WorldWideScience

Sample records for opa1 intron sequence

  1. Antisense Oligonucleotide Mediated Splice Correction of a Deep Intronic Mutation in OPA1

    Directory of Open Access Journals (Sweden)

    Tobias Bonifert

    2016-01-01

    Full Text Available Inherited optic neuropathies (ION present an important cause of blindness in the European working-age population. Recently we reported the discovery of four independent families with deep intronic mutations in the main inherited optic neuropathies gene OPA1. These deep intronic mutations cause mis-splicing of the OPA1 pre-messenger-RNA transcripts by creating cryptic acceptor splice sites. As a rescue strategy we sought to prevent mis-splicing of the mutant pre-messenger-RNA by applying 2′O-methyl-antisense oligonucleotides (AONs with a full-length phosphorothioate backbone that target the cryptic acceptor splice sites and the predicted novel branch point created by the deep intronic mutations, respectively. Transfection of patient-derived primary fibroblasts with these AONs induced correct splicing of the mutant pre-messenger-RNA in a time and concentration dependent mode of action, as detected by pyrosequencing of informative heterozygous variants. The treatment showed strong rescue effects (≃55% using the cryptic acceptor splice sites targeting AON and moderate rescue (≃16% using the branch point targeting AON. The highest efficacy of Splice correction could be observed 4 days after treatment however, significant effects were still seen 14 days post-transfection. Western blot analysis revealed increased amounts of OPA1 protein with maximum amounts at ≃3 days post-treatment. In summary, we provide the first mutation-specific in vitro rescue strategy for OPA1 deficiency using synthetic AONs.

  2. Origin of introns by 'intronization' of exonic sequences

    DEFF Research Database (Denmark)

    Irimia, Manuel; Rukov, Jakob Lewin; Penny, David;

    2008-01-01

    The mechanisms of spliceosomal intron creation have proved elusive. Here we describe a new mechanism: the recruitment of internal exonic sequences ('intronization') in Caenorhabditis species. The numbers of intronization events and introns gained by other mechanisms are similar, suggesting...

  3. Genomic deletions in OPA1 in Danish patients with autosomal dominant optic atrophy

    Directory of Open Access Journals (Sweden)

    Larsen Michael

    2011-04-01

    Full Text Available Abstract Background Autosomal dominant optic atrophy (ADOA, Kjer disease, MIM #165500 is the most common form of hereditary optic neuropathy. Mutations in OPA1 located at chromosome 3q28 are the predominant cause for ADOA explaining between 32 and 89% of cases. Although deletions of OPA1 were recently reported in ADOA, the frequency of OPA1 genomic rearrangements in Denmark, where ADOA has a high prevalence, is unknown. The aim of the study was to identify copy number variations in OPA1 in Danish ADOA patients. Methods Forty unrelated ADOA patients, selected from a group of 100 ADOA patients as being negative for OPA1 point mutations, were tested for genomic rearrangements in OPA1 by multiplex ligation probe amplification (MLPA. When only one probe was abnormal results were confirmed by additional manually added probes. Segregation analysis was performed in families with detected mutations when possible. Results Ten families had OPA1 deletions, including two with deletions of the entire coding region and eight with intragenic deletions. Segregation analysis was possible in five families, and showed that the deletions segregated with the disease. Conclusion Deletions in the OPA1 gene were found in 10 patients presenting with phenotypic autosomal dominant optic neuropathy. Genetic testing for deletions in OPA1 should be offered for patients with clinically diagnosed ADOA and no OPA1 mutations detected by DNA sequencing analysis.

  4. A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family

    Science.gov (United States)

    Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

    2014-11-01

    Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

  5. OPA1-associated disorders: phenotypes and pathophysiology

    DEFF Research Database (Denmark)

    Amati-Bonneau, Patrizia; Milea, Dan; Bonneau, Dominique

    2009-01-01

    in patients with hereditary optic neuropathies indicates that the clinical spectrum of ADOA is larger than previously thought. Specific OPA1 mutations are responsible for several distinct clinical presentations, such as ADOA with deafness (ADOAD), and severe multi-systemic syndromes, the so-called "ADOA plus......" disorders, which involve neurological and neuromuscular symptoms similar to those due to mitochondrial oxidative phosphorylation defects or mitochondrial DNA instability. The study of the various clinical presentations of ADOA in conjunction with the investigation of OPA1 mutations in fibroblasts from...

  6. OPA1-related dominant optic atrophy is not strongly influenced by mitochondrial DNA background

    Directory of Open Access Journals (Sweden)

    Amati-Bonneau Patrizia

    2009-07-01

    Full Text Available Abstract Background Leber's hereditary optic neuropathy (LHON and autosomal dominant optic atrophy (ADOA are the most frequent forms of hereditary optic neuropathies. LHON is associated with mitochondrial DNA (mtDNA mutations whereas ADOA is mainly due to mutations in the OPA1 gene that encodes a mitochondrial protein involved in the mitochondrial inner membrane remodeling. A striking influence of mtDNA haplogroup J on LHON expression has been demonstrated and it has been recently suggested that this haplogroup could also influence ADOA expression. In this study, we have tested the influence of mtDNA backgrounds on OPA1 mutations. Methods To define the relationships between OPA1 mutations and mtDNA backgrounds, we determined the haplogroup affiliation of 41 French patients affected by OPA1-related ADOA by control-region sequencing and RFLP survey of their mtDNAs. Results The comparison between patient and reference populations did not revealed any significant difference. Conclusion Our results argue against a strong influence of mtDNA background on ADOA expression. These data allow to conclude that OPA1 could be considered as a "severe mutation", directly responsible of the optic atrophy, whereas OPA1-negative ADOA and LHON mutations need an external factor(s to express the pathology (i.e. synergistic interaction with mitochondrial background.

  7. Sequence features responsible for intron retention in human

    Directory of Open Access Journals (Sweden)

    Sakabe Noboru

    2007-02-01

    Full Text Available Abstract Background One of the least common types of alternative splicing is the complete retention of an intron in a mature transcript. Intron retention (IR is believed to be the result of intron, rather than exon, definition associated with failure of the recognition of weak splice sites flanking short introns. Although studies on individual retained introns have been published, few systematic surveys of large amounts of data have been conducted on the mechanisms that lead to IR. Results TTo understand how sequence features are associated with or control IR, and to produce a generalized model that could reveal previously unknown signals that regulate this type of alternative splicing, we partitioned intron retention events observed in human cDNAs into two groups based on the relative abundance of both isoforms and compared relevant features. We found that a higher frequency of IR in human is associated with individual introns that have weaker splice sites, genes with shorter intron lengths, higher expression levels and lower density of both a set of exon splicing silencers (ESSs and the intronic splicing enhancer GGG. Both groups of retained introns presented events conserved in mouse, in which the retained introns were also short and presented weaker splice sites. Conclusion Although our results confirmed that weaker splice sites are associated with IR, they showed that this feature alone cannot explain a non-negligible fraction of events. Our analysis suggests that cis-regulatory elements are likely to play a crucial role in regulating IR and also reveals previously unknown features that seem to influence its occurrence. These results highlight the importance of considering the interplay among these features in the regulation of the relative frequency of IR.

  8. Novel OPA1 mutation featuring spastic paraparesis and intestinal dysmotility

    Directory of Open Access Journals (Sweden)

    Mohamed Kazamel

    2014-01-01

    Full Text Available A 58-year-old man with optic atrophy, spastic paraparesis, axonal sensorimotor peripheral neuropathy and intestinal dysmotility harbors a novel heterozygous missense mutation in the mitochondrial import signal peptide of OPA1. The case underscores the role of OPA1 in the pathogenesis of spastic paraparesis, so far reported only in very few cases, and it adds intestinal dysmotility to the spectrum of adult-onset clinical manifestation of OPA1-associated disease.

  9. Reversible optic neuropathy with OPA1 exon 5b mutation

    DEFF Research Database (Denmark)

    Cornille, K.; Milea, D.; Amati-Bonneau, P.

    2008-01-01

    A new c.740G>A (R247H) mutation in OPA1 alternate spliced exon 5b was found in a patient presenting with bilateral optic neuropathy followed by partial, spontaneous visual recovery. R247H fibroblasts from the patient and his unaffected father presented unusual highly tubular mitochondrial network......, significant increased susceptibility to apoptosis, oxidative phosphorylation uncoupling, and altered OPA1 protein profile, supporting the pathogenicity of this mutation. These results suggest that the clinical spectrum of the OPA1-associated optic neuropathies may be larger than previously described...

  10. OPA1基因G401D突变导致常染色体视神经萎缩和听力受损%The G401D mutation of OPA1 causes autosomal dominant optic atrophy and hearing loss in a Chinese family

    Institute of Scientific and Technical Information of China (English)

    柯铁; 聂尚武; 杨琴波; 刘剑萍; 周琳娜; 任翔; 刘静宇; 王擎; 刘木根

    2006-01-01

    Objective To describe the clinical and genetic characteristics of a Chinese family affected with optic atrophy 1 (OPA1). Methods Linkage analysis and DNA sequencing as well as PCR/restriction fragment length polymorphism (RFLP) analysis were performed to identify the disease-causing mutation. Results A missense mutation, G401D in the OPA1 gene was identified, and the patients demonstrate inherited syndrome of optic atrophy and hearing loss. Conclusion The present study demonstrates that a mutation in the OPA1 gene can cause optic atrophy in Chinese patients, and supports the notion that OPA1 mutation may lead to OPA1 combined with hearing loss.%目的 对一个中国视神经萎缩1(optic atrophy 1, OPA1)家系进行临床和基因分析. 方法 对家系进行连锁分析,通过测序和限制性片段长度多态鉴定致病基因突变. 结果 在家系患者中均发现OPA1基因的一个错义突变1202(G→A),即G401D, 而且患者呈现出视神经萎缩以及听力受损的综合征症状.结论 在中国OPA1患者中鉴定了OPA1基因突变,并支持OPA1基因突变可导致伴随有听力受损的视神经萎缩.

  11. Nearest neighbour spacing distribution of basis in some intron-less and intron-containing DNA sequences

    CERN Document Server

    Higareda, M F; Méndez-Sánchez, R A

    2006-01-01

    We show that the nearest neighbour distribution of distances between basis pairs of some intron-less and intron-containing coding regions are the same when a procedure, called {\\em unfolding}, is applied. Such a procedure consists in separating the secular variations from the oscillatory terms. The form of the distribution obtained is quite similar to that of a random, i.e. Poissonian, sequence. This is done for the HUMBMYH7CD, DROMYONMA, HUMBMYH7 and DROMHC sequences. The first two correspond to highly coding regions while the last two correspond to non-coding regions. We also show that the distributions before the unfolding procedure depend on the secular part but, after the unfolding procedure we obtain an striking result: all distributions are similar to each other. The result becomes independent of the content of introns or the species we have chosen. This is in contradiction with the results obtained with the detrended fluctuation analysis in which the correlations yield different results for intron-les...

  12. A novel OPA1 mutation in a Chinese family with autosomal dominant optic atrophy

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Juanjuan; Yuan, Yimin; Lin, Bing; Feng, Hao; Li, Yan [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou 325027, Zhejiang (China); Dai, Xianning; Zhou, Huihui [Attardi Institute of Mitochondrial Biomedicine and Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou 325035, Zhejiang (China); Dong, Xujie [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou 325027, Zhejiang (China); Liu, Xiao-Ling, E-mail: lxl@mail.eye.ac.cn [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou 325027, Zhejiang (China); Guan, Min-Xin, E-mail: min-xin.guan@cchmc.org [Attardi Institute of Mitochondrial Biomedicine and Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou 325035, Zhejiang (China); Institute of Genetics, Zhejiang University, Hangzhou, Zhejiang 310012 (China); Division of Human Genetics, Cincinnati Children' s Hospital Medical Center, OH 45229 (United States)

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer We report the characterization of a four-generation large Chinese family with ADOA. Black-Right-Pointing-Pointer We find a new heterozygous mutation c.C1198G in OPA1 gene which may be a novel pathogenic mutation in this pedigree. Black-Right-Pointing-Pointer We do not find any mitochondrial DNA mutations associated with optic atrophy. Black-Right-Pointing-Pointer Other factors may also contribute to the phenotypic variability of ADOA in this pedigree. -- Abstract: A large four-generation Chinese family with autosomal dominant optic atrophy (ADOA) was investigated in the present study. Eight of the family members were affected in this pedigree. The affected family members exhibited early-onset and progressive visual impairment, resulting in mild to profound loss of visual acuity. The average age-at-onset was 15.9 years. A new heterozygous mutation c.C1198G was identified by sequence analysis of the 12th exon of the OPA1 gene. This mutation resulted in a proline to alanine substitution at codon 400, which was located in an evolutionarily conserved region. This missense mutation in the GTPase domain was supposed to result in a loss of function for the encoded protein and act through a dominant negative effect. No other mutations associated with optic atrophy were found in our present study. The c.C1198G heterozygous mutation in the OPA1 gene may be a novel key pathogenic mutation in this pedigree with ADOA. Furthermore, additional nuclear modifier genes, environmental factors, and psychological factors may also contribute to the phenotypic variability of ADOA in this pedigree.

  13. The antiapoptotic OPA1/Parl couple participates in mitochondrial adaptation to heat shock☆

    Science.gov (United States)

    Sanjuán Szklarz, Luiza K.; Scorrano, Luca

    2012-01-01

    The mitochondria-shaping protein optic atrophy 1 (OPA1) has genetically distinguishable roles in mitochondrial morphology and apoptosis. The latter depends on the presenilin associated rhomboid like (PARL) protease, essential for the accumulation of a soluble intermembrane space form of OPA1 (IMS-OPA1). Here we show that OPA1 and PARL participate in the heat shock response, a stereotypical cellular process of adaptation to thermal stress. Upon heat shock, long forms of OPA1 are lost and mitochondria fragment. However, mitochondrial fusion is dispensable to maintain viability, whereas IMS-OPA1 is required. Upon conditioning—a process of mild heat shock and recovery—IMS-OPA1 accumulates, OPA1 oligomers increase and mitochondria release less cytochrome c, ultimately resulting in cellular resistance to subsequent apoptotic inducers. In Parl−/− cells accumulation of IMS-OPA1 is blunted and conditioning fails to protect from cytochrome c release and apoptosis. Thus, the OPA1/PARL dependent pathway of cristae remodeling is implicated in heat shock. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). PMID:22579715

  14. Novel OPA1 missense mutation in a family with optic atrophy and severe widespread neurological disorder.

    Science.gov (United States)

    Liskova, Petra; Ulmanova, Olga; Tesina, Petr; Melsova, Hana; Diblik, Pavel; Hansikova, Hana; Tesarova, Marketa; Votruba, Marcela

    2013-05-01

    To identify the underlying molecular genetic cause in a Czech family with optic atrophy, deafness, ptosis, ophthalmoplegia, polyneuropathy and ataxia transmitted as an autosomal dominant trait. Ophthalmological and neurological examination followed by molecular genetic analyses. Seven family members were clinically affected. There was a variable but progressive visual, hearing and neurological disability across the family as a whole. The majority of subjects presented with impairment of visual function and a variable degree of ptosis and/or ophthalmoplegia from the first to the third decade of life. Deafness, neuropathy and ataxia appeared later, in the third and fourth decade. Migraine, tachycardia, intention tremor, nystagmus and cervical dystonia were observed in isolated individuals. A significant overall feature was the high level of neurological disability leading to 3 of 4 members being unable to walk or stand unaided before the age of 60 years. A novel missense mutation c.1345A>C (p.Thr449Pro) in OPA1 segregating with the disease phenotype over three generations was detected. In silico analysis supported pathogenicity of the identified sequence variant. Our work expands the spectrum of mutation in OPA1, which may lead to severe multisystem neurological disorder. The molecular genetic cause of dominant optic atrophy in the Czech population is reported for the first time. We propose that regular cardiac follow-up in patients diagnosed with dominant optic atrophy and widespread neurological disease should be considered. © 2013 The Authors. Acta Ophthalmologica © 2013 Acta Ophthalmologica Scandinavica Foundation.

  15. Ancient, highly polymorphic human major histocompatibility complex DQA1 intron sequence

    Energy Technology Data Exchange (ETDEWEB)

    McGinnis, M.D.; Quinn, D.L.; Lebo, R.V. [Univ. of California, San Francisco, CA (United States); Simons, M.J. [GeneType Pty. Ltd., Fitzroy, Victoria (Australia)

    1994-10-01

    A 438 basepair intron 1 sequence adjacent to exon 2 in the human major histocompatibility complex DQA1 gene defined 16 allelic variants in 69 individuals from wide ethnic backgrounds. In contrast, the most variable coding region spanned by the 247 basepair exon 2 defined 11 allelic variants. Our phylogenetic human intron 1 tree derived by the Bootstrap algorithm reflects the same relative allelic relationships as the reported DQA1 exon 2 have cosegregated since divergence of the human races. Comparison of human alleles to a Rhesus monkey DQA1 first intron sequence found only 10 nucleotide substitutions unique to Rhesus, with the other 428 positions (98%) found in at least one human allele. This high degree of homology reflects the evolutionary stability of intron sequences since these two species diverged over 20 million years ago. Because more intron 1 alleles exist than exon 2 alleles, these polymorphic introns can be used to improve tissue typing for transplantation, paternity testing, and forensics and to derive more complete phylogenetic trees. These results suggest that introns represent a previously underutilized polymorphic resource. 42 refs., 3 figs., 1 tab.

  16. Common variants of OPA1 conferring genetic susceptibility to leprosy in Han Chinese from Southwest China.

    Science.gov (United States)

    Xiang, Yang-Lin; Zhang, Deng-Feng; Wang, Dong; Li, Yu-Ye; Yao, Yong-Gang

    2015-11-01

    Leprosy is an ancient chronic infection caused by Mycobacterium leprae. Onset of leprosy was highly affected by host nutritional condition and energy production, (partially) due to genomic loss and parasitic life style of M. leprae. The optic atrophy 1 (OPA1) gene plays an essential role in mitochondria, which function in cellular energy supply and innate immunity. To investigate the potential involvement of OPA1 in leprosy. We analyzed 7 common genetic variants of OPA1 in 1110 Han Chinese subjects with and without leprosy, followed by mRNA expression profiling and protein-protein interaction (PPI) network analysis. We observed positive associations between OPA1 variants rs9838374 (Pgenotypic=0.003) and rs414237 (Pgenotypic=0.002) with lepromatous leprosy. expression quantitative trait loci (eQTL) analysis showed that the leprosy-related risk allele C of rs414237 is correlated with lower OPA1 mRNA expression level. Indeed, we identified a decrease of OPA1 mRNA expression in both with patients and cellular model of leprosy. In addition, the PPI analysis showed that OPA1 protein was actively involved in the interaction network of M. leprae induced differentially expressed genes. Our results indicated that OPA1 variants confer risk of leprosy and may affect OPA1 expression, mitochondrial function and antimicrobial pathways. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. Intron sequences provide a tool for high-resolution phylogenetic analysis of volvocine algae.

    Science.gov (United States)

    Liss, M; Kirk, D L; Beyser, K; Fabry, S

    1997-03-01

    Three nuclear spliceosomal introns in conserved locations were amplified and sequenced from 28 strains representing 14 species and 4 genera of volvocalean green algae. Data derived from the three different introns yielded congruent results in nearly all cases. In pairwise comparisons, a spectrum of taxon-specific sequence differences ranging from complete identity to no significant similarity was observed, with the most distantly related organisms lacking any conserved elements apart from exon-intron boundaries and a pyrimidine-rich stretch near the 3' splice site. A metric (SI50), providing a measure of the degree of similarity of any pair of intron sequences, was defined and used to calculate phylogenetic distances between organisms whose introns displayed statistically significant similarities. The rate of sequences divergence in the introns was great enough to provide useful information about relationships among different geographical isolates of a single species, but in most cases was too great to provide reliable guides to relationships above the species level. A substitution rate of approximately 3 x 10(-8) per intron position per year was estimated, which is about 150-fold higher than in nuclear genes encoding rRNA and about 10-fold higher than the synonymous substitution rate in protein-coding regions. Thus, these homologous introns not only provide useful information about intraspecific phylogenetic relationships, but also illustrate the concept that different parts of a gene may be subject to extremely different intensities of selection. The intron data generated here (1) reliably resolve for the first time the relationships among the five most extensively studied strains of Volvox, (2) reveal that two other Volvox species may be more closely related than had previously been suspected, (3) confirm prior evidence that particular isolates of Eudorina elegans and Pleodorina illinoisensis appear to be sibling taxa, and (4) contribute to the resolution of

  18. a Simple Symmetric Algorithm Using a Likeness with Introns Behavior in RNA Sequences

    Science.gov (United States)

    Regoli, Massimo

    2009-02-01

    The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. The RNA sequences has some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algoritnm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.

  19. Identification of copy number variation in the gene for autosomal dominant optic atrophy, OPA1, in a Chinese pedigree.

    Science.gov (United States)

    Jin, X; Chen, Y H; Liu, Z; Deng, Y; Li, N N; Huang, H; Qi, M; Yi, X; Zhu, J

    2015-09-21

    Autosomal dominant optic atrophy (ADOA) is an optic neuropathy characterized by bilateral optic nerve pallor and decreased visual acuity. It has been reported to be associated with two genes, OPA1, OPA3, and the OPA4, OPA5, and OPA8 loci. However, mutations in OPA1 constitute the most prevalent cause of ADOA. The purpose of this study was to identify the underlying genetic defect in a Chinese pedigree with ADOA. DNA from six members of a Chinese pedigree was collected for testing genomic and copy number variation (CNV) by targeted region capture and next generation sequencing (targeted NGS). A new developmental CNV detection method was applied to analyze the sequence data. Further verification of CNV was performed by real-time polymerase chain reaction (PCR). Three members of the pedigree with clinically diagnosed ADOA were screened for pathogenic genes related to ophthalmic genetic disease. No eligible pathogenic point mutations associated with ADOA disease-causing genes were found in pedigree members with ADOA. Upon further analysis for CNVs, we found a heterozygous deletion in exons 1-9 of OPA1, which was confirmed by real-time PCR. In this study we used a new developmental method to detect CNVs associated with ADOA in a Chinese pedigree. To our knowledge, this is the first case of ADOA caused by a CNV of the OPA1 gene in Chinese patients. The findings suggest that CNVs might be an important mutation type in Chinese patients with ADOA, and that CNV screening should be performed when point mutation screens are negative in these patients.

  20. Opa1 is required for proper mitochondrial metabolism in early development.

    Directory of Open Access Journals (Sweden)

    Jennifer J Rahn

    Full Text Available Opa1 catalyzes fusion of inner mitochondrial membranes and formation of the cristae. OPA1 mutations in humans lead to autosomal dominant optic atrophy. OPA1 knockout mice lose viability around embryonic day 9 from unknown reasons, indicating that OPA1 is essential for embryonic development. Zebrafish are an attractive model for studying vertebrate development and have been used for many years to describe developmental events that are difficult or impractical to view in mammalian models. In this study, Opa1 was successfully depleted in zebrafish embryos using antisense morpholinos, which resulted in disrupted mitochondrial morphology. Phenotypically, these embryos exhibited abnormal blood circulation and heart defects, as well as small eyes and small pectoral fin buds. Additionally, startle response was reduced and locomotor activity was impaired. Furthermore, Opa1 depletion caused bioenergetic defects, without impairing mitochondrial efficiency. In response to mitochondrial dysfunction, a transient upregulation of the master regulator of mitochondrial biogenesis, pgc1a, was observed. These results not only reveal a new Opa1-associated phenotype in a vertebrate model system, but also further elucidates the absolute requirement of Opa1 for successful vertebrate development.

  1. Genomic deletions in OPA1 in Danish patients with autosomal dominant optic atrophy

    DEFF Research Database (Denmark)

    Almind, Gitte J; Grønskov, Karen; Milea, Dan;

    2011-01-01

    Autosomal dominant optic atrophy (ADOA, Kjer disease, MIM #165500) is the most common form of hereditary optic neuropathy. Mutations in OPA1 located at chromosome 3q28 are the predominant cause for ADOA explaining between 32 and 89% of cases. Although deletions of OPA1 were recently reported...

  2. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  3. Exon sequence requirements for excision in vivo of the bacterial group II intron RmInt1

    Directory of Open Access Journals (Sweden)

    Toro Nicolás

    2011-05-01

    Full Text Available Abstract Background Group II intron splicing proceeds through two sequential transesterification reactions in which the 5' and 3'-exons are joined together and the lariat intron is released. The intron-encoded protein (IEP assists the splicing of the intron in vivo and remains bound to the excised intron lariat RNA in a ribonucleoprotein particle (RNP that promotes intron mobility. Exon recognition occurs through base-pairing interactions between two guide sequences on the ribozyme domain dI known as EBS1 and EBS2 and two stretches of sequence known as IBS1 and IBS2 on the 5' exon, whereas the 3' exon is recognized through interaction with the sequence immediately upstream from EBS1 [(δ-δ' interaction (subgroup IIA] or with a nucleotide [(EBS3-IBS3 interaction (subgroup IIB and IIC] located in the coordination-loop of dI. The δ nucleotide is involved in base pairing with another intron residue (δ' in subgroup IIB introns and this interaction facilitates base pairing between the 5' exon and the intron. Results In this study, we investigated nucleotide requirements in the distal 5'- and 3' exon regions, EBS-IBS interactions and δ-δ' pairing for excision of the group IIB intron RmInt1 in vivo. We found that the EBS1-IBS1 interaction was required and sufficient for RmInt1 excision. In addition, we provide evidence for the occurrence of canonical δ-δ' pairing and its importance for the intron excision in vivo. Conclusions The excision in vivo of the RmInt1 intron is a favored process, with very few constraints for sequence recognition in both the 5' and 3'-exons. Our results contribute to understand how group II introns spread in nature, and might facilitate the use of RmInt1 in gene targeting.

  4. Progressive External Ophthalmoplegia and Vision and Hearing Loss in a Patient With Mutations in POLG2 and OPA1

    Science.gov (United States)

    Ferraris, Silvio; Clark, Susanna; Garelli, Emanuela; Davidzon, Guido; Moore, Steven A.; Kardon, Randy H.; Bienstock, Rachelle J.; Longley, Matthew J.; Mancuso, Michelangelo; Ríos, Purificación Gutiérrez; Hirano, Michio; Copeland, William C.; DiMauro, Salvatore

    2008-01-01

    Objective To describe the clinical features, muscle pathological characteristics, and molecular studies of a patient with a mutation in the gene encoding the accessory subunit (p55) of polymerase γ (POLG2) and a mutation in the OPA1 gene. Design Clinical examination and morphological, biochemical, and molecular analyses. Setting Tertiary care university hospitals and molecular genetics and scientific computing laboratory. Patient A 42-year-old man experienced hearing loss, progressive external ophthalmoplegia (PEO), loss of central vision, macrocytic anemia, and hypogonadism. His family history was negative for neurological disease, and his serum lactate level was normal. Results A muscle biopsy specimen showed scattered intensely succinate dehydrogenase–positive and cytochrome-c oxidase–negative fibers. Southern blot of muscle mitochondrial DNA showed multiple deletions. The results of screening for mutations in the nuclear genes associated with PEO and multiple mitochondrial DNA deletions, including those in POLG (polymerase γ gene), ANT1 (gene encoding adenine nucleotide translocator 1), and PEO1, were negative, but sequencing of POLG2 revealed a G1247C mutation in exon 7, resulting in the substitution of a highly conserved glycine with an alanine at codon 416 (G416A). Because biochemical analysis of the mutant protein showed no alteration in chromatographic properties and normal ability to protect the catalytic subunit from N-ethylmaleimide, we also sequenced the OPA1 gene and identified a novel heterozygous mutation (Y582C). Conclusion Although we initially focused on the mutation in POLG2, the mutation in OPA1 is more likely to explain the late-onset PEO and multisystem disorder in this patient. PMID:18195150

  5. The Opa1-Dependent Mitochondrial Cristae Remodeling Pathway Controls Atrophic, Apoptotic, and Ischemic Tissue Damage

    Science.gov (United States)

    Varanita, Tatiana; Soriano, Maria Eugenia; Romanello, Vanina; Zaglia, Tania; Quintana-Cabrera, Rubén; Semenzato, Martina; Menabò, Roberta; Costa, Veronica; Civiletto, Gabriele; Pesce, Paola; Viscomi, Carlo; Zeviani, Massimo; Di Lisa, Fabio; Mongillo, Marco; Sandri, Marco; Scorrano, Luca

    2015-01-01

    Summary Mitochondrial morphological and ultrastructural changes occur during apoptosis and autophagy, but whether they are relevant in vivo for tissue response to damage is unclear. Here we investigate the role of the optic atrophy 1 (OPA1)-dependent cristae remodeling pathway in vivo and provide evidence that it regulates the response of multiple tissues to apoptotic, necrotic, and atrophic stimuli. Genetic inhibition of the cristae remodeling pathway in vivo does not affect development, but protects mice from denervation-induced muscular atrophy, ischemic heart and brain damage, as well as hepatocellular apoptosis. Mechanistically, OPA1-dependent mitochondrial cristae stabilization increases mitochondrial respiratory efficiency and blunts mitochondrial dysfunction, cytochrome c release, and reactive oxygen species production. Our results indicate that the OPA1-dependent cristae remodeling pathway is a fundamental, targetable determinant of tissue damage in vivo. PMID:26039448

  6. Dysregulated mitophagy and mitochondrial organization in optic atrophy due to OPA1 mutations

    Science.gov (United States)

    Liao, Chunyan; Ashley, Neil; Diot, Alan; Morten, Karl; Phadwal, Kanchan; Williams, Andrew; Fearnley, Ian; Rosser, Lyndon; Lowndes, Jo; Fratter, Carl; Ferguson, David J.P.; Vay, Laura; Quaghebeur, Gerardine; Moroni, Isabella; Bianchi, Stefania; Lamperti, Costanza; Downes, Susan M.; Sitarz, Kamil S.; Flannery, Padraig J.; Carver, Janet; Dombi, Eszter; East, Daniel; Laura, Matilde; Reilly, Mary M.; Mortiboys, Heather; Prevo, Remko; Campanella, Michelangelo; Daniels, Matthew J.; Zeviani, Massimo; Yu-Wai-Man, Patrick; Simon, Anna Katharina; Votruba, Marcela

    2017-01-01

    Objective: To investigate mitophagy in 5 patients with severe dominantly inherited optic atrophy (DOA), caused by depletion of OPA1 (a protein that is essential for mitochondrial fusion), compared with healthy controls. Methods: Patients with severe DOA (DOA plus) had peripheral neuropathy, cognitive regression, and epilepsy in addition to loss of vision. We quantified mitophagy in dermal fibroblasts, using 2 high throughput imaging systems, by visualizing colocalization of mitochondrial fragments with engulfing autophagosomes. Results: Fibroblasts from 3 biallelic OPA1(−/−) patients with severe DOA had increased mitochondrial fragmentation and mitochondrial DNA (mtDNA)–depleted cells due to decreased levels of OPA1 protein. Similarly, in siRNA-treated control fibroblasts, profound OPA1 knockdown caused mitochondrial fragmentation, loss of mtDNA, impaired mitochondrial function, and mitochondrial mislocalization. Compared to controls, basal mitophagy (abundance of autophagosomes colocalizing with mitochondria) was increased in (1) biallelic patients, (2) monoallelic patients with DOA plus, and (3) OPA1 siRNA–treated control cultures. Mitophagic flux was also increased. Genetic knockdown of the mitophagy protein ATG7 confirmed this by eliminating differences between patient and control fibroblasts. Conclusions: We demonstrated increased mitophagy and excessive mitochondrial fragmentation in primary human cultures associated with DOA plus due to biallelic OPA1 mutations. We previously found that increased mitophagy (mitochondrial recycling) was associated with visual loss in another mitochondrial optic neuropathy, Leber hereditary optic neuropathy (LHON). Combined with our LHON findings, this implicates excessive mitochondrial fragmentation, dysregulated mitophagy, and impaired response to energetic stress in the pathogenesis of mitochondrial optic neuropathies, potentially linked with mitochondrial mislocalization and mtDNA depletion. PMID:27974645

  7. Group I Intron Internal Guide Sequence Binding Strength as a Component of Ribozyme Network Formation

    Directory of Open Access Journals (Sweden)

    Laura Elizabeth Satterwhite

    2016-09-01

    Full Text Available Origins-of-life research requires searching for a plausible transition from simple chemicals to larger macromolecules that can both hold information and catalyze their own production. We have previously shown that some group I intron ribozymes possess the ability to help synthesize other ribozyme genotypes by recombination reactions in small networks in an autocatalytic fashion. By simplifying these recombination reactions, using fluorescent anisotropy, we quantified the thermodynamic binding strength between two nucleotides of two group I intron RNA fragments for all 16 possible genotype combinations. We provide evidence that the binding strength (KD between the 3-nucleotide internal guide sequence (IGS of one ribozyme and its complement in another is correlated to the catalytic ability of the ribozyme. This work demonstrates that one can begin to deconstruct the thermodynamic basis of information in prebiotic RNA systems.

  8. Increased steroidogenesis promotes early-onset and severe vision loss in females with OPA1 dominant optic atrophy

    DEFF Research Database (Denmark)

    Sarzi, Emmanuelle; Seveno, Marie; Angebault, Claire

    2016-01-01

    tested the hypothesis of deregulated steroid production in retina due to a disease-causing OPA1 mutation and its contribution to the visual phenotypic variations. Using the mouse model carrying the human recurrent OPA1 mutation, we disclosed that Opa1 haploinsufficiency leads to very high circulating...... activity, promoting RGC apoptosis in females. We further demonstrate the involvement of Muller glial cells as increased pregnenolone production in female cells is noxious and compromises their role in supporting RGC survival. In parallel, we analyzed ophthalmological data of a multicentre OPA1 patient...

  9. Dominant optic atrophy in Denmark – report of 15 novel mutations in OPA1, using a strategy with a detection rate of 90%

    Directory of Open Access Journals (Sweden)

    Almind Gitte J

    2012-08-01

    Full Text Available Abstract Background Investigation of the OPA1 mutation spectrum in autosomal dominant optic atrophy (ADOA in Denmark. Methods Index patients from 93 unrelated ADOA families were assessed for a common Danish founder mutation (c.2826_2836delinsGGATGCTCCA inOPA1. If negative, direct DNA sequencing of the coding sequence and multiplex ligation-dependent probe amplification (MLPA were performed. Results from MLPA analysis have been previously reported. Haplotype analysis was carried out analysing single nucleotide polymorphisms (SNP. Retrospective clinical data were retrieved from medical files. Results Probably causative mutations were identified in 84 out of 93 families (90% including 15 novel mutations. Three mutations c.983A > G, c.2708_2711delTTAG and c.2826_2836delinsGGATGCTCCA, were responsible for ADOA in10, 11 and 28 families, respectively, corresponding to 11%, 12% and 30%. A common haplotype in nine of ten c.983A > G families suggests that they descend from a single founder. The c.2708_2711delTTAG mutation was present on at least two haplotypes and has been repeatedly reported in various ethnic groups,thus represents a mutational hotspot. Clinical examinations of index patients with the two latter mutations demonstrated large inter- and intra-familial variations apparently. Conclusions Genetic testing for OPA1mutations assist in the diagnosis. We have identified mutations in OPA1 in 90% of families including 15 novel mutations. Both DNA sequencing and MLPA analysis are necessary to achieve a high detection rate. More than half of the affected families in Denmark are represented by three common mutations, at least two of which are due to a founder effect, which may account for the high prevalence of ADOA in Denmark.

  10. How are exons encoding transmembrane sequences distributed in the exon-intron structure of genes?

    Science.gov (United States)

    Sawada, Ryusuke; Mitaku, Shigeki

    2011-01-01

    The exon-intron structure of eukaryotic genes raises a question about the distribution of transmembrane regions in membrane proteins. Were exons that encode transmembrane regions formed simply by inserting introns into preexisting genes or by some kind of exon shuffling? To answer this question, the exon-per-gene distribution was analyzed for all genes in 40 eukaryotic genomes with a particular focus on exons encoding transmembrane segments. In 21 higher multicellular eukaryotes, the percentage of multi-exon genes (those containing at least one intron) within all genes in a genome was high (>70%) and with a mean of 87%. When genes were grouped by the number of exons per gene in higher eukaryotes, good exponential distributions were obtained not only for all genes but also for the exons encoding transmembrane segments, leading to a constant ratio of membrane proteins independent of the exon-per-gene number. The positional distribution of transmembrane regions in single-pass membrane proteins showed that they are generally located in the amino or carboxyl terminal regions. This nonrandom distribution of transmembrane regions explains the constant ratio of membrane proteins to the exon-per-gene numbers because there are always two terminal (i.e., the amino and carboxyl) regions - independent of the length of sequences.

  11. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    Tran Duc

    2010-05-01

    Full Text Available Abstract Background Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the

  12. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  13. Exome sequencing identifies a novel intronic mutation in ENG that causes recurrence of pulmonary arteriovenous malformations.

    Science.gov (United States)

    Saji, Naoki; Kawarai, Toshitaka; Miyamoto, Ryosuke; Sato, Takahiro; Morino, Hiroyuki; Orlacchio, Antonio; Oki, Ryosuke; Kimura, Kazumi; Kaji, Ryuji

    2015-05-15

    Hereditary hemorrhagic telangiectasia (HHT) occasionally can be discovered in patients with cerebrovascular disease. Pulmonary arteriovenous malformation (PAVM) is one of the complications in HHT and occasionally is causative for life-threatening embolic stroke. Several genetic defects have been reported in patients with HHT. The broad spectrum of phenotype and intrafamilial phenotype variations, including age-at-onset of vascular events, often make an early diagnosis difficult. We present here a Japanese family with a novel intronic heterozygous mutation of ENG, which was identified using whole exome sequencing (WES). The intronic mutation, IVS3+4delAGTG, results in in-frame deletion of exon 3 and would produce a shorter ENG protein lacking the extracellular forty-seven amino acid sequences, which is located within the orphan domain. Our findings highlight the importance of the domain for the downstream signaling pathway of transforming growth factor-beta and bone morphogenesis protein superfamily receptors. Considering the phenotype variations and the available treatment for vascular complications, an early diagnosis using genetic testing, including WES, should be considered for individuals at risk of HHT. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. [Development and appraisement of functional molecular marker: intron sequence amplified polymorphism (ISAP)].

    Science.gov (United States)

    Lu, Cai-Rui; Yu, Shu-Xun; Yu, Ji-Wen; Fan, Shu-Li; Song, Mei-Zhen; Wang, Wu; Ma, Shu-Juan

    2008-09-01

    Molecular markers are playing an increasingly important role in map construction, QTL analysis, gene mapping and marker-assisted selection. Researchers hope the target gene and locus are as close as possible, one locus can present one gene, or linked with some important trait, then, individuals with useful trait can be selected through molecular markers selecting, and it's the functional molecular marker. PCR-based molecular markers such as RAPD, SSR, AFLP amplified non-coding regions, or the whole genome randomly, the locus is far away from the gene of targeted trait, this limit the ap-plication of these molecular markers. This study established a kind of functional molecular markers based on intron of gene sequence, trying to link loci with gene sequence to achieve the purpose of its function. It used the conservative consistent sequence of intron splicing sites as its core sequence of amplification. ISAP is a PCR-based marker system, it has two kinds of primers: forward primer and reverse primer, both primers are 18 bases. Any of the primers can be used to construct a primer combination with the other kind of primers. Seventeen primers, 9 forward and 8 reverse, were used to construct 72 primer combinations, 67 of them showed polymorphism in a G. hirsutum cv. CCRI36 x G. barbadense cv. H7124 F2 population and a total of 212 loci were obtained. Together with 164 SRAP loci, these 212 loci were used to construct a genetic linkage map. ISAP markers distributed evenly in the entire linkage group, part of the region had a high saturation, might be the coding sequence-rich region. Sequencing results of 20 fragments showed that 85% of the sequences announced homology with published EST sequence stored in the NCBI which indicated that they were amplified adjacent to expressed sequences. These results showed that ISAP marker system was simple, efficient, reliable, and had a relatively high polymorphism, furthermore, it directly targeted gene sequence, was a functional

  15. Deregulation of Mitochondria-Shaping Proteins Opa-1 and Drp-1 in Manganese-Induced Apoptosis

    Science.gov (United States)

    Alaimo, Agustina; Gorojod, Roxana M.; Beauquis, Juan; Muñoz, Manuel J.; Saravia, Flavia; Kotler, Mónica L.

    2014-01-01

    Mitochondria are dynamic organelles that undergo fusion and fission processes. These events are regulated by mitochondria-shaping proteins. Changes in the expression and/or localization of these proteins lead to a mitochondrial dynamics impairment and may promote apoptosis. Increasing evidence correlates the mitochondrial dynamics disruption with the occurrence of neurodegenerative diseases. Therefore, we focused on this topic in Manganese (Mn)-induced Parkinsonism, a disorder associated with Mn accumulation preferentially in the basal ganglia where mitochondria from astrocytes represent an early target. Using MitoTracker Red staining we observed increased mitochondrial network fission in Mn-exposed rat astrocytoma C6 cells. Moreover, Mn induced a marked decrease in fusion protein Opa-1 levels as well as a dramatic increase in the expression of fission protein Drp-1. Additionally, Mn provoked a significant release of high MW Opa-1 isoforms from the mitochondria to the cytosol as well as an increased Drp-1 translocation to the mitochondria. Both Mdivi-1, a pharmacological Drp-1 inhibitor, and rat Drp-1 siRNA reduced the number of apoptotic nuclei, preserved the mitochondrial network integrity and prevented cell death. CsA, an MPTP opening inhibitor, prevented mitochondrial Δψm disruption, Opa-1 processing and Drp-1 translocation to the mitochondria therefore protecting Mn-exposed cells from mitochondrial disruption and apoptosis. The histological analysis and Hoechst 33258 staining of brain sections of Mn-injected rats in the striatum showed a decrease in cellular mass paralleled with an increase in the occurrence of apoptotic nuclei. Opa-1 and Drp-1 expression levels were also changed by Mn-treatment. Our results demonstrate for the first time that abnormal mitochondrial dynamics is implicated in both in vitro and in vivo Mn toxicity. In addition we show that the imbalance in fusion/fission equilibrium might be involved in Mn-induced apoptosis. This knowledge may

  16. Rhomboid-7 over-expression results in Opa1-like processing and malfunctioning mitochondria.

    Science.gov (United States)

    Rahman, Mokhlasur; Kylsten, Per

    2011-10-22

    Rhomboid-7 (rho-7) is a mitochondrial-specific intramembranous protease. The loss-of-function mutation rho-7 results in semi-lethality, while escapers have a reduced lifespan with several neurological disorders [1]. Here we show that general, or CNS-specific expression of rho-7 can rescue the lethality of rho-7. General, or CNS-specific over-expression of rho-7 in otherwise wild-type animals caused semi-lethality, with approximately 50% of the animals escaping this lethality, developing into adults displaying a shortened life span with larval locomotory problem. On a cellular level, over-expression resulted in severe depression of ATP levels and cytochrome c oxidase subunit II mRNA levels, a lowered number of mitochondria in neurons and aggregation of mitochondria in the brain indicating mitochondrial malfunction. Over-expression of rho-7 in developing eye discs resulted in an elevated apoptotic index. In the CNS, elevated levels of rho-7 were accompanied by both isoforms of Opa1-like, a dynamin-like GTPase, a mitochondrial component involved in regulating mitochondrial dynamics and function, including apoptosis. Most, but not all, of rho-7 over-expression phenotypes were suppressed by introducing a heterozygous mutation for Opa1-like. Our results suggest that rho-7 and Opa1-like function in a common molecular pathway affecting mitochondrial function and apoptosis in Drosophila melanogaster.

  17. Different evolutionary pathway of B*570101 and B*5801 (B17 group) alleles based in intron sequences.

    Science.gov (United States)

    Martinez-Laso, Jorge; Moscoso, Juan; Zamora, Jorge; Martin-Villa, Manuel; Lowy, Ernesto; Vargas-Alarcon, Gilberto; Serrano-Vela, Juan Ignacio; Gomez-Casado, Eduardo; Arnaiz-Villena, Antonio

    2004-03-01

    Two theories about MHC allele generation have been put forward: (1) point mutation diversification and/or (2) gene conversion events. A model supporting the existence of both of these mechanisms is shown in this paper; the possible evolution of the HLA-B*570101 and HLA-B*5801 alleles (which belong to the HLA-B17 serology group) is studied. The hypothesis favoured is that gene conversion events have originated these alleles, because intron sequences are also analysed. Evolution by point mutation should only be accepted if flanking introns have also been sequenced.

  18. Phylogenetic inferences in Avena based on analysis of FL intron2 sequences.

    Science.gov (United States)

    Peng, Yuan-Ying; Wei, Yu-Ming; Baum, Bernard R; Yan, Ze-Hong; Lan, Xiu-Jin; Dai, Shou-Fen; Zheng, You-Liang

    2010-09-01

    The development and application of molecular methods in oats has been relatively slow compared with other crops. Results from the previous analyses have left many questions concerning species evolutionary relationships unanswered, especially regarding the origins of the B and D genomes, which are only known to be present in polyploid oat species. To investigate the species and genome relationships in genus Avena, among 13 diploid (A and C genomes), we used the second intron of the nuclear gene FLORICAULA/LEAFY (FL int2) in seven tetraploid (AB and AC genomes), and five hexaploid (ACD genome) species. The Avena FL int2 is rather long, and high levels of variation in length and sequence composition were found. Evidence for more than one copy of the FL int2 sequence was obtained for both the A and C genome groups, and the degree of divergence of the A genome copies was greater than that observed within the C genome sequences. Phylogenetic analysis of the FL int2 sequences resulted in topologies that contained four major groups; these groups reemphasize the major genomic divergence between the A and C genomes, and the close relationship among the A, B, and D genomes. However, the D genome in hexaploids more likely originated from a C genome diploid rather than the generally believed A genome, and the C genome diploid A. clauda may have played an important role in the origination of both the C and D genome in polyploids.

  19. Sequencing of Intron 3 of Porcine Heart Fatty Acid-Binding Protein Gene%猪H-FABP基因intron3全序列测定

    Institute of Scientific and Technical Information of China (English)

    杨文平; 张家琦; 李彩桃; 王明艳; 张红梅; 李超; 曹果清; 周忠孝

    2012-01-01

    [目的]为将H-FABP基因应用于猪育种过程中的标记辅助选择提供基础资料.[方法]根据GenBank数据库上公开发表的相关的猪H-FABP基因序列设计特异性扩增引物,对H-FABP基因内含子3的PCR产物纯化后直接进行测序.[结果]成功扩增出猪H-FABP基因intron 3的全序列,全长为1 350 bp,已向GenBank数据库提交,检索号为DQ 002993.[结论]该研究为确定影响肌内脂肪沉积的主效基因奠定了理论基础.%[ Objective ]The aim of this paper is to provide the basic data for marker-assisted selection of pig breeding using porcine heart fatty acid-binding protein (H-FABP) gene. [Method]According to the related sequences of porcine H-FABP gene released in GenBank,specific primers were designed to amplify the intron 3 of porcine H-FABP gene. [ Result] The intron 3 of porcine H-FABP gene was amplified successfully. Its whole sequence was 1 350 bp in length and had been submitted to GenBank (Accesion no. :DQ 002993). [Conclusion] The study lays a theoretical foundation for deter ruination of the major genes affecting intramuscular fat deposition.

  20. Association of OPA1 polymorphisms with NTG and HTG: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Yatu Guo

    Full Text Available BACKGROUND: Genetic polymorphisms of the Optic atrophy 1 gene have been implicated in altering the risk of primary open angle glaucoma (POAG, especially the susceptibility to normal tension glaucoma (NTG, but the results remain controversial. METHODS: Multiple electronic databases (up to January 20, 2012 were searched independently by two investigators. A meta-analysis was performed on the association between Optic atrophy 1 polymorphisms (rs 166850 and rs 10451941 and normal tension glaucoma (NTG/high tension glaucoma (HTG. Summary odds ratios (ORs and 95% confidence intervals (CI were estimated. RESULTS: Seven studies of 713 cases and 964 controls for NTG and five studies of 1200 cases and 971 controls for HTG on IVS8+4C>T (rs 166850 and IVS8+32T>C (rs10451941 were identified. There were significant associations between the OPA1 rs10451941polymorphism and NTG susceptibility for all genetic models(C vs. T OR = 1.26, 95% CI 1.09-1.47, p = 0.002; CC vs. TT: OR = 1.52, 95% CI 1.04-2.20, p = 0.029; CC vs. CT+TT: OR = 1.64, 95% CI 1.16-2.33, p = 0.005; CC+CT vs. TT: OR = 1.21, 95% CI 1.02-1.44, p = 0.032. However, no evidence of associations was detected between the OPA1 IVS8+32C>T polymorphism and POAG susceptibility to HTG. Similarly, clear associations between the rs 166850 variant and NTG were observed in allelic and dominant models (T vs. C OR = 1.52, 95% CI 1.16-1.99, p = 0.002; TT+TC vs. CC OR = 1.50, 95% CI 1.13-2.01, p = 0.006 but not to HTG. In subgroup analyses by ethnicity, we detected an association between both OPA1 polymorphisms and risk for NTG in Caucasians but not in Asians. By contrast, no significant findings were noted between OPA1 variants for HTG, either in Caucasians or in Asians. CONCLUSIONS: Both the IVS8+4C>T and IVS8+32T>C variants may affect individual susceptibility to NTG. Moreover, stratified analyses for NTG detecting the effects of both OPA1 polymorphisms seemed to vary with ethnicity. Further investigations are

  1. Expression of the human glucokinase gene: important roles of the 5' flanking and intron 1 sequences.

    Directory of Open Access Journals (Sweden)

    Yi Wang

    Full Text Available BACKGROUND: Glucokinase plays important tissue-specific roles in human physiology, where it acts as a sensor of blood glucose levels in the pancreas, and a few other cells of the gut and brain, and as the rate-limiting step in glucose metabolism in the liver. Liver-specific expression is driven by one of the two tissue-specific promoters, and has an absolute requirement for insulin. The sequences that mediate regulation by insulin are incompletely understood. METHODOLOGY/PRINCIPAL FINDINGS: To better understand the liver-specific expression of the human glucokinase gene we compared the structures of this gene from diverse mammals. Much of the sequence located between the 5' pancreatic beta-cell-specific and downstream liver-specific promoters of the glucokinase genes is composed of repetitive DNA elements that were inserted in parallel on different mammalian lineages. The transcriptional activity of the liver-specific promoter 5' flanking sequences were tested with and without downstream intronic sequences in two human liver cells lines, HepG2 and L-02. While glucokinase liver-specific 5' flanking sequences support expression in liver cell lines, a sequence located about 2000 bases 3' to the liver-specific mRNA start site represses gene expression. Enhanced reporter gene expression was observed in both cell lines when cells were treated with fetal calf serum, but only in the L-02 cells was expression enhanced by insulin. CONCLUSIONS/SIGNIFICANCE: Our results suggest that the normal liver L-02 cell line may be a better model to understand the regulation of the liver-specific expression of the human glucokinase gene. Our results also suggest that sequences downstream of the liver-specific mRNA start site have important roles in the regulation of liver-specific glucokinase gene expression.

  2. Phylogenetic relationships of 18 passerines based on Adenylate Kinase Intron 5 sequences

    Institute of Scientific and Technical Information of China (English)

    GUO Hui-yan; YU Hui-xin; BAI Su-ying; MA Yu-kun

    2008-01-01

    The 18 species of bird studied originally are known to belong to muscicapids, robins and sylviids of passerines, but some disputations are always present in their classification systems. In this experiment, phylogenetic relationships of 18 species of passerines were studied using Adenylate Kinase Intron 5 (AK5) sequences and DNA techniques. Through sequences analysis in comparison with each other, phylogenetic tree figures of 18 species of passerines were constructed using Neighbor-Joining (NJ) and Maximum-Parsimony (MP) methods . The results showed that sylviids should be listed as an independent family, while robins and flycatchers should be listed into Muscicapidae. Since the phylogenetic relationships between long-tailed tits and old world warblers are closer than that between long-tailed tits and parids, the long-tailed tits should be independent of paridae and be categorized into aegithalidae. Muscicapidae and Paridae are known to be two monophylitic families, but Sylviidae is not a monophyletic group. AK5 sequences had better efficacy in resolving close relationships of interspecies among intrageneric groups.

  3. Hybridization Capture-Based Next-Generation Sequencing to Evaluate Coding Sequence and Deep Intronic Mutations in the NF1 Gene.

    Science.gov (United States)

    Cunha, Karin Soares; Oliveira, Nathalia Silva; Fausto, Anna Karoline; de Souza, Carolina Cruz; Gros, Audrey; Bandres, Thomas; Idrissi, Yamina; Merlio, Jean-Philippe; de Moura Neto, Rodrigo Soares; Silva, Rosane; Geller, Mauro; Cappellen, David

    2016-12-17

    Neurofibromatosis 1 (NF1) is one of the most common genetic disorders and is caused by mutations in the NF1 gene. NF1 gene mutational analysis presents a considerable challenge because of its large size, existence of highly homologous pseudogenes located throughout the human genome, absence of mutational hotspots, and diversity of mutations types, including deep intronic splicing mutations. We aimed to evaluate the use of hybridization capture-based next-generation sequencing to screen coding and noncoding NF1 regions. Hybridization capture-based next-generation sequencing, with genomic DNA as starting material, was used to sequence the whole NF1 gene (exons and introns) from 11 unrelated individuals and 1 relative, who all had NF1. All of them met the NF1 clinical diagnostic criteria. We showed a mutation detection rate of 91% (10 out of 11). We identified eight recurrent and two novel mutations, which were all confirmed by Sanger methodology. In the Sanger sequencing confirmation, we also included another three relatives with NF1. Splicing alterations accounted for 50% of the mutations. One of them was caused by a deep intronic mutation (c.1260 + 1604A > G). Frameshift truncation and missense mutations corresponded to 30% and 20% of the pathogenic variants, respectively. In conclusion, we show the use of a simple and fast approach to screen, at once, the entire NF1 gene (exons and introns) for different types of pathogenic variations, including the deep intronic splicing mutations.

  4. Hybridization Capture-Based Next-Generation Sequencing to Evaluate Coding Sequence and Deep Intronic Mutations in the NF1 Gene

    Science.gov (United States)

    Cunha, Karin Soares; Oliveira, Nathalia Silva; Fausto, Anna Karoline; de Souza, Carolina Cruz; Gros, Audrey; Bandres, Thomas; Idrissi, Yamina; Merlio, Jean-Philippe; de Moura Neto, Rodrigo Soares; Silva, Rosane; Geller, Mauro; Cappellen, David

    2016-01-01

    Neurofibromatosis 1 (NF1) is one of the most common genetic disorders and is caused by mutations in the NF1 gene. NF1 gene mutational analysis presents a considerable challenge because of its large size, existence of highly homologous pseudogenes located throughout the human genome, absence of mutational hotspots, and diversity of mutations types, including deep intronic splicing mutations. We aimed to evaluate the use of hybridization capture-based next-generation sequencing to screen coding and noncoding NF1 regions. Hybridization capture-based next-generation sequencing, with genomic DNA as starting material, was used to sequence the whole NF1 gene (exons and introns) from 11 unrelated individuals and 1 relative, who all had NF1. All of them met the NF1 clinical diagnostic criteria. We showed a mutation detection rate of 91% (10 out of 11). We identified eight recurrent and two novel mutations, which were all confirmed by Sanger methodology. In the Sanger sequencing confirmation, we also included another three relatives with NF1. Splicing alterations accounted for 50% of the mutations. One of them was caused by a deep intronic mutation (c.1260 + 1604A > G). Frameshift truncation and missense mutations corresponded to 30% and 20% of the pathogenic variants, respectively. In conclusion, we show the use of a simple and fast approach to screen, at once, the entire NF1 gene (exons and introns) for different types of pathogenic variations, including the deep intronic splicing mutations. PMID:27999334

  5. Hybridization Capture-Based Next-Generation Sequencing to Evaluate Coding Sequence and Deep Intronic Mutations in the NF1 Gene

    Directory of Open Access Journals (Sweden)

    Karin Soares Cunha

    2016-12-01

    Full Text Available Neurofibromatosis 1 (NF1 is one of the most common genetic disorders and is caused by mutations in the NF1 gene. NF1 gene mutational analysis presents a considerable challenge because of its large size, existence of highly homologous pseudogenes located throughout the human genome, absence of mutational hotspots, and diversity of mutations types, including deep intronic splicing mutations. We aimed to evaluate the use of hybridization capture-based next-generation sequencing to screen coding and noncoding NF1 regions. Hybridization capture-based next-generation sequencing, with genomic DNA as starting material, was used to sequence the whole NF1 gene (exons and introns from 11 unrelated individuals and 1 relative, who all had NF1. All of them met the NF1 clinical diagnostic criteria. We showed a mutation detection rate of 91% (10 out of 11. We identified eight recurrent and two novel mutations, which were all confirmed by Sanger methodology. In the Sanger sequencing confirmation, we also included another three relatives with NF1. Splicing alterations accounted for 50% of the mutations. One of them was caused by a deep intronic mutation (c.1260 + 1604A > G. Frameshift truncation and missense mutations corresponded to 30% and 20% of the pathogenic variants, respectively. In conclusion, we show the use of a simple and fast approach to screen, at once, the entire NF1 gene (exons and introns for different types of pathogenic variations, including the deep intronic splicing mutations.

  6. Ethambutol-induced optic neuropathy linked to OPA1 mutation and mitochondrial toxicity.

    Science.gov (United States)

    Guillet, Virginie; Chevrollier, Arnaud; Cassereau, Julien; Letournel, Franck; Gueguen, Naïg; Richard, Laurence; Desquiret, Valérie; Verny, Christophe; Procaccio, Vincent; Amati-Bonneau, Patrizia; Reynier, Pascal; Bonneau, Dominique

    2010-03-01

    Ethambutol (EMB), widely used in the treatment of tuberculosis, has been reported to cause Leber's hereditary optic neuropathy in patients carrying mitochondrial DNA mutations. We study the effect of EMB on mitochondrial metabolism in fibroblasts from controls and from a man carrying an OPA1 mutation, in whom the drug induced the development of autosomal dominant optic atrophy (ADOA). EMB produced a mitochondrial coupling defect together with a 25% reduction in complex IV activity. EMB induced the formation of vacuoles associated with decreased mitochondrial membrane potential and increased fragmentation of the mitochondrial network. Mitochondrial genetic variations may therefore be predisposing factors in EMB-induced ocular injury.

  7. The C. elegans Opa1 homologue EAT-3 is essential for resistance to free radicals.

    Science.gov (United States)

    Kanazawa, Takayuki; Zappaterra, Mauro D; Hasegawa, Ayako; Wright, Ashley P; Newman-Smith, Erin D; Buttle, Karolyn F; McDonald, Kent; Mannella, Carmen A; van der Bliek, Alexander M

    2008-02-29

    The C. elegans eat-3 gene encodes a mitochondrial dynamin family member homologous to Opa1 in humans and Mgm1 in yeast. We find that mutations in the C. elegans eat-3 locus cause mitochondria to fragment in agreement with the mutant phenotypes observed in yeast and mammalian cells. Electron microscopy shows that the matrices of fragmented mitochondria in eat-3 mutants are divided by inner membrane septae, suggestive of a specific defect in fusion of the mitochondrial inner membrane. In addition, we find that C. elegans eat-3 mutant animals are smaller, grow slower, and have smaller broodsizes than C. elegans mutants with defects in other mitochondrial fission and fusion proteins. Although mammalian Opa1 is antiapoptotic, mutations in the canonical C. elegans cell death genes ced-3 and ced-4 do not suppress the slow growth and small broodsize phenotypes of eat-3 mutants. Instead, the phenotypes of eat-3 mutants are consistent with defects in oxidative phosphorylation. Moreover, eat-3 mutants are hypersensitive to paraquat, which promotes damage by free radicals, and they are sensitive to loss of the mitochondrial superoxide dismutase sod-2. We conclude that free radicals contribute to the pathology of C. elegans eat-3 mutants.

  8. Mitochondrial oxidative phosphorylation compensation may preserve vision in patients with OPA1-linked autosomal dominant optic atrophy.

    Science.gov (United States)

    Van Bergen, Nicole J; Crowston, Jonathan G; Kearns, Lisa S; Staffieri, Sandra E; Hewitt, Alex W; Cohn, Amy C; Mackey, David A; Trounce, Ian A

    2011-01-01

    Autosomal Dominant Optic Atrophy (ADOA) is the most common inherited optic atrophy where vision impairment results from specific loss of retinal ganglion cells of the optic nerve. Around 60% of ADOA cases are linked to mutations in the OPA1 gene. OPA1 is a fission-fusion protein involved in mitochondrial inner membrane remodelling. ADOA presents with marked variation in clinical phenotype and varying degrees of vision loss, even among siblings carrying identical mutations in OPA1. To determine whether the degree of vision loss is associated with the level of mitochondrial impairment, we examined mitochondrial function in lymphoblast cell lines obtained from six large Australian OPA1-linked ADOA pedigrees. Comparing patients with severe vision loss (visual acuity [VA]vision (VA>6/9) a clear defect in mitochondrial ATP synthesis and reduced respiration rates were observed in patients with poor vision. In addition, oxidative phosphorylation (OXPHOS) enzymology in ADOA patients with normal vision revealed increased complex II+III activity and levels of complex IV protein. These data suggest that OPA1 deficiency impairs OXPHOS efficiency, but compensation through increases in the distal complexes of the respiratory chain may preserve mitochondrial ATP production in patients who maintain normal vision. Identification of genetic variants that enable this response may provide novel therapeutic insights into OXPHOS compensation for preventing vision loss in optic neuropathies.

  9. Drosophila Erect wing (Ewg) controls mitochondrial fusion during muscle growth and maintenance by regulation of the Opa1-like gene.

    Science.gov (United States)

    Rai, Mamta; Katti, Prasanna; Nongthomba, Upendra

    2014-01-01

    Mitochondrial biogenesis and morphological changes are associated with tissue-specific functional demand, but the factors and pathways that regulate these processes have not been completely identified. A lack of mitochondrial fusion has been implicated in various developmental and pathological defects. The spatiotemporal regulation of mitochondrial fusion in a tissue such as muscle is not well understood. Here, we show in Drosophila indirect flight muscles (IFMs) that the nuclear-encoded mitochondrial inner membrane fusion gene, Opa1-like, is regulated in a spatiotemporal fashion by the transcription factor/co-activator Erect wing (Ewg). In IFMs null for Ewg, mitochondria undergo mitophagy and/or autophagy accompanied by reduced mitochondrial functioning and muscle degeneration. By following the dynamics of mitochondrial growth and shape in IFMs, we found that mitochondria grow extensively and fuse during late pupal development to form the large tubular mitochondria. Our evidence shows that Ewg expression during early IFM development is sufficient to upregulate Opa1-like, which itself is a requisite for both late pupal mitochondrial fusion and muscle maintenance. Concomitantly, by knocking down Opa1-like during early muscle development, we show that it is important for mitochondrial fusion, muscle differentiation and muscle organization. However, knocking down Opa1-like, after the expression window of Ewg did not cause mitochondrial or muscle defects. This study identifies a mechanism by which mitochondrial fusion is regulated spatiotemporally by Ewg through Opa1-like during IFM differentiation and growth.

  10. Occurrence of Can-SINEs and intron sequence evolution supports robust phylogeny of pinniped carnivores and their terrestrial relatives.

    Science.gov (United States)

    Schröder, Christiane; Bleidorn, Christoph; Hartmann, Stefanie; Tiedemann, Ralph

    2009-12-15

    Investigating the dog genome we found 178965 introns with a moderate length of 200-1000 bp. A screening of these sequences against 23 different repeat libraries to find insertions of short interspersed elements (SINEs) detected 45276 SINEs. Virtually all of these SINEs (98%) belong to the tRNA-derived Can-SINE family. Can-SINEs arose about 55 million years ago before Carnivora split into two basal groups, the Caniformia (dog-like carnivores) and the Feliformia (cat-like carnivores). Genome comparisons of dog and cat recovered 506 putatively informative SINE loci for caniformian phylogeny. In this study we show how to use such genome information of model organisms to research the phylogeny of related non-model species of interest. Investigating a dataset including representatives of all major caniformian lineages, we analysed 24 randomly chosen loci for 22 taxa. All loci were amplifiable and revealed 17 parsimony-informative SINE insertions. The screening for informative SINE insertions yields a large amount of sequence information, in particular of introns, which contain reliable phylogenetic information as well. A phylogenetic analysis of intron- and SINE sequence data provided a statistically robust phylogeny which is congruent with the absence/presence pattern of our SINE markers. This phylogeny strongly supports a sistergroup relationship of Musteloidea and Pinnipedia. Within Pinnipedia, we see strong support from bootstrapping and the presence of a SINE insertion for a sistergroup relationship of the walrus with the Otariidae.

  11. Application of rps16 Intron and trnL-trnF Intergenic Spacer Sequences to Identify Rengas Clone Riau

    Directory of Open Access Journals (Sweden)

    Dewi Indriyani Roslim

    2017-07-01

    Full Text Available Rengas clone Riau has been identified using morphological characters and molecular technique with a psbA-trnH intergenic spacer, however, this method can only determine its taxonomic status at genus level, namely Gluta sp.  This study reports application two DNA barcodes, i.e. rps16 intron and trnL-trnF intergenic spacer, to identify Rengas clone Riau.  The methods included collection of the leaves from Kajuik Lake, total DNA isolation, electrophoresis, PCR (polymerase chain reaction, gel purification and sequencing.  The rps16 intron size was 659 bp and the trnL-trnF intergenic spacer was 527 bp. The BLASTn analysis showed that sequences of the rps16 intron and the trnL-trnF intergenic spacer of Gluta sp clone Riau had 100% similarity to those of G. renghas deposited in GenBank.  These results were supported by high max score, high total score, query cover = 100%, and E-value = 0.  The dendrograms also showed the closest relationship of Gluta sp clone Riau with G. renghas deposited in GenBank compared to other species of Gluta.  In conclusion, this study succeeded in identifying Rengas clone Riau as Gluta renghas by using sequences of the rps16 intron and the trnL-trnF intergenic spacer. A combination of DNA barcodes could be applied to identify various plants as long as the database for the DNA barcodes is available in public database such as GenBank. 

  12. Next-Generation Sequencing Reveals Deep Intronic Cryptic ABCC8 and HADH Splicing Founder Mutations Causing Hyperinsulinism by Pseudoexon Activation

    Science.gov (United States)

    Flanagan, Sarah E.; Xie, Weijia; Caswell, Richard; Damhuis, Annet; Vianey-Saban, Christine; Akcay, Teoman; Darendeliler, Feyza; Bas, Firdevs; Guven, Ayla; Siklar, Zeynep; Ocal, Gonul; Berberoglu, Merih; Murphy, Nuala; O’Sullivan, Maureen; Green, Andrew; Clayton, Peter E.; Banerjee, Indraneel; Clayton, Peter T.; Hussain, Khalid; Weedon, Michael N.; Ellard, Sian

    2013-01-01

    Next-generation sequencing (NGS) enables analysis of the human genome on a scale previously unachievable by Sanger sequencing. Exome sequencing of the coding regions and conserved splice sites has been very successful in the identification of disease-causing mutations, and targeting of these regions has extended clinical diagnostic testing from analysis of fewer than ten genes per phenotype to more than 100. Noncoding mutations have been less extensively studied despite evidence from mRNA analysis for the existence of deep intronic mutations in >20 genes. We investigated individuals with hyperinsulinaemic hypoglycaemia and biochemical or genetic evidence to suggest noncoding mutations by using NGS to analyze the entire genomic regions of ABCC8 (117 kb) and HADH (94 kb) from overlapping ∼10 kb PCR amplicons. Two deep intronic mutations, c.1333-1013A>G in ABCC8 and c.636+471G>T HADH, were identified. Both are predicted to create a cryptic splice donor site and an out-of-frame pseudoexon. Sequence analysis of mRNA from affected individuals’ fibroblasts or lymphoblastoid cells confirmed mutant transcripts with pseudoexon inclusion and premature termination codons. Testing of additional individuals showed that these are founder mutations in the Irish and Turkish populations, accounting for 14% of focal hyperinsulinism cases and 32% of subjects with HADH mutations in our cohort. The identification of deep intronic mutations has previously focused on the detection of aberrant mRNA transcripts in a subset of disorders for which RNA is readily obtained from the target tissue or ectopically expressed at sufficient levels. Our approach of using NGS to analyze the entire genomic DNA sequence is applicable to any disease. PMID:23273570

  13. Nucleotide sequence composition adjacent to intronic splice sites improves splicing efficiency via its effect on pre-mRNA local folding in fungi.

    Science.gov (United States)

    Zafrir, Zohar; Tuller, Tamir

    2015-10-01

    RNA splicing is the central process of intron removal in eukaryotes known to regulate various cellular functions such as growth, development, and response to external signals. The canonical sequences indicating the splicing sites needed for intronic boundary recognition are well known. However, the roles and evolution of the local folding of intronic and exonic sequence features adjacent to splice sites has yet to be thoroughly studied. Here, focusing on four fungi (Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus nidulans, and Candida albicans), we performed for the first time a comprehensive high-resolution study aimed at characterizing the encoding of intronic splicing efficiency in pre-mRNA transcripts and its effect on intron evolution. Our analysis supports the conjecture that pre-mRNA local folding strength at intronic boundaries is under selective pressure, as it significantly affects splicing efficiency. Specifically, we show that in the immediate region of 12-30 nucleotides (nt) surrounding the intronic donor site there is a preference for weak pre-mRNA folding; similarly, in the region of 15-33 nt surrounding the acceptor and branch sites there is a preference for weak pre-mRNA folding. We also show that in most cases there is a preference for strong pre-mRNA folding further away from intronic splice sites. In addition, we demonstrate that these signals are not associated with gene-specific functions, and they correlate with splicing efficiency measurements (r = 0.77, P = 2.98 × 10(-21)) and with expression levels of the corresponding genes (P = 1.24 × 10(-19)). We suggest that pre-mRNA folding strength in the above-mentioned regions has a direct effect on splicing efficiency by improving the recognition of intronic boundaries. These new discoveries are contributory steps toward a broader understanding of splicing regulation and intronic/transcript evolution.

  14. Whole exome sequencing in congenital pain insensitivity identifies a novel causative intronic NTRK1-mutation due to uniparental disomy.

    Science.gov (United States)

    Kurth, Ingo; Baumgartner, Manuela; Schabhüttl, Maria; Tomni, Cecilia; Windhager, Reinhard; Strom, Tim M; Wieland, Thomas; Gremel, Kurt; Auer-Grumbach, Michaela

    2016-09-01

    Congenital insensitivity to pain and anhidrosis (CIPA), also known as hereditary sensory and autonomic neuropathy type IV (HSAN IV), is characterized by recurrent episodes of unexplained high fever, loss of pain perception and temperature sensation, absent sweating, repeated traumatic and thermal injuries, and mild mental retardation. After exclusion of obviously pathogenic mutations in NTRK1, the most common cause of CIPA, whole exome sequencing (WES) was carried out in a CIPA patient with unrelated parents. No mutations in known HSAN genes were identified. However, filtering for genes carrying two rare sequence variations detected 13 homozygous single nucleotide variants (SNV), all being located on chromosome 1. Further analysis strongly suggested that this finding might be best explained by uniparental disomy of chromosome 1. Because NTRK1 is also located on chromosome 1, we re-evaluated WES data and detected a novel intronic sequence variation at position c.2188-12 C>A, homozygously because of uniparental disomy. Subsequent analysis of NTRK1 transcripts in peripheral blood cells of the patient revealed an influence of the variant on mRNA splicing. The C>A transversion generated a novel splice-site, which led to the incorporation of 10 intronic bases into the NTRK1 mRNA and consequently to a non-functional gene product. © 2016 Wiley Periodicals, Inc.

  15. Effect of Introns and AT-Rich Sequences on Expression of the Bacterial Hygromycin B Resistance Gene in the Basidiomycete Schizophyllum commune

    Science.gov (United States)

    Scholtmeijer, Karin; Wösten, Han A. B.; Springer, Jan; Wessels, Joseph G. H.

    2001-01-01

    Previously, it was shown that introns are required for efficient mRNA accumulation in Schizophyllum commune and that the presence of AT-rich sequences in the coding region of genes can result in truncation of transcripts in this homobasidiomycete. Here we show that intron-dependent mRNA accumulation and truncation of transcripts are two independent events that both affect expression of the bacterial hygromycin B resistance gene in S. commune. PMID:11133486

  16. The 135 kbp mitochondrial genome of Agaricus bisporus is the largest known eukaryotic reservoir of group I introns and plasmid-related sequences.

    Science.gov (United States)

    Férandon, Cyril; Xu, Jianping; Barroso, Gérard

    2013-06-01

    At 135,005 nt, the mitochondrial genome in Agaricus bisporus represents the largest fungal mitochondrial genome sequenced to date. Its large size is mainly due to the presence of mobile genetic elements, including a total of 43 group I introns, three group II introns, and five DNA fragments that show sequence similarity to linear invertron-like plasmids. The introns are distributed in eight of the 15 protein coding genes. These introns contain a total of 61,092 nt (∼45.3% of the whole mitochondrial genome) and include representatives of most of the group I introns so far found in mitochondrial genomes of Basidiomycota. The plasmid-like sequences include 6730 nt total representing 5.0% of the genome. These sequences showed high-level similarities to two different mitochondrial plasmids reported for basidiomycete mushrooms: the autonomously replicating pEM in Agaricus bitorquis and the integrated linear plasmid sequences in Agrocybe aegerita and Moniliophthora perniciosa. Moreover, the plasmid-related sequences are located within or adjacent to two large (4559 nt) inverted repeats containing also two sets of mitochondrial tRNA genes. Our analyses are consistent with the hypothesis that horizontal DNA transfer has played a significant role in the evolution of the A. bisporus mitochondrial genome.

  17. A common class of transcripts with 5′-intron depletion, distinct early coding sequence features, and N1-methyladenosine modification

    Science.gov (United States)

    Cenik, Can; Chua, Hon Nian; Singh, Guramrit; Akef, Abdalla; Snyder, Michael P.; Palazzo, Alexander F.

    2017-01-01

    Introns are found in 5′ untranslated regions (5′UTRs) for 35% of all human transcripts. These 5′UTR introns are not randomly distributed: Genes that encode secreted, membrane-bound and mitochondrial proteins are less likely to have them. Curiously, transcripts lacking 5′UTR introns tend to harbor specific RNA sequence elements in their early coding regions. To model and understand the connection between coding-region sequence and 5′UTR intron status, we developed a classifier that can predict 5′UTR intron status with >80% accuracy using only sequence features in the early coding region. Thus, the classifier identifies transcripts with 5′ proximal-intron-minus-like-coding regions (“5IM” transcripts). Unexpectedly, we found that the early coding sequence features defining 5IM transcripts are widespread, appearing in 21% of all human RefSeq transcripts. The 5IM class of transcripts is enriched for non-AUG start codons, more extensive secondary structure both preceding the start codon and near the 5′ cap, greater dependence on eIF4E for translation, and association with ER-proximal ribosomes. 5IM transcripts are bound by the exon junction complex (EJC) at noncanonical 5′ proximal positions. Finally, N1-methyladenosines are specifically enriched in the early coding regions of 5IM transcripts. Taken together, our analyses point to the existence of a distinct 5IM class comprising ∼20% of human transcripts. This class is defined by depletion of 5′ proximal introns, presence of specific RNA sequence features associated with low translation efficiency, N1-methyladenosines in the early coding region, and enrichment for noncanonical binding by the EJC. PMID:27994090

  18. Molecular screening of 980 cases of suspected hereditary optic neuropathy with a report on 77 novel OPA1 mutations

    DEFF Research Database (Denmark)

    Ferré, Marc; Bonneau, Dominique; Milea, Dan

    2009-01-01

    We report the results of molecular screening in 980 patients carried out as part of their work-up for suspected hereditary optic neuropathies. All the patients were investigated for Leber's hereditary optic neuropathy (LHON) and autosomal dominant optic atrophy (ADOA), by searching for the ten...... novel OPA1 mutations reported here. The statistical analysis of this large set of mutations has led us to propose a diagnostic strategy that should help with the molecular work-up of optic neuropathies. Our results highlight the importance of investigating LHON-causing mtDNA mutations as well as OPA1...... and OPA3 mutations in cases of suspected hereditary optic neuropathy, even in absence of a family history of the disease....

  19. Introns: The Functional Benefits of Introns in Genomes

    Directory of Open Access Journals (Sweden)

    Bong-Seok Jo

    2015-12-01

    Full Text Available The intron has been a big biological mystery since it was first discovered in several aspects. First, all of the completely sequenced eukaryotes harbor introns in the genomic structure, whereas no prokaryotes identified so far carry introns. Second, the amount of total introns varies in different species. Third, the length and number of introns vary in different genes, even within the same species genome. Fourth, all introns are copied into RNAs by transcription and DNAs by replication processes, but intron sequences do not participate in protein-coding sequences. The existence of introns in the genome should be a burden to some cells, because cells have to consume a great deal of energy to copy and excise them exactly at the correct positions with the help of complicated spliceosomal machineries. The existence throughout the long evolutionary history is explained, only if selective advantages of carrying introns are assumed to be given to cells to overcome the negative effect of introns. In that regard, we summarize previous research about the functional roles or benefits of introns. Additionally, several other studies strongly suggesting that introns should not be junk will be introduced.

  20. Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns

    Directory of Open Access Journals (Sweden)

    Fraser Tresa S

    2010-11-01

    Full Text Available Abstract Background Dengue viruses (DENV are one of the most important viral diseases in the world with approximately 100 million infections and 200,000 deaths each year. The current lack of an approved tetravalent vaccine and ineffective insecticide control measures warrant a search for alternatives to effectively combat DENV. The trans-splicing variant of the Tetrahymena thermophila group I intron catalytic RNA, or ribozyme, is a powerful tool for post-transcriptional RNA modification. The nature of the ribozyme and the predictability with which it can be directed makes it a powerful tool for modifying RNA in nearly any cell type without the need for genome-altering gene therapy techniques or dependence on native cofactors. Results Several anti-DENV Group I trans-splicing introns (αDENV-GrpIs were designed and tested for their ability to target DENV-2 NGC genomes in situ. We have successfully targeted two different uracil bases on the positive sense genomic strand within the highly conserved 5'-3' cyclization sequence (CS region common to all serotypes of DENV with our αDENV-GrpIs. Our ribozymes have demonstrated ability to specifically trans-splice a new RNA sequence downstream of the targeted site in vitro and in transfected insect cells as analyzed by firefly luciferase and RT-PCR assays. The effectiveness of these αDENV-GrpIs to target infecting DENV genomes is also validated in transfected or transformed Aedes mosquito cell lines upon infection with unattenuated DENV-2 NGC. Conclusions Analysis shows that our αDENV-GrpIs have the ability to effectively trans-splice the DENV genome in situ. Notably, these results show that the αDENV-GrpI 9v1, designed to be active against all forms of Dengue virus, effectively targeted the DENV-2 NGC genome in a sequence specific manner. These novel αDENV-GrpI introns provide a striking alternative to other RNA based approaches for the transgenic suppression of DENV in transformed mosquito cells and

  1. Analysis of intron sequence variability of the conservative HMG-box of Sox9 genes in allotetraploids and their original parents

    Institute of Scientific and Technical Information of China (English)

    Liu Jifang; Liu Shaojun; Tao Min; Li Wei; Liu Yun

    2007-01-01

    The Sox genes of allotetraploids and their original maternal red crucian carp ( Carassius caassius red var. ) and original paternal common carp ( Cyprinus carpio L. ) were detected by PCR with the designed primers based on the conserved HMG-box sequence in different species. Sequencing of Sox genes indicated that two Sox9 genes (Atsox9a and Atsox9b ) existed in allotetraploids, while only one Sox9 gene existed in red crucian carp ( Rcsox9a ) and common carp ( Ccsox9b ). All of the four Sox9 genes contained an intron in the HMG-box, with the sizes of 413 bp, 703 bp, 401 bp and 714 bp, respectively. Moreover, the introns obeyed the rule of "GT-AG". A high similarity was observed between introns of Atsox9a and Rcsox9a (94.4 % ), Atsox9b and Ccsox9b (97.8 % ). Interestingly, the deduced amino acid sequences of their corresponding exons all shared 100 % identity. Thus, introns of the HMG-domain of Sox9s in allotetraploids and their original parents have not only the length polymorphism but also intron variability. Our results provide significant molecular evidence for the origin and evolution of allotetraploids.

  2. Short-term sequence evolution and vertical inheritance of the Naegleria twin-ribozyme group I intron

    Directory of Open Access Journals (Sweden)

    De Jonckheere Johan F

    2006-05-01

    Full Text Available Abstract Background Ribosomal DNA of several species of the free-living Naegleria amoeba harbors an optional group I intron within the nuclear small subunit ribosomal RNA gene. The intron (Nae.S516 has a complex organization of two ribozyme domains (NaGIR1 and NaGIR2 and a homing endonuclease gene (NaHEG. NaGIR2 is responsible for intron excision, exon ligation, and full-length intron RNA circularization, reactions typical for nuclear group I intron ribozymes. NaGIR1, however, is essential for NaHEG expression by generating the 5' end of the homing endonuclease messenger RNA. Interestingly, this unusual class of ribozyme adds a lariat-cap at the mRNA. Results To elucidate the evolutionary history of the Nae.S516 twin-ribozyme introns we have analyzed 13 natural variants present in distinct Naegleria isolates. Structural variabilities were noted within both the ribozyme domains and provide strong comparative support to the intron secondary structure. One of the introns, present in N. martinezi NG872, contains hallmarks of a degenerated NaHEG. Phylogenetic analyses performed on separate data sets representing NaGIR1, NaGIR2, NaHEG, and ITS1-5.8S-ITS2 ribosomal DNA are consistent with an overall vertical inheritance pattern of the intron within the Naegleria genus. Conclusion The Nae.S516 twin-ribozyme intron was gained early in the Naegleria evolution with subsequent vertical inheritance. The intron was lost in the majority of isolates (70%, leaving a widespread but scattered distribution pattern. Why the apparent asexual Naegleria amoebae harbors active intron homing endonucleases, dependent on sexual reproduction for its function, remains a puzzle.

  3. A phylogenetic analysis of the genus Fragaria (strawberry) using intron-containing sequence from the ADH-1 gene.

    Science.gov (United States)

    DiMeglio, Laura M; Staudt, Günter; Yu, Hongrun; Davis, Thomas M

    2014-01-01

    The genus Fragaria encompasses species at ploidy levels ranging from diploid to decaploid. The cultivated strawberry, Fragaria×ananassa, and its two immediate progenitors, F. chiloensis and F. virginiana, are octoploids. To elucidate the ancestries of these octoploid species, we performed a phylogenetic analysis using intron-containing sequences of the nuclear ADH-1 gene from 39 germplasm accessions representing nineteen Fragaria species and one outgroup species, Dasiphora fruticosa. All trees from Maximum Parsimony and Maximum Likelihood analyses showed two major clades, Clade A and Clade B. Each of the sampled octoploids contributed alleles to both major clades. All octoploid-derived alleles in Clade A clustered with alleles of diploid F. vesca, with the exception of one octoploid allele that clustered with the alleles of diploid F. mandshurica. All octoploid-derived alleles in clade B clustered with the alleles of only one diploid species, F. iinumae. When gaps encoded as binary characters were included in the Maximum Parsimony analysis, tree resolution was improved with the addition of six nodes, and the bootstrap support was generally higher, rising above the 50% threshold for an additional nine branches. These results, coupled with the congruence of the sequence data and the coded gap data, validate and encourage the employment of sequence sets containing gaps for phylogenetic analysis. Our phylogenetic conclusions, based upon sequence data from the ADH-1 gene located on F. vesca linkage group II, complement and generally agree with those obtained from analyses of protein-encoding genes GBSSI-2 and DHAR located on F. vesca linkage groups V and VII, respectively, but differ from a previous study that utilized rDNA sequences and did not detect the ancestral role of F. iinumae.

  4. A phylogenetic analysis of the genus Fragaria (strawberry using intron-containing sequence from the ADH-1 gene.

    Directory of Open Access Journals (Sweden)

    Laura M DiMeglio

    Full Text Available The genus Fragaria encompasses species at ploidy levels ranging from diploid to decaploid. The cultivated strawberry, Fragaria×ananassa, and its two immediate progenitors, F. chiloensis and F. virginiana, are octoploids. To elucidate the ancestries of these octoploid species, we performed a phylogenetic analysis using intron-containing sequences of the nuclear ADH-1 gene from 39 germplasm accessions representing nineteen Fragaria species and one outgroup species, Dasiphora fruticosa. All trees from Maximum Parsimony and Maximum Likelihood analyses showed two major clades, Clade A and Clade B. Each of the sampled octoploids contributed alleles to both major clades. All octoploid-derived alleles in Clade A clustered with alleles of diploid F. vesca, with the exception of one octoploid allele that clustered with the alleles of diploid F. mandshurica. All octoploid-derived alleles in clade B clustered with the alleles of only one diploid species, F. iinumae. When gaps encoded as binary characters were included in the Maximum Parsimony analysis, tree resolution was improved with the addition of six nodes, and the bootstrap support was generally higher, rising above the 50% threshold for an additional nine branches. These results, coupled with the congruence of the sequence data and the coded gap data, validate and encourage the employment of sequence sets containing gaps for phylogenetic analysis. Our phylogenetic conclusions, based upon sequence data from the ADH-1 gene located on F. vesca linkage group II, complement and generally agree with those obtained from analyses of protein-encoding genes GBSSI-2 and DHAR located on F. vesca linkage groups V and VII, respectively, but differ from a previous study that utilized rDNA sequences and did not detect the ancestral role of F. iinumae.

  5. A proteomic screen with Drosophila Opa1-like identifies Hsc70-5/Mortalin as a regulator of mitochondrial morphology and cellular homeostasis.

    Science.gov (United States)

    Banerjee, Shamik; Chinthapalli, Balaji

    2014-09-01

    Mitochondrial morphology is regulated by conserved proteins involved in fusion and fission processes. The mammalian Optic atrophy 1 (OPA1) that functions in mitochondrial fusion is associated with Optic Atrophy and has been implicated in inner membrane cristae remodeling during cell death. Here, we show Drosophila Optic atrophy 1-like (Opa1-like) influences mitochondrial morphology through interaction with 'mitochondria-shaping' proteins like Mitochondrial assembly regulatory factor (Marf) and Drosophila Mitofilin (dMitofilin). To gain an insight into Opa1-like's network, we delineated bonafide interactors like dMitofilin, Marf, Serine protease High temperature requirement protein A2 (HTRA2), Rhomboid-7 (Rho-7) along with novel interactors such as Mortalin ortholog (Hsc70-5) from Drosophila mitochondrial extract. Interestingly, RNAi mediated down-regulation of hsc70-5 in Drosophila wing imaginal disc's peripodial cells resulted in fragmented mitochondria with reduced membrane potential leading to proteolysis of Opa1-like. Increased ecdysone activity induced dysfunctional fragmented mitochondria for clearance through lysosomes, an effect enhanced in hsc70-5 RNAi leading to increased cell death. Over-expression of Opa1-like rescues mitochondrial morphology and cell death in prepupal tissues expressing hsc70-5 RNAi. Taken together, we have identified a novel interaction between Hsc70-5/Mortalin and Opa1-like that influences cellular homeostasis through mitochondrial fusion.

  6. Some novel intron positions in conserved Drosophila genes are caused by intron sliding or tandem duplication

    Directory of Open Access Journals (Sweden)

    Stadler Peter F

    2010-05-01

    Full Text Available Abstract Background Positions of spliceosomal introns are often conserved between remotely related genes. Introns that reside in non-conserved positions are either novel or remnants of frequent losses of introns in some evolutionary lineages. A recent gain of such introns is difficult to prove. However, introns verified as novel are needed to evaluate contemporary processes of intron gain. Results We identified 25 unambiguous cases of novel intron positions in 31 Drosophila genes that exhibit near intron pairs (NIPs. Here, a NIP consists of an ancient and a novel intron position that are separated by less than 32 nt. Within a single gene, such closely-spaced introns are very unlikely to have coexisted. In most cases, therefore, the ancient intron position must have disappeared in favour of the novel one. A survey for NIPs among 12 Drosophila genomes identifies intron sliding (migration as one of the more frequent causes of novel intron positions. Other novel introns seem to have been gained by regional tandem duplications of coding sequences containing a proto-splice site. Conclusions Recent intron gains sometimes appear to have arisen by duplication of exonic sequences and subsequent intronization of one of the copies. Intron migration and exon duplication together may account for a significant amount of novel intron positions in conserved coding sequences.

  7. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability

    Directory of Open Access Journals (Sweden)

    Joardar Vinita

    2012-12-01

    Full Text Available Abstract Background The genera Aspergillus and Penicillium include some of the most beneficial as well as the most harmful fungal species such as the penicillin-producer Penicillium chrysogenum and the human pathogen Aspergillus fumigatus, respectively. Their mitochondrial genomic sequences may hold vital clues into the mechanisms of their evolution, population genetics, and biology, yet only a handful of these genomes have been fully sequenced and annotated. Results Here we report the complete sequence and annotation of the mitochondrial genomes of six Aspergillus and three Penicillium species: A. fumigatus, A. clavatus, A. oryzae, A. flavus, Neosartorya fischeri (A. fischerianus, A. terreus, P. chrysogenum, P. marneffei, and Talaromyces stipitatus (P. stipitatum. The accompanying comparative analysis of these and related publicly available mitochondrial genomes reveals wide variation in size (25–36 Kb among these closely related fungi. The sources of genome expansion include group I introns and accessory genes encoding putative homing endonucleases, DNA and RNA polymerases (presumed to be of plasmid origin and hypothetical proteins. The two smallest sequenced genomes (A. terreus and P. chrysogenum do not contain introns in protein-coding genes, whereas the largest genome (T. stipitatus, contains a total of eleven introns. All of the sequenced genomes have a group I intron in the large ribosomal subunit RNA gene, suggesting that this intron is fixed in these species. Subsequent analysis of several A. fumigatus strains showed low intraspecies variation. This study also includes a phylogenetic analysis based on 14 concatenated core mitochondrial proteins. The phylogenetic tree has a different topology from published multilocus trees, highlighting the challenges still facing the Aspergillus systematics. Conclusions The study expands the genomic resources available to fungal biologists by providing mitochondrial genomes with consistent

  8. Revised Mimivirus major capsid protein sequence reveals intron-containing gene structure and extra domain

    Directory of Open Access Journals (Sweden)

    Suzan-Monti Marie

    2009-05-01

    Full Text Available Abstract Background Acanthamoebae polyphaga Mimivirus (APM is the largest known dsDNA virus. The viral particle has a nearly icosahedral structure with an internal capsid shell surrounded with a dense layer of fibrils. A Capsid protein sequence, D13L, was deduced from the APM L425 coding gene and was shown to be the most abundant protein found within the viral particle. However this protein remained poorly characterised until now. A revised protein sequence deposited in a database suggested an additional N-terminal stretch of 142 amino acids missing from the original deduced sequence. This result led us to investigate the L425 gene structure and the biochemical properties of the complete APM major Capsid protein. Results This study describes the full length 3430 bp Capsid coding gene and characterises the 593 amino acids long corresponding Capsid protein 1. The recombinant full length protein allowed the production of a specific monoclonal antibody able to detect the Capsid protein 1 within the viral particle. This protein appeared to be post-translationnally modified by glycosylation and phosphorylation. We proposed a secondary structure prediction of APM Capsid protein 1 compared to the Capsid protein structure of Paramecium Bursaria Chlorella Virus 1, another member of the Nucleo-Cytoplasmic Large DNA virus family. Conclusion The characterisation of the full length L425 Capsid coding gene of Acanthamoebae polyphaga Mimivirus provides new insights into the structure of the main Capsid protein. The production of a full length recombinant protein will be useful for further structural studies.

  9. mRNA sequencing of a novel NPHS2 intronic mutation in a child with focal and segmental glomerulosclerosis

    Directory of Open Access Journals (Sweden)

    Elisa Benetti

    2014-01-01

    Full Text Available The NPHS2 gene encodes podocin, a membrane protein that acts as the structural scaffold in podocyte foot processes. NPHS2 mutations are associated with steroid-resistant neph-rotic syndrome (SRNS, with the pathologic variant being focal and segmental glomerulosclerosis (FSGS, an emerging cause of end-stage renal disease in children. We describe a novel NPHS2 sequence variant in a girl with SRNS. Onset occurred at the age of seven years, with edema, hypo-proteinemia, hypoalbuminemia, hypercholesterolemia, hypertriglyceridemia and nephrotic protei-nuria. Renal function was normal and autoimmunity markers were negative. Proteinuria failed to decrease after standard steroid therapy. Renal biopsy showed FSGS. Cyclosporine therapy was instituted, but no remission of proteinuria was achieved and chronic renal failure developed. Mole-cular analysis of the NPHS2 gene revealed a homozygous nucleotide substitution in position c.451+3A>T in intron 3-4. This nucleotide substitution has not been reported in the literature till date. The effect of the detected substitution on podocin protein was demonstrated by renal biopsy RNA extraction and cDNA amplification analysis. This technique had never been applied to a NPHS2 mutation. Based on these results, immunosuppressive drugs were discontinued and conser-vative therapy was undertaken.

  10. Inferring Invasion History of Red Swamp Crayfish (Procambarus clarkii in China from Mitochondrial Control Region and Nuclear Intron Sequences

    Directory of Open Access Journals (Sweden)

    Yanhe Li

    2015-06-01

    Full Text Available Identifying the dispersal pathways of an invasive species is useful for adopting the appropriate strategies to prevent and control its spread. However, these processes are exceedingly complex. So, it is necessary to apply new technology and collect representative samples for analysis. This study used Approximate Bayesian Computation (ABC in combination with traditional genetic tools to examine extensive sample data and historical records to infer the invasion history of the red swamp crayfish, Procambarus clarkii, in China. The sequences of the mitochondrial control region and the proPOx intron in the nuclear genome of samples from 37 sites (35 in China and one each in Japan and the USA were analyzed. The results of combined scenarios testing and historical records revealed a much more complex invasion history in China than previously believed. P. clarkii was most likely originally introduced into China from Japan from an unsampled source, and the species then expanded its range primarily into the middle and lower reaches and, to a lesser extent, into the upper reaches of the Changjiang River in China. No transfer was observed from the upper reaches to the middle and lower reaches of the Changjiang River. Human-mediated jump dispersal was an important dispersal pathway for P. clarkii. The results provide a better understanding of the evolutionary scenarios involved in the rapid invasion of P. clarkii in China.

  11. Frequent mutations of the CA simple sequence repeat in intron 1 of EGFR in mismatch repair-deficient colorectal cancers

    Institute of Scientific and Technical Information of China (English)

    Marie-Pierre Buisine; Thècla Lesuffleur; Agnès Wacrenier; Christophe Mariette; Emmanuelle Leteurtre; Fabienne Escande; Sana Aissi; Amandine Ketele; Annette Leclercq; Nicole Porchet

    2008-01-01

    AIM:To investigate the polymorphic simple sequence repeat in intron 1 of the epidermal growth factor receptor gene(EGFR)(CA-SSR I),which is known to affect the efficiency of gene transcription as a putative target of the mismatch repair (MMR) machinery in colorectal tumors.METHODS:The CA-SSR I genotype was analyzed in a total of 86 primary colorectal tumors,selected upon their microsatellite instability (MSI) status [42 with high frequency MSI (MSI-H) and 44 microsatellite stable (MSS)]and their respective normal tissue.The effect of the CASSR I genotype on the expression of the EGFR gene was evaluated in 18 specimens using quantitative real-time reverse transcription PCR and immunohistochemistry.RESULTS:Mutations in CA-SSR I were detected in 86%(36 of 42) of MSI-H colorectal tumors and 0% (0 of 44) of MSS tumors,indicating the EGFR gene as a novel putative specific target of the defective MMR system (P<0.001).Impaired expression of EGFR was detected in most of the colorectal tumors analyzed [6/12 (50%) at the mRNA level and 15/18 (83%) at the peptide level].However,no association was apparent between EGFR expression and CA-SSR I status in tumors or normal tissues.CONCLUSION:Our results suggest that CA-SSR I sequence does not contribute to the regulation of EGFR transcription in colon,and should thus not be considered as a promising predictive marker for response to EGFR inhibitors in patients with colorectal cancer.

  12. Solving a 50 year mystery of a missing OPA1 mutation: more insights from the first family diagnosed with autosomal dominant optic atrophy

    Directory of Open Access Journals (Sweden)

    Zrenner Eberhart

    2010-06-01

    Full Text Available Abstract Background Up to the 1950s, there was an ongoing debate about the diversity of hereditary optic neuropathies, in particular as to whether all inherited optic atrophies can be ascribed to Leber's hereditary optic neuropathy (LHON or represent different disease entities. In 1954 W. Jaeger published a detailed clinical and genealogical investigation of a large family with explicit autosomal dominant segregation of optic atrophy thus proving the existence of a discrete disease different from LHON, which is nowadays known as autosomal dominant optic atrophy (ADOA. Since the year 2000 ADOA is associated with genomic mutations in the OPA1 gene, which codes for a protein that is imported into mitochondria where it is required for mitochondrial fusion. Interestingly enough, the underlying mutation in this family has not been identified since then. Results We have reinvestigated this family with the aim to identify the mutation and to further clarify the underlying pathomechanism. Patients showed a classical non-syndromic ADOA. The long term deterioration in vision in the two teenagers examined 50 years later is of particular note 5/20 to 6/120. Multiplex ligation probe amplification revealed a duplication of the OPA1 exons 7-9 which was confirmed by long distance PCR and cDNA analysis, resulting in an in-frame duplication of 102 amino acids. Segregation was verified in 53 available members of the updated pedigree and a penetrance of 88% was calculated. Fibroblast cultures from skin biopsies were established to assess the mitochondrial network integrity and to qualitatively and quantitatively study the consequences of the mutation on transcript and protein level. Fibroblast cultures demonstrated a fragmented mitochondrial network. Processing of the OPA1 protein was altered. There was no correlation of the OPA1 transcript levels and the OPA1 protein levels in the fibroblasts. Intriguingly an overall decrease of mitochondrial proteins was observed

  13. Comparison of Colletotrichum orbiculare and Several Allied Colletotrichum spp. for mtDNA RFLPs, Intron RFLP and Sequence Variation, Vegetative Compatibility, and Host Specificity.

    Science.gov (United States)

    Liu, B; Wasilwa, L A; Morelock, T E; O'Neill, N R; Correll, J C

    2007-10-01

    ABSTRACT Based on spore morphology, appressorium development, sequence similarities of the rDNA, and similarities in amplified restriction fragment length polymorphism (AFLP), it has been proposed that Colletotrichum orbiculare, C. trifolii, C. lindemuthianum, and C. malvarum represent a single phylogenetic species, C. orbiculare. In the current study, the phylogenetic relationship among isolates in the C. orbiculare species complex was reassessed. In all, 72 isolates of C. orbiculare from cultivated cucurbit or weed hosts, C. trifolii from alfalfa, C. lindemuthianum from green bean, and C. malvarum from prickly sida (Sida spinosa) were examined for mitochondrial DNA (mtDNA) restriction fragment length polymorphisms (RFLPs), RFLPs and sequence variation of a 900-bp intron of the glutamine synthetase gene and a 200-bp intron of the glyceraldehyde-3-phosphate dehydrogenase gene, and vegetative compatibility. In addition, host specificity was examined in foliar inoculations on cucurbit, bean, and alfalfa hosts. Inoculations also were conducted on cucumber fruit. Genetically distinct isolates, based on vegetative compatibility, within the species complex (C. orbiculare, C. trifolii, and C. malvarum) had an identical mtDNA haplotype (haplotype A) when examined with each of three different restriction enzymes. Isolates of C. lindemuthianum had a very similar mtDNA haplotype to haplotype A, with a single polymorphism detected with the enzyme HaeIII. The four species represent a phylogenetically closely related group based on a statistical analysis of the 900- and 200-bp intron sequences. However, distinct RFLPs in the 900-bp intron were consistently associated with each species and could be used to qualitatively and quantitatively distinguish each species. Furthermore, each of the species showed distinct host specificity, with isolates of C. orbiculare (from cucurbits), C. lindemuthianum, and C. trifolii being pathogenic only on cucurbits, green bean, and alfalfa

  14. Structure and expression of the human Lysyl hydroxylase gene (PLOD): Introns 9 and 16 contain Alu sequences at the sites of recombination in Ehlers-Danlos syndrome type VI patients

    Energy Technology Data Exchange (ETDEWEB)

    Heikkinen, J.; Hautala, T.; Kivirikko, K.I. [Univ. of Oulu (Finland)] [and others

    1994-12-01

    Lysyl hydroxylase (EC 1.14.11.4) catalyzes the formation of hydroxylysine in collagens by the hydroxylation of lysine residues in peptide linkages. This enzyme activity is known to be reduced in patients with the type VI variant of the Ehlers-Danlos syndrome, and the first mutations in the lysyl hydroxylase gene (PLOD) have recently been identified. We have now isolated genomic clones for human lysyl hydroxylase and determined the complete structure of the gene, which contains 19 exons and a 5{prime} flanking region with characteristics shared by housekeeping genes. The constitutive expression of the gene in different tissues further suggests that lysyl hydroxylase has an essential function. We have sequenced the introns of the gene in the region where many mutations and rearrangements analyzed to date are concentrated. Intron 9 and intron 16 show extensive homology resulting from the many Alu sequences found in these introns. Intron 9 contains five and intron 16 eight Alu sequences. The high homology and many short identical or complementary sequences in these introns generate many potential recombination sites with the gene. The delineation of the structure of the lysyl hydroxylase gene contributes significantly to our understanding of the rearrangements in the genome of Ehlers-Danlos type VI patients. 21 refs., 2 figs., 2 tabs.

  15. 牦牛和普通牛 DRB1* Intron 1-exon 2序列变异分析%Sequence Variation at BoLA-DRB1 * Intron 1-exon 2 in Yak and Cattle

    Institute of Scientific and Technical Information of China (English)

    田知利; 陈杰; 胡江; 罗玉柱; 刘秀; 李少斌; 郭淑珍; 牟永娟

    2016-01-01

    To accumulate more molecular genetics materials for revealing stress resistance and disease resist-ance breeding by testing the sequence variation at DRB1 gene and analyzing genetic parameters in detecting re-gionin in yak and cattle.Gannan yak,Qinghai yak,Tianzhu white yak,Datong yak and Cattle were used in this stud-y.The polymorphism of intron 1 and exon 2 in BoLA-DRB1 gene were analyzed using PCR-single-strand conforma-tional polymorphism.The results showed that 4 SNPs and 1 insertion /deletion mutation were detected in intron 1 , and 17 SNPs were detected in exon 2,and they were highly polymorphism;Between these two regions,twenty-one haplotypes and the linkage disequilibrium phenomenon were found,and haplptypes A-A 1 ,A-B 1 ,B-A 1 and B-B 1 were most common in yak and cattle.The cluster analysis of DRB1 gene exon 2 showed that yak and other 6 species,cat-tle and goat were the highest on homology and the phylogenetic distance consistent with their genetic relationship. DRB1 gene intron 1 and exon 2 have high of sequence polymorphism,it might be used as genetic marker in yak and cattle.%为揭示牦牛抗逆性及抗病育种积累更多的分子遗传学资料,通过检测 DRB1基因在牦牛和普通牛群体中的变异,分析该基因检测区域遗传参数。以甘南牦牛、青海牦牛、天祝白牦牛、大通牦牛和普通牛为研究对象。应用PCR-SSCP 方法检测 BoLA-DRB1基因第1内含子及第2外显子部分序列多态性。DRB1基因第1内含子区检测到4处 SNPs 及1处插入/缺失突变,第2外显子区检测到17处 SNPs,两区域均表现为高度多态;单倍型连锁分析发现21种 intron 1-exon 2单倍型组型且存在单倍型连锁不平衡现象,A-A 1、A-B 1、B-A 1和 B-B 1单倍型在牦牛和普通牛中频率较高;聚类分析表明,牦牛 DRB1基因第2外显子区碱基序列与普通牛及山羊的同源性最高,系统进化情况与它们亲缘关系远近一致。牦牛和普通牛 Bo

  16. SDOCT Thickness Measurements of Various Retinal Layers in Patients with Autosomal Dominant Optic Atrophy due to OPA1 Mutations

    Directory of Open Access Journals (Sweden)

    Andrea M. Schild

    2013-01-01

    Full Text Available Purpose. To specify thickness values of various retinal layers on macular spectral domain Optical Coherence Tomography (SDOCT scans in patients with autosomal dominant optic atrophy (ADOA compared to healthy controls. Methods. SDOCT volume scans of 7 patients with ADOA (OPA-1 mutation and 14 healthy controls were quantitatively analyzed using manual grading software. Mean thickness values for the ETDRS grid subfields 5–8 were calculated for the spaces neurosensory retina, retinal nerve fiber layer (RNFL, ganglion cell layer (GCL, a combined space of inner plexiform layer/outer plexiform layer/inner nuclear layer (IPL+INL+OPL, and a combined space of outer nuclear layer/photoreceptor layers (ONL+PL. Results. ADOA patients showed statistically significant lower retinal thickness values than controls (. RNFL ( and GCL thicknesses ( were significantly lower in ADOA patients. There was no difference in IPL+INL+OPL and in ONL+PL thickness. Conclusion. Manual subanalysis of macular SDOCT volume scans allowed detailed subanalysis of various retinal layers. Not only RNFL but also GCL thicknesses are reduced in the macular area of ADOA patients whereas subjacent layers are not involved. Together with clinical findings, macular SDOCT helps to identify patients with suspicion for hereditary optic neuropathy before genetic analysis confirms the diagnosis.

  17. Phylogenetic relationships of Cyprinidae (Teleostei: Cypriniformes) inferred from the partial S6K1 gene sequences and implication of indel sites in intron 1

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The family Cyprinidae is widely distributed in East Asia, and has the important phylogenetic signifi- cance in the fish evolution. In this study, the 5′ end partial sequences (containing exon 1, exon 2 and indel 1) of S6K1 gene were obtained from 30 representative species in Cyprinidae and outgroup using PCR amplification and sequencing. The phylogenetic relationships of Cyprinidae were reconstructed with neighbor joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian meth- ods. Myxocyprinus asiaticus (Catostomidae) was assigned to the outgroup taxon. Similar phylogenetic relationships within the family Cyprinidae were achieved with the four analyses. Leuciscini and Barbini were monophyletic lineages respectively with the high nodal supports. Leuciscini comprises Hypophthalmichthyinae, Xenocyprinae, Cultrinae, Gobioninae, Acheilognathinae and East Asian species of Leuciscinae and Danioninae. Monophyly of East Asian clade was supported with high nodal support. Barbini comprises Schizothoracinae, Barbinae, Cyprininae and Labeoninae. The monophyletic lineage consisting of Danio rerio, D. myersi, and Rasbora trilineata was basal in the tree. In addition, the large fragment indels in intron 1 were analyzed to improve the understanding of Cyprinidae relationships. The results showed that the large fragment indels were correlated with the relations among species. Some conserved regions in intron 1 were thought to be involved in the functional regulation. However, no correlation was found between sequence variations and species characteristic size.

  18. Neural-specific deletion of Htra2 causes cerebellar neurodegeneration and defective processing of mitochondrial OPA1.

    Directory of Open Access Journals (Sweden)

    Victoria L Patterson

    Full Text Available HTRA2, a serine protease in the intermembrane space, has important functions in mitochondrial stress signaling while its abnormal activity may contribute to the development of Parkinson's disease. Mice with a missense or null mutation of Htra2 fail to thrive, suffer striatal neuronal loss, and a parkinsonian phenotype that leads to death at 30-40 days of age. While informative, these mouse models cannot separate neural contributions from systemic effects due to the complex phenotypes of HTRA2 deficiency. Hence, we developed mice carrying a Htra2-floxed allele to query the consequences of tissue-specific HTRA2 deficiency. We found that mice with neural-specific deletion of Htra2 exhibited atrophy of the thymus and spleen, cessation to gain weight past postnatal (P day 18, neurological symptoms including ataxia and complete penetrance of premature death by P40. Histologically, increased apoptosis was detected in the cerebellum, and to a lesser degree in the striatum and the entorhinal cortex, from P25. Even earlier at P20, mitochondria in the cerebella already exhibited abnormal morphology, including swelling, vesiculation, and fragmentation of the cristae. Furthermore, the onset of these structural anomalies was accompanied by defective processing of OPA1, a key molecule for mitochondrial fusion and cristae remodeling, leading to depletion of the L-isoform. Together, these findings suggest that HTRA2 is essential for maintenance of the mitochondrial integrity in neurons. Without functional HTRA2, a lifespan as short as 40 days accumulates a large quantity of dysfunctional mitochondria that contributes to the demise of mutant mice.

  19. 视神经萎缩相关感觉神经性耳聋中的OPA1R445H突变

    Institute of Scientific and Technical Information of China (English)

    Amati-Bonneau; P.; Guichet; A.; Olichon; A.

    2006-01-01

    在5例视神经萎缩和耳聋患者中发现OPA1杂合子R445H突变。对患者进行听力测试表明,感觉神经性耳聋是由听神经病变所致。皮肤成纤维细胞显示,线粒体网状结构过度破碎、线粒体膜电位降低和ATP合成缺陷。另外,在豚鼠的感觉和神经耳蜗细胞发现OPA1广泛表达。因此,视神经萎缩和耳聋可能与破碎的线粒体网状结构所致能量缺陷有关。

  20. Modulation of mitochondrial function and morphology by interaction of Omi/HtrA2 with the mitochondrial fusion factor OPA1

    Energy Technology Data Exchange (ETDEWEB)

    Kieper, Nicole; Holmstroem, Kira M.; Ciceri, Dalila; Fiesel, Fabienne C. [Center of Neurology and Hertie Institute for Clinical Brain Research, 72076 Tuebingen (Germany); Wolburg, Hartwig [Institute of Pathology, University of Tuebingen, 72076 Tuebingen (Germany); Ziviani, Elena; Whitworth, Alexander J. [Medical Research Council Centre for Developmental and Biomedical Genetics, University of Sheffield, Sheffield S10 2TN (United Kingdom); Martins, L. Miguel [Cell Death Regulation Laboratory, MRC Toxicology Unit, Leicester LE1 9HN (United Kingdom); Kahle, Philipp J., E-mail: philipp.kahle@uni-tuebingen.de [Center of Neurology and Hertie Institute for Clinical Brain Research, 72076 Tuebingen (Germany); Krueger, Rejko, E-mail: rejko.krueger@uni-tuebingen.de [Center of Neurology and Hertie Institute for Clinical Brain Research, 72076 Tuebingen (Germany)

    2010-04-15

    Loss of Omi/HtrA2 function leads to nerve cell loss in mouse models and has been linked to neurodegeneration in Parkinson's and Huntington's disease. Omi/HtrA2 is a serine protease released as a pro-apoptotic factor from the mitochondrial intermembrane space into the cytosol. Under physiological conditions, Omi/HtrA2 is thought to be involved in protection against cellular stress, but the cytological and molecular mechanisms are not clear. Omi/HtrA2 deficiency caused an accumulation of reactive oxygen species and reduced mitochondrial membrane potential. In Omi/HtrA2 knockout mouse embryonic fibroblasts, as well as in Omi/HtrA2 silenced human HeLa cells and Drosophila S2R+ cells, we found elongated mitochondria by live cell imaging. Electron microscopy confirmed the mitochondrial morphology alterations and showed abnormal cristae structure. Examining the levels of proteins involved in mitochondrial fusion, we found a selective up-regulation of more soluble OPA1 protein. Complementation of knockout cells with wild-type Omi/HtrA2 but not with the protease mutant [S306A]Omi/HtrA2 reversed the mitochondrial elongation phenotype and OPA1 alterations. Finally, co-immunoprecipitation showed direct interaction of Omi/HtrA2 with endogenous OPA1. Thus, we show for the first time a direct effect of loss of Omi/HtrA2 on mitochondrial morphology and demonstrate a novel role of this mitochondrial serine protease in the modulation of OPA1. Our results underscore a critical role of impaired mitochondrial dynamics in neurodegenerative disorders.

  1. The Comparative RNA Web (CRW Site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs

    Directory of Open Access Journals (Sweden)

    Müller Kirsten M

    2002-01-01

    Full Text Available Abstract Background Comparative analysis of RNA sequences is the basis for the detailed and accurate predictions of RNA structure and the determination of phylogenetic relationships for organisms that span the entire phylogenetic tree. Underlying these accomplishments are very large, well-organized, and processed collections of RNA sequences. This data, starting with the sequences organized into a database management system and aligned to reveal their higher-order structure, and patterns of conservation and variation for organisms that span the phylogenetic tree, has been collected and analyzed. This type of information can be fundamental for and have an influence on the study of phylogenetic relationships, RNA structure, and the melding of these two fields. Results We have prepared a large web site that disseminates our comparative sequence and structure models and data. The four major types of comparative information and systems available for the three ribosomal RNAs (5S, 16S, and 23S rRNA, transfer RNA (tRNA, and two of the catalytic intron RNAs (group I and group II are: (1 Current Comparative Structure Models; (2 Nucleotide Frequency and Conservation Information; (3 Sequence and Structure Data; and (4 Data Access Systems. Conclusions This online RNA sequence and structure information, the result of extensive analysis, interpretation, data collection, and computer program and web development, is accessible at our Comparative RNA Web (CRW Site http://www.rna.icmb.utexas.edu. In the future, more data and information will be added to these existing categories, new categories will be developed, and additional RNAs will be studied and presented at the CRW Site.

  2. FGLamide Allatostatin genes in Arthropoda: introns early or late?

    Science.gov (United States)

    Martínez-Pérez, Francisco; Bendena, William G; Chang, Belinda S W; Tobe, Stephen S

    2009-07-01

    FGLamide allatostatins are invertebrate neuropeptides which inhibit juvenile hormone biosynthesis in Dictyoptera and related orders and also show myomodulatory activity. The FGLamide allatostatin (AST) gene structure in Dictyoptera is intronless within the ORF, whereas in 9 species of Diptera, the FGLamide AST ORF has one intron. To investigate the evolutionary history of AST intron structure, (intron early versus intron late hypothesis), all available Arthropoda FGLamide AST gene sequences were examined from genome databases with reference to intron presence and position/phase. Three types of FGLamide AST ORF organization were found: intronless in I. scapularis and P. humanus corporis; one intron in D. pulex, A. pisum, A. mellifera and five Drosophila sp.; two introns in N. vitripennis, B. mori strains, A. aegypti, A. gambiae and C. quinquefasciatus. The literature suggests that for the majority of genes examined, most introns exist between codons (phase 0) which may reflect an ancient function of introns to separate protein modules. 60% of the FGLamide AST ORFs introns were between the first and second base within a codon (phase 1), 28% were between the second and third nucleotides within a codon (phase two) and 12% were phase 0. As would be required for correct intron splicing consensus sequence, 84% of introns were in codons starting with guanine. The positioning of introns was a maximum of 9 codons from a dibasic cleavage site. Our results suggest that the introns in the analyzed species support the intron late model.

  3. Splicing-related features of introns serve to propel evolution.

    Science.gov (United States)

    Luo, Yuping; Li, Chun; Gong, Xi; Wang, Yanlu; Zhang, Kunshan; Cui, Yaru; Sun, Yi Eve; Li, Siguang

    2013-01-01

    The role of spliceosomal intronic structures played in evolution has only begun to be elucidated. Comparative genomic analyses of fungal snoRNA sequences, which are often contained within introns and/or exons, revealed that about one-third of snoRNA-associated introns in three major snoRNA gene clusters manifested polymorphisms, likely resulting from intron loss and gain events during fungi evolution. Genomic deletions can clearly be observed as one mechanism underlying intron and exon loss, as well as generation of complex introns where several introns lie in juxtaposition without intercalating exons. Strikingly, by tracking conserved snoRNAs in introns, we found that some introns had moved from one position to another by excision from donor sites and insertion into target sties elsewhere in the genome without needing transposon structures. This study revealed the origin of many newly gained introns. Moreover, our analyses suggested that intron-containing sequences were more prone to sustainable structural changes than DNA sequences without introns due to intron's ability to jump within the genome via unknown mechanisms. We propose that splicing-related structural features of introns serve as an additional motor to propel evolution.

  4. Splicing-related features of introns serve to propel evolution.

    Directory of Open Access Journals (Sweden)

    Yuping Luo

    Full Text Available The role of spliceosomal intronic structures played in evolution has only begun to be elucidated. Comparative genomic analyses of fungal snoRNA sequences, which are often contained within introns and/or exons, revealed that about one-third of snoRNA-associated introns in three major snoRNA gene clusters manifested polymorphisms, likely resulting from intron loss and gain events during fungi evolution. Genomic deletions can clearly be observed as one mechanism underlying intron and exon loss, as well as generation of complex introns where several introns lie in juxtaposition without intercalating exons. Strikingly, by tracking conserved snoRNAs in introns, we found that some introns had moved from one position to another by excision from donor sites and insertion into target sties elsewhere in the genome without needing transposon structures. This study revealed the origin of many newly gained introns. Moreover, our analyses suggested that intron-containing sequences were more prone to sustainable structural changes than DNA sequences without introns due to intron's ability to jump within the genome via unknown mechanisms. We propose that splicing-related structural features of introns serve as an additional motor to propel evolution.

  5. Low genetic structuring among Pericharax heteroraphis (Porifera: Calcarea) populations from the Great Barrier Reef (Australia), revealed by analysis of nrDNA and nuclear intron sequences

    Science.gov (United States)

    Bentlage, B.; Wörheide, G.

    2007-12-01

    A new nuclear marker system for sponges, the second intron of the nuclear ATP synthetase beta subunit gene (ATPSbeta-iII), was analysed together with nuclear ribosomal DNA (nrDNA) internal transcribed spacer (ITS) sequences aiming to uncover phylogeographic patterns of the coral reef sponge Pericharax heteroraphis in the south-west Pacific, focussing on the Great Barrier Reef (GBR). Variation among ITS sequences was low (Single-Stranded Conformation Polymorphism (SSCP) analysis proved to be an effective tool for phasing ATPSbeta-iII alleles of 292 bp length. Although sample sizes were limited for most populations and these results await corroboration by an extended sampling regime, a past population subdivision with subsequent range expansion was indicated by a ‘dumb-bell’ shaped statistical parsimony network of GBR ATPSbeta-iII alleles. Although no clear phylogeographic break was discovered on the GBR, the northern GBR was genetically differentiated from the central/southern GBR and Queensland Plateau, based on significant pairwise F st values (0.137-0.275 and p ≤ 0.05) of pooled regional populations. The ATPSbeta-iII used in this study outperformed the frequently employed nrDNA ITS and might also turn out to be useful for phylogeographic studies of other coral reef taxa.

  6. Group I intron ribozymes

    DEFF Research Database (Denmark)

    Nielsen, Henrik

    2012-01-01

    Group I intron ribozymes constitute one of the main classes of ribozymes and have been a particularly important model in the discovery of key concepts in RNA biology as well as in the development of new methods. Compared to other ribozyme classes, group I intron ribozymes display considerable......, the intronic products of these pathways have the potential to integrate into targets and to form various types of circular RNA molecules. Thus, group I intron ribozymes and associated elements found within group I introns is a rich source of biological phenomena. This chapter provides a strategy and protocols...... for initial characterization of new group I intron ribozymes....

  7. Stoichiometric expression of mtHsp40 and mtHsp70 modulates mitochondrial morphology and cristae structure via Opa1L cleavage.

    Science.gov (United States)

    Lee, Byoungchun; Ahn, Younghee; Kang, Sung-Myung; Park, Youngjin; Jeon, You-Jin; Rho, Jong M; Kim, Sung-Woo

    2015-06-15

    Deregulation of mitochondrial heat-shock protein 40 (mtHsp40) and dysfunction of mtHsp70 are associated with mitochondrial fragmentation, suggesting that mtHsp40 and mtHsp70 may play roles in modulating mitochondrial morphology. However, the mechanism of mitochondrial fragmentation induced by mtHsp40 deregulation and mtHsp70 dysfunction remains unclear. In addition, the functional link between mitochondrial morphology change upon deregulated mtHsp40/mtHsp70 and mitochondrial function has been unexplored. Our coimmunoprecipitation and protein aggregation analysis showed that both overexpression and depletion of mtHsp40 accumulated aggregated proteins in fragmented mitochondria. Moreover, mtHsp70 loss and expression of a mtHsp70 mutant lacking the client-binding domain caused mitochondrial fragmentation. Together the data suggest that the molecular ratio of mtHsp40 to mtHsp70 is important for their chaperone function and mitochondrial morphology. Whereas mitochondrial translocation of Drp1 was not altered, optic atrophy 1 (Opa1) short isoform accumulated in fragmented mitochondria, suggesting that mitochondrial fragmentation in this study results from aberration of mitochondrial inner membrane fusion. Finally, we found that fragmented mitochondria were defective in cristae development, OXPHOS, and ATP production. Taken together, our data suggest that impaired stoichiometry between mtHsp40 and mtHsp70 promotes Opa1L cleavage, leading to cristae opening, decreased OXPHOS, and triggering of mitochondrial fragmentation after reduction in their chaperone function.

  8. A spliceosomal intron in Giardia lamblia

    Science.gov (United States)

    Nixon, Julie E. J.; Wang, Amy; Morrison, Hilary G.; McArthur, Andrew G.; Sogin, Mitchell L.; Loftus, Brendan J.; Samuelson, John

    2002-01-01

    Short introns occur in numerous protist lineages, but there are no reports of intervening sequences in the protists Giardia lamblia and Trichomonas vaginalis, which may represent the deepest known branches in the eukaryotic line of descent. We have discovered a 35-bp spliceosomal intron in a gene encoding a putative [2Fe-2S] ferredoxin of G. lamblia. The Giardia intron contains a canonical splice site at its 3′ end (AG), a noncanonical splice site at its 5′ end (CT), and a branch point sequence that fits the yeast consensus sequence of TACTAAC except for the first nucleotide (AACTAAC). We have also identified several G. lamblia genes with spliceosomal peptides, including homologues of eukaryote-specific spliceosomal peptides (Prp8 and Prp11), several DExH-box RNA-helicases that have homologues in eubacteria, but serve essential functions in the splicing of introns in eukaryotes, and 11 predicted archaebacteria-like Sm and like-Sm core peptides, which coat small nuclear RNAs. Phylogenetic analyses show the Giardia Sm core peptides are the products of multiple, ancestral gene duplications followed by divergence, but they retain strong similarity to Sm and like-Sm peptides of other eukaryotes. Although we have documented only a single intron in Giardia, it likely has other introns and fully functional, spliceosomal machinery. If introns were added during eukaryotic evolution (the introns-late hypothesis), then these results push back the date of this event before the branching of G. lamblia. PMID:11854456

  9. Genome-wide analyses of Epstein-Barr virus reveal conserved RNA structures and a novel stable intronic sequence RNA

    OpenAIRE

    2013-01-01

    Background Epstein-Barr virus (EBV) is a human herpesvirus implicated in cancer and autoimmune disorders. Little is known concerning the roles of RNA structure in this important human pathogen. This study provides the first comprehensive genome-wide survey of RNA and RNA structure in EBV. Results Novel EBV RNAs and RNA structures were identified by computational modeling and RNA-Seq analyses of EBV. Scans of the genomic sequences of four EBV strains (EBV-1, EBV-2, GD1, and GD2) and of the clo...

  10. Conserved intron positions in ancient protein modules

    Directory of Open Access Journals (Sweden)

    de Roos Albert DG

    2007-02-01

    Full Text Available Abstract Background The timing of the origin of introns is of crucial importance for an understanding of early genome architecture. The Exon theory of genes proposed a role for introns in the formation of multi-exon proteins by exon shuffling and predicts the presence of conserved splice sites in ancient genes. In this study, large-scale analysis of potential conserved splice sites was performed using an intron-exon database (ExInt derived from GenBank. Results A set of conserved intron positions was found by matching identical splice sites sequences from distantly-related eukaryotic kingdoms. Most amino acid sequences with conserved introns were homologous to consensus sequences of functional domains from conserved proteins including kinases, phosphatases, small GTPases, transporters and matrix proteins. These included ancient proteins that originated before the eukaryote-prokaryote split, for instance the catalytic domain of protein phosphatase 2A where a total of eleven conserved introns were found. Using an experimental setup in which the relation between a splice site and the ancientness of its surrounding sequence could be studied, it was found that the presence of an intron was positively correlated to the ancientness of its surrounding sequence. Intron phase conservation was linked to the conservation of the gene sequence and not to the splice site sequence itself. However, no apparent differences in phase distribution were found between introns in conserved versus non-conserved sequences. Conclusion The data confirm an origin of introns deep in the eukaryotic branch and is in concordance with the presence of introns in the first functional protein modules in an 'Exon theory of genes' scenario. A model is proposed in which shuffling of primordial short exonic sequences led to the formation of the first functional protein modules, in line with hypotheses that see the formation of introns integral to the origins of genome evolution

  11. The origin of introns and their role in eukaryogenesis: a compromise solution to the introns-early versus introns-late debate?

    Directory of Open Access Journals (Sweden)

    Koonin Eugene V

    2006-08-01

    Full Text Available Abstract Background Ever since the discovery of 'genes in pieces' and mRNA splicing in eukaryotes, origin and evolution of spliceosomal introns have been considered within the conceptual framework of the 'introns early' versus 'introns late' debate. The 'introns early' hypothesis, which is closely linked to the so-called exon theory of gene evolution, posits that protein-coding genes were interrupted by numerous introns even at the earliest stages of life's evolution and that introns played a major role in the origin of proteins by facilitating recombination of sequences coding for small protein/peptide modules. Under this scenario, the absence of spliceosomal introns in prokaryotes is considered to be a result of "genome streamlining". The 'introns late' hypothesis counters that spliceosomal introns emerged only in eukaryotes, and moreover, have been inserted into protein-coding genes continuously throughout the evolution of eukaryotes. Beyond the formal dilemma, the more substantial side of this debate has to do with possible roles of introns in the evolution of eukaryotes. Results I argue that several lines of evidence now suggest a coherent solution to the introns-early versus introns-late debate, and the emerging picture of intron evolution integrates aspects of both views although, formally, there seems to be no support for the original version of introns-early. Firstly, there is growing evidence that spliceosomal introns evolved from group II self-splicing introns which are present, usually, in small numbers, in many bacteria, and probably, moved into the evolving eukaryotic genome from the α-proteobacterial progenitor of the mitochondria. Secondly, the concept of a primordial pool of 'virus-like' genetic elements implies that self-splicing introns are among the most ancient genetic entities. Thirdly, reconstructions of the ancestral state of eukaryotic genes suggest that the last common ancestor of extant eukaryotes had an intron

  12. Is the human dystrophin gene's intron structure related to its intron instability?

    Institute of Scientific and Technical Information of China (English)

    盛文利; 陈江瑛; 朱良付; 刘焯霖

    2003-01-01

    Objective To study the human dystrophin gene molecular deletion mechanism, we analyzed breakpoint regions within junction fragments of deletion-type patients and investigated whether the dystrophin gene's intron structure might be related to intron instability.Methods Junction fragments corresponding to exon 46 and 51 deletions were cloned. The breakpoint regions were sequenced, and the features of introns with available Genebank sequences were analyzed.Results An analysis of junction fragment sequences corresponding to exon 46 and 51 deletions showed that all 5' and 3' breakpoints are located within repeat sequences. No small insertions, small deletions, or point mutations are located near the breakpoint junctions. By analyzing the secondary structure of the junction fragments, we demonstrated that all junction fragment breakpoints are located in non-matching regions of single-stranded hairpin loops. A high concentration of repetitive elements is found to be a key feature of many dystrophin introns. In total, 34.8% of the overall dystrophin intron sequences is composed of repeat sequences.Conclusion Repeat elements in many dystrophin gene introns are the key to their structural bases and reflect intron instability. As a result of the primary DNA sequences, single-stranded hairpin loops form, increasing the instability of the gene, and forming the base for breaks in the DNA. The formation of the single-stranded hairpins can result in reattachment of two different breakpoints, producing a deletion.

  13. Phase distribution of spliceosomal introns: implications for intron origin

    Directory of Open Access Journals (Sweden)

    Yoshihama Maki

    2006-09-01

    Full Text Available Abstract Background The origin of spliceosomal introns is the central subject of the introns-early versus introns-late debate. The distribution of intron phases is non-uniform, with an excess of phase-0 introns. Introns-early explains this by speculating that a fraction of present-day introns were present between minigenes in the progenote and therefore must lie in phase-0. In contrast, introns-late predicts that the nonuniformity of intron phase distribution reflects the nonrandomness of intron insertions. Results In this paper, we tested the two theories using analyses of intron phase distribution. We inferred the evolution of intron phase distribution from a dataset of 684 gene orthologs from seven eukaryotes using a maximum likelihood method. We also tested whether the observed intron phase distributions from 10 eukaryotes can be explained by intron insertions on a genome-wide scale. In contrast to the prediction of introns-early, the inferred evolution of intron phase distribution showed that the proportion of phase-0 introns increased over evolution. Consistent with introns-late, the observed intron phase distributions matched those predicted by an intron insertion model quite well. Conclusion Our results strongly support the introns-late hypothesis of the origin of spliceosomal introns.

  14. Copper deficiency alters cell bioenergetics and induces mitochondrial fusion through up-regulation of MFN2 and OPA1 in erythropoietic cells

    Energy Technology Data Exchange (ETDEWEB)

    Bustos, Rodrigo I.; Jensen, Erik L.; Ruiz, Lina M.; Rivera, Salvador; Ruiz, Sebastián [Center for Biomedical Research, Faculty of Biological Sciences and Faculty of Medicine, Universidad Andres Bello, Santiago (Chile); Simon, Felipe; Riedel, Claudia [Center for Biomedical Research, Faculty of Biological Sciences and Faculty of Medicine, Universidad Andres Bello, Santiago (Chile); Millennium Institute of Immunology and Immunotherapy, Santiago (Chile); Ferrick, David [Seahorse Bioscience, Billerica, MA (United States); Elorza, Alvaro A., E-mail: aelorza@unab.cl [Center for Biomedical Research, Faculty of Biological Sciences and Faculty of Medicine, Universidad Andres Bello, Santiago (Chile); Millennium Institute of Immunology and Immunotherapy, Santiago (Chile)

    2013-08-02

    Highlights: •In copper deficiency, cell proliferation is not affected. In turn, cell differentiation is impaired. •Enlarged mitochondria are due to up-regulation of MNF2 and OPA1. •Mitochondria turn off respiratory chain and ROS production. •Energy metabolism switch from mitochondria to glycolysis. -- Abstract: Copper is essential in cell physiology, participating in numerous enzyme reactions. In mitochondria, copper is a cofactor for respiratory complex IV, the cytochrome c oxidase. Low copper content is associated with anemia and the appearance of enlarged mitochondria in erythropoietic cells. These findings suggest a connection between copper metabolism and bioenergetics, mitochondrial dynamics and erythropoiesis, which has not been explored so far. Here, we describe that bathocuproine disulfonate-induced copper deficiency does not alter erythropoietic cell proliferation nor induce apoptosis. However it does impair erythroid differentiation, which is associated with a metabolic switch between the two main energy-generating pathways. That is, from mitochondrial function to glycolysis. Switching off mitochondria implies a reduction in oxygen consumption and ROS generation along with an increase in mitochondrial membrane potential. Mitochondrial fusion proteins MFN2 and OPA1 were up-regulated along with the ability of mitochondria to fuse. Morphometric analysis of mitochondria did not show changes in total mitochondrial biomass but rather bigger mitochondria because of increased fusion. Similar results were also obtained with human CD34+, which were induced to differentiate into red blood cells. In all, we have shown that adequate copper levels are important for maintaining proper mitochondrial function and for erythroid differentiation where the energy metabolic switch plus the up-regulation of fusion proteins define an adaptive response to copper deprivation to keep cells alive.

  15. 内含子序列对CART基因转录调控作用的初步研究%Regulation role of intron sequence in CART gene transcription

    Institute of Scientific and Technical Information of China (English)

    张静; 裴雪涛; 王思涵; 杨印祥; 姚海雷; 陈琳; 吕洋; 南雪; 岳文; 李艳华

    2011-01-01

    目的 研究内含子序列对可卡因-苯丙胺调节转录肤(cocaine-and amphetamine-regulated transcript.CART)基因转录水平的调控作用.方法 分别以HeLa细胞和人源性间充质干细胞(mesenchymal stem cells,MSCs)的基因组DNA为模板,PCR扩增CART内含子Ⅰ(Intron)、CART截短内含子Ⅰ(去除NRSE基序,NBSEnon Intron)序列,克隆入载体 pGL3-Basic-CART32,构建pGL3-Basic-CART32-Intron、pGL3-Basic-CART32-NRSEnon Intron 荧光素酶报告载体.经质粒酶切和DNA测序进行鉴定.将报告载体瞬时转染入NT2/CloneD1细胞系,进行荧光素酶活性的分析.取1×107NT2/CloneD1细胞,采用抗NRSF和抗IgG抗体进行染色质免疫共沉淀,分析NRSF与CART内含子区NRSE的体内结合情况.结果 构建的pGL3-Basic-CART32-Intron、pGL3-Basic-CART32-NRSEnon Intron报告载体经酶切和测序鉴定正确.pGL3-Basic-CART32-Intren荧光素酶活性相对pGL3-Basic-CART32下调57.9%(P<0.05),pGL3-Basic-CART32-NBSEnon Intron相对pGL3-Basic-CART32-Intron上调53.8%(P<0.05).在NT2/CloneD1细胞中,CART内含子区NRSE调控元件能与NRSF蛋白结合.结论 研究结果表明,CART内含子序列对CART基因转录发挥负调控作用,内含子中的NRSE序列参与介导了其时CART基因的转录负调控作用.%Objective To explore the regulation role of intron sequence in CART gene transcription. Methods CART Intron and CART NRSEnon Intron fragments were respoctively amplified from human genomic DNA isolated from HeLa cells and mesenchymal stem ceils before being cloned into pGL3-Basic-CART32 vector to generate pGL3-Basic-CART32-Intron and pGL3-Basic-CART32-NRSEnon Intron reporter gene constructs. Restriction enzyme digestion and plasmid sequencing methods were used to verify the construction. Subsequently, pGL3-Basic-CART32-Intron, pGL3-Basic-CART32-NRSEnon Intron reporter gene constructs and the vector pGL3-Basic-CART32 were transfected into NTera2/CloneD1 cells and pRLCMV plasmid was co-transfected to normalize

  16. Intronic Alus influence alternative splicing.

    Directory of Open Access Journals (Sweden)

    Galit Lev-Maor

    Full Text Available Examination of the human transcriptome reveals higher levels of RNA editing than in any other organism tested to date. This is indicative of extensive double-stranded RNA (dsRNA formation within the human transcriptome. Most of the editing sites are located in the primate-specific retrotransposed element called Alu. A large fraction of Alus are found in intronic sequences, implying extensive Alu-Alu dsRNA formation in mRNA precursors. Yet, the effect of these intronic Alus on splicing of the flanking exons is largely unknown. Here, we show that more Alus flank alternatively spliced exons than constitutively spliced ones; this is especially notable for those exons that have changed their mode of splicing from constitutive to alternative during human evolution. This implies that Alu insertions may change the mode of splicing of the flanking exons. Indeed, we demonstrate experimentally that two Alu elements that were inserted into an intron in opposite orientation undergo base-pairing, as evident by RNA editing, and affect the splicing patterns of a downstream exon, shifting it from constitutive to alternative. Our results indicate the importance of intronic Alus in influencing the splicing of flanking exons, further emphasizing the role of Alus in shaping of the human transcriptome.

  17. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    Energy Technology Data Exchange (ETDEWEB)

    Solera, J. (Unidades de Genetica Molecular, Madrid (Spain)); Magallon, M.; Martin-Villar, J. (Hemofilia Hospital, Madrid (Spain)); Coloma, A. (Departamento deBioquimica de la Facultad de Medicina de la Universidad Autonoma, Madrid (Spain))

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.

  18. An intron in a ribosomal protein gene from Tetrahymena

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Andreasen, Per Hove; Dreisig, Hanne

    1986-01-01

    of hybrid-selected mRNA and authentic ribosomal proteins. The proteins show strong homology to ribosomal protein S12 from Escherichia coli. The coding region of the gene is interrupted by a 979-bp intron 68 bp downstream of the translation start. This is the first intron in a protein encoding gene...... of a ciliate to be described at the nucleotide sequence level. The intron obeys the GT/AG rule for splice junctions of nuclear mRNA introns from higher eukaryotes but lacks the pyrimidine stretch usually found in the immediate vicinity of the 3' splice junction. The structure of the intron and the fact...

  19. Finding exonic islands in a sea of non-coding sequence: splicing related constraints on protein composition and evolution are common in intron-rich genomes.

    NARCIS (Netherlands)

    Warnecke, T.; Parmley, J.L.; Hurst, L.D.

    2008-01-01

    BACKGROUND: In mammals, splice-regulatory domains impose marked trends on the relative abundance of certain amino acids near exon-intron boundaries. Is this a mammalian particularity or symptomatic of exonic splicing regulation across taxa? Are such trends more common in species that a priori have a

  20. Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation.

    Directory of Open Access Journals (Sweden)

    David M Truong

    2015-08-01

    Full Text Available Mobile bacterial group II introns are evolutionary ancestors of spliceosomal introns and retroelements in eukaryotes. They consist of an autocatalytic intron RNA (a "ribozyme" and an intron-encoded reverse transcriptase, which function together to promote intron integration into new DNA sites by a mechanism termed "retrohoming". Although mobile group II introns splice and retrohome efficiently in bacteria, all examined thus far function inefficiently in eukaryotes, where their ribozyme activity is limited by low Mg2+ concentrations, and intron-containing transcripts are subject to nonsense-mediated decay (NMD and translational repression. Here, by using RNA polymerase II to express a humanized group II intron reverse transcriptase and T7 RNA polymerase to express intron transcripts resistant to NMD, we find that simply supplementing culture medium with Mg2+ induces the Lactococcus lactis Ll.LtrB intron to retrohome into plasmid and chromosomal sites, the latter at frequencies up to ~0.1%, in viable HEK-293 cells. Surprisingly, under these conditions, the Ll.LtrB intron reverse transcriptase is required for retrohoming but not for RNA splicing as in bacteria. By using a genetic assay for in vivo selections combined with deep sequencing, we identified intron RNA mutations that enhance retrohoming in human cells, but <4-fold and not without added Mg2+. Further, the selected mutations lie outside the ribozyme catalytic core, which appears not readily modified to function efficiently at low Mg2+ concentrations. Our results reveal differences between group II intron retrohoming in human cells and bacteria and suggest constraints on critical nucleotide residues of the ribozyme core that limit how much group II intron retrohoming in eukaryotes can be enhanced. These findings have implications for group II intron use for gene targeting in eukaryotes and suggest how differences in intracellular Mg2+ concentrations between bacteria and eukarya may have

  1. Evidence for a DNA-based mechanism of intron-mediated enhancement

    Directory of Open Access Journals (Sweden)

    Alan B. Rose

    2011-12-01

    Full Text Available Many introns significantly increase gene expression through a process termed Intron-Mediated Enhancement (IME. Introns exist in the transcribed DNA and the nascent RNA, and could affect expression from either location. To determine which is more relevant to IME, hybrid introns were constructed that contain sequences from stimulating Arabidopsis thaliana introns either in their normal orientation or as the reverse complement. Both ends of each intron are from the non-stimulatory COR15a intron in their normal orientation to allow splicing. The inversions create major alterations to the sequence of the transcribed RNA with relatively minor changes to the DNA structure. Introns containing portions of either the UBQ10 or ATPK1 intron increased expression to a similar degree regardless of orientation. Also, computational predictions of IME improve when both intron strands are considered. These findings are more consistent with models of IME that act at the level of DNA rather than RNA.

  2. Ribosomal DNA sequence divergence and group I introns within the Leucostoma species L. cinctum, L. persoonii, and L. parapersoonii sp. nov., ascomycetes that cause Cytospora canker of fruit trees.

    Science.gov (United States)

    Adams, Gerard C; Surve-Iyer, Rupa S; Iezzoni, Amy F

    2002-01-01

    the small subunit (SSU) of the nuclear rDNA of L. cinctum were identified as Group 1 introns; intron 1 at position 943 and intron 2 at position 1199. The two introns were found to be consistently present in isolates of L. cinctum PG 4 and PG 5 and absent from L. cinctum PG 6 isolates, despite the similarity of the ITS sequence and teleomorph morphology. Intron 1 was of subgroup 1C1 whereas intron 2 was of an unknown subgroup. RFLP patterns and presence/absence of introns were useful characters for expediting the identification of cultures of Leucostoma isolated from stone and pome fruit cankers. RFLP patterns from 13 endonucleases provided an effective method for selecting an array of diverse PG 1 isolates useful in screening plant germplasm for disease-resistance.

  3. Intron evolution in Neurospora: the role of mutational bias and selection.

    Science.gov (United States)

    Sun, Yu; Whittle, Carrie A; Corcoran, Pádraic; Johannesson, Hanna

    2015-01-01

    We used comparative and population genomics to study intron evolutionary dynamics in the fungal model genus Neurospora. For our investigation, we used well-annotated genomes of N. crassa, N. discreta, and N. tetrasperma, and 92 resequenced genomes of N. tetrasperma from natural populations. By analyzing the four well-annotated genomes, we identified 9495 intron sites in 7619 orthologous genes. Our data supports nonhomologous end joining (NHEJ) and tandem duplication as mechanisms for intron gains in the genus and the RT-mRNA process as a mechanism for intron loss. We found a moderate intron gain rate (5.78-6.89 × 10(-13) intron gains per nucleotide site per year) and a high intron loss rate (7.53-13.76 × 10(-10) intron losses per intron sites per year) as compared to other eukaryotes. The derived intron gains and losses are skewed to high frequencies, relative to neutral SNPs, in natural populations of N. tetrasperma, suggesting that selection is involved in maintaining a high intron turnover. Furthermore, our analyses of the association between intron population-level frequency and genomic features suggest that selection is involved in shaping a 5' intron position bias and a low intron GC content. However, intron sequence analyses suggest that the gained introns were not exposed to recent selective sweeps. Taken together, this work contributes to our understanding of the importance of mutational bias and selection in shaping the intron distribution in eukaryotic genomes.

  4. Intronic alternative splicing regulators identified by comparative genomics in nematodes.

    Directory of Open Access Journals (Sweden)

    Jennifer L Kabat

    2006-07-01

    Full Text Available Many alternative splicing events are regulated by pentameric and hexameric intronic sequences that serve as binding sites for splicing regulatory factors. We hypothesized that intronic elements that regulate alternative splicing are under selective pressure for evolutionary conservation. Using a Wobble Aware Bulk Aligner genomic alignment of Caenorhabditis elegans and Caenorhabditis briggsae, we identified 147 alternatively spliced cassette exons that exhibit short regions of high nucleotide conservation in the introns flanking the alternative exon. In vivo experiments on the alternatively spliced let-2 gene confirm that these conserved regions can be important for alternative splicing regulation. Conserved intronic element sequences were collected into a dataset and the occurrence of each pentamer and hexamer motif was counted. We compared the frequency of pentamers and hexamers in the conserved intronic elements to a dataset of all C. elegans intron sequences in order to identify short intronic motifs that are more likely to be associated with alternative splicing. High-scoring motifs were examined for upstream or downstream preferences in introns surrounding alternative exons. Many of the high-scoring nematode pentamer and hexamer motifs correspond to known mammalian splicing regulatory sequences, such as (TGCATG, indicating that the mechanism of alternative splicing regulation is well conserved in metazoans. A comparison of the analysis of the conserved intronic elements, and analysis of the entire introns flanking these same exons, reveals that focusing on intronic conservation can increase the sensitivity of detecting putative splicing regulatory motifs. This approach also identified novel sequences whose role in splicing is under investigation and has allowed us to take a step forward in defining a catalog of splicing regulatory elements for an organism. In vivo experiments confirm that one novel high-scoring sequence from our analysis

  5. Origin and inheritance of group I introns in 26S rRNA genes of Gaeumannomyces graminis.

    Science.gov (United States)

    Tan, M K

    1997-06-01

    Studies of the distribution of the three group I introns (intron A, intron T, and intron AT) in the 26S rDNA of Gaeumannomyces graminis had suggested that they were transferred to a common ancestor of G. graminis var. avenae and var. tritici after it had branched off from var. graminis. Intron AT and intron A exhibited vertical inheritance and coevolved in concert with their hosts. Intron loss could occur after its acquisition. Loss of any one of the three introns could occur in var. tritici whereas only loss of intron T had been found in the majority of var. avenae isolates. The existence of isolates of var. tritici and var. avenae with three introns suggested that intron loss could be reversed by intron acquisition and that the whole process is a dynamic one. This process of intron acquisition and intron loss reached different equilibrium points for different varieties and subgroups, which explained the irregular distribution of these introns in G. graminis. Each of the three group I introns was more closely related to other intron sequences that share the same insertion point in the 26S rDNA than to each other. These introns in distantly related organisms appeared to have a common ancestry. This system had provided a good model for studies on both the lateral transfer and common ancestry of group I introns in the 26S rRNA genes.

  6. RNA-sequencing of a mouse-model of spinal muscular atrophy reveals tissue-wide changes in splicing of U12-dependent introns

    DEFF Research Database (Denmark)

    Doktor, Thomas Koed; Hua, Yimin; Andersen, Henriette Skovgaard

    2016-01-01

    Spinal Muscular Atrophy (SMA) is a neuromuscular disorder caused by insufficient levels of the Survival of Motor Neuron (SMN) protein. SMN is expressed ubiquitously and functions in RNA processing pathways that include trafficking of mRNA and assembly of snRNP complexes. Importantly, SMA severity...... is correlated with decreased snRNP assembly activity. In particular, the minor spliceosomal snRNPs are affected, and some U12-dependent introns have been reported to be aberrantly spliced in patient cells and animal models. SMA is characterized by loss of motor neurons, but the underlying mechanism is largely...... unknown. It is likely that aberrant splicing of genes expressed in motor neurons is involved in SMA pathogenesis, but increasing evidence indicates that pathologies also exist in other tissues. We present here a comprehensive RNA-seq study that covers multiple tissues in an SMA mouse model. We show...

  7. A group I intron in the nuclear small subunit ribosomal DNA of Gaeumannomyces graminis.

    Science.gov (United States)

    Fouly, H M; Wilkinson, H T

    2000-05-01

    The length of the small subunit ribosomal DNA (SSU rDNA) differs among isolates of species and varieties of Gaeumannomyces. The sequence of the 3' region of the SSU rDNA revealed 340-, 365-, and 520-bp insertions for G. graminis varieties avenae, tritici, and graminis, respectively. The intron sequences from varities tritici and avenae were similar, except there was an insert of 23 nucleotides at base 328 from the 5' end of the G. g. var. tritici intron. The G. g. var. graminis intron sequences had 92.4% homology compared with the intron sequences of varieties tritici and avenae. In addition, the intron sequence of variety graminis is larger, having an insert of 155 nucleotides at base 365 of the 5' end of the intron. Little variation in the DNA sequences flanking the introns has been detected among the isolates of Gaeumannomyces that either have or lack an intron. Reverse transcriptase PCR (RT-PCR) indicated the absence of the intron in the mature rRNA. The intron sequence had both a conserved sequence and secondary structural elements classifying it as a group I intron.

  8. Influence of intron length on interaction characters between post-spliced intron and its CDS in ribosomal protein genes

    Science.gov (United States)

    Zhao, Xiaoqing; Li, Hong; Bao, Tonglaga; Ying, Zhiqiang

    2012-09-01

    Many experiment evidences showed that sequence structures of introns and intron loss/gain can influence gene expression, but current mechanisms did not refer to the functions of post-spliced introns directly. We propose that postspliced introns play their functions in gene expression by interacting with their mRNA sequences and the interaction is characterized by the matched segments between introns and their CDS. In this study, we investigated the interaction characters with length series by improved Smith-Waterman local alignment software for the ribosomal protein genes in C. elegans and D. melanogaster. Our results showed that RF values of five intron groups are significantly high in the central non-conserved region and very low in 5'-end and 3'-end splicing region. It is interesting that the number of the optimal matched regions gradually increases with intron length. Distributions of the optimal matched regions are different for five intron groups. Our study revealed that there are more interaction regions between longer introns and their CDS than shorter, and it provides a positive pattern for regulating the gene expression.

  9. Accelerated evolution of fetuin family proteins in Protobothrops flavoviridis (habu snake) serum and the discovery of an L1-like genomic element in the intronic sequence of a fetuin-encoding gene.

    Science.gov (United States)

    Tanaka, Yasuyoshi; Oyama, Sachiko; Hori, Shin-ichi; Ushio, Koya; Shioi, Narumi; Terada, Shigeyuki; Deshimaru, Masanobu

    2013-01-01

    Habu serum factor (HSF) and HSF-like protein (HLP) are fetuin family proteins isolated from Protobothrops flavoviridis (habu snake) serum with different physiological activities. A comparison of their cDNAs and intronic sequences revealed that nucleotide substitutions were primarily in protein-coding regions, and the substitution patterns indicated accelerated evolution of these proteins. Genomic DNA fragment analysis, including intron 1, revealed a 6.6-kb insertion homologous to the full-length mammalian LINE1 (L1) retrotransposable element (PfL1) only in the HLP gene. This segment retains an open reading frame (ORF) that encodes a reverse transcriptase (RT)-like protein (PfRT). We further found that a large number of homologous segments have dispersed in the habu snake genome, although we could not determine the enzymatic activities of their products. Moreover, an analysis of habu snake liver RNA indicated active transcription of the PfRT genes, suggesting that high levels of RT activity in this snake have driven the evolution of unique phenotypes of venom enzymes and serum inhibitors of them.

  10. Introns in higher plant genes

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The intron is an important component of eukaryotic gene. Extensive studies have been conducted to get a better understanding of its structure and function. This paper presents a brief review of the structure and function of introns in higher plant genes. It is shown that higher plant introns possess structural properties shared by all eukaryotic introns, however, they also exhibit a striking degree of diversity. The process of intron splicing in higher plant genes involves interaction between multiple cis-acting elements and trans-acting factors, such as 5′ splicing site, 3′ splicing site and many protein factors. The process of intron splicing is an important level at which gene expression is regulated. Especially alternative splicing of intron can regulate time and space of gene expression. In addition, some introns in higher plant genes also regulate gene expression by affecting the pattern of gene expression, enhancing the level of gene expression and driving the gene expression.

  11. The peculiarities of large intron splicing in animals.

    Science.gov (United States)

    Shepard, Samuel; McCreary, Mark; Fedorov, Alexei

    2009-11-16

    In mammals a considerable 92% of genes contain introns, with hundreds and hundreds of these introns reaching the incredible size of over 50,000 nucleotides. These "large introns" must be spliced out of the pre-mRNA in a timely fashion, which involves bringing together distant 5' and 3' acceptor and donor splice sites. In invertebrates, especially Drosophila, it has been shown that larger introns can be spliced efficiently through a process known as recursive splicing-a consecutive splicing from the 5'-end at a series of combined donor-acceptor splice sites called RP-sites. Using a computational analysis of the genomic sequences, we show that vertebrates lack the proper enrichment of RP-sites in their large introns, and, therefore, require some other method to aid splicing. We analyzed over 15,000 non-redundant, large introns from six mammals, 1,600 from chicken and zebrafish, and 560 non-redundant large introns from five invertebrates. Our bioinformatic investigation demonstrates that, unlike the studied invertebrates, the studied vertebrate genomes contain consistently abundant amounts of direct and complementary strand interspersed repetitive elements (mainly SINEs and LINEs) that may form stems with each other in large introns. This examination showed that predicted stems are indeed abundant and stable in the large introns of mammals. We hypothesize that such stems with long loops within large introns allow intron splice sites to find each other more quickly by folding the intronic RNA upon itself at smaller intervals and, thus, reducing the distance between donor and acceptor sites.

  12. The peculiarities of large intron splicing in animals.

    Directory of Open Access Journals (Sweden)

    Samuel Shepard

    Full Text Available In mammals a considerable 92% of genes contain introns, with hundreds and hundreds of these introns reaching the incredible size of over 50,000 nucleotides. These "large introns" must be spliced out of the pre-mRNA in a timely fashion, which involves bringing together distant 5' and 3' acceptor and donor splice sites. In invertebrates, especially Drosophila, it has been shown that larger introns can be spliced efficiently through a process known as recursive splicing-a consecutive splicing from the 5'-end at a series of combined donor-acceptor splice sites called RP-sites. Using a computational analysis of the genomic sequences, we show that vertebrates lack the proper enrichment of RP-sites in their large introns, and, therefore, require some other method to aid splicing. We analyzed over 15,000 non-redundant, large introns from six mammals, 1,600 from chicken and zebrafish, and 560 non-redundant large introns from five invertebrates. Our bioinformatic investigation demonstrates that, unlike the studied invertebrates, the studied vertebrate genomes contain consistently abundant amounts of direct and complementary strand interspersed repetitive elements (mainly SINEs and LINEs that may form stems with each other in large introns. This examination showed that predicted stems are indeed abundant and stable in the large introns of mammals. We hypothesize that such stems with long loops within large introns allow intron splice sites to find each other more quickly by folding the intronic RNA upon itself at smaller intervals and, thus, reducing the distance between donor and acceptor sites.

  13. Rapid and recent diversification of curassows, guans, and chachalacas (Galliformes: Cracidae) out of Mesoamerica: Phylogeny inferred from mitochondrial, intron, and ultraconserved element sequences.

    Science.gov (United States)

    Hosner, Peter A; Braun, Edward L; Kimball, Rebecca T

    2016-09-01

    The Cracidae (curassows, guans, and chachalacas) include some of the most spectacular and endangered Neotropical bird species. They lack a comprehensive phylogenetic hypothesis, hence their geographic origin and the history of their diversification remain unclear. We present a species-level phylogeny of Cracidae inferred from a matrix of 430 ultraconserved elements (UCEs; at least one species sampled per genus) and eight more variable loci (introns and mtDNA; all available species). We use this phylogeny along with probabilistic biogeographic modeling to test whether Gondwanan vicariance, ancient dispersal to South America, ancient dispersal from South America, or massive global cooling isolated cracids in the Neotropics. Contrary to previous estimates that extant cracids diversified in the Cretaceous, our fossil-calibrated divergence time estimates instead support that crown Cracidae originated in the late Miocene. Species-rich genera Crax, Penelope, and Ortalis began diversifying as recently as 3Mya. Biogeographic reconstructions indicate that modern cracids originated in Mesoamerica and were isolated from a widespread Laurasian ancestor, consistent with the massive global cooling hypothesis. Current South American diversity is the result of multiple colonization events following uplift of the Panamanian Isthmus, coupled with rapid diversification and evolution of secondary sympatry. Of the four major cracid lineages (curassows, chachalacas, typical guans, horned guan), the only lineage that has failed to colonize and diversify South America is the unique horned guan (Oreophasis derbianus), which is sister to curassows and chachalacas rather than typical guans. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. An intronic open reading frame was released from one of group II introns in the mitochondrial genome of the haptophyte Chrysochromulina sp. NIES-1333.

    Science.gov (United States)

    Nishimura, Yuki; Kamikawa, Ryoma; Hashimoto, Tetsuo; Inagaki, Yuji

    2014-01-01

    Mitochondrial (mt) genome sequences, which often bear introns, have been sampled from phylogenetically diverse eukaryotes. Thus, we can anticipate novel insights into intron evolution from previously unstudied mt genomes. We here investigated the origins and evolution of three introns in the mt genome of the haptophyte Chrysochromulina sp. NIES-1333, which was sequenced completely in this study. All the three introns were characterized as group II, on the basis of predicted secondary structure, and the conserved sequence motifs at the 5' and 3' termini. Our comparative studies on diverse mt genomes prompt us to propose that the Chrysochromulina mt genome laterally acquired the introns from mt genomes in distantly related eukaryotes. Many group II introns harbor intronic open reading frames for the proteins (intron-encoded proteins or IEPs), which likely facilitate the splicing of their host introns. However, we propose that a "free-standing," IEP-like protein, which is not encoded within any introns in the Chrysochromulina mt genome, is involved in the splicing of the first cox1 intron that lacks any open reading frames.

  15. Frequent gain and loss of introns in fungal cytochrome b genes.

    Directory of Open Access Journals (Sweden)

    Liang-Fen Yin

    Full Text Available In this study, all available cytochrome b (Cyt b genes from the GOBASE database were compiled and the evolutionary dynamics of the Cyt b gene introns was assessed. Cyt b gene introns were frequently present in the fungal kingdom and some lower plants, but generally absent or rare in Chromista, Protozoa, and Animalia. Fungal Cyt b introns were found at 35 positions in Cyt b genes and the number of introns varied at individual positions from a single representative to 32 different introns at position 131, showing a wide and patchy distribution. Many homologous introns were present at the same position in distantly related species but absent in closely related species, suggesting that introns of the Cyt b genes were frequently lost. On the other hand, highly similar intron sequences were observed in some distantly related species rather than in closely related species, suggesting that these introns were gained independently, likely through lateral transfers. The intron loss-and-gain events could be mediated by transpositions that might have occurred between nuclear and mitochondria. Southern hybridization analysis confirmed that some introns contained repetitive sequences and might be transposable elements. An intron gain in Botryotinia fuckeliana prevented the development of QoI fungicide resistance, suggesting that intron loss-and-gain events were not necessarily beneficial to their host organisms.

  16. An ancient spliceosomal intron in the ribosomal protein L7a gene (Rpl7a of Giardia lamblia

    Directory of Open Access Journals (Sweden)

    Gray Michael W

    2005-08-01

    Full Text Available Abstract Background Only one spliceosomal-type intron has previously been identified in the unicellular eukaryotic parasite, Giardia lamblia (a diplomonad. This intron is only 35 nucleotides in length and is unusual in possessing a non-canonical 5' intron boundary sequence, CT, instead of GT. Results We have identified a second spliceosomal-type intron in G. lamblia, in the ribosomal protein L7a gene (Rpl7a, that possesses a canonical GT 5' intron boundary sequence. A comparison of the two known Giardia intron sequences revealed extensive nucleotide identity at both the 5' and 3' intron boundaries, similar to the conserved sequence motifs recently identified at the boundaries of spliceosomal-type introns in Trichomonas vaginalis (a parabasalid. Based on these observations, we searched the partial G. lamblia genome sequence for these conserved features and identified a third spliceosomal intron, in an unassigned open reading frame. Our comprehensive analysis of the Rpl7a intron in other eukaryotic taxa demonstrates that it is evolutionarily conserved and is an ancient eukaryotic intron. Conclusion An analysis of the phylogenetic distribution and properties of the Rpl7a intron suggests its utility as a phylogenetic marker to evaluate particular eukaryotic groupings. Additionally, analysis of the G. lamblia introns has provided further insight into some of the conserved and unique features possessed by the recently identified spliceosomal introns in related organisms such as T. vaginalis and Carpediemonas membranifera.

  17. Comparative genomic survey, exon-intron annotation and phylogenetic analysis of NAT-homologous sequences in archaea, protists, fungi, viruses, and invertebrates

    Science.gov (United States)

    We have previously published extensive genomic surveys [1-3], reporting NAT-homologous sequences in hundreds of sequenced bacterial, fungal and vertebrate genomes. We present here the results of our latest search of 2445 genomes, representing 1532 (70 archaeal, 1210 bacterial, 43 protist, 97 fungal,...

  18. Aberrant splicing in transgenes containing introns, exons, and V5 epitopes: lessons from developing an FSHD mouse model expressing a D4Z4 repeat with flanking genomic sequences.

    Directory of Open Access Journals (Sweden)

    Eugénie Ansseau

    Full Text Available The DUX4 gene, encoded within D4Z4 repeats on human chromosome 4q35, has recently emerged as a key factor in the pathogenic mechanisms underlying Facioscapulohumeral muscular dystrophy (FSHD. This recognition prompted development of animal models expressing the DUX4 open reading frame (ORF alone or embedded within D4Z4 repeats. In the first published model, we used adeno-associated viral vectors (AAV and strong viral control elements (CMV promoter, SV40 poly A to demonstrate that the DUX4 cDNA caused dose-dependent toxicity in mouse muscles. As a follow-up, we designed a second generation of DUX4-expressing AAV vectors to more faithfully genocopy the FSHD-permissive D4Z4 repeat region located at 4q35. This new vector (called AAV.D4Z4.V5.pLAM contained the D4Z4/DUX4 promoter region, a V5 epitope-tagged DUX4 ORF, and the natural 3' untranslated region (pLAM harboring two small introns, DUX4 exons 2 and 3, and the non-canonical poly A signal required for stabilizing DUX4 mRNA in FSHD. AAV.D4Z4.V5.pLAM failed to recapitulate the robust pathology of our first generation vectors following delivery to mouse muscle. We found that the DUX4.V5 junction sequence created an unexpected splice donor in the pre-mRNA that was preferentially utilized to remove the V5 coding sequence and DUX4 stop codon, yielding non-functional DUX4 protein with 55 additional residues on its carboxyl-terminus. Importantly, we further found that aberrant splicing could occur in any expression construct containing a functional splice acceptor and sequences resembling minimal splice donors. Our findings represent an interesting case study with respect to AAV.D4Z4.V5.pLAM, but more broadly serve as a note of caution for designing constructs containing V5 epitope tags and/or transgenes with downstream introns and exons.

  19. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa.

    Science.gov (United States)

    Nielsen, H; Simon, E M; Engberg, J

    1992-01-01

    We have previously argued from phylogenetic sequence data that the group I intron in the rRNA genes of Tetrahymena was acquired by different Tetrahymena species at different times during evolution. We have now approached the question of intron mobility experimentally by crossing intron+ and intron- strains looking for a strong polarity in the inheritance of the intron (intron homing). Based on the genetic analysis we find that the intron in T. pigmentosa is inherited as a neutral character and that intron+ and intron- alleles segregate in a Mendelian fashion with no sign of intron homing. In an analysis of vegetatively growing cells containing intron+ and intron- rDNA, initially in the same macronucleus, we similarly find no evidence of intron homing. During the course of this work, we observed to our surprise that progeny clones from some crosses contained three types of rDNA. One possible explanation is that T. pigmentosa has two rdn loci in contrast to the single locus found in T. thermophila. Some of the progeny clones from the genetic analysis were expanded for several hundred generations, and allelic assortment of the rDNA was demonstrated by subcloning analysis.

  20. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S. (Univ. of North Carolina, Chapel Hill (USA)); Brown, T.R.; Migeon, C.J. (Johns Hopkins Univ. School of Medicine, Baltimore, MD (USA))

    1989-12-01

    Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development.

  1. c-Myc/Max heterodimers bind cooperatively to the E-box sequences located in the first intron of the rat ornithine decarboxylase (ODC) gene

    NARCIS (Netherlands)

    Walhout, A.J.M.; Gubbels, J.M.; Bernards, R.A.; Vliet, P.C. van der; Timmers, H.T.M.

    1997-01-01

    The oncoprotein c-Myc plays an important role in cell proliferation, transformation, inhibition of differentiation and apoptosis. These functions most likely result from the transcription factor activity of c-Myc. As a heterodimer with Max, the c-Myc protein binds to the E-box sequence (CACGTG), whi

  2. Functional analysis of deep intronic SNP rs13438494 in intron 24 of PCLO gene.

    Directory of Open Access Journals (Sweden)

    Seunghee Seo

    Full Text Available The single nucleotide polymorphism (SNP rs13438494 in intron 24 of PCLO was significantly associated with bipolar disorder in a meta-analysis of genome-wide association studies. In this study, we performed functional minigene analysis and bioinformatics prediction of splicing regulatory sequences to characterize the deep intronic SNP rs13438494. We constructed minigenes with A and C alleles containing exon 24, intron 24, and exon 25 of PCLO to assess the genetic effect of rs13438494 on splicing. We found that the C allele of rs13438494 reduces the splicing efficiency of the PCLO minigene. In addition, prediction analysis of enhancer/silencer motifs using the Human Splice Finder web tool indicated that rs13438494 induces the abrogation or creation of such binding sites. Our results indicate that rs13438494 alters splicing efficiency by creating or disrupting a splicing motif, which functions by binding of splicing regulatory proteins, and may ultimately result in bipolar disorder in affected people.

  3. A general model for the evolution of nuclear pre-mRNA introns.

    Science.gov (United States)

    Hickey, D A; Benkel, B F; Abukashawa, S M

    1989-03-07

    We present an overview of the evolution of eukaryotic split gene structure and pre-mRNA splicing mechanisms. We have drawn together several seemingly conflicting ideas and we show that they can all be incorporated in a single unified theory of intron evolution. The resulting model is consistent with the notion that introns, as a class, are very ancient, having originated in the "RNA world"; it also supports the concept that introns may have played a crucial role in the construction of many eukaryotic genes and it accommodates the idea that introns are related to mobile insertion elements. Our conclusion is that introns could have a profound effect on the course of eukaryotic gene evolution, but that the origin and maintenance of intron sequences depends, largely, on natural selection acting on the intron sequences themselves.

  4. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters.

    Science.gov (United States)

    Zhang, Ning; McHale, Leah K; Finer, John J

    2016-01-01

    Introns, especially the first intron in the 5' untranslated region (5'UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement.

  5. The Biology of Intron Gain and Loss

    DEFF Research Database (Denmark)

    Jeffares, Daniel C; Mourier, Tobias; Penny, David

    2006-01-01

    Intron density in eukaryote genomes varies by more than three orders of magnitude, so there must have been extensive intron gain and/or intron loss during evolution. A favored and partial explanation for this range of intron densities has been that introns have accumulated stochastically in large...... eukaryote genomes during their evolution from an intron-poor ancestor. However, recent studies have shown that some eukaryotes lost many introns, whereas others accumulated and/or gained many introns. In this article, we discuss the growing evidence that these differences are subject to selection acting...... on introns depending on the biology of the organism and the gene involved....

  6. 基于13个内含子的序列探讨鲸目的系统发育关系%Molecular phylogenetics of cetaceans: an insight from 13 nuclear intron sequences

    Institute of Scientific and Technical Information of China (English)

    熊晔; 周旭明; 杨梅; 张盼; 杨云霞; 杨光

    2011-01-01

    本文基于实验室筛选得到的13对内含子标记,在鲸偶蹄目的15个物种中进行有效扩增,并重建了这15个物种的系统发育关系.结果表明,抹香鲸总科(Physeteroidea)位于齿鲸亚目(Odontoceti)的基部,从而支持了传统的齿鲸亚目的单系性.在海豚总科(Delphinoidea)内部,贝斯分析结果支持了鼠海豚科(Phocoenidae)和一角鲸科(Monodontidae)的姐妹群关系,而后再与海豚科(Delphinidae)相聚.系统发育分析同时还强烈支持了海豚科的四个属(Sousa,Tursiops,Stenella,Delphinus)组成一个单系的"复合体".另外,我们的分析结果并不支持瓶鼻海豚属(Tursiops)和原海豚属(Stenella)的单系性.基于松散分子钟的分歧时间估算与以往文献中的结果没有明显差异.这些研究结果提示,核基因内含子序列有希望解决一些长期存在的鲸类系统发育问题.%Sequences of 13 introns from 15 Cetartiodactyla species were determined to reveal the phylogeny of cetaceans.Our results support the monophyly of the traditionally accepted suborder Odontoceti ( toothed whales ), placing the dwarf sperm whale ( Kogia sima), a representative species of superfamily Physeteroidea, as sister to other toothed whales. Within the superfamily Delphinoidea, phylogenetic analyses identified a sister relationship between Delphinidae and Monodontidae + Phocoenidae. A close relationship among four genera ( Sousa, Tursiops, Stenella, and Delphinus) is strongly supported,which suggested the monophyly of the Sousa-Stenella-Tursiops-Delphinus complex. Neither the two Tursiops species ( T.truncates and T. aduncus ) nor the two Stenella species (S. coeruleoalba and S. attenuata ) examined in present study clustered together, which strongly supported the paraphyly of these two genera as suggested in previous studies. Furthermore,the present Bayesian inference with a lognormal relaxed molecular clock provided divergence time for each clade, which is consistent with

  7. Molecular phylogenetics of Alchemilla, Aphanes and Lachemilla (Rosaceae) inferred from plastid and nuclear intron and spacer DNA sequences, with comments on generic classification.

    Science.gov (United States)

    Gehrke, B; Bräuchler, C; Romoleroux, K; Lundberg, M; Heubl, G; Eriksson, T

    2008-06-01

    Alchemilla (the lady's mantles) is a well known but inconspicuous group in the Rosaceae, notable for its ornamental leaves and pharmaceutical properties. The systematics of Alchemilla has remained poorly understood, most likely due to confusion resulting from apomixis, polyploidisation and hybridisation, which are frequently observed in the group, and which have led to the description of a large number of (micro-) species. A molecular phylogeny of the genus, including all sections of Alchemilla and Lachemilla as well as five representatives of Aphanes, based on the analysis of the chloroplast trnL-trnF and the nuclear ITS regions is presented here. Gene phylogenies reconstructed from the nuclear and chloroplast sequence data were largely congruent. Limited conflict between the data partitions was observed with respect to a small number of taxa. This is likely to be the result of hybridisation/introgression or incomplete lineage sorting. Four distinct clades were resolved, corresponding to major geographical division and life forms: Eurasian Alchemilla, annual Aphanes, South American Lachemilla and African Alchemilla. We argue for a wider circumscription of the genus Alchemilla, including Lachemilla and Aphanes, based on the morphology and the phylogenetic relationships between the different clades.

  8. Epigenetic Regulation of Intronic Transgenes in Arabidopsis

    Science.gov (United States)

    Osabe, Kenji; Harukawa, Yoshiko; Miura, Saori; Saze, Hidetoshi

    2017-01-01

    Defense mechanisms of plant genomes can epigenetically inactivate repetitive sequences and exogenous transgenes. Loss of mutant phenotypes in intronic T-DNA insertion lines by interaction with another T-DNA locus, termed T-DNA suppression, has been observed in Arabidopsis thaliana, although the molecular basis of establishment and maintenance of T-DNA suppression is poorly understood. Here we show that maintenance of T-DNA suppression requires heterochromatinisation of T-DNA sequences and the nuclear proteins, INCREASED IN BONSAI METHYLATION 2 (IBM2) and ENHANCED DOWNY MILDEW 2 (EDM2), which prevent ectopic 3′ end processing of mRNA in atypically long introns containing T-DNA sequences. Initiation of T-DNA suppression is mediated by the canonical RdDM pathway after hybridisation of two T-DNA strains, accompanied by DNA hypermethylation of T-DNA sequences in the F1 generation. Our results reveal the presence of a genome surveillance mechanism through genome hybridisation that masks repetitive DNAs intruding into transcription units. PMID:28338020

  9. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  10. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  11. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  12. Intronic splicing mutations in PTCH1 cause Gorlin syndrome.

    Science.gov (United States)

    Bholah, Zaynab; Smith, Miriam J; Byers, Helen J; Miles, Emma K; Evans, D Gareth; Newman, William G

    2014-09-01

    Gorlin syndrome is an autosomal dominant disorder characterized by multiple early-onset basal cell carcinoma, odontogenic keratocysts and skeletal abnormalities. It is caused by heterozygous mutations in the tumour suppressor PTCH1. Routine clinical genetic testing, by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) to confirm a clinical diagnosis of Gorlin syndrome, identifies a mutation in 60-90 % of cases. We undertook RNA analysis on lymphocytes from ten individuals diagnosed with Gorlin syndrome, but without known PTCH1 mutations by exonic sequencing or MLPA. Two altered PTCH1 transcripts were identified. Genomic DNA sequence analysis identified an intron 7 mutation c.1068-10T>A, which created a strong cryptic splice acceptor site, leading to an intronic insertion of eight bases; this is predicted to create a frameshift p.(His358Alafs*12). Secondly, a deep intronic mutation c.2561-2057A>G caused an inframe insertion of 78 intronic bases in the cDNA transcript, leading to a premature stop codon p.(Gly854fs*3). The mutations are predicted to cause loss of function of PTCH1, consistent with its tumour suppressor function. The findings indicate the importance of RNA analysis to detect intronic mutations in PTCH1 not identified by routine screening techniques.

  13. Phylogenetic distribution of intron positions in alpha-amylase genes of bilateria suggests numerous gains and losses.

    Directory of Open Access Journals (Sweden)

    Jean-Luc Da Lage

    Full Text Available Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that "resets" of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures.

  14. 50/50 Expressional Odds of Retention Signifies the Distinction between Retained Introns and Constitutively Spliced Introns in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Rui Mao

    2017-10-01

    Full Text Available Intron retention, one of the most prevalent alternative splicing events in plants, can lead to introns retained in mature mRNAs. However, in comparison with constitutively spliced introns (CSIs, the relevantly distinguishable features for retained introns (RIs are still poorly understood. This work proposes a computational pipeline to discover novel RIs from multiple next-generation RNA sequencing (RNA-Seq datasets of Arabidopsis thaliana. Using this pipeline, we detected 3,472 novel RIs from 18 RNA-Seq datasets and re-confirmed 1,384 RIs which are currently annotated in the TAIR10 database. We also use the expression of intron-containing isoforms as a new feature in addition to the conventional features. Based on these features, RIs are highly distinguishable from CSIs by machine learning methods, especially when the expressional odds of retention (i.e., the expression ratio of the RI-containing isoforms relative to the isoforms without RIs for the same gene reaches to or larger than 50/50. In this case, the RIs and CSIs can be clearly separated by the Random Forest with an outstanding performance of 0.95 on AUC (the area under a receiver operating characteristics curve. The closely related characteristics to the RIs include the low strength of splice sites, high similarity with the flanking exon sequences, low occurrence percentage of YTRAY near the acceptor site, existence of putative intronic splicing silencers (ISSs, i.e., AG/GA-rich motifs and intronic splicing enhancers (ISEs, i.e., TTTT-containing motifs, and enrichment of Serine/Arginine-Rich (SR proteins and heterogeneous nuclear ribonucleoparticle proteins (hnRNPs.

  15. Functional comparison of three transformer gene introns regulating conditional female lethality

    Science.gov (United States)

    The trasformer gene plays a critical role in the sex determination pathways of many insects. We cloned two transformer gene introns from Anastrepha suspensa, the Caribbean fruit fly. These introns have sequences that putatively have a role in sex-specific splicing patterns that affect sex determinat...

  16. An intron in a ribosomal protein gene from Tetrahymena

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Andreasen, Per Hove; Dreisig, Hanne

    1986-01-01

    We have cloned and sequenced a single copy gene encoding a ribosomal protein from the ciliate Tetrahymena thermophila. The gene product was identified as ribosomal protein S25 by comparison of the migration in two-dimensional polyacrylamide gels of the protein synthesized by translation in vitro...... of hybrid-selected mRNA and authentic ribosomal proteins. The proteins show strong homology to ribosomal protein S12 from Escherichia coli. The coding region of the gene is interrupted by a 979-bp intron 68 bp downstream of the translation start. This is the first intron in a protein encoding gene...

  17. Origin and evolution of a new retained intron on the vulcan gene in Drosophila melanogaster subgroup species.

    Science.gov (United States)

    Zhan, Leilei; Meng, Qiaohong; Chen, Ran; Yue, Yuan; Jin, Yongfeng

    2014-10-01

    Although numerous intron gains have been discovered, the mechanisms of intron creation have proven to be elusive. Previous study revealed that the vulcan gene of Drosophila melanogaster contained four exons in its coding region. In the current study, a newly created intron (Intron L) was identified on exon 2 of vulcan in D. melanogaster by comparing expression sequence tags. The RT-PCR experiment revealed that Intron L was associated with intron retention, in which two alternative transcripts of the gene differ by the inclusion or removal of an intron. It was found that Intron L was created by intronization of exonic sequence, and its donor and acceptor splice sites were created by synonymous mutation, leading to the origin of a new vulcan protein that is 22 amino acids shorter than the previously reported vulcan protein. Moreover, to track the origin of Intron L, 36 orthologous genes of species of Drosophila were cloned or annotated, and phylogenetic analysis was carried out. It indicated that the common ancestor of D. melangaster subgroup species created Intron L about 15 million years ago.

  18. Statistical characteristics of eukaryotic intron database

    Institute of Scientific and Technical Information of China (English)

    HE Miao; LI Jidong; ZHANG Shanghong

    2006-01-01

    A database called eukaryotic intron database (EID) was developed based on the data from GenBank.Studies on the statistical characteristics of EID show that there were 103,848 genes,478,484 introns,and 582,332 exons,with an average of 4.61 introns and 5.61 exons per gene.Introns of 40-120 nt in length were abundant in the database.Results of the statistical analysis on the data from nine model species showed that in eukaryotes,higher species do not necessarily have more introns or exons in a gene than lower species.Furthermore,characteristics of EID,such as intron phase,distribution of different splice sites,and the relationship between genome size and intron proportion or intron density,have been studied.

  19. Intronic L1 retrotransposons and nested genes cause transcriptional interference by inducing intron retention, exonization and cryptic polyadenylation.

    Directory of Open Access Journals (Sweden)

    Kristel Kaer

    Full Text Available BACKGROUND: Transcriptional interference has been recently recognized as an unexpectedly complex and mostly negative regulation of genes. Despite a relatively few studies that emerged in recent years, it has been demonstrated that a readthrough transcription derived from one gene can influence the transcription of another overlapping or nested gene. However, the molecular effects resulting from this interaction are largely unknown. METHODOLOGY/PRINCIPAL FINDINGS: Using in silico chromosome walking, we searched for prematurely terminated transcripts bearing signatures of intron retention or exonization of intronic sequence at their 3' ends upstream to human L1 retrotransposons, protein-coding and noncoding nested genes. We demonstrate that transcriptional interference induced by intronic L1s (or other repeated DNAs and nested genes could be characterized by intron retention, forced exonization and cryptic polyadenylation. These molecular effects were revealed from the analysis of endogenous transcripts derived from different cell lines and tissues and confirmed by the expression of three minigenes in cell culture. While intron retention and exonization were comparably observed in introns upstream to L1s, forced exonization was preferentially detected in nested genes. Transcriptional interference induced by L1 or nested genes was dependent on the presence or absence of cryptic splice sites, affected the inclusion or exclusion of the upstream exon and the use of cryptic polyadenylation signals. CONCLUSIONS/SIGNIFICANCE: Our results suggest that transcriptional interference induced by intronic L1s and nested genes could influence the transcription of the large number of genes in normal as well as in tumor tissues. Therefore, this type of interference could have a major impact on the regulation of the host gene expression.

  20. Intronic polymorphisms of cytochromes P450

    Directory of Open Access Journals (Sweden)

    Ingelman-Sundberg Magnus

    2010-08-01

    Full Text Available Abstract The cytochrome P450 enzymes active in drug metabolism are highly polymorphic. Most allelic variants have been described for enzymes encoded by the cytochrome P450 family 2 (CYP2 gene family, which has 252 different alleles. The intronic polymorphisms in the cytochrome P450 genes account for only a small number of the important variant alleles; however, the most important ones are CYP2D6*4 and CYP2D6*41, which cause abolished and reduced CYP2D6 activity, respectively, and CYP3A5*3 and CYP3A5*5, common in Caucasian populations, which cause almost null activity. Their discoveries have been based on phenotypic alterations within individuals in a population, and their identification has, in several cases, been difficult and taken a long time. In light of the next-generation sequencing projects, it is anticipated that further alleles with intronic mutations will be identified that can explain the hitherto unidentified genetic basis of inter-individual differences in cytochrome P450-mediated drug and steroid metabolism.

  1. 云南元江普通野生稻群体Wx基因(CT)n重复序列和第1内含子G/T位碱基分析%Genetic Diversity of Microsatellite Sequence (CT) n and Intron 1 G/T in Wx Gene of O. rufipogon Population in Yuanjiang of Yunnan Province

    Institute of Scientific and Technical Information of China (English)

    孙一丁; 陆辉; 许明辉

    2012-01-01

    In the present study, the genetic diversity of microsatellite sequence (CT)n and intron 1 G/T in Wx gene were determined for 90 individuals in the natural population of 0. rufipogon from Yuanjiang of Yunnan Province. In the loci of the microsatellite sequence (CT)n and intron 1st G/T in Wx gene, all of individuals from the natural population of wild rice in Yuanjiang were homogenetic, whose intron 1 G/T were base G, the band type of microsatellite sequence (CT)n wassimilar to one of the local indica cultivars from Yunnan.%对云南元江普通野生稻90个个体Wx基因区段内的重复序列(CT)n和第1内含子供体+1位碱基G/T分别进行了比较分析.结果表明云南元江普通野生稻3个居群中的90个单株在重复序列(CT)n和G/T位点纯合一致,没有多态性;其G/T位点碱基均为G;其重复序列(CT)n基因型与云南地方籼稻品种优势基因型相似但又有所区别.本研究结果为云南元江普通野生稻WX基因利用和在稻种进化上的地位提供了信息.

  2. Intron distribution in Plantae: 500 million years of stasis during land plant evolution.

    Science.gov (United States)

    Teich, René; Grauvogel, Carina; Petersen, Jörn

    2007-06-01

    Little is known about the evolution of the intron-exon organization in the more primitive groups of land plants, and the intron distribution among Plantae (glauco-, rhodo-, chloro- and streptophytes) has not been investigated so far. The present study is focused on some key species such as the liverwort Marchantia polymorpha, representing the most ancient lineage of land plants, and the streptophycean green alga Mesostigma viride, branching prior to charophycean green algae and terrestrial plants. The intron distribution of six genes for sugar phosphate metabolism was analyzed including four different glyceraldehyde-3-phosphate dehydrogenases (GAPDH), the sedoheptulose-1,7-bisphosphatase (SBP) and the glucose-6-phosphate isomerase (GPI). We established 15 new sequences including three cDNA and twelve genomic clones with up to 24 introns per gene, which were identified in the GPI of Marchantia. The intron patterns of all six genes are completely conserved among seed plants, lycopods, mosses and even liverworts. This intron stasis without any gain of novel introns seem to last for nearly 500 million years and may be characteristic for land plants in general. Some unique intron positions in Mesostigma document that a uniform distribution is no common trait of all streptophytes, but it may correlate with the transition to terrestrial habitats. However, the respective genes of chlorophycean green algae display largely different patterns, thus indicating at least one phase of massive intron rearrangement in the green lineage. We moreover included rhodophyte and glaucophyte reference sequences in our analyses and, even if the well documented monophyly of Plantae is not reflected by a uniform intron distribution, at least one GPI intron is strictly conserved for 1.5 billion years.

  3. Nucleolar introns from Physarum flavicomum contain insertion elements that may explain how mobile group I introns gained their open reading frames.

    Science.gov (United States)

    Vader, A; Naess, J; Haugli, K; Haugli, F; Johansen, S

    1994-01-01

    Comparison of two group I intron sequences in the nucleolar genome of the myxomycete Physarum flavicomum to their homologs in the closely related Physarum polycephalum revealed insertion-like elements. One of the insertion-like elements consists of two repetitive sequence motifs of 11 and 101 bp in five and three copies, respectively. The smaller motif, which flanks the larger, resembles a target duplication and indicates a relationship to transposons or retroelements. The insertion-like elements are found in the peripheral loops of the RNA structure; the positions occupied by the ORFs of mobile nucleolar group I introns. The P. flavicomum introns are 1184 and 637 bp in size, located in the large subunit ribosomal RNA gene, and can be folded into group I intron structures at the RNA level. However, the intron 2s from both P. flavicomum and P. polycephalum contain an unusual core region that lacks the P8 segment. None of the introns are able to self-splice in vitro. Southern analysis of different isolates indicates that the introns are not optional in myxomycetes. Images PMID:7984404

  4. Many independent origins of trans splicing of a plant mitochondrial group II intron.

    Science.gov (United States)

    Qiu, Yin-Long; Palmer, Jeffrey D

    2004-07-01

    We examined the cis- vs. trans-splicing status of the mitochondrial group II intron nad1i728 in 439 species (427 genera) of land plants, using both Southern hybridization results (for 416 species) and intron sequence data from the literature. A total of 164 species (157 genera), all angiosperms, was found to have a trans-spliced form of the intron. Using a multigene land plant phylogeny, we infer that the intron underwent a transition from cis to trans splicing 15 times among the sampled angiosperms. In 10 cases, the intron was fractured between its 5' end and the intron-encoded matR gene, while in the other 5 cases the fracture occurred between matR and the 3' end of the intron. The 15 intron fractures took place at different time depths during the evolution of angiosperms, with those in Nymphaeales, Austrobaileyales, Chloranthaceae, and eumonocots occurring early in angiosperm evolution and those in Syringodium filiforme, Hydrocharis morsus- ranae, Najas, and Erodium relatively recently. The trans-splicing events uncovered in Austrobaileyales, eumonocots, Polygonales, Caryophyllales, Sapindales, and core Rosales reinforce the naturalness of these major clades of angiosperms, some of which have been identified solely on the basis of recent DNA sequence analyses.

  5. Insertion of Introns: A Strategy to Facilitate Assembly of Infectious Full Length Clones

    DEFF Research Database (Denmark)

    Johansen, Ida Elisabeth; Lund, Ole Søgaard

    2008-01-01

    Some DNA fragments are difficult to clone in Escherichia coli by standard methods. It has been speculated that unintended transcription and translation result in expression of proteins that are toxic to the bacteria. This problem is frequently observed during assembly of infectious full......-length virus clones. If the clone is constructed for transcription in vivo, interrupting the virus sequence with an intron can solve the toxicity problem. The AU-rich introns generally contain many stop codons, which interrupt translation in E. coli, while the intron sequence is precisely eliminated from...

  6. Naturally occuring nucleosome positioning signals in human exons and introns

    DEFF Research Database (Denmark)

    Baldi, Pierre; Brunak, Søren; Chauvin, Yves;

    1996-01-01

    alignments of internal exon and intron sequences corresponds to a periodic "in phase" bending potential towards the major groove of the DNA. The nucleosome positioning data show that the consensus triplets (and their complements) have a preference for locations on a bent double helix where the major groove...... of roughly ten nucleotides. The periodic pattern is also present in intron sequences, although the strength per nucleotide is weaker. Using two independent profile methods based on triplet bendability parameters from DNase I experiments and nucleosome positioning data, we show that the pattern in multiple...... faces inward and is compressed. The in-phase triplets are located adjacent to GCC/GGC triplets known to have the strongest bias in their positioning on the nucleosome. Analysis of mRNA sequences encoding proteins with known tertiary structure exclude the possibility that the pattern is a consequence...

  7. Intron analyses reveal multiple calmodulin copies in Littorina.

    Science.gov (United States)

    Simpson, R J; Wilding, C S; Grahame, J

    2005-04-01

    Intron 3 and the flanking exons of the calmodulin gene have been amplified, cloned, and sequenced from 18 members of the gastropod genus Littorina. From the 48 sequences, at least five different gene copies have been identified and their functionality characterized using a strategy based upon the potential protein product predicted from flanking exon data. The functionality analyses suggest that four of the genes code for functional copies of calmodulin. All five copies have been identified across a wide range of littorinid species although not ubiquitously. Using this novel approach based on intron sequences, we have identified an unprecedented number of potential calmodulin copies in Littorina, exceeding that reported for any other invertebrate. This suggests a higher number of, and more ancient, gene duplications than previously detected in a single genus.

  8. Insights into the strategies used by related group II introns to adapt successfully for the colonisation of a bacterial genome.

    Science.gov (United States)

    Martínez-Rodríguez, Laura; García-Rodríguez, Fernando M; Molina-Sánchez, María Dolores; Toro, Nicolás; Martínez-Abarca, Francisco

    2014-01-01

    Group II introns are self-splicing RNAs and site-specific mobile retroelements found in bacterial and organellar genomes. The group II intron RmInt1 is present at high copy number in Sinorhizobium meliloti species, and has a multifunctional intron-encoded protein (IEP) with reverse transcriptase/maturase activities, but lacking the DNA-binding and endonuclease domains. We characterized two RmInt1-related group II introns RmInt2 from S. meliloti strain GR4 and Sr.md.I1 from S. medicae strain WSM419 in terms of splicing and mobility activities. We used both wild-type and engineered intron-donor constructs based on ribozyme ΔORF-coding sequence derivatives, and we determined the DNA target requirements for RmInt2, the element most distantly related to RmInt1. The excision and mobility patterns of intron-donor constructs expressing different combinations of IEP and intron RNA provided experimental evidence for the co-operation of IEPs and intron RNAs from related elements in intron splicing and, in some cases, in intron homing. We were also able to identify the DNA target regions recognized by these IEPs lacking the DNA endonuclease domain. Our results provide new insight into the versatility of related group II introns and the possible co-operation between these elements to facilitate the colonization of bacterial genomes.

  9. The molecular evolution and structural organization of group I introns at position 1389 in nuclear small subunit rDNA of myxomycetes.

    Science.gov (United States)

    Wikmark, Odd-Gunnar; Haugen, Peik; Lundblad, Eirik W; Haugli, Kari; Johansen, Steinar D

    2007-01-01

    The number of nuclear group I introns from myxomycetes is rapidly increasing in GenBank as more rDNA sequences from these organisms are being sequenced. They represent an interesting and complex group of intervening sequences because several introns are mobile (or inferred to be mobile) and many contain large and unusual insertions in peripheral loops. Here we describe related group I introns at position 1389 in the small subunit rDNA of representatives from the myxomycete family Didymiaceae. Phylogenetic analyses support a common origin and mainly vertical inheritance of the intron. All S1389 introns from the Didymiaceae belong to the IC1 subclass of nuclear group I introns. The central catalytic core region of about 100 nt appears divergent in sequence composition even though the introns reside in closely related species. Furthermore, unlike the majority of group I introns from myxomycetes the S1389 introns do not self-splice as naked RNA in vitro under standard conditions, consistent with a dependence on host factors for folding or activity. Finally, the myxomycete S1389 introns are exclusively found within the family Didymiaceae, which suggests that this group I intron was acquired after the split between the families Didymiaceae and Physaraceae.

  10. The Agaricus bisporus cox1 Gene: The Longest Mitochondrial Gene and the Largest Reservoir of Mitochondrial Group I Introns

    Science.gov (United States)

    Férandon, Cyril; Moukha, Serge; Callac, Philippe; Benedetto, Jean-Pierre; Castroviejo, Michel; Barroso, Gérard

    2010-01-01

    In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp) are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II) according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a “Homing Endonuclease Gene” (heg) encoding a DNA endonuclease acting in transfer and site-specific integration (“homing”) and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain) is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt) and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote. PMID:21124976

  11. The Agaricus bisporus cox1 gene: the longest mitochondrial gene and the largest reservoir of mitochondrial group i introns.

    Directory of Open Access Journals (Sweden)

    Cyril Férandon

    Full Text Available In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a "Homing Endonuclease Gene" (heg encoding a DNA endonuclease acting in transfer and site-specific integration ("homing" and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote.

  12. Molecular characterization of a new member of the lariat capping twin-ribozyme introns

    Science.gov (United States)

    2014-01-01

    Background Twin-ribozyme introns represent a complex class of mobile group I introns that harbour a lariat capping (LC) ribozyme and a homing endonuclease gene embedded in a conventional self-splicing group I ribozyme (GIR2). Twin-ribozyme introns have so far been confined to nucleolar DNA in Naegleria amoeboflagellates and the myxomycete Didymium iridis. Results We characterize structural organization, catalytic properties and molecular evolution of a new twin-ribozyme intron in Allovahlkampfia (Heterolobosea). The intron contains two ribozyme domains with different functions in ribosomal RNA splicing and homing endonuclease mRNA maturation. We found Allovahlkampfia GIR2 to be a typical group IC1 splicing ribozyme responsible for addition of the exogenous guanosine cofactor (exoG), exon ligation and circularization of intron RNA. The Allovahlkampfia LC ribozyme, by contrast, represents an efficient self-cleaving ribozyme that generates a small 2′,5′ lariat cap at the 5′ end of the homing endonuclease mRNA, and thus contributes to intron mobility. Conclusions The discovery of a twin-ribozyme intron in a member of Heterolobosea expands the distribution pattern of LC ribozymes. We identify a putative regulatory RNA element (AP2.1) in the Allovahlkampfia LC ribozyme that involves homing endonuclease mRNA coding sequences as an important structural component. PMID:25342998

  13. U12 type introns were lost at multiple occasions during evolution

    Directory of Open Access Journals (Sweden)

    Bartschat Sebastian

    2010-02-01

    Full Text Available Abstract Background Two categories of introns are known, a common U2 type and a rare U12 type. These two types of introns are removed by distinct spliceosomes. The phylogenetic distribution of spliceosomal RNAs that are characteristic of the U12 spliceosome, i.e. the U11, U12, U4atac and U6atac RNAs, suggest that U12 spliceosomes were lost in many phylogenetic groups. We have now examined the distribution of U2 and U12 introns in many of these groups. Results U2 and U12 introns were predicted by making use of available EST and genomic sequences. The results show that in species or branches where U12 spliceosomal components are missing, also U12 type of introns are lacking. Examples are the choanoflagellate Monosiga brevicollis, Entamoeba histolytica, green algae, diatoms, and the fungal lineage Basidiomycota. Furthermore, whereas U12 splicing does not occur in Caenorhabditis elegans, U12 introns as well as U12 snRNAs are present in Trichinella spiralis, which is deeply branching in the nematode tree. A comparison of homologous genes in T. spiralis and C. elegans revealed different mechanisms whereby U12 introns were lost. Conclusions The phylogenetic distribution of U12 introns and spliceosomal RNAs give further support to an early origin of U12 dependent splicing. In addition, this distribution identifies a large number of instances during eukaryotic evolution where such splicing was lost.

  14. Diversity, mobility, and structural and functional evolution of group II introns carrying an unusual 3' extension

    Directory of Open Access Journals (Sweden)

    Tourasse Nicolas J

    2011-12-01

    Full Text Available Abstract Background Group II introns are widespread genetic elements endowed with a dual functionality. They are catalytic RNAs (ribozymes that are able of self-splicing and they are also mobile retroelements that can invade genomic DNA. The group II intron RNA secondary structure is typically made up of six domains. However, a number of unusual group II introns carrying a unique extension of 53-56 nucleotides at the 3' end have been identified previously in bacteria of the Bacillus cereus group. Methods In the present study, we conducted combined sequence comparisons and phylogenetic analyses of introns, host gene, plasmid and chromosome of host strains in order to gain insights into mobility, dispersal, and evolution of the unusual introns and their extension. We also performed in vitro mutational and kinetic experiments to investigate possible functional features related to the extension. Results We report the identification of novel copies of group II introns carrying a 3' extension including the first two copies in bacteria not belonging to the B. cereus group, Bacillus pseudofirmus OF4 and Bacillus sp. 2_A_57_CT2, an uncharacterized species phylogenetically close to B. firmus. Interestingly, the B. pseudofirmus intron has a longer extension of 70 bases. From sequence comparisons and phylogenetic analyses, several possible separate events of mobility involving the atypical introns could be identified, including both retrohoming and retrotransposition events. In addition, identical extensions were found in introns that otherwise exhibit little sequence conservation in the rest of their structures, with the exception of the conserved and catalytically critical domains V and VI, suggesting either separate acquisition of the extra segment by different group II introns or a strong selection pressure acting on the extension. Furthermore, we show by in vitro splicing experiments that the 3' extension affects the splicing properties differently in

  15. Reenacting the birth of an intron

    Energy Technology Data Exchange (ETDEWEB)

    Hellsten, Uffe; Aspden, Julie L.; Rio, Donald C.; Rokhsar, Daniel S.

    2011-07-01

    An intron is an extended genomic feature whose function requires multiple constrained positions - donor and acceptor splice sites, a branch point, a polypyrimidine tract and suitable splicing enhancers - that may be distributed over hundreds or thousands of nucleotides. New introns are therefore unlikely to emerge by incremental accumulation of functional sub-elements. Here we demonstrate that a functional intron can be created de novo in a single step by a segmental genomic duplication. This experiment recapitulates in vivo the birth of an intron that arose in the ancestral jawed vertebrate lineage nearly half a billion years ago.

  16. Pre-Mrna Introns as a Model for Cryptographic Algorithm:. Theory and Experiments

    Science.gov (United States)

    Regoli, Massimo

    2010-01-01

    The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. In particular the RNA sequences have some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algorithm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.

  17. First intron retention in part transcripts of OsEBP-89 gene in tissues of rice

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    OsEBP-89 is a transcription factor gene of rice.It contains two introns. Using RT-PCR and Southern hybridization to study OsEBP-89 tissue-specific expression, we found that its first intron (115 bp in length) of its was retained in a fraction of its transcripts of this gene in rice developing seeds. Furthermore, two OsEBP-89 cDNA clones (c89L and c89LH) were screened from a rice cDNA library.Sequence analysis revealed that the first intron was retained in c89L clone, whereas, both the first and second intron sequences were spliced in c89LH. In addition to developing seeds, the first intron unspliced transcripts of OsEBP-89 are detected in leaves and roots of rice, too. However, the ratio of the first intron unspliced to spliced OsEBP-89 transcripts varied in different tissues examined. The potential biological significance of intron retention in OsEBP-89 transcript was discussed.

  18. Intronic RNAs constitute the major fraction of the non-coding RNA in mammalian cells

    Directory of Open Access Journals (Sweden)

    St Laurent Georges

    2012-09-01

    Full Text Available Abstract Background The function of RNA from the non-coding (the so called “dark matter” regions of the genome has been a subject of considerable recent debate. Perhaps the most controversy is regarding the function of RNAs found in introns of annotated transcripts, where most of the reads that map outside of exons are usually found. However, it has been reported that the levels of RNA in introns are minor relative to those of the corresponding exons, and that changes in the levels of intronic RNAs correlate tightly with that of adjacent exons. This would suggest that RNAs produced from the vast expanse of intronic space are just pieces of pre-mRNAs or excised introns en route to degradation. Results We present data that challenges the notion that intronic RNAs are mere by-standers in the cell. By performing a highly quantitative RNAseq analysis of transcriptome changes during an inflammation time course, we show that intronic RNAs have a number of features that would be expected from functional, standalone RNA species. We show that there are thousands of introns in the mouse genome that generate RNAs whose overall abundance, which changes throughout the inflammation timecourse, and other properties suggest that they function in yet unknown ways. Conclusions So far, the focus of non-coding RNA discovery has shied away from intronic regions as those were believed to simply encode parts of pre-mRNAs. Results presented here suggest a very different situation – the sequences encoded in the introns appear to harbor a yet unexplored reservoir of novel, functional RNAs. As such, they should not be ignored in surveys of functional transcripts or other genomic studies.

  19. Lineage-specific group II intron gains and losses of the mitochondrial rps3 gene in gymnosperms.

    Science.gov (United States)

    Regina, Teresa M R; Quagliariello, Carla

    2010-08-01

    According to PCR assays and sequencing, we now report the shared presence of two rps3 introns, namely the rps3i74 and the rps3i249, in the mitochondria of all the classes representing the surviving lineages of gymnosperms, and unveil several lineages experiencing intron loss. Interestingly, the rps3 intron gains and losses within the four groups of gymnosperms let us sort out the Pinaceae and the non-Pinaceae into intron (+)- and intron (-)-lineages, respectively. Worthy of mention is also the finding that only Gnetum within the Gnetales harbours both the rps3 introns. This intron distribution pattern is consistent with the hypothesis that the two rps3 introns were likely present in the common ancestor of the seed plants and, then, independently lost in the non-Pinaceae during gymnosperm evolution. The derived secondary structural model of the novel group IIA intron improves our understanding of the significance and origin of the extraordinary length polymorphisms observed among rps3i249 orthologs. Despite the remarkable structural plasticity to adopt and reject introns, the rps3 mRNAs undergo accurate processing by splicing and extensive editing in gymnosperm mitochondria. This study provides additional insights into the evolutionarily high dynamics of mitochondrial introns which may come and go in closely related plant species. The turnover of the mitochondrial rps3 group II introns seen among lineages of seed plants further suggests that these introns might be an additional signature to discriminate between particularly cryptical taxonomic groups for which there is a need of a further evaluation of their evolutionary affiliation.

  20. A Novel Regulatory Mechanism of Type II Collagen Expression via a SOX9-dependent Enhancer in Intron 6.

    Science.gov (United States)

    Yasuda, Hideyo; Oh, Chun-do; Chen, Di; de Crombrugghe, Benoit; Kim, Jin-Hoi

    2017-01-13

    Type II collagen α1 is specific for cartilaginous tissues, and mutations in its gene are associated with skeletal diseases. Its expression has been shown to be dependent on SOX9, a master transcription factor required for chondrogenesis that binds to an enhancer region in intron 1. However, ChIP sequencing revealed that SOX9 does not strongly bind to intron 1, but rather it binds to intron 6 and a site 30 kb upstream of the transcription start site. Here, we aimed to determine the role of the novel SOX9-binding site in intron 6. We prepared reporter constructs that contain a Col2a1 promoter, intron 1 with or without intron 6, and the luciferase gene. Although the reporter constructs were not activated by SOX9 alone, the construct that contained both introns 1 and 6 was activated 5-10-fold by the SOX9/SOX5 or the SOX9/SOX6 combination in transient-transfection assays in 293T cells. This enhancement was also observed in rat chondrosarcoma cells that stably expressed the construct. CRISPR/Cas9-induced deletion of intron 6 in RCS cells revealed that a 10-bp region of intron 6 is necessary both for Col2a1 expression and SOX9 binding. Furthermore, SOX9, but not SOX5, binds to this region as demonstrated in an electrophoretic mobility shift assay, although both SOX9 and SOX5 bind to a larger 325-bp fragment of intron 6 containing this small sequence. These findings suggest a novel mechanism of action of SOX5/6; namely, the SOX9/5/6 combination enhances Col2a1 transcription through a novel enhancer in intron 6 together with the enhancer in intron 1. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Analysis of phylogenetic signal in protostomial intron patterns using Mutual Information.

    Science.gov (United States)

    Hill, Natascha; Leow, Alexander; Bleidorn, Christoph; Groth, Detlef; Tiedemann, Ralph; Selbig, Joachim; Hartmann, Stefanie

    2013-06-01

    Many deep evolutionary divergences still remain unresolved, such as those among major taxa of the Lophotrochozoa. As alternative phylogenetic markers, the intron-exon structure of eukaryotic genomes and the patterns of absence and presence of spliceosomal introns appear to be promising. However, given the potential homoplasy of intron presence, the phylogenetic analysis of this data using standard evolutionary approaches has remained a challenge. Here, we used Mutual Information (MI) to estimate the phylogeny of Protostomia using gene structure data, and we compared these results with those obtained with Dollo Parsimony. Using full genome sequences from nine Metazoa, we identified 447 groups of orthologous sequences with 21,732 introns in 4,870 unique intron positions. We determined the shared absence and presence of introns in the corresponding sequence alignments and have made this data available in "IntronBase", a web-accessible and downloadable SQLite database. Our results obtained using Dollo Parsimony are obviously misled through systematic errors that arise from multiple intron loss events, but extensive filtering of data improved the quality of the estimated phylogenies. Mutual Information, in contrast, performs better with larger datasets, but at the same time it requires a complete data set, which is difficult to obtain for orthologs from a large number of taxa. Nevertheless, Mutual Information-based distances proved to be useful in analyzing this kind of data, also because the estimation of MI-based distances is independent of evolutionary models and therefore no pre-definitions of ancestral and derived character states are necessary.

  2. Caryophyllales: Evaluating phylogenetic signal in trnK intron versus matK

    Institute of Scientific and Technical Information of China (English)

    Sunny S. CRAWLEY; Khidir W. HILU

    2012-01-01

    We assess the phylogenetic information in trnK intron at the ordinal level using the Caryophyllales and compare it with that derived from matK.The trnK gene is split into two exons by an intron that includes the matK gene.The plastid trnK is a tRNA gene encoding Lysine(UUU),whereas the matK gene is a putative group Ⅱ intron maturase.The two regions are usually coamplified,and trnK intron is partially sequenced but its sequences are often excluded from phylogenetic reconstruction at deep historic levels.This study shows that the two regions are comparable in proportion of variable sites,possess a comparable pattern of substitution rates per site,and display similar phylogenetic informativeness profiles and per-site informativeness.Phylogenetic analyses show strong congruence between phylogenetic trees based on matK and trnK intron partitioned datasets from 45 genera representing 30 of the 34 recognized Caryophyllales families.The trnK intron alone provides a relatively well-resolved topology for the order.Combining the trnK intron with matK sequence data resulted in six most parsimonious trees,differing only in the placement of Claytonia (Portulacaceae) within the noncore group.A well-supported major basal split in the order into core and noncore Caryophyllales with Rhabdodendraceae,Simmondsiaceae,and Asteropeiaceae as sister to remaining core lineages is evident in partitioned and combined analyses.The placement of these three families has been disputable,impacting the overall backbone topology of the Caryophyllales.This study demonstrates the cost effectiveness of using the trnK intron along with matK (both substitutions and insertions/deletions) at deeper phylogenetic level.

  3. Development of rapidly evolving intron markers to estimate multilocus species trees of rodents.

    Directory of Open Access Journals (Sweden)

    Ana Rodríguez-Prieto

    Full Text Available One of the major challenges in the analysis of closely related species, speciation and phylogeography is the identification of variable sequence markers that allow the determination of genealogical relationships in multiple genomic regions using coalescent and species tree approaches. Rodent species represent nearly half of the mammalian diversity, but so far no systematic study has been carried out to detect suitable informative markers for this group. Here, we used a bioinformatic pipeline to extract intron sequences from rodent genomes available in databases and applied a series of filters that allowed the identification of 208 introns that adequately fulfilled several criteria for these studies. The main required characteristics of the introns were that they had the maximum possible mutation rates, that they were part of single-copy genes, that they had an appropriate sequence length for amplification, and that they were flanked by exons with suitable regions for primer design. In addition, in order to determine the validity of this approach, we chose ten of these introns for primer design and tested them in a panel of eleven rodent species belonging to different representative families. We show that all these introns can be amplified in the majority of species and that, overall, 79% of the amplifications worked with minimum optimization of the annealing temperature. In addition, we confirmed for a pair of sister species the relatively high level of sequence divergence of these introns. Therefore, we provide here a set of adequate intron markers that can be applied to different species of Rodentia for their use in studies that require significant sequence variability.

  4. Whence genes in pieces: reconstruction of the exon-intron gene structures of the last eukaryotic common ancestor and other ancestral eukaryotes.

    Science.gov (United States)

    Koonin, Eugene V; Csuros, Miklos; Rogozin, Igor B

    2013-01-01

    In eukaryotes, protein-coding sequences are interrupted by non-coding sequences known as introns. During mRNA maturation, introns are excised by the spliceosome and the coding regions, exons, are spliced to form the mature coding region. The intron densities widely differ between eukaryotic lineages, from 6 to 7 introns per kb of coding sequence in vertebrates, some invertebrates and green plants, to only a few introns across the entire genome in many unicellular eukaryotes. Evolutionary reconstructions using maximum likelihood methods suggest intron-rich ancestors for each major group of eukaryotes. For the last common ancestor of animals, the highest intron density of all extant and extinct eukaryotes was inferred, at 120-130% of the human intron density. Furthermore, an intron density within 53-74% of the human values was inferred for the last eukaryotic common ancestor. Accordingly, evolution of eukaryotic genes in all lines of descent involved primarily intron loss, with substantial gain only at the bases of several branches including plants and animals. These conclusions have substantial biological implications indicating that the common ancestor of all modern eukaryotes was a complex organism with a gene architecture resembling those in multicellular organisms. Alternative splicing most likely initially appeared as an inevitable result of splicing errors and only later was employed to generate structural and functional diversification of proteins. Copyright © 2012 John Wiley & Sons, Ltd.

  5. Changes in exon–intron structure during vertebrate evolution affect the splicing pattern of exons

    Science.gov (United States)

    Gelfman, Sahar; Burstein, David; Penn, Osnat; Savchenko, Anna; Amit, Maayan; Schwartz, Schraga; Pupko, Tal; Ast, Gil

    2012-01-01

    Exon–intron architecture is one of the major features directing the splicing machinery to the short exons that are located within long flanking introns. However, the evolutionary dynamics of exon–intron architecture and its impact on splicing is largely unknown. Using a comparative genomic approach, we analyzed 17 vertebrate genomes and reconstructed the ancestral motifs of both 3′ and 5′ splice sites, as also the ancestral length of exons and introns. Our analyses suggest that vertebrate introns increased in length from the shortest ancestral introns to the longest primate introns. An evolutionary analysis of splice sites revealed that weak splice sites act as a restrictive force keeping introns short. In contrast, strong splice sites allow recognition of exons flanked by long introns. Reconstruction of the ancestral state suggests these phenomena were not prevalent in the vertebrate ancestor, but appeared during vertebrate evolution. By calculating evolutionary rate shifts in exons, we identified cis-acting regulatory sequences that became fixed during the transition from early vertebrates to mammals. Experimental validations performed on a selection of these hexamers confirmed their regulatory function. We additionally revealed many features of exons that can discriminate alternative from constitutive exons. These features were integrated into a machine-learning approach to predict whether an exon is alternative. Our algorithm obtains very high predictive power (AUC of 0.91), and using these predictions we have identified and successfully validated novel alternatively spliced exons. Overall, we provide novel insights regarding the evolutionary constraints acting upon exons and their recognition by the splicing machinery. PMID:21974994

  6. Evidence for transitional stages in the evolution of euglenid group II introns and twintrons in the Monomorphina aenigmatica plastid genome.

    Directory of Open Access Journals (Sweden)

    Jean-François Pombert

    Full Text Available BACKGROUND: Photosynthetic euglenids acquired their plastid by secondary endosymbiosis of a prasinophyte-like green alga. But unlike its prasinophyte counterparts, the plastid genome of the euglenid Euglena gracilis is riddled with introns that interrupt almost every protein-encoding gene. The atypical group II introns and twintrons (introns-within-introns found in the E. gracilis plastid have been hypothesized to have been acquired late in the evolution of euglenids, implying that massive numbers of introns may be lacking in other taxa. This late emergence was recently corroborated by the plastid genome sequences of the two basal euglenids, Eutreptiella gymnastica and Eutreptia viridis, which were found to contain fewer introns. METHODOLOGY/PRINCIPAL FINDINGS: To gain further insights into the proliferation of introns in euglenid plastids, we have characterized the complete plastid genome sequence of Monomorphina aenigmatica, a freshwater species occupying an intermediate phylogenetic position between early and late branching euglenids. The M. aenigmatica UTEX 1284 plastid genome (74,746 bp, 70.6% A+T, 87 genes contains 53 intron insertion sites, of which 41 were found to be shared with other euglenids including 12 of the 15 twintron insertion sites reported in E. gracilis. CONCLUSIONS: The pattern of insertion sites suggests an ongoing but uneven process of intron gain in the lineage, with perhaps a minimum of two bursts of rapid intron proliferation. We also identified several sites that represent intermediates in the process of twintron evolution, where the external intron is in place, but not the internal one, offering a glimpse into how these convoluted molecular contraptions originate.

  7. Nuclear group I introns in self-splicing and beyond

    Science.gov (United States)

    2013-01-01

    Group I introns are a distinct class of RNA self-splicing introns with an ancient origin. All known group I introns present in eukaryote nuclei interrupt functional ribosomal RNA genes located in ribosomal DNA loci. The discovery of the Tetrahymena intron more than 30 years ago has been essential to our understanding of group I intron catalysis, higher-order RNA structure, and RNA folding, but other intron models have provided information about the biological role. Nuclear group I introns appear widespread among eukaryotic microorganisms, and the plasmodial slime molds (myxomycetes) contain an abundance of self-splicing introns. Here, we summarize the main conclusions from previous work on the Tetrahymena intron on RNA self-splicing catalysis as well as more recent work on myxomycete intron biology. Group I introns in myxomycetes that represent different evolutionary stages, biological roles, and functional settings are discussed. PMID:23738941

  8. Intron phase correlations and the evolution of the intron/exon structure of genes.

    Science.gov (United States)

    Long, M; Rosenberg, C; Gilbert, W

    1995-01-01

    Two issues in the evolution of the intron/exon structure of genes are the role of exon shuffling and the origin of introns. Using a large data base of eukaryotic intron-containing genes, we have found that there are correlations between intron phases leading to an excess of symmetric exons and symmetric exon sets. We interpret these excesses as manifestations of exon shuffling and make a conservative estimate that at least 19% of the exons in the data base were involved in exon shuffling, suggesting an important role for exon shuffling in evolution. Furthermore, these excesses of symmetric exons appear also in those regions of eukaryotic genes that are homologous to prokaryotic genes: the ancient conserved regions. This last fact cannot be explained in terms of the insertional theory of introns but rather supports the concept that some of the introns were ancient, the exon theory of genes. PMID:8618928

  9. The low information content of Neurospora splicing signals: implications for RNA splicing and intron origin.

    Science.gov (United States)

    Collins, Richard A; Stajich, Jason E; Field, Deborah J; Olive, Joan E; DeAbreu, Diane M

    2015-05-01

    When we expressed a small (0.9 kb) nonprotein-coding transcript derived from the mitochondrial VS plasmid in the nucleus of Neurospora we found that it was efficiently spliced at one or more of eight 5' splice sites and ten 3' splice sites, which are present apparently by chance in the sequence. Further experimental and bioinformatic analyses of other mitochondrial plasmids, random sequences, and natural nuclear genes in Neurospora and other fungi indicate that fungal spliceosomes recognize a wide range of 5' splice site and branchpoint sequences and predict introns to be present at high frequency in random sequence. In contrast, analysis of intronless fungal nuclear genes indicates that branchpoint, 5' splice site and 3' splice site consensus sequences are underrepresented compared with random sequences. This underrepresentation of splicing signals is sufficient to deplete the nuclear genome of splice sites at locations that do not comprise biologically relevant introns. Thus, the splicing machinery can recognize a wide range of splicing signal sequences, but splicing still occurs with great accuracy, not because the splicing machinery distinguishes correct from incorrect introns, but because incorrect introns are substantially depleted from the genome.

  10. Obligatory group I introns with unusual features at positions 1949 and 2449 in nuclear LSU rDNA of Didymiaceae myxomycetes.

    Science.gov (United States)

    Wikmark, Odd-Gunnar; Haugen, Peik; Haugli, Kari; Johansen, Steinar D

    2007-05-01

    Myxomycetes (plasmodial slime molds) belonging to the order Physarales contain obligatory group I introns at positions 1949 and 2449 in their large subunit ribosomal RNA gene. Here, we report 36 group I introns from the Didymiaceae family (order Physarales) from 18 isolates representing three genera and seven species, and have reconstructed both host and intron phylogenies. The introns, named L1949 and L2449, were found in all isolates analyzed, consistent with an obligatory distribution in Didymiaceae. The introns fold at the RNA-level into typical group I ribozyme core structures that are relatively conserved, but contain large and highly variable extension sequences in peripheral domains without any detectable protein coding capacities. Furthermore, the L1949 and L2449 introns have probably become dependent on host factors for folding or activity. This assumption is based on that all introns tested for self-splicing in vitro failed to ligate the flanking exon regions. Phylogenies based on LSU rDNA and intron sequences are consistent with that the L1949 and L2449 introns follow a strict vertical inheritance within Didymiaceae. We suggest that the Didymiaceae L1949 and L2449 introns are well suited as high-resolution markers in genetic assessments at various taxonomic levels, from closely related strains of a single species to separating genera.

  11. An intronic G run within HIV-1 intron 2 is critical for splicing regulation of vif mRNA.

    Science.gov (United States)

    Widera, Marek; Erkelenz, Steffen; Hillebrand, Frank; Krikoni, Aikaterini; Widera, Darius; Kaisers, Wolfgang; Deenen, René; Gombert, Michael; Dellen, Rafael; Pfeiffer, Tanya; Kaltschmidt, Barbara; Münk, Carsten; Bosch, Valerie; Köhrer, Karl; Schaal, Heiner

    2013-03-01

    Within target T lymphocytes, human immunodeficiency virus type I (HIV-1) encounters the retroviral restriction factor APOBEC3G (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3G; A3G), which is counteracted by the HIV-1 accessory protein Vif. Vif is encoded by intron-containing viral RNAs that are generated by splicing at 3' splice site (3'ss) A1 but lack splicing at 5'ss D2, which results in the retention of a large downstream intron. Hence, the extents of activation of 3'ss A1 and repression of D2, respectively, determine the levels of vif mRNA and thus the ability to evade A3G-mediated antiviral effects. The use of 3'ss A1 can be enhanced or repressed by splicing regulatory elements that control the recognition of downstream 5'ss D2. Here we show that an intronic G run (G(I2)-1) represses the use of a second 5'ss, termed D2b, that is embedded within intron 2 and, as determined by RNA deep-sequencing analysis, is normally inefficiently used. Mutations of G(I2)-1 and activation of D2b led to the generation of transcripts coding for Gp41 and Rev protein isoforms but primarily led to considerable upregulation of vif mRNA expression. We further demonstrate, however, that higher levels of Vif protein are actually detrimental to viral replication in A3G-expressing T cell lines but not in A3G-deficient cells. These observations suggest that an appropriate ratio of Vif-to-A3G protein levels is required for optimal virus replication and that part of Vif level regulation is effected by the novel G run identified here.

  12. The mitochondrial LSU rRNA group II intron of Ustilago maydis encodes an active homing endonuclease likely involved in intron mobility.

    Directory of Open Access Journals (Sweden)

    Anja Pfeifer

    Full Text Available BACKGROUND: The a2 mating type locus gene lga2 is critical for uniparental mitochondrial DNA inheritance during sexual development of Ustilago maydis. Specifically, the absence of lga2 results in biparental inheritance, along with efficient transfer of intronic regions in the large subunit rRNA gene between parental molecules. However, the underlying role of the predicted LAGLIDADG homing endonuclease gene I-UmaI located within the group II intron LRII1 has remained unresolved. METHODOLOGY/PRINCIPAL FINDINGS: We have investigated the enzymatic activity of I-UmaI in vitro based on expression of a tagged full-length and a naturally occurring mutant derivative, which harbors only the N-terminal LAGLIDADG domain. This confirmed Mg²⁺-dependent endonuclease activity and cleavage at the LRII1 insertion site to generate four base pair extensions with 3' overhangs. Specifically, I-UmaI recognizes an asymmetric DNA sequence with a minimum length of 14 base pairs (5'-GACGGGAAGACCCT-3' and tolerates subtle base pair substitutions within the homing site. Enzymatic analysis of the mutant variant indicated a correlation between the activity in vitro and intron homing. Bioinformatic analyses revealed that putatively functional or former functional I-UmaI homologs are confined to a few members within the Ustilaginales and Agaricales, including the phylogenetically distant species Lentinula edodes, and are linked to group II introns inserted into homologous positions in the LSU rDNA. CONCLUSIONS/SIGNIFICANCE: The present data provide strong evidence that intron homing efficiently operates under conditions of biparental inheritance in U. maydis. Conversely, uniparental inheritance may be critical to restrict the transmission of mobile introns. Bioinformatic analyses suggest that I-UmaI-associated introns have been acquired independently in distant taxa and are more widespread than anticipated from available genomic data.

  13. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  14. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.

    Science.gov (United States)

    Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan

    2008-01-01

    In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera.

  15. Evidence for intron length conservation in a set of mammalian genes associated with embryonic development

    LENUS (Irish Health Repository)

    2011-10-05

    Abstract Background We carried out an analysis of intron length conservation across a diverse group of nineteen mammalian species. Motivated by recent research suggesting a role for time delays associated with intron transcription in gene expression oscillations required for early embryonic patterning, we searched for examples of genes that showed the most extreme conservation of total intron content in mammals. Results Gene sets annotated as being involved in pattern specification in the early embryo or containing the homeobox DNA-binding domain, were significantly enriched among genes with highly conserved intron content. We used ancestral sequences reconstructed with probabilistic models that account for insertion and deletion mutations to distinguish insertion and deletion events on lineages leading to human and mouse from their last common ancestor. Using a randomization procedure, we show that genes containing the homeobox domain show less change in intron content than expected, given the number of insertion and deletion events within their introns. Conclusions Our results suggest selection for gene expression precision or the existence of additional development-associated genes for which transcriptional delay is functionally significant.

  16. CYP17A1 intron mutation causing cryptic splicing in 17α-hydroxylase deficiency.

    Directory of Open Access Journals (Sweden)

    Daw-Yang Hwang

    Full Text Available 17α-Hydroxylase/17, 20-lyase deficiency (17OHD is an autosomal recessive disease causing congenital adrenal hyperplasia and a rare cause of hypertension with hypokalemia. The CYP17A1 gene mutation leads to 17OHD and its clinical features. We described an 18 y/o female with clinical features of 17α-hydroxylase/17, 20-lyase deficiency and characterized the functional consequences of an intronic CYP17A1 mutation. The coding regions and flanking intronic bases of the CYP17A1 gene were amplified by PCR and sequenced. The patient is a compound heterozygote for the previously described p.R358X and IVS1 +2T>C mutations. A first intron splice donor site mutation was re-created in minigene and full-length expression vectors. Pre-mRNA splicing of the variant CYP17A1 intron was studied in transfected cells and in a transformed lymphoblastoid cell line. When the full-length CYP17A1 gene and minigene containing the intronic mutation was expressed in transfected cells, the majority (>90% of mRNA transcripts were incorrectly spliced. Only the p.R358X transcript was detected in the EBV-transformed lymphoblastoid cell line. The IVS1 +2T>C mutation abolished most 17α-hydroxylase/17, 20-lyase enzyme activity by aberrant mRNA splicing to an intronic pseudo-exon, causing a frame shift and early termination.

  17. Genome-wide transcript profiling reveals novel breast cancer-associated intronic sense RNAs.

    Science.gov (United States)

    Kim, Sang Woo; Fishilevich, Elane; Arango-Argoty, Gustavo; Lin, Yuefeng; Liu, Guodong; Li, Zhihua; Monaghan, A Paula; Nichols, Mark; John, Bino

    2015-01-01

    Non-coding RNAs (ncRNAs) play major roles in development and cancer progression. To identify novel ncRNAs that may identify key pathways in breast cancer development, we performed high-throughput transcript profiling of tumor and normal matched-pair tissue samples. Initial transcriptome profiling using high-density genome-wide tiling arrays revealed changes in over 200 novel candidate genomic regions that map to intronic regions. Sixteen genomic loci were identified that map to the long introns of five key protein-coding genes, CRIM1, EPAS1, ZEB2, RBMS1, and RFX2. Consistent with the known role of the tumor suppressor ZEB2 in the cancer-associated epithelial to mesenchymal transition (EMT), in situ hybridization reveals that the intronic regions deriving from ZEB2 as well as those from RFX2 and EPAS1 are down-regulated in cells of epithelial morphology, suggesting that these regions may be important for maintaining normal epithelial cell morphology. Paired-end deep sequencing analysis reveals a large number of distinct genomic clusters with no coding potential within the introns of these genes. These novel transcripts are only transcribed from the coding strand. A comprehensive search for breast cancer associated genes reveals enrichment for transcribed intronic regions from these loci, pointing to an underappreciated role of introns or mechanisms relating to their biology in EMT and breast cancer.

  18. Genome-wide transcript profiling reveals novel breast cancer-associated intronic sense RNAs.

    Directory of Open Access Journals (Sweden)

    Sang Woo Kim

    Full Text Available Non-coding RNAs (ncRNAs play major roles in development and cancer progression. To identify novel ncRNAs that may identify key pathways in breast cancer development, we performed high-throughput transcript profiling of tumor and normal matched-pair tissue samples. Initial transcriptome profiling using high-density genome-wide tiling arrays revealed changes in over 200 novel candidate genomic regions that map to intronic regions. Sixteen genomic loci were identified that map to the long introns of five key protein-coding genes, CRIM1, EPAS1, ZEB2, RBMS1, and RFX2. Consistent with the known role of the tumor suppressor ZEB2 in the cancer-associated epithelial to mesenchymal transition (EMT, in situ hybridization reveals that the intronic regions deriving from ZEB2 as well as those from RFX2 and EPAS1 are down-regulated in cells of epithelial morphology, suggesting that these regions may be important for maintaining normal epithelial cell morphology. Paired-end deep sequencing analysis reveals a large number of distinct genomic clusters with no coding potential within the introns of these genes. These novel transcripts are only transcribed from the coding strand. A comprehensive search for breast cancer associated genes reveals enrichment for transcribed intronic regions from these loci, pointing to an underappreciated role of introns or mechanisms relating to their biology in EMT and breast cancer.

  19. Characterization of the molecular basis of group II intron RNA recognition by CRS1-CRM domains.

    Science.gov (United States)

    Keren, Ido; Klipcan, Liron; Bezawork-Geleta, Ayenachew; Kolton, Max; Shaya, Felix; Ostersetzer-Biran, Oren

    2008-08-22

    CRM (chloroplast RNA splicing and ribosome maturation) is a recently recognized RNA-binding domain of ancient origin that has been retained in eukaryotic genomes only within the plant lineage. Whereas in bacteria CRM domains exist as single domain proteins involved in ribosome maturation, in plants they are found in a family of proteins that contain between one and four repeats. Several members of this family with multiple CRM domains have been shown to be required for the splicing of specific plastidic group II introns. Detailed biochemical analysis of one of these factors in maize, CRS1, demonstrated its high affinity and specific binding to the single group II intron whose splicing it facilitates, the plastid-encoded atpF intron RNA. Through its association with two intronic regions, CRS1 guides the folding of atpF intron RNA into its predicted "catalytically active" form. To understand how multiple CRM domains cooperate to achieve high affinity sequence-specific binding to RNA, we analyzed the RNA binding affinity and specificity associated with each individual CRM domain in CRS1; whereas CRM3 bound tightly to the RNA, CRM1 associated specifically with a unique region found within atpF intron domain I. CRM2, which demonstrated only low binding affinity, also seems to form specific interactions with regions localized to domains I, III, and IV. We further show that CRM domains share structural similarities and RNA binding characteristics with the well known RNA recognition motif domain.

  20. Evidence for intron length conservation in a set of mammalian genes associated with embryonic development

    Directory of Open Access Journals (Sweden)

    Korir Paul K

    2011-10-01

    Full Text Available Abstract Background We carried out an analysis of intron length conservation across a diverse group of nineteen mammalian species. Motivated by recent research suggesting a role for time delays associated with intron transcription in gene expression oscillations required for early embryonic patterning, we searched for examples of genes that showed the most extreme conservation of total intron content in mammals. Results Gene sets annotated as being involved in pattern specification in the early embryo or containing the homeobox DNA-binding domain, were significantly enriched among genes with highly conserved intron content. We used ancestral sequences reconstructed with probabilistic models that account for insertion and deletion mutations to distinguish insertion and deletion events on lineages leading to human and mouse from their last common ancestor. Using a randomization procedure, we show that genes containing the homeobox domain show less change in intron content than expected, given the number of insertion and deletion events within their introns. Conclusions Our results suggest selection for gene expression precision or the existence of additional development-associated genes for which transcriptional delay is functionally significant.

  1. A novel additional group II intron distinguishes the mitochondrial rps3 gene in gymnosperms.

    Science.gov (United States)

    Regina, Teresa M R; Picardi, Ernesto; Lopez, Loredana; Pesole, Graziano; Quagliariello, Carla

    2005-02-01

    Comparative analysis of the ribosomal protein S3 gene (rps3) in the mitochondrial genome of Cycas with newly sequenced counterparts from Magnolia and Helianthus and available sequences from higher plants revealed that the positional clustering with the genes for ribosomal protein S19 (rps19) and L16 (rpl16) is preserved in gymnosperms. However, in contrast to the other land plant species, the rps3 gene in Cycas mitochondria is unique in possessing a second intron: rps3i2. Reverse transcription-polymerase chain reaction (RT-PCR) analysis of the transcripts generated from the rps19-rps3-rpl16 cluster in Cycas mitochondria demonstrated that the genes are cotranscribed and extensively modified by RNA editing and that both introns are efficiently spliced. Despite remarkable size heterogeneity, the Cycas rps3i1 can be shown to be homologous to the group IIA introns present within the rps3 gene of algae and land plants, including Magnolia and Helianthus. Conversely, sequences similar to the rps3i2 have not been reported previously. On the basis of conserved primary and secondary structure the second intervening sequence interrupting the Cycas rps3 gene has been classified as a group II intron. The close relationship of the rps3i2 to a group of different plant mitochondrial introns is intriguing and suggestive of a mitochondrial derivation for this novel intervening sequence. Interestingly, the rps3i2 appears to be conserved at the same gene location in other gymnosperms. Furthermore, the pattern of the rps3i2 distribution among algae and land plants provides evidence for the evolutionary acquisition of this novel intron in gymnosperms via intragenomic transposition or retrotransposition.

  2. Genic regions of a large salamander genome contain long introns and novel genes

    Directory of Open Access Journals (Sweden)

    Bryant Susan V

    2009-01-01

    Full Text Available Abstract Background The basis of genome size variation remains an outstanding question because DNA sequence data are lacking for organisms with large genomes. Sixteen BAC clones from the Mexican axolotl (Ambystoma mexicanum: c-value = 32 × 109 bp were isolated and sequenced to characterize the structure of genic regions. Results Annotation of genes within BACs showed that axolotl introns are on average 10× longer than orthologous vertebrate introns and they are predicted to contain more functional elements, including miRNAs and snoRNAs. Loci were discovered within BACs for two novel EST transcripts that are differentially expressed during spinal cord regeneration and skin metamorphosis. Unexpectedly, a third novel gene was also discovered while manually annotating BACs. Analysis of human-axolotl protein-coding sequences suggests there are 2% more lineage specific genes in the axolotl genome than the human genome, but the great majority (86% of genes between axolotl and human are predicted to be 1:1 orthologs. Considering that axolotl genes are on average 5× larger than human genes, the genic component of the salamander genome is estimated to be incredibly large, approximately 2.8 gigabases! Conclusion This study shows that a large salamander genome has a correspondingly large genic component, primarily because genes have incredibly long introns. These intronic sequences may harbor novel coding and non-coding sequences that regulate biological processes that are unique to salamanders.

  3. Sequence analyses reveal that a TPR-DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR-DP domains and prokaryotic GerD proteins.

    Science.gov (United States)

    Hernández Torres, Jorge; Papandreou, Nikolaos; Chomilier, Jacques

    2009-05-01

    The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR-DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR-DP domains.

  4. Mechanisms of intron gain and loss in Drosophila

    Directory of Open Access Journals (Sweden)

    Yenerall Paul

    2011-12-01

    Full Text Available Abstract Background It is widely accepted that orthologous genes have lost or gained introns throughout evolution. However, the specific mechanisms that generate these changes have proved elusive. Introns are known to affect nearly every level of gene expression. Therefore, understanding their mechanism of evolution after their initial fixation in eukaryotes is pertinent to understanding the means by which organisms develop greater regulation and complexity. Results To investigate possible mechanisms of intron gain and loss, we identified 189 intron gain and 297 intron loss events among 11 Drosophila species. We then investigated these events for signatures of previously proposed mechanisms of intron gain and loss. This work constitutes the first comprehensive study into the specific mechanisms that may generate intron gains and losses in Drosophila. We report evidence of intron gain via transposon insertion; the first intron loss that may have occurred via non-homologous end joining; intron gains via the repair of a double strand break; evidence of intron sliding; and evidence that internal or 5' introns may not frequently be deleted via the self-priming of reverse transcription during mRNA-mediated intron loss. Our data also suggest that the transcription process may promote or result in intron gain. Conclusion Our findings support the occurrence of intron gain via transposon insertion, repair of double strand breaks, as well as intron loss via non-homologous end joining. Furthermore, our data suggest that intron gain may be enabled by or due to transcription, and we shed further light on the exact mechanism of mRNA-mediated intron loss.

  5. Functional characterisation of an intron retaining K+ transporter of barley reveals intron-mediated alternate splicing

    KAUST Repository

    Shahzad, K.

    2015-01-01

    Intron retention in transcripts and the presence of 5 and 3 splice sites within these introns mediate alternate splicing, which is widely observed in animals and plants. Here, functional characterisation of the K+ transporter, HvHKT2;1, with stably retained introns from barley (Hordeum vulgare) in yeast (Saccharomyces cerevisiae), and transcript profiling in yeast and transgenic tobacco (Nicotiana tabacum) is presented. Expression of intron-retaining HvHKT2;1 cDNA (HvHKT2;1-i) in trk1, trk2 yeast strain defective in K+ uptake restored growth in medium containing hygromycin in the presence of different concentrations of K+ and mediated hypersensitivity to Na+. HvHKT2;1-i produces multiple transcripts via alternate splicing of two regular introns and three exons in different compositions. HKT isoforms with retained introns and exon skipping variants were detected in relative expression analysis of (i) HvHKT2;1-i in barley under native conditions, (ii) in transgenic tobacco plants constitutively expressing HvHKT2;1-i, and (iii) in trk1, trk2 yeast expressing HvHKT2;1-i under control of an inducible promoter. Mixed proportions of three HKT transcripts: HvHKT2;1-e (first exon region), HvHKT2;1-i1 (first intron) and HvHKT2;1-i2 (second intron) were observed. The variation in transcript accumulation in response to changing K+ and Na+ concentrations was observed in both heterologous and plant systems. These findings suggest a link between intron-retaining transcripts and different splice variants to ion homeostasis, and their possible role in salt stress.

  6. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten;

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  7. Molecular phylogenetics of the family Cyprinidae (Actinopterygii: Cypriniformes) as evidenced by sequence variation in the first intron of S7 ribosomal protein-coding gene: further evidence from a nuclear gene of the systematic chaos in the family.

    Science.gov (United States)

    He, Shunping; Mayden, Richard L; Wang, Xuzheng; Wang, Wei; Tang, Kevin L; Chen, Wei-Jen; Chen, Yiyu

    2008-03-01

    The family Cyprinidae is the largest freshwater fish group in the world, including over 200 genera and 2100 species. The phylogenetic relationships of major clades within this family are simply poorly understood, largely because of the overwhelming diversity of the group; however, several investigators have advanced different hypotheses of relationships that pre- and post-date the use of shared-derived characters as advocated through phylogenetic systematics. As expected, most previous investigations used morphological characters. Recently, mitochondrial DNA (mtDNA) sequences and combined morphological and mtDNA investigations have been used to explore and advance our understanding of species relationships and test monophyletic groupings. Limitations of these studies include limited taxon sampling and a strict reliance upon maternally inherited mtDNA variation. The present study is the first endeavor to recover the phylogenetic relationships of the 12 previously recognized monophyletic subfamilies within the Cyprinidae using newly sequenced nuclear DNA (nDNA) for over 50 species representing members of the different previously hypothesized subfamily and family groupings within the Cyprinidae and from other cypriniform families as outgroup taxa. Hypothesized phylogenetic relationships are constructed using maximum parsimony and Basyesian analyses of 1042 sites, of which 971 sites were variable and 790 were phylogenetically informative. Using other appropriate cypriniform taxa of the families Catostomidae (Myxocyprinus asiaticus), Gyrinocheilidae (Gyrinocheilus aymonieri), and Balitoridae (Nemacheilus sp. and Beaufortia kweichowensis) as outgroups, the Cyprinidae is resolved as a monophyletic group. Within the family the genera Raiamas, Barilius, Danio, and Rasbora, representing many of the tropical cyprinids, represent basal members of the family. All other species can be classified into variably supported and resolved monophyletic lineages, depending upon analysis

  8. Macronuclear genome structure of the ciliate Nyctotherus ovalis: Single-gene chromosomes and tiny introns

    Directory of Open Access Journals (Sweden)

    Landweber Laura F

    2008-12-01

    Full Text Available Abstract Background Nyctotherus ovalis is a single-celled eukaryote that has hydrogen-producing mitochondria and lives in the hindgut of cockroaches. Like all members of the ciliate taxon, it has two types of nuclei, a micronucleus and a macronucleus. N. ovalis generates its macronuclear chromosomes by forming polytene chromosomes that subsequently develop into macronuclear chromosomes by DNA elimination and rearrangement. Results We examined the structure of these gene-sized macronuclear chromosomes in N. ovalis. We determined the telomeres, subtelomeric regions, UTRs, coding regions and introns by sequencing a large set of macronuclear DNA sequences (4,242 and cDNAs (5,484 and comparing them with each other. The telomeres consist of repeats CCC(AAAACCCCn, similar to those in spirotrichous ciliates such as Euplotes, Sterkiella (Oxytricha and Stylonychia. Per sequenced chromosome we found evidence for either a single protein-coding gene, a single tRNA, or the complete ribosomal RNAs cluster. Hence the chromosomes appear to encode single transcripts. In the short subtelomeric regions we identified a few overrepresented motifs that could be involved in gene regulation, but there is no consensus polyadenylation site. The introns are short (21–29 nucleotides, and a significant fraction (1/3 of the tiny introns is conserved in the distantly related ciliate Paramecium tetraurelia. As has been observed in P. tetraurelia, the N. ovalis introns tend to contain in-frame stop codons or have a length that is not dividable by three. This pattern causes premature termination of mRNA translation in the event of intron retention, and potentially degradation of unspliced mRNAs by the nonsense-mediated mRNA decay pathway. Conclusion The combination of short leaders, tiny introns and single genes leads to very minimal macronuclear chromosomes. The smallest we identified contained only 150 nucleotides.

  9. Functional intron+ and intron- rDNA in the same macronucleus of the ciliate Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J

    1985-01-01

    alleles was followed in the total culture and in single cells during their vegetative segregation and it was observed that replication was non-preferential with respect to the two alleles. The diallelic clones were also used to demonstrate that intron-containing rDNA was transcribed and the transcript......Diallelic clones of Tetrahymena pigmentosa containing equal amounts of intron+ and intron- rDNA in the macronucleus were constructed. The macronucleus of the resulting strains divides amitotically during vegetative growth and the diallelic genotype is therefore unstable. The coexistence of the two...

  10. Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication.

    Science.gov (United States)

    Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun

    2016-06-04

    Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to "Gopoong" and "K-1" were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information.

  11. Intron and intronless transcription of the chicken polyubiquitin gene UbII.

    Science.gov (United States)

    Mezquita, J; López-Ibor, B; Pau, M; Mezquita, C

    1993-03-22

    We have previously reported that the chicken polyubiquitin gene UbII is preferentially expressed during spermatogenesis and we show here that UbII is the predominant polyubiquitin gene expressed in early embryogenesis. Two main initiation sites were detected. Transcription from the initiation site used in early embryos results in the presence of an intron in the 5'-untranslated region of the transcripts as has been reported for other polyubiquitin messages. In mature testis, however, the use of a different initiation site, located within the intron, produces intronless transcripts. Distinct promoter sequences, present in each initiation site, may regulate the differential expression observed in this gene.

  12. The dynamic loss and gain of introns during the evolution of the Brassicaceae.

    Science.gov (United States)

    Milia, Giampiera; Camiolo, Salvatore; Avesani, Linda; Porceddu, Andrea

    2015-06-01

    Sequence comparison allows the detailed analysis of evolution at the nucleotide and amino acid levels, but much less information is known about the structural evolution of genes, i.e. how the number, length and distribution of introns change over time. We constructed a parsimonious model for the evolutionary rate of intron loss (IL) and intron gain (IG) within the Brassicaceae and found that IL/IG has been highly dynamic, with substantial differences between and even within lineages. The divergence of the Brassicaceae lineages I and II marked a dramatic change in the IL rate, with the common ancestor of lineage I losing introns three times more rapidly than the common ancestor of lineage II. Our data also indicate a subsequent declining trend in the rate of IL, although in Arabidopsis thaliana introns continue to be lost at approximately the ancestral rate. Variations in the rate of IL/IG within lineage II have been even more remarkable. Brassica rapa appears to have lost introns approximately 15 times more rapidly than the common ancestor of B. rapa and Schenkiella parvula, and approximately 25 times more rapidly than its sister species Eutrema salsugineum. Microhomology was detected at the splice sites of several dynamic introns suggesting that the non-homologous end-joining and double-strand break repair is a common pathway underlying IL/IG in these species. We also detected molecular signatures typical of mRNA-mediated IL, but only in B. rapa. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  13. Recent horizontal transfer, functional adaptation and dissemination of a bacterial group II intron.

    Science.gov (United States)

    LaRoche-Johnston, Félix; Monat, Caroline; Cousineau, Benoit

    2016-10-20

    Group II introns are catalytically active RNA and mobile retroelements present in certain eukaryotic organelles, bacteria and archaea. These ribozymes self-splice from the pre-mRNA of interrupted genes and reinsert within target DNA sequences by retrohoming and retrotransposition. Evolutionary hypotheses place these retromobile elements at the origin of over half the human genome. Nevertheless, the evolution and dissemination of group II introns was found to be quite difficult to infer. We characterized the functional and evolutionary relationship between the model group II intron from Lactococcus lactis, Ll.LtrB, and Ef.PcfG, a newly discovered intron from a clinical strain of Enterococcus faecalis. Ef.PcfG was found to be homologous to Ll.LtrB and to splice and mobilize in its native environment as well as in L. lactis. Interestingly, Ef.PcfG was shown to splice at the same level as Ll.LtrB but to be significantly less efficient to invade the Ll.LtrB recognition site. We also demonstrated that specific point mutations between the IEPs of both introns correspond to functional adaptations which developed in L. lactis as a response to selective pressure on mobility efficiency independently of splicing. The sequence of all the homologous full-length variants of Ll.LtrB were compared and shown to share a conserved pattern of mutation acquisition. This work shows that Ll.LtrB and Ef.PcfG are homologous and have a common origin resulting from a recent lateral transfer event followed by further adaptation to the new target site and/or host environment. We hypothesize that Ef.PcfG is the ancestor of Ll.LtrB and was initially acquired by L. lactis, most probably by conjugation, via a single event of horizontal transfer. Strong selective pressure on homing site invasion efficiency then led to the emergence of beneficial point mutations in the IEP, enabling the successful establishment and survival of the group II intron in its novel lactococcal environment. The current

  14. Isolation of tomato proteinase inhibitor Ⅱ gene and the function of its intron

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The genomic DNA sequence of tomato proteinase inhibitor Ⅱ gene (named tin2i, whose accession number in GenBank is AF007240) was isolated by PCR techniques. The intron sequence (TPI), with a length of 109 bp, owns typical structures of GT/AG dinucleotides at both ends and high content of AT base pairs which accounts for 80.7% of the total nucleotides. As shown by recombination experiment, the TPI sequence could efficiently promote the expression of the reporter gene gusA and this effect was independent of the position and orientation of the intron, thus showing its role as an enhancer. Such experiments as gel retardation assays, GUS histochemical staining and GUS fluorometric assays further demonstrated that TPI sequence maybe has promoter-like activity.

  15. Splicing of Nascent RNA Coincides with Intron Exit from RNA Polymerase II.

    Science.gov (United States)

    Carrillo Oesterreich, Fernando; Herzel, Lydia; Straube, Korinna; Hujer, Katja; Howard, Jonathon; Neugebauer, Karla M

    2016-04-01

    Protein-coding genes in eukaryotes are transcribed by RNA polymerase II (Pol II) and introns are removed from pre-mRNA by the spliceosome. Understanding the time lag between Pol II progression and splicing could provide mechanistic insights into the regulation of gene expression. Here, we present two single-molecule nascent RNA sequencing methods that directly determine the progress of splicing catalysis as a function of Pol II position. Endogenous genes were analyzed on a global scale in budding yeast. We show that splicing is 50% complete when Pol II is only 45 nt downstream of introns, with the first spliced products observed as introns emerge from Pol II. Perturbations that slow the rate of spliceosome assembly or speed up the rate of transcription caused splicing delays, showing that regulation of both processes determines in vivo splicing profiles. We propose that matched rates streamline the gene expression pathway, while allowing regulation through kinetic competition.

  16. Extensive intron gain in the ancestor of placental mammals

    Science.gov (United States)

    2011-01-01

    Background Genome-wide studies of intron dynamics in mammalian orthologous genes have found convincing evidence for loss of introns but very little for intron turnover. Similarly, large-scale analysis of intron dynamics in a few vertebrate genomes has identified only intron losses and no gains, indicating that intron gain is an extremely rare event in vertebrate evolution. These studies suggest that the intron-rich genomes of vertebrates do not allow intron gain. The aim of this study was to search for evidence of de novo intron gain in domesticated genes from an analysis of their exon/intron structures. Results A phylogenomic approach has been used to analyse all domesticated genes in mammals and chordates that originated from the coding parts of transposable elements. Gain of introns in domesticated genes has been reconstructed on well established mammalian, vertebrate and chordate phylogenies, and examined as to where and when the gain events occurred. The locations, sizes and amounts of de novo introns gained in the domesticated genes during the evolution of mammals and chordates has been analyzed. A significant amount of intron gain was found only in domesticated genes of placental mammals, where more than 70 cases were identified. De novo gained introns show clear positional bias, since they are distributed mainly in 5' UTR and coding regions, while 3' UTR introns are very rare. In the coding regions of some domesticated genes up to 8 de novo gained introns have been found. Intron densities in Eutheria-specific domesticated genes and in older domesticated genes that originated early in vertebrates are lower than those for normal mammalian and vertebrate genes. Surprisingly, the majority of intron gains have occurred in the ancestor of placentals. Conclusions This study provides the first evidence for numerous intron gains in the ancestor of placental mammals and demonstrates that adequate taxon sampling is crucial for reconstructing intron evolution. The

  17. Extensive intron gain in the ancestor of placental mammals

    Directory of Open Access Journals (Sweden)

    Kordiš Dušan

    2011-11-01

    Full Text Available Abstract Background Genome-wide studies of intron dynamics in mammalian orthologous genes have found convincing evidence for loss of introns but very little for intron turnover. Similarly, large-scale analysis of intron dynamics in a few vertebrate genomes has identified only intron losses and no gains, indicating that intron gain is an extremely rare event in vertebrate evolution. These studies suggest that the intron-rich genomes of vertebrates do not allow intron gain. The aim of this study was to search for evidence of de novo intron gain in domesticated genes from an analysis of their exon/intron structures. Results A phylogenomic approach has been used to analyse all domesticated genes in mammals and chordates that originated from the coding parts of transposable elements. Gain of introns in domesticated genes has been reconstructed on well established mammalian, vertebrate and chordate phylogenies, and examined as to where and when the gain events occurred. The locations, sizes and amounts of de novo introns gained in the domesticated genes during the evolution of mammals and chordates has been analyzed. A significant amount of intron gain was found only in domesticated genes of placental mammals, where more than 70 cases were identified. De novo gained introns show clear positional bias, since they are distributed mainly in 5' UTR and coding regions, while 3' UTR introns are very rare. In the coding regions of some domesticated genes up to 8 de novo gained introns have been found. Intron densities in Eutheria-specific domesticated genes and in older domesticated genes that originated early in vertebrates are lower than those for normal mammalian and vertebrate genes. Surprisingly, the majority of intron gains have occurred in the ancestor of placentals. Conclusions This study provides the first evidence for numerous intron gains in the ancestor of placental mammals and demonstrates that adequate taxon sampling is crucial for

  18. Intronic mutations outside of Alu-repeat-rich domains of the LDL receptor gene are a cause of familial hypercholesterolemia.

    Science.gov (United States)

    Amsellem, Sabine; Briffaut, Dorothée; Carrié, Alain; Rabès, Jean Pierre; Girardet, Jean Philippe; Fredenrich, Alexandre; Moulin, Philippe; Krempf, Michel; Reznik, Yves; Vialettes, Bernard; de Gennes, Jean Luc; Brukert, Eric; Benlian, Pascale

    2002-12-01

    Familial hypercholesterolemia (FH), a frequent monogenic condition complicated by premature cardiovascular disease, is characterized by high allelic heterogeneity at the low-density lipoprotein receptor ( LDLR) locus. Despite more than a decade of genetic testing, knowledge about intronic disease-causing mutations has remained limited because of lack of available genomic sequences. Based on the finding from bioinformatic analysis that Alu repeats represent 85% of LDLR intronic sequences outside exon-intron junctions, we designed a strategy to improve the exploration of genomic regions in the vicinity of exons in 110 FH subjects from an admixed population. In the first group of 42 patients of negative mutation carriers, as previously established by former screening strategies (denaturing gradient gel electrophoresis, DNA sequencing with former primers overlapping splice-sites, Southern Blotting), about half ( n=22) were found to be carriers of at least one heterozygous mutation. Among a second group of 68 newly recruited patients, 27% of mutation carriers ( n=37) had a splicing regulatory mutation. Overall, out of the 54 mutations identified, 13 were intronic, and 18 were novel, out of which nearly half were intronic. Two novel intronic mutations (IVS8-10G-->A within the polypyrimidine tract and IVS7+10G-->A downstream of donor site) might create potential aberrant splice sites according to neural-network computed estimation, contrary to 31 common single nucleotide variations also identified at exon-intron junctions. This new strategy of detecting the most likely disease-causing LDLR mutations outside of Alu-rich genomic regions reveals that intronic mutations may have a greater impact than previously reported on the molecular basis of FH.

  19. Deep intronic GPR143 mutation in a Japanese family with ocular albinism.

    Science.gov (United States)

    Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

    2015-06-10

    Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease.

  20. Using intron position conservation for homology-based gene prediction.

    Science.gov (United States)

    Keilwagen, Jens; Wenk, Michael; Erickson, Jessica L; Schattat, Martin H; Grau, Jan; Hartung, Frank

    2016-05-19

    Annotation of protein-coding genes is very important in bioinformatics and biology and has a decisive influence on many downstream analyses. Homology-based gene prediction programs allow for transferring knowledge about protein-coding genes from an annotated organism to an organism of interest.Here, we present a homology-based gene prediction program called GeMoMa. GeMoMa utilizes the conservation of intron positions within genes to predict related genes in other organisms. We assess the performance of GeMoMa and compare it with state-of-the-art competitors on plant and animal genomes using an extended best reciprocal hit approach. We find that GeMoMa often makes more precise predictions than its competitors yielding a substantially increased number of correct transcripts. Subsequently, we exemplarily validate GeMoMa predictions using Sanger sequencing. Finally, we use RNA-seq data to compare the predictions of homology-based gene prediction programs, and find again that GeMoMa performs well.Hence, we conclude that exploiting intron position conservation improves homology-based gene prediction, and we make GeMoMa freely available as command-line tool and Galaxy integration. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  2. Transcriptomic analysis of diplomonad parasites reveals a trans-spliced intron in a helicase gene in Giardia

    Science.gov (United States)

    2017-01-01

    Background The mechanisms by which DNA sequences are expressed is the central preoccupation of molecular genetics. Recently, ourselves and others reported that in the diplomonad protist Giardia lamblia, the coding regions of several mRNAs are produced by ligation of independent RNA species expressed from distinct genomic loci. Such trans-splicing of introns was found to affect nearly as many genes in this organism as does classical cis-splicing of introns. These findings raised questions about the incidence of intron trans-splicing both across the G. lambliatranscriptome and across diplomonad diversity in general, however a dearth of transcriptomic data at the time prohibited systematic study of these questions. Methods I leverage newly available transcriptomic data from G. lamblia and the related diplomonad Spironucleus salmonicidato search for trans-spliced introns. My computational pipeline recovers all four previously reported trans-spliced introns in G. lamblia, suggesting good sensitivity. Results Scrutiny of thousands of potential cases revealed only a single additional trans-spliced intron in G. lamblia, in the p68 helicase gene, and no cases in S. salmonicida. The p68 intron differs from the previously reported trans-spliced introns in its high degree of streamlining: the core features of G. lamblia trans-spliced introns are closely packed together, revealing striking economy in the implementation of a seemingly inherently uneconomical molecular mechanism. Discussion These results serve to circumscribe the role of trans-splicing in diplomonads both in terms of the number of genes effected and taxonomically. Future work should focus on the molecular mechanisms, evolutionary origins and phenotypic implications of this intriguing phenomenon. PMID:28090405

  3. Intron-specific patterns of divergence of lin-11 regulatory function in the C. elegans nervous system.

    Science.gov (United States)

    Amon, Siavash; Gupta, Bhagwati P

    2017-04-01

    The diversity of neurons in the nervous system is specified by many genes, including those that encode transcription factors (TFs) and play crucial roles in coordinating gene transcription. To understand how the spatiotemporal expression of TF genes is regulated to generate neuronal diversity, we used one member of the LIM-Hox family, lin-11, as a model that is necessary for the differentiation of amphid neurons in the nematode C. elegans and a related species C. briggsae. We characterized transcriptional regulation of lin-11 and uncovered regulatory roles of two of the largest introns, intron 3 and intron 7. These introns promote lin-11 expression in non-overlapping sets of neurons. Phenotypic rescue experiments in C. elegans revealed that intron 3 is capable of restoring lin-11 function based on gene expression patterns and behavioral assays. Interestingly, intron 3-driven reporter expression showed differences in neuronal cell types between C. briggsae and C. elegans, indicating evolutionary changes in lin-11 regulation between the two species. Reciprocal transformation experiments provided further evidence consistent with functional changes in both cis and trans regulation of lin-11. To further investigate transcriptional regulation of lin-11, we dissected the intronic regions in C. elegans and identified cell-specific enhancers. These enhancers possess multiple sequence blocks that are conserved among Caenorhabditis species and possess TF binding sites. We tested the role of a subset of predicted TFs and discovered that while three of them (SKN-1, CEH-6, and CRH-1) act via the intron 3 enhancer to negatively regulate lin-11 expression in neurons, another TF (CES-1) acts positively via the intron 7 enhancer. Overall, our findings demonstrate that neuronal expression of lin-11 involves multiple TF regulators and regulatory modules some of which have diverged in Caenorhabditis nematodes.

  4. Identification of minimal eukaryotic introns through GeneBase, a user-friendly tool for parsing the NCBI Gene databank.

    Science.gov (United States)

    Piovesan, Allison; Caracausi, Maria; Ricci, Marco; Strippoli, Pierluigi; Vitale, Lorenza; Pelleri, Maria Chiara

    2015-12-01

    We have developed GeneBase, a full parser of the National Center for Biotechnology Information (NCBI) Gene database, which generates a fully structured local database with an intuitive user-friendly graphic interface for personal computers. Features of all the annotated eukaryotic genes are accessible through three main software tables, including for each entry details such as the gene summary, the gene exon/intron structure and the specific Gene Ontology attributions. The structuring of the data, the creation of additional calculation fields and the integration with nucleotide sequences allow users to make many types of comparisons and calculations that are useful for data retrieval and analysis. We provide an original example analysis of the existing introns across all the available species, through which the classic biological problem of the 'minimal intron' may find a solution using available data. Based on all currently available data, we can define the shortest known eukaryotic GT-AG intron length, setting the physical limit at the 30 base pair intron belonging to the human MST1L gene. This 'model intron' will shed light on the minimal requirement elements of recognition used for conventional splicing functioning. Remarkably, this size is indeed consistent with the sum of the splicing consensus sequence lengths.

  5. Mechanisms used for genomic proliferation by thermophilic group II introns.

    Directory of Open Access Journals (Sweden)

    Georg Mohr

    Full Text Available Mobile group II introns, which are found in bacterial and organellar genomes, are site-specific retroelements hypothesized to be evolutionary ancestors of spliceosomal introns and retrotransposons in higher organisms. Most bacteria, however, contain no more than one or a few group II introns, making it unclear how introns could have proliferated to higher copy numbers in eukaryotic genomes. An exception is the thermophilic cyanobacterium Thermosynechococcus elongatus, which contains 28 closely related copies of a group II intron, constituting approximately 1.3% of the genome. Here, by using a combination of bioinformatics and mobility assays at different temperatures, we identified mechanisms that contribute to the proliferation of T. elongatus group II introns. These mechanisms include divergence of DNA target specificity to avoid target site saturation; adaptation of some intron-encoded reverse transcriptases to splice and mobilize multiple degenerate introns that do not encode reverse transcriptases, leading to a common splicing apparatus; and preferential insertion within other mobile introns or insertion elements, which provide new unoccupied sites in expanding non-essential DNA regions. Additionally, unlike mesophilic group II introns, the thermophilic T. elongatus introns rely on elevated temperatures to help promote DNA strand separation, enabling access to a larger number of DNA target sites by base pairing of the intron RNA, with minimal constraint from the reverse transcriptase. Our results provide insight into group II intron proliferation mechanisms and show that higher temperatures, which are thought to have prevailed on Earth during the emergence of eukaryotes, favor intron proliferation by increasing the accessibility of DNA target sites. We also identify actively mobile thermophilic introns, which may be useful for structural studies, gene targeting in thermophiles, and as a source of thermostable reverse transcriptases.

  6. The intraspecific variability of mitochondrial genes of Agaricus bisporus reveals an extensive group I intron mobility combined with low nucleotide substitution rates.

    Science.gov (United States)

    Jalalzadeh, Banafsheh; Saré, Idy Carras; Férandon, Cyril; Callac, Philippe; Farsi, Mohammad; Savoie, Jean-Michel; Barroso, Gérard

    2015-02-01

    Intraspecific mitochondrial variability was studied in ten strains of A. bisporus var. bisporus, in a strain representative of A. bisporus var. eurotetrasporus and in a strain of the closely related species Agaricus devoniensis. In A. bisporus, the cox1 gene is the richest in group I introns harboring homing endonuclease genes (heg). This study led to identify group I introns as the main source of cox1 gene polymorphism. Among the studied introns, two groups were distinguished according to the heg they contained. One group harbored heg maintained putatively functional. The other group was composed of eroded heg sequences that appeared to evolve toward their elimination. Low nucleotide substitution rates were found in both types of intronic sequences. This feature was also shared by all types of studied mitochondrial sequences, not only intronic but also genic and intergenic ones, when compared with nuclear sequences. Hence, the intraspecific evolution of A. bisporus mitochondrial genome appears characterized by both an important mobility (presence/absence) of large group I introns and by low nt substitution rates. This stringent conservation of mitochondrial sequences, when compared with their nuclear counterparts, appears irrespective of their apparent functionality and contrasts to what is widely accepted in fungal sequence evolution. This strengthens the usefulness of mtDNA sequences to get clues on intraspecific evolution.

  7. Classifying Genomic Sequences by Sequence Feature Analysis

    Institute of Scientific and Technical Information of China (English)

    Zhi-Hua Liu; Dian Jiao; Xiao Sun

    2005-01-01

    Traditional sequence analysis depends on sequence alignment. In this study, we analyzed various functional regions of the human genome based on sequence features, including word frequency, dinucleotide relative abundance, and base-base correlation. We analyzed the human chromosome 22 and classified the upstream,exon, intron, downstream, and intergenic regions by principal component analysis and discriminant analysis of these features. The results show that we could classify the functional regions of genome based on sequence feature and discriminant analysis.

  8. Multiple group I introns in the small-subunit rDNA of Botryosphaeria dothidea: implication for intraspecific genetic diversity.

    Directory of Open Access Journals (Sweden)

    Chao Xu

    Full Text Available Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU ribosomal DNA (rDNA sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF for encoding the homing endonuclease (HE, whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron and genotype IV (Bdo.S1199-B were each found in only one strain, whereas genotype I (Bdo.S1199-A and genotype II (Bdo.S943 and Bdo.S1506 occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea.

  9. Proliferation of group II introns in the chloroplast genome of the green alga Oedocladium carolinianum (Chlorophyceae

    Directory of Open Access Journals (Sweden)

    Jean-Simon Brouard

    2016-10-01

    Full Text Available Background The chloroplast genome sustained extensive changes in architecture during the evolution of the Chlorophyceae, a morphologically and ecologically diverse class of green algae belonging to the Chlorophyta; however, the forces driving these changes are poorly understood. The five orders recognized in the Chlorophyceae form two major clades: the CS clade consisting of the Chlamydomonadales and Sphaeropleales, and the OCC clade consisting of the Oedogoniales, Chaetophorales, and Chaetopeltidales. In the OCC clade, considerable variations in chloroplast DNA (cpDNA structure, size, gene order, and intron content have been observed. The large inverted repeat (IR, an ancestral feature characteristic of most green plants, is present in Oedogonium cardiacum (Oedogoniales but is lacking in the examined members of the Chaetophorales and Chaetopeltidales. Remarkably, the Oedogonium 35.5-kb IR houses genes that were putatively acquired through horizontal DNA transfer. To better understand the dynamics of chloroplast genome evolution in the Oedogoniales, we analyzed the cpDNA of a second representative of this order, Oedocladium carolinianum. Methods The Oedocladium cpDNA was sequenced and annotated. The evolutionary distances separating Oedocladium and Oedogonium cpDNAs and two other pairs of chlorophycean cpDNAs were estimated using a 61-gene data set. Phylogenetic analysis of an alignment of group IIA introns from members of the OCC clade was performed. Secondary structures and insertion sites of oedogonialean group IIA introns were analyzed. Results The 204,438-bp Oedocladium genome is 7.9 kb larger than the Oedogonium genome, but its repertoire of conserved genes is remarkably similar and gene order differs by only one reversal. Although the 23.7-kb IR is missing the putative foreign genes found in Oedogonium, it contains sequences coding for a putative phage or bacterial DNA primase and a hypothetical protein. Intergenic sequences are 1.5-fold

  10. Ancient nature of alternative splicing and functions of introns

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Kemin; Salamov, Asaf; Kuo, Alan; Aerts, Andrea; Grigoriev, Igor

    2011-03-21

    Using four genomes: Chamydomonas reinhardtii, Agaricus bisporus, Aspergillus carbonarius, and Sporotricum thermophile with EST coverage of 2.9x, 8.9x, 29.5x, and 46.3x respectively, we identified 11 alternative splicing (AS) types that were dominated by intron retention (RI; biased toward short introns) and found 15, 35, 52, and 63percent AS of multiexon genes respectively. Genes with AS were more ancient, and number of AS correlated with number of exons, expression level, and maximum intron length of the gene. Introns with tendency to be retained had either stop codons or length of 3n+1 or 3n+2 presumably triggering nonsense-mediated mRNA decay (NMD), but introns retained in major isoforms (0.2-6percent of all introns) were biased toward 3n length and stop codon free. Stopless introns were biased toward phase 0, but 3n introns favored phase 1 that introduced more flexible and hydrophilic amino acids on both ends of introns which would be less disruptive to protein structure. We proposed a model in which minor RI intron could evolve into major RI that could facilitate intron loss through exonization.

  11. Intron Derived Size Polymorphism in the Mitochondrial Genomes of Closely Related Chrysoporthe Species.

    Science.gov (United States)

    Kanzi, Aquillah Mumo; Wingfield, Brenda Diana; Steenkamp, Emma Theodora; Naidoo, Sanushka; van der Merwe, Nicolaas Albertus

    2016-01-01

    In this study, the complete mitochondrial (mt) genomes of Chrysoporthe austroafricana (190,834 bp), C. cubensis (89,084 bp) and C. deuterocubensis (124,412 bp) were determined. Additionally, the mitochondrial genome of another member of the Cryphonectriaceae, namely Cryphonectria parasitica (158,902 bp), was retrieved and annotated for comparative purposes. These genomes showed high levels of synteny, especially in regions including genes involved in oxidative phosphorylation and electron transfer, unique open reading frames (uORFs), ribosomal RNAs (rRNAs) and transfer RNAs (tRNAs), as well as intron positions. Comparative analyses revealed signatures of duplication events, intron number and length variation, and varying intronic ORFs which highlighted the genetic diversity of mt genomes among the Cryphonectriaceae. These mt genomes showed remarkable size polymorphism. The size polymorphism in the mt genomes of these closely related Chrysoporthe species was attributed to the varying number and length of introns, coding sequences and to a lesser extent, intergenic sequences. Compared to publicly available fungal mt genomes, the C. austroafricana mt genome is the second largest in the Ascomycetes thus far.

  12. Biased exon/intron distribution of cryptic and de novo 3' splice sites.

    Science.gov (United States)

    Královicová, Jana; Christensen, Mikkel B; Vorechovský, Igor

    2005-01-01

    We compiled sequences of previously published aberrant 3' splice sites (3'ss) that were generated by mutations in human disease genes. Cryptic 3'ss, defined here as those resulting from a mutation of the 3'YAG consensus, were more frequent in exons than in introns. They clustered in approximately 20 nt region adjacent to authentic 3'ss, suggesting that their under-representation in introns is due to a depletion of AG dinucleotides in the polypyrimidine tract (PPT). In contrast, most aberrant 3'ss that were induced by mutations outside the 3'YAG consensus (designated 'de novo') were in introns. The activation of intronic de novo 3'ss was largely due to AG-creating mutations in the PPT. In contrast, exonic de novo 3'ss were more often induced by mutations improving the PPT, branchpoint sequence (BPS) or distant auxiliary signals, rather than by direct AG creation. The Shapiro-Senapathy matrix scores had a good prognostic value for cryptic, but not de novo 3'ss. Finally, AG-creating mutations in the PPT that produced aberrant 3'ss upstream of the predicted BPS in vivo shared a similar 'BPS-new AG' distance. Reduction of this distance and/or the strength of the new AG PPT in splicing reporter pre-mRNAs improved utilization of authentic 3'ss, suggesting that AG-creating mutations that are located closer to the BPS and are preceded by weaker PPT may result in less severe splicing defects.

  13. Unusual intron conservation near tissue-regulated exons found by splicing microarrays.

    Directory of Open Access Journals (Sweden)

    Charles W Sugnet

    2006-01-01

    Full Text Available Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5' splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families.

  14. High frequency of p53 intronic point mutations in laryngeal squamous cell carcinoma

    Institute of Scientific and Technical Information of China (English)

    ZHAO Xu; LI Fucai; SONG Yutong; LI Yinghui; FU Weineng; XU Zhenming; SUN Kailai

    2004-01-01

    Intronic point mutations are rare and totally unknown for human laryngeal squamous cell carcinoma (LSCC). To explore the relationship of p53 gene intronic mutation to the development of human LSCC, DNA was extracted from both tumor tissues and matched normal tissues of 55 patients with LSCC in northeast of China. Polymerase chain reaction amplification-single strand conformational polymorphism (PCR-SSCP) combined with silver staining and DNA direct sequencing were used to detect mutations in exons 7~8 (p53E7 and p53E8) and introns 7~8 (p53I7 and p53I8) of p53 gene. The p53E7 mutation was detected in 17 out of 55 patients, and the p53I7 mutation in 21 patients. No mutation was found at p53E8 or p53I8 site. The difference between tumor group and paired normal group on the rates of both p53E7 and p53I7 mutations was statistically significant. The rate of p53I7 mutations in tumor tissue was higher than that of normal tissue, and so was that of p53E7. Sequence analysis revealed that most p53I7 mutations were at the nucleotides in the branch point sequence or the polypyrimidine tract in the 3′-splice acceptor site of the intron 7. The high incidence of p53 gene intronic mutation in LSCC indicates that genetic changes within the noncoding region of the p53 gene may serve as an alternative mechanism of activating the pathogenesis of human laryngeal squamous cell carcinoma. Mutations in the noncoding region of this gene should be further studied.

  15. Evolution of group I introns in Porifera: new evidence for intron mobility and implications for DNA barcoding.

    Science.gov (United States)

    Schuster, Astrid; Lopez, Jose V; Becking, Leontine E; Kelly, Michelle; Pomponi, Shirley A; Wörheide, Gert; Erpenbeck, Dirk; Cárdenas, Paco

    2017-03-20

    Mitochondrial introns intermit coding regions of genes and feature characteristic secondary structures and splicing mechanisms. In metazoans, mitochondrial introns have only been detected in sponges, cnidarians, placozoans and one annelid species. Within demosponges, group I and group II introns are present in six families. Based on different insertion sites within the cox1 gene and secondary structures, four types of group I and two types of group II introns are known, which can harbor up to three encoding homing endonuclease genes (HEG) of the LAGLIDADG family (group I) and/or reverse transcriptase (group II). However, only little is known about sponge intron mobility, transmission, and origin due to the lack of a comprehensive dataset. We analyzed the largest dataset on sponge mitochondrial group I introns to date: 95 specimens, from 11 different sponge genera which provided novel insights into the evolution of group I introns. For the first time group I introns were detected in four genera of the sponge family Scleritodermidae (Scleritoderma, Microscleroderma, Aciculites, Setidium). We demonstrated that group I introns in sponges aggregate in the most conserved regions of cox1. We showed that co-occurrence of two introns in cox1 is unique among metazoans, but not uncommon in sponges. However, this combination always associates an active intron with a degenerating one. Earlier hypotheses of HGT were confirmed and for the first time VGT and secondary losses of introns conclusively demonstrated. This study validates the subclass Spirophorina (Tetractinellida) as an intron hotspot in sponges. Our analyses confirm that most sponge group I introns probably originated from fungi. DNA barcoding is discussed and the application of alternative primers suggested.

  16. Insights into the history of a bacterial group II intron remnant from the genomes of the nitrogen-fixing symbionts Sinorhizobium meliloti and Sinorhizobium medicae.

    Science.gov (United States)

    Toro, N; Martínez-Rodríguez, L; Martínez-Abarca, F

    2014-10-01

    Group II introns are self-splicing catalytic RNAs that act as mobile retroelements. In bacteria, they are thought to be tolerated to some extent because they self-splice and home preferentially to sites outside of functional genes, generally within intergenic regions or in other mobile genetic elements, by mechanisms including the divergence of DNA target specificity to prevent target site saturation. RmInt1 is a mobile group II intron that is widespread in natural populations of Sinorhizobium meliloti and was first described in the GR4 strain. Like other bacterial group II introns, RmInt1 tends to evolve toward an inactive form by fragmentation, with loss of the 3' terminus. We identified genomic evidence of a fragmented intron closely related to RmInt1 buried in the genome of the extant S. meliloti/S. medicae species. By studying this intron, we obtained evidence for the occurrence of intron insertion before the divergence of ancient rhizobial species. This fragmented group II intron has thus existed for a long time and has provided sequence variation, on which selection can act, contributing to diverse genetic rearrangements, and to generate pan-genome divergence after strain differentiation. The data presented here suggest that fragmented group II introns within intergenic regions closed to functionally important neighboring genes may have been microevolutionary forces driving adaptive evolution of these rhizobial species.

  17. Spliceosomal intron size expansion in domesticated grapevine (Vitis vinifera

    Directory of Open Access Journals (Sweden)

    Goertzen Leslie R

    2011-03-01

    Full Text Available Abstract Background Spliceosomal introns are important components of eukaryotic genes as their structure, sizes and contents reflect the architecture of gene and genomes. Intron size, determined by both neutral evolution, repetitive elements activities and potential functional constraints, varies significantly in eukaryotes, suggesting unique dynamics and evolution in different lineages of eukaryotic organisms. However, the evolution of intron size, is rarely studied. To investigate intron size dynamics in flowering plants, in particular domesticated grapevines, a survey of intron size and content in wine grape (Vitis vinifera Pinot Noir genes was conducted by assembling and mapping the transcriptome of V. vinifera genes from ESTs to characterize and analyze spliceosomal introns. Results Uncommonly large size of spliceosomal intron was observed in V. vinifera genome, otherwise inconsistent with overall genome size dynamics when comparing Arabidopsis, Populus and Vitis. In domesticated grapevine, intron size is generally not related to gene function. The composition of enlarged introns in grapevines indicated extensive transposable element (TE activity within intronic regions. TEs comprise about 80% of the expanded intron space and in particular, recent LTR retrotransposon insertions are enriched in these intronic regions, suggesting an intron size expansion in the lineage leading to domesticated grapevine, instead of size contractions in Arabidopsis and Populus. Comparative analysis of selected intronic regions in V. vinifera cultivars and wild grapevine species revealed that accelerated TE activity was associated with grapevine domestication, and in some cases with the development of specific cultivars. Conclusions In this study, we showed intron size expansion driven by TE activities in domesticated grapevines, likely a result of long-term vegetative propagation and intensive human care, which simultaneously promote TE proliferation and

  18. Constructing Competitive Reverse Transcription Polymerize Chain Reaction Inter-Reference of PC mRNA by Intron Approach

    Institute of Scientific and Technical Information of China (English)

    XU Chuang; XIA Cheng; LIU Guo-wen; WANG Zhe; JIANG Yu-fu; ZHANG Nai-sheng; FU Shi-xin

    2004-01-01

    Inter-reference ofcompetitive reverse transcription polymerase chain reaction(RT-PCR)was constructed by intron method to detect the change of PC mRNA level in the pathway of carbohydrate metabolism.The experiment based on the principle that 81bp intron sequence was deleted in PC mRNA compared with PC DNA sequence.The 466bp competitive DNA template recombinant plasmid of PC mRNAwas successfully built by a pair of primer and was cloned once,PC DNA and PC mRNA could be inter-referred each other.The intron approach used in the experiment has broken through the traditional method of constructing competitive template.

  19. Selection-driven extinction dynamics for group II introns in Enterobacteriales.

    Science.gov (United States)

    Leclercq, Sébastien; Cordaux, Richard

    2012-01-01

    Transposable elements (TEs) are one of the major driving forces of genome evolution, raising the question of the long-term dynamics underlying their evolutionary success. Some TEs were proposed to evolve under a pattern of periodic extinctions-recolonizations, in which elements recurrently invade and quickly proliferate within their host genomes, then start to disappear until total extinction. Depending on the model, TE extinction is assumed to be driven by purifying selection against colonized host genomes (Sel-DE model) or by saturation of host genomes (Sat-DE model). Bacterial group II introns are suspected to follow an extinction-recolonization model of evolution, but whether they follow Sel-DE or Sat-DE dynamics is not known. Our analysis of almost 200 group II intron copies from 90 sequenced Enterobacteriales genomes confirms their extinction-recolonization dynamics: patchy element distributions among genera and even among strains within genera, acquisition of new group II introns through plasmids or other mobile genetic elements, and evidence for recent proliferations in some genomes. Distributions of recent and past proliferations and of their respective homing sites further provide strong support for the Sel-DE model, suggesting that group II introns are deleterious to their hosts. Overall, our observations emphasize the critical impact of host properties on TE dynamics.

  20. Selection-driven extinction dynamics for group II introns in Enterobacteriales.

    Directory of Open Access Journals (Sweden)

    Sébastien Leclercq

    Full Text Available Transposable elements (TEs are one of the major driving forces of genome evolution, raising the question of the long-term dynamics underlying their evolutionary success. Some TEs were proposed to evolve under a pattern of periodic extinctions-recolonizations, in which elements recurrently invade and quickly proliferate within their host genomes, then start to disappear until total extinction. Depending on the model, TE extinction is assumed to be driven by purifying selection against colonized host genomes (Sel-DE model or by saturation of host genomes (Sat-DE model. Bacterial group II introns are suspected to follow an extinction-recolonization model of evolution, but whether they follow Sel-DE or Sat-DE dynamics is not known. Our analysis of almost 200 group II intron copies from 90 sequenced Enterobacteriales genomes confirms their extinction-recolonization dynamics: patchy element distributions among genera and even among strains within genera, acquisition of new group II introns through plasmids or other mobile genetic elements, and evidence for recent proliferations in some genomes. Distributions of recent and past proliferations and of their respective homing sites further provide strong support for the Sel-DE model, suggesting that group II introns are deleterious to their hosts. Overall, our observations emphasize the critical impact of host properties on TE dynamics.

  1. Design and Experimental Evolution of trans-Splicing Group I Intron Ribozymes

    Directory of Open Access Journals (Sweden)

    Ulrich F. Müller

    2017-01-01

    Full Text Available Group I intron ribozymes occur naturally as cis-splicing ribozymes, in the form of introns that do not require the spliceosome for their removal. Instead, they catalyze two consecutive trans-phosphorylation reactions to remove themselves from a primary transcript, and join the two flanking exons. Designed, trans-splicing variants of these ribozymes replace the 3′-portion of a substrate with the ribozyme’s 3′-exon, replace the 5′-portion with the ribozyme’s 5′-exon, or insert/remove an internal sequence of the substrate. Two of these designs have been evolved experimentally in cells, leading to variants of group I intron ribozymes that splice more efficiently, recruit a cellular protein to modify the substrate’s gene expression, or elucidate evolutionary pathways of ribozymes in cells. Some of the artificial, trans-splicing ribozymes are promising as tools in therapy, and as model systems for RNA evolution in cells. This review provides an overview of the different types of trans-splicing group I intron ribozymes that have been generated, and the experimental evolution systems that have been used to improve them.

  2. In vivo expression of a group I intron HEG from the antisense strand of Didymium ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Vader, Anna; Sjøttem, Eva

    2006-01-01

    Two different isolates of the myxomycete Didymium iridis harbour homing endonuclease genes that are expressed from group I introns inserted into identical sites within the small subunit ribosomal DNA. The homing endonuclease proteins are related in sequence, and their gene structures share similar...

  3. Position-dependent repression and promotion of DQB1 intron 3 splicing by GGGG motifs.

    Science.gov (United States)

    Královicová, Jana; Vorechovsky, Igor

    2006-02-15

    Alternative splicing of HLA-DQB1 exon 4 is allele-dependent and results in variable expression of soluble DQbeta. We have recently shown that differential inclusion of this exon in mature transcripts is largely due to intron 3 variants in the branch point sequence (BPS) and polypyrimidine tract. To identify additional regulatory cis-elements that contribute to haplotype-specific splicing of DQB1, we systematically examined the effect of guanosine (G) repeats on intron 3 removal. We found that the GGG or GGGG repeats generally improved splicing of DQB1 intron 3, except for those that were adjacent to the 5' splice site where they had the opposite effect. The most prominent splicing enhancement was conferred by GGGG motifs arranged in tandem upstream of the BPS. Replacement of a G-rich segment just 5' of the BPS with a series of random sequences markedly repressed splicing, whereas substitutions of a segment further upstream that lacked the G-rich elements and had the same size did not result in comparable splicing inhibition. Systematic mutagenesis of both suprabranch guanosine quadruplets (G(4)) revealed a key role of central G residues in splicing enhancement, whereas cytosines in these positions had the most prominent repressive effects. Together, these results show a significant role of tandem G(4)NG(4) structures in splicing of both complete and truncated DQB1 intron 3, support position dependency of G repeats in splicing promotion and inhibition, and identify positively and negatively acting sequences that contribute to the haplotype-specific DQB1 expression.

  4. Mammalian Introns: When the Junk Generates Molecular Diversity

    Directory of Open Access Journals (Sweden)

    Florent Hubé

    2015-02-01

    Full Text Available Introns represent almost half of the human genome, yet their vast majority is eliminated from eukaryotic transcripts through RNA splicing. Nevertheless, they feature key elements and functions that deserve further interest. At the level of DNA, introns are genomic segments that can shelter independent transcription units for coding and non-coding RNAs which transcription may interfere with that of the host gene, and regulatory elements that can influence gene expression and splicing itself. From the RNA perspective, some introns can be subjected to alternative splicing. Intron retention appear to provide some plasticity to the nature of the protein produced, its distribution in a given cell type and timing of its translation. Intron retention may also serve as a switch to produce coding or non-coding RNAs from the same transcription unit. Conversely, splicing of introns has been directly implicated in the production of small regulatory RNAs. Hence, splicing of introns also appears to provide plasticity to the type of RNA produced from a genetic locus (coding, non-coding, short or long. We addressed these aspects to add to our understanding of mechanisms that control the fate of introns and could be instrumental in regulating genomic output and hence cell fate.

  5. A possible role for short introns in the acquisition of stroma-targeting peptides in the flagellate Euglena gracilis.

    Science.gov (United States)

    Vesteg, Matej; Vacula, Rostislav; Steiner, Jürgen M; Mateásiková, Bianka; Löffelhardt, Wolfgang; Brejová, Brona; Krajcovic, Juraj

    2010-08-01

    The chloroplasts of Euglena gracilis bounded by three membranes arose via secondary endosymbiosis of a green alga in a heterotrophic euglenozoan host. Many genes were transferred from symbiont to the host nucleus. A subset of Euglena nuclear genes of predominately symbiont, but also host, or other origin have obtained complex presequences required for chloroplast targeting. This study has revealed the presence of short introns (41-93 bp) either in the second half of presequence-encoding regions or shortly downstream of them in nine nucleus-encoded E. gracilis genes for chloroplast proteins (Eno29, GapA, PetA, PetF, PetJ, PsaF, PsbM, PsbO, and PsbW). In addition, the E. gracilis Pbgd gene contains two introns in the second half of presequence-encoding region and one at the border of presequence-mature peptide-encoding region. Ten of 12 introns present within presequence-encoding regions or shortly downstream of them identified in this study have typical eukaryotic GT/AG borders, are T-rich, 45-50 bp long, and pairwise sequence identities range from 27 to 61%. Thus single recombination events might have been mediated via these cis-spliced introns. A double crossing over between these cis-spliced introns and trans-spliced introns present in 5'-UTRs of Euglena nuclear genes is also likely to have occurred. Thus introns and exon-shuffling could have had an important role in the acquisition of chloroplast targeting signals in E. gracilis. The results are consistent with a late origin of photosynthetic euglenids.

  6. Novel +90G>A Intronic Polymorphism of CYP2D6

    Directory of Open Access Journals (Sweden)

    Monir Modaresi-nejad

    2015-04-01

    Full Text Available Objective: CYP2D6, an enzyme, metabolizes a large number of commonly prescribed drugs. Variations in CYP2D6 gene encoding this enzyme have been associated with individual differences in drug metabolism rates. The purpose of our study was to identify some allelic variants of CYP2D6 gene and to detect defective CYP2D6 alleles, as part of a pharmacogenetic screening program. Materials and Methods: A prospective study was done on 120 participants referred to Royan Institute in 2013. Allele and genotype frequencies for polymorphism of CYP2D6 gene in exons 1 and 4 were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis and sequencing on PCR products, respectively. Results: We identified a novel variant of the gene encoding cytochrome P450 2D6 (CYP2D6 at position +90 of intron 4 by sequencing method. This novel polymorphism of CYP2D6 has been deposited in GeneBank® under the accession number KF225465 in Jun 2013. Conclusion: In the current study, we identified novel polymorphism in intron 4. This single nucleotide polymorphism (SNP is known as +90G>A in the fourth intron.

  7. Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphism

    Directory of Open Access Journals (Sweden)

    Daniel Nowak, Maximilian Mossner, Claudia D. Baldus, Olaf Hopfer, Eckhard Thiel, Wolf-Karsten Hofmann

    2006-01-01

    Full Text Available hCDC4 (FBW7, FBXW7 is a new potential tumor suppressor gene which provides substrate specificity for SCF (Skp–Cullin–F-box ubiquitin ligases and thereby regulates the degradation of potent oncogenes such as cyclin E, Myc, c-Jun and Notch. Mutations in the hCDC4 gene have been found in several solid tumors such as pancreas, colorectal or endometrial cancer. We carried out a mutation analysis of the hCDC4 gene in 35 samples of patients with Acute Myeloid Leukemia (AML to elucidate a possible role of hCDC4 mutations in this disease. By direct DNA sequencing and digestion with Surveyor nuclease one heterozygous mutation in the 5' untranslated region of exon 1, transcript variant 3 was detected. Additionally, we could identify a new intronic SNP downstream of exon 10. The new variation was present in 20% of AML samples and was furthermore confirmed in a panel of 51 healthy individuals where it displayed a frequency of 14%. In conclusion we provide first data that in contrast to several solid tumors, mutations in the hCDC4 gene may not play a pivotal role in the pathogenesis of AML. Furthermore, we describe a new intronic polymorphism with high frequency in the intron sequence of the hCDC4 gene.

  8. Characterization of Exon 2 and Intron 2 of Leptin Gene in Native Anatolian Goat Breeds

    Directory of Open Access Journals (Sweden)

    Özge BAKIRCIOĞLU

    2016-07-01

    Full Text Available Studies performed on farm animals like cattle and pig have shown that there has been a relationship between leptin gene (LEP and carcass meat quality, milk production and content, and economic parameters such as reproduction and food consumption. There has been scarce research conducted related to leptin gene of sheep and especially goat. The aim of the study is to reveal the genetic structures of goats living in Turkey through nucleotide sequence analysis in targeted zones of LEP gene Exon 2 and Intron 2 of Anatolian Black, Kilis and Angora goat breeds which are commonly fed in Anatolia. According to the sequence analysis results of each three breeds, Anatolian Black goat breed have the highest haplotype number with nucleotide and haplotype diversity both in exon 2 and intron 2. There was only one haplotype found in both exon 2 and intron 2 in Angora goat breed. There was no nucleotide diversity found in individuals belonging to Angora goat breed. Taking the regions analyzed for LEP gene into consideration, it is seen that Anatolian Black goat breed has the highest genetic diversity among other goat breeds fed in Anatolia. Future studies upon the LEP gene in goats should take into account of increasing the sample size and of base in order to obtain more useful information for better understanding the gene structure.

  9. Epidermal growth factor receptor intron-1 polymorphism predicts gefitinib outcome in advanced non-small cell lung cancer.

    Science.gov (United States)

    Tiseo, Marcello; Capelletti, Marzia; De Palma, Giuseppe; Franciosi, Vittorio; Cavazzoni, Andrea; Mozzoni, Paola; Alfieri, Roberta R; Goldoni, Matteo; Galetti, Maricla; Bortesi, Beatrice; Bozzetti, Cecilia; Loprevite, Maura; Boni, Luca; Camisa, Roberta; Rindi, Guido; Petronini, Pier Giorgio; Ardizzoni, Andrea

    2008-10-01

    Epidermal growth factor receptor (EGFR) gene intron 1 contains a polymorphic single sequence dinucleotide repeat (CA)n whose length has been found to inversely correlate with transcriptional activity. This study was designed to assess the role of (CA)n polymorphism in predicting the outcome of gefitinib treatment in advanced non-small cell lung cancer (NSCLC). Blood and tumor tissue from 58 patients with advanced NSCLC submitted to gefitinib were collected. EGFR intron 1 gene polymorphism, along with EGFR gene mutation, gene copy number and immunohistochemistry expression were determined. Moreover, a panel of lung cancer cell lines characterized for EGFR intron 1 polymorphism was also studied. EGFR intron 1 polymorphism showed a statistically significant correlation with the gefitinib response (response rate 25 versus 0%, for patients with a (CA)16 and with a (CA)else genotype, respectively; p = 0.044). Patients with a (CA)16 genotype had a longer survival compared with those with a (CA)else genotype (11.4 versus 4.8 months, respectively; p = 0.037). In addition, cell lines lacking the (CA)16 allele showed a statistically significant higher IC50 compared with cell lines bearing at least one (CA)16 allele (p = 0.003). This study supports a potential role of EGFR intron 1 polymorphism in predicting the outcome of gefitinib treatment in advanced NSCLC.

  10. Regulation of mRNA Levels by Decay-Promoting Introns that Recruit the Exosome Specificity Factor Mmi1

    Directory of Open Access Journals (Sweden)

    Cornelia Kilchert

    2015-12-01

    Full Text Available In eukaryotic cells, inefficient splicing is surprisingly common and leads to the degradation of transcripts with retained introns. How pre-mRNAs are committed to nuclear decay is unknown. Here, we uncover a mechanism by which specific intron-containing transcripts are targeted for nuclear degradation in fission yeast. Sequence elements within these “decay-promoting” introns co-transcriptionally recruit the exosome specificity factor Mmi1, which induces degradation of the unspliced precursor and leads to a reduction in the levels of the spliced mRNA. This mechanism negatively regulates levels of the RNA helicase DDX5/Dbp2 to promote cell survival in response to stress. In contrast, fast removal of decay-promoting introns by co-transcriptional splicing precludes Mmi1 recruitment and relieves negative expression regulation. We propose that decay-promoting introns facilitate the regulation of gene expression. Based on the identification of multiple additional Mmi1 targets, including mRNAs, long non-coding RNAs, and sn/snoRNAs, we suggest a general role in RNA regulation for Mmi1 through transcript degradation.

  11. A novel mouse c-fos intronic promoter that responds to CREB and AP-1 is developmentally regulated in vivo.

    Directory of Open Access Journals (Sweden)

    Vincent Coulon

    Full Text Available BACKGROUND: The c-fos proto-oncogene is an archetype for rapid and integrative transcriptional activation. Innumerable studies have focused on the canonical promoter, located upstream from the transcriptional start site. However, several regulatory sequences have been found in the first intron. METHODOLOGY/PRINCIPAL FINDINGS: Here we describe an extremely conserved region in c-fos first intron that contains a putative TATA box, and functional TRE and CRE sites. This fragment drives reporter gene activation in fibroblasts, which is enhanced by increasing intracellular calcium and cAMP and by cotransfection of CREB or c-Fos/c-Jun expression vectors. We produced transgenic mice expressing a lacZ reporter controlled by the intronic promoter. Lac Z expression of this promoter is restricted to the developing central nervous system (CNS and the mesenchyme of developing mammary buds in embryos 12.5 days post-conception, and to brain tissue in adults. RT-QPCR analysis of tissue mRNA, including the anlage of the mammary gland and the CNS, confirms the existence of a novel, nested mRNA initiated in the first intron. CONCLUSIONS/SIGNIFICANCE: Our results provide evidence for a novel, developmentally regulated promoter in the first intron of the c-fos gene.

  12. An intronic deletion in the PROM1 gene leads to autosomal recessive cone-rod dystrophy

    Science.gov (United States)

    Eidinger, Osnat; Leibu, Rina; Newman, Hadas; Rizel, Leah; Perlman, Ido

    2015-01-01

    Purpose To investigate the genetic basis for autosomal recessive cone-rod dystrophy (CRD) in a consanguineous Israeli Jewish family. Methods Patients underwent a detailed ophthalmic evaluation, including eye examination, visual field testing, optical coherence tomography (OCT), and electrophysiological tests, electroretinography (ERG) and visual evoked potential (VEP). Genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array was performed to identify homozygous regions shared among two of the affected individuals. Mutation screening of the underlying gene was performed with direct sequencing. In silico and in vitro analyses were used to predict the effect of the identified mutation on splicing. Results The affected family members are three siblings who have various degrees of progressive visual deterioration, glare, color vision abnormalities, and night vision difficulties. Visual field tests revealed central scotomas of different extension. Cone and rod ERG responses were reduced, with cones more severely affected. Homozygosity mapping revealed several homozygous intervals shared among two of the affected individuals. One included the PROM1 gene. Sequence analysis of the 26 coding exons of PROM1 in one affected individual revealed no mutations in the coding sequence or in intronic splice sites. However, in intron 21, proximate to the intron–exon junction, we observed a homozygous 10 bp deletion between positions −26 and −17 (c.2281–26_-17del). The deletion was linked to a known SNP, c.2281–6C>G. The deletion cosegregated with the disease in the family, and was not detected in public databases or in 101 ethnically-matched control individuals. In silico analysis predicted that this deletion would lead to altered intron 21 splicing. Bioinformatic analysis predicted that a recognition site for the SRSF2 splicing factor is located within the deleted sequence. The in vitro splicing assay demonstrated that c.2281–26_-17del leads to

  13. Alteration of introns in a hyaluronan synthase 1 (HAS1 minigene convert Pre-mRNA [corrected] splicing to the aberrant pattern in multiple myeloma (MM: MM patients harbor similar changes.

    Directory of Open Access Journals (Sweden)

    Jitra Kriangkum

    Full Text Available Aberrant pre-mRNA splice variants of hyaluronan synthase 1 (HAS1 have been identified in malignant cells from cancer patients. Bioinformatic analysis suggests that intronic sequence changes can underlie aberrant splicing. Deletions and mutations were introduced into HAS1 minigene constructs to identify regions that can influence aberrant intronic splicing, comparing the splicing pattern in transfectants with that in multiple myeloma (MM patients. Introduced genetic variations in introns 3 and 4 of HAS1 as shown here can promote aberrant splicing of the type detected in malignant cells from MM patients. HAS1Vd is a novel intronic splice variant first identified here. HAS1Vb, an intronic splice variant previously identified in patients, skips exon 4 and utilizes the same intron 4 alternative 3'splice site as HAS1Vd. For transfected constructs with unaltered introns 3 and 4, HAS1Vd transcripts are readily detectable, frequently to the exclusion of HAS1Vb. In contrast, in MM patients, HAS1Vb is more frequent than HAS1Vd. In the HAS1 minigene, combining deletion in intron 4 with mutations in intron 3 leads to a shift from HAS1Vd expression to HAS1Vb expression. The upregulation of aberrant splicing, exemplified here by the expression of HAS1Vb, is shown here to be influenced by multiple genetic changes in intronic sequences. For HAS1Vb, this includes enhanced exon 4 skipping and increased usage of alternative 3' splice sites. Thus, the combination of introduced mutations in HAS1 intron3 with introduced deletions in HAS1 intron 4 promoted a shift to an aberrant splicing pattern previously shown to be clinically significant. Most MM patients harbor genetic variations in intron 4, and as shown here, nearly half harbor recurrent mutations in HAS1 intron 3. Our work suggests that aberrant intronic HAS1 splicing in MM patients may rely on intronic HAS1 deletions and mutations that are frequent in MM patients but absent from healthy donors.

  14. ConservedPrimers 2.0: a high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery.

    Science.gov (United States)

    You, Frank M; Huo, Naxin; Gu, Yong Q; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D

    2009-10-13

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they are located in exonic sequences which are usually conserved between related species, "conserved primers". They are useful for large-scale single nucleotide polymorphism (SNP) discovery and marker development, especially in species, such as wheat, for which a large number of ESTs are available but for which genome sequences and intron/exon boundaries are not available. To date, no suitable high-throughput tool is available for this purpose. We have developed, the ConservedPrimers 2.0 pipeline, for designing intron-flanking primers for large-scale SNP discovery and marker development, and demonstrated its utility in wheat. This tool uses non-redundant wheat EST sequences, such as wheat contigs and singleton ESTs, and related genomic sequences, such as those of rice, as inputs. It aligns the ESTs to the genomic sequences to identify unique colinear exon blocks and predicts intron lengths. Intron-flanking primers are then designed based on the intron/exon information using the Primer3 core program or BatchPrimer3. Finally, a tab-delimited file containing intron-flanking primer pair sequences and their primer properties is generated for primer ordering and their PCR applications. Using this tool, 1,922 bin-mapped wheat ESTs (31.8% of the 6,045 in total) were found to have unique colinear exon blocks suitable for primer design and 1,821 primer pairs were designed from these single- or low-copy genes for PCR amplification and SNP discovery. With these primers and subsequently designed genome-specific primers, a total of 1,527 loci were found to contain one or more genome-specific SNPs. The ConservedPrimers 2.0 pipeline for designing intron-flanking primers was developed and its

  15. Intron Retention and TE Exonization Events in ZRANB2

    Directory of Open Access Journals (Sweden)

    Sang-Je Park

    2012-01-01

    Full Text Available The Zinc finger, RAN-binding domain-containing protein 2 (ZRANB2, contains arginine/serine-rich (RS domains that mediate its function in the regulation of alternative splicing. The ZRANB2 gene contains 2 LINE elements (L3b, Plat_L3 between the 9th and 10th exons. We identified the exonization event of a LINE element (Plat_L3. Using genomic PCR, RT-PCR amplification, and sequencing of primate DNA and RNA samples, we analyzed the evolutionary features of ZRANB2 transcripts. The results indicated that 2 of the LINE elements were integrated in human and all of the tested primate samples (hominoids: 3 species; Old World monkey: 8 species; New World monkey: 6 species; prosimian: 1 species. Human, rhesus monkey, crab-eating monkey, African-green monkey, and marmoset harbor the exon derived from LINE element (Plat_L3. RT-PCR amplification revealed the long transcripts and their differential expression patterns. Intriguingly, these long transcripts were abundantly expressed in Old World monkey lineages (rhesus, crab-eating, and African-green monkeys and were expressed via intron retention (IR. Thus, the ZRANB2 gene produces 3 transcript variants in which the Cterminus varies by transposable elements (TEs exonization and IR mechanisms. Therefore, ZRANB2 is valuable for investigating the evolutionary mechanisms of TE exonization and IR during primate evolution.

  16. Tandem inversion duplication within F8 Intron 1 associated with mild haemophilia A.

    Science.gov (United States)

    Lannoy, N; Bandelier, C; Grisart, B; Reginster, M; Ronge-Collard, E; Vikkula, M; Hermans, C

    2015-07-01

    In approximately 90% of mild haemophilia A (HA) patients, a missense mutation can be identified using complete gene sequencing. In this study, multiplex ligation-dependent probe amplification analysis was performed as a second step in 10 French-speaking Belgian with mild HA presenting no detectable causal mutation by complete sequencing of the factor VIII (FVIII) (F8) gene's 26 exons and its 1.2 kb of contiguous promoter sequence. This gene dosage technique enabled the detection of exon 1 duplications of F8 in three apparently unrelated subjects. Using array-comparative genomic hybridization, breakpoint analysis delimited the duplication extent to 210 kb in the F8 intron 1 and VBP1 gene intragenic position. We postulated that the rearrangement responsible for this duplication, never before reported, could be attributed to a symmetrical tandem inversion duplication, resulting in a large 233 kb rearrangement of F8 intron 1. This rearranged intron should lead to the production of a small number of normal mRNA transcripts in relation to the mild HA phenotype. Our analysis of the entire F8 mRNA from index case 1, particularly the segment containing exons 1-9, revealed normal amplification and sequencing. Reduced plasma FVIII antigen levels caused by cross-reacting material is associated with a quantitative deficiency of plasma FVIII. Male patients were unresponsive to desmopressin (1-deamino-8-D-arginine vasopressin). All patients displayed identical F8 haplotypes, despite not being related, which suggests a possible founder effect caused by a 210 kb duplication involving F8 exon 1.

  17. Group II intron-anchored gene deletion in Clostridium.

    Directory of Open Access Journals (Sweden)

    Kaizhi Jia

    Full Text Available Clostridium plays an important role in commercial and medical use, for which targeted gene deletion is difficult. We proposed an intron-anchored gene deletion approach for Clostridium, which combines the advantage of the group II intron "ClosTron" system and homologous recombination. In this approach, an intron carrying a fragment homologous to upstream or downstream of the target site was first inserted into the genome by retrotransposition, followed by homologous recombination, resulting in gene deletion. A functional unknown operon CAC1493-1494 located in the chromosome, and an operon ctfAB located in the megaplasmid of C. acetobutylicum DSM1731 were successfully deleted by using this approach, without leaving antibiotic marker in the genome. We therefore propose this approach can be used for targeted gene deletion in Clostridium. This approach might also be applicable for gene deletion in other bacterial species if group II intron retrotransposition system is established.

  18. Allele-specific recognition of the 3′ splice site of INS intron 1

    Science.gov (United States)

    Kralovicova, Jana

    2010-01-01

    Genetic predisposition to type 1 diabetes (T1D) has been associated with a chromosome 11 locus centered on the proinsulin gene (INS) and with differential steady-state levels of INS RNA from T1D-predisposing and -protective haplotypes. Here, we show that the haplotype-specific expression is determined by INS variants that control the splicing efficiency of intron 1. The adenine allele at IVS1-6 (rs689), which rapidly expanded in modern humans, renders the 3′ splice site of this intron more dependent on the auxiliary factor of U2 small nuclear ribonucleoprotein (U2AF). This interaction required both zinc fingers of the 35-kD U2AF subunit (U2AF35) and was associated with repression of a competing 3′ splice site in INS exon 2. Systematic mutagenesis of reporter constructs showed that intron 1 removal was facilitated by conserved guanosine-rich enhancers and identified additional splicing regulatory motifs in exon 2. Sequencing of intron 1 in primates revealed that relaxation of its 3′ splice site in Hominidae coevolved with the introduction of a short upstream open reading frame, providing a more efficient coupled splicing and translation control. Depletion of SR proteins 9G8 and transformer-2 by RNA interference was associated with exon 2 skipping whereas depletion of SRp20 with increased representation of transcripts containing a cryptic 3′ splice site in the last exon. Together, these findings reveal critical interactions underlying the allele-dependent INS expression and INS-mediated risk of T1D and suggest that the increased requirement for U2AF35 in higher primates may hinder thymic presentation of autoantigens encoded by transcripts with weak 3′ splice sites. Electronic supplementary material The online version of this article (doi:10.1007/s00439-010-0860-1) contains supplementary material, which is available to authorized users. PMID:20628762

  19. Strong signature of natural selection within an FHIT intron implicated in prostate cancer risk.

    Directory of Open Access Journals (Sweden)

    Yan Ding

    Full Text Available Previously, a candidate gene linkage approach on brother pairs affected with prostate cancer identified a locus of prostate cancer susceptibility at D3S1234 within the fragile histidine triad gene (FHIT, a tumor suppressor that induces apoptosis. Subsequent association tests on 16 SNPs spanning approximately 381 kb surrounding D3S1234 in Americans of European descent revealed significant evidence of association for a single SNP within intron 5 of FHIT. In the current study, re-sequencing and genotyping within a 28.5 kb region surrounding this SNP further delineated the association with prostate cancer risk to a 15 kb region. Multiple SNPs in sequences under evolutionary constraint within intron 5 of FHIT defined several related haplotypes with an increased risk of prostate cancer in European-Americans. Strong associations were detected for a risk haplotype defined by SNPs 138543, 142413, and 152494 in all cases (Pearson's chi(2 = 12.34, df 1, P = 0.00045 and for the homozygous risk haplotype defined by SNPs 144716, 142413, and 148444 in cases that shared 2 alleles identical by descent with their affected brothers (Pearson's chi(2 = 11.50, df 1, P = 0.00070. In addition to highly conserved sequences encompassing SNPs 148444 and 152413, population studies revealed strong signatures of natural selection for a 1 kb window covering the SNP 144716 in two human populations, the European American (pi = 0.0072, Tajima's D = 3.31, 14 SNPs and the Japanese (pi = 0.0049, Fay & Wu's H = 8.05, 14 SNPs, as well as in chimpanzees (Fay & Wu's H = 8.62, 12 SNPs. These results strongly support the involvement of the FHIT intronic region in an increased risk of prostate cancer.

  20. Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss

    Science.gov (United States)

    2013-01-01

    Background Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. Results In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Conclusions Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes. PMID:23497167

  1. Evolutionary dynamics of triosephosphate isomerase gene intron location pattern in Metazoa: A new perspective on intron evolution in animals.

    Science.gov (United States)

    Chen, Bing; Shao, Jingru; Zhuang, Huifu; Wen, Jianfan

    2017-02-20

    Intron evolution, including its dynamics in the evolutionary transitions and diversification of eukaryotes, remains elusive. Inadequate taxon sampling due to data shortage, unclear phylogenetic framework, and inappropriate outgroup application might be among the causes. Besides, the integrity of all the introns within a gene was often neglected previously. Taking advantage of the ancient conserved triosephosphate isomerase gene (tim), the relatively robust phylogeny of Metazoa, and choanoflagellates as outgroup, the evolutionary dynamics of tim intron location pattern (ILP) in Metazoa was investigated. From 133 representative species of ten phyla, 30 types of ILPs were identified. A most common one, which harbors the maximum six intron positions, is deduced to be the common ancestral tim ILP of Metazoa, which almost had formed in their protozoan ancestor and was surprisingly retained and passed down till to each ancestors of metazoan phyla. In the subsequent animal diversification, it underwent different evolutionary trajectories: within Deuterostomia, it was almost completely retained only with changes in a few species with relatively recently fast-evolving histories, while within the rapidly radiating Protostomia, besides few but remarkable retention, it usually displayed extensive intron losses and a few gains. Therefore, a common ancestral exon-intron arrangement pattern of an animal gene is definitely discovered; besides the 'intron-rich view' of early animal genes being confirmed, the novel insight that high exon-intron re-arrangements of genes seem to be associated with the relatively recently rapid evolution of lineages/species/genomes but have no correlation with the ancient major evolutionary transitions in animal evolution, is revealed. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Exon-primed, intron-crossing (EPIC) loci for five nuclear genes in deep-sea protobranch bivalves: primer design, PCR protocols and locus utility.

    Science.gov (United States)

    Jennings, Robert M; Etter, R J

    2011-11-01

    We describe PCR primers and amplification protocols developed to obtain introns from conserved nuclear genes in deep-sea protobranch bivalves. Because almost no sequence data for protobranchs are publically available, mollusk and other protostome sequences from GenBank were used to design degenerate primers, making these loci potentially useful in other invertebrate taxa. Amplification and sequencing success varied across the test group of 30 species, and we present five loci spanning this range of outcomes. Intron presence in the targeted regions also varied across genes and species, often within single genera; for instance, the calmodulin and β-tubulin loci contained introns with high frequency, whereas the triose phosphate isomerase locus never contained an intron. In introns for which we were able to obtain preliminary estimates of polymorphism levels in single species, polymorphism was greater than traditional mitochondrial loci. These markers will greatly increase the ability to assess population structure in the ecologically important protobranchs, and may prove useful in other taxa as well.

  3. A modified group I intron can function as both a ribozyme and a 5' exon in a trans-exon ligation reaction.

    Science.gov (United States)

    Tasiouka, K I; Burke, J M

    1994-06-24

    Here, we show that a single RNA molecule derived from a group-I intron can provide the catalytic activity, the substrate recognition domain and the attacking nucleophile in a reaction that mimics the exon ligation step of splicing. To accomplish this reaction, we have linked a 5' exon sequence to the 3' end of an attenuated form of the self-splicing Tetrahymena rRNA intron. The ribozyme (I-E1) attacks an oligoribonucleotide analog of the 3' splice site (I'-E2) to generate a product containing ligated exons (I-E1-E2) and a small intron fragment (I'). Two modified introns were constructed and tested for activity. A construct designed to interact with the 3' splice site through intermolecular P9.0 and P10 helices was found to be inactive due to failure to form a stable ribozyme-substrate complex. A second modified intron and substrate combination was engineered, in which the complex was further stabilized by an intermolecular P9.2 helix. In this case, stable complexes and reaction products were identified. The reaction efficiency was low compared to splicing of the unmodified intron-containing precursor, and will be optimized in future experiments. Following optimization, we believe that this system may be exploited to examine the functional consequences of a wide variety of 3' splice-site modifications, and may provide the basis for development of highly selective trans-acting ribozymes.

  4. Muscleblind-like 1 activates insulin receptor exon 11 inclusion by enhancing U2AF65 binding and splicing of the upstream intron.

    Science.gov (United States)

    Echeverria, Gloria V; Cooper, Thomas A

    2014-02-01

    Alternative splicing regulates developmentally and tissue-specific gene expression programs, disruption of which have been implicated in numerous diseases. Muscleblind-like 1 (MBNL1) regulates splicing transitions, which are disrupted on loss of MBNL1 function in myotonic dystrophy type 1 (DM1). One such event is MBNL1-mediated activation of insulin receptor exon 11 inclusion, which requires an intronic enhancer element downstream of exon 11. The mechanism of MBNL1-mediated activation of exon inclusion is unknown. We developed an in vitro splicing assay, which robustly recapitulates MBNL1-mediated splicing activation of insulin receptor exon 11 and found that MBNL1 activates removal of the intron upstream of exon 11 upon binding its functional response element in the downstream intron. MBNL1 enhances early spliceosome assembly as evidenced by enhanced complex A formation and binding of U2 small nuclear ribonucleoprotein auxiliary factor 65 kDa subunit (U2AF65) on the upstream intron. We demonstrated that neither the 5' splice site nor exon 11 sequences are required for MBNL1-activated U2AF65 binding. Interestingly, the 5' splice site is required for MBNL1-mediated activation of upstream intron removal, although MBNL1 has no effect on U1 snRNA recruitment. These results suggest that MBNL1 directly activates binding of U2AF65 to enhance upstream intron removal to ultimately activate alternative exon inclusion.

  5. Suppression of the Arboviruses Dengue and Chikungunya Using a Dual-Acting Group-I Intron Coupled with Conditional Expression of the Bax C-Terminal Domain.

    Directory of Open Access Journals (Sweden)

    James R Carter

    Full Text Available In portions of South Asia, vectors and patients co-infected with dengue (DENV and chikungunya (CHIKV are on the rise, with the potential for this occurrence in other regions of the world, for example the United States. Therefore, we engineered an antiviral approach that suppresses the replication of both arboviruses in mosquito cells using a single antiviral group I intron. We devised unique configurations of internal, external, and guide sequences that permit homologous recognition and splicing with conserved target sequences in the genomes of both viruses using a single trans-splicing Group I intron, and examined their effectiveness to suppress infections of DENV and CHIKV in mosquito cells when coupled with a proapoptotic 3' exon, ΔN Bax. RT-PCR demonstrated the utility of these introns in trans-splicing the ΔN Bax sequence downstream of either the DENV or CHIKV target site in transformed Aedes albopictus C6/36 cells, independent of the order in which the virus specific targeting sequences were inserted into the construct. This trans-splicing reaction forms DENV or CHIKV ΔN Bax RNA fusions that led to apoptotic cell death as evidenced by annexin V staining, caspase, and DNA fragmentation assays. TCID50-IFA analyses demonstrate effective suppression of DENV and CHIKV infections by our anti-arbovirus group I intron approach. This represents the first report of a dual-acting Group I intron, and demonstrates that we can target DENV and CHIKV RNAs in a sequence specific manner with a single, uniquely configured CHIKV/DENV dual targeting group I intron, leading to replication suppression of both arboviruses, and thus providing a promising single antiviral for the transgenic suppression of multiple arboviruses.

  6. Interrupted thymidylate synthase gene of bacteriophages T2 and T6 and other potential self-splicing introns in the T-even bacteriophages

    Energy Technology Data Exchange (ETDEWEB)

    Chu, F.K.; Maley, F.; Martinez, J.; Maley, G.F.

    1987-09-01

    Southern hybridization analyses of procaryotic DNA from Escherchia coli, lambda bacteriophage, and T1 to T7 phages were carried out. The hybridization probes used consisted of DNA restriction fragments derived from the T4 phage intron-containing thymidylate synthase gene (td) and short synthetic oligodeoxynucleotides defining specific exon and intron regions of the gene. It was shown that intact as well as restricted DNA from the T-even phages hybridized not only to both T4 phage td intron- and exon-specific probes but also to probes defining the td 5' (exon I-intron) and 3' (intron-exon II) presplice junctions. These data strongly suggest that, analogous to the T4 phage, only the T2 and T6 phages among the procaryotes tested contain interrupted td genes. The td intervening sequence in each phage is roughly 1 kilobase pair (kb) in size and interrupts the td gene at a site analogous to that in the T4 phage. This was confirmed by data from Northern (RNA) hybridization analysis of td-specific in vitro transcripts of these phage DNAs. (..cap alpha..-/sup 32/P)GTP in vitro labeling of total RNA from T4 phage-infected cells produced five species of labeled RNAs that were 1, 0.9, 0.83, 0.75, and 0.6 kb in size. Only the 1-, 0.9-, and 0.75-kb species were labeled in RNA from T2- or T6-infected cells. The commonly present 1-kb RNA is the excised td intron, which exists in both linear and circular forms in the respective T-even-phage-infected cells, while the 0.6-kb RNA unique to T4 may be the excised intron derived from the ribonucleotide reductase small subunit gene (nrdB) of the phage. The remaining labeled RNA species are likely candidates for other self-splicing introns.

  7. TP53 intron 1 hotspot rearrangements are specific to sporadic osteosarcoma and can cause Li-Fraumeni syndrome.

    Science.gov (United States)

    Ribi, Sebastian; Baumhoer, Daniel; Lee, Kristy; Edison; Teo, Audrey S M; Madan, Babita; Zhang, Kang; Kohlmann, Wendy K; Yao, Fei; Lee, Wah Heng; Hoi, Qiangze; Cai, Shaojiang; Woo, Xing Yi; Tan, Patrick; Jundt, Gernot; Smida, Jan; Nathrath, Michaela; Sung, Wing-Kin; Schiffman, Joshua D; Virshup, David M; Hillmer, Axel M

    2015-04-10

    Somatic mutations of TP53 are among the most common in cancer and germline mutations of TP53 (usually missense) can cause Li-Fraumeni syndrome (LFS). Recently, recurrent genomic rearrangements in intron 1 of TP53 have been described in osteosarcoma (OS), a highly malignant neoplasm of bone belonging to the spectrum of LFS tumors. Using whole-genome sequencing of OS, we found features of TP53 intron 1 rearrangements suggesting a unique mechanism correlated with transcription. Screening of 288 OS and 1,090 tumors of other types revealed evidence for TP53 rearrangements in 46 (16%) OS, while none were detected in other tumor types, indicating this rearrangement to be highly specific to OS. We revisited a four-generation LFS family where no TP53 mutation had been identified and found a 445 kb inversion spanning from the TP53 intron 1 towards the centromere. The inversion segregated with tumors in the LFS family. Cancers in this family had loss of heterozygosity, retaining the rearranged allele and resulting in TP53 expression loss. In conclusion, intron 1 rearrangements cause p53-driven malignancies by both germline and somatic mechanisms and provide an important mechanism of TP53 inactivation in LFS, which might in part explain the diagnostic gap of formerly classified "TP53 wild-type" LFS.

  8. Correlation of PTPN11 polymorphism at intron 3 with gastric cancer

    Directory of Open Access Journals (Sweden)

    Li ZHANG

    2011-05-01

    Full Text Available Objective To explore the correlation of protein-tyrosine-phosphatase nonreceptor-type 11(PTPN11 polymorphism at intron 3 with gastric cancer in Chinese population,and the feasibility and accuracy of employing mastrix-assisted laser desorption ionization time-of-flight mass spectrogram(MALDI-TOF-MS in genotyping of this SNP.Methods Two hundred and forty-seven patients with gastric cancer,212 cancer-free patients and 160 cord blood samples were enrolled in present study.Genotypes of PTPN11 G/A polymorphism at intron 3 were determined by MALDI-TOF-MS analysis,and direct sequencing of PCR products with 20 samples of the gene locus was done for checking the accuracy of MALDI-TOF-MS.Histological examination,Helicobacter pylori culture,rapid urease test,serum anti-H.pylori antibodies(ELISA and urease colloidal gold test were performed to evaluate H.pylori infection.Results Direct sequencing of 20 random selected samples were well consistent with the MALDI-TOF-MS results.The rates of H.pylori infection were 73.68% in gastric cancer patients and 75.47% in cancer-free patients,implying no significant difference between the two groups.The distributions of genotypes were in Hardy Weinberg equilibrium in both gastric cancer patients and controls.There were no significant differences in the genotype frequencies between the 2 groups(P>0.05.Compared with the GG genotype,GA+AA genotype could not influence the risk of gastric cancer.When stratified for status,PTPN11 polymorphism was not associated with age,gender and H.pylori infection states in both cancer patients and controls.Conclusion It seems that PTPN11 G/A polymorphism at intron 3 has no affection on the risk of gastric cancer in Chinese population.

  9. The Long Intron 1 of Growth Hormone Gene from Reeves' Turtle (Chinemys reevesii) Correlates with Negatively Regulated GH Expression in Four Cell Lines.

    Science.gov (United States)

    Liu, Wen-Sheng; Ma, Jing-E; Li, Wei-Xia; Zhang, Jin-Ge; Wang, Juan; Nie, Qing-Hua; Qiu, Feng-Fang; Fang, Mei-Xia; Zeng, Fang; Wang, Xing; Lin, Xi-Ran; Zhang, Li; Chen, Shao-Hao; Zhang, Xi-Quan

    2016-04-12

    Turtles grow slowly and have a long lifespan. Ultrastructural studies of the pituitary gland in Reeves' turtle (Chinemys reevesii) have revealed that the species possesses a higher nucleoplasmic ratio and fewer secretory granules in growth hormone (GH) cells than other animal species in summer and winter. C. reevesii GH gene was cloned and species-specific similarities and differences were investigated. The full GH gene sequence in C. reevesii contains 8517 base pairs (bp), comprising five exons and four introns. Intron 1 was found to be much longer in C. reevesii than in other species. The coding sequence (CDS) of the turtle's GH gene, with and without the inclusion of intron 1, was transfected into four cell lines, including DF-1 chicken embryo fibroblasts, Chinese hamster ovary (CHO) cells, human embryonic kidney 293FT cells, and GH4C1 rat pituitary cells; the turtle growth hormone (tGH) gene mRNA and protein expression levels decreased significantly in the intron-containing CDS in these cell lines, compared with that of the corresponding intronless CDS. Thus, the long intron 1 of GH gene in Reeves' turtle might correlate with downregulated gene expression.

  10. The Long Intron 1 of Growth Hormone Gene from Reeves’ Turtle (Chinemys reevesii Correlates with Negatively Regulated GH Expression in Four Cell Lines

    Directory of Open Access Journals (Sweden)

    Wen-Sheng Liu

    2016-04-01

    Full Text Available Turtles grow slowly and have a long lifespan. Ultrastructural studies of the pituitary gland in Reeves’ turtle (Chinemys reevesii have revealed that the species possesses a higher nucleoplasmic ratio and fewer secretory granules in growth hormone (GH cells than other animal species in summer and winter. C. reevesii GH gene was cloned and species-specific similarities and differences were investigated. The full GH gene sequence in C. reevesii contains 8517 base pairs (bp, comprising five exons and four introns. Intron 1 was found to be much longer in C. reevesii than in other species. The coding sequence (CDS of the turtle’s GH gene, with and without the inclusion of intron 1, was transfected into four cell lines, including DF-1 chicken embryo fibroblasts, Chinese hamster ovary (CHO cells, human embryonic kidney 293FT cells, and GH4C1 rat pituitary cells; the turtle growth hormone (tGH gene mRNA and protein expression levels decreased significantly in the intron-containing CDS in these cell lines, compared with that of the corresponding intronless CDS. Thus, the long intron 1 of GH gene in Reeves’ turtle might correlate with downregulated gene expression.

  11. Molecular evolution of Adh and LEAFY and the phylogenetic utility of their introns in Pyrus (Rosaceae

    Directory of Open Access Journals (Sweden)

    Cao Jiashu

    2011-09-01

    Full Text Available Abstract Background The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh were selected to investigate their molecular evolution and phylogenetic utility. Results DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Conclusions Our study represents the first phylogenetic analyses based

  12. Differentiation of Candida parapsilosis, C. orthopsilosis, and C. metapsilosis by specific PCR amplification of the RPS0 intron.

    Science.gov (United States)

    del Pilar Vercher, M; García Martínez, José M; Cantón, Emilia; Pemán, Javier; Gómez García, M Micaela; Gómez, Eulogio Valentín; del Castillo Agudo, Lucas

    2011-08-01

    Although Candida parapsilosis is the most prevalent among the 3 species of the *psilosis group, studies applying DNA-based diagnostic techniques with isolates previously identified as C. parapsilosis have revealed that both C. orthopsilosis and C. metapsilosis account for 0-10% of all these isolates, depending on the geographical area. Differences in the degrees of antifungal susceptibility and virulence have been found, so a more precise identification is required. In a first approach, we reidentified 38 randomly chosen clinical isolates, previously identified as C. parapsilosis, using the RPO2 (CA2) RAPD marker. Among them, we reclassified 4 as C. metapsilosis and 5 as C. orthopsilosis. We previously developed a method to identify different pathogen yeast species, including C. parapsilosis, based on the amplification of the RPS0 gene intron. In this work, we extend this approach to the new *psilosis species by partially sequencing their RPS0 gene, including the intron sequence. Based on intron sequences, we designed specific primers capable of identifying C. orthopsilosis and C. metapsilosis species, and we reidentified species among the initial isolates. These new primers have allowed a specific and rapid identification of C. orthopsilosis and C. metapsilosis.

  13. Genome analysis reveals interplay between 5'UTR introns and nuclear mRNA export for secretory and mitochondrial genes.

    Directory of Open Access Journals (Sweden)

    Can Cenik

    2011-04-01

    Full Text Available In higher eukaryotes, messenger RNAs (mRNAs are exported from the nucleus to the cytoplasm via factors deposited near the 5' end of the transcript during splicing. The signal sequence coding region (SSCR can support an alternative mRNA export (ALREX pathway that does not require splicing. However, most SSCR-containing genes also have introns, so the interplay between these export mechanisms remains unclear. Here we support a model in which the furthest upstream element in a given transcript, be it an intron or an ALREX-promoting SSCR, dictates the mRNA export pathway used. We also experimentally demonstrate that nuclear-encoded mitochondrial genes can use the ALREX pathway. Thus, ALREX can also be supported by nucleotide signals within mitochondrial-targeting sequence coding regions (MSCRs. Finally, we identified and experimentally verified novel motifs associated with the ALREX pathway that are shared by both SSCRs and MSCRs. Our results show strong correlation between 5' untranslated region (5'UTR intron presence/absence and sequence features at the beginning of the coding region. They also suggest that genes encoding secretory and mitochondrial proteins share a common regulatory mechanism at the level of mRNA export.

  14. Alternative splicing mechanisms orchestrating post-transcriptional gene expression: intron retention and the intron-rich genome of apicomplexan parasites.

    Science.gov (United States)

    Lunghi, Matteo; Spano, Furio; Magini, Alessandro; Emiliani, Carla; Carruthers, Vern B; Di Cristina, Manlio

    2016-02-01

    Apicomplexan parasites including Toxoplasma gondii and Plasmodium species have complex life cycles that include multiple hosts and differentiation through several morphologically distinct stages requiring marked changes in gene expression. This review highlights emerging evidence implicating regulation of mRNA splicing as a mechanism to prime these parasites for rapid gene expression upon differentiation. We summarize the most important insights in alternative splicing including its role in regulating gene expression by decreasing mRNA abundance via 'Regulated Unproductive Splicing and Translation'. As a related but less well-understood mechanism, we discuss also our recent work suggesting a role for intron retention for precluding translation of stage specific isoforms of T. gondii glycolytic enzymes. We additionally provide new evidence that intron retention might be a widespread mechanism during parasite differentiation. Supporting this notion, recent genome-wide analysis of Toxoplasma and Plasmodium suggests intron retention is more pervasive than heretofore thought. These findings parallel recent emergence of intron retention being more prevalent in mammals than previously believed, thereby adding to the established roles in plants, fungi and unicellular eukaryotes. Deeper mechanistic studies of intron retention will provide important insight into its role in regulating gene expression in apicomplexan parasites and more general in eukaryotic organisms.

  15. Correlations between recombination rate and intron distributions along chromosomes of C.elegans

    Institute of Scientific and Technical Information of China (English)

    Hong Li; Guoqing Liu; Xuhua Xia

    2009-01-01

    Generally speaking,the intron size positively correlates with recombination rate in Caenorhabditis elegans genome.Here,we analyze the correlations between recombination rate and some measures of different intron lengths so as to know whether the recombination influences the introns of different lengths in the same way.Results show that the correlation between the recombination rate and the percentage of short introns(<100 bp)is negative,but the correlation between the recombination rate and the percentage of introns that are larger than 500 bp is positive.Average intron length correlates positively with the recombination rate for introns whose length is in the range of 100-1000 bp.We speculate that the recombination mainly exerts impact on introns whose length ranges from 100-1000 bp.We also show that the average intron number per gene correlates negatively with the recombination rate.

  16. New intronic splicing mutation in the LMNA gene causing progressive cardiac conduction defects and variable myopathy.

    Science.gov (United States)

    Rogozhina, Y; Mironovich, S; Shestak, A; Adyan, T; Polyakov, A; Podolyak, D; Bakulina, A; Dzemeshkevich, S; Zaklyazminskaya, E

    2016-12-31

    Most of mutations in the LMNA gene are unique and have been found in only a few unrelated families. The clinical interpretation of new genetic variants, especially beyond the coding area and canonical splice sites, is proving to be difficult and requires advanced investigation. This study included patients with progressive cardiac conduction defects with neuromuscular involvement. The clinical evaluation included medical history and 24-h Holter monitoring. The genetic evaluation included mutation screening in the LMNA gene by the Sanger sequence. Sanger sequencing was followed by RT-PCR of the target fragment of cDNA. In silico modeling was performed with CCBulder and Modeller software. The diagnosis of limb-girdle muscular dystrophy type 1B (LGMD1B) was established. The new intronic variant c.513+45T>G was found in the LMNA gene in the proband and affected daughter. The insertion of 45bp was confirmed in the proband's cDNA. The structural and possible functional effects of the aberrant protein were predicted. Variant c.513+45T>G in the LMNA gene likely translates into the longer lamin A/C proteins with additional 15 amino acids. This variant is thought to be pathogenic. Intronic variants in the LMNA gene located beside canonic splice sites may be responsible for some genotype-negative cases with clinical phenotype of laminopathies. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Neomycin B inhibits splicing of the td intron indirectly by interfering with translation and enhances missplicing in vivo.

    Science.gov (United States)

    Waldsich, C; Semrad, K; Schroeder, R

    1998-12-01

    The aminoglycoside antibiotic neomycin B inhibits translation in prokaryotes and interferes with RNA-protein interactions in HIV both in vivo and in vitro. Hitherto, inhibition of ribozyme catalysis has only been observed in vitro. We therefore monitored the activity of neomycin B and several other aminoglycoside antibiotics on splicing of the T4 phage thymidylate synthase (td) intron in vivo. All antibiotics tested inhibited splicing, even chloramphenicol, which does not inhibit splicing in vitro. Splicing of the td intron in vivo requires translation for proper folding of the pre-mRNA. In the absence of translation, two interactions between sequences in the upstream exon and the 5' and 3' splice sites trap the pre-mRNA in splicing-incompetent conformations. Their disruption by mutations rendered splicing less dependent on translation and also less sensitive to neomycin B. Intron splicing was affected by neither neomycin B nor gentamicin in Escherichia coli strains carrying antibiotic-resistance genes that modify the ribosomal RNA. Taken together, this demonstrates that in vivo splicing of td intron is not directly inhibited by aminoglycosides, but rather indirectly by their interference with translation. This was further confirmed by assaying splicing of the Tetrahymena group I intron, which is inserted in the E. coli 23 S rRNA and, thus, not translated. Furthermore, neomycin B, paromomycin, and streptomycin enhanced missplicing in antibiotic-sensitive strains. Missplicing is caused by an alternative structural element containing a cryptic 5' splice site, which serves as a substrate for the ribozyme. Our results demonstrate that aminoglycoside antibiotics display different effects on ribozymes in vivo and in vitro.

  18. Evolution of Fungal U3 snoRNAs: Structural Variation and Introns

    Directory of Open Access Journals (Sweden)

    Sebastian Canzler

    2017-01-01

    Full Text Available The U3 small nucleolar RNA (snoRNA is an essential player in the initial steps of ribosomal RNA biogenesis which is ubiquitously present in Eukarya. It is exceptional among the small nucleolar RNAs in its size, the presence of multiple conserved sequence boxes, a highly conserved secondary structure core, its biogenesis as an independent gene transcribed by polymerase III, and its involvement in pre-rRNA cleavage rather than chemical modification. Fungal U3 snoRNAs share many features with their sisters from other eukaryotic kingdoms but differ from them in particular in their 5’ regions, which in fungi has a distinctive consensus structure and often harbours introns. Here we report on a comprehensive homology search and detailed analysis of the evolution of sequence and secondary structure features covering the entire kingdom Fungi.

  19. 5´-UTR introns enhance protein expression in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Hoshida, Hisashi; Kondo, Masaki; Kobayashi, Takafumi; Yarimizu, Tohru; Akada, Rinji

    2017-01-01

    Saccharomyces cerevisiae is one of the most suitable microorganisms for recombinant protein production. To enhance protein production, various expression systems have been intensively studied. However, the effect of introns on protein expression has not been examined deeply in S. cerevisiae. In this study, we analyzed the effect of some introns on protein expression. RPS25A, RPS26A, and RPS26B contain single introns within the 5´-untranslated regions (5´-UTRs), and RPS24A has an intron just downstream of the initiation codon. Expression activity of the promoter regions containing introns (intron promoters) were analyzed by luciferase reporter assays. These intron promoters showed higher expression than the TDH3 promoter (TDH3p), which is one of the strongest promoters in S. cerevisiae. Deletion of the introns from these promoters decreased luciferase expression, indicating that introns have a role in enhancing protein expression. To develop artificial strong intron promoters, several chimeric promoters were constructed using the TDH3p and the RPS25A intron promoter. A construct containing the entire TDH3p followed by the RPS25A intron showed about 50-fold higher expression than the TDH3p alone. Inducible expressions driven by the GAL10 promoter and the CUP1 promoter were also enhanced by the RPS25A intron. However, enhancement of mRNA accumulation by the TDH3p and the GAL10 promoter with the RPS25A intron was lower than the effect on luciferase activity, suggesting that the intron affects post-transcriptionally. The chimeric promoter, TDH3p-RPS25A-intron, enhanced expressions of some, but not all proteins examined, indicating that 5'-UTR introns increase production of a certain type of recombinant proteins in S. cerevisiae.

  20. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    Science.gov (United States)

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  1. Phylogenetics of early branching eudicots: Comparing phylogenetic signal across plastid introns, spacers, and genes

    Institute of Scientific and Technical Information of China (English)

    Anna-Magdalena BARNISKE; Thomas BORSCH; Kai M(U)LLER; Michael KRUG; Andreas WORBERG; Christoph NEINHUIS; Dietmar QUANDT

    2012-01-01

    Recent phylogenetic analyses revealed a grade with Ranunculales,Sabiales,Proteales,Trochodendrales,and Buxales as first branching eudicots,with the respective positions of Proteales and Sabiales still lacking statistical confidence.As previous analyses of conserved plastid genes remain inconclusive,we aimed to use and evaluate a representative set of plastid introns (group Ⅰ:trnL; group Ⅱ:petD,rpll6,trnK) and intergenic spacers (trnL-F,petB-petD,atpB-rbcL,rps3-rpll6) in comparison to the rapidly evolving matK and slowly evolving atpB and rbcL genes.Overall patterns of microstructural mutations converged across genomic regions,underscoring the existence of a general mutational pattern throughout the plastid genome.Phylogenetic signal differed strongly between functionally and structurally different genomic regions and was highest in matK,followed by spacers,then group Ⅱ and group Ⅰ introns.The more conserved atpB and rbcL coding regions showed distinctly lower phylogenetic information content.Parsimony,maximum likelihood,and Bayesian phylogenetic analyses based on the combined dataset of non-coding and rapidly evolving regions (>14 000 aligned characters) converged to a backbone topology ofeudicots with Ranunculales branching first,a Proteales-Sabiales clade second,followed by Trochodendrales and Buxales.Gunnerales generally appeared as sister to all remaining core eudicots with maximum support.Our results show that a small number of intron and spacer sequences allow similar insights into phylogenetic relationships of eudicots compared to datasets of many combined genes.The non-coding proportion of the plastid genome thus can be considered an important information source for plastid phylogenomics.

  2. The doublesex splicing enhancer components Tra2 and Rbp1 also repress splicing through an intronic silencer.

    Science.gov (United States)

    Qi, Junlin; Su, Shihuang; Mattox, William

    2007-01-01

    The activation of sex-specific alternative splice sites in the Drosophila melanogaster doublesex and fruitless pre-mRNAs has been well studied and depends on the serine-arginine-rich (SR) splicing factors Tra, Tra2, and Rbp1. Little is known, however, about how SR factors negatively regulate splice sites in other RNAs. Here we examine how Tra2 blocks splicing of the M1 intron from its own transcript. We identify an intronic splicing silencer (ISS) adjacent to the M1 branch point that is sufficient to confer Tra2-dependent repression on another RNA. The ISS was found to function independently of its position within the intron, arguing against the idea that bound repressors function by simply interfering with branch point accessibility to general splicing factors. Conserved subelements of the silencer include five short repeated sequences that are required for Tra2 binding but differ from repeated binding sites found in Tra2-dependent splicing enhancers. The ISS also contains a consensus binding site for Rbp1, and this protein was found to facilitate repression of M1 splicing both in vitro and in Drosophila larvae. In contrast to the cooperative binding of SR proteins observed on the doublesex splicing enhancer, we found that Rbp1 and Tra2 bind to the ISS independently through distinct sequences. Our results suggest that functionally synergistic interactions of these SR factors can cause either splicing activation or repression.

  3. Spinocerebellar ataxia in the Italian Spinone dog is associated with an intronic GAA repeat expansion in ITPR1.

    Science.gov (United States)

    Forman, Oliver P; De Risio, Luisa; Matiasek, Kaspar; Platt, Simon; Mellersh, Cathryn

    2015-02-01

    Spinocerebellar ataxia in the Italian Spinone dog breed is characterised by a progressive gait abnormality that manifests from approximately 4 months of age. The disorder shows an autosomal recessive mode of inheritance, and affected individuals are usually euthanized by one year of age on welfare grounds due to an inability to ambulate. Using a homozygosity mapping technique with six cases and six controls, we mapped the disease locus to chromosome 20 of the canine genome. Linkage analysis across an extended pedigree confirmed the association, with microsatellite C20.374 achieving a maximal LOD score of 4.41. All five genes within the disease-associated interval were exon resequenced, although no exonic candidate mutations were identified. A targeted resequencing approach was therefore adopted to sequence the entire disease-associated interval. Analysis of the sequencing data revealed a GAA repeat expansion in intron 35 of ITPR1, which was homozygous in all cases and heterozygous in obligate carriers. Partial impairment of cerebellar ITPR1 expression in affected dogs was demonstrated by immunohistochemistry. Given the association of ITPR1 mutations with spinocerebellar ataxia (SCA) type 15 (also designated SCA16) in humans and that an intronic GAA repeat expansion has been shown to cause Friedreich ataxia, the repeat expansion is an excellent candidate for the cause of spinocerebellar ataxia in the Italian Spinone. This finding represents the first naturally occurring pathogenic intronic GAA repeat expansion in a non-human species and a novel mechanism for ITPR1 associated spinocerebellar ataxia.

  4. Molecular characterization of a new member of the lariat capping twin-ribozyme introns

    DEFF Research Database (Denmark)

    Tang, Yunjia; Nielsen, Henrik; Masquida, Benoît

    2014-01-01

    in Naegleria amoeboflagellates and the myxomycete Didymium iridis. RESULTS: We characterize structural organization, catalytic properties and molecular evolution of a new twin-ribozyme intron in Allovahlkampfia (Heterolobosea). The intron contains two ribozyme domains with different functions in ribosomal RNA...

  5. Position-dependent repression and promotion of DQB1 intron 3 splicing by GGGG motifs

    National Research Council Canada - National Science Library

    Královicová, Jana; Vorechovsky, Igor

    2006-01-01

    ...) repeats on intron 3 removal. We found that the GGG or GGGG repeats generally improved splicing of DQB1 intron 3, except for those that were adjacent to the 5' splice site where they had the opposite effect...

  6. Epithelium-specific ets transcription factor 2 upregulates cytokeratin 18 expression in pulmonary epithelial cells through an interaction with cytokeratin 18 intron 1

    Institute of Scientific and Technical Information of China (English)

    Deanna YANIW; Jim HU

    2005-01-01

    The role of Ese-2, an Ets family transcription factor, in gene regulation is not known. In this study, the interaction between Ese-2 and cytokeratin 18 (K18) intron 1 was characterized in lung epithelial cells. Reporter gene assays showed Ese-2 was able to upregulate K18 intron 1 enhanced reporter gene expression by approximately 2-fold. We found that full length Ese-2 did not bind DNA strongly, therefore truncated versions of the protein, containing the ETS domain or Pointed domain, were created and tested in electrophoresis mobility shift assays. Multiple interactions between the ETS domain and putative DNA binding sites within K18 intron 1 were observed, which led to the determination of a possible Ese-2 DNA binding consensus sequence. These experiments suggest that Ese-2 could play a role in the regulation of K18 expression in lung epithelial cells.

  7. KEJADIAN INDEL SIMULTAN PADA INTRON 7 GEN BRANCHED-CHAIN Α-KETOACID DEHYDROGENASE E1A (BCKDHA PADA SAPI MADURA

    Directory of Open Access Journals (Sweden)

    Asri Febriana

    2015-08-01

    Full Text Available Madura cattle is one of the Indonesian local cattle breeds derived from crossing between Zebu cattle (Bos indicus and banteng (Bos javanicus. Branched-chain α-ketoacid dehydrogenase (BCKDH is one of the main enzyme complexes in the inner mitochondrial membrane that metabolizes branched chain amino acid (BCAA, ie valine, leucine, and isoleucine. The diversity of the nucleotide sequences of the genes largely determine the efficiency of enzyme encoded. This paper aimed to determine the nucleotide variation contained in section intron 7, exon 8, and intron 8 genes BCKDHA on Madura cattle. This study was conducted on three Madura cattle that used as bull race (karapan, beauty contest (sonok, and beef cattle. The analysis showed that the variation in intron higher than occurred in the exon. Simultaneous indel found at base position 34 and 68 in sonok cattle. In addition, the C266T variant found in beef cattle. These variants do not cause significant changes in amino acids. There was no specific mutation in intron 7, exon 8, and intron 8 were found in Madura cattle designation. This indicated the absence of differentiation Madura cattle designation of selection pressure of BCKDHA gene.

  8. Evidence of uneven selective pressure on different subsets of the conserved human genome; implications for the significance of intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    MacKenzie Alasdair

    2009-12-01

    Full Text Available Abstract Background Human genetic variation produces the wide range of phenotypic differences that make us individual. However, little is known about the distribution of variation in the most conserved functional regions of the human genome. We examined whether different subsets of the conserved human genome have been subjected to similar levels of selective constraint within the human population. We used set theory and high performance computing to carry out an analysis of the density of Single Nucleotide Polymorphisms (SNPs within the evolutionary conserved human genome, at three different selective stringencies, intersected with exonic, intronic and intergenic coordinates. Results We demonstrate that SNP density across the genome is significantly reduced in conserved human sequences. Unexpectedly, we further demonstrate that, despite being conserved to the same degree, SNP density differs significantly between conserved subsets. Thus, both the conserved exonic and intronic genomes contain a significantly reduced density of SNPs compared to the conserved intergenic component. Furthermore the intronic and exonic subsets contain almost identical densities of SNPs indicating that they have been constrained to the same degree. Conclusion Our findings suggest the presence of a selective linkage between the exonic and intronic subsets and ascribes increased significance to the role of introns in human health. In addition, the identification of increased plasticity within the conserved intergenic subset suggests an important role for this subset in the adaptation and diversification of the human population.

  9. Vertical evolution and intragenic spread of lichen-fungal group I introns.

    Science.gov (United States)

    Bhattacharya, Debashish; Friedl, Thomas; Helms, Gert

    2002-07-01

    One family within the Euascomycetes (Ascomycota), the lichen-forming Physciaceae, is particularly rich in nuclear ribosomal [r]DNA group I introns. We used phylogenetic analyses of group I introns and lichen-fungal host cells to address four questions about group I intron evolution in lichens, and generally in all eukaryotes: 1) Is intron spread in the lichens associated with the intimate association of the fungal and photosynthetic cells that make up the lichen thallus? 2) Are the multiple group I introns in the lichen-fungi of independent origins, or have existing introns spread into novel sites in the rDNA? 3) If introns have moved to novel sites, then does the exon context of these sites provide insights into the mechanism of intron spread? and 4) What is the pattern of intron loss in the small subunit rDNA gene of lichen-fungi? Our analyses show that group I introns in the lichen-fungi and in the lichen-algae (and lichenized cyanobacteria) do not share a close evolutionary relationship, suggesting that these introns do not move between the symbionts. Many group I introns appear to have originated in the common ancestor of the Lecanorales, whereas others have spread within this lineage (particularly in the Physciaceae) putatively through reverse-splicing into novel rRNA sites. We suggest that the evolutionary history of most lichen-fungal group I introns is characterized by rare gains followed by extensive losses in descendants, resulting in a sporadic intron distribution. Detailed phylogenetic analyses of the introns and host cells are required, therefore, to distinguish this scenario from the alternative hypothesis of widespread and independent intron gains in the different lichen-fungal lineages.

  10. A site-specific endonuclease encoded by a typical archaeal intron

    DEFF Research Database (Denmark)

    Dalgaard, Jacob; Garrett, Roger Antony; Belfort, Malene

    1993-01-01

    The protein encoded by the archaeal intron in the 23S rRNA gene of the hyperthermophile Desulfurococcus mobilis is a double-strand DNase that, like group I intron homing endonucleases, is capable of cleaving an intronless allele of the gene. This enzyme, I-Dmo I, is unusual among the intron...... of endonucleases and intron core elements and are consistent with the invasive potential of endonuclease genes....

  11. Site-specific, insertional inactivation of incA in Chlamydia trachomatis using a group II intron.

    Science.gov (United States)

    Johnson, Cayla M; Fisher, Derek J

    2013-01-01

    Chlamydia trachomatis is an obligate, intracellular bacterial pathogen that has until more recently remained recalcitrant to genetic manipulation. However, the field still remains hindered by the absence of tools to create selectable, targeted chromosomal mutations. Previous work with mobile group II introns demonstrated that they can be retargeted by altering DNA sequences within the intron's substrate recognition region to create site-specific gene insertions. This platform (marketed as TargeTron™, Sigma) has been successfully employed in a variety of bacteria. We subsequently modified TargeTron™ for use in C. trachomatis and as proof of principle used our system to insertionally inactivate incA, a chromosomal gene encoding a protein required for homotypic fusion of chlamydial inclusions. C. trachomatis incA::GII(bla) mutants were selected with ampicillin and plaque purified clones were then isolated for genotypic and phenotypic analysis. PCR, Southern blotting, and DNA sequencing verified proper GII(bla) insertion, while continuous passaging in the absence of selection demonstrated that the insertion was stable. As seen with naturally occurring IncA(-) mutants, light and immunofluorescence microscopy confirmed the presence of non-fusogenic inclusions in cells infected with the incA::GII(bla) mutants at a multiplicity of infection greater than one. Lack of IncA production by mutant clones was further confirmed by Western blotting. Ultimately, the ease of retargeting the intron, ability to select for mutants, and intron stability in the absence of selection makes this method a powerful addition to the growing chlamydial molecular toolbox.

  12. Biochemical and proteomic analysis of spliceosome factors interacting with intron-1 of human papillomavirus type-16.

    Science.gov (United States)

    Martínez-Salazar, Martha; López-Urrutia, Eduardo; Arechaga-Ocampo, Elena; Bonilla-Moreno, Raul; Martínez-Castillo, Macario; Díaz-Hernández, Job; Del Moral-Hernández, Oscar; Cedillo-Barrón, Leticia; Martines-Juarez, Víctor; De Nova-Ocampo, Monica; Valdes, Jesús; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

    2014-12-05

    The human papillomavirus type 16 (HPV-16) E6/E7 spliced transcripts are heterogeneously expressed in cervical carcinoma. The heterogeneity of the E6/E7 splicing profile might be in part due to the intrinsic variation of splicing factors in tumor cells. However, the splicing factors that bind the E6/E7 intron 1 (In-1) have not been defined. Therefore, we aimed to identify these factors; we used HeLa nuclear extracts (NE) for in vitro spliceosome assembly. The proteins were allowed to bind to an RNA/DNA hybrid formed by the In-1 transcript and a 5'-biotinylated DNA oligonucleotide complementary to the upstream exon sequence, which prevented interference in protein binding to the intron. The hybrid probes bound with the nuclear proteins were coupled to streptavidin magnetic beads for chromatography affinity purification. Proteins were eluted and identified by mass spectrometry (MS). Approximately 170 proteins were identified by MS, 80% of which were RNA binding proteins, including canonical spliceosome core components, helicases and regulatory splicing factors. The canonical factors were identified as components of the spliceosomal B-complex. Although 35-40 of the identified factors were cognate splicing factors or helicases, they have not been previously detected in spliceosome complexes that were assembled using in vivo or in vitro models.

  13. Genetic Analysis of the Chlamydomonas Reinhardtii I-Crei Mobile Intron Homing System in Escherichia Coli

    Science.gov (United States)

    Seligman, L. M.; Stephens, K. M.; Savage, J. H.; Monnat-Jr., R. J.

    1997-01-01

    We have developed and used a genetic selection system in Escherichia coli to study functional requirements for homing site recognition and cleavage by a representative eukaryotic mobile intron endonuclease. The homing endonuclease, I-CreI, was originally isolated from the chloroplast of the unicellular green alga Chlamydomonas reinhardtii. I-CreI homing site mutants contained base pair substitutions or single base deletions that altered the rate of homing site cleavage and/or product release. I-CreI endonuclease mutants fell into six phenotypic classes that differed in in vivo activity, toxicity or genetic dominance. Inactivating mutations clustered in the N-terminal 60% of the I-CreI amino acid sequence, and two frameshift mutations were isolated that resulted in premature translation termination though retained partial activity. These mutations indicate that the N-terminal two-thirds of the I-CreI endonuclease is sufficient for homing site recognition and cleavage. Substitution mutations altered in four potential active site residues were examined: D20N, Q47H or R70A substitutions inactivated endonuclease activity, whereas S22A did not. The genetic approach we have taken complements phylogenetic and structural studies of mobile intron endonucleases and has provided new information on the mechanistic basis of I-CreI homing site recognition and cleavage. PMID:9409828

  14. Genomewide analysis of intronic microRNAs in rice and Arabidopsis

    Indian Academy of Sciences (India)

    G. D. Yang; K. Yan; B. J. Wu; Y. H. Wang; Y. X. Gao; C. C. Zheng

    2012-12-01

    MicroRNAs (miRNAs) are potent regulators of gene transcription and posttranscriptional processes. The majority of miRNAs are localized within intronic regions of protein-coding genes (host genes) and have diverse functions in regulating important cellular processes in animals. To date, few plant intronic miRNAs have been studied functionally. Here we report a comprehensive computational analysis to characterize intronic miRNAs in rice and Arabidopsis. RT-PCR analysis confirmed that the identified intronic miRNAs were derived from the real introns of host genes. Interestingly, 13 intronic miRNAs in rice and two in Arabidopsis were located within seven clusters, of which four polycistronic clusters contain miRNAs derived from different families, suggesting that these clustered intronic miRNAs might be involved in extremely complex regulation in rice. Length analysis of miRNA-carrying introns, promoter prediction and qRT-PCR analysis results indicated that intronic miRNAs are coexpressed with their host genes. Expression pattern analysis demonstrated that host genes had a very broad expression spectrum in different stages of development, suggesting the intronic miRNAs might play an important role in plant development. This comparative genomics analysis of intronic miRNAs in rice and Arabidopsis provides new insight into the functions and regulatory mechanisms of intronic miRNAs in monocots and dicots.

  15. Accumulation of Stable Full-Length Circular Group I Intron RNAs during Heat-Shock

    DEFF Research Database (Denmark)

    Andersen, Kasper L.; Beckert, Bertrand; Masquida, Benoit;

    2016-01-01

    the copy number of circular intron RNA from the myxomycete Didymium iridis. In exponentially growing amoebae, the circular introns are nuclear and found in 70 copies per cell. During heat-shock, the circular form is up-regulated to more than 500 copies per cell. The intron harbours two ribozymes that have...

  16. Accumulation of Stable Full-Length Circular Group I Intron RNAs during Heat-Shock

    DEFF Research Database (Denmark)

    Andersen, Kasper L.; Beckert, Bertrand; Masquida, Benoit

    2016-01-01

    the copy number of circular intron RNA from the myxomycete Didymium iridis. In exponentially growing amoebae, the circular introns are nuclear and found in 70 copies per cell. During heat-shock, the circular form is up-regulated to more than 500 copies per cell. The intron harbours two ribozymes that have...

  17. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Directory of Open Access Journals (Sweden)

    Turner Seán

    2007-09-01

    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  18. Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations

    Directory of Open Access Journals (Sweden)

    Funkenstein Bruria

    2011-02-01

    Full Text Available Abstract Background Myostatin (MSTN is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Results Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2. We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R

  19. Localized Retroprocessing as a Model of Intron Loss in the Plant Mitochondrial Genome.

    Science.gov (United States)

    Cuenca, Argelia; Ross, T Gregory; Graham, Sean W; Barrett, Craig F; Davis, Jerrold I; Seberg, Ole; Petersen, Gitte

    2016-08-03

    Loss of introns in plant mitochondrial genes is commonly explained by retroprocessing. Under this model, an mRNA is reverse transcribed and integrated back into the genome, simultaneously affecting the contents of introns and edited sites. To evaluate the extent to which retroprocessing explains intron loss, we analyzed patterns of intron content and predicted RNA editing for whole mitochondrial genomes of 30 species in the monocot order Alismatales. In this group, we found an unusually high degree of variation in the intron content, even expanding the hitherto known variation among angiosperms. Some species have lost some two-third of the cis-spliced introns. We found a strong correlation between intron content and editing frequency, and detected 27 events in which intron loss is consistent with the presence of nucleotides in an edited state, supporting retroprocessing. However, we also detected seven cases of intron loss not readily being explained by retroprocession. Our analyses are also not consistent with the entire length of a fully processed cDNA copy being integrated into the genome, but instead indicate that retroprocessing usually occurs for only part of the gene. In some cases, several rounds of retroprocessing may explain intron loss in genes completely devoid of introns. A number of taxa retroprocessing seem to be very common and a possibly ongoing process. It affects the entire mitochondrial genome.

  20. Site-specific reverse splicing of a HEG-containing group I intron in ribosomal RNA

    Science.gov (United States)

    Birgisdottir, Åsa B.; Johansen, Steinar

    2005-01-01

    The wide, but scattered distribution of group I introns in nature is a result of two processes; the vertical inheritance of introns with or without losses, and the occasional transfer of introns across species barriers. Reversal of the group I intron self-splicing reaction, termed reverse splicing, coupled with reverse transcription and genomic integration potentially mediate an RNA-based intron mobility pathway. Compared to the well characterized endonuclease-mediated intron homing, reverse splicing is less specific and represents a likely explanation for many intron transpositions into new genomic sites. However, the frequency and general role of an RNA-based mobility pathway in the spread of natural group I introns is still unclear. We have used the twin-ribozyme intron (Dir.S956-1) from the myxomycete Didymium iridis to test how a mobile group I intron containing a homing endonuclease gene (HEG) selects between potential insertion sites in the small subunit (SSU) rRNA in vitro, in Escherichia coli and in yeast. Surprisingly, the results show a site-specific RNA-based targeting of Dir.S956-1 into its natural (S956) SSU rRNA site. Our results suggest that reverse splicing, in addition to the established endonuclease-mediated homing mechanism, potentially accounts for group I intron spread into the homologous sites of different strains and species. PMID:15817568

  1. Development of Novel, Exon-Primed Intron-Crossing (EPIC Markers from EST Databases and Evaluation of their Phylogenetic Utility in Commiphora (Burseraceae

    Directory of Open Access Journals (Sweden)

    Morgan R. Gostel

    2014-03-01

    Full Text Available Premise of the study: Novel nuclear exon-primed intron-crossing (EPIC markers were developed to increase phylogenetic resolution among recently diverged lineages in the frankincense and myrrh family, Burseraceae, using Citrus, Arabidopsis, and Oryza genome resources. Methods and Results: Primer pairs for 48 nuclear introns were developed using the genome resource IntrEST and were screened using species of Commiphora and other Burseraceae taxa. Four putative intron regions (RPT6A, BXL2, mtATP Synthase D, and Rab6 sequenced successfully for multiple taxa and recovered phylogenies consistent with those of existing studies. In some cases, these regions yielded informative sequence variation on par with that of the nuclear ribosomal DNA internal transcribed spacer. Conclusions: The combination of freely available genome resources and our design criteria have uncovered four single-copy nuclear intron regions that are useful for phylogenetic reconstruction of Burseraceae taxa. Because our EPIC primers also amplify Arabidopsis, we recommend their trial in other rosid and eudicot lineages.

  2. [The chromosomal genes for black widow spider neurotoxins do not contain introns].

    Science.gov (United States)

    Danilevich, V N; Grishin, E V

    2000-12-01

    The overlapping fragments of the chromosomal DNA from black widow spider Latrodectus mactans carrying genes for high-molecular-mass protein neurotoxins, alpha- and delta-latroinsectotoxins (alpha-LIT and delta-LIT) and alpha-latrotoxin (alpha-LTX), were PCR-amplified and cloned. Restriction analysis of the PCR products showed that the distribution and sizes of the restriction fragments coincided with those deduced from the earlier sequencing of cDNAs of the corresponding genes. It thus followed that the alpha-LIT and delta-LIT genes are intronless. Along with our data on the structure of the alpha-latrocrustotoxin (alpha-LCT), this implies that the lack of introns is a common feature of the black widow spider genes encoding high molecular mass neurotoxins.

  3. Analysis and recognition of 5 ' UTR intron splice sites in human pre-mRNA

    DEFF Research Database (Denmark)

    Eden, E.; Brunak, Søren

    2004-01-01

    Prediction of splice sites in non-coding regions of genes is one of the most challenging aspects of gene structure recognition. We perform a rigorous analysis of such splice sites embedded in human 5' untranslated regions (UTRs), and investigate correlations between this class of splice sites...... and other features found in the adjacent exons and introns. By restricting the training of neural network algorithms to 'pure' UTRs (not extending partially into protein coding regions), we for the first time investigate the predictive power of the splicing signal proper, in contrast to conventional splice...... site prediction, which typically relies on the change in sequence at the transition from protein coding to non-coding. By doing so, the algorithms were able to pick up subtler splicing signals that were otherwise masked by 'coding' noise, thus enhancing significantly the prediction of 5' UTR splice...

  4. In vitro correction of a pseudoexon-generating deep intronic mutation in LGMD2A by antisense oligonucleotides and modified small nuclear RNAs.

    Science.gov (United States)

    Blázquez, Lorea; Aiastui, Ana; Goicoechea, Maria; Martins de Araujo, Mafalda; Avril, Aurélie; Beley, Cyriaque; García, Luis; Valcárcel, Juan; Fortes, Puri; López de Munain, Adolfo

    2013-10-01

    Limb-girdle muscular dystrophy type 2A (LGMD2A) is the most frequent autosomal recessive muscular dystrophy. It is caused by mutations in the calpain-3 (CAPN3) gene. The majority of the mutations described to date are located in the coding sequence of the gene. However, it is estimated that 25% of the mutations are present at exon-intron boundaries and modify the pre-mRNA splicing of the CAPN3 transcript. We have previously described the first deep intronic mutation in the CAPN3 gene: c.1782+1072G>C mutation. This mutation causes the pseudoexonization of an intronic sequence of the CAPN3 gene in the mature mRNA. In the present work, we show that the point mutation generates the inclusion of the pseudoexon in the mRNA using a minigene assay. In search of a treatment that restores normal splicing, splicing modulation was induced by RNA-based strategies, which included antisense oligonucleotides and modified small-nuclear RNAs. The best effect was observed with antisense sequences, which induced pseudoexon skipping in both HeLa cells cotransfected with mutant minigene and in fibroblasts from patients. Finally, transfection of antisense sequences and siRNA downregulation of serine/arginine-rich splicing factor 1 (SRSF1) indicate that binding of this factor to splicing enhancer sequences is involved in pseudoexon activation. © 2013 WILEY PERIODICALS, INC.

  5. Single nucleotide polymorphisms in intron 1 and intron 2 of Larimichthys crocea growth hormone gene are correlated with growth traits

    Science.gov (United States)

    Ni, Jing; You, Feng; Xu, Jianhe; Xu, Dongdong; Wen, Aiyun; Wu, Zhihao; Xu, Yongli; Zhang, Peijun

    2012-03-01

    The growth hormone gene ( GH) affects animal growth and is a potential target for genetic studies of variation related to growth traits. In this study, we analyzed single nucleotide polymorphisms (SNPs) in GH intron regions and their associations with growth traits in large yellow croaker, Larimichthys crocea, from Zhejiang and Fujian stocks. The results of PCR-single strand conformation polymorphism showed two haplotypes of intron 1, named AA and AB genotypes, in Zhejiang stock. AB exhibited an SNP at position 196 (G→A) that was negatively correlated with body height and positively correlated with standard length/body height ( P≤0.05). Two different genotypes, CC and CD, were identified in intron 2 in Fujian stock, with CD showing an SNP at position 692 (T→C). The CD genotype had a significantly positive correlation with both weight and total length ( P≤0.01). These basic data highlight the potential for using GH as a genetic marker of fish growth in marker assisted selection.

  6. Single nucleotide polymorphisms in intron 1 and intron 2 of Larimichthys crocea growth hormone gene are correlated with growth traits

    Institute of Scientific and Technical Information of China (English)

    NI Jing; YOU Feng; XU Jianhe; XU Dongdong; WEN Aiyun; WU Zhihao; XU Yongli; ZHANG Peijun

    2012-01-01

    The growth hormone gene (GH) affects animal growth and is a potential target for genetic studies of variation related to growth traits.In this study,we analyzed single nucleotide polymorphisms (SNPs) in GH intron regions and their associations with growth traits in large yellow croaker,Larimichthys crocea,from Zhejiang and Fujian stocks.The results of PCR-single strand conformation polymorphism showed two haplotypes of intron 1,named AA and AB genotypes,in Zhejiang stock.AB exhibited an SNP at position 196 (G→A) that was negatively correlated with body height and positively correlated with standard length/body height (P≤0.05).Two different genotypes,CC and CD,were identified in intron 2 in Fujian stock,with CD showing an SNP at position 692 (T→C).The CD genotype had a significantly positive correlation with both weight and total length (P≤0.01).These basic data highlight the potential for using GH as a genetic marker of fish growth in marker assisted selection.

  7. Identification of intron 1 and intron 22 inversions of factor VIII gene in Serbian patients with hemophilia A

    Directory of Open Access Journals (Sweden)

    Ilić Nina

    2013-01-01

    Full Text Available Hemophilia A (HA is a common X-linked recessive bleeding disease caused by mutations of FVIII gene. Inversion of intron 1 (inv1 and intron 22 (inv22 are recurrent mutations in severe HA, causing 50% of cases. Inv1 has been reported to occur in 2-5% and inv 22 in 45% of severe HA patients. Our objective was to determine, for the first time in Serbia, the frequency of inv1 and inv22 in a group of severe HA patients and to compare these data with those from other countries. Study subjects were 50 HA patients, diagnosed and treated from April 2009 to June 2012 at Mother and Child Health Care Institute of Serbia “Dr Vukan Cupic” (IHS and Institute for Child and Youth Health Care of Vojvodina (IHV.The presence of inv1 and inv22 was analyzed using Inverse shifting PCR (IS-PCR. Our results revealed that the frequencies of inv1 and inv22 in the cohort of Serbian patients were 6 % and 42% (34% of inv22 type I and 8% of inv22 type II respectively . These frequencies were in line with those found in other populations. Carrier status analyses of 65 family members (mothers and sisters showed the de novo inversion of intron 22 in one patient. Genetic Counseling Units of IHS and IHV provide the adequate genetic advice to all HA affected patients and their family members. [Projekat Ministarstva nauke Republike Srbije, br. 173046 i br. 175056

  8. Discovery of novel human transcript variants by analysis of intronic single-block EST with polyadenylation site

    Directory of Open Access Journals (Sweden)

    Yu Peng

    2009-11-01

    Full Text Available Abstract Background Alternative polyadenylation sites within a gene can lead to alternative transcript variants. Although bioinformatic analysis has been conducted to detect polyadenylation sites using nucleic acid sequences (EST/mRNA in the public databases, one special type, single-block EST is much less emphasized. This bias leaves a large space to discover novel transcript variants. Results In the present study, we identified novel transcript variants in the human genome by detecting intronic polyadenylation sites. Poly(A/T-tailed ESTs were obtained from single-block ESTs and clustered into 10,844 groups standing for 5,670 genes. Most sites were not found in other alternative splicing databases. To verify that these sites are from expressed transcripts, we analyzed the supporting EST number of each site, blasted representative ESTs against known mRNA sequences, traced terminal sequences from cDNA clones, and compared with the data of Affymetrix tiling array. These analyses confirmed about 84% (9,118/10,844 of the novel alternative transcripts, especially, 33% (3,575/10,844 of the transcripts from 2,704 genes were taken as high-reliability. Additionally, RT-PCR confirmed 38% (10/26 of predicted novel transcript variants. Conclusion Our results provide evidence for novel transcript variants with intronic poly(A sites. The expression of these novel variants was confirmed with computational and experimental tools. Our data provide a genome-wide resource for identification of novel human transcript variants with intronic polyadenylation sites, and offer a new view into the mystery of the human transcriptome.

  9. Mitochondrion-to-Chloroplast DNA Transfers and Intragenomic Proliferation of Chloroplast Group II Introns in Gloeotilopsis Green Algae (Ulotrichales, Ulvophyceae).

    Science.gov (United States)

    Turmel, Monique; Otis, Christian; Lemieux, Claude

    2016-09-19

    To probe organelle genome evolution in the Ulvales/Ulotrichales clade, the newly sequenced chloroplast and mitochondrial genomes of Gloeotilopsis planctonica and Gloeotilopsis sarcinoidea (Ulotrichales) were compared with those of Pseudendoclonium akinetum (Ulotrichales) and of the few other green algae previously sampled in the Ulvophyceae. At 105,236 bp, the G planctonica mitochondrial DNA (mtDNA) is the largest mitochondrial genome reported so far among chlorophytes, whereas the 221,431-bp G planctonica and 262,888-bp G sarcinoidea chloroplast DNAs (cpDNAs) are the largest chloroplast genomes analyzed among the Ulvophyceae. Gains of non-coding sequences largely account for the expansion of these genomes. Both Gloeotilopsis cpDNAs lack the inverted repeat (IR) typically found in green plants, indicating that two independent IR losses occurred in the Ulvales/Ulotrichales. Our comparison of the Pseudendoclonium and Gloeotilopsis cpDNAs offered clues regarding the mechanism of IR loss in the Ulotrichales, suggesting that internal sequences from the rDNA operon were differentially lost from the two original IR copies during this process. Our analyses also unveiled a number of genetic novelties. Short mtDNA fragments were discovered in two distinct regions of the G sarcinoidea cpDNA, providing the first evidence for intracellular inter-organelle gene migration in green algae. We identified for the first time in green algal organelles, group II introns with LAGLIDADG ORFs as well as group II introns inserted into untranslated gene regions. We discovered many group II introns occupying sites not previously documented for the chloroplast genome and demonstrated that a number of them arose by intragenomic proliferation, most likely through retrohoming.

  10. Structural and functional characterization of ribosomal protein gene introns in sponges.

    Science.gov (United States)

    Perina, Drago; Korolija, Marina; Mikoč, Andreja; Roller, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with "higher" metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales.

  11. Structural and functional characterization of ribosomal protein gene introns in sponges.

    Directory of Open Access Journals (Sweden)

    Drago Perina

    Full Text Available Ribosomal protein genes (RPGs are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs. These ancient ncRNAs are small nucleolar RNAs (snoRNAs essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with "higher" metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales.

  12. Information Analysis of DNA Sequences

    CERN Document Server

    Mohammed, Riyazuddin

    2010-01-01

    The problem of differentiating the informational content of coding (exons) and non-coding (introns) regions of a DNA sequence is one of the central problems of genomics. The introns are estimated to be nearly 95% of the DNA and since they do not seem to participate in the process of transcription of amino-acids, they have been termed "junk DNA." Although it is believed that the non-coding regions in genomes have no role in cell growth and evolution, demonstration that these regions carry useful information would tend to falsify this belief. In this paper, we consider entropy as a measure of information by modifying the entropy expression to take into account the varying length of these sequences. Exons are usually much shorter in length than introns; therefore the comparison of the entropy values needs to be normalized. A length correction strategy was employed using randomly generated nucleonic base strings built out of the alphabet of the same size as the exons under question. Our analysis shows that intron...

  13. "Cryptic" group-I introns in the nuclear SSU-rRNA gene of Verticillium dahliae.

    Science.gov (United States)

    Papaioannou, Ioannis A; Dimopoulou, Chrysoula D; Typas, Milton A

    2014-08-01

    Group-I introns are widespread--though irregularly distributed--in eukaryotic organisms, and they have been extensively used for discrimination and phylogenetic analyses. Within the Verticillium genus, which comprises important phytopathogenic fungi, a group-I intron was previously identified in the SSU-rRNA (18S) gene of only V. longisporum. In this work, we aimed at elucidating the SSU-located intron distribution in V. dahliae and other Verticillium species, and the assessment of heterogeneity regarding intron content among rDNA repeats of fungal strains. Using conserved PCR primers for the amplification of the SSU gene, a structurally similar novel intron (sub-group IC1) was detected in only a few V. dahliae isolates. However, when intron-specific primers were used for the screening of a diverse collection of Verticillium isolates that originally failed to produce intron-containing SSU amplicons, most were found to contain one or both intron types, at variable rDNA repeat numbers. This marked heterogeneity was confirmed with qRT-PCR by testing rDNA copy numbers (varying from 39 to 70 copies per haploid genome) and intron copy ratios in selected isolates. Our results demonstrate that (a) IC1 group-I introns are not specific to V. longisporum within the Verticillium genus, (b) V. dahliae isolates of vegetative compatibility groups (VCGs) 4A and 6, which bear the novel intron at most of their rDNA repeats, are closely related, and (c) there is considerable intra-genomic heterogeneity for the presence or absence of introns among the ribosomal repeats. These findings underline that distributions of introns in the highly heterogeneous repetitive rDNA complex should always be verified with sensitive methods to avoid misleading conclusions for the phylogeny of fungi and other organisms.

  14. Characterization of a New DGKE Intronic Mutation in Genetically Unsolved Cases of Familial Atypical Hemolytic Uremic Syndrome

    Science.gov (United States)

    Mele, Caterina; Lemaire, Mathieu; Iatropoulos, Paraskevas; Piras, Rossella; Bresin, Elena; Bettoni, Serena; Bick, David; Helbling, Daniel; Veith, Regan; Valoti, Elisabetta; Donadelli, Roberta; Murer, Luisa; Neunhäuserer, Maria; Breno, Matteo; Frémeaux-Bacchi, Véronique; Lifton, Richard; Noris, Marina

    2015-01-01

    Background and objectives Genetic and acquired abnormalities causing dysregulation of the complement alternative pathway contribute to atypical hemolytic uremic syndrome (aHUS), a rare disorder characterized by thrombocytopenia, nonimmune microangiopathic hemolytic anemia, and acute kidney failure. However, in a substantial proportion of patients the disease-associated alterations are still unknown. Design, setting, participants, & measurements Whole-exome and whole-genome sequencing were performed in two unrelated families with infantile recessive aHUS. Sequencing of cDNA from affected individuals was used to test for the presence of aberrant mRNA species. Expression of mutant diacylglycerol kinase epsilon (DGKE) protein was evaluated with western blotting. Results Whole-exome sequencing analysis with conventional variant filtering parameters did not reveal any obvious candidate mutation in the first family. The report of aHUS-associated mutations in DGKE, encoding DGKE, led to re-examination of the noncoding DGKE variants obtained from next-generation sequencing, allowing identification of a novel intronic DGKE mutation (c.888+40A>G) that segregated with disease. Sequencing of cDNA from affected individuals revealed aberrant forms of DGKE mRNA predicted to cause profound abnormalities in the protein catalytic site. By whole-genome sequencing, the same mutation was found in compound heterozygosity with a second nonsense DGKE mutation in all affected siblings of another unrelated family. Homozygous and compound heterozygous patients presented similar clinical features, including aHUS presentation in the first year of life, multiple relapsing episodes, and proteinuria, which are prototypical of DGKE-associated aHUS. Conclusions This is the first report of a mutation located beyond the exon-intron boundaries in aHUS. Intronic mutations such as these are underreported because conventional filtering parameters used to process next-generation sequencing data routinely

  15. A few nucleotide polymorphisms are sufficient to recruit nuclear factors differentially to the intron 1 of HPV-16 intratypic variants.

    Science.gov (United States)

    López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

    2012-06-01

    The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants.

  16. I-PfoP3I: a novel nicking HNH homing endonuclease encoded in the group I intron of the DNA polymerase gene in Phormidium foveolarum phage Pf-WMP3.

    Directory of Open Access Journals (Sweden)

    Shuanglei Kong

    Full Text Available Homing endonucleases encoded in a group I self-splicing intron in a protein-coding gene in cyanophage genomes have not been reported, apart from some free-standing homing edonucleases. In this study, a nicking DNA endonuclease, I-PfoP3I, encoded in a group IA2 intron in the DNA polymerase gene of a T7-like cyanophage Pf-WMP3, which infects the freshwater cyanobacterium Phormidium foveolarum is described. The Pf-WMP3 intron splices efficiently in vivo and self-splices in vitro simultaneously during transcription. I-PfoP3I belongs to the HNH family with an unconventional C-terminal HNH motif. I-PfoP3I nicks the intron-minus Pf-WMP3 DNA polymerase gene more efficiently than the Pf-WMP4 DNA polymerase gene that lacks any intervening sequence in vitro, indicating the variable capacity of I-PfoP3I. I-PfoP3I cleaves 4 nt upstream of the intron insertion site on the coding strand of EXON 1 on both intron-minus Pf-WMP3 and Pf-WMP4 DNA polymerase genes. Using an in vitro cleavage assay and scanning deletion mutants of the intronless target site, the minimal recognition site was determined to be a 14 bp region downstream of the cut site. I-PfoP3I requires Mg(2+, Ca(2+ or Mn(2+ for nicking activity. Phylogenetic analysis suggests that the intron and homing endonuclease gene elements might be inserted in Pf-WMP3 genome individually after differentiation from Pf-WMP4. To our knowledge, this is the first report of the presence of a group I self-splicing intron encoding a functional homing endonuclease in a protein-coding gene in a cyanophage genome.

  17. Propionic and Methylmalonic Acidemia: Antisense Therapeutics for Intronic Variations Causing Aberrantly Spliced Messenger RNA

    OpenAIRE

    Rincón, A. ; Aguado, C. ; Desviat, L. R. ; Sánchez-Alcudia, R. ; Ugarte, M. ; Pérez, B. 

    2007-01-01

    We describe the use of antisense morpholino oligonucleotides (AMOs) to restore normal splicing caused by intronic molecular defects identified in methylmalonic acidemia (MMA) and propionic acidemia (PA). The three new point mutations described in deep intronic regions increase the splicing scores of pseudoexons or generate consensus binding motifs for splicing factors, such as SRp40, which favor the intronic inclusions in MUT (r.1957ins76), PCCA (r.1284ins84), or PCCB (r.654ins72) messenger R...

  18. Intraspecific variations of Dekkera/Brettanomyces bruxellensis genome studied by capillary electrophoresis separation of the intron splice site profiles.

    Science.gov (United States)

    Vigentini, Ileana; De Lorenzis, Gabriella; Picozzi, Claudia; Imazio, Serena; Merico, Annamaria; Galafassi, Silvia; Piškur, Jure; Foschino, Roberto

    2012-06-15

    In enology, "Brett" character refers to the wine spoilage caused by the yeast Dekkera/Brettanomyces bruxellensis and its production of volatile phenolic off-flavours. However, the spoilage potential of this yeast is strain-dependent. Therefore, a rapid and reliable recognition at the strain level is a key point to avoid serious economic losses. The present work provides an operative tool to assess the genetic intraspecific variation in this species through the use of introns as molecular targets. Firstly, the available partial D./B. bruxellensis genome sequence was investigated in order to build primers annealing to introns 5' splice site sequence (ISS). This analysis allowed the detection of a non-random vocabulary flanking the site and, exploiting this feature, the creation of specific probes for strain discrimination. Secondly, the separation of the intron splice site PCR fragments was obtained throughout the set up of a capillary electrophoresis protocol, giving a 94% repeatability threshold in our experimental conditions. The comparison of results obtained with ISS-PCR/CE versus the ones performed by mtDNA RFLP revealed that the former protocol is more discriminating and allowed a reliable identification at strain level. Actually sixty D./B. bruxellensis isolates were recognised as unique strains, showing a level of similarity below 79% and confirming the high genetic polymorphism existing within the species. Two main clusters were grouped at similarity levels of about 46% and 47%, respectively, showing a poor correlation with the geographic area of isolation. Moreover, from the evolutionary point of view, the proposed technique could determine the frequency of the genome rearrangements that can occur in D./B. bruxellesis populations. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. The Chloroplast Genome of Euglena mutabilis-Cluster Arrangement, Intron Analysis, and Intrageneric Trends.

    Science.gov (United States)

    Dabbagh, Nadja; Preisfeld, Angelika

    2017-01-01

    A comparative analysis of the chloroplast genome of Euglena mutabilis underlined a high diversity in the evolution of plastids in euglenids. Gene clusters in more derived Euglenales increased in complexity with only a few, but remarkable changes in the genus Euglena. Euglena mutabilis differed from other Euglena species in a mirror-inverted arrangement of 12 from 15 identified clusters, making it very likely that the emergence at the base of the genus Euglena, which has been considered a long branch artifact, is truly a probable position. This was corroborated by many similarities in gene arrangement and orientation with Strombomonas and Monomorphina, rendering the genome organization of E. mutabilis in certain clusters as plesiomorphic feature. By RNA analysis exact exon-intron boundaries and the type of the 77 introns identified were mostly determined unambiguously. A detailed intron study of psbC pointed at two important issues: First, the number of introns varied even between species, and no trend from few to many introns could be observed. Second, mat1 was localized in Eutreptiales exclusively in intron 1, and mat2 was not identified. With the emergence of Euglenaceae in most species, a new intron containing mat2 inserted in front of the previous intron 1 and thereby became intron 2 with mat1.

  20. Selection for reduced translation costs at the intronic 5′ end in fungi

    Science.gov (United States)

    Zafrir, Zohar; Zur, Hadas; Tuller, Tamir

    2016-01-01

    It is generally believed that introns are not translated; therefore, the potential intronic features that may be related to the translation step (occurring after splicing) have yet to be thoroughly studied. Here, focusing on four fungi, we performed for the first time a comprehensive study aimed at characterizing how translation efficiency is encoded in introns and affects their evolution. By analysing their intronome we provide evidence of selection for STOP codons close to the intronic 5′ end, and show that the beginning of introns are selected for significantly high translation, presumably to reduce translation and metabolic costs in cases of non-spliced introns. Ribosomal profiling data analysis in Saccharomyces cerevisiae supports the conjecture that in this organism intron retention frequently occurs, introns are partially translated, and their translation efficiency affects organismal fitness. We show that the reported results are more significant in highly translated and highly spliced genes, but are not associated only with genes with a specific function. We also discuss the potential relation of the reported signals to efficient nonsense-mediated decay due to splicing errors. These new discoveries are supported by population-genetics considerations. In addition, they are contributory steps towards a broader understanding of intron evolution and the effect of silent mutations on gene expression and organismal fitness. PMID:27260512

  1. Polymorphism of DFR Gene Intron 2 and Intron 3 in Sweet Cherry%甜樱桃DFR基因内含子2和内含子3的多态性

    Institute of Scientific and Technical Information of China (English)

    王廿; 鄢锦辉; 张开春; 王晶; 张晓明; 闫国华

    2012-01-01

    [Objective] The relationship between polymorphism of DFR gene and pericarp colors was studied in 70 sweet cherry varieties. [Method] DNA sequences analysis was applied to detect the polymorphism of DFR gene in 10 sweet cherry varieties (Prunus avium L.) of different colors in pericarp. Special primers were designed to amplify the polymorphic DNA fragments. 70 sweet cherry varieties (P. Avium L.) were used to test DFR gene polymorphism. [Result] The DNA sequences of partial DFR gene about 1 kb were obtained from sweet cherry (P. Avium). The identity of these DNA sequences was 80% with DFR gene of peach (Prunus persica). The identity of predicted amino acid sequences was 99% with the amino acid sequence of DFR in sweet cherry. This partial DFR gene contained 3 extrons and 3 introns. Two polymorphic loci were detected in intron 2 and intron 3. Three haplotypes and five haplotype combinations were found among 70 sweet cherry varieties which are composed of yellow pericarp group, yellow with a pink blush pericarp group and red pericarp group. There was no significant difference in the DFR gene frequencies between yellow with a pink blush pericarp group and dark red pericarp group. [Conclusion] Two polymorphism loci were detected in intron 2 and intron 3 of DFR gene. Preponderatn alleles frequencies of 70 sweet cherry varieties was 0.864 in intron 2 and 0.679 in intron 3. Respectively. There is no direct relationship between pericarp colors and polymorphisms DFR gene in intron 2 and intron 3.%[目的]研究70个甜樱桃品种DFR基因多态性与果皮颜色的相关性.[方法]通过DNA序列分析,以不同果皮颜色的10个甜樱桃品种(Prunus aviumL.)为材料,检测DFR基因的多态性.根据多态性出现的位点设计特异引物,通过PCR扩增检测70个甜樱桃品种DFR基因的多态性.[结果]获得甜樱桃DFR基因约1 kb的片段,测序结果用BLAST分析发现,其核苷酸序列与樱桃李(Prunus cerasifera)的核苷酸相似性为80%,预

  2. Polyphyletic origin of the genus Physarum (Physarales, Myxomycetes revealed by nuclear rDNA mini-chromosome analysis and group I intron synapomorphy

    Directory of Open Access Journals (Sweden)

    Nandipati Satish CR

    2012-08-01

    Full Text Available Abstract Background Physarales represents the largest taxonomic order among the plasmodial slime molds (myxomycetes. Physarales is of particular interest since the two best-studied myxomycete species, Physarum polycephalum and Didymium iridis, belong to this order and are currently subjected to whole genome and transcriptome analyses. Here we report molecular phylogeny based on ribosomal DNA (rDNA sequences that includes 57 Physarales isolates. Results The Physarales nuclear rDNA sequences were found to be loaded with 222 autocatalytic group I introns, which may complicate correct alignments and subsequent phylogenetic tree constructions. Phylogenetic analysis of rDNA sequences depleted of introns confirmed monophyly of the Physarales families Didymiaceae and Physaraceae. Whereas good correlation was noted between phylogeny and taxonomy among the Didymiaceae isolates, significant deviations were seen in Physaraceae. The largest genus, Physarum, was found to be polyphyletic consisting of at least three well supported clades. A synapomorphy, located at the highly conserved G-binding site of L2449 group I intron ribozymes further supported the Physarum clades. Conclusions Our results provide molecular relationship of Physarales genera, species, and isolates. This information is important in further interpretations of comparative genomics nd transcriptomics. In addition, the result supports a polyphyletic origin of the genus Physarum and calls for a reevaluation of current taxonomy.

  3. Polyphyletic origin of the genus Physarum (Physarales, Myxomycetes) revealed by nuclear rDNA mini-chromosome analysis and group I intron synapomorphy.

    Science.gov (United States)

    Nandipati, Satish C R; Haugli, Kari; Coucheron, Dag H; Haskins, Edward F; Johansen, Steinar D

    2012-08-31

    Physarales represents the largest taxonomic order among the plasmodial slime molds (myxomycetes). Physarales is of particular interest since the two best-studied myxomycete species, Physarum polycephalum and Didymium iridis, belong to this order and are currently subjected to whole genome and transcriptome analyses. Here we report molecular phylogeny based on ribosomal DNA (rDNA) sequences that includes 57 Physarales isolates. The Physarales nuclear rDNA sequences were found to be loaded with 222 autocatalytic group I introns, which may complicate correct alignments and subsequent phylogenetic tree constructions. Phylogenetic analysis of rDNA sequences depleted of introns confirmed monophyly of the Physarales families Didymiaceae and Physaraceae. Whereas good correlation was noted between phylogeny and taxonomy among the Didymiaceae isolates, significant deviations were seen in Physaraceae. The largest genus, Physarum, was found to be polyphyletic consisting of at least three well supported clades. A synapomorphy, located at the highly conserved G-binding site of L2449 group I intron ribozymes further supported the Physarum clades. Our results provide molecular relationship of Physarales genera, species, and isolates. This information is important in further interpretations of comparative genomics nd transcriptomics. In addition, the result supports a polyphyletic origin of the genus Physarum and calls for a reevaluation of current taxonomy.

  4. In situ genetic correction of F8 intron 22 inversion in hemophilia A patient-specific iPSCs.

    Science.gov (United States)

    Wu, Yong; Hu, Zhiqing; Li, Zhuo; Pang, Jialun; Feng, Mai; Hu, Xuyun; Wang, Xiaolin; Lin-Peng, Siyuan; Liu, Bo; Chen, Fangping; Wu, Lingqian; Liang, Desheng

    2016-01-08

    Nearly half of severe Hemophilia A (HA) cases are caused by F8 intron 22 inversion (Inv22). This 0.6-Mb inversion splits the 186-kb F8 into two parts with opposite transcription directions. The inverted 5' part (141 kb) preserves the first 22 exons that are driven by the intrinsic F8 promoter, leading to a truncated F8 transcript due to the lack of the last 627 bp coding sequence of exons 23-26. Here we describe an in situ genetic correction of Inv22 in patient-specific induced pluripotent stem cells (iPSCs). By using TALENs, the 627 bp sequence plus a polyA signal was precisely targeted at the junction of exon 22 and intron 22 via homologous recombination (HR) with high targeting efficiencies of 62.5% and 52.9%. The gene-corrected iPSCs retained a normal karyotype following removal of drug selection cassette using a Cre-LoxP system. Importantly, both F8 transcription and FVIII secretion were rescued in the candidate cell types for HA gene therapy including endothelial cells (ECs) and mesenchymal stem cells (MSCs) derived from the gene-corrected iPSCs. This is the first report of an efficient in situ genetic correction of the large inversion mutation using a strategy of targeted gene addition.

  5. Gender-Specific Amelioration of SMA Phenotype upon Disruption of a Deep Intronic Structure by an Oligonucleotide.

    Science.gov (United States)

    Howell, Matthew D; Ottesen, Eric W; Singh, Natalia N; Anderson, Rachel L; Singh, Ravindra N

    2017-06-07

    Spinal muscular atrophy (SMA), the leading genetic disease of children, is caused by low levels of survival motor neuron (SMN) protein. Here, we employ A15/283, an antisense oligonucleotide targeting a deep intronic sequence/structure, to examine the impact of restoration of SMN in a mild SMA mouse model. We show gender-specific amelioration of tail necrosis upon subcutaneous administrations of A15/283 into SMA mice at postnatal days 1 and 3. We also demonstrate that a modest increase in SMN due to early administrations of A15/283 dramatically improves testicular development and spermatogenesis. Our results reveal near total correction of expression of several genes in adult testis upon temporary increase in SMN during early postnatal development. This is the first demonstration of in vivo efficacy of an antisense oligonucleotide targeting a deep intronic sequence/structure. This is also the first report of gender-specific amelioration of SMA pathology upon a modest peripheral increase of SMN. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  6. Polymorphism of the aryl-hydrocarbon receptor gene in intron 10 of human cancers

    Directory of Open Access Journals (Sweden)

    M. Rocas

    2011-11-01

    Full Text Available Polychlorinated dibenzo-p-dioxins (PCDDs and related halogenated aromatic hydrocarbons (e.g., PCDFs, often called "dioxins", are ubiquitously present environmental contaminants. Some of them, notably 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD, are among the most toxic synthetic compounds known. The biological effects of dioxins are mediated via the aryl hydrocarbon receptor (AhR. Mutations in the AhR transactivation domain are linked to sensitivity to the acute lethality of TCDD. We present here a study of AhR gene polymorphism in normal and cancer human tissues affecting pre-mRNA splicing in the AhR gene-coding transactivation domain region (exon 10, intron 10, exon 11 region, previously shown to be associated with AhR dysfunction. We tested 126 pairs of normal and cancer tissue samples from liver, lung, stomach, kidney, mucous, breast, and pancreas of 49 males and 77 females (45-70 years of age. We used in vitro splicing assay, RT-PCR and sequencing methods. Our results showed that in an in vitro system it is possible to reconstitute cellular pre-mRNA splicing events. Tested cancer tissues did not contain mutations in the AhR transactivation domain region when the DNA sequences were compared with those from normal tissues. There were also no differences in AhR mRNA splice variants between normal and malignant breast tissues and no polymorphisms in the studied regions or cDNA.

  7. Polymorphism of the aryl-hydrocarbon receptor gene in intron 10 of human cancers.

    Science.gov (United States)

    Rocas, M; Jakubauskiene, E; Kanopka, A

    2011-11-01

    Polychlorinated dibenzo-p-dioxins (PCDDs) and related halogenated aromatic hydrocarbons (e.g., PCDFs), often called "dioxins", are ubiquitously present environmental contaminants. Some of them, notably 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), are among the most toxic synthetic compounds known. The biological effects of dioxins are mediated via the aryl hydrocarbon receptor (AhR). Mutations in the AhR transactivation domain are linked to sensitivity to the acute lethality of TCDD. We present here a study of AhR gene polymorphism in normal and cancer human tissues affecting pre-mRNA splicing in the AhR gene-coding transactivation domain region (exon 10, intron 10, exon 11 region), previously shown to be associated with AhR dysfunction. We tested 126 pairs of normal and cancer tissue samples from liver, lung, stomach, kidney, mucous, breast, and pancreas of 49 males and 77 females (45-70 years of age). We used in vitro splicing assay, RT-PCR and sequencing methods. Our results showed that in an in vitro system it is possible to reconstitute cellular pre-mRNA splicing events. Tested cancer tissues did not contain mutations in the AhR transactivation domain region when the DNA sequences were compared with those from normal tissues. There were also no differences in AhR mRNA splice variants between normal and malignant breast tissues and no polymorphisms in the studied regions or cDNA.

  8. What an Intron May Tell: Several Sexual Biospecies Coexist in Meriderma spp. (Myxomycetes).

    Science.gov (United States)

    Feng, Yun; Klahr, Anja; Janik, Paulina; Ronikier, Anna; Hoppe, Thomas; Novozhilov, Yuri K; Schnittler, Martin

    2016-06-01

    Specimens of the snowbank myxomycete Meriderma atrosporum agg. from five European mountain ranges were sequenced for parts of the nuclear small subunit ribosomal RNA gene (SSU) and the protein elongation factor 1 alpha gene (EF1A). A phylogeny of the EF1A gene, including a very variable spliceosomal intron, resulted in seven phylogroups, and this topology was confirmed by SSU sequences. Two thirds of all specimens were heterozygous for the EF1A gene, and the two haplotypes of these specimens occurred always in the same phylogroup. Except for two cases in closely related phylogroups all ribotypes were as well limited to one phylogroup. This pattern is consistent with the assumption of reproductively isolated sexual biospecies. Numbers of EF1A-haplotypes shared between mountain ranges correlate with geographical distance, suggesting relative isolation but occasional long-distance dispersal by spores. Most subpopulations (divided by putative biospecies and mountain ranges) were in Hardy-Weinberg equilibrium. A simulation assuming panmixis within but not in between subpopulations suggested that similar numbers of shared genotypes can be created by chance through sexual reproduction alone. Our results support the biospecies concept, derived from experiments with cultivable members of the Physarales. We discuss the results on the background of possible reproductive options in myxomycetes. Copyright © 2016 Elsevier GmbH. All rights reserved.

  9. Gene arrangement convergence, diverse intron content, and genetic code modifications in mitochondrial genomes of sphaeropleales (chlorophyta).

    Science.gov (United States)

    Fučíková, Karolina; Lewis, Paul O; González-Halphen, Diego; Lewis, Louise A

    2014-08-08

    The majority of our knowledge about mitochondrial genomes of Viridiplantae comes from land plants, but much less is known about their green algal relatives. In the green algal order Sphaeropleales (Chlorophyta), only one representative mitochondrial genome is currently available-that of Acutodesmus obliquus. Our study adds nine completely sequenced and three partially sequenced mitochondrial genomes spanning the phylogenetic diversity of Sphaeropleales. We show not only a size range of 25-53 kb and variation in intron content (0-11) and gene order but also conservation of 13 core respiratory genes and fragmented ribosomal RNA genes. We also report an unusual case of gene arrangement convergence in Neochloris aquatica, where the two rns fragments were secondarily placed in close proximity. Finally, we report the unprecedented usage of UCG as stop codon in Pseudomuriella schumacherensis. In addition, phylogenetic analyses of the mitochondrial protein-coding genes yield a fully resolved, well-supported phylogeny, showing promise for addressing systematic challenges in green algae. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Role of intron-mediated enhancement on accumulation of an Arabidopsis NB-LRR class R-protein that confers resistance to Cucumber mosaic virus.

    Directory of Open Access Journals (Sweden)

    Yukiyo Sato

    Full Text Available The accumulation of RCY1 protein, which is encoded by RESISTANCE TO CMV(Y (RCY1, a CC-NB-LRR class R-gene, is tightly correlated with the strength of the resistance to a yellow strain of Cucumber mosaic virus [CMV(Y] in Arabidopsis thaliana. In order to enhance resistance to CMV by overexpression of RCY1, A. thaliana was transformed with intron-less RCY1 cDNA construct under the control of strong CaMV35S promoter. Remarkably, a relative amount of RCY1 protein accumulation in the transformants was much lower than that in plants expressing genomic RCY1 under the control of its native promoter. To identify a regulatory element of RCY1 that could cause such differential levels of RCY1 accumulation, a series of RCY1 cDNA and genomic RCY1 constructs were transiently expressed in Nicotiana benthamiana leaves by the Agrobacterium-mediated infiltration method. Comparative analysis of the level of RCY1 accumulation in the leaf tissues transiently expressing each construct indicated that the intron located in the RCY1-coding region of genomic RCY1, but not the native RCY1 genomic promoter or the 5'-and 3'-untranslated regions of RCY1, was indispensable for high level RCY1 accumulation. The increased levels of RCY1 accelerated plant disease defense reactions. Interestingly, such intron-mediated enhancement of RCY1 accumulation depended neither on the abundance of the RCY1 transcript nor on the RCY1 specific-intron sequence. Taken together, intron-mediated RCY1 expression seems to play a key role in the expression of complete resistance to CMV(Y by maintaining RCY1 accumulation at high levels.

  11. Genotyping of intron 22 inversion of factor VIII gene for diagnosis of hemophilia A by inverse-shifting polymerase chain reaction and capillary electrophoresis.

    Science.gov (United States)

    Pan, Tzu-Yu; Wang, Chun-Chi; Shih, Chi-Jen; Wu, Hui-Fen; Chiou, Shyh-Shin; Wu, Shou-Mei

    2014-09-01

    This is the first capillary electrophoresis (CE) analysis for diagnosis of hemophilia A (HA). The intron 22 inversion of factor VIII gene (F8) causes 40-50 % of severe bleeding disorder of HA in all human populations. Consequently, identification of the disease-causing mutations is becoming increasingly important for accurate genetic counseling and prenatal diagnosis. In this study, the key steps of inverse-shifting polymerase chain reaction (IS-PCR) and of short-end injection capillary electrophoresis were used for more specific and rapid genotyping of intron 22 inversion of F8. In IS-PCR, three specific primers were used to amplify 512-bp amplicon for wild type and 584-bp amplicon for patients with intron 22 inversion. The capillary gel electrophoresis (CGE) system was performed using 1× Tris-borate-EDTA (TBE) buffer containing 0.3 % (w/v) polyethylene oxide (PEO). The PCR amplicons were electrokinetically injected at 10 kV for 10 s at a temperature of 25 °C. The optimal short-end injection CGE was applied to detect the F8 gene of HA patients and carriers within 5 min. Intron 22 inversion was indeed found on some HA patients (13/35, 37.1 %). All genotyping results showed good agreement with DNA sequencing method and long-distance polymerase chain reaction (LD-PCR). The IS-PCR combined with short-end injection CGE method was feasible and efficient for intron 22 inversion screening of F8 in the HA populations.

  12. The presence of the NOS3 gene polymorphism for intron 4 mitigates the beneficial effects of exercise training on ambulatory blood pressure monitoring in adults.

    Science.gov (United States)

    Sponton, Carlos H; Esposti, Rodrigo; Rodovalho, Cynara M; Ferreira, Maycon J; Jarrete, Aline P; Anaruma, Chadi P; Bacci, Mauricio; Zanesco, Angelina

    2014-06-15

    The number of studies that have evaluated exercise training (ET) and nitric oxide synthase (NOS)3 gene polymorphisms is scarce. The present study was designed to evaluate the relationship between exercise training and NOS3 polymorphisms at -786T>C, 894G>T, and intron 4b/a on blood pressure (BP) using 24-h ambulatory BP monitoring (ABPM), nitrate/nitrite levels (NOx), and redox state. Eighty-six volunteers (51 ± 0.6 yr old) were genotyped into nonpolymorphic and polymorphic groups for each of the three positions of NOS3 polymorphisms. Auscultatory BP, ABPM, SOD activity, catalase activity, NOx levels, and malondialdehyde levels were measured. DNA was extracted from leukocytes, and PCR followed by sequencing was applied for genotype analysis. Aerobic ET consisted of 24 sessions for 3 days/wk for 40 min at moderate intensity. This study was performed in a double-blind and crossover format. ET was effective in lowering office BP (systolic BP: 3.2% and diastolic BP: 3%) as well as ABPM (systolic BP: 2% and diastolic BP: 1.3%). Increased SOD and catalase activity (42.6% and 15.1%, respectively) were also observed. The NOS3 polymorphism for intron 4 mitigated the beneficial effect of ET for systolic BP (nonpolymorphic group: -3.0% and polymorphic group: -0.6%) and diastolic BP (nonpolymorphic group: -3.2% and polymorphic group: -0.5%), but it was not associated with NOx level and redox state. Paradoxical responses were found for positions T786-C and G894T for the NOS3 gene. Consistently, the presence of the polymorphism for intron 4 blunted the beneficial effects of ET in middle-aged adults. Possibly, this effect might be as consequence of intron 4 acting as a short intronic repeat RNA controlling endothelial NOS activity epigenetically. Copyright © 2014 the American Physiological Society.

  13. Compensatory relationship between splice sites and exonic splicing signals depending on the length of vertebrate introns

    Directory of Open Access Journals (Sweden)

    Rogozin Igor B

    2006-12-01

    Full Text Available Abstract Background The signals that determine the specificity and efficiency of splicing are multiple and complex, and are not fully understood. Among other factors, the relative contributions of different mechanisms appear to depend on intron size inasmuch as long introns might hinder the activity of the spliceosome through interference with the proper positioning of the intron-exon junctions. Indeed, it has been shown that the information content of splice sites positively correlates with intron length in the nematode, Drosophila, and fungi. We explored the connections between the length of vertebrate introns, the strength of splice sites, exonic splicing signals, and evolution of flanking exons. Results A compensatory relationship is shown to exist between different types of signals, namely, the splice sites and the exonic splicing enhancers (ESEs. In the range of relatively short introns (approximately, Conclusion Several weak but statistically significant correlations were observed between vertebrate intron length, splice site strength, and potential exonic splicing signals. Taken together, these findings attest to a compensatory relationship between splice sites and exonic splicing signals, depending on intron length.

  14. Forks in the tracks: Group II introns, spliceosomes, telomeres and beyond.

    Science.gov (United States)

    Agrawal, Rajendra Kumar; Wang, Hong-Wei; Belfort, Marlene

    2016-12-01

    Group II introns are large catalytic RNAs that form a ribonucleoprotein (RNP) complex by binding to an intron-encoded protein (IEP). The IEP, which facilitates both RNA splicing and intron mobility, has multiple activities including reverse transcriptase. Recent structures of a group II intron RNP complex and of IEPs from diverse bacteria fuel arguments that group II introns are ancestrally related to eukaryotic spliceosomes as well as to telomerase and viruses. Furthermore, recent structural studies of various functional states of the spliceosome allow us to draw parallels between the group II intron RNP and the spliceosome. Here we present an overview of these studies, with an emphasis on the structure of the IEPs in their isolated and RNA-bound states and on their evolutionary relatedness. In addition, we address the conundrum of the free, albeit truncated IEPs forming dimers, whereas the IEP bound to the intron ribozyme is a monomer in the mature RNP. Future studies needed to resolve some of the outstanding issues related to group II intron RNP function and dynamics are also discussed.

  15. EVIDENCE FOR INDEPENDENT ACQUISITION OF GROUP-I INTRONS IN GREEN-ALGAE

    NARCIS (Netherlands)

    VANOPPEN, MJH; OLSEN, JL; STAM, WT

    1993-01-01

    We report the occurrence of a group I intron, 452 nucleotides in length, in the nuclear small-subunit ribosomal gene of the benthic seaweed Urospora penicilliformis, a member of the green algal class Ulvophyceae. Group I introns have been reported in fungi, myxomycetes, the ciliate genus

  16. EVIDENCE FOR INDEPENDENT ACQUISITION OF GROUP-I INTRONS IN GREEN-ALGAE

    NARCIS (Netherlands)

    VANOPPEN, MJH; OLSEN, JL; STAM, WT

    1993-01-01

    We report the occurrence of a group I intron, 452 nucleotides in length, in the nuclear small-subunit ribosomal gene of the benthic seaweed Urospora penicilliformis, a member of the green algal class Ulvophyceae. Group I introns have been reported in fungi, myxomycetes, the ciliate genus Tetrahymena

  17. Two CRM protein subfamilies cooperate in the splicing of group IIB introns in chloroplasts.

    Science.gov (United States)

    Asakura, Yukari; Bayraktar, Omer Ali; Barkan, Alice

    2008-11-01

    Chloroplast genomes in angiosperms encode approximately 20 group II introns, approximately half of which are classified as subgroup IIB. The splicing of all but one of the subgroup IIB introns requires a heterodimer containing the peptidyl-tRNA hydrolase homolog CRS2 and one of two closely related proteins, CAF1 or CAF2, that harbor a recently recognized RNA binding domain called the CRM domain. Two CRS2/CAF-dependent introns require, in addition, a CRM domain protein called CFM2 that is only distantly related to CAF1 and CAF2. Here, we show that CFM3, a close relative of CFM2, associates in vivo with those CRS2/CAF-dependent introns that are not CFM2 ligands. Mutant phenotypes in rice and Arabidopsis support a role for CFM3 in the splicing of most of the introns with which it associates. These results show that either CAF1 or CAF2 and either CFM2 or CFM3 simultaneously bind most chloroplast subgroup IIB introns in vivo, and that the CAF and CFM subunits play nonredundant roles in splicing. These results suggest that the expansion of the CRM protein family in plants resulted in two subfamilies that play different roles in group II intron splicing, with further diversification within a subfamily to accommodate multiple intron ligands.

  18. Molecular genetic analysis of cereal β-amylase genes using exon-primed intron-crossing (EPIC PCR

    Directory of Open Access Journals (Sweden)

    Stratula Olga

    2014-01-01

    Full Text Available The proteins encoded by cereal β-amylase genes Bamy1 and Bamy2 genes play an important role in seedling germination and in the brewing process. Here, we use exon-primed intron-crossing (EPIC to analyse Bamy1 and Bamy2 genetic diversity among 38 accessions belonging to six Poaceae tribes. DNA sequence alignment of multiple Poaceae species β-amylase sequences allowed design of EPIC primers that simultaneously amplify Bamy1 and Bamy2 in all the cereal species investigated. The genetic variation observed in the samples investigated is analysed and discussed, and illustrates the effectiveness of this approach for intra- and interspecific analysis in plant species.

  19. The active gene that encodes human High Mobility Group 1 protein (HMG1) contains introns and maps to chromosome 13

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S. [Dipartimento di Genetica e di Biologia dei Microrganismi, Milan (Italy); Finelli, P.; Rocchi, M. [Istituto di Genetica, Bari (Italy)] [and others

    1996-07-15

    The human genome contains a large number of sequences related to the cDNA for High Mobility Group 1 protein (HMG1), which so far has hampered the cloning and mapping of the active HMG1 gene. We show that the human HMG1 gene contains introns, while the HMG1-related sequences do not and most likely are retrotransposed pseudogenes. We identified eight YACs from the ICI and CEPH libraries that contain the human HMG1 gene. The HMG1 gene is similar in structure to the previously characterized murine homologue and maps to human chromosome 13 and q12, as determined by in situ hybridization. The mouse Hmg1 gene maps to the telomeric region of murine Chromosome 5, which is syntenic to the human 13q12 band. 18 refs., 3 figs.

  20. Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.

    Directory of Open Access Journals (Sweden)

    Alla Buzina

    2008-04-01

    Full Text Available The Locus Control Region (LCR requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate

  1. Long range correlations in DNA sequences

    CERN Document Server

    Mohanty, A K

    2002-01-01

    The so called long range correlation properties of DNA sequences are studied using the variance analyses of the density distribution of a single or a group of nucleotides in a model independent way. This new method which was suggested earlier has been applied to extract slope parameters that characterize the correlation properties for several intron containing and intron less DNA sequences. An important aspect of all the DNA sequences is the properties of complimentarity by virtue of which any two complimentary distributions (like GA is complimentary to TC or G is complimentary to ATC) have identical fluctuations at all scales although their distribution functions need not be identical. Due to this complimentarity, the famous DNA walk representation whose statistical interpretation is still unresolved is shown to be a special case of the present formalism with a density distribution corresponding to a purine or a pyrimidine group. Another interesting aspect of most of the DNA sequences is that the factorial m...

  2. RNA-Seq Analysis of Differential Splice Junction Usage and Intron Retentions by DEXSeq.

    Directory of Open Access Journals (Sweden)

    Yafang Li

    Full Text Available Alternative splicing is an important biological process in the generation of multiple functional transcripts from the same genomic sequences. Differential analysis of splice junctions (SJs and intron retentions (IRs is helpful in the detection of alternative splicing events. In this study, we conducted differential analysis of SJs and IRs by use of DEXSeq, a Bioconductor package originally designed for differential exon usage analysis in RNA-seq data analysis. We set up an analysis pipeline including mapping of RNA-seq reads, the preparation of count tables of SJs and IRs as the input files, and the differential analysis in DEXSeq. We analyzed the public RNA-seq datasets generated from RNAi experiments on Drosophila melanogaster S2-DRSC cells to deplete RNA-binding proteins (GSE18508. The analysis confirmed previous findings on the alternative splicing of the trol and Ant2 (sesB genes in the CG8144 (ps-depletion experiment and identified some new alternative splicing events in other RNAi experiments. We also identified IRs that were confirmed in our SJ analysis. The proposed method used in our study can output the genomic coordinates of differentially used SJs and thus enable sequence motif search. Sequence motif search and gene function annotation analysis helped us infer the underlying mechanism in alternative splicing events. To further evaluate this method, we also applied the method to public RNA-seq data from human breast cancer (GSE45419 and the plant Arabidopsis (SRP008262. In conclusion, our study showed that DEXSeq can be adapted to differential analysis of SJs and IRs, which will facilitate the identification of alternative splicing events and provide insights into the molecular mechanisms of transcription processes and disease development.

  3. RNA-Seq Analysis of Differential Splice Junction Usage and Intron Retentions by DEXSeq

    Science.gov (United States)

    Li, Yafang; Rao, Xiayu; Mattox, William W.; Amos, Christopher I.; Liu, Bin

    2015-01-01

    Alternative splicing is an important biological process in the generation of multiple functional transcripts from the same genomic sequences. Differential analysis of splice junctions (SJs) and intron retentions (IRs) is helpful in the detection of alternative splicing events. In this study, we conducted differential analysis of SJs and IRs by use of DEXSeq, a Bioconductor package originally designed for differential exon usage analysis in RNA-seq data analysis. We set up an analysis pipeline including mapping of RNA-seq reads, the preparation of count tables of SJs and IRs as the input files, and the differential analysis in DEXSeq. We analyzed the public RNA-seq datasets generated from RNAi experiments on Drosophila melanogaster S2-DRSC cells to deplete RNA-binding proteins (GSE18508). The analysis confirmed previous findings on the alternative splicing of the trol and Ant2 (sesB) genes in the CG8144 (ps)-depletion experiment and identified some new alternative splicing events in other RNAi experiments. We also identified IRs that were confirmed in our SJ analysis. The proposed method used in our study can output the genomic coordinates of differentially used SJs and thus enable sequence motif search. Sequence motif search and gene function annotation analysis helped us infer the underlying mechanism in alternative splicing events. To further evaluate this method, we also applied the method to public RNA-seq data from human breast cancer (GSE45419) and the plant Arabidopsis (SRP008262). In conclusion, our study showed that DEXSeq can be adapted to differential analysis of SJs and IRs, which will facilitate the identification of alternative splicing events and provide insights into the molecular mechanisms of transcription processes and disease development. PMID:26327458

  4. Conservation of intron and intein insertion sites: implications for life histories of parasitic genetic elements

    Directory of Open Access Journals (Sweden)

    Senejani Alireza G

    2009-12-01

    Full Text Available Abstract Background Inteins and introns are genetic elements that are removed from proteins and RNA after translation or transcription, respectively. Previous studies have suggested that these genetic elements are found in conserved parts of the host protein. To our knowledge this type of analysis has not been done for group II introns residing within a gene. Here we provide quantitative statistical support from an analyses of proteins that host inteins, group I introns, group II introns and spliceosomal introns across all three domains of life. Results To determine whether or not inteins, group I, group II, and spliceosomal introns are found preferentially in conserved regions of their respective host protein, conservation profiles were generated and intein and intron positions were mapped to the profiles. Fisher's combined probability test was used to determine the significance of the distribution of insertion sites across the conservation profile for each protein. For a subset of studied proteins, the conservation profile and insertion positions were mapped to protein structures to determine if the insertion sites correlate to regions of functional activity. All inteins and most group I introns were found to be preferentially located within conserved regions; in contrast, a bacterial intein-like protein, group II and spliceosomal introns did not show a preference for conserved sites. Conclusions These findings demonstrate that inteins and group I introns are found preferentially in conserved regions of their respective host proteins. Homing endonucleases are often located within inteins and group I introns and these may facilitate mobility to conserved regions. Insertion at these conserved positions decreases the chance of elimination, and slows deletion of the elements, since removal of the elements has to be precise as not to disrupt the function of the protein. Furthermore, functional constrains on the targeted site make it more difficult

  5. Structure et réarrangements conformationnels au cours de l’épissage du composant ribozyme d’un intron de groupe II

    OpenAIRE

    Li, Cheng-Fang

    2011-01-01

    Group II introns are a class of RNAs best known for their ribozyme-catalyzed, self-splicing reaction. Under certain conditions, the introns can excise themselves from precursor mRNAs and ligate together their flanking exons, without the aid of proteins. Group II introns generally excise from pre-mRNA as a lariat, like the one formed by spliceosomal introns, similarities in the splicing mechanism suggest that group II introns and nuclear spliceosomal introns may share a common evolutionary anc...

  6. Identification and Functional Characterization of Two Intronic NIPBL Mutations in Two Patients with Cornelia de Lange Syndrome.

    Science.gov (United States)

    Teresa-Rodrigo, María E; Eckhold, Juliane; Puisac, Beatriz; Pozojevic, Jelena; Parenti, Ilaria; Baquero-Montoya, Carolina; Gil-Rodríguez, María C; Braunholz, Diana; Dalski, Andreas; Hernández-Marcos, María; Ayerza, Ariadna; Bernal, María L; Ramos, Feliciano J; Wieczorek, Dagmar; Gillessen-Kaesbach, Gabriele; Pié, Juan; Kaiser, Frank J

    2016-01-01

    Cornelia de Lange syndrome (CdLS) is a rare genetically heterogeneous disorder with a high phenotypic variability including mental retardation, developmental delay, and limb malformations. The genetic causes in about 30% of patients with CdLS are still unknown. We report on the functional characterization of two intronic NIPBL mutations in two patients with CdLS that do not affect a conserved splice-donor or acceptor site. Interestingly, mRNA analyses showed aberrantly spliced transcripts missing exon 28 or 37, suggesting the loss of the branch site by the c.5329-15A>G transition and a disruption of the polypyrimidine by the c.6344del(-13)_(-8) deletion. While the loss of exon 28 retains the reading frame of the NIBPL transcript resulting in a shortened protein, the loss of exon 37 shifts the reading frame with the consequence of a premature stop of translation. Subsequent quantitative PCR analysis demonstrated a 30% decrease of the total NIPBL mRNA levels associated with the frameshift transcript. Consistent with our results, this patient shows a more severe phenotype compared to the patient with the aberrant transcript that retains its reading frame. Thus, intronic variants identified by sequencing analysis in CdLS diagnostics should carefully be examined before excluding them as nonrelevant to disease.

  7. Identification and Functional Characterization of Two Intronic NIPBL Mutations in Two Patients with Cornelia de Lange Syndrome

    Directory of Open Access Journals (Sweden)

    María E. Teresa-Rodrigo

    2016-01-01

    Full Text Available Cornelia de Lange syndrome (CdLS is a rare genetically heterogeneous disorder with a high phenotypic variability including mental retardation, developmental delay, and limb malformations. The genetic causes in about 30% of patients with CdLS are still unknown. We report on the functional characterization of two intronic NIPBL mutations in two patients with CdLS that do not affect a conserved splice-donor or acceptor site. Interestingly, mRNA analyses showed aberrantly spliced transcripts missing exon 28 or 37, suggesting the loss of the branch site by the c.5329-15A>G transition and a disruption of the polypyrimidine by the c.6344del(-13_(-8 deletion. While the loss of exon 28 retains the reading frame of the NIBPL transcript resulting in a shortened protein, the loss of exon 37 shifts the reading frame with the consequence of a premature stop of translation. Subsequent quantitative PCR analysis demonstrated a 30% decrease of the total NIPBL mRNA levels associated with the frameshift transcript. Consistent with our results, this patient shows a more severe phenotype compared to the patient with the aberrant transcript that retains its reading frame. Thus, intronic variants identified by sequencing analysis in CdLS diagnostics should carefully be examined before excluding them as nonrelevant to disease.

  8. Activation and repression functions of an SR splicing regulator depend on exonic versus intronic-binding position.

    Science.gov (United States)

    Shen, Manli; Mattox, William

    2012-01-01

    SR proteins and related factors play widespread roles in alternative pre-mRNA splicing and are known to promote splice site recognition through their Arg-Ser-rich effector domains. However, binding of SR regulators to some targets results in repression of splice sites through a distinct mechanism. Here, we investigate how activated and repressed targets of the Drosophila SR regulator Transformer2 elicit its differing effects on splicing. We find that, like activation, repression affects early steps in the recognition of splice sites and spliceosome assembly. Repositioning of regulatory elements reveals that Tra2 complexes that normally repress splicing from intronic positions activate splicing when located in an exon. Protein tethering experiments demonstrate that this position dependence is an intrinsic property of Tra2 and further show that repression and activation are mediated by separate effector domains of this protein. When other Drosophila SR factors (SF2 and Rbp1) that activate splicing from exonic positions were tethered intronically they failed to either activate or repress splicing. Interestingly, both activities of Tra2 favor the exonic identity of the RNA sequences that encompass its binding sites. This suggests a model in which these two opposite functions act in concert to define both the position and extent of alternatively spliced exons.

  9. The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

    Directory of Open Access Journals (Sweden)

    Madeleine Zerbato

    Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

  10. The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

    Science.gov (United States)

    Zerbato, Madeleine; Holic, Nathalie; Moniot-Frin, Sophie; Ingrao, Dina; Galy, Anne; Perea, Javier

    2013-01-01

    Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP) and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

  11. Extensive mis-splicing of a bi-partite plant mitochondrial group II intron.

    Science.gov (United States)

    Elina, Helen; Brown, Gregory G

    2010-01-01

    Expression of the seed plant mitochondrial nad5 gene involves two trans-splicing events that remove fragmented group II introns and join the small, central exon c to exons b and d. We show that in both monocot and eudicot plants, extensive mis-splicing of the bi-partite intron 2 takes place, resulting in the formation of aberrantly spliced products in which exon c is joined to various sites within exon b. These mis-spliced products accumulate to levels comparable to or greater than that of the correctly spliced mRNA. We suggest that mis-splicing may result from folding constraints imposed on intron 2 by base-pairing between exon a and a portion of the bi-partite intron 3 downstream of exon c. Consistent with this hypothesis, we find that mis-splicing does not occur in Oenothera mitochondria, where intron 3 is further fragmented such that the predicted base-pairing region is not covalently linked to exon c. Our findings suggest that intron fragmentation may lead to mis-splicing, which may be corrected by further intron fragmentation.

  12. Accumulation of Stable Full-Length Circular Group I Intron RNAs during Heat-Shock

    Directory of Open Access Journals (Sweden)

    Kasper L. Andersen

    2016-10-01

    Full Text Available Group I introns in nuclear ribosomal RNA of eukaryotic microorganisms are processed by splicing or circularization. The latter results in formation of full-length circular introns without ligation of the exons and has been proposed to be active in intron mobility. We applied qRT-PCR to estimate the copy number of circular intron RNA from the myxomycete Didymium iridis. In exponentially growing amoebae, the circular introns are nuclear and found in 70 copies per cell. During heat-shock, the circular form is up-regulated to more than 500 copies per cell. The intron harbours two ribozymes that have the potential to linearize the circle. To understand the structural features that maintain circle integrity, we performed chemical and enzymatic probing of the splicing ribozyme combined with molecular modeling to arrive at models of the inactive circular form and its active linear counterpart. We show that the two forms have the same overall structure but differ in key parts, including the catalytic core element P7 and the junctions at which reactions take place. These differences explain the relative stability of the circular species, demonstrate how it is prone to react with a target molecule for circle integration and thus supports the notion that the circular form is a biologically significant molecule possibly with a role in intron mobility.

  13. Accumulation of Stable Full-Length Circular Group I Intron RNAs during Heat-Shock.

    Science.gov (United States)

    Andersen, Kasper L; Beckert, Bertrand; Masquida, Benoit; Johansen, Steinar D; Nielsen, Henrik

    2016-10-31

    Group I introns in nuclear ribosomal RNA of eukaryotic microorganisms are processed by splicing or circularization. The latter results in formation of full-length circular introns without ligation of the exons and has been proposed to be active in intron mobility. We applied qRT-PCR to estimate the copy number of circular intron RNA from the myxomycete Didymium iridis. In exponentially growing amoebae, the circular introns are nuclear and found in 70 copies per cell. During heat-shock, the circular form is up-regulated to more than 500 copies per cell. The intron harbours two ribozymes that have the potential to linearize the circle. To understand the structural features that maintain circle integrity, we performed chemical and enzymatic probing of the splicing ribozyme combined with molecular modeling to arrive at models of the inactive circular form and its active linear counterpart. We show that the two forms have the same overall structure but differ in key parts, including the catalytic core element P7 and the junctions at which reactions take place. These differences explain the relative stability of the circular species, demonstrate how it is prone to react with a target molecule for circle integration and thus supports the notion that the circular form is a biologically significant molecule possibly with a role in intron mobility.

  14. Functionality of in vitro reconstituted group II intron RmInt1-derived ribonucleoprotein particles

    Directory of Open Access Journals (Sweden)

    María Dolores Molina-Sánchez

    2016-09-01

    Full Text Available The functional unit of mobile group II introns is a ribonucleoprotein particle (RNP consisting of the intron-encoded protein (IEP and the excised intron RNA. The IEP has reverse transcriptase activity but also promotes RNA splicing, and the RNA-protein complex triggers site-specific DNA insertion by reverse splicing, in a process called retrohoming. In vitro reconstituted ribonucleoprotein complexes from the Lactococcus lactis group II intron Ll.LtrB, which produce a double strand break, have recently been studied as a means of developing group II intron-based gene targeting methods for higher organisms. The Sinorhizobium meliloti group II intron RmInt1 is an efficient mobile retroelement, the dispersal of which appears to be linked to transient single-stranded DNA during replication. The RmInt1IEP lacks the endonuclease domain (En and cannot cut the bottom strand to generate the 3’ end to initiate reverse transcription. We used an Escherichia coli expression system to produce soluble and active RmInt1 IEP and reconstituted RNPs with purified components in vitro. The RNPs generated were functional and reverse-spliced into a single-stranded DNA target. This work constitutes the starting point for the use of group II introns lacking DNA endonuclease domain-derived RNPs for highly specific gene targeting methods.

  15. Alternative splicing of a group II intron in a surface layer protein gene in Clostridium tetani.

    Science.gov (United States)

    McNeil, Bonnie A; Simon, Dawn M; Zimmerly, Steven

    2014-02-01

    Group II introns are ribozymes and retroelements found in bacteria, and are thought to have been the ancestors of nuclear pre-mRNA introns. Whereas nuclear introns undergo prolific alternative splicing in some species, group II introns are not known to carry out equivalent reactions. Here we report a group II intron in the human pathogen Clostridium tetani, which undergoes four alternative splicing reactions in vivo. Together with unspliced transcript, five mRNAs are produced, each encoding a distinct surface layer protein isoform. Correct fusion of exon reading frames requires a shifted 5' splice site located 8 nt upstream of the canonical boundary motif. The shifted junction is accomplished by an altered IBS1-EBS1 pairing between the intron and 5' exon. Growth of C. tetani under a variety of conditions did not result in large changes in alternative splicing levels, raising the possibility that alternative splicing is constitutive. This work demonstrates a novel type of gene organization and regulation in bacteria, and provides an additional parallel between group II and nuclear pre-mRNA introns.

  16. A distant cis acting intronic element induces site-selective RNA editing

    DEFF Research Database (Denmark)

    Daniel, Chammiran; Venø, Morten Trillingsgaard; Ekdahl, Ylva

    2012-01-01

    Transcripts have been found to be site selectively edited from adenosine-to-inosine (A-to-I) in the mammalian brain, mostly in genes involved in neurotransmission. While A-to-I editing occurs at double-stranded structures, other structural requirements are largely unknown. We have investigated...... the requirements for editing at the I/M site in the Gabra-3 transcript of the GABA(A) receptor. We identify an evolutionarily conserved intronic duplex, 150 nt downstream of the exonic hairpin where the I/M site resides, which is required for its editing. This is the first time a distant RNA structure has been...... shown to be important for A-to-I editing. We demonstrate that the element also can induce editing in related but normally not edited RNA sequences. In human, thousands of genes are edited in duplexes formed by inverted repeats in non-coding regions. It is likely that numerous such duplexes can induce...

  17. High-throughput construction of intron-containing hairpin RNA vectors for RNAi in plants.

    Directory of Open Access Journals (Sweden)

    Pu Yan

    Full Text Available With the wide use of double-stranded RNA interference (RNAi for the analysis of gene function in plants, a high-throughput system for making hairpin RNA (hpRNA constructs is in great demand. Here, we describe a novel restriction-ligation approach that provides a simple but efficient construction of intron-containing hpRNA (ihpRNA vectors. The system takes advantage of the type IIs restriction enzyme BsaI and our new plant RNAi vector pRNAi-GG based on the Golden Gate (GG cloning. This method requires only a single PCR product of the gene of interest flanked with BsaI recognition sequence, which can then be cloned into pRNAi-GG at both sense and antisense orientations simultaneously to form ihpRNA construct. The process, completed in one tube with one restriction-ligation step, produced a recombinant ihpRNA with high efficiency and zero background. We demonstrate the utility of the ihpRNA constructs generated with pRNAi-GG vector for the effective silencing of various individual endogenous and exogenous marker genes as well as two genes simultaneously. This method provides a novel and high-throughput platform for large-scale analysis of plant functional genomics.

  18. G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

    Energy Technology Data Exchange (ETDEWEB)

    Willing, M.; Deschenes, S. [Univ. of Iowa, Iowa City, IA (United States)

    1994-09-01

    We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exon 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.

  19. Did group II intron proliferation in an endosymbiont-bearing archaeon create eukaryotes?

    Directory of Open Access Journals (Sweden)

    Poole Anthony M

    2006-12-01

    Full Text Available Abstract Martin & Koonin recently proposed that the eukaryote nucleus evolved as a quality control mechanism to prevent ribosome readthrough into introns. In their scenario, the bacterial ancestor of mitochondria was resident in an archaeal cell, and group II introns (carried by the fledgling mitochondrion inserted into coding regions in the archaeal host genome. They suggest that if transcription and translation were coupled, and because splicing is expected to have been slower than translation, the effect of insertion would have been ribosome readthrough into introns, resulting in production of aberrant proteins. The emergence of the nuclear compartment would thus have served to separate transcription and splicing from translation, thereby alleviating this problem. In this article, I argue that Martin & Koonin's model is not compatible with current knowledge. The model requires that group II introns would spread aggressively through an archaeal genome. It is well known that selfish elements can spread through an outbreeding sexual population despite a substantial fitness cost to the host. The same is not true for asexual lineages however, where both theory and observation argue that such elements will be under pressure to reduce proliferation, and may be lost completely. The recent introduction of group II introns into archaea by horizontal transfer provides a natural test case with which to evaluate Martin & Koonin's model. The distribution and behaviour of these introns fits prior theoretical expectations, not the scenario of aggressive proliferation advocated by Martin & Koonin. I therefore conclude that the mitochondrial seed hypothesis for the origin of eukaryote introns, on which their model is based, better explains the early expansion of introns in eukaryotes. The mitochondrial seed hypothesis has the capacity to separate the origin of eukaryotes from the origin of introns, leaving open the possibility that the cell that engulfed the

  20. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1992-01-01

    . In an analysis of vegetatively growing cells containing intron+ and intron- rDNA, initially in the same macronucleus, we similarly find no evidence of intron homing. During the course of this work, we observed to our surprise that progeny clones from some crosses contained three types of rDNA. One possible...... explanation is that T. pigmentosa has two rdn loci in contrast to the single locus found in T. thermophila. Some of the progeny clones from the genetic analysis were expanded for several hundred generations, and allelic assortment of the rDNA was demonstrated by subcloning analysis....

  1. The Macronuclear Genome of Stentor coeruleus Reveals Tiny Introns in a Giant Cell.

    Science.gov (United States)

    Slabodnick, Mark M; Ruby, J Graham; Reiff, Sarah B; Swart, Estienne C; Gosai, Sager; Prabakaran, Sudhakaran; Witkowska, Ewa; Larue, Graham E; Fisher, Susan; Freeman, Robert M; Gunawardena, Jeremy; Chu, William; Stover, Naomi A; Gregory, Brian D; Nowacki, Mariusz; Derisi, Joseph; Roy, Scott W; Marshall, Wallace F; Sood, Pranidhi

    2017-02-20

    The giant, single-celled organism Stentor coeruleus has a long history as a model system for studying pattern formation and regeneration in single cells. Stentor [1, 2] is a heterotrichous ciliate distantly related to familiar ciliate models, such as Tetrahymena or Paramecium. The primary distinguishing feature of Stentor is its incredible size: a single cell is 1 mm long. Early developmental biologists, including T.H. Morgan [3], were attracted to the system because of its regenerative abilities-if large portions of a cell are surgically removed, the remnant reorganizes into a normal-looking but smaller cell with correct proportionality [2, 3]. These biologists were also drawn to Stentor because it exhibits a rich repertoire of behaviors, including light avoidance, mechanosensitive contraction, food selection, and even the ability to habituate to touch, a simple form of learning usually seen in higher organisms [4]. While early microsurgical approaches demonstrated a startling array of regenerative and morphogenetic processes in this single-celled organism, Stentor was never developed as a molecular model system. We report the sequencing of the Stentor coeruleus macronuclear genome and reveal key features of the genome. First, we find that Stentor uses the standard genetic code, suggesting that ciliate-specific genetic codes arose after Stentor branched from other ciliates. We also discover that ploidy correlates with Stentor's cell size. Finally, in the Stentor genome, we discover the smallest spliceosomal introns reported for any species. The sequenced genome opens the door to molecular analysis of single-cell regeneration in Stentor. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Mitochondrial large ribosomal subunit sequences are homogeneous within isolates of Glomus (arbuscular mycorrhizal fungi, Glomeromycota).

    Science.gov (United States)

    Raab, Philipp A; Brennwald, Annemarie; Redecker, Dirk

    2005-12-01

    Partial sequences of the mtLSU rDNA were obtained from the arbuscular mycorrhizal (AM) fungi Glomus proliferum (isolate DAOM 226389) and G. intraradices (isolates JJ291 and BEG75). The exon sequences of the two species showed regions of strong divergence. There was no evidence of intra-isolate sequence heterogeneity as it is found in variable regions of nuclear ribosomal genes of Glomeromycota. In G. intraradices JJ291, two introns were found in the partial LSU sequence. One of the introns contained an ORF for a putative site-specific homing endonuclease of the LAGLIDADG family. In G. intraradices BEG75, one of the introns was missing and the other had a DNA sequence distinct from JJ291. G. proliferum had no introns in the region sequenced. A PCR primer was designed to amplify the fragment of the mtLSU of a different, distinguishable G. intraradices genotype from colonized roots of a field sample. These mitochondrial gene sequences are the first reported from the phylum Glomeromycota. Our findings indicate that the intra-individual sequence heterogeneity of the Glomeromycota may be a peculiar feature of the nuclear genes. Therefore, mtLSU and its introns have the potential to be highly sensitive genetic markers for these fungi in the future.

  3. Recent mobility of plastid encoded group II introns and twintrons in five strains of the unicellular red alga Porphyridium

    Directory of Open Access Journals (Sweden)

    Marie-Mathilde Perrineau

    2015-06-01

    Full Text Available Group II introns are closely linked to eukaryote evolution because nuclear spliceosomal introns and the small RNAs associated with the spliceosome are thought to trace their ancient origins to these mobile elements. Therefore, elucidating how group II introns move, and how they lose mobility can potentially shed light on fundamental aspects of eukaryote biology. To this end, we studied five strains of the unicellular red alga Porphyridium purpureum that surprisingly contain 42 group II introns in their plastid genomes. We focused on a subset of these introns that encode mobility-conferring intron-encoded proteins (IEPs and found them to be distributed among the strains in a lineage-specific manner. The reverse transcriptase and maturase domains were present in all lineages but the DNA endonuclease domain was deleted in vertically inherited introns, demonstrating a key step in the loss of mobility. P. purpureum plastid intron RNAs had a classic group IIB secondary structure despite variability in the DIII and DVI domains. We report for the first time the presence of twintrons (introns-within-introns, derived from the same mobile element in Rhodophyta. The P. purpureum IEPs and their mobile introns provide a valuable model for the study of mobile retroelements in eukaryotes and offer promise for biotechnological applications.

  4. Recent mobility of plastid encoded group II introns and twintrons in five strains of the unicellular red alga Porphyridium.

    Science.gov (United States)

    Perrineau, Marie-Mathilde; Price, Dana C; Mohr, Georg; Bhattacharya, Debashish

    2015-01-01

    Group II introns are closely linked to eukaryote evolution because nuclear spliceosomal introns and the small RNAs associated with the spliceosome are thought to trace their ancient origins to these mobile elements. Therefore, elucidating how group II introns move, and how they lose mobility can potentially shed light on fundamental aspects of eukaryote biology. To this end, we studied five strains of the unicellular red alga Porphyridium purpureum that surprisingly contain 42 group II introns in their plastid genomes. We focused on a subset of these introns that encode mobility-conferring intron-encoded proteins (IEPs) and found them to be distributed among the strains in a lineage-specific manner. The reverse transcriptase and maturase domains were present in all lineages but the DNA endonuclease domain was deleted in vertically inherited introns, demonstrating a key step in the loss of mobility. P. purpureum plastid intron RNAs had a classic group IIB secondary structure despite variability in the DIII and DVI domains. We report for the first time the presence of twintrons (introns-within-introns, derived from the same mobile element) in Rhodophyta. The P. purpureum IEPs and their mobile introns provide a valuable model for the study of mobile retroelements in eukaryotes and offer promise for biotechnological applications.

  5. Simultaneous detection of the exon 10 polymorphism and a novel intronic single base insertion polymorphism in the XPD gene using single strand conformation polymorphism.

    Science.gov (United States)

    Kumar, Rajiv; Angelini, Sabrina; Hemminki, Kari

    2003-03-01

    We developed a new method based on the single strand conformation polymorphism (SSCP) technique for the detection of a G23591A (Asp312Asn) polymorphism in exon 10 of the XPD gene. In the process we also identified a novel polymorphism 23623C-ins (IVS10+17C-ins) in intron 10 of the same gene. With this newly developed SSCP-based method of genotyping we could detect both polymorphisms in the same assay and thus consequently determine the haplotype. In order to determine the population frequency of the novel polymorphism and the haplotype frequency, 302 healthy individuals were genotyped. The allelic frequency of the 23623C-ins intronic polymorphism was 0.16, whereas the frequency of the variant allele for the G23591A polymorphism was 0.39. Forty-three individuals (14%) were heterozygous for both polymorphisms but none carried polymorphic variants for both G23591A and 23623C-ins on the same allele. The effect of the novel intronic insertion polymorphism, which is located 16 nt downstream of the 3'-end of exon 10 of the XPD gene and involves a mononucleotide C repeat sequence, on expression remains to be determined.

  6. Identification of a purine-rich intronic enhancer element in the mouse eosinophil-associated ribonuclease 2 (mEar 2) gene.

    Science.gov (United States)

    Dyer, Kimberly D; Nitto, Takeaki; Moreau, Joanne M; McDevitt, Amanda L; Rosenberg, Helene F

    2004-02-01

    The Mus musculus eosinophil-associated ribonuclease (mEar) gene cluster includes multiple distinct coding sequences that are highly divergent orthologs of the human eosinophil ribonucleases, eosinophil-derived neurotoxin (EDN/RNase 2) and eosinophil cationic protein (ECP/RNase 3). We present a transcriptional analysis of the gene encoding mEar 2, the only member of this cluster with a well-defined expression profile. In this work, we demonstrate that the presence of non-coding exon 1 and the intron in tandem with a 361-bp 5' promoter of mEar 2 results in enhanced reporter gene expression, as much as 6-to 10-fold over the activity observed with the 5' promoter alone. We have identified a conserved purine-rich element in the intron of the mEar 2 gene that is necessary for maximum transcription and that interacts specifically with NFAT-binding proteins in nuclear extracts derived from the mouse LA4 epithelial cell line. Similar intronic enhancers have been described as regulating transcription of the human EDN gene, suggesting an overall conservation of an important regulatory strategy.

  7. Bacterial group II introns in a deep-sea hydrothermal vent environment.

    Science.gov (United States)

    Podar, Mircea; Mullineaux, Lauren; Huang, Hon-Ren; Perlman, Philip S; Sogin, Mitchell L

    2002-12-01

    Group II introns are catalytic RNAs and mobile retrotransposable elements known to be present in the genomes of some nonmarine bacteria and eukaryotic organelles. Here we report the discovery of group II introns in a bacterial mat sample collected from a deep-sea hydrothermal vent near 9 degrees N on the East Pacific Rise. One of the introns was shown to self-splice in vitro. This is the first example of marine bacterial introns from molecular population structure studies of microorganisms that live in the proximity of hydrothermal vents. These types of mobile genetic elements may prove useful in improving our understanding of bacterial genome evolution and may serve as valuable markers in comparative studies of bacterial communities.

  8. Cotranscriptional splicing of a group I intron is facilitated by the Cbp2 protein

    Energy Technology Data Exchange (ETDEWEB)

    Lewin, A.S.; Thomas, J. Jr.; Tirupati, H.K. [Univ. of Florida College of Medicine, Gainesville, FL (United States)

    1995-12-01

    This report investigates the coupling between transcription and splicing of a mitochondrial group I intron in Saccharomyces cerevisiae and the effect of the Cbp2 protein on splicing. 65 refs., 7 figs.

  9. Effects of Antioxidants in Human Cancers: Differential Effects on Non-Coding Intronic RNA Expression

    Directory of Open Access Journals (Sweden)

    Shreya Menon

    2016-01-01

    Full Text Available The notion that dietary antioxidants can help fight cancer is popular. However, the mechanism(s behind the effect of antioxidants in cancer is still unclear. Previous studies indicate that supplements can influence gene expression; however, all of these studies were focused on the coding/exonic gene expression. Studies are now emerging to highlight critical functional roles for RNAs expressed from the non-coding regions. This project was designed to study the effect of antioxidant supplements on non-coding intronic RNA expression in human cancers. Vitamin E, N-Acetyl cysteine (NAC and Sulforaphane are commonly used supplements to prevent diseases including cancers. We studied the effect of these antioxidant supplements on the non-coding intronic RNA expression using publicly available datasets from a mouse model for lung cancer and prostate cancer cell lines. Although high throughput polyA-enriched RNA-Seq data characterize spliced coding mRNA regions, recent studies reveal the expression of reads from the non-coding intronic regions. Our analyses indicate that cancer cells have higher expression of introns compared to that of normal cells and that treatment with antioxidant supplements reduces the increased expression of introns of several genes. However, we did find high expression of introns of multiple genes including many oncogenes in the supplement treated groups compared to that of the control; this effect was distinct depending on the cell type and the supplement studied. Using RT-PCRs, we validated the expression of introns of two oncogenes, DLK1 and LRG1, known to be key players in lung cancer progression, and demonstrate changed intronic expression with supplement treatment in cancer cells. With regard to the antioxidant system, supplements did not change the intronic RNAs for endogenous antioxidant enzymes except for a significant decrease in the expression of superoxide dismutase (SOD intronic RNA. Concurrently, we also found that a

  10. Asthma and COPD in cystic fibrosis intron-8 5T carriers. A population-based study

    DEFF Research Database (Denmark)

    Dahl, Morten; Tybjaerg-Hansen, Anne; Lange, Peter;

    2005-01-01

    Carriers of cystic fibrosis intron-8 5T alleles with high exon-9 skipping could have increased annual lung function decline and increased risk for asthma or chronic obstructive pulmonary disease (COPD).......Carriers of cystic fibrosis intron-8 5T alleles with high exon-9 skipping could have increased annual lung function decline and increased risk for asthma or chronic obstructive pulmonary disease (COPD)....

  11. Discovery and analysis of evolutionarily conserved intronic splicing regulatory elements.

    Directory of Open Access Journals (Sweden)

    Gene W Yeo

    2007-05-01

    Full Text Available Knowledge of the functional cis-regulatory elements that regulate constitutive and alternative pre-mRNA splicing is fundamental for biology and medicine. Here we undertook a genome-wide comparative genomics approach using available mammalian genomes to identify conserved intronic splicing regulatory elements (ISREs. Our approach yielded 314 ISREs, and insertions of ~70 ISREs between competing splice sites demonstrated that 84% of ISREs altered 5' and 94% altered 3' splice site choice in human cells. Consistent with our experiments, comparisons of ISREs to known splicing regulatory elements revealed that 40%-45% of ISREs might have dual roles as exonic splicing silencers. Supporting a role for ISREs in alternative splicing, we found that 30%-50% of ISREs were enriched near alternatively spliced (AS exons, and included almost all known binding sites of tissue-specific alternative splicing factors. Further, we observed that genes harboring ISRE-proximal exons have biases for tissue expression and molecular functions that are ISRE-specific. Finally, we discovered that for Nova1, neuronal PTB, hnRNP C, and FOX1, the most frequently occurring ISRE proximal to an alternative conserved exon in the splicing factor strongly resembled its own known RNA binding site, suggesting a novel application of ISRE density and the propensity for splicing factors to auto-regulate to associate RNA binding sites to splicing factors. Our results demonstrate that ISREs are crucial building blocks in understanding general and tissue-specific AS regulation and the biological pathways and functions regulated by these AS events.

  12. Intron definition and a branch site adenosine at nt 385 control RNA splicing of HPV16 E6*I and E7 expression.

    Science.gov (United States)

    Ajiro, Masahiko; Jia, Rong; Zhang, Lifang; Liu, Xuefeng; Zheng, Zhi-Ming

    2012-01-01

    HPV16 E6 and E7, two viral oncogenes, are expressed from a single bicistronic pre-mRNA. In this report, we provide the evidence that the bicistronic pre-mRNA intron 1 contains three 5' splice sites (5' ss) and three 3' splice sites (3' ss) normally used in HPV16(+) cervical cancer and its derived cell lines. The choice of two novel alternative 5' ss (nt 221 5' ss and nt 191 5' ss) produces two novel isoforms of E6E7 mRNAs (E6*V and E6*VI). The nt 226 5' ss and nt 409 3' ss is preferentially selected over the other splice sites crossing over the intron to excise a minimal length of the intron in RNA splicing. We identified AACAAAC as the preferred branch point sequence (BPS) and an adenosine at nt 385 (underlined) in the BPS as a branch site to dictate the selection of the nt 409 3' ss for E6*I splicing and E7 expression. Introduction of point mutations into the mapped BPS led to reduced U2 binding to the BPS and thereby inhibition of the second step of E6E7 splicing at the nt 409 3' ss. Importantly, the E6E7 bicistronic RNA with a mutant BPS and inefficient splicing makes little or no E7 and the resulted E6 with mutations of (91)QYNK(94) to (91)PSFW(94) displays attenuate activity on p53 degradation. Together, our data provide structural basis of the E6E7 intron 1 for better understanding of how viral E6 and E7 expression is regulated by alternative RNA splicing. This study elucidates for the first time a mapped branch point in HPV16 genome involved in viral oncogene expression.

  13. Intron definition and a branch site adenosine at nt 385 control RNA splicing of HPV16 E6*I and E7 expression.

    Directory of Open Access Journals (Sweden)

    Masahiko Ajiro

    Full Text Available HPV16 E6 and E7, two viral oncogenes, are expressed from a single bicistronic pre-mRNA. In this report, we provide the evidence that the bicistronic pre-mRNA intron 1 contains three 5' splice sites (5' ss and three 3' splice sites (3' ss normally used in HPV16(+ cervical cancer and its derived cell lines. The choice of two novel alternative 5' ss (nt 221 5' ss and nt 191 5' ss produces two novel isoforms of E6E7 mRNAs (E6*V and E6*VI. The nt 226 5' ss and nt 409 3' ss is preferentially selected over the other splice sites crossing over the intron to excise a minimal length of the intron in RNA splicing. We identified AACAAAC as the preferred branch point sequence (BPS and an adenosine at nt 385 (underlined in the BPS as a branch site to dictate the selection of the nt 409 3' ss for E6*I splicing and E7 expression. Introduction of point mutations into the mapped BPS led to reduced U2 binding to the BPS and thereby inhibition of the second step of E6E7 splicing at the nt 409 3' ss. Importantly, the E6E7 bicistronic RNA with a mutant BPS and inefficient splicing makes little or no E7 and the resulted E6 with mutations of (91QYNK(94 to (91PSFW(94 displays attenuate activity on p53 degradation. Together, our data provide structural basis of the E6E7 intron 1 for better understanding of how viral E6 and E7 expression is regulated by alternative RNA splicing. This study elucidates for the first time a mapped branch point in HPV16 genome involved in viral oncogene expression.

  14. Multilocus Intron Trees Reveal Extensive Male-Biased Homogenization of Ancient Populations of Chamois (Rupicapra spp.) across Europe during Late Pleistocene.

    Science.gov (United States)

    Pérez, Trinidad; Fernández, Margarita; Hammer, Sabine E; Domínguez, Ana

    2017-01-01

    The inferred phylogenetic relationships between organisms often depend on the molecular marker studied due to the diverse evolutionary mode and unlike evolutionary histories of different parts of the genome. Previous studies have shown conflicting patterns of differentiation of mtDNA and several nuclear markers in chamois (genus Rupicapra) that indicate a complex evolutionary picture. Chamois are mountain caprine that inhabit most of the medium to high altitude mountain ranges of southern Eurasia. The most accepted taxonomical classification considers two species, R. pyrenaica (with the subspecies parva, pyrenaica and ornata) from southwestern Europe and R. rupicapra (with the subspecies cartusiana, rupicapra, tatrica, carpatica, balcanica, asiatica and caucasica) from northeastern Europe. Phylogenies of mtDNA revealed three very old clades (from the early Pleistocene, 1.9 Mya) with a clear geographical signal. Here we analyze a set of 23 autosomal introns, comprising 15,411 nucleotides, in 14 individuals covering the 10 chamois subspecies. Introns offered an evolutionary scenario that contrasts with mtDNA. The nucleotidic diversity was 0.0013± 0.0002, at the low range of what is found in other mammals even if a single species is considered. A coalescent multilocus analysis with *BEAST indicated that introns diversified 88 Kya, in the late Pleistocene, and the effective population size at the root was lower than 10,000 individuals. The dispersal of some few migrant males should have rapidly spread trough the populations of chamois, given the homogeneity of intron sequences. The striking differences between mitochondrial and nuclear markers can be attributed to strong female philopatry and extensive male dispersal. Our results highlight the need of analyzing multiple and varied genome components to capture the complex evolutionary history of organisms.

  15. Multi-species comparative analysis of the equine ACE gene identifies a highly conserved potential transcription factor binding site in intron 16.

    Directory of Open Access Journals (Sweden)

    Natasha A Hamilton

    Full Text Available Angiotensin converting enzyme (ACE is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism.

  16. SR proteins Asf/SF2 and 9G8 interact to activate enhancer-dependent intron D splicing of bovine growth hormone pre-mRNA in vitro.

    Science.gov (United States)

    Li, X; Shambaugh, M E; Rottman, F M; Bokar, J A

    2000-01-01

    The alternative splicing of the last intron (intron D) of bovine growth hormone (bGH) pre-mRNA requires a down-stream exonic splicing enhancer (FP/ESE). The presence of at least one SR protein has been shown to be essential for FP/ESE function and splicing of intron D in in vitro splicing assays. However, in vitro reconstitution of splicing using individual purified SR proteins may not accurately reflect the true complexity of alternative splicing in an intact nucleus, where multiple SR proteins in varying amounts are likely to be available simultaneously. Here, a panel of recombinant baculovirus-expressed SR proteins was produced and tested for the ability to activate FP/ESE-dependent splicing. Individual recombinant SR proteins differed significantly in their activity in promoting intron D splicing. Among the recombinant SR proteins tested, SRp55 was the most active, SC35 showed very little activity, and ASF/SF2 and 9G8 individually had intermediate activity. At least one SR protein (ASF/SF2) bound to the FP/ESE with characteristics of a cooperative interaction. Most interestingly, low concentrations of ASF/SF2 and 9G8 acted synergistically to activate intron D splicing. This was due in part to synergistic binding to the FP/ESE. Splicing of bGH intron D is inherently complex, and is likely controlled by an interaction of the FP/ESE with several trans-acting protein factors acting both independently and cooperatively. This level of complexity may be required for precise control of alternative splicing by an exon sequence, which simultaneously is constrained to maintain translational integrity of the mature mRNA. PMID:11142383

  17. Trichinella pseudospiralis vs. T. spiralis thymidylate synthase gene structure and T. pseudospiralis thymidylate synthase retrogene sequence.

    Science.gov (United States)

    Jagielska, Elżbieta; Płucienniczak, Andrzej; Dąbrowska, Magdalena; Dowierciał, Anna; Rode, Wojciech

    2014-04-09

    Thymidylate synthase is a housekeeping gene, designated ancient due to its role in DNA synthesis and ubiquitous phyletic distribution. The genomic sequences were characterized coding for thymidylate synthase in two species of the genus Trichinella, an encapsulating T. spiralis and a non-encapsulating T. pseudospiralis. Based on the sequence of parasitic nematode Trichinella spiralis thymidylate synthase cDNA, PCR techniques were employed. Each of the respective gene structures encompassed 6 exons and 5 introns located in conserved sites. Comparison with the corresponding gene structures of other eukaryotic species revealed lack of common introns that would be shared among selected fungi, nematodes, mammals and plants. The two deduced amino acid sequences were 96% identical. In addition to the thymidylate synthase gene, the intron-less retrocopy, i.e. a processed pseudogene, with sequence identical to the T. spiralis gene coding region, was found to be present within the T. pseudospiralis genome. This pseudogene, instead of the gene, was confirmed by RT-PCR to be expressed in the parasite muscle larvae. Intron load, as well as distribution of exon and intron phases in thymidylate synthase genes from various sources, point against the theory of gene assembly by the primordial exon shuffling and support the theory of evolutionary late intron insertion into spliceosomal genes. Thymidylate synthase pseudogene expressed in T. pseudospiralis muscle larvae is designated a retrogene.

  18. The molecular evolution and structural organization of self-splicing group I introns at position 516 in nuclear SSU rDNA of myxomycetes.

    Science.gov (United States)

    Haugen, Peik; Coucheron, Dag H; Rønning, Sissel B; Haugli, Kari; Johansen, Steinar

    2003-01-01

    Group I introns are relatively common within nuclear ribosomal DNA of eukaryotic microorganisms, especially in myxomycetes. Introns at position S516 in the small subunit ribosomal RNA gene are particularly common, but have a sporadic occurrence in myxomycetes. Fuligo septica, Badhamia gracilis, and Physarum flavicomum, all members of the family Physaraceae, contain related group IC1 introns at this site. The F. septica intron was studied at the molecular level and found to self-splice as naked RNA and to generate full-length intron RNA circles during incubation. Group I introns at position S516 appear to have a particularly widespread distribution among protists and fungi. Secondary structural analysis of more than 140 S516 group I introns available in the database revealed five different types of organization, including IC1 introns with and without His-Cys homing endonuclease genes, complex twin-ribozyme introns, IE introns, and degenerate group I-like introns. Both intron structural and phylogenetic analyses indicate a multiple origin of the S516 introns during evolution. The myxomycete introns are related to S516 introns in the more distantly related brown algae and Acanthamoeba species. Possible mechanisms of intron transfer both at the RNA- and DNA-levels are discussed in order to explain the observed widespread, but scattered, phylogenetic distribution.

  19. The CFTR M470V, Intron 8 Poly-T, and 8 TG-Repeats Detection in Chinese Males with Congenital Bilateral Absence of the Vas Deferens

    Directory of Open Access Journals (Sweden)

    Qiang Du

    2014-01-01

    Full Text Available Purpose. To evaluate the significance of molecular detection of cystic fibrosis transmembrane conductance regulator (CFTR M470V, intron 8 poly-T, and intron 8 TG-repeats in congenital bilateral absence of the vas deferens (CBAVD. Methods. Eighty-nine male patients with CBAVD and 103 healthy males were included in this study. Polymerase chain reaction was performed to amplify the polymorphic regions using primers from conserved regions. M470V was genotyped using real-time PCR by cycling probe. The exon 9 DNA sequence was determined using an automated sequencer. TG-repeats and poly-T were identified by direct sequencing analysis. Results. The 5T allele distribution was 0.32, 0.66 for 7T, and 0.02 for 9T in CBAVD males, respectively. In contrast, the 5T allele distribution was 0.03, 0.96 for 7T, and 0.01 for 9T in healthy control. Study of the polymorphisms of the upstream of exon 9 revealed a higher frequency of 5T allele in the CBAVD males. All cases with TG13T5 haplotype and TG12T5 homozygous led to CBAVD. The CFTR TG12T5-V470 variant haplotype was associated with CBAVD. Conclusion. The 5T allele of intron 8 of CFTR has clinically significant association with CBAVD. TG13T5 and TG12T5 homozygously led to CBAVD, and TG12T5-V470 may also lead to CBAVD.

  20. Sequence Classification: 890678 [

    Lifescience Database Archive (English)

    Full Text Available DNA endonuclease, encoded by the mitochondrial group I intron of the 21S_rRNA gene; mediates gene conversion that propagates the int...ron into intron-less copies of the 21S_rRNA gene; Sceip || http://www.ncbi.nlm.nih.gov/protein/6226538 ...

  1. Assessment of allelic diversity in intron-containing Mal d 1 genes and their association to apple allergenicity

    Directory of Open Access Journals (Sweden)

    Bolhaar Suzanne THP

    2008-11-01

    Full Text Available Abstract Background Mal d 1 is a major apple allergen causing food allergic symptoms of the oral allergy syndrome (OAS in birch-pollen sensitised patients. The Mal d 1 gene family is known to have at least 7 intron-containing and 11 intronless members that have been mapped in clusters on three linkage groups. In this study, the allelic diversity of the seven intron-containing Mal d 1 genes was assessed among a set of apple cultivars by sequencing or indirectly through pedigree genotyping. Protein variant constitutions were subsequently compared with Skin Prick Test (SPT responses to study the association of deduced protein variants with allergenicity in a set of 14 cultivars. Results From the seven intron-containing Mal d 1 genes investigated, Mal d 1.01 and Mal d 1.02 were highly conserved, as nine out of ten cultivars coded for the same protein variant, while only one cultivar coded for a second variant. Mal d 1.04, Mal d 1.05 and Mal d 1.06 A, B and C were more variable, coding for three to six different protein variants. Comparison of Mal d 1 allelic composition between the high-allergenic cultivar Golden Delicious and the low-allergenic cultivars Santana and Priscilla, which are linked in pedigree, showed an association between the protein variants coded by the Mal d 1.04 and -1.06A genes (both located on linkage group 16 with allergenicity. This association was confirmed in 10 other cultivars. In addition, Mal d 1.06A allele dosage effects associated with the degree of allergenicity based on prick to prick testing. Conversely, no associations were observed for the protein variants coded by the Mal d 1.01 (on linkage group 13, -1.02, -1.06B, -1.06C genes (all on linkage group 16, nor by the Mal d 1.05 gene (on linkage group 6. Conclusion Protein variant compositions of Mal d 1.04 and -1.06A and, in case of Mal d 1.06A, allele doses are associated with the differences in allergenicity among fourteen apple cultivars. This information

  2. An ancient repeat sequence in the ATP synthase beta-subunit gene of forcipulate sea stars.

    Science.gov (United States)

    Foltz, David W

    2007-11-01

    A novel repeat sequence with a conserved secondary structure is described from two nonadjacent introns of the ATP synthase beta-subunit gene in sea stars of the order Forcipulatida (Echinodermata: Asteroidea). The repeat is present in both introns of all forcipulate sea stars examined, which suggests that it is an ancient feature of this gene (with an approximate age of 200 Mya). Both stem and loop regions show high levels of sequence constraint when compared to flanking nonrepetitive intronic regions. The repeat was also detected in (1) the family Pterasteridae, order Velatida and (2) the family Korethrasteridae, order Velatida. The repeat was not detected in (1) the family Echinasteridae, order Spinulosida, (2) the family Astropectinidae, order Paxillosida, (3) the family Solasteridae, order Velatida, or (4) the family Goniasteridae, order Valvatida. The repeat lacks similarity to published sequences in unrestricted GenBank searches, and there are no significant open reading frames in the repeat or in the flanking intron sequences. Comparison via parametric bootstrapping to a published phylogeny based on 4.2 kb of nuclear and mitochondrial sequence for a subset of these species allowed the null hypothesis of a congruent phylogeny to be rejected for each repeat, when compared separately to the published phylogeny. In contrast, the flanking nonrepetitive sequences in each intron yielded separate phylogenies that were each congruent with the published phylogeny. In four species, the repeat in one or both introns has apparently experienced gene conversion. The two introns also show a correlated pattern of nucleotide substitutions, even after excluding the putative cases of gene conversion.

  3. Evidence against the energetic cost hypothesis for the short introns in highly expressed genes

    Directory of Open Access Journals (Sweden)

    Niu Deng-Ke

    2008-05-01

    Full Text Available Abstract Background In animals, the moss Physcomitrella patens and the pollen of Arabidopsis thaliana, highly expressed genes have shorter introns than weakly expressed genes. A popular explanation for this is selection for transcription efficiency, which includes two sub-hypotheses: to minimize the energetic cost or to minimize the time cost. Results In an individual human, different organs may differ up to hundreds of times in cell number (for example, a liver versus a hypothalamus. Considered at the individual level, a gene specifically expressed in a large organ is actually transcribed tens or hundreds of times more than a gene with a similar expression level (a measure of mRNA abundance per cell specifically expressed in a small organ. According to the energetic cost hypothesis, the former should have shorter introns than the latter. However, in humans and mice we have not found significant differences in intron length between large-tissue/organ-specific genes and small-tissue/organ-specific genes with similar expression levels. Qualitative estimation shows that the deleterious effect (that is, the energetic burden of long introns in highly expressed genes is too negligible to be efficiently selected against in mammals. Conclusion The short introns in highly expressed genes should not be attributed to energy constraint. We evaluated evidence for the time cost hypothesis and other alternatives.

  4. Evolution of red algal plastid genomes: ancient architectures, introns, horizontal gene transfer, and taxonomic utility of plastid markers.

    Directory of Open Access Journals (Sweden)

    Jan Janouškovec

    Full Text Available Red algae have the most gene-rich plastid genomes known, but despite their evolutionary importance these genomes remain poorly sampled. Here we characterize three complete and one partial plastid genome from a diverse range of florideophytes. By unifying annotations across all available red algal plastid genomes we show they all share a highly compact and slowly-evolving architecture and uniquely rich gene complements. Both chromosome structure and gene content have changed very little during red algal diversification, and suggest that plastid-to nucleus gene transfers have been rare. Despite their ancient character, however, the red algal plastids also contain several unprecedented features, including a group II intron in a tRNA-Met gene that encodes the first example of red algal plastid intron maturase - a feature uniquely shared among florideophytes. We also identify a rare case of a horizontally-acquired proteobacterial operon, and propose this operon may have been recruited for plastid function and potentially replaced a nucleus-encoded plastid-targeted paralogue. Plastid genome phylogenies yield a fully resolved tree and suggest that plastid DNA is a useful tool for resolving red algal relationships. Lastly, we estimate the evolutionary rates among more than 200 plastid genes, and assess their usefulness for species and subspecies taxonomy by comparison to well-established barcoding markers such as cox1 and rbcL. Overall, these data demonstrates that red algal plastid genomes are easily obtainable using high-throughput sequencing of total genomic DNA, interesting from evolutionary perspectives, and promising in resolving red algal relationships at evolutionarily-deep and species/subspecies levels.

  5. Insertion of part of an intron into the 5[prime] untranslated region of a Caenorhabditis elegans gene converts it into a trans-spliced gene

    Energy Technology Data Exchange (ETDEWEB)

    Conrad, R.; Thomas, J.; Spieth, J.; Blumenthal, T. (Indiana University, Bloomington (United States))

    1991-04-01

    In nematodes, the RNA products of some genes are trans-spliced to a 22-nucleotide spliced leader (SL), while the RNA products of other genes are not. In Caenorhabditis elegans, there are two SLs, Sl1 and SL2, donated by two distinct small nuclear ribonucleoprotein particles in a process functionally quite similar to nuclear intron removal. The authors demonstrate here that it is possible to convert a non-trans-spliced gene into a trans-spliced gene by placement of an intron missing only the 5[prime] splice site into the 5[prime] untranslated region. Stable transgenic strains were isolated expressing a gene in which 69 nucleotides of a vit-5 intron, including the 3[prime] splice site, were inserted into the 5[prime] untranslated region of a vit-2/vit-6 fusion gene. The RNA product of this gene was examined by primer extension and PCR amplification. Although the vit-2/vit-6 transgene product is not normally trans-spliced, the majority of transcripts from this altered gene were trans-spliced to SL1. They termed the region of a trans-spliced mRNA precursor between the 5[prime] end and the first 3[prime] splice site an 'outrun'. The results suggest that if a transcript begins with intronlike sequence followed by a 3[prime] splice site, this alone may constitute an outrun and be sufficient to demarcate a transcript as a trans-splice acceptor. These findings leave open the possibility that specific sequences are required to increase the efficiency of trans-splicing.

  6. Exon-primed intron-crossing (EPIC markers as a tool for ant phylogeography

    Directory of Open Access Journals (Sweden)

    Patrícia R. Ströher

    2013-12-01

    Full Text Available Exon-primed intron-crossing (EPIC markers as a tool for ant phylogeography. Due to their local abundance, diversity of adaptations and worldwide distribution, ants are a classic example of adaptive radiation. Despite this evolutionary and ecological importance, phylogeographical studies on ants have relied largely on mitochondrial markers. In this study we design and test exon-primed intron-crossing (EPIC markers, which can be widely used to uncover ant intraspecific variation. Candidate markers were obtained through screening the available ant genomes for unlinked conserved exonic regions interspersed with introns. A subset of 15 markers was tested in vitro and showed successful amplification in several phylogenetically distant ant species. These markers represent an important step forward in ant phylogeography and population genetics, allowing for more extensive characterization of variation in ant nuclear DNA without the need to develop species-specific markers.

  7. The strength of intron donor splice sites in human genes displays a bell-shaped pattern

    DEFF Research Database (Denmark)

    Wang, Kai; Wernersson, Rasmus; Brunak, Søren

    2011-01-01

    MOTIVATION: The gene concept has recently changed from the classical one protein notion into a much more diverse picture, where overlapping or fused transcripts, alternative transcription initiation, and genes within genes, add to the complexity generated by alternative splicing. Increased...... understanding of the mechanisms controlling pre-mRNA splicing is thus important for a wide range of aspects relating to gene expression. RESULTS: We have discovered a convex gene delineating pattern in the strength of 5' intron splice sites. When comparing the strengths of >18 000 intron containing Human genes......, we found that when analysing them separately according to the number of introns they contain, initial splice sites were always stronger on average than subsequent ones, and that a similar reversed trend exist towards the terminal gene part. The convex pattern is strongest for genes with up to 10...

  8. In vivo expression of the nucleolar group I intron-encoded I-dirI homing endonuclease involves the removal of a spliceosomal intron

    DEFF Research Database (Denmark)

    Vader, A; Nielsen, Henrik; Johansen, S

    1999-01-01

    ) is inserted in DiGIR2, carries out hydrolysis at internal processing sites (IPS1 and IPS2) located at its 3' end. Examination of the in vivo expression of DiSSU1 shows that after excision, DiSSU1 is matured further into the I-DirI mRNA by internal DiGIR1-catalysed cleavage upstream of the ORF 5' end, as well......The Didymium iridis DiSSU1 intron is located in the nuclear SSU rDNA and has an unusual twin-ribozyme organization. One of the ribozymes (DiGIR2) catalyses intron excision and exon ligation. The other ribozyme (DiGIR1), which along with the endonuclease-encoding I-DirI open reading frame (ORF...

  9. Novel RNA structural features of an alternatively splicing group II intron from Clostridium tetani.

    Science.gov (United States)

    McNeil, Bonnie A; Zimmerly, Steven

    2014-06-01

    Group II introns are ribozymes in bacterial and organellar genomes that function as self-splicing introns and as retroelements. Previously, we reported that the group II intron C.te.I1 of Clostridium tetani alternatively splices in vivo to produce five distinct coding mRNAs. Accurate fusion of upstream and downstream reading frames requires a shifted 5' splice site located 8 nt upstream of the usual 5' GUGYG motif. This site is specified by the ribozyme through an altered intron/exon-binding site 1 (IBS1-EBS1) pairing. Here we use mutagenesis and self-splicing assays to investigate in more detail the significance of the structural features of the C.te.I1 ribozyme. The shifted 5' splice site is shown to be affected by structures in addition to IBS1-EBS1, and unlike other group II introns, C.te.I1 appears to require a spacer between IBS1 and the GUGYG motif. In addition, the mechanism of 3' exon recognition is modified from the ancestral IIB mechanism to a IIA-like mechanism that appears to be longer than the typical single base-pair interaction and may extend up to 4 bp. The novel ribozyme properties that have evolved for C.te.I1 illustrate the plasticity of group II introns in adapting new structural and catalytic properties that can be utilized to affect gene expression. © 2014 McNeil and Zimmerly; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  10. Exon-Primed Intron-Crossing (EPIC Markers for Evolutionary Studies of Ficus and Other Taxa in the Fig Family (Moraceae

    Directory of Open Access Journals (Sweden)

    Xiaohong Yao

    2013-10-01

    Full Text Available Premise of the study: The genus Ficus (fig trees comprises ca. 750 species of trees, vines, and stranglers found in tropical forests throughout the world. Fig trees are keystone species in many tropical forests, and their relationship with host-specific wasp pollinators has received much attention, although many questions remain unresolved regarding the levels of host specificity, cospeciation, and the role of hybridization in fig and wasp speciation. We developed exon-primed intron-crossing (EPIC markers to obtain phylogenetic resolution needed to address these questions. Methods and Results: Expressed sequence tags (ESTs from F. elastica were compared to Arabidopsis and Populus genomes to locate introns and to design primers in flanking exons. Primer pairs for 80 EPIC markers were tested in samples from divergent clades within Ficus and the outgroup Poulsenia (Moraceae. Conclusions: Thirty-one EPIC markers were successfully sequenced across Ficus, and 29 of the markers also amplified in Poulsenia, indicating broad transferability within Moraceae. All of the EPIC markers were polymorphic and showed levels of polymorphism similar to that of the widely used internal transcribed spacer (ITS.

  11. Small RNA profiling of Xenopus embryos reveals novel miRNAs and a new class of small RNAs derived from intronic transposable elements.

    Science.gov (United States)

    Harding, Joanne L; Horswell, Stuart; Heliot, Claire; Armisen, Javier; Zimmerman, Lyle B; Luscombe, Nicholas M; Miska, Eric A; Hill, Caroline S

    2014-01-01

    Small RNA control of gene expression is critical for developmental processes in vertebrate embryos. To determine the dynamics of small RNA expression and to uncover novel small RNAs in the early vertebrate embryo, we performed high-throughput sequencing of all small RNAs in Xenopus tropicalis embryos at three developmental time points and in dissected halves of gastrula embryos. This analysis allowed us to identify novel microRNAs and we show that microRNA expression is highly dynamic and spatially localized in early embryos. In addition, we have developed a microRNA prediction pipeline and demonstrate that it has the power to predict new miRNAs that are experimentally detectable in frogs, mice, and humans. By combining the small RNA sequencing with mRNA profiling at the different developmental stages, we identify a new class of small noncoding RNAs that we name siteRNAs, which align in clusters to introns of protein-coding genes. We show that siteRNAs are derived from remnants of transposable elements present in the introns. We find that genes containing clusters of siteRNAs are transcriptionally repressed as compared with all genes. Furthermore, we show that this is true for individual genes containing siteRNA clusters, and that these genes are enriched in specific repressive histone modifications. Our data thus suggest a new mechanism of siteRNA-mediated gene silencing in vertebrates, and provide an example of how mobile elements can affect gene regulation.

  12. Use of an intron length polymorphism to localize the tropoelastin gene to mouse Chromosome 5 in a region of linkage conservation with human Chromosome 7

    Energy Technology Data Exchange (ETDEWEB)

    Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Sechler, J.L.; Boyd, C.D. [UMDNJ-Robert Wood Johnson Medical School, New Brunswick, NJ (United States)

    1994-09-01

    The complete coding sequence for mouse tropoelastin was obtained from overlapping reverse transcriptase polymerase chain reaction (PCR) amplimers. These cDNA fragments were derived from mouse tropoelastin mRNA using PCR oligomers complementary to conserved domains within rat tropoelastin mRNA. A comparison of coding domains of mouse and rat tropoelastin mRNA revealed a greater than 93% homology at the nucleotide level and over 96% similarity in the predicted amino acid sequence. PCR primers complementary to regions of the mouse tropoelastin mRNA were used to define a novel intron length polymorphism (ILP) within intron 8 of the mouse tropoelastin gene (Eln). This ILP proved to be informative in an intraspecific backcross in which genomic DNA samples from 75 backcross mice were used to map the tropoelastin gene to a position in the distal half of mouse chromosome 5. The linkage and genetic distances between Eln and the closest molecular markers used in this study are centromere-D5Mit95, D5Mit96-6.7 cM-Gus, Eln-4.0 cM-Zp3-telomere.

  13. An intronic microRNA silences genes that are functionally antagonistic to its host gene

    OpenAIRE

    Barik, Sailen

    2008-01-01

    MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of ‘host’ genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products ar...

  14. Hsp27gene in Drosophila ananassae subgroup was split by a recently acquired intron

    Indian Academy of Sciences (India)

    LI ZHANG; HAN KANG; SHAN JIN; QING TAO ZENG; YONG YANG

    2016-06-01

    InDrosophila , heat shock protein 27 (Hsp27) is a critical single-copy intron-free nuclear gene involved in the defense responseagainst fungi and bacteria, and is a regulator of adult lifespan. In the present study, 33 homologousHsp27nucleotide sequencesfrom differentDrosophilaspecies were amplified by PCR and reverse transcription PCR, and the phylogenetic relationshipswere analysed using neighbour-joining, maximum-likelihood and Bayesian methods. The phylogenetic topologies from anal-ysis with different algorithms were similar, suggesting that theHsp27gene was split by a recently acquired intron during theevolution of theDrosophila ananassaesubgroup

  15. Mobile group II intron based gene targeting in Lactobacillus plantarum WCFS1.

    Science.gov (United States)

    Sasikumar, Ponnusamy; Paul, Eldho; Gomathi, Sivasamy; Abhishek, Albert; Sasikumar, Sundaresan; Selvam, Govindan Sadasivam

    2016-10-01

    The usage of recombinant lactic acid bacteria for delivery of therapeutic proteins to the mucosa has been emerging. In the present study, an attempt was made to engineer a thyA mutant of Lactobacillus plantarum (L. plantarum) using lactococcal group II intron Ll.LtrB for the development of biologically contained recombinant L. plantarum for prevention of calcium oxalate stone disease. The 3 kb Ll.LtrB intron donor cassettes from the source vector pACD4C was PCR amplified, ligated into pSIP series of lactobacillus vector pLp_3050sAmyA, yielding a novel vector pLpACD4C (8.6 kb). The quantitative real-time PCR experiment shows 94-fold increased expression of Ll.LtrB intron and 14-fold increased expression of ltrA gene in recombinant L. plantarum containing pLpACD4C. In order to target the thyA gene, the potential intron RNA binding sites in the thyA gene of L. plantarum was predicted with help of computer algorithm. The insertion location 188|189s of thyA gene (lowest E-0.134) was chosen and the wild type intron Ll.LtrB was PCR modified, yielding a retargeted intron of pLpACDthyA. The retargeted intron was expressed by using induction peptide (sppIP), subsequently the integration of intron in thyA gene was identified by PCR screening and finally ThyA(-) mutant of L. plantarum (ThyA18) was detected. In vitro growth curve result showed that in the absence of thymidine, colony forming units of mutant ThyA18 was decreased, whereas high thymidine concentration (10 μM) supported the growth of the culture until saturation. In conclusion, ThyA(-) mutant of L. plantarum (ThyA18) constructed in this study will be used as a biologically contained recombinant probiotic to deliver oxalate decarboxylase into the lumen for treatment of hyperoxaluria and calcium oxalate stone deposition.

  16. Reconstruction of structural evolution in the trnL intron P6b loop of symbiotic Nostoc (Cyanobacteria).

    Science.gov (United States)

    Olsson, Sanna; Kaasalainen, Ulla; Rikkinen, Jouko

    2012-02-01

    In this study we reconstruct the structural evolution of the hyper-variable P6b region of the group I trnLeu intron in a monophyletic group of lichen-symbiotic Nostoc strains and establish it as a useful marker in the phylogenetic analysis of these organisms. The studied cyanobacteria occur as photosynthetic and/or nitrogen-fixing symbionts in lichen species of the diverse Nephroma guild. Phylogenetic analyses and secondary structure reconstructions are used to improve the understanding of the replication mechanisms in the P6b stem-loop and to explain the observed distribution patterns of indels. The variants of the P6b region in the Nostoc clade studied consist of different combinations of five sequence modules. The distribution of indels together with the ancestral character reconstruction performed enables the interpretation of the evolution of each sequence module. Our results indicate that the indel events are usually associated with single nucleotide changes in the P6b region and have occurred several times independently. In spite of their homoplasy, they provide phylogenetic information for closely related taxa. Thus we recognize that features of the P6b region can be used as molecular markers for species identification and phylogenetic studies involving symbiotic Nostoc cyanobacteria.

  17. Cloning, sequencing and expression of a xylanase gene from the maize pathogen Helminthosporium turcicum

    DEFF Research Database (Denmark)

    Degefu, Y.; Paulin, L.; Lübeck, Peter Stephensen

    2001-01-01

    A gene encoding an endoxylanase from the phytopathogenic fungus Helminthosporium turcicum Pass. was cloned and sequenced. The entire nucleotide sequence of a 1991 bp genomic fragment containing an endoxylanase gene was determined. The xylanase gene of 795 bp, interrupted by two introns of 52 and ...

  18. The U2AF35-related protein Urp contacts the 3' splice site to promote U12-type intron splicing and the second step of U2-type intron splicing.

    Science.gov (United States)

    Shen, Haihong; Zheng, Xuexiu; Luecke, Stephan; Green, Michael R

    2010-11-01

    The U2AF35-related protein Urp has been implicated previously in splicing of the major class of U2-type introns. Here we show that Urp is also required for splicing of the minor class of U12-type introns. Urp is recruited in an ATP-dependent fashion to the U12-type intron 3' splice site, where it promotes formation of spliceosomal complexes. Remarkably, Urp also contacts the 3' splice site of a U2-type intron, but in this case is specifically required for the second step of splicing. Thus, through recognition of a common splicing element, Urp facilitates distinct steps of U2- and U12-type intron splicing.

  19. Modification of pGH cDNA using the first intron and adenovirus-mediated expression in CHO cells

    Institute of Scientific and Technical Information of China (English)

    李秀锦; 仲飞; 齐顺章

    2003-01-01

    Objective This study was conducted to investigate the function of the first intron of porcine growth hormone (pGH) gene in the gene expression.Methods PCR method was used to amplify the first intron from pig genomic DNA. The intron was then inserted into pGH cDNA to construct pGH cDNA-intron (pGH cDNA-in). The recombinant adenoviruses containing pGH cDNA and pGH cDNA-in genes under control of CMV promoter were generated by homologous recombination method in HEK 293 cells respectively. The effect of the first intron on gene expression was evaluated by comparing the expression levels of pGH cDNA-in and pGH cDNA mediated by adenovirus vectors in CHO cells.Results The expression level of pGH cDNA containing the first intron increased by 117%, which was significantly higher than that of pGH cDNA without the intron (P<0.001). Conclusion The first intron of pGH gene has the function to improve pGH gene expression.

  20. Localization of a bacterial group II intron-encoded protein in eukaryotic nuclear splicing-related cell compartments.

    Directory of Open Access Journals (Sweden)

    Rafael Nisa-Martínez

    Full Text Available Some bacterial group II introns are widely used for genetic engineering in bacteria, because they can be reprogrammed to insert into the desired DNA target sites. There is considerable interest in developing this group II intron gene targeting technology for use in eukaryotes, but nuclear genomes present several obstacles to the use of this approach. The nuclear genomes of eukaryotes do not contain group II introns, but these introns are thought to have been the progenitors of nuclear spliceosomal introns. We investigated the expression and subcellular localization of the bacterial RmInt1 group II intron-encoded protein (IEP in Arabidopsis thaliana protoplasts. Following the expression of translational fusions of the wild-type protein and several mutant variants with EGFP, the full-length IEP was found exclusively in the nucleolus, whereas the maturase domain alone targeted EGFP to nuclear speckles. The distribution of the bacterial RmInt1 IEP in plant cell protoplasts suggests that the compartmentalization of eukaryotic cells into nucleus and cytoplasm does not prevent group II introns from invading the host genome. Furthermore, the trafficking of the IEP between the nucleolus and the speckles upon maturase inactivation is consistent with the hypothesis that the spliceosomal machinery evolved from group II introns.

  1. A CRM domain protein functions dually in group I and group II intron splicing in land plant chloroplasts.

    Science.gov (United States)

    Asakura, Yukari; Barkan, Alice

    2007-12-01

    The CRM domain is a recently recognized RNA binding domain found in three group II intron splicing factors in chloroplasts, in a bacterial protein that associates with ribosome precursors, and in a family of uncharacterized proteins in plants. To elucidate the functional repertoire of proteins with CRM domains, we studied CFM2 (for CRM Family Member 2), which harbors four CRM domains. RNA coimmunoprecipitation assays showed that CFM2 in maize (Zea mays) chloroplasts is associated with the group I intron in pre-trnL-UAA and group II introns in the ndhA and ycf3 pre-mRNAs. T-DNA insertions in the Arabidopsis thaliana ortholog condition a defective-seed phenotype (strong allele) or chlorophyll-deficient seedlings with impaired splicing of the trnL group I intron and the ndhA, ycf3-int1, and clpP-int2 group II introns (weak alleles). CFM2 and two previously described CRM proteins are bound simultaneously to the ndhA and ycf3-int1 introns and act in a nonredundant fashion to promote their splicing. With these findings, CRM domain proteins are implicated in the activities of three classes of catalytic RNA: group I introns, group II introns, and 23S rRNA.

  2. Convergent Evolution of Fern-Specific Mitochondrial Group II Intron atp1i361g2 and Its Ancient Source Paralogue rps3i249g2 and Independent Losses of Intron and RNA Editing among Pteridaceae

    Science.gov (United States)

    Zumkeller, Simon Maria; Knoop, Volker; Knie, Nils

    2016-01-01

    Mitochondrial intron patterns are highly divergent between the major land plant clades. An intron in the atp1 gene, atp1i361g2, is an example for a group II intron specific to monilophytes (ferns). Here, we report that atp1i361g2 is lost independently at least 4 times in the fern family Pteridaceae. Such plant organelle intron losses have previously been found to be accompanied by loss of RNA editing sites in the flanking exon regions as a consequence of genomic recombination of mature cDNA. Instead, we now observe that RNA editing events in both directions of pyrimidine exchange (C-to-U and U-to-C) are retained in atp1 exons after loss of the intron in Pteris argyraea/biaurita and in Actiniopteris and Onychium. We find that atp1i361g2 has significant similarity with intron rps3i249g2 present in lycophytes and gymnosperms, which we now also find highly conserved in ferns. We conclude that atp1i361g2 may have originated from the more ancestral rps3i249g2 paralogue by a reverse splicing copy event early in the evolution of monilophytes. Secondary structure elements of the two introns, most characteristically their domains III, show strikingly convergent evolution in the monilophytes. Moreover, the intron paralogue rps3i249g2 reveals relaxed evolution in taxa where the atp1i361g2 paralogue is lost. Our findings may reflect convergent evolution of the two related mitochondrial introns exerted by co-evolution with an intron-binding protein simultaneously acting on the two paralogues. PMID:27492234

  3. Twelve Group I introns in the same pre-rRNA transcript of the myxomycete Fuligo septica: RNA processing and evolution.

    Science.gov (United States)

    Lundblad, Eirik W; Einvik, Christer; Rønning, Sissel; Haugli, Kari; Johansen, Steinar

    2004-07-01

    The ribosomal DNA region of the myxomycete Fuligo septica was investigated and found to contain 12 group I introns (four in the small subunit and eight in the large subunit ribosomal RNAs). We have performed molecular and phylogenetic analyses to provide insight into intron structure and function, intron-host biology, and intron origin and evolution. The introns vary in size from 398 to 943 nt, all lacking detectable open reading frames. Secondary structure models revealed considerable structural diversity, but all, except one (subclass IB), represent the common group IC1 intron subclass. In vitro splicing analysis revealed that 10 of the 12 introns were able to self-splice as naked RNA, but all 12 introns were able to splice out from the precursor rRNA in vivo as evaluated by reverse transcription PCR analysis on total F. septica RNA. Furthermore, RNA processing analyses in vitro and in vivo showed that 10 of 12 introns perform hydrolytic cleavage at the 3' splice site, as well as intron circularization. Full-length intron RNA circles were detected in vivo. The order of splicing was analyzed by a reverse transcription PCR approach on cellular RNA, but no strict order of intron excision could be detected. Phylogenetic analysis indicated that most Fuligo introns were distantly related to each other and were independently gained in ribosomal DNA during evolution.

  4. Genome Editing via Mobile Group-II Introns and Cre/lox

    Science.gov (United States)

    Enyeart, P. E.; Perutka, J.; Dao, M.; Ellington, A. E.

    2010-04-01

    Mobile group-II introns and the Cre/lox systems are combined to allow large segments of DNA to be removed or transferred within/between bacterial genomes. Planned applications include metabolic optimization and development of novel dissimilatory metal-reducing bacteria.

  5. DNA methylation levels of α-synuclein intron 1 in the aging brain.

    Science.gov (United States)

    de Boni, Laura; Riedel, Linda; Schmitt, Ina; Kraus, Theo F J; Kaut, Oliver; Piston, Dominik; Akbarian, Schahram; Wüllner, Ullrich

    2015-12-01

    DNA methylation patterns change with age, and aging itself is a major confounding risk factor for Parkinson's disease (PD). Duplication and triplication, that is, increased expression of the α-synuclein (SNCA) gene, cause familial PD, and demethylation of SNCA intron 1 has been shown to result in increased expression of SNCA. We thus hypothesized that age-related alterations of SNCA methylation might underly the increased susceptibility toward PD in later life. The present study sought to determine (1) whether alterations of SNCA intron 1 methylation occurred during aging, (2) whether the methylation pattern differed between men and women, and (3) whether purified neurons compared with non-neuronal cells exhibited different methylation patterns. The analysis of DNA from brain tissue and fluorescence activated cell sorting-sorted purified neurons of 41 individuals revealed only a minor increase of SNCA intron 1 DNA methylation levels in presumably healthy individuals during aging but no significant difference between men and women. Interestingly enough, methylation of SNCA intron 1 was higher in neurons compared with non-neuronal cells, although non-neuronal cells express lower levels of SNCA. Therefore, the normal pattern of SNCA methylation during aging should not result in increased expression of α-synuclein protein. It is thus likely that additional, yet not identified, mechanisms contribute to the tissue specificity of SNCA expression and the presumed dysregulation in PD.

  6. Intron 1 and exon 1 alpha estrogen receptor gene polymorphisms in women with endometriosis.

    Science.gov (United States)

    Sato, Hélio; Nogueira-de-Souza, Naiara C; D'Amora, Paulo; Silva, Ismael D C G; Girão, Manoel J B C; Schor, Eduardo

    2008-12-01

    To evaluate the association of intron 1 and exon 1 polymorphisms in the estrogen receptor alpha gene (ER-alpha) with endometriosis in women. Association study. Endometriosis Unit, Federal University of São Paulo. The control group consisted of volunteers older than 45 years who had no evidence of endometriosis antecedents. Two groups with the disease were evaluated: the first group had stage I or II endometriosis and the second group stage III or IV. Polymerase chain reaction (PCR) followed by digestion with HaeIII and MspI endonucleases (RFLP) were applied to detect intron 1 and exon 1 polymorphisms, respectively, in a total of 125 controls and 105 affected women. Frequency and distribution of HaeIII and MspI polymorphisms in ER-alpha. No significant differences in the frequency of polymorphisms either in intron 1 or exon 1 of ER-alpha were found when endometriosis patients were compared with control subjects. Furthermore, the frequency of ER-alpha polymorphisms within the two different groups of patients with disease was statistically similar. The odds ratio between presence of intron 1 single-nucleotide polymorphisms (SNP) and endometriosis was 0.904, and the odds ratio between exon 1 SNP and endometriosis was 0.976. The evaluated polymorphisms were not associated with endometriosis.

  7. Surfactant Protein B Intron 4 Variation in German Patients with COPD and Acute Respiratory Failure

    Directory of Open Access Journals (Sweden)

    Carola Seifart

    2002-01-01

    Full Text Available Chronic obstructive pulmonary disease (COPD is a major health problem. Genetic factors that contribute to the disease have been postulated. The pulmonary surfactant protein B (SP-B, which is essential for normal lung function, is considered as a candidate gene for COPD in this case-control study. We studied the SP-B intron 4 size variants in 346 individuals. This group consisted of 118 patients with chronic bronchitis or COPD, including 24 patients with acute respiratory failure (ARF in COPD, 118 matched controls without pulmonary disease and 110 healthy individuals (population control. The frequency of intron 4 variants was similar in either control group (10.9%, 14.4% respectively, with a small increase in the COPD group (18.6%. This increase was due to a high increase of intron 4 variants in the ARF subgroup (37.5%, p = 0.003, OR 4.9, 95% CI: 1.76–13.6. The data indicate that SP-B intron 4 variants may associate with increased risk of ARF in COPD and may be used as a marker of susceptibility in this disease subgroup.

  8. A U1-U2 snRNP interaction network during intron definition.

    Science.gov (United States)

    Shao, Wei; Kim, Hyun-Soo; Cao, Yang; Xu, Yong-Zhen; Query, Charles C

    2012-01-01

    The assembly of prespliceosomes is responsible for selection of intron sites for splicing. U1 and U2 snRNPs recognize 5' splice sites and branch sites, respectively; although there is information regarding the composition of these complexes, little is known about interaction among the components or between the two snRNPs. Here we describe the protein network of interactions linking U1 and U2 snRNPs with the ATPase Prp5, important for branch site recognition and fidelity during the first steps of the reaction, using fission yeast Schizosaccharomyces pombe. The U1 snRNP core protein U1A binds to a novel SR-like protein, Rsd1, which has homologs implicated in transcription. Rsd1 also contacts S. pombe Prp5 (SpPrp5), mediated by SR-like domains in both proteins. SpPrp5 then contacts U2 snRNP through SF3b, mediated by a conserved DPLD motif in Prp5. We show that mutations in this motif have consequences not only in vitro (defects in prespliceosome formation) but also in vivo, yielding intron retention and exon skipping defects in fission yeast and altered intron recognition in budding yeast Saccharomyces cerevisiae, indicating that the U1-U2 network provides critical, evolutionarily conserved contacts during intron definition.

  9. Phylogenomic Resolution of the Phylogeny of Laurasiatherian Mammals: Exploring Phylogenetic Signals within Coding and Noncoding Sequences.

    Science.gov (United States)

    Chen, Meng-Yun; Liang, Dan; Zhang, Peng

    2017-08-01

    The interordinal relationships of Laurasiatherian mammals are currently one of the most controversial questions in mammalian phylogenetics. Previous studies mainly relied on coding sequences (CDS) and seldom used noncoding sequences. Here, by data mining public genome data, we compiled an intron data set of 3,638 genes (all introns from a protein-coding gene are considered as a gene) (19,055,073 bp) and a CDS data set of 10,259 genes (20,994,285 bp), covering all major lineages of Laurasiatheria (except Pholidota). We found that the intron data contained stronger and more congruent phylogenetic signals than the CDS data. In agreement with this observation, concatenation and species-tree analyses of the intron data set yielded well-resolved and identical phylogenies, whereas the CDS data set produced weakly supported and incongruent results. Further analyses showed that the phylogeny inferred from the intron data is highly robust to data subsampling and change in outgroup, but the CDS data produced unstable results under the same conditions. Interestingly, gene tree statistical results showed that the most frequently observed gene tree topologies for the CDS and intron data are identical, suggesting that the major phylogenetic signal within the CDS data is actually congruent with that within the intron data. Our final result of Laurasiatheria phylogeny is (Eulipotyphla,((Chiroptera, Perissodactyla),(Carnivora, Cetartiodactyla))), favoring a close relationship between Chiroptera and Perissodactyla. Our study 1) provides a well-supported phylogenetic framework for Laurasiatheria, representing a step towards ending the long-standing "hard" polytomy and 2) argues that intron within genome data is a promising data resource for resolving rapid radiation events across the tree of life. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. The 253-kb inversion and deep intronic mutations in UNC13D are present in North American patients with familial hemophagocytic lymphohistiocytosis 3.

    Science.gov (United States)

    Qian, Yaping; Johnson, Judith A; Connor, Jessica A; Valencia, C Alexander; Barasa, Nathaniel; Schubert, Jeffery; Husami, Ammar; Kissell, Diane; Zhang, Ge; Weirauch, Matthew T; Filipovich, Alexandra H; Zhang, Kejian

    2014-06-01

    The mutations in UNC13D are responsible for familial hemophagocytic lymphohistiocytosis (FHL) type 3. A 253-kb inversion and two deep intronic mutations, c.118-308C > T and c.118-307G > A, in UNC13D were recently reported in European and Asian FHL3 patients. We sought to determine the prevalence of these three non-coding mutations in North American FHL patients and evaluate the significance of examining these new mutations in genetic testing. We performed DNA sequencing of UNC13D and targeted analysis of these three mutations in 1,709 North American patients with a suspected clinical diagnosis of hemophagocytic lymphohistiocytosis (HLH). The 253-kb inversion, intronic mutations c.118-308C > T and c.118-307G > A were found in 11, 15, and 4 patients, respectively, in which the genetic basis (bi-allelic mutations) explained 25 additional patients. Taken together with previously diagnosed FHL3 patients in our HLH patient registry, these three non-coding mutations were found in 31.6% (25/79) of the FHL3 patients. The 253-kb inversion, c.118-308C > T and c.118-307G > A accounted for 7.0%, 8.9%, and 1.3% of mutant alleles, respectively. Significantly, eight novel mutations in UNC13D are being reported in this study. To further evaluate the expression level of the newly reported intronic mutation c.118-307G > A, reverse transcription PCR and Western blot analysis revealed a significant reduction of both RNA and protein levels suggesting that the c.118-307G > A mutation affects transcription. These specified non-coding mutations were found in a significant number of North American patients and inclusion of them in mutation analysis will improve the molecular diagnosis of FHL3. © 2014 Wiley Periodicals, Inc.

  11. The effect of intron location on the splicing of BmKK2 in 293T cells.

    Science.gov (United States)

    Zhijian, Cao; Chao, Dai; Dahe, Jiang; Wenxin, Li

    2006-01-01

    Previously reported results showed that the BmKK2's intron could be recognized and spliced in cultured HEK 293T cells. At the same time, a cryptic splicing site of BmKK2 gene was found in the second exon. Moreover, replacing BmKK2's intron with BmP03's intron (an artificial BmKK2-BmP03 mosaic gene) did not affect the intron's recognition and splicing, but increased the expression level of the toxin-GFP fusion protein (Cao et al., J Biochem Mol Toxicol 2006;20:1-6). In this investigation, the BmKK2's intron with 79 nucleotides length was artificially shifted from the 49th nt (the 17th Gly codon between the first base and the second base) to the 100th nt (the 34th Gly codon between the first base and the second base). Based on the constructed intron-splicing system, the results of RT-PCR and the western blotting analysis showed that the BmKK2's shifted-intron (named BmKK2-s) was not recognized and spliced correctly, but the cryptic splicing site of BmKK2 gene was still spliced in the second exon, which possibly indicated that locations of introns were very important to the recognition and splicing of introns, and splicing of introns was very much associated with the corresponding upstream and downstream exons. This result possibly provides evidence for splice-site recognition across the exons. (c) 2006 Wiley Periodicals, Inc.

  12. Spliceosomal intron insertions in genome compacted ray-finned fishes as evident from phylogeny of MC receptors, also supported by a few other GPCRs.

    Directory of Open Access Journals (Sweden)

    Abhishek Kumar

    Full Text Available BACKGROUND: Insertions of spliceosomal introns are very rare events during evolution of vertebrates and the mechanisms governing creation of novel intron(s remain obscure. Largely, gene structures of melanocortin (MC receptors are characterized by intron-less architecture. However, recently a few exceptions have been reported in some fishes. This warrants a systematic survey of MC receptors for understanding intron insertion events during vertebrate evolution. METHODOLOGY/PRINCIPAL FINDINGS: We have compiled an extended list of MC receptors from different vertebrate genomes with variations in fishes. Notably, the closely linked MC2Rs and MC5Rs from a group of ray-finned fishes have three and one intron insertion(s, respectively, with conserved positions and intron phase. In both genes, one novel insertion was in the highly conserved DRY motif at the end of helix TM3. Further, the proto-splice site MAG↑R is maintained at intron insertion sites in these two genes. However, the orthologs of these receptors from zebrafish and tetrapods are intron-less, suggesting these introns are simultaneously created in selected fishes. Surprisingly, these novel introns are traceable only in four fish genomes. We found that these fish genomes are severely compacted after the separation from zebrafish. Furthermore, we also report novel intron insertions in P2Y receptors and in CHRM3. Finally, we report ultrasmall introns in MC2R genes from selected fishes. CONCLUSIONS/SIGNIFICANCE: The current repository of MC receptors illustrates that fishes have no MC3R ortholog. MC2R, MC5R, P2Y receptors and CHRM3 have novel intron insertions only in ray-finned fishes that underwent genome compaction. These receptors share one intron at an identical position suggestive of being inserted contemporaneously. In addition to repetitive elements, genome compaction is now believed to be a new hallmark that promotes intron insertions, as it requires rapid DNA breakage and subsequent

  13. Inactivation of hnRNP K by expanded intronic AUUCU repeat induces apoptosis via translocation of PKCdelta to mitochondria in spinocerebellar ataxia 10.

    Directory of Open Access Journals (Sweden)

    Misti C White

    2010-06-01

    Full Text Available We have identified a large expansion of an ATTCT repeat within intron 9 of ATXN10 on chromosome 22q13.31 as the genetic mutation of spinocerebellar ataxia type 10 (SCA10. Our subsequent studies indicated that neither a gain nor a loss of function of ataxin 10 is likely the major pathogenic mechanism of SCA10. Here, using SCA10 cells, and transfected cells and transgenic mouse brain expressing expanded intronic AUUCU repeats as disease models, we show evidence for a key pathogenic molecular mechanism of SCA10. First, we studied the fate of the mutant repeat RNA by in situ hybridization. A Cy3-(AGAAU(10 riboprobe detected expanded AUUCU repeats aggregated in foci in SCA10 cells. Pull-down and co-immunoprecipitation data suggested that expanded AUUCU repeats within the spliced intronic sequence strongly bind to hnRNP K. Co-localization of hnRNP K and the AUUCU repeat aggregates in the transgenic mouse brain and transfected cells confirmed this interaction. To examine the impact of this interaction on hnRNP K function, we performed RT-PCR analysis of a splicing-regulatory target of hnRNP K, and found diminished hnRNP K activity in SCA10 cells. Cells expressing expanded AUUCU repeats underwent apoptosis, which accompanied massive translocation of PKCdelta to mitochondria and activation of caspase 3. Importantly, siRNA-mediated hnRNP K deficiency also caused the same apoptotic event in otherwise normal cells, and over-expression of hnRNP K rescued cells expressing expanded AUUCU repeats from apoptosis, suggesting that the loss of function of hnRNP K plays a key role in cell death of SCA10. These results suggest that the expanded AUUCU-repeat in the intronic RNA undergoes normal transcription and splicing, but causes apoptosis via an activation cascade involving a loss of hnRNP K activities, massive translocation of PKCdelta to mitochondria, and caspase 3 activation.

  14. Non-Watson Crick base pairs might stabilize RNA structural motifs in ribozymes – A comparative study of group-I intron structures

    Indian Academy of Sciences (India)

    K Chandrasekhar; R Malathi

    2003-09-01

    In recent decades studies on RNA structure and function have gained significance due to discoveries on diversified functions of RNA. A common element for RNA secondary structure formed by series of non-Watson/Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural motifs in ribozymes, playing a crucial role in their enzymatic activity. To understand the functional significance of these non-canonical base pairs in catalytic RNA, we analysed the sequences of group-I introns from nuclear genes. The results suggest that they might form the building blocks of folded RNA motifs which are crucial to the catalytic activity of the ribozyme. The conservation of these, as observed from divergent organisms, argues for the presence of non-canonical base pairs as an important requisite for the structure and enzymatic property of ribozymes by enabling them to carry out functions such as replication, polymerase activity etc. in primordial conditions in the absence of proteins.

  15. Polymorphisms of exon 5, exon 7 and intron 10 of MMP2 gene and their association with wool density in Rex rabbits

    Directory of Open Access Journals (Sweden)

    S.J. Chen

    2017-06-01

    Full Text Available Wool density is an important index that influences Rex rabbit fur quality. In our earlier studies, we found some important differentially expressed genes in different wool density of Rex rabbit by cDNA microarray. Based on the outcome, we conducted an association study to identify single nucleotide polymorphisms (SNPs of exon 1, 5, 7 and 10 of matrix metalloproteinase-2 (MMP2 gene and their ligands associated with wool density. The results showed that exon 1 and exon 10 of MMP2 gene did not occur mutation in 100 Rex rabbits, meanwhile 3 SNPs were identified in exon 5, exon 7 and intron 10 of MMP2 gene sequence respectively, the 3 mutation sites were as follows: MMP2-exon 5-26C/G, MMP2-exon 7-101C/T and MMP2-intron 10-6C/T. The 3 SNPs were all in Hardy-Weinberg equilibrium. Phenotypic correlation analysis results showed the 3 mutations lacked significant associations (P>0.05 with the wool density.

  16. A phylogeny of cycads (Cycadales) inferred from chloroplast matK gene, trnK intron, and nuclear rDNA ITS region.

    Science.gov (United States)

    Chaw, Shu-Miaw; Walters, Terrence W; Chang, Chien-Chang; Hu, Shu-Hsuan; Chen, Shin-Hsiao

    2005-10-01

    Phylogenetic relationships among the three families and 12 living genera of cycads were reconstructed by distance and parsimony criteria using three markers: the chloroplast matK gene, the chloroplast trnK intron and the nuclear ITS/5.8S rDNA sequence. All datasets indicate that Cycadaceae (including only the genus Cycas) is remotely related to other cycads, in which Dioon was resolved as the basal-most clade, followed by Bowenia and a clade containing the remaining nine genera. Encephalartos and Lepidozamia are closer to each other than to Macrozamia. The African genus Stangeria is embedded within the New World subfamily Zamiodeae. Therefore, Bowenia is an unlikely sister to Stangeria, contrary to the view that they form the Stangeriaceae. The generic status of Dyerocycas and Chigua is unsupportable as they are paraphyletic with Cycas and the Zamia, respectively. Nonsense mutations in the matK gene and indels in the other two datasets lend evidence to reinforce the above conclusions. According to the phylogenies, the past geography of the genera of cycads and the evolution of character states are hypothesized and discussed. Within the suborder Zamiieae, Stangeria, and the tribe Zamieae evolved significantly faster than other genera. The matK gene and ITS/5.8S region contain more useful information than the trnK intron in addressing phylogeny. Redelimitations of Zamiaceae, Stangeriaceae, subfamily Encephalartoideae and subtribe Macrozamiineae are necessary.

  17. Chloroplast protein and centrosomal genes, a tRNA intron, and odd telomeres in an unusually compact eukaryotic genome, the cryptomonad nucleomorph.

    Science.gov (United States)

    Zauner, S; Fraunholz, M; Wastl, J; Penny, S; Beaton, M; Cavalier-Smith, T; Maier, U G; Douglas, S

    2000-01-04

    Cells of several major algal groups are evolutionary chimeras of two radically different eukaryotic cells. Most of these "cells within cells" lost the nucleus of the former algal endosymbiont. But after hundreds of millions of years cryptomonads still retain the nucleus of their former red algal endosymbiont as a tiny relict organelle, the nucleomorph, which has three minute linear chromosomes, but their function and the nature of their ends have been unclear. We report extensive cryptomonad nucleomorph sequences (68.5 kb), from one end of each of the three chromosomes of Guillardia theta. Telomeres of the nucleomorph chromosomes differ dramatically from those of other eukaryotes, being repeats of the 23-mer sequence (AG)(7)AAG(6)A, not a typical hexamer (commonly TTAGGG). The subterminal regions comprising the rRNA cistrons and one protein-coding gene are exactly repeated at all three chromosome ends. Gene density (one per 0.8 kb) is the highest for any cellular genome. None of the 38 protein-coding genes has spliceosomal introns, in marked contrast to the chlorarachniophyte nucleomorph. Most identified nucleomorph genes are for gene expression or protein degradation; histone, tubulin, and putatively centrosomal ranbpm genes are probably important for chromosome segregation. No genes for primary or secondary metabolism have been found. Two of the three tRNA genes have introns, one in a hitherto undescribed location. Intergenic regions are exceptionally short; three genes transcribed by two different RNA polymerases overlap their neighbors. The reported sequences encode two essential chloroplast proteins, FtsZ and rubredoxin, thus explaining why cryptomonad nucleomorphs persist.

  18. Skipping of exons by premature termination of transcription and alternative splicing within intron-5 of the sheep SCF gene: a novel splice variant.

    Directory of Open Access Journals (Sweden)

    Siva Arumugam Saravanaperumal

    Full Text Available Stem cell factor (SCF is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM, SCF is produced either as a membrane-bound (- or soluble (+ forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR. Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp cDNA encodes a precursor protein of 274 amino acids (aa, commonly known as 'soluble' isoform. In contrast, the shorter (835 and/or 725 bp cDNA was found to be a 'novel' mRNA splice variant. It contains an open reading frame (ORF corresponding to a truncated protein of 181 aa (vs 245 aa with an unique C-terminus lacking the primary proteolytic segment (28 aa right after the D(175G site which is necessary to produce 'soluble' form of SCF. This alternative splice (AS variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5-exon 6 (948 bp with a premature termination codon (PTC whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6-9/10. We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+ and/or absence (- of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals.

  19. Identification and Genetic Analysis of a Factor IX Gene Intron 3 Mutation in a Hemophilia B Pedigree in China

    Directory of Open Access Journals (Sweden)

    Dong Hua Cao

    2014-09-01

    Full Text Available OBJECTIVE: Hemophilia B is caused by coagulation defects in the factor IX gene located in Xq27.1 on the X chromosome. A wide range of mutations, showing extensive molecular heterogeneity, have been described in hemophilia B patients. Our study was aimed at genetic analysis and prenatal diagnosis of hemophilia B in order to further elucidate the pathogenesis of the hemophilia B pedigree in China. METHODS: Polymerase chain reaction amplification and direct sequencing of all the coding regions was conducted in hemophilia B patients and carriers. Prenatal diagnosis of the proband was conducted at 20 weeks. RESULTS: We identified the novel point mutation 10.389 A>G, located upstream of the intron 3 acceptor site in hemophilia B patients. The fetus of the proband’s cousin was identified as a carrier. CONCLUSION: Our identification of a novel mutation in the F9 gene associated with hemophilia B provides novel insight into the pathogenesis of this genetically inherited disorder and also represents the basis of prenatal diagnosis.

  20. Comparative evolution of S7 Intron 1 and ribosomal internal transcribed spacer in Coilia nasus (Clupeiformes: Engraulidae).

    Science.gov (United States)

    Liu, Dong; Guo, Hong-Yi; Tang, Wen-Qiao; Yang, Jin-Quan

    2012-01-01

    Coilia nasus is widely distributed in the Yangtze River, the coastal waters of China, Korea and the Ariake Sound of Japan. Several ecotypes exist and this provides a useful model for the study of comparative diversity between molecular markers. Here we analyze and compare the nucleotide sequences between single-copy ribosomal protein S7 gene intron 1 (rpS7) and multiple-copy ribosomal internal transcribed spacer 1 (ITS1) in this species to compare the phylogenetic signal of the two nuclear genes. Nucleotide substitutions among the two gene sequences and partial sequence of mitochondrial cytochrome c oxidase subunit I (COI) gene were also analyzed. A total of 115 clones for rpS7 and 122 clones for ITS1 were obtained from 37 specimens. The nucleotide sequence length is 741 to 743 bp for rpS7 and 334 to 348 bp for ITS1. Intra- and inter-specimen variation in rpS7 results from nucleotide substitution, while such variation in ITS1 is mainly due to different numbers of short base repeats. The content of G + C is lower in rpS7 (43.5%) than in ITS1 (68.2%). Our results indicate that the proportion of the sequence variable sites is higher in rpS7 (61) than in ITS1 (23); the informative parsimony of rpS7 is evidently higher than that of ITS1 (26 vs. 2); the overall ratio between transitions and transversions in ITS1 is slightly lower than in rpS7, but remarkably lower than in COI. These results suggest that rpS7 is more suitable than ITS1 as a marker for genetic divergence of this group. Furthermore, gene flow is observed between the different geographic populations of C. nasus from the phylogeny of this species based on rpS7, showing that rpS7 has more evolutionary characteristics for understanding the processes of genomic evolution at the intraspecific level.

  1. Comparative Evolution of S7 Intron 1 and Ribosomal Internal Transcribed Spacer in Coilia nasus (Clupeiformes: Engraulidae

    Directory of Open Access Journals (Sweden)

    Jin-Quan Yang

    2012-03-01

    Full Text Available Coilia nasus is widely distributed in the Yangtze River, the coastal waters of China, Korea and the Ariake Sound of Japan. Several ecotypes exist and this provides a useful model for the study of comparative diversity between molecular markers. Here we analyze and compare the nucleotide sequences between single-copy ribosomal protein S7 gene intron 1 (rpS7 and multiple-copy ribosomal internal transcribed spacer 1 (ITS1 in this species to compare the phylogenetic signal of the two nuclear genes. Nucleotide substitutions among the two gene sequences and partial sequence of mitochondrial cytochrome c oxidase subunit I (COI gene were also analyzed. A total of 115 clones for rpS7 and 122 clones for ITS1 were obtained from 37 specimens. The nucleotide sequence length is 741 to 743 bp for rpS7 and 334 to 348 bp for ITS1. Intra- and inter-specimen variation in rpS7 results from nucleotide substitution, while such variation in ITS1 is mainly due to different numbers of short base repeats. The content of G + C is lower in rpS7 (43.5% than in ITS1 (68.2%. Our results indicate that the proportion of the sequence variable sites is higher in rpS7 (61 than in ITS1 (23; the informative parsimony of rpS7 is evidently higher than that of ITS1 (26 vs. 2; the overall ratio between transitions and transversions in ITS1 is slightly lower than in rpS7, but remarkably lower than in COI. These results suggest that rpS7 is more suitable than ITS1 as a marker for genetic divergence of this group. Furthermore, gene flow is observed between the different geographic populations of C. nasus from the phylogeny of this species based on rpS7, showing that rpS7 has more evolutionary characteristics for understanding the processes of genomic evolution at the intraspecific level.

  2. Intronic regulation of Aire expression by Jmjd6 for self-tolerance induction in the thymus.

    Science.gov (United States)

    Yanagihara, Toyoshi; Sanematsu, Fumiyuki; Sato, Tetsuya; Uruno, Takehito; Duan, Xuefeng; Tomino, Takahiro; Harada, Yosuke; Watanabe, Mayuki; Wang, Yuqing; Tanaka, Yoshihiko; Nakanishi, Yoichi; Suyama, Mikita; Yoshinori, Fukui

    2015-11-04

    The thymus has spatially distinct microenvironments, the cortex and the medulla, where the developing T-cells are selected to mature or die through the interaction with thymic stromal cells. To establish the immunological self in the thymus, medullary thymic epithelial cells (mTECs) express diverse sets of tissue-specific self-antigens (TSAs). This ectopic expression of TSAs largely depends on the transcriptional regulator Aire, yet the mechanism controlling Aire expression itself remains unknown. Here, we show that Jmjd6, a dioxygenase that catalyses lysyl hydroxylation of splicing regulatory proteins, is critical for Aire expression. Although Jmjd6 deficiency does not affect abundance of Aire transcript, the intron 2 of Aire gene is not effectively spliced out in the absence of Jmjd6, resulting in marked reduction of mature Aire protein in mTECs and spontaneous development of multi-organ autoimmunity in mice. These results highlight the importance of intronic regulation in controlling Aire protein expression.

  3. Intronic SH2D1A mutation with impaired SAP expression and agammaglobulinemia.

    Science.gov (United States)

    Recher, Mike; Fried, Ari J; Massaad, Michel J; Kim, Hye Young; Rizzini, Michela; Frugoni, Francesco; Walter, Jolan E; Mathew, Divij; Eibel, Hermann; Hess, Christoph; Giliani, Silvia; Umetsu, Dale T; Notarangelo, Luigi D; Geha, Raif S

    2013-02-01

    X-linked lymphoproliferative (XLP) disease is a primary immunodeficiency syndrome associated with the inability to control Epstein-Barr virus (EBV), lymphoma, and hypogammaglobulinemia. XLP is caused by mutations in the SH2D1A gene, which encodes the SLAM-associated protein (SAP), or in the BIRC4 gene, which encodes the X-linked inhibitor of apoptosis protein (XIAP). Here we report a patient with recurrent respiratory tract infections and early onset agammaglobulinemia who carried a unique disease-causing intronic loss-of-function mutation in SH2D1A. The intronic mutation affected SH2D1A gene transcription but not mRNA splicing, and led to markedly reduced level of SAP protein. Despite undetectable serum immunoglobulins, the patient's B cells replicated and differentiated into antibody producing cells normally in vitro.

  4. Intron-Mediated Enhancement: A Tool for Heterologous Gene Expression in Plants?

    Science.gov (United States)

    Laxa, Miriam

    2017-01-01

    Many plant promoters were characterized and used for transgene expression in plants. Even though these promoters drive high levels of transgene expression in plants, the expression patterns are rarely constitutive but restricted to some tissues and developmental stages. In terms of crop improvement not only the enhancement of expression per se but, in particular, tissue-specific and spatial expression of genes plays an important role. Introns were used to boost expression in transgenic plants in the field of crop improvement for a long time. However, the mechanism behind this so called intron-mediated enhancement (IME) is still largely unknown. This review highlights the complexity of IME on the levels of its regulation and modes of action and gives an overview on IME methodology, examples in fundamental research and models of proposed mechanisms. In addition, the application of IME in heterologous gene expression is discussed. PMID:28111580

  5. A novel A-isoform-like inositol 1,4,5-trisphosphate 3-kinase from chicken erythrocytes exhibits alternative splicing and conservation of intron positions between vertebrates and invertebrates.

    Science.gov (United States)

    Bertsch, U; Haefs, M; Möller, M; Deschermeier, C; Fanick, W; Kitzerow, A; Ozaki, S; Meyer, H E; Mayr, G W

    1999-03-04

    Based on the partial peptide sequence of inositol 1,4, 5-trisphosphate 3-kinase purified with 135 000-fold enrichment from chicken erythrocytes, cDNA-fragments were cloned by RT-PCR using degenerate oligonucleotides. Subsequent hybridization screening of an embryonic chicken cDNA library and 5'-RACE yielded a cDNA-contig of 2418 bp, encoding a 452 amino acid protein. The amino acid sequence shows the highest degree of homology with A-isoforms of inositol 1,4,5-trisphosphate 3-kinase (65% identities), whereas homology towards B and C isoforms was lower (57% and 52% amino acid identities respectively). These findings reveal a new tissue-specific pattern of A-isoform expression, a form which so far has only been found in brain and testes. Two overlapping lambda-genomic clones for chicken inositol 1,4,5-trisphosphate 3-kinase, isolated by hybridization screening, covered 18 499 bp of genomic sequence. This contig included four exons: three of them were present in all cDNA clones, whereas one was only represented in a single cDNA clone. In addition, the sequence of the latter differed from the other cDNAs by an in-frame deletion of 72 bp within the coding region for the catalytic domain of the enzyme. This divergent cDNA suggests the existence of alternative splice products, at least in embryonic tissue.A comparison of the position of introns, with the respective introns known from the corresponding gene from Caenorhabditis elegans, revealed a high degree of conservation of intron positions between vertebrates and invertebrates. Functional data for the enzyme suggests that the conserved exons represent defined functional protein modules.

  6. Characterization of cryptic splicing in germline PTEN intronic variants in Cowden syndrome.

    Science.gov (United States)

    Chen, Hannah Jinlian; Romigh, Todd; Sesock, Kaitlin; Eng, Charis

    2017-10-01

    Germline mutations in the tumor-suppressor gene PTEN predispose to subsets of Cowden syndrome (CS), Bannayan-Riley-Ruvalcaba syndrome, and autism. Evidence-based classification of PTEN variants as either deleterious or benign is urgently needed for accurate molecular diagnosis and gene-informed genetic counseling. We studied 34 different germline PTEN intronic variants from 61 CS patients, characterized their PTEN mRNA processing, and analyzed PTEN expression and downstream readouts of P-AKT and P-ERK1/2. While we found that many mutations near splice junctions result in exon skipping, we also identified the presence of cryptic splicing that resulted in premature termination or a shift in isoform usage. PTEN protein expression is significantly lower in the group with splicing changes while P-AKT, but not P-ERK1/2, is significantly increased. Our observations of these PTEN intronic variants should contribute to the determination of pathogenicity of PTEN intronic variants and aid in genetic counseling. © 2017 The Authors. Human Mutation published by Wiley Periodicals, Inc.

  7. First intron of nestin gene regulates its expression during C2C12 myoblast ifferentiation

    Institute of Scientific and Technical Information of China (English)

    Hua Zhong; Zhigang Jin; Yongfeng Chen; Ting Zhang; Wei Bian; Xing Cui; Naihe Jing

    2008-01-01

    Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China Nestin is an intermediate filament protein expressed in neural progenitor cells and in developing skeletal muscle. Nestin has been widely used as a neural progenitor cell marker. It is well established that the specific expression of the nestin gene in neural progenitor cells is conferred by the neural-specific enhancer located in the second intron of the nestin gene. However, the transcriptional mechanism of nestin expression in developing muscle is still unclear. In this study, we identified a muscle cell-specific enhancer in the first intron of mouse nestin gene in mouse myoblast C2C12 cells.We localized the core enhancer activity to the 291-661 region of the first intron, and showed that the two E-boxes in the core enhancer region were important for enhancer activity in differentiating C2C12 cells. We also showed that MyoD protein was involved in the regulation of nestin expression in the myogenic differentiation of C2C12 cells.

  8. Pentamidine inhibits Coxiella burnetii growth and 23S rRNA intron splicing in vitro.

    Science.gov (United States)

    Minnick, Michael F; Hicks, Linda D; Battisti, James M; Raghavan, Rahul

    2010-10-01

    Coxiella burnetii is the bacterial agent of Q fever in humans. Acute Q fever generally manifests as a flu-like illness and is typically self-resolving. In contrast, chronic Q fever usually presents with endocarditis and is often life-threatening without appropriate antimicrobial therapy. Unfortunately, available options for the successful treatment of chronic Q fever are both limited and protracted (>18 months). Pentamidine, an RNA splice inhibitor used to treat fungal and protozoal infections, was shown to reduce intracellular growth of Coxiella by ca. 73% at a concentration of 1 microM (ca. 0.6 microg/mL) compared with untreated controls, with no detectable toxic effects on host cells. Bacterial targets of pentamidine include Cbu.L1917 and Cbu.L1951, two group I introns that disrupt the 23S rRNA gene of Coxiella, as demonstrated by the drug's ability to inhibit intron RNA splicing in vitro. Since both introns are highly conserved amongst all eight genotypes of the pathogen, pentamidine is predicted to be efficacious against numerous strains of C. burnetii. To our knowledge, this is the first report describing antibacterial activity for this antifungal/antiprotozoal agent.

  9. Molecular phylogeny of Sri Lankan Dipterocarpaceae in relation to other Asian Dipterocarpaceae based on chloroplast DNA sequences

    National Research Council Canada - National Science Library

    GAMAGE, Dayananda Thawalama; SILVA, Morley de; YOSHIDA, Akira; SZMIDT, Alfred E; YAMAZAKI, Tsuneyuki

    2003-01-01

    .... We studied this relationship using chloroplast DNA nucleotide sequences. DNA sequences of trnL-trnF spacer and trnL intron regions from 27 Sri Lankan species, and 62 other species belonging to 14 genera were included in the study...

  10. A generalized topological entropy for analyzing the complexity of DNA sequences.

    Science.gov (United States)

    Jin, Shuilin; Tan, Renjie; Jiang, Qinghua; Xu, Li; Peng, Jiajie; Wang, Yong; Wang, Yadong

    2014-01-01

    Topological entropy is one of the most difficult entropies to be used to analyze the DNA sequences, due to the finite sample and high-dimensionality problems. In order to overcome these problems, a generalized topological entropy is introduced. The relationship between the topological entropy and the generalized topological entropy is compared, which shows the topological entropy is a special case of the generalized entropy. As an application the generalized topological entropy in introns, exons and promoter regions was computed, respectively. The results indicate that the entropy of introns is higher than that of exons, and the entropy of the exons is higher than that of the promoter regions for each chromosome, which suggest that DNA sequence of the promoter regions is more regular than the exons and introns.

  11. Sequence analysis of three mitochondrial DNA molecules reveals interesting differences among Saccharomyces yeasts

    DEFF Research Database (Denmark)

    Langkjær, Rikke Breinhold; Casaregola, S.; Ussery, David;

    2003-01-01

    mtDNA, are not present. Surprisingly, four genes (ATP6, COX2, COX3 and COB) in the mtDNA of S. servazzii contain, in total, five + 1 frameshifts. mtDNAs of S. castellii, S. servazzii and S. cerevisiae contain all genes on the same strand, except for one tRNA gene. On the other hand, the gene order......The complete sequences of mitochondrial DNA ( mtDNA) from the two budding yeasts Saccharomyces castellii and Saccharomyces servazzii, consisting of 25 753 and 30 782 bp, respectively, were analysed and compared to Saccharomyces cerevisiae mtDNA. While some of the traits are very similar among...... Saccharomyces yeasts, others have highly diverged. The two mtDNAs are much more compact than that of S. cerevisiae and contain fewer introns and intergenic sequences, although they have almost the same coding potential. A few genes contain group I introns, but group II introns, otherwise found in S. cerevisiae...

  12. A nucleotide substitution at the 5′splice site of intron 1 of rice HEADING DATE 1 (HD1) gene homolog in foxtail millet, broadly found in landraces from Europe and Asia

    Institute of Scientific and Technical Information of China (English)

    Kenji Fukunaga; Naoko Izuka; Takehiro Hachiken; Satoshi Mizuguchi; Hidemi Ito; Katsuyuki Ichitani

    2015-01-01

    We investigated genetic variation of a rice HEADING DATE 1(HD1) homolog in foxtail millet. First, we searched for a rice HD1 homolog in a foxtail millet genome sequence and designed primers to amplify the entire coding sequence of the gene. We compared full HD1 gene sequences of 11 accessions (including Yugu 1, a Chinese cultivar used for genome sequencing) from various regions in Europe and Asia, found a nucleotide substitution at a putative splice site of intron 1, and designated the accessions with the nucleotide substitution as carrying a splicing variant. We verified by RT-PCR that this single nucleotide substitution causes aberrant splicing of intron 1. We investigated the geographical distribution of the splicing variant in 480 accessions of foxtail millet from various regions of Europe and Asia and part of Africa by dCAPS and found that the splicing variant is broadly distributed in Europe and Asia. Differences of heading times between accessions with wild type allele of the HD1 gene and those with the splicing variant allele were unclear. We also investigated variation in 13 accessions of ssp. viridis, the wild ancestor, and the results suggested that the wild type is predominant in the wild ancestor.

  13. A nucleotide substitution at the 5′ splice site of intron 1 of rice HEADING DATE 1(HD1) gene homolog in foxtail millet, broadly found in landraces from Europe and Asia

    Institute of Scientific and Technical Information of China (English)

    Kenji Fukunaga; Naoko Izuka; Takehiro Hachiken; Satoshi Mizuguchi; Hidemi Ito; Katsuyuki Ichitani

    2015-01-01

    We investigated genetic variation of a rice HEADING DATE 1(HD1) homolog in foxtail millet.First, we searched for a rice HD1 homolog in a foxtail millet genome sequence and designed primers to amplify the entire coding sequence of the gene. We compared full HD1 gene sequences of 11 accessions(including Yugu 1, a Chinese cultivar used for genome sequencing) from various regions in Europe and Asia, found a nucleotide substitution at a putative splice site of intron 1, and designated the accessions with the nucleotide substitution as carrying a splicing variant. We verified by RT-PCR that this single nucleotide substitution causes aberrant splicing of intron 1. We investigated the geographical distribution of the splicing variant in 480 accessions of foxtail millet from various regions of Europe and Asia and part of Africa by d CAPS and found that the splicing variant is broadly distributed in Europe and Asia. Differences of heading times between accessions with wild type allele of the HD1 gene and those with the splicing variant allele were unclear. We also investigated variation in 13 accessions of ssp. viridis, the wild ancestor, and the results suggested that the wild type is predominant in the wild ancestor.

  14. Mutation analysis in Duchenne and Becker muscular dystrophy patients from Bulgaria shows a peculiar distribution of breakpoints by intron

    Energy Technology Data Exchange (ETDEWEB)

    Todorova, A.; Bronzova, J.; Kremensky, I. [Univ. Hospital of Obstetrics and Gynecology, Sofia (Bulgaria)] [and others

    1996-10-02

    For the first time in Bulgaria, a deletion/duplication screening was performed on a group of 84 unrelated Duchenne/Becker muscular dystrophy patients, and the breakpoint distribution in the dystrophin gene was analyzed. Intragenic deletions were detected in 67.8% of patients, and intragenic duplications in 2.4%. A peculiar distribution of deletion breakpoints was found. Only 13.2% of the deletion breakpoints fell in the {open_quotes}classical{close_quotes} hot spot in intron 44, whereas the majority (> 54%) were located within the segment encompassing introns 45-51, which includes intron 50, the richest in breakpoints (16%) in the Bulgarian sample. Comparison with data from Greece and Turkey points at the probable existence of a deletion hot spot within intron 50, which might be a characteristic of populations of the Balkan region. 17 refs., 2 figs.

  15. Phylogeny of suckermouth catfishes (Mochokidae: Chiloglanis) from Kenya: the utility of Growth Hormone introns in species level phylogenies.

    Science.gov (United States)

    Schmidt, Ray C; Bart, Henry L; Nyingi, Dorothy Wanja; Gichuki, Nathan Ndegwa

    2014-10-01

    African suckermouth catfishes (Mochokidae: Chiloglanis) occur in freshwater throughout tropical Africa. Specimens from all major drainages across Kenya were collected over three field seasons. Here we present a phylogeny inferred from both mitochondrial cytochrome b (cyt b) and introns of the nuclear Growth Hormone gene (GH). The phylogeny inferred from introns is largely congruent with the results from an analysis of cyt b. The length and variability of GH introns make them ideal species level nuclear markers without the problem of introgression commonly encountered with mitochondrial genes. This analysis confirmed the presence of two previously known undescribed Chiloglanis species and also suggests the presence of previously unknown diversity within the Athi River system. The resulting phylogeny also indicates the presence of two separate lineages within C. brevibarbis. The historical biogeography of Chiloglanis within Kenya is discussed. The utility of GH intron for species level phylogenies of Siluriformes is compared to that in other groups.

  16. The intron-22-inverted F8 locus permits factor VIII synthesis: explanation for low inhibitor risk and a role for pharmacogenomics.

    Science.gov (United States)

    Sauna, Zuben E; Lozier, Jay N; Kasper, Carol K; Yanover, Chen; Nichols, Timothy; Howard, Tom E

    2015-01-01

    Intron-22-inversion patients express the entire Factor VIII (FVIII)-amino-acid sequence intracellularly as 2 non-secreted polypeptides and have a positive "intracellular (I)-FVIII-CRM" status. Mutations conferring a positive I-FVIII-CRM status are associated with low inhibitor risk and are pharmacogenetically relevant because inhibitor risk may be affected by the nature of the therapeutic FVIII-protein (tFVIII), the affinity of any tFVIII-derived foreign peptide (tFVIII-fp) for any HLA class-II isomer (HLA-II) comprising individual major histocompatibility complex (MHC) repertoires, and the stability of any tFVIII-fp/HLA-II complex. We hypothesize that mutations conferring a completely or substantially negative I-FVIII-CRM status are pharmacogenetically irrelevant because inhibitor risk is high with any tFVIII and individual MHC repertoire.

  17. [25S intron analysis followed by restriction enzyme digestion performed for genotyping Candida albicans isolates].

    Science.gov (United States)

    Karahan, Zeynep Ceren; Saran, Begüm; Yenice, Sevinç; Ağırbaşlı, Handan; Arıkan Akan, Ozay; Tekeli, Alper

    2012-04-01

    Candida albicans is the most frequently encountered fungal pathogen especially in the immunocompromised hosts. Genotyping clinical microbial isolates is important for obtaining epidemiological data and for establishing appropriate infection control strategies in the hospital setting. 25S intron analysis is an easy and reliable method used for genotyping C.albicans strains. As it has a low discriminatory power, its use is limited in epidemiological studies. In this study, our aim was to genotype clinical C.albicans isolates by using 25S intron analysis followed by restriction enzyme digestion in order to develop a more discriminative genotyping system for C.albicans. A total of 260 clinical C.albicans strains isolated from various infection sites (121 blood, 69 sputum, 36 vaginal discharge, 26 wound, 8 urine samples) were genotyped by 25S intron analysis, and all the products obtained by polymerase chain reaction (PCR) were digested with HaeIII restriction enzyme. Discriminatory power of each method was calculated. Among the isolates 184 (70.8%) were classified as genotype A, 42 (16.2%) as genotype B, and 34 (13%) as genotype C by 25S intron analysis. Discriminatory power of the method was calculated as 0.46. HaeIII restriction of genotype A, B and C isolates produced ten, one, and five restriction patterns (genotypes), respectively. By the addition of restriction enzyme analysis, the number of genotypes obtained was increased to 16, and the discriminatory power of the method to 0.79. Combining different genotyping methods increases the discriminatory power by increasing the number of genotypes obtained. However, there is also a risk to split certain strains in different genotypes by the different methods used and this makes the genotypic evaluation more difficult. On the other hand, combining 25S intron analysis with restriction enzyme analysis increases the discriminatory power without introducing a totally different method, and makes the method more suitable for

  18. Identification of a human ABCC10 orthologue in Catharanthus roseus reveals a U12-type intron determinant for the N-terminal domain feature

    Indian Academy of Sciences (India)

    Taissir El-Guizani; Clotilde Guibert; Saïda Triki; Benoit St-Pierre; Eric Ducos

    2014-04-01

    ABC (ATP-binding cassette) transporters are members of a large superfamily of proteins that utilize ATP hydrolysis to translocate a wide range of substrates across biological membranes. In general, members of C subfamily (ABCC) are structurally characterized by an additional (N-terminal) transmembrane domain (TMD0). Phylogenetic analysis of plant ABCCs separates their protein sequences into three distinct clusters: I and II are plant specific whereas cluster III contains both human and plant ABCCs. Screening of the Plant Medicinal Genomics Resource database allowed us to identify 16 ABCCs partial sequences in Catharanthus roseus; two of which belong to the unique CrABCC1 transcript that we identified in cluster III. Genomic organization of CrABCC1 TMD0 coding sequence displays an AT-AC U12-type intron that is conserved in higher plant orthologues. We showed that CrABCC1, like its human orthologue ABCC10, produces alternative transcripts that encode protein sequences with a truncated form of TMD0 without the first transmembrane span (TM1). Subcellular localization of CrABCC1 TMD0 variants using yellow fluorescent protein fusions reveals that the TM1 is required for a correct routing of the TMD0 to the tonoplast. Finally, the specific repartition of CrABCC1 orthologues in some species suggests that this gene was lost several times during evolution and that its physiological function may, rely on a common feature of multicellular eukaryotes.

  19. Identification and characterization of polymorphisms within the 5' flanking region, first exon and part of first intron of bovine GH gene.

    Science.gov (United States)

    Ferraz, A L J; Bortolossi, J C; Curi, R A; Ferro, M I T; Ferro, J A; Furlan, L R

    2006-06-01

    The aim of the present study was to identify and characterize polymorphisms within the 5' flanking region, first exon and part of first intron of the bovine growth hormone gene among different beef cattle breeds: Nelore (n = 25), Simmental (n = 39), Simbrasil (n = 24), Simmental x Nelore (n = 30), Canchim x Nelore (n = 30) and Angus x Nelore (n = 30). Two DNA fragments (GH1, 464 bp and GH2, 453 bp) were amplified by polymerase chain reaction and then used for polymorphism identification by SSCP. Within the GH1 fragment, five polymorphisms were identified, corresponding to three different alleles: GH1.1, GH1.2 and GH1.3 (GenBank: AY662648, AY662649 and AY662650, respectively). These allele sequences were aligned and compared with bovine GH gene nucleotide sequence (GenBank: M57764 and AF118837), resulting in the identification of five insertion/deletions (INDELs) and five single nucleotide polymorphisms (SNPs). In the GH2 fragment two alleles were identified, GH2.1 and GH2.2 (GenBank: AY662651 and AY662652, respectively). The allele sequences were compared with GenBank sequences (M57764, AF007750 and AH009106) and three INDELs and four SNPs were identified. In conclusion, we were able to identify six new polymorphisms of the bovine GH gene (one INDEL and five SNPs), which can be used as molecular markers in genetic studies.

  20. Fox-2 Splicing Factor Binds to a Conserved Intron Motif to PromoteInclusion of Protein 4.1R Alternative Exon 16

    Energy Technology Data Exchange (ETDEWEB)

    Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo; Lersch,Robert A.; Gee, Sherry L.; Hou, Victor C.; Lo, Annie J.; Short, Sarah A.; Chasis, Joel A.; Winkelmann, John C.; Conboy, John G.

    2006-03-01

    Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding to the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.

  1. Sequence conservation in the Ancylostoma secreted protein-2 of Necator americanus (Na-ASP-2) from hookworm infected individuals in Thailand.

    Science.gov (United States)

    Ungcharoensuk, Charoenchai; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

    2012-12-01

    The Ancylostoma secreted protein-2 of Necator americanus (Na-ASP-2) was one of the promising vaccine candidates against the most prevalent human hookworm species as adverse vaccine reaction has compromised further human vaccine trials. To elucidate the gene structure and the extent of sequence diversity, we determined the complete nucleotide sequence of the Na-asp-2 gene of individual larvae from 32 infected subjects living in 3 different endemic areas of Thailand. Sequence analysis revealed that the gene encoding Na-ASP-2 comprised 8 exons. Of 3 nucleotide substitutions in these exons, only one causes an amino acid change from leucine to methionine. A consensus conserved GT and AG at the 5' and the 3' boundaries of each intron was observed akin to those found in other eukaryotic genes. Introns of Na-asp-2 contained 23 nucleotide substitutions and 0-18 indels. The mean number of nucleotide substitutions per site (d) in introns was not significantly different from the mean number of synonymous substitutions per synonymous site (d(S)) in exons whereas d in introns was significantly exceeded d(N) (the mean number of nonsynonymous substitutions per nonsynonymous site) in exons (pASP-2. A recombination site was identified in an intron near the 3' portion of the gene. The positions of introns and the intron phases in the Na-asp-2 gene comparing with those in other pathogenesis-related-1 proteins of Loa loa, Onchocerca volvulus, Heterodera glycines, Caenorhabditis elegans and human were relatively conserved, suggesting evolutionary conservation of these genes. Sequence conservation in Na-ASP-2 may not compromise further vaccine design if adverse vaccine effects could be resolved whereas microheterogeneity in introns of this locus may be useful for population genetics analysis of N. americanus. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Prevalent Exon-Intron Structural Changes in the APETALA1/FRUITFULL, SEPALLATA, AGAMOUS-LIKE6, and FLOWERING LOCUS C MADS-Box Gene Subfamilies Provide New Insights into Their Evolution.

    Science.gov (United States)

    Yu, Xianxian; Duan, Xiaoshan; Zhang, Rui; Fu, Xuehao; Ye, Lingling; Kong, Hongzhi; Xu, Guixia; Shan, Hongyan

    2016-01-01

    AP1/FUL, SEP, AGL6, and FLC subfamily genes play important roles in flower development. The phylogenetic relationships among them, however, have been controversial, which impedes our understanding of the origin and functional divergence of these genes. One possible reason for the controversy may be the problems caused by changes in the exon-intron structure of genes, which, according to recent studies, may generate non-homologous sites and hamper the homology-based sequence alignment. In this study, we first performed exon-by-exon alignments of these and three outgroup subfamilies (SOC1, AG, and STK). Phylogenetic trees reconstructed based on these matrices show improved resolution and better congruence with species phylogeny. In the context of these phylogenies, we traced evolutionary changes of exon-intron structures in each subfamily. We found that structural changes have occurred frequently following gene duplication and speciation events. Notably, exons 7 and 8 (if present) suffered more structural changes than others. With the knowledge of exon-intron structural changes, we generated more reasonable alignments containing all the focal subfamilies. The resulting trees showed that the SEP subfamily is sister to the monophyletic group formed by AP1/FUL and FLC subfamily genes and that the AGL6 subfamily forms a sister group to the three abovementioned subfamilies. Based on this topology, we inferred the evolutionary history of exon-intron structural changes among different subfamilies. Particularly, we found that the eighth exon originated before the divergence of AP1/FUL, FLC, SEP, and AGL6 subfamilies and degenerated in the ancestral FLC-like gene. These results provide new insights into the origin and evolution of the AP1/FUL, FLC, SEP, and AGL6 subfamilies.

  3. 地衣型真菌的Ⅰ型内含子及其在系统发育中的应用%Group Ⅰ introns in lichen forming fungi and their application for phylogenetic analysis

    Institute of Scientific and Technical Information of China (English)

    曹叔楠; 刘萌; 周启明; 郭守玉

    2011-01-01

    以蜈蚣衣属、黑蜈蚣衣属地衣样品为材料,结合GenBank中相关数据,对地衣型真菌核糖体小亚基DNA上的Ⅰ型内含子分布模式进行归纳,并探讨了其在地衣型真菌系统发育研究中的应用.结果表明在地衣型真菌核糖体小亚基DNA上存在多个Ⅰ型内含子插入位点,通过二级结构分析给出了天然状态下Ⅰ型内含子发生转座的证据.分析显示,Ⅰ型内含子作为分子标记,只适合用于种下单位的系统发育研究中.%Group I introns in SSU (Small Subunit) rDNA of lichen forming fungi and their distribution modes were analyzed in this study. The data were obtained from eight species of the lichen genera Physcia and Phaeophyscia with some sequences retrieved from GenBank. Our result indicates that there are multiple group I introns insertion sites in SSU rDNA of lichen forming fungi, and their secondary structures gives the evidences of transposition when group I introns are in its nature states. Our result also demonstrates that group I introns are only suitable for the phylogenetic analysis at infraspecific levels.

  4. Using Group II Introns for Attenuating the In Vitro and In Vivo Expression of a Homing Endonuclease.

    Directory of Open Access Journals (Sweden)

    Tuhin Kumar Guha

    Full Text Available In Chaetomium thermophilum (DSM 1495 within the mitochondrial DNA (mtDNA small ribosomal subunit (rns gene a group IIA1 intron interrupts an open reading frame (ORF encoded within a group I intron (mS1247. This arrangement offers the opportunity to examine if the nested group II intron could be utilized as a regulatory element for the expression of the homing endonuclease (HEase. Constructs were generated where the codon-optimized ORF was interrupted with either the native group IIA1 intron or a group IIB type intron. This study showed that the expression of the HEase (in vivo in Escherichia coli can be regulated by manipulating the splicing efficiency of the HEase ORF-embedded group II introns. Exogenous magnesium chloride (MgCl2 stimulated the expression of a functional HEase but the addition of cobalt chloride (CoCl2 to growth media antagonized the expression of HEase activity. Ultimately the ability to attenuate HEase activity might be useful in precision genome engineering, minimizing off target activities, or where pathways have to be altered during a specific growth phase.

  5. Cloning and sequence analysis of the partial sequence of the rbcL from Bryopsis hypnoides

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The partial sequence of the rbcL from Bryopsis hypnoides, including the sequences of the upstream, extron and partial intron, was amplified by PCR and their sequences were determined. With Spinacia oleracea as the outgroup, neighbor-joining method and maximum parsimony method were used respectively to build phylogenetic trees according to the rbcL exon sequence among 13species that were the typical species of six phyla. Two kinds of trees showed clearly that there were two groups among those species,the green lineage and the non-green lineage. And the relationships of algae in the green lineage were similar in the two trees but those in the non-green lineage were not consistent. Analysis of codon preference indicated that the codon preference of the rbcL exon of Bryopsis hypnoides distinctly differed from that of the relevant sequence of photosynthetic bacteria.

  6. Morquio A syndrome: Cloning, sequence, and structure of the human N-acetylgalactosamine 6-sulfatase (GALNS) gene

    Energy Technology Data Exchange (ETDEWEB)

    Morris, C.P.; Guo, Xiao-Hui; Apostolou, S. [Adelaide Children`s Hospital, North Adelaide (Australia)] [and others

    1994-08-01

    Deficiency of the lysosomal enzyme, N-acetylgalactosamine 6-sulfatase (GALNS;EC 3.1.6.4), results in the storage of the glycosaminoglycans, keratan sulfate and chrondroitin 6-sulfate, which leads to the lysosomal storage disorder Morquio A syndrome. Four overlapping genomic clones derived from a chromosome 16-specific gridded cosmid library containing the entire GALNS gene were isolated. The structure of the gene and the sequence of the exon/intron boundaries and the 5{prime} promoter region were determined. The GALNS gene is split into 14 exons spanning approximately 40 kb. The potential promoter for GALNS lacks a TATA box but contains GC box consensus sequences, consistent with its role as a housekeeping gene. The GALNS gene contains an Alu repeat in intron 5 and a VNTR-like sequence in intron 6. 12 refs., 3 figs., 1 tab.

  7. Determination of RET Sequence Variation in an MEN2 Unaffected Cohort Using Multiple-Sample Pooling and Next-Generation Sequencing

    Directory of Open Access Journals (Sweden)

    R. L. Margraf

    2012-01-01

    Full Text Available Multisample, nonindexed pooling combined with next-generation sequencing (NGS was used to discover RET proto-oncogene sequence variation within a cohort known to be unaffected by multiple endocrine neoplasia type 2 (MEN2. DNA samples (113 Caucasians, 23 persons of other ethnicities were amplified for RET intron 9 to intron 16 and then divided into 5 pools of <30 samples each before library prep and NGS. Two controls were included in this study, a single sample and a pool of 50 samples that had been previously sequenced by the same NGS methods. All 59 variants previously detected in the 50-pool control were present. Of the 61 variants detected in the unaffected cohort, 20 variants were novel changes. Several variants were validated by high-resolution melting analysis and Sanger sequencing, and their allelic frequencies correlated well with those determined by NGS. The results from this unaffected cohort will be added to the RET MEN2 database.

  8. Evaluation of a target region capture sequencing platform using monogenic diabetes as a study-model

    DEFF Research Database (Denmark)

    Gao, R.; Liu, Y. X.; Gjesing, A. P.;

    2014-01-01

    diabetes as a study-model. Results: The performance of the assay was evaluated in 70 patients carrying known disease causing mutations previously identified in HNF4A, GCK, HNF1A, HNF1B, INS, or KCNJ11. Target regions with a less than 20-fold sequencing depth were either introns or UTRs. When only...

  9. Distinguishing between weedy Amaranthus species based on intron one sequences from the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS)gene

    Science.gov (United States)

    Hybridization between Amaranthus species and the potential for herbicide resistance to be transferred by hybridization are of growing concern in the weed science community. It is important to confirm suspect hybrid populations early to develop an effective control strategy. With this in mind, a PC...

  10. Characterization of the Human SLC30A8 Promoter and Intronic Enhancer

    Science.gov (United States)

    Pound, Lynley D.; Sarkar, Suparna A.; Cauchi, Stéphane; Wang, Yingda; Oeser, James K.; Lee, Catherine E.; Froguel, Philippe; Hutton, John C.; O'Brien1, Richard M.

    2011-01-01

    Genome-wide association (GWA) studies have shown that a polymorphic variant in SLC30A8, which encodes zinc transporter-8 (ZnT-8), is associated with altered susceptibility to type 2 diabetes (T2D). This association is consistent with the observation that glucose-stimulated insulin secretion is decreased in islets isolated from Slc30a8 knockout mice. In the present study immunohistochemical staining was first used to show that SLC30A8 is expressed specifically in pancreatic islets. Fusion gene studies were then used to examine the molecular basis for the islet-specific expression of SLC30A8. The analysis of SLC30A8-luciferase expression in βTC-3 cells revealed that the proximal promoter region, located between −6154 and −1, relative to the translation start site, was only active in stable but not transient transfections. VISTA analyses identified three regions in the SLC30A8 promoter and a region in SLC30A8 intron 2 that are conserved in the mouse Slc30a8 gene. Additional fusion gene experiments demonstrated that none of these Slc30a8 promoter regions exhibited enhancer activity when ligated to a heterologous promoter whereas the conserved region in SLC30A8 intron 2 conferred elevated reporter gene expression selectively in βTC-3 but not αTC-6 cells. Finally, the functional effects of a single nucleotide polymorphism (SNP), rs62510556, in this conserved intron 2 enhancer were investigated. Gel retardation studies showed that rs62510556 affects the binding of an unknown transcription factor and fusion gene analyses showed that it modulates enhancer activity. However genetic analyses suggest that this SNP is not a causal variant that contributes to the association between SLC30A8 and T2D, at least in Europeans. PMID:21798992

  11. The intron 4c allele of the NOS3 gene is associated with ischemic stroke in African Americans

    Directory of Open Access Journals (Sweden)

    Juo Ss H

    2007-12-01

    Full Text Available Abstract Background Ischemic stroke is the most common cause of disability in North America and in addition to the generally accepted risk factors, there is increasing evidence for the potential pathophysiological role of genes. One of these genes, the endothelial nitric oxide synthase gene (NOS3 has been reported as a genetic risk factor for ischemic stroke. To independently confirm and extend the results of these previous reports, we investigated this gene as a risk factor for stroke in an ethnically diverse study population. Methods Using the TOAST classification, we characterized and studied 377 patients with ischemic stroke. We genotyped two common variants in the NOS3 gene, the intron 4 insertion/deletion and an exonic single nucleotide polymorphism (SNP, G894T, in these patients and compared them with 502 controls. Chi-square or Fisher's exact tests were used to examine allele effects on stroke and stroke subtypes. Logistic regression analysis was used to adjust for confounding covariate effects. Results All genotypes are in Hardy-Weinberg equilibrium except for intron 4c, which is overrepresented in ischemic stroke patients. In pooled analysis of all patients, intron 4c, but not intron 4a, intron 4b or G894T alleles are associated with stroke (p Conclusion We are unable to confirm previous reports of an association of the intron 4a or the G894T alleles with ischemic stroke. However, although limited by a relatively small sample size, our study suggests a potentially important role of the intron 4c allele as a genetic marker of ischemic stroke in African Americans.

  12. Automatic sequences

    CERN Document Server

    Haeseler, Friedrich

    2003-01-01

    Automatic sequences are sequences which are produced by a finite automaton. Although they are not random they may look as being random. They are complicated, in the sense of not being not ultimately periodic, they may look rather complicated, in the sense that it may not be easy to name the rule by which the sequence is generated, however there exists a rule which generates the sequence. The concept automatic sequences has special applications in algebra, number theory, finite automata and formal languages, combinatorics on words. The text deals with different aspects of automatic sequences, in particular:· a general introduction to automatic sequences· the basic (combinatorial) properties of automatic sequences· the algebraic approach to automatic sequences· geometric objects related to automatic sequences.

  13. A Tth111I RFLP in intron 1 of the mouse Pgk-1 gene allows tracing of X chromosome inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Shanmugan, V.; Saha, B.K. [Emory Univ. School of Medicine, Atlanta, GA (United States)

    1994-09-01

    The X-linked immunodeficiency (xid) in CBA/N mice serves as a model for the X-linked agammaglobulinemia (XLA) syndrome in humans. Like the XLA carriers, the female mice heterozygous for xid (X{sup xid}/X{sup W}) are asymptomatic. The pattern of X chromosome inactivation in the F1 heterozygotes [CBA/N (X{sup xid}/X{sup xid}) X CAST/Ei (X{sup W}/Y)] was investigated by monitoring the methylation status of the two Pgk-1 alleles. Methylation of a CpG dinucleotide in the 5{prime} region of the Pgk-1 gene was previously shown to absolutely correlate with the inactivation of the corresponding X chromosome. In order to distinguish the two alleles, the proximal end of intron 1 of the Pgk-1 gene from CBA/N and CAST/Ei was sequenced. Several nucleotide polymorphisms, including a Tth111I RFLP, were detected in close proximity of the critical CpG dinucleotide. This allowed us to devise an assay based on PCR-amplification of a target DNA encompassing the CpG site as well as the Tth111I site. Results indicate that in circulating B lymphocytes of the female heterozygote only the X-chromosome carrying the normal allele is active (non-random inactivation of the X chromosome) whereas in non-B cells both the X chromosomes are active (random inactivation of the X chromosome). These results were further confirmed by direct measurement of transcription of the two alleles (X{sup xid} and X{sup W}).

  14. Phylogeny of the beaked whale genus Mesoplodon (Ziphiidae: Cetacea) revealed by nuclear introns: implications for the evolution of male tusks.

    Science.gov (United States)

    Dalebout, Merel L; Steel, Debbie; Baker, C Scott

    2008-12-01

    With 14 species currently recognized, the beaked whale genus Mesoplodon (family Ziphiidae) is the most speciose in the order Cetacea. Beaked whales are widely distributed but are rarely seen at sea due to their oceanic distribution, deep-diving capacity, and apparent low abundance. Morphological differentiation among Mesoplodon species is relatively limited, with the exception of tooth form in adult males. Based on scarring patterns, males appear to use their tusk-like teeth as weapons in aggressive encounters with other males. Females are effectively toothless. We used sequences from seven nuclear introns (3348 base pairs) to construct a robust and highly resolved phylogeny, which was then used as a framework to test predictions from four hypotheses seeking to explain patterns of Mesoplodon tusk morphology and/or the processes that have driven the diversification of this genus: (1) linear progression of tusk form; (2) allopatric speciation through isolation in adjacent deep-sea canyons; (3) sympatric speciation through sexual selection on tusks; and (4) selection for species-recognition cues. Maximum-likelihood and Bayesian reconstructions confirmed the monophyly of the genus and revealed that what were considered ancestral and derived tusk forms have in fact arisen independently on several occasions, contrary to predictions from the linear-progression hypothesis. Further, none of the three well-supported species clades was confined to a single ocean basin, as might have been expected from the deep-sea canyon-isolation or sexual-selection hypotheses, and some species with similar tusks have overlapping distributions, contrary to predictions from the species-recognition hypothesis. However, the divergent tusk forms and sympatric distributions of three of the four sister-species pairs identified suggest that sexual selection on male tusks has likely played an important role in this unique radiation, although other forces are clearly also involved. To our knowledge

  15. Identification of a single nucleotide polymorphism at intron 16 of the caprine acyl-coenzyme A: diacylglycerol acyltransferase 1 (DGAT1) gene.

    Science.gov (United States)

    Angiolillo, Antonella; Amills, Marcel; Urrutia, Baltasar; Doménech, Anna; Sastre, Yolanda; Badaoui, Bouabid; Jordana, Jordi

    2007-02-01

    The DGAT1 gene encodes a microsomal enzyme that catalyses the only committed step in triacylglycerol synthesis by joining diacylglycerol and fatty acyl coenzyme A. In cattle, a K232A substitution in the DGAT1 molecule has a significant effect on enzyme activity and milk fat content. The prominent role of this gene in lipid metabolism led us to undertake the structural characterization of DGAT1 in goats. In this way, we have sequenced a 1552 bp fragment of the goat DGAT1 cDNA, which encompasses most of the coding sequence (from exon 1 to 17), and a genomic fragment covering exons 12 to 17. Multiple alignment of the goat DGAT1 sequences revealed the existence of a single nucleotide polymorphism (SNP) involving a T to C substitution at intron 16. We optimized a primer extension based genotyping method that allowed us to determine that the C variant is a minority allele with frequencies ranging from 0.062 (Murciano-Granadina) to 0.109 (Malagueña). This SNP, although not expected to have any functional effect, might be useful as a genetic marker in association studies to detect additional DGAT1 polymorphisms which might influence fat milk content and other traits of economic interest.

  16. Regulation of expression of two LY-6 family genes by intron retention and transcription induced chimerism

    Directory of Open Access Journals (Sweden)

    Mallya Meera

    2008-09-01

    Full Text Available Abstract Background Regulation of the expression of particular genes can rely on mechanisms that are different from classical transcriptional and translational control. The LY6G5B and LY6G6D genes encode LY-6 domain proteins, whose expression seems to be regulated in an original fashion, consisting of an intron retention event which generates, through an early premature stop codon, a non-coding transcript, preventing expression in most cell lines and tissues. Results The MHC LY-6 non-coding transcripts have shown to be stable and very abundant in the cell, and not subject to Nonsense Mediated Decay (NMD. This retention event appears not to be solely dependent on intron features, because in the case of LY6G5B, when the intron is inserted in the artificial context of a luciferase expression plasmid, it is fully spliced but strongly stabilises the resulting luciferase transcript. In addition, by quantitative PCR we found that the retained and spliced forms are differentially expressed in tissues indicating an active regulation of the non-coding transcript. EST database analysis revealed that these genes have an alternative expression pathway with the formation of Transcription Induced Chimeras (TIC. This data was confirmed by RT-PCR, revealing the presence of different transcripts that would encode the chimeric proteins CSNKβ-LY6G5B and G6F-LY6G6D, in which the LY-6 domain would join to a kinase domain and an Ig-like domain, respectively. Conclusion In conclusion, the LY6G5B and LY6G6D intron-retained transcripts are not subjected to NMD and are more abundant than the properly spliced forms. In addition, these genes form chimeric transcripts with their neighbouring same orientation 5' genes. Of interest is the fact that the 5' genes (CSNKβ or G6F undergo differential splicing only in the context of the chimera (CSNKβ-LY6G5B or G6F-LY6G6C and not on their own.

  17. Intronic T-DNA insertion in Arabidopsis NBR1 conditionally affects wild-type transcript level

    OpenAIRE

    Rodríguez, Milagros Collados; Wawrzyńska, Anna; Sirko, Agnieszka

    2014-01-01

    Abstract The SALK_135513 line of Arabidopsis thaliana is annotated by GenBank to have the T-DNA insertion in the fourth exon of NBR1 (At4g24690). Careful molecular analyses of the homozygous plants of SALK_135513 line indicated the place of T-DNA insertion in the fourth intron. Unexpectedly, 2 kinds of NBR1 transcripts, the wild-type and the mutated, resulting from alternative splicing events, were detected in those plants. Our findings explain the problems encountered by us with phenotypic e...

  18. Morpholino antisense oligonucleotides targeting intronic repressor Element1 improve phenotype in SMA mouse models

    OpenAIRE

    Osman, Erkan Y.; Miller, Madeline R.; Robbins, Kate L.; Lombardi, Abby M.; Atkinson, Arleigh K.; Brehm, Amanda J.; Lorson, Christian L.

    2014-01-01

    Spinal muscular atrophy (SMA) is a neurodegenerative disease caused by the loss of Survival Motor Neuron-1 (SMN1). In all SMA patients, a nearly identical copy gene called SMN2 is present, which produces low levels of functional protein owing to an alternative splicing event. To prevent exon-skipping, we have targeted an intronic repressor, Element1 (E1), located upstream of SMN2 exon 7 using Morpholino-based antisense oligonucleotides (E1MO-ASOs). A single intracerebroventricular injection i...

  19. Two novel mutations on exon 8 and intron 65 of COL7A1 gene in two Chinese brothers result in recessive dystrophic epidermolysis bullosa.

    Directory of Open Access Journals (Sweden)

    Ying Lin

    Full Text Available Dystrophic epidermolysis bullosa is an inherited bullous dermatosis caused by the COL7A1 gene mutation in autosomal dominant or recessive mode. COL7A1 gene encodes type VII collagen - the main component of the anchoring fibrils at the dermal-epidermal junction. Besides the 730 mutations reported, we identified two novel COL7A1 gene mutations in a Chinese family, which caused recessive dystrophic epidermolysis bullosa (RDEB. The diagnosis was established histopathologically and ultrastructurally. After genomic DNA extraction from the peripheral blood sample of all subjects (5 pedigree members and 136 unrelated control individuals, COL7A1 gene screening was performed by polymerase chain reaction amplification and direct DNA sequencing of the whole coding exons and flanking intronic regions. Genetic analysis of the COL7A1 gene in affected individuals revealed compound heterozygotes with identical novel mutations. The maternal mutation is a 2-bp deletion at exon 8 (c.1006_1007delCA, leading to a subsequent reading frame-shift and producing a premature termination codon located 48 amino acids downstream in exon 9 (p.Q336EfsX48, consequently resulting in the truncation of 2561 amino acids downstream. This was only present in two affected brothers, but not in the other unaffected family members. The paternal mutation is a 1-bp deletion occurring at the first base of intron 65 (c.IVS5568+1delG that deductively changes the strongly conserved GT dinucleotide at the 5' donor splice site, results in subsequent reading-through into intron 65, and creates a stop codon immediately following the amino acids encoded by exon 65 (GTAA→TAA. This is predicted to produce a truncated protein lacking of 1089 C-terminal amino acids downstream. The latter mutation was found in all family members except one of the two unaffected sisters. Both mutations were observed concurrently only in the two affected brothers. Neither mutation was discovered in 136 unrelated Chinese

  20. The 5′UTR-intron of the Gladiolus polyubiquitin promoter GUBQ1 enhances translation efficiency in Gladiolus and Arabidopsis

    Directory of Open Access Journals (Sweden)

    Kamo Kathryn

    2012-06-01

    Full Text Available Abstract Background There are many non-cereal monocots of agronomic, horticultural, and biofuel importance. Successful transformation of these species requires an understanding of factors controlling expression of their genes. Introns have been known to affect both the level and tissue-specific expression of genes in dicots and cereal monocots, but there have been no studies on an intron isolated from a non-cereal monocot. This study characterizes the levels of GUS expression and levels of uidA mRNA that code for β-glucuronidase (GUS expression in leaves of Gladiolus and Arabidopsis using GUBQ1, a polyubiquitin promoter with a 1.234 kb intron, isolated from the non-cereal monocot Gladiolus, and an intronless version of this promoter. Results Gladiolus and Arabidopsis were verified by Southern hybridization to be transformed with the uidA gene that was under control of either the GUBQ1 promoter (1.9 kb, a 5′ GUBQ1 promoter missing its 1.234 kb intron (0.68 kb, or the CaMV 35 S promoter. Histochemical staining showed that GUS was expressed throughout leaves and roots of Gladiolus and Arabidopsis with the 1.9 kb GUBQ1 promoter. GUS expression was significantly decreased in Gladiolus and abolished in Arabidopsis when the 5′UTR-intron was absent. In Arabidopsis and Gladiolus, the presence of uidA mRNA was independent of the presence of the 5′UTR-intron. The 5′-UTR intron enhanced translation efficiency for both Gladiolus and Arabidopsis. Conclusions The GUBQ1 promoter directs high levels of GUS expression in young leaves of both Gladiolus and Arabidopsis. The 5′UTR-intron from GUBQ1 resulted in a similar pattern of β-glucuronidase translation efficiency for both species even though the intron resulted in different patterns of uidA mRNA accumulation for each species.

  1. The complete exon-intron structure of the 156-kb human gene NFKB1, which encodes the p105 and p50 proteins of transcription factors NF-{kappa}B and I{kappa}B-{gamma}: Implications for NF-{kappa}B-mediated signal transduction

    Energy Technology Data Exchange (ETDEWEB)

    Heron, E.; Deloukas, P.; van Loon, A.P.G.M. [F. Hoffmann-La Roche Limited, Basel (Switzerland)

    1995-12-10

    The NFKB1 gene encodes three proteins of the NF-{kappa}/Rel and I{kappa}B families: p105, p50, and (in mouse) I{kappa}B-{gamma}. We determined the complete genomic structure of human NFKB1. NFKB1 spans 156 kb and has 24 exons with introns varying between 40,000 and 323 bp in length. Although NFKB2, which encodes p100 and p52, also has 24 exons and has a comparable exon-intron structure, it is 20 times shorter than NFKB1. We propose that the long size of NFKB1 is important for transient activation of NF-{kappa}B complexes containing p50. I{kappa}B-{gamma} corresponds to the carboxyl-terminal half of p105. DNA sequence analysis showed that the 3{prime}-end of human intron 11 and the 5{prime}-end of exon 12 of NFKB1 are colinear with the 5{prime}-untranslated region of mouse I{kappa}B-{gamma} cDNA. I{kappa}B-{gamma} is thus likely to be generated by transcription starting within intron 11 and not by alternative splicing of the mouse mRNA encoding p105 and p50. 71 refs., 5 figs., 1 tab.

  2. Invariant U2 snRNA nucleotides form a stem loop to recognize the intron early in splicing.

    Science.gov (United States)

    Perriman, Rhonda; Ares, Manuel

    2010-05-14

    U2 snRNA-intron branchpoint pairing is a critical step in pre-mRNA recognition by the splicing apparatus, but the mechanism by which these two RNAs engage each other is unknown. Here, we identify a U2 snRNA structure, the branchpoint-interacting stem loop (BSL), which presents the U2 nucleotides that will contact the intron. We provide evidence that the BSL forms prior to interaction with the intron and is disrupted by the DExD/H protein Prp5p during engagement of the snRNA with the intron. In vitro splicing complex assembly in a BSL-destabilized mutant extract suggests that the BSL is required at a previously unrecognized step between commitment complex and prespliceosome formation. The extreme evolutionary conservation of the BSL suggests that it represents an ancient structural solution to the problem of intron branchpoint recognition by dynamic RNA elements that must serve multiple functions at other times during splicing. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  3. Phylogenetic studies of pantherine cats (Felidae) based on multiple genes, with novel application of nuclear beta-fibrinogen intron 7 to carnivores.

    Science.gov (United States)

    Yu, Li; Zhang, Ya-Ping

    2005-05-01

    The pantherine lineage of the cat family Felidae (order: Carnivora) includes five big cats of genus Panthera and a great many midsized cats known worldwide. Presumably because of their recent and rapid radiation, the evolutionary relationship among pantherines remains ambiguous. We provide an independent assessment of the evolutionary history of pantherine lineage using two complete mitochondrial (mt) genes (ND2 and ND4) and the nuclear beta-fibrinogen intron 7 gene, whose utility in carnivoran phylogeny was first explored. The available four mt (ND5, cytb, 12S, and 16SrRNA) and two nuclear (IRBP and TTR) sequence loci were also combined to reconstruct phylogeny of 14 closely related cat species. Our analyses of combined mt data (six genes; approximately 3750 bp) and combined mt and nuclear data (nine genes; approximately 6500 bp) obtained identical tree topologies, which were well-resolved and strongly supported for almost all nodes. Monophyly of Panthera genus in pantherine lineage was confirmed and interspecific affinities within this genus revealed a novel branching pattern, with P. tigris diverging first in Panthera genus, followed by P. onca, P. leo, and last two sister species P. pardus and P. uncia. In addition, close association of Neofelis nebulosa to Panthera, the phylogenetic redefinition of Otocolobus manul within the domestic cat group, and the relatedness of Acinonyx jubatus and Puma concolor were all important findings in the resulting phylogenies. The potential utilities of nine different genes for phylogenetic resolution of closely related pantherine species were also evaluated, with special interest in that of the novel nuclear beta-fibrinogen intron 7.

  4. Semantic Search-Based Genetic Programming and the Effect of Intron Deletion.

    Science.gov (United States)

    Castelli, Mauro; Vanneschi, Leonardo; Silva, Sara

    2014-01-01

    The concept of semantics (in the sense of input-output behavior of solutions on training data) has been the subject of a noteworthy interest in the genetic programming (GP) research community over the past few years. In this paper, we present a new GP system that uses the concept of semantics to improve search effectiveness. It maintains a distribution of different semantic behaviors and biases the search toward solutions that have similar semantics to the best solutions that have been found so far. We present experimental evidence of the fact that the new semantics-based GP system outperforms the standard GP and the well-known bacterial GP on a set of test functions, showing particularly interesting results for noncontinuous (i.e., generally harder to optimize) test functions. We also observe that the solutions generated by the proposed GP system often have a larger size than the ones returned by standard GP and bacterial GP and contain an elevated number of introns, i.e., parts of code that do not have any effect on the semantics. Nevertheless, we show that the deletion of introns during the evolution does not affect the performance of the proposed method.

  5. Regulatory single nucleotide polymorphisms at the beginning of intron 2 of the human gene

    Indian Academy of Sciences (India)

    Elena V Antontseva; Marina Yu Matveeva; Natalia P Bondar; Elena V Kashina; Elena Yu Leberfarb; Leonid O Bryzgalov; Polina A Gervas; Anastasia A Ponomareva; Nadezhda V Cherdyntseva; Yury L Orlov; Tatiana I Merkulova

    2015-12-01

    There are two regulatory single nucleotide polymorphisms (rSNPs) at the beginning of the second intron of the mouse - gene that are strongly associated with lung cancer susceptibility. We performed functional analysis of three SNPs (rs12228277: T>A, rs12226937: G>A, and rs61761074: T>G) located in the same region of human . We found that rs12228277 and rs61761074 result in differential binding patterns of lung nuclear proteins to oligonucleotide probes corresponding two alternative alleles; in both cases, the transcription factor NF-Y is involved. G>A substitution (rs12226937) had no effect on the binding of lung nuclear proteins. However, all the nucleotide substitutions under study showed functional effects in a luciferase reporter assay. Among them, rs61761074 demonstrated a significant correlation with allele frequency in non-small-cell lung cancer (NSCLC). Taken together, the results of our study suggest that a T>G substitution at nucleotide position 615 in the second intron of the KRAS gene (rs61761074) may represent a promising genetic marker of NSCLC.

  6. Use of ribosomal introns as new markers of genetic diversity in Exophiala dermatitidis.

    Science.gov (United States)

    Machouart, Marie; Gueidan, Cécile; Khemisti, Arnaud; Dulongcourty, Rémy; Sudhadham, Montarop; de Hoog, G Sybren

    2011-10-01

    Exophiala dermatitidis is one of the prevalent black yeasts found as opportunistic pathogens or colonizers in humans. In the tropics its natural habitat is thought to be fruit surfaces and it is also found in the digestive system of fruit-eating animals. However, it has recently been abundantly isolated from human-made environments (steam baths, railway ties, dishwashers) in tropical and temperate climates. Two genotypes have been distinguished within this species: genotype A, mostly corresponding to strains isolated from patients, and genotype B, to strains isolated from the natural environment. In human-made environments, both genotypes A and B occur. A previous study suggested that one genotype had been selected for in the human host. In our study, the distribution of ribosomal insertions agrees with an ecological specialization of E. dermatitidis genotypes by showing a significantly higher frequency of ribosomal insertions in clinical strains in comparison to environmental ones. The characterization of these insertions shows that they correspond to introns of group IC or IE, the most frequent types within the fungal kingdom. These ribosomal group I introns could be used as new markers for populations of E. dermatitidis.

  7. Induction of antagonistic soluble decoy receptor tyrosine kinases by intronic polyA activation.

    Science.gov (United States)

    Vorlová, Sandra; Rocco, Gina; Lefave, Clare V; Jodelka, Francine M; Hess, Ken; Hastings, Michelle L; Henke, Erik; Cartegni, Luca

    2011-09-16

    Alternative intronic polyadenylation (IPA) can generate truncated protein isoforms with significantly altered functions. Here, we describe 31 dominant-negative, secreted variant isoforms of receptor tyrosine kinases (RTKs) that are produced by activation of intronic poly(A) sites. We show that blocking U1-snRNP can activate IPA, indicating a larger role for U1-snRNP in RNA surveillance. Moreover, we report the development of an antisense-based method to effectively and specifically activate expression of individual soluble decoy RTKs (sdRTKs) to alter signaling, with potential therapeutic implications. In particular, a quantitative switch from signal transducing full-length vascular endothelial growth factor receptor-2 (VEGFR2/KDR) to a dominant-negative sKDR results in a strong antiangiogenic effect both on directly targeted cells and on naive cells exposed to conditioned media, suggesting a role for this approach in interfering with angiogenic paracrine and autocrine loops. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Exploiting mid-range DNA patterns for sequence classification: binary abstraction Markov models

    Science.gov (United States)

    Shepard, Samuel S.; McSweeny, Andrew; Serpen, Gursel; Fedorov, Alexei

    2012-01-01

    Messenger RNA sequences possess specific nucleotide patterns distinguishing them from non-coding genomic sequences. In this study, we explore the utilization of modified Markov models to analyze sequences up to 44 bp, far beyond the 8-bp limit of conventional Markov models, for exon/intron discrimination. In order to analyze nucleotide sequences of this length, their information content is first reduced by conversion into shorter binary patterns via the application of numerous abstraction schemes. After the conversion of genomic sequences to binary strings, homogenous Markov models trained on the binary sequences are used to discriminate between exons and introns. We term this approach the Binary Abstraction Markov Model (BAMM). High-quality abstraction schemes for exon/intron discrimination are selected using optimization algorithms on supercomputers. The best MM classifiers are then combined using support vector machines into a single classifier. With this approach, over 95% classification accuracy is achieved without taking reading frame into account. With further development, the BAMM approach can be applied to sequences lacking the genetic code such as ncRNAs and 5′-untranslated regions. PMID:22344692

  9. Conservation of the Exon-Intron Structure of Long Intergenic Non-Coding RNA Genes in Eutherian Mammals

    Directory of Open Access Journals (Sweden)

    Diana Chernikova

    2016-07-01

    Full Text Available The abundance of mammalian long intergenic non-coding RNA (lincRNA genes is high, yet their functions remain largely unknown. One possible way