo; Marée, Athanasius F.M.; Scheres, Ben

2012-01-01

SUMMARY In plants, where cells cannot migrate, asymmetric cell divisions (ACDs) must be confined to the appropriate spatial context. We investigate tissue-generating asymmetric divisions in a stem cell daughter within the Arabidopsis root. Spatial restriction of these divisions requires physical binding of the stem cell regulator SCARECROW (SCR) by the RETINOBLASTOMA-RELATED (RBR) protein. In the stem cell niche, SCR activity is counteracted by phosphorylation of RBR through a cyclinD6;1-CDK complex. This cyclin is itself under transcriptional control of SCR and its partner SHORT ROOT (SHR), creating a robust bistable circuit with either high or low SHR-SCR complex activity. Auxin biases this circuit by promoting CYCD6;1 transcription. Mathematical modeling shows that ACDs are only switched on after integration of radial and longitudinal information, determined by SHR and auxin distribution, respectively. Coupling of cell-cycle progression to protein degradation resets the circuit, resulting in a “flip flop” that constrains asymmetric cell division to the stem cell region. PMID:22921914

Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

Science.gov (United States)

Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

2017-10-01

One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

Heat dissipation and information flow for delayed bistable Langevin systems near coherence resonance.

Science.gov (United States)

Xiao, Tiejun

2016-11-01

In this paper, stochastic thermodynamics of delayed bistable Langevin systems near coherence resonance is discussed. We calculate the heat dissipation rate and the information flow of a delayed bistable Langevin system under various noise intensities. Both the heat dissipation rate and the information flow are found to be bell-shaped functions of the noise intensity, which implies that coherence resonance manifests itself in the thermodynamic properties.

A minimal model of burst-noise induced bistability.

Directory of Open Access Journals (Sweden)

Johannes Falk

Full Text Available We investigate the influence of intrinsic noise on stable states of a one-dimensional dynamical system that shows in its deterministic version a saddle-node bifurcation between monostable and bistable behaviour. The system is a modified version of the Schlögl model, which is a chemical reaction system with only one type of molecule. The strength of the intrinsic noise is varied without changing the deterministic description by introducing bursts in the autocatalytic production step. We study the transitions between monostable and bistable behavior in this system by evaluating the number of maxima of the stationary probability distribution. We find that changing the size of bursts can destroy and even induce saddle-node bifurcations. This means that a bursty production of molecules can qualitatively change the dynamics of a chemical reaction system even when the deterministic description remains unchanged.

Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

Science.gov (United States)

Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

2016-09-01

The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

Prevalence of transcription promoters within archaeal operons and coding sequences.

Science.gov (United States)

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

Experimental Analysis of a Coupled Energy Harvesting System with Monostable and Bistable Configuration

International Nuclear Information System (INIS)

Hoffmann, D; Folkmer, B; Manoli, Y

2014-01-01

In this paper we present experimental results from an energy harvesting system with two coupled energy harvesters. The energy conversion mechanism of the two coupled energy harvesters is based on the electromagnetic principle. The coupling is generated by two magnets in a repulsive arrangement. In this manner a bistable configuration can be obtained if the gap between the magnets is sufficiently small. We demonstrate that the total power output can be increased in comparison to a linear reference system, if specific conditions are fulfilled. In this respect, the highest power output occurs in the nonlinear region of a monostable system configuration, mostly near the transition to a bistable configuration. On the other hand, the results also indicate, that a bistable operating mode does not necessarily enhance the power output of the coupled system

Topical Meeting on Optical Bistability Held at Rochester, New York on 15-17 June 1983.

Science.gov (United States)

1983-01-01

ThB16-1 SELF-BEATING INSTABILITIES IN BISTABLE DEVICES J.A. MARTIN-PEREDA .. M.A. MURIEL DEPARTAMENTO DE ELECTRONICA CUANTICA E.T.S. ING...OPTICAL BISTABLL SYSTEMS J.A. MARTIN PEREDA M.A. MURIEL ; DEPARTAMENIO DE ELECTRONICA CUANTICA E.T.S. ING. TELLCOMUNICACION UNIVERSIDAD POLITECNICA DE

An Optically Driven Bistable Janus Rotor with Patterned Metal Coatings.

Science.gov (United States)

Zong, Yiwu; Liu, Jing; Liu, Rui; Guo, Honglian; Yang, Mingcheng; Li, Zhiyuan; Chen, Ke

2015-11-24

Bistable rotation is realized for a gold-coated Janus colloidal particle in an infrared optical trap. The metal coating on the Janus particles are patterned by sputtering gold on a monolayer of closely packed polystyrene particles. The Janus particle is observed to stably rotate in an optical trap. Both the direction and the rate of rotation can be experimentally controlled. Numerical calculations reveal that the bistable rotation is the result of spontaneous symmetry breaking induced by the uneven curvature of the coating patterns on the Janus sphere. Our results thus provide a simple method to construct large quantities of fully functional rotary motors for nano- or microdevices.

Mathematical modeling of Myosin induced bistability of Lamellipodial fragments.

Science.gov (United States)

Hirsch, S; Manhart, A; Schmeiser, C

2017-01-01

For various cell types and for lamellipodial fragments on flat surfaces, externally induced and spontaneous transitions between symmetric nonmoving states and polarized migration have been observed. This behavior is indicative of bistability of the cytoskeleton dynamics. In this work, the Filament Based Lamellipodium Model (FBLM), a two-dimensional, anisotropic, two-phase continuum model for the dynamics of the actin filament network in lamellipodia, is extended by a new description of actin-myosin interaction. For appropriately chosen parameter values, the resulting model has bistable dynamics with stable states showing the qualitative features observed in experiments. This is demonstrated by numerical simulations and by an analysis of a strongly simplified version of the FBLM with rigid filaments and planar lamellipodia at the cell front and rear.

clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

Science.gov (United States)

Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

2015-03-01

The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

NATO Advanced Research Workshop on Optical Switching in Low-Dimensional Systems

CERN Document Server

Bányai, L

1989-01-01

This book contains all the papers presented at the NATO workshop on "Optical Switching in Low Dimensional Systems" held in Marbella, Spain from October 6th to 8th, 1988. Optical switching is a basic function for optical data processing, which is of technological interest because of its potential parallelism and its potential speed. Semiconductors which exhibit resonance enhanced optical nonlinearities in the frequency range close to the band edge are the most intensively studied materials for optical bistability and fast gate operation. Modern crystal growth techniques, particularly molecular beam epitaxy, allow the manufacture of semiconductor microstructures such as quantum wells, quantum wires and quantum dots in which the electrons are only free to move in two, one or zero dimensions, of the optically excited electron-hole pairs in these low respectively. The spatial confinement dimensional structures gives rise to an enhancement of the excitonic nonlinearities. Furthermore, the variations of the microstr...

rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

Science.gov (United States)

Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

2016-01-01

The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

Traveling and Pinned Fronts in Bistable Reaction-Diffusion Systems on Networks

Science.gov (United States)

Kouvaris, Nikos E.; Kori, Hiroshi; Mikhailov, Alexander S.

2012-01-01

Traveling fronts and stationary localized patterns in bistable reaction-diffusion systems have been broadly studied for classical continuous media and regular lattices. Analogs of such non-equilibrium patterns are also possible in networks. Here, we consider traveling and stationary patterns in bistable one-component systems on random Erdös-Rényi, scale-free and hierarchical tree networks. As revealed through numerical simulations, traveling fronts exist in network-organized systems. They represent waves of transition from one stable state into another, spreading over the entire network. The fronts can furthermore be pinned, thus forming stationary structures. While pinning of fronts has previously been considered for chains of diffusively coupled bistable elements, the network architecture brings about significant differences. An important role is played by the degree (the number of connections) of a node. For regular trees with a fixed branching factor, the pinning conditions are analytically determined. For large Erdös-Rényi and scale-free networks, the mean-field theory for stationary patterns is constructed. PMID:23028746

Optical bistability in a single-sided cavity coupled to a quantum channel

Science.gov (United States)

Payravi, M.; Solookinejad, Gh; Jabbari, M.; Nafar, M.; Ahmadi Sangachin, E.

2018-06-01

In this paper, we discuss the long wavelength optical reflection and bistable behavior of an InGaN/GaN quantum dot nanostructure coupled to a single-sided cavity. It is found that due to the presence of a strong coupling field, the reflection coefficient can be controlled at long wavelength, which is essential for adjusting the threshold of reflected optical bistability. Moreover, the phase shift features of the reflection pulse inside an electromagnetically induced transparency window are also discussed.

Toward Singlet-Triplet Bistable Nonalternant Kekulé Hydrocarbons: Azulene-to-Naphthalene Rearrangement.

Science.gov (United States)

Das, Soumyajit; Wu, Jishan

2015-12-04

Recent developments of open-shell singlet diradicaloids motivated the search for stable singlet-triplet bistable nonalternant polycyclic hydrocarbons. During the synthesis of this type of molecule, such as the dibenzo-cyclohepta[def]fluorene 3, an unexpected azulene-to-naphthalene rearrangement was observed at room temperature, which resulted in new nonalternant hydrocarbons 8a/8b with a closed-shell singlet ground state. These studies provided insight into the unique chemistry of azulene and challenges for the synthesis of singlet-triplet bistable polycyclic hydrocarbons.

Kerr nonlinearity and plasmonic bistability in graphene nanoribbons

DEFF Research Database (Denmark)

Christensen, Thomas; Yan, Wei; Jauho, Antti-Pekka

2015-01-01

due to field enhancement, and the total nonlinearity is significantly affected by the field inhomogeneity of the plasmonic excitation. Finally, we discuss the emergence of a plasmonic bistability which exists for energies red-shifted relative to the linear resonance. Our results offer insights...

Epigenetic control of virulence gene expression in Pseudomonas aeruginosa by a LysR-type transcription regulator.

Directory of Open Access Journals (Sweden)

Keith H Turner

2009-12-01

Full Text Available Phenotypic variation within an isogenic bacterial population is thought to ensure the survival of a subset of cells in adverse conditions. The opportunistic pathogen Pseudomonas aeruginosa variably expresses several phenotypes, including antibiotic resistance, biofilm formation, and the production of CupA fimbriae. Here we describe a previously unidentified bistable switch in P. aeruginosa. This switch controls the expression of a diverse set of genes, including aprA, which encodes the secreted virulence factor alkaline protease. We present evidence that bistable expression of PA2432, herein named bexR (bistable expression regulator, which encodes a LysR-type transcription regulator, controls this switch. In particular, using DNA microarrays, quantitative RT-PCR analysis, chromatin immunoprecipitation, and reporter gene fusions, we identify genes directly under the control of BexR and show that these genes are bistably expressed. Furthermore, we show that bexR is itself bistably expressed and positively autoregulated. Finally, using single-cell analyses of a GFP reporter fusion, we present evidence that positive autoregulation of bexR is necessary for bistable expression of the BexR regulon. Our findings suggest that a positive feedback loop involving a LysR-type transcription regulator serves as the basis for an epigenetic switch that controls virulence gene expression in P. aeruginosa.

Molecular switches at the synapse emerge from receptor and kinase traffic.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Changes in the synaptic connection strengths between neurons are believed to play a role in memory formation. An important mechanism for changing synaptic strength is through movement of neurotransmitter receptors and regulatory proteins to and from the synapse. Several activity-triggered biochemical events control these movements. Here we use computer models to explore how these putative memory-related changes can be stabilised long after the initial trigger, and beyond the lifetime of synaptic molecules. We base our models on published biochemical data and experiments on the activity-dependent movement of a glutamate receptor, AMPAR, and a calcium-dependent kinase, CaMKII. We find that both of these molecules participate in distinct bistable switches. These simulated switches are effective for long periods despite molecular turnover and biochemical fluctuations arising from the small numbers of molecules in the synapse. The AMPAR switch arises from a novel self-recruitment process where the presence of sufficient receptors biases the receptor movement cycle to insert still more receptors into the synapse. The CaMKII switch arises from autophosphorylation of the kinase. The switches may function in a tightly coupled manner, or relatively independently. The latter case leads to multiple stable states of the synapse. We propose that similar self-recruitment cycles may be important for maintaining levels of many molecules that undergo regulated movement, and that these may lead to combinatorial possible stable states of systems like the synapse.

Loads Bias Genetic and Signaling Switches in Synthetic and Natural Systems

Science.gov (United States)

Medford, June; Prasad, Ashok

2014-01-01

Biological protein interactions networks such as signal transduction or gene transcription networks are often treated as modular, allowing motifs to be analyzed in isolation from the rest of the network. Modularity is also a key assumption in synthetic biology, where it is similarly expected that when network motifs are combined together, they do not lose their essential characteristics. However, the interactions that a network module has with downstream elements change the dynamical equations describing the upstream module and thus may change the dynamic and static properties of the upstream circuit even without explicit feedback. In this work we analyze the behavior of a ubiquitous motif in gene transcription and signal transduction circuits: the switch. We show that adding an additional downstream component to the simple genetic toggle switch changes its dynamical properties by changing the underlying potential energy landscape, and skewing it in favor of the unloaded side, and in some situations adding loads to the genetic switch can also abrogate bistable behavior. We find that an additional positive feedback motif found in naturally occurring toggle switches could tune the potential energy landscape in a desirable manner. We also analyze autocatalytic signal transduction switches and show that a ubiquitous positive feedback switch can lose its switch-like properties when connected to a downstream load. Our analysis underscores the necessity of incorporating the effects of downstream components when understanding the physics of biochemical network motifs, and raises the question as to how these effects are managed in real biological systems. This analysis is particularly important when scaling synthetic networks to more complex organisms. PMID:24676102

CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

Directory of Open Access Journals (Sweden)

Marasco Rosangela

2006-11-01

Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

Bistable out-of-plane stress-mismatched thermally actuated bilayer devices with large deflection

International Nuclear Information System (INIS)

Goessling, B A; Lucas, T M; Moiseeva, E V; Aebersold, J W; Harnett, C K

2011-01-01

In this paper, we explore microfabricated bistable actuators released as thin films from a silicon wafer. The actuators are based on a serpentine design where two cantilevers are coupled at the tips by a thin-film bar. These devices are parameterized by two lengths: cantilever length and the length of the coupling bar. These two dimensions are systematically varied to study the effect of design parameters on bistability. The three-dimensional devices have extremely large deflection (hundreds of microns rather than tens of microns for most planar microactuators of similar size) and are thermally actuated out of the plane of the wafer by applying a bias across either the left or right side of the serpentine. The bistability of these devices is evaluated using electron and optical microscopy. Potential applications include non-volatile mechanical memory, optical shutters, and reconfigurable antenna elements

A silicon-nanowire memory driven by optical gradient force induced bistability

Energy Technology Data Exchange (ETDEWEB)

Dong, B. [School of Electrical and Electronic Engineering, Nanyang Technological University, Singapore 639798 (Singapore); Institute of Microelectronics, A*STAR (Agency for Science, Technology and Research), Singapore 117685 (Singapore); Cai, H., E-mail: caih@ime.a-star.edu.sg; Gu, Y. D.; Kwong, D. L. [Institute of Microelectronics, A*STAR (Agency for Science, Technology and Research), Singapore 117685 (Singapore); Chin, L. K.; Ng, G. I.; Ser, W. [School of Electrical and Electronic Engineering, Nanyang Technological University, Singapore 639798 (Singapore); Huang, J. G. [School of Electrical and Electronic Engineering, Nanyang Technological University, Singapore 639798 (Singapore); Institute of Microelectronics, A*STAR (Agency for Science, Technology and Research), Singapore 117685 (Singapore); School of Mechanical Engineering, Xi' an Jiaotong University, Xi' an 710049 (China); Yang, Z. C. [School of Electronics Engineering and Computer Science, Peking University, Beijing 100871 (China); Liu, A. Q., E-mail: eaqliu@ntu.edu.sg [School of Electrical and Electronic Engineering, Nanyang Technological University, Singapore 639798 (Singapore); School of Electronics Engineering and Computer Science, Peking University, Beijing 100871 (China)

2015-12-28

In this paper, a bistable optical-driven silicon-nanowire memory is demonstrated, which employs ring resonator to generate optical gradient force over a doubly clamped silicon-nanowire. Two stable deformation positions of a doubly clamped silicon-nanowire represent two memory states (“0” and “1”) and can be set/reset by modulating the light intensity (<3 mW) based on the optical force induced bistability. The time response of the optical-driven memory is less than 250 ns. It has applications in the fields of all optical communication, quantum computing, and optomechanical circuits.

The effect of magnetic field on bistability in 1D photonic crystal doped by magnetized plasma and coupled nonlinear defects

International Nuclear Information System (INIS)

Mehdian, H.; Mohammadzahery, Z.; Hasanbeigi, A.

2014-01-01

In this work, we study the defect mode and bistability behavior of 1-D photonic band gap structure with magnetized plasma and coupled nonlinear defects. The transfer matrix method has been employed to investigate the magnetic field effect on defect mode frequency and bistability threshold. The obtained results show that the frequency of defect mode and bistability threshold can be altered, without changing the structure of the photonic multilayer. Therefore, the bistability behavior of the subjected structure in the presence of magnetized plasma can be utilized in manufacturing wide frequency range devices

Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

Science.gov (United States)

Cortes, Teresa; Cox, Robert Ashley

2015-04-01

Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

Modeling bistable behaviors in morphing structures through finite element simulations.

Science.gov (United States)

Guo, Qiaohang; Zheng, Huang; Chen, Wenzhe; Chen, Zi

2014-01-01

Bistable structures, exemplified by the Venus flytrap and slap bracelets, can transit between different configurations upon certain external stimulation. Here we study, through three-dimensional finite element simulations, the bistable behaviors in elastic plates in the absence of terminate loads, but with pre-strains in one (or both) of the two composite layers. Both the scenarios with and without a given geometric mis-orientation angle are investigated, the results of which are consistent with recent theoretical and experimental studies. This work can open ample venues for programmable designs of plant/shell structures with large deformations, with applications in designing bio-inspired robotics for biomedical research and morphing/deployable structures in aerospace engineering.

Spatial waves of advance with bistable dynamics: cytoplasmic and genetic analogues of Allee effects.

Science.gov (United States)

Barton, N H; Turelli, Michael

2011-09-01

Unlike unconditionally advantageous "Fisherian" variants that tend to spread throughout a species range once introduced anywhere, "bistable" variants, such as chromosome translocations, have two alternative stable frequencies, absence and (near) fixation. Analogous to populations with Allee effects, bistable variants tend to increase locally only once they become sufficiently common, and their spread depends on their rate of increase averaged over all frequencies. Several proposed manipulations of insect populations, such as using Wolbachia or "engineered underdominance" to suppress vector-borne diseases, produce bistable rather than Fisherian dynamics. We synthesize and extend theoretical analyses concerning three features of their spatial behavior: rate of spread, conditions to initiate spread from a localized introduction, and wave stopping caused by variation in population densities or dispersal rates. Unlike Fisherian variants, bistable variants tend to spread spatially only for particular parameter combinations and initial conditions. Wave initiation requires introduction over an extended region, while subsequent spatial spread is slower than for Fisherian waves and can easily be halted by local spatial inhomogeneities. We present several new results, including robust sufficient conditions to initiate (and stop) spread, using a one-parameter cubic approximation applicable to several models. The results have both basic and applied implications.

Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

DEFF Research Database (Denmark)

Danielsen, S; Kilstrup, M; Barilla, K

1992-01-01

. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

Interplay of bistable kinetics of gene expression during cellular growth

International Nuclear Information System (INIS)

Zhdanov, Vladimir P

2009-01-01

In cells, the bistable kinetics of gene expression can be observed on the level of (i) one gene with positive feedback between protein and mRNA production, (ii) two genes with negative mutual feedback between protein and mRNA production, or (iii) in more complex cases. We analyse the interplay of two genes of type (ii) governed by a gene of type (i) during cellular growth. In particular, using kinetic Monte Carlo simulations, we show that in the case where gene 1, operating in the bistable regime, regulates mutually inhibiting genes 2 and 3, also operating in the bistable regime, the latter genes may eventually be trapped either to the state with high transcriptional activity of gene 2 and low activity of gene 3 or to the state with high transcriptional activity of gene 3 and low activity of gene 2. The probability to get to one of these states depends on the values of the model parameters. If genes 2 and 3 are kinetically equivalent, the probability is equal to 0.5. Thus, our model illustrates how different intracellular states can be chosen at random with predetermined probabilities. This type of kinetics of gene expression may be behind complex processes occurring in cells, e.g., behind the choice of the fate by stem cells

Implications of the spatial dynamics of fire spread for the bistability of savanna and forest.

Science.gov (United States)

Schertzer, E; Staver, A C; Levin, S A

2015-01-01

The role of fire in expanding the global distribution of savanna is well recognized. Empirical observations and modeling suggest that fire spread has a threshold response to fuel-layer continuity, which sets up a positive feedback that maintains savanna-forest bistability. However, modeling has so far failed to examine fire spread as a spatial process that interacts with vegetation. Here, we use simple, well-supported assumptions about fire spread as an infection process and its effects on trees to ask whether spatial dynamics qualitatively change the potential for savanna-forest bistability. We show that the spatial effects of fire spread are the fundamental reason that bistability is possible: because fire spread is an infection process, it exhibits a threshold response to fuel continuity followed by a rapid increase in fire size. Other ecological processes affecting fire spread may also contribute including temporal variability in demography or fire spread. Finally, including the potential for spatial aggregation increases the potential both for savanna-forest bistability and for savanna and forest to coexist in a landscape mosaic.

Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

Science.gov (United States)

Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

2013-10-01

The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Pattern formation in the bistable Gray-Scott model

DEFF Research Database (Denmark)

Mazin, W.; Rasmussen, K.E.; Mosekilde, Erik

1996-01-01

The paper presents a computer simulation study of a variety of far-from-equilibrium phenomena that can arise in a bistable chemical reaction-diffusion system which also displays Turing and Hopf instabilities. The Turing bifurcation curve and the wave number for the patterns of maximum linear grow...

Global analysis of dynamical decision-making models through local computation around the hidden saddle.

Directory of Open Access Journals (Sweden)

Laura Trotta

Full Text Available Bistable dynamical switches are frequently encountered in mathematical modeling of biological systems because binary decisions are at the core of many cellular processes. Bistable switches present two stable steady-states, each of them corresponding to a distinct decision. In response to a transient signal, the system can flip back and forth between these two stable steady-states, switching between both decisions. Understanding which parameters and states affect this switch between stable states may shed light on the mechanisms underlying the decision-making process. Yet, answering such a question involves analyzing the global dynamical (i.e., transient behavior of a nonlinear, possibly high dimensional model. In this paper, we show how a local analysis at a particular equilibrium point of bistable systems is highly relevant to understand the global properties of the switching system. The local analysis is performed at the saddle point, an often disregarded equilibrium point of bistable models but which is shown to be a key ruler of the decision-making process. Results are illustrated on three previously published models of biological switches: two models of apoptosis, the programmed cell death and one model of long-term potentiation, a phenomenon underlying synaptic plasticity.

Bistability of self-modulation oscillations in an autonomous solid-state ring laser

International Nuclear Information System (INIS)

Dudetskii, V Yu

2013-01-01

Bistable self-modulation regimes of generation for a ring YAG : Nd chip laser with the counterpropagating waves asymmetrically coupled via backward scattering are simulated numerically. Two branches of bistable self-modulation regimes of generation are found in the domain of the parametric resonance between the selfmodulation and relaxation oscillations. The self-modulation regimes observed in earlier experiments pertain to only one of the branches. Possible reasons for such a discrepancy are considered, related to the influence of technical and natural noise on the dynamics of solid-state ring lasers. (control of laser radiation parameters)

vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

DEFF Research Database (Denmark)

Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

2014-01-01

We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

Deployable structures using bistable reeled composites

Science.gov (United States)

Daton-Lovett, Andrew J.; Compton-Bishop, Quentin M.; Curry, Richard G.

2000-06-01

This paper describes an innovative, patented use of composite materials developed by RolaTube Technology Ltd. to make smart deployable structures. Bi-stable reeled composites (BRCs) can alternate between two stable forms; that of a strong, rigid structure and that of a compact coil of flat-wound material. Bi-stability arises as a result of the manipulation of Poisson's ratio and isotropy in the various layers of the material. BRCs are made of fiber- reinforced composite materials, most often with a thermoplastic matrix. A range of fibers and polymer matrices can be used according to the requirements of the operating environment. Samples of a BRC structure were constructed using layers of unidirectional, fiber-reinforced thermoplastic sheet with the layers at different angles. The whole assembly was then consolidated under conditions of elevated temperature and pressure. The properties of the BRC are described and the result of a series of experiments performed on the sample to determine the tensile strength of the BRC structure are reported. A full analysis using finite element methods is being undertaken in collaboration with the University of Cambridge, England. The first commercial use has been to fabricate boom and drive mechanisms for the remote inspection of industrial plant.

Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

Science.gov (United States)

Burbank, Lindsey P; Van Horn, Christopher R

2017-11-01

The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

Optically levitated nanoparticle as a model system for stochastic bistable dynamics.

Science.gov (United States)

Ricci, F; Rica, R A; Spasenović, M; Gieseler, J; Rondin, L; Novotny, L; Quidant, R

2017-05-09

Nano-mechanical resonators have gained an increasing importance in nanotechnology owing to their contributions to both fundamental and applied science. Yet, their small dimensions and mass raises some challenges as their dynamics gets dominated by nonlinearities that degrade their performance, for instance in sensing applications. Here, we report on the precise control of the nonlinear and stochastic bistable dynamics of a levitated nanoparticle in high vacuum. We demonstrate how it can lead to efficient signal amplification schemes, including stochastic resonance. This work contributes to showing the use of levitated nanoparticles as a model system for stochastic bistable dynamics, with applications to a wide variety of fields.

Design of all-optical flip-flop by using optical bistability in passive micro-rings

International Nuclear Information System (INIS)

Karimi, M.; Abolfazli, M. J.; Rouholamini Nejad, H.; Bahrampour, A.

2007-01-01

In this paper at first, Optical bistability in the micro ring resonators in the presence of Kerr and two-photon absorption effects is studied and also, attenuation in micro rings with these nonlinear effects is calculated. An all-optical R-S flip-flop is designed by using optical bistability. Conditions for SET and RESET signals are calculated and their dependences on the optical parameters of micro rings are investigated.

Drag force actuated bistable microswitches for flow sensing

NARCIS (Netherlands)

Kuipers, W.J.; van Baar, J.J.J.; Dijkstra, Marcel; Wiegerink, Remco J.; Lammerink, Theodorus S.J.; de Boer, J.H.; Krijnen, Gijsbertus J.M.

2006-01-01

This paper presents bistable microswitches with Au contacts with the aim to combine them with artificial hairs for flow sensing. The Au contacts are applied on both ends of a silicon nitride beam, suspended by a torsional bar at its center. The beam is provided with electrodes for electrostatic

Bistable dark solitons of a cubic-quintic Helmholtz equation

International Nuclear Information System (INIS)

Christian, J. M.; McDonald, G. S.; Chamorro-Posada, P.

2010-01-01

We provide a report on exact analytical bistable dark spatial solitons of a nonlinear Helmholtz equation with a cubic-quintic refractive-index model. Our analysis begins with an investigation of the modulational instability characteristics of Helmholtz plane waves. We then derive a dark soliton by mapping the desired asymptotic form onto a uniform background field and obtain a more general solution by deploying rotational invariance laws in the laboratory frame. The geometry of the new soliton is explored in detail, and a range of new physical predictions is uncovered. Particular attention is paid to the unified phenomena of arbitrary-angle off-axis propagation and nondegenerate bistability. Crucially, the corresponding solution of paraxial theory emerges in a simultaneous multiple limit. We conclude with a set of computer simulations that examine the role of Helmholtz dark solitons as robust attractors.

Pramana – Journal of Physics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Bistable soliton states and switching in doubly inhomogeneously doped fiber couplers. Ajit Kumar. Theoretical aspects of optical solitons Volume 57 Issue 5-6 November-December 2001 pp 969-979 ... Switching between the bistable soliton states in a doubly and inhomogeneously doped fiber system is studied numerically.

Optical bistability and multistability in a three-level Δ-type atomic system under the nonresonant condition

International Nuclear Information System (INIS)

Ai-Xi, Chen; Zhi-Ping, Wang; De-Hai, Chen; Yan-Qiu, Xu

2009-01-01

Under a nonresonant condition, we theoretically investigate hybrid absorptive-dispersive optical bistability and multistability behaviours in a three-level Δ-type system by using a microwave field to drive a hyperfine transition between two upper excited states inside a unidirectional ring cavity. We find that the optical bistability and multistability behaviours can be controlled by adjusting the intensity of the microwave field or the intensity of the coherent coupling field. Furthermore, our studies show an interesting phenomenon of the transition from the optical bistability to the optical multistability only by changing the negative detuning of the coupling field into the positive detuning of the coupling field. (classical areas of phenomenology)

Bistability of heat transfer of a viscous liquid under conditions of flow channel

International Nuclear Information System (INIS)

Melkikh, A.V.; Seleznev, V.D.

2001-01-01

The heat exchange model for a viscous liquid flowing under the pressure drop effect in a tube, surrounded by the medium with a lower temperature, is considered. It is shown that the system bistable behavior is possible by availability of the liquid viscosity exponential dependence on the temperature and by negligible dissipative heat release. The transitions between cold and hot flows in this case should proceed by a jump. The liquid and channel parameters, whereby the bistability may be observed, are determined [ru

Structural characterization of the Salmonella typhimurium LT2 umu operon

International Nuclear Information System (INIS)

Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

1990-01-01

The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

Electrical bistability and charge-transport mechanisms in cuprous sulfide nanosphere-poly(N-vinylcarbazole) composite films

International Nuclear Information System (INIS)

Tang Aiwei; Teng Feng; Liu Jie; Wang Yichao; Peng Hongshang; Hou Yanbing; Wang Yongsheng

2011-01-01

In this study, electrically bistable devices were fabricated by incorporating cuprous sulfide (Cu 2 S) nanospheres with mean size less than 10 nm into a poly(N-vinylcarbazole) (PVK) matrix. A remarkable electrical bistability was clearly observed in the current–voltage curves of the devices due to an electric-field-induced charge transfer between the dodecanethiol-capped Cu 2 S nanospheres and PVK. The maximum ON/OFF current ratio reached up to value as large as 10 4 , which was dependent on the mass ratios of Cu 2 S nanospheres to PVK, the amplitude of the scanning voltages, and the film thickness. The charge-transport mechanisms of the electrically bistable devices were described on the basis of the experimental results using different theoretical models of organic electronics.

Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

Directory of Open Access Journals (Sweden)

Jan Ewald

2015-04-01

Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

All-polymer bistable resistive memory device based on nanoscale phase-separated PCBM-ferroelectric blends

KAUST Repository

Khan, Yasser

2012-11-21

All polymer nonvolatile bistable memory devices are fabricated from blends of ferroelectric poly(vinylidenefluoride-trifluoroethylene (P(VDF-TrFE)) and n-type semiconducting [6,6]-phenyl-C61-butyric acid methyl ester (PCBM). The nanoscale phase separated films consist of PCBM domains that extend from bottom to top electrode, surrounded by a ferroelectric P(VDF-TrFE) matrix. Highly conducting poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) polymer electrodes are used to engineer band offsets at the interfaces. The devices display resistive switching behavior due to modulation of this injection barrier. With careful optimization of the solvent and processing conditions, it is possible to spin cast very smooth blend films (Rrms ≈ 7.94 nm) and with good reproducibility. The devices exhibit high Ion/I off ratios (≈3 × 103), low read voltages (≈5 V), excellent dielectric response at high frequencies (Ïμr ≈ 8.3 at 1 MHz), and excellent retention characteristics up to 10 000 s. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

Directory of Open Access Journals (Sweden)

Sun Yuan

2006-02-01

Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

Synthesizing a novel genetic sequential logic circuit: a push-on push-off switch.

Science.gov (United States)

Lou, Chunbo; Liu, Xili; Ni, Ming; Huang, Yiqi; Huang, Qiushi; Huang, Longwen; Jiang, Lingli; Lu, Dan; Wang, Mingcong; Liu, Chang; Chen, Daizhuo; Chen, Chongyi; Chen, Xiaoyue; Yang, Le; Ma, Haisu; Chen, Jianguo; Ouyang, Qi

2010-01-01

Design and synthesis of basic functional circuits are the fundamental tasks of synthetic biologists. Before it is possible to engineer higher-order genetic networks that can perform complex functions, a toolkit of basic devices must be developed. Among those devices, sequential logic circuits are expected to be the foundation of the genetic information-processing systems. In this study, we report the design and construction of a genetic sequential logic circuit in Escherichia coli. It can generate different outputs in response to the same input signal on the basis of its internal state, and 'memorize' the output. The circuit is composed of two parts: (1) a bistable switch memory module and (2) a double-repressed promoter NOR gate module. The two modules were individually rationally designed, and they were coupled together by fine-tuning the interconnecting parts through directed evolution. After fine-tuning, the circuit could be repeatedly, alternatively triggered by the same input signal; it functions as a push-on push-off switch.

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

Science.gov (United States)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

2015-01-01

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

Review of inductively coupled plasmas: Nano-applications and bistable hysteresis physics

Science.gov (United States)

Lee, Hyo-Chang

2018-03-01

Many different gas discharges and plasmas exhibit bistable states under a given set of conditions, and the history-dependent hysteresis that is manifested by intensive quantities of the system upon variation of an external parameter has been observed in inductively coupled plasmas (ICPs). When the external parameters (such as discharge powers) increase, the plasma density increases suddenly from a low- to high-density mode, whereas decreasing the power maintains the plasma in a relatively high-density mode, resulting in significant hysteresis. To date, a comprehensive description of plasma hysteresis and a physical understanding of the main mechanism underlying their bistability remain elusive, despite many experimental observations of plasma bistability conducted under radio-frequency ICP excitation. This fundamental understanding of mode transitions and hysteresis is essential and highly important in various applied fields owing to the widespread use of ICPs, such as semiconductor/display/solar-cell processing (etching, deposition, and ashing), wireless light lamp, nanostructure fabrication, nuclear-fusion operation, spacecraft propulsion, gas reformation, and the removal of hazardous gases and materials. If, in such applications, plasma undergoes a mode transition and hysteresis occurs in response to external perturbations, the process result will be strongly affected. Due to these reasons, this paper comprehensively reviews both the current knowledge in the context of the various applied fields and the global understanding of the bistability and hysteresis physics in the ICPs. At first, the basic understanding of the ICP is given. After that, applications of ICPs to various applied fields of nano/environmental/energy-science are introduced. Finally, the mode transition and hysteresis in ICPs are studied in detail. This study will show the fundamental understanding of hysteresis physics in plasmas and give open possibilities for applications to various applied

Involvement of the visual change detection process in facilitating perceptual alternation in the bistable image.

Science.gov (United States)

Urakawa, Tomokazu; Bunya, Mao; Araki, Osamu

2017-08-01

A bistable image induces one of two perceptual alternatives. When the bistable visual image is continuously viewed, the percept of the image alternates from one possible percept to the other. Perceptual alternation was previously reported to be induced by an exogenous perturbation in the bistable image, and this perturbation was theoretically interpreted to cause neural noise, prompting a transition between two stable perceptual states. However, little is known experimentally about the visual processing of exogenously driven perceptual alternation. Based on the findings of a previous behavioral study (Urakawa et al. in Perception 45:474-482, 2016), the present study hypothesized that the automatic visual change detection process, which is relevant to the detection of a visual change in a sequence of visual events, has an enhancing effect on the induction of perceptual alternation, similar to neural noise. In order to clarify this issue, we developed a novel experimental paradigm in which visual mismatch negativity (vMMN), an electroencephalographic brain response that reflects visual change detection, was evoked while participants continuously viewed the bistable image. In terms of inter-individual differences in neural and behavioral data, we found that enhancements in the peak amplitude of vMMN1, early vMMN at a latency of approximately 150 ms, correlated with increases in the proportion of perceptual alternation across participants. Our results indicate the involvement of automatic visual change detection in the induction of perceptual alternation, similar to neural noise, thereby providing a deeper insight into the neural mechanisms underlying exogenously driven perceptual alternation in the bistable image.

Entanglement and bistability in coupled quantum dots inside a driven cavity

International Nuclear Information System (INIS)

Mitra, Arnab; Vyas, Reeta

2010-01-01

Generation and dissipation of entanglement between two coupled quantum dots (QDs) in a cavity driven by a coherent field is studied. We find that it is possible to generate and sustain a large amount of entanglement between the quantum dots in the steady state, even in the presence of strong decay in both the cavity and the dots. We investigate the effect of different parameters (decay rates, coupling strengths, and detunings) on entanglement. We find that the cavity field shows bistability and study the effect of relevant parameters on the existence of this bistable behavior. We also study the correlation between the cavity field and the entanglement between the dots. The experimental viability of the proposed scheme is discussed.

Decreases in average bacterial community rRNA operon copy number during succession.

Science.gov (United States)

Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

2016-05-01

Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

Combined fMRI- and eye movement-based decoding of bistable plaid motion perception.

Science.gov (United States)

Wilbertz, Gregor; Ketkar, Madhura; Guggenmos, Matthias; Sterzer, Philipp

2018-05-01

The phenomenon of bistable perception, in which perception alternates spontaneously despite constant sensory stimulation, has been particularly useful in probing the neural bases of conscious perception. The study of such bistability requires access to the observer's perceptual dynamics, which is usually achieved via active report. This report, however, constitutes a confounding factor in the study of conscious perception and can also be biased in the context of certain experimental manipulations. One approach to circumvent these problems is to track perceptual alternations using signals from the eyes or the brain instead of observers' reports. Here we aimed to optimize such decoding of perceptual alternations by combining eye and brain signals. Eye-tracking and functional magnetic resonance imaging (fMRI) was performed in twenty participants while they viewed a bistable visual plaid motion stimulus and reported perceptual alternations. Multivoxel pattern analysis (MVPA) for fMRI was combined with eye-tracking in a Support vector machine to decode participants' perceptual time courses from fMRI and eye-movement signals. While both measures individually already yielded high decoding accuracies (on average 86% and 88% correct, respectively) classification based on the two measures together further improved the accuracy (91% correct). These findings show that leveraging on both fMRI and eye movement data may pave the way for optimized no-report paradigms through improved decodability of bistable motion perception and hence for a better understanding of the neural correlates of consciousness. Copyright © 2018 Elsevier Inc. All rights reserved.

Phase-locking and bistability in neuronal networks with synaptic depression

Science.gov (United States)

Akcay, Zeynep; Huang, Xinxian; Nadim, Farzan; Bose, Amitabha

2018-02-01

We consider a recurrent network of two oscillatory neurons that are coupled with inhibitory synapses. We use the phase response curves of the neurons and the properties of short-term synaptic depression to define Poincaré maps for the activity of the network. The fixed points of these maps correspond to phase-locked modes of the network. Using these maps, we analyze the conditions that allow short-term synaptic depression to lead to the existence of bistable phase-locked, periodic solutions. We show that bistability arises when either the phase response curve of the neuron or the short-term depression profile changes steeply enough. The results apply to any Type I oscillator and we illustrate our findings using the Quadratic Integrate-and-Fire and Morris-Lecar neuron models.

Orientational transitions in ferromagnetic liquid crystals with bistable coupling between colloidal particles and the matrix

Energy Technology Data Exchange (ETDEWEB)

Zakhlevnykh, A. N., E-mail: anz@psu.ru; Petrov, D. A. [Perm State National Research University (Russian Federation)

2016-10-15

We study the orientational response of a ferromagnetic liquid crystal that is induced by magnetic and electric fields. A modified form of the energy of the orientational interaction between magnetic impurity particles and the liquid crystal matrix that leads to bistable coupling is considered. It is shown that apart from magnetic impurity segregation, first-order orientational transitions can be due to the bistability of the potential of the orientational coupling between the director and the magnetization. The ranges of material parameters that lead to optical bistability are determined. The possibility of first-order orientational transitions is analyzed for the optical phase difference between the ordinary and extraordinary light rays transmitted through a ferronematic cell. It is shown that an electric field applied in the given geometry considerably enhances the magneto-orientational response of the ferronematic.

EDITORIAL: Molecular switches at surfaces Molecular switches at surfaces

Science.gov (United States)

Weinelt, Martin; von Oppen, Felix

2012-10-01

electron-vibration coupling in transport through single moleculesKatharina J Franke and Jose Ignacio Pascual Vibrational heating in single-molecule switches: an energy-dependent density-of-states approachT Brumme, R Gutierrez and G Cuniberti Reversible switching of single tin phthalocyanine molecules on the InAs(111)A surfaceC Nacci, K Kanisawa and S Fölsch Tuning the interaction between carbon nanotubes and dipole switches: the influence of the change of the nanotube-spiropyran distanceP Bluemmel, A Setaro, C Maity, S Hecht and S Reich Carbon nanotubes as substrates for molecular spiropyran-based switchesE Malic, A Setaro, P Bluemmel, Carlos F Sanz-Navarro, Pablo Ordejón, S Reich and A Knorr Ultrafast dynamics of dithienylethenes differently linked to the surface of TiO2 nanoparticlesLars Dworak, Marc Zastrow, Gehad Zeyat, Karola Rück-Braun and Josef Wachtveitl Switching the electronic properties of Co-octaethylporphyrin molecules on oxygen-covered Ni films by NO adsorptionC F Hermanns, M Bernien, A Krüger, J Miguel and W Kuch STM-switching of organic molecules on semiconductor surfaces: an above threshold density matrix model for 1,5 cyclooctadiene on Si(100)K Zenichowski, Ch Nacci, S Fölsch, J Dokić, T Klamroth and P Saalfrank A switch based on self-assembled thymineFatih Kalkan, Michael Mehlhorn and Karina Morgenstern The growth and electronic structure of azobenzene-based functional molecules on layered crystalsJ Iwicki, E Ludwig, J Buck, M Kalläne, F Köhler, R Herges, L Kipp and K Rossnagel Voltage-dependent conductance states of a single-molecule junctionY F Wang, N Néel, J Kröger, H Vázquez, M Brandbyge, B Wang and R Berndt Molecules with multiple switching units on a Au(111) surface: self-organization and single-molecule manipulationJohannes Mielke, Sofia Selvanathan, Maike Peters, Jutta Schwarz, Stefan Hecht and Leonhard Grill Preparing and regulating a bi-stable molecular switch by atomic manipulationS Sakulsermsuk, R E Palmer and P A Sloan Mixed self

Maximizing direct current power delivery from bistable vibration energy harvesting beams subjected to realistic base excitations

Science.gov (United States)

Dai, Quanqi; Harne, Ryan L.

2017-04-01

Effective development of vibration energy harvesters is required to convert ambient kinetic energy into useful electrical energy as power supply for sensors, for example in structural health monitoring applications. Energy harvesting structures exhibiting bistable nonlinearities have previously been shown to generate large alternating current (AC) power when excited so as to undergo snap-through responses between stable equilibria. Yet, most microelectronics in sensors require rectified voltages and hence direct current (DC) power. While researchers have studied DC power generation from bistable energy harvesters subjected to harmonic excitations, there remain important questions as to the promise of such harvester platforms when the excitations are more realistic and include both harmonic and random components. To close this knowledge gap, this research computationally and experimentally studies the DC power delivery from bistable energy harvesters subjected to such realistic excitation combinations as those found in practice. Based on the results, it is found that the ability for bistable energy harvesters to generate peak DC power is significantly reduced by introducing sufficient amount of stochastic excitations into an otherwise harmonic input. On the other hand, the elimination of a low amplitude, coexistent response regime by way of the additive noise promotes power delivery if the device was not originally excited to snap-through. The outcomes of this research indicate the necessity for comprehensive studies about the sensitivities of DC power generation from bistable energy harvester to practical excitation scenarios prior to their optimal deployment in applications.

Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

Directory of Open Access Journals (Sweden)

Altenbuchner Josef

2011-10-01

Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

Phenomenological approach to bistable behavior of Josephson junctions

International Nuclear Information System (INIS)

Nishi, K.; Nara, S.; Hamanaka, K.

1985-01-01

The interaction of unbiased Josephson junction with external electromagnetic field in the presence of externally applied uniform magnetic field is theoretically examined by means of phenomenological treatment. It is proposed that an irradiated junction with suitably chosen parameters shows a bistable behavior of voltage across the junction as a function of the radiation intensity

Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

OpenAIRE

Riyanti, Eny Ida; Rogers, Peter L

2009-01-01

Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

Science.gov (United States)

Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

2014-10-01

Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

Different cell fates from cell-cell interactions: core architectures of two-cell bistable networks.

Science.gov (United States)

Rouault, Hervé; Hakim, Vincent

2012-02-08

The acquisition of different fates by cells that are initially in the same state is central to development. Here, we investigate the possible structures of bistable genetic networks that can allow two identical cells to acquire different fates through cell-cell interactions. Cell-autonomous bistable networks have been previously sampled using an evolutionary algorithm. We extend this evolutionary procedure to take into account interactions between cells. We obtain a variety of simple bistable networks that we classify into major subtypes. Some have long been proposed in the context of lateral inhibition through the Notch-Delta pathway, some have been more recently considered and others appear to be new and based on mechanisms not previously considered. The results highlight the role of posttranscriptional interactions and particularly of protein complexation and sequestration, which can replace cooperativity in transcriptional interactions. Some bistable networks are entirely based on posttranscriptional interactions and the simplest of these is found to lead, upon a single parameter change, to oscillations in the two cells with opposite phases. We provide qualitative explanations as well as mathematical analyses of the dynamical behaviors of various created networks. The results should help to identify and understand genetic structures implicated in cell-cell interactions and differentiation. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

DEFF Research Database (Denmark)

Givskov, M; Eberl, L; Christiansen, Gunna

1995-01-01

. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

Basins of attraction of the bistable region of time-delayed cutting dynamics

Science.gov (United States)

Yan, Yao; Xu, Jian; Wiercigroch, Marian

2017-09-01

This paper investigates the effects of bistability in a nonsmooth time-delayed dynamical system, which is often manifested in science and engineering. Previous studies on cutting dynamics have demonstrated persistent coexistence of chatter and chatter-free responses in a bistable region located in the linearly stable zone. As there is no widely accepted definition of basins of attraction for time-delayed systems, bistable regions are coined as unsafe zones (UZs). Hence, we have attempted to define the basins of attraction and stability basins for a typical delayed system to get insight into the bistability in systems with time delays. Special attention was paid to the influences of delayed initial conditions, starting points, and states at time zero on the long-term dynamics of time-delayed systems. By using this concept, it has been confirmed that the chatter is prone to occur when the waviness frequency in the workpiece surface coincides with the effective natural frequency of the cutting process. Further investigations unveil a thin "boundary layer" inside the UZ in the immediate vicinity of the stability boundary, in which we observe an extremely fast growth of the chatter basin stability. The results reveal that the system is more stable when the initial cutting depth is smaller. The physics of the tool deflection at the instant of the tool-workpiece engagement is used to evaluate the cutting safety, and the safe level could be zero when the geometry of tool engagement is unfavorable. Finally, the basins of attraction are used to quench the chatter by a single strike, where the resultant "islands" offer an opportunity to suppress the chatter even when the cutting is very close to the stability boundary.

Basins of attraction of the bistable region of time-delayed cutting dynamics.

Science.gov (United States)

Yan, Yao; Xu, Jian; Wiercigroch, Marian

2017-09-01

This paper investigates the effects of bistability in a nonsmooth time-delayed dynamical system, which is often manifested in science and engineering. Previous studies on cutting dynamics have demonstrated persistent coexistence of chatter and chatter-free responses in a bistable region located in the linearly stable zone. As there is no widely accepted definition of basins of attraction for time-delayed systems, bistable regions are coined as unsafe zones (UZs). Hence, we have attempted to define the basins of attraction and stability basins for a typical delayed system to get insight into the bistability in systems with time delays. Special attention was paid to the influences of delayed initial conditions, starting points, and states at time zero on the long-term dynamics of time-delayed systems. By using this concept, it has been confirmed that the chatter is prone to occur when the waviness frequency in the workpiece surface coincides with the effective natural frequency of the cutting process. Further investigations unveil a thin "boundary layer" inside the UZ in the immediate vicinity of the stability boundary, in which we observe an extremely fast growth of the chatter basin stability. The results reveal that the system is more stable when the initial cutting depth is smaller. The physics of the tool deflection at the instant of the tool-workpiece engagement is used to evaluate the cutting safety, and the safe level could be zero when the geometry of tool engagement is unfavorable. Finally, the basins of attraction are used to quench the chatter by a single strike, where the resultant "islands" offer an opportunity to suppress the chatter even when the cutting is very close to the stability boundary.

Reversal of Flux Closure States in Cobalt Nanoparticle Rings With Coaxial Magnetic Pulses

DEFF Research Database (Denmark)

Kasama, T; Dunin-Borkowski, Rafal E.; Scheinfein, MR

2008-01-01

Bistable flux closure (FC) states in Co nanoparticle rings can be switched reversibly by applying a coaxial magnetic field (H-z). The FC switching phenomena can be reproduced by micromagnetics simulations, which also reveal novel magnetic states at intermediate applied field strengths.......Bistable flux closure (FC) states in Co nanoparticle rings can be switched reversibly by applying a coaxial magnetic field (H-z). The FC switching phenomena can be reproduced by micromagnetics simulations, which also reveal novel magnetic states at intermediate applied field strengths....

Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

Science.gov (United States)

Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

2014-12-01

Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

Optical bistability of a thin film of resonant atoms in a phase-sensitive thermostate

International Nuclear Information System (INIS)

Basharov, A.M.

1995-01-01

It is shown theoretically that when a thin film of two-level atoms interacting with a resonant coherent electromagnetic wave is additionally illuminated with a squeezed field, a bistable transmission/reflection regime for coherent waves is obtained. This regime depends strongly on the phase difference between the coherent and the squeezed fields. New regimes, including a bistable regime, for the interaction of a coherent field with a film of resonant atoms are predicted based on this phenomenon. 14 refs., 5 figs

Remnants of semiclassical bistability in the few-photon regime of cavity QED.

Science.gov (United States)

Kerckhoff, Joseph; Armen, Michael A; Mabuchi, Hideo

2011-11-21

Broadband homodyne detection of the light transmitted by a Fabry-Perot cavity containing a strongly-coupled (133)Cs atom is used to probe the dynamic optical response in a regime where semiclassical theory predicts bistability but strong quantum corrections should apply. While quantum fluctuations destabilize true equilibrium bistability, our observations confirm the existence of metastable states with finite lifetimes and a hysteretic response is apparent when the optical drive is modulated on comparable timescales. Our experiment elucidates remnant semiclassical behavior in the attojoule (~10 photon) regime of single-atom cavity QED, of potential significance for ultra-low power photonic signal processing. © 2011 Optical Society of America

Eucaryotic operon genes can define highly conserved syntenies

Czech Academy of Sciences Publication Activity Database

Trachtulec, Zdeněk

2004-01-01

Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

Bistability and displacement fluctuations in a quantum nanomechanical oscillator

Science.gov (United States)

Avriller, R.; Murr, B.; Pistolesi, F.

2018-04-01

Remarkable features have been predicted for the mechanical fluctuations at the bistability transition of a classical oscillator coupled capacitively to a quantum dot [Micchi et al., Phys. Rev. Lett. 115, 206802 (2015), 10.1103/PhysRevLett.115.206802]. These results have been obtained in the regime ℏ ω0≪kBT ≪ℏ Γ , where ω0, T , and Γ are the mechanical resonating frequency, the temperature, and the tunneling rate, respectively. A similar behavior could be expected in the quantum regime of ℏ Γ ≪kBT ≪ℏ ω0 . We thus calculate the energy- and displacement-fluctuation spectra and study their behavior as a function of the electromechanical coupling constant when the system enters the Frank-Condon regime. We find that in analogy with the classical case, the energy-fluctuation spectrum and the displacement spectrum widths show a maximum for values of the coupling constant at which a mechanical bistability is established.

Waterbomb base: a symmetric single-vertex bistable origami mechanism

International Nuclear Information System (INIS)

Hanna, Brandon H; Lund, Jason M; Magleby, Spencer P; Howell, Larry L; Lang, Robert J

2014-01-01

The origami waterbomb base is a single-vertex bistable origami mechanism that has unique properties which may prove useful in a variety of applications. It also shows promise as a test bed for smart materials and actuation because of its straightforward geometry and multiple phases of motion, ranging from simple to more complex. This study develops a quantitative understanding of the symmetric waterbomb base's kinetic behavior. This is done by completing kinematic and potential energy analyses to understand and predict bistable behavior. A physical prototype is constructed and tested to validate the results of the analyses. Finite element and virtual work analyses based on the prototype are used to explore the locations of the stable equilibrium positions and the force–deflection response. The model results are verified through comparisons to measurements on a physical prototype. The resulting models describe waterbomb base behavior and provide an engineering tool for application development. (paper)

A Reliable Bistable Board Implementation through I/O Redundancy

International Nuclear Information System (INIS)

Kim, Min Gyu; Chung, Tae Hyok; Lee, Youn Sang; Kim, Tae Hee; Song, Seung Hwan

2010-01-01

Nuclear power plant safety systems and related equipment used in the design, including an accident in all driving conditions that must be proven In addition, the safety-related equipment that is derived according to the digitization of the safety equipment is the most important factors. Therefore, it is necessary to prove that the device was satisfied the requirements for a given performance for safety-related digital equipment for the life of the installation. These proven is done through the process, design verification of the equipment, production management, such as installation and maintenance. Among other things, it is most important to implement of the performance and reliability features the safety-related equipment in the design phase. In this paper, Bistable Board implemented to generate a ESF sign-on signal throughout the signal processing of input signal from sensors. Also, for the reliable signal input and output, I/O Module that implements the redundancy increases the reliability of the Bistable Board , to verify the performance of safety-related equipment

On square-wave-driven stochastic resonance for energy harvesting in a bistable system

Energy Technology Data Exchange (ETDEWEB)

Su, Dongxu, E-mail: sudx@iis.u-tokyo.ac.jp [Graduate School of Engineering, The University of Tokyo, Tokyo 1538505 (Japan); Zheng, Rencheng; Nakano, Kimihiko [Institute of Industrial Science, The University of Tokyo, Tokyo 1538505 (Japan); Cartmell, Matthew P [Department of Mechanical Engineering, University of Sheffield, Sheffield S1 3JD (United Kingdom)

2014-11-15

Stochastic resonance is a physical phenomenon through which the throughput of energy within an oscillator excited by a stochastic source can be boosted by adding a small modulating excitation. This study investigates the feasibility of implementing square-wave-driven stochastic resonance to enhance energy harvesting. The motivating hypothesis was that such stochastic resonance can be efficiently realized in a bistable mechanism. However, the condition for the occurrence of stochastic resonance is conventionally defined by the Kramers rate. This definition is inadequate because of the necessity and difficulty in estimating white noise density. A bistable mechanism has been designed using an explicit analytical model which implies a new approach for achieving stochastic resonance in the paper. Experimental tests confirm that the addition of a small-scale force to the bistable system excited by a random signal apparently leads to a corresponding amplification of the response that we now term square-wave-driven stochastic resonance. The study therefore indicates that this approach may be a promising way to improve the performance of an energy harvester under certain forms of random excitation.

On square-wave-driven stochastic resonance for energy harvesting in a bistable system

International Nuclear Information System (INIS)

Su, Dongxu; Zheng, Rencheng; Nakano, Kimihiko; Cartmell, Matthew P

2014-01-01

Stochastic resonance is a physical phenomenon through which the throughput of energy within an oscillator excited by a stochastic source can be boosted by adding a small modulating excitation. This study investigates the feasibility of implementing square-wave-driven stochastic resonance to enhance energy harvesting. The motivating hypothesis was that such stochastic resonance can be efficiently realized in a bistable mechanism. However, the condition for the occurrence of stochastic resonance is conventionally defined by the Kramers rate. This definition is inadequate because of the necessity and difficulty in estimating white noise density. A bistable mechanism has been designed using an explicit analytical model which implies a new approach for achieving stochastic resonance in the paper. Experimental tests confirm that the addition of a small-scale force to the bistable system excited by a random signal apparently leads to a corresponding amplification of the response that we now term square-wave-driven stochastic resonance. The study therefore indicates that this approach may be a promising way to improve the performance of an energy harvester under certain forms of random excitation

Bistability in self-activating genes regulated by non-coding RNAs

International Nuclear Information System (INIS)

Miro-Bueno, Jesus

2015-01-01

Non-coding RNA molecules are able to regulate gene expression and play an essential role in cells. On the other hand, bistability is an important behaviour of genetic networks. Here, we propose and study an ODE model in order to show how non-coding RNA can produce bistability in a simple way. The model comprises a single gene with positive feedback that is repressed by non-coding RNA molecules. We show how the values of all the reaction rates involved in the model are able to control the transitions between the high and low states. This new model can be interesting to clarify the role of non-coding RNA molecules in genetic networks. As well, these results can be interesting in synthetic biology for developing new genetic memories and biomolecular devices based on non-coding RNAs

Input-Independent Energy Harvesting in Bistable Lattices from Transition Waves.

Science.gov (United States)

Hwang, Myungwon; Arrieta, Andres F

2018-02-26

We demonstrate the utilisation of transition waves for realising input-invariant, frequency-independent energy harvesting in 1D lattices of bistable elements. We propose a metamaterial-inspired design with an integrated electromechanical transduction mechanism to the unit cell, rendering the power conversion capability an intrinsic property of the lattice. Moreover, focusing of transmitted energy to desired locations is demonstrated numerically and experimentally by introducing engineered defects in the form of perturbation in mass or inter-element forcing. We achieve further localisation of energy and numerically observe a breather-like mode for the first time in this type of lattice, improving the harvesting performance by an order of magnitude. Our approach considers generic bistable unit cells and thus provides a universal mechanism to harvest energy and realise metamaterials effectively behaving as a capacitor and power delivery system.

The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

Science.gov (United States)

Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

2013-02-01

Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

Controlling the optical bistability beyond the multi-photon resonance condition in a three-level closed-loop atomic system

International Nuclear Information System (INIS)

Mahmoudi, Mohammad; Nozari, Narges; Vafafard, Azar; Sahrai, Mostafa

2012-01-01

We investigate the optical bistability behavior of a three-level closed-loop atomic system beyond the multi-photon resonance condition. Using the Floquet decomposition, we solve the time-dependent equations of motion, beyond the multi-photon resonance condition. By identifying the different scattering processes contributing to the medium response, it is shown that in general the optical bistability behavior of the system is not phase-dependent. The phase dependence is due to the scattering of the driving and coupling fields into the probe field at a frequency, which, in general, differs from the probe field frequency. - Highlights: → We investigate optical bistability of a three-level closed-loop atomic system, beyond the multi-photon resonance condition. → By applying Floquet decomposition to the equation of motion, the different scattering processes contributing to the medium response are determined. → It is shown that the phase dependence of optical bistability arises from the scattering of the driving and coupling fields into the probe field frequency.

Effect on the mean first passage time in symmetrical bistable systems by cross-correlation between noises

International Nuclear Information System (INIS)

Wang, J.; Cao, L.; Wu, D.J.

2003-01-01

We present an analytic investigation of the mean first passage time in two opposite directions (from the left well to the right well and from right to left) by studying symmetrical bistable systems driven by correlated Gaussian white noises, and prove that the mean first passage time in two opposite directions is not symmetrical any more when noises are correlated. As examples, the mean first passage time in the quartic bistable model and the sawtooth bistable model are calculated, respectively. From the analytic results of the mean first passage time, we testify further the relation T(from x - to x + ,λ)≠T(from x + to x - ,λ) in the same area of the parameter plan. Moreover, it is found that the dependences of T + (i.e., T(from x - to x + ,λ)) and T - (i.e., T(from x + to x - ,λ)) upon the multiplicative noise intensity Q and the additive noise intensity D exhibit entirely different properties. For same areas of the parameter plan: in the quartic bistable system, when the T + vs. Q curve exhibits a maximum, while the T - vs. Q curve is monotonous; when the T + vs. D curve is monotonous, while the T - vs. D curve experiences a phase transition from decreasing monotonously to possessing one minimum. Increasing Q, when the T + vs. D curve experiences a phase transition from decreasing monotonously to possessing one maximum, while the T - vs. D curve only increases monotonously. Similar behaviours also exist in the sawtooth bistable model

Study on non-linear bistable dynamics model based EEG signal discrimination analysis method.

Science.gov (United States)

Ying, Xiaoguo; Lin, Han; Hui, Guohua

2015-01-01

Electroencephalogram (EEG) is the recording of electrical activity along the scalp. EEG measures voltage fluctuations generating from ionic current flows within the neurons of the brain. EEG signal is looked as one of the most important factors that will be focused in the next 20 years. In this paper, EEG signal discrimination based on non-linear bistable dynamical model was proposed. EEG signals were processed by non-linear bistable dynamical model, and features of EEG signals were characterized by coherence index. Experimental results showed that the proposed method could properly extract the features of different EEG signals.

Design and experiment of controlled bistable vortex induced vibration energy harvesting systems operating in chaotic regions

Science.gov (United States)

Huynh, B. H.; Tjahjowidodo, T.; Zhong, Z.-W.; Wang, Y.; Srikanth, N.

2018-01-01

Vortex induced vibration based energy harvesting systems have gained interests in these recent years due to its potential as a low water current energy source. However, the effectiveness of the system is limited only at a certain water current due to the resonance principle that governs the concept. In order to extend the working range, a bistable spring to support the structure is introduced on the system. The improvement on the performance is essentially dependent on the bistable gap as one of the main parameters of the nonlinear spring. A sufficiently large bistable gap will result in a significant performance improvement. Unfortunately, a large bistable gap might also increase a chance of chaotic responses, which in turn will result in diminutive harvested power. To mitigate the problem, an appropriate control structure is required to stabilize the chaotic vibrations of a VIV energy converter with the bistable supporting structure. Based on the nature of the double-well potential energy in a bistable spring, the ideal control structure will attempt to drive the responses to inter-well periodic vibrations in order to maximize the harvested power. In this paper, the OGY control algorithm is designed and implemented to the system. The control strategy is selected since it requires only a small perturbation in a structural parameter to execute the control effort, thus, minimum power is needed to drive the control input. Facilitated by a wake oscillator model, the bistable VIV system is modelled as a 4-dimensional autonomous continuous-time dynamical system. To implement the controller strategy, the system is discretized at a period estimated from the subspace hyperplane intersecting to the chaotic trajectory, whereas the fixed points that correspond to the desired periodic orbits are estimated by the recurrence method. Simultaneously, the Jacobian and sensitivity matrices are estimated by the least square regression method. Based on the defined fixed point and the

Bistable (latching) solenoid actuated propellant isolation valve

Science.gov (United States)

Wichmann, H.; Deboi, H. H.

1979-01-01

The design, fabrication, assembly and test of a development configuration bistable (latching) solenoid actuated propellant isolation valve suitable for the control hydrazine and liquid fluorine to an 800 pound thrust rocket engine is described. The valve features a balanced poppet, utilizing metal bellows, a hard poppet/seat interface and a flexure support system for the internal moving components. This support system eliminates sliding surfaces, thereby rendering the valve free of self generated particles.

msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

Science.gov (United States)

Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

2015-02-01

Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

Directory of Open Access Journals (Sweden)

Qinna Cui

Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.