International Nuclear Information System (INIS)
Altomare, Deborah A; Rybak, Susanna M; Pei, Jianming; Maizel, Jacob V; Cheung, Mitchell; Testa, Joseph R; Shogen, Kuslima
2010-01-01
Onconase represents a new class of RNA-damaging drugs. Mechanistically, Onconase is thought to internalize, where it degrades intracellular RNAs such as tRNA and double-stranded RNA, and thereby suppresses protein synthesis. However, there may be additional or alternative mechanism(s) of action. In this study, microarray analysis was used to compare gene expression profiles in untreated human malignant mesothelioma (MM) cell lines and cells exposed to 5 μg/ml Onconase for 24 h. A total of 155 genes were found to be regulated by Onconase that were common to both epithelial and biphasic MM cell lines. Some of these genes are known to significantly affect apoptosis (IL-24, TNFAIP3), transcription (ATF3, DDIT3, MAFF, HDAC9, SNAPC1) or inflammation and the immune response (IL-6, COX-2). RT-PCR analysis of selected up- or down-regulated genes treated with varying doses and times of Onconase generally confirmed the expression array findings in four MM cell lines. Onconase treatment consistently resulted in up-regulation of IL-24, previously shown to have tumor suppressive activity, as well as ATF3 and IL-6. Induction of ATF3 and the pro-apoptotic factor IL-24 by Onconase was highest in the two most responsive MM cell lines, as defined by DNA fragmentation analysis. In addition to apoptosis, gene ontology analysis indicated that pathways impacted by Onconase include MAPK signaling, cytokine-cytokine-receptor interactions, and Jak-STAT signaling. These results provide a broad picture of gene activity after treatment with a drug that targets small non-coding RNAs and contribute to our overall understanding of MM cell response to Onconase as a therapeutic strategy. The findings provide insights regarding mechanisms that may contribute to the efficacy of this novel drug in clinical trials of MM patients who have failed first line chemotherapy or radiation treatment
Directory of Open Access Journals (Sweden)
Mariona Callís
Full Text Available Onconase® is a highly cytotoxic amphibian homolog of Ribonuclease A. Here, we describe the construction of circularly permuted Onconase® variants by connecting the N- and C-termini of this enzyme with amino acid residues that are recognized and cleaved by the human immunodeficiency virus protease. Uncleaved circularly permuted Onconase® variants are unusually stable, non-cytotoxic and can internalize in human T-lymphocyte Jurkat cells. The structure, stability and dynamics of an intact and a cleaved circularly permuted Onconase® variant were determined by Nuclear Magnetic Resonance spectroscopy and provide valuable insight into the changes in catalytic efficiency caused by the cleavage. The understanding of the structural environment and the dynamics of the activation process represents a first step toward the development of more effective drugs for the treatment of diseases related to pathogens expressing a specific protease. By taking advantage of the protease's activity to initiate a cytotoxic cascade, this approach is thought to be less susceptible to known resistance mechanisms.
Onconase-induced changes in radiation response and physiological parameters in solid tumors
International Nuclear Information System (INIS)
Lee, I.; Shui, C.; Shogen, K.; Mikulski, S.M.; Nunno, M.; Wallner, P.E.
1996-01-01
Purpose: Onconase (ONC), previously known as P-30 protein, is a novel basic amphibian protein isolated from eggs of the leopard frog. The original study conducted by Darzynkiewicz et al. (Cell Tissue Kinetics, 1988) demonstrated that ONC shows anti-proliferative and cytotoxic activities against several tumor cell lines in vitro. Since then, to our knowledge, no studies regarding the inhibitory effect of ONC in solid tumor models were performed. ONC is also known to inhibit cell-cycle progression from the radiation-sensitive G 1 phase to the radiation-resistant S phase. Thus, we examined the effect of ONC as a potential radiation sensitizer. The radiation response and physiological parameters were evaluated in C3H mice and/or nude mice bearing various (murine and/or human) tumor models. Materials and Method: First, we examined the effect of ONC on the cellular proliferative, as well as the clonogenic, response of various cell lines (i.e., H4IIE rat hepatoma, AsPC-1 human pancreas adenocarcinoma, DU145 human prostate carcinoma, LS174T human colon adenocarcinoma, A549 human lung carcinoma, MCaIV murine adenocarcinoma, FSaII murine fibrosarcoma, and CCL-209 bovine artery pulmonary endothelial cells) by using the MTT and clonogenic cell survival assays. Second, we determined the enhancement of radiation response before, during, and after treatment with ONC in several cell lines. Third, we determined whether ONC can inhibit the growth of solid tumors in vivo (i.e., FSaII and MCaIV in C3H mice, LS174T in nude mice). Fourth, we examined whether minocycline, an antiangiogenic agent, could amplify the tumoricidal efficacy of ONC in solid tumors. To test our hypothesis: if ONC could eradicate the outgrowth of tumor cells in confined spaces, it could lower the elevated pressure in solid tumors, we measured tumor interstitial fluid pressure (TIFP) using the wick-in-needle method, and systemic pressure using the right carotid artery cannulation method after treatment with ONC
KBERG: KnowledgeBase for Estrogen Responsive Genes
DEFF Research Database (Denmark)
Tang, Suisheng; Zhang, Zhuo; Tan, Sin Lam
2007-01-01
Estrogen has a profound impact on human physiology affecting transcription of numerous genes. To decipher functional characteristics of estrogen responsive genes, we developed KnowledgeBase for Estrogen Responsive Genes (KBERG). Genes in KBERG were derived from Estrogen Responsive Gene Database...... (ERGDB) and were analyzed from multiple aspects. We explored the possible transcription regulation mechanism by capturing highly conserved promoter motifs across orthologous genes, using promoter regions that cover the range of [-1200, +500] relative to the transcription start sites. The motif detection...... is based on ab initio discovery of common cis-elements from the orthologous gene cluster from human, mouse and rat, thus reflecting a degree of promoter sequence preservation during evolution. The identified motifs are linked to transcription factor binding sites based on the TRANSFAC database. In addition...
HRGFish: A database of hypoxia responsive genes in fishes
Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo
2017-02-01
Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.
T-cell activation and early gene response in dogs.
Directory of Open Access Journals (Sweden)
Sally-Anne Mortlock
Full Text Available T-cells play a crucial role in canine immunoregulation and defence against invading pathogens. Proliferation is fundamental to T-cell differentiation, homeostasis and immune response. Initiation of proliferation following receptor mediated stimuli requires a temporally programmed gene response that can be identified as immediate-early, mid- and late phases. The immediate-early response genes in T-cell activation engage the cell cycle machinery and promote subsequent gene activation events. Genes involved in this immediate-early response in dogs are yet to be identified. The present study was undertaken to characterise the early T-cell gene response in dogs to improve understanding of the genetic mechanisms regulating immune function. Gene expression profiles were characterised using canine gene expression microarrays and quantitative reverse transcription PCR (qRT-PCR, and paired samples from eleven dogs. Significant functional annotation clusters were identified following stimulation with phytohemagluttinin (PHA (5μg/ml, including the Toll-like receptor signaling pathway and phosphorylation pathways. Using strict statistical criteria, 13 individual genes were found to be differentially expressed, nine of which have ontologies that relate to proliferation and cell cycle control. These included, prostaglandin-endoperoxide synthase 2 (PTGS2/COX2, early growth response 1 (EGR1, growth arrest and DNA damage-inducible gene (GADD45B, phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, V-FOS FBJ murine osteosarcoma viral oncogene homolog (FOS, early growth response 2 (EGR2, hemogen (HEMGN, polo-like kinase 2 (PLK2 and polo-like kinase 3 (PLK3. Differential gene expression was re-examined using qRT-PCR, which confirmed that EGR1, EGR2, PMAIP1, PTGS2, FOS and GADD45B were significantly upregulated in stimulated cells and ALAS2 downregulated. PTGS2 and EGR1 showed the highest levels of response in these dogs. Both of these genes are involved in
Development of a radiation-responsive gene expression system
International Nuclear Information System (INIS)
Ogawa, Ryohei; Morii, Akihiro; Watanabe, Akihiko
2013-01-01
We have obtained a promoter enhancing expression of a gene of our interest connected downstream after activation in response to radiation stimulation and it could be used in radiogenetic therapy, a combination between radiotherapy and gene therapy. The promoter has been chosen out of a library of DNA fragments constructed by connecting the TATA box to randomly combined binding sequences of transcription factors that are activated in response to radiation. Although it was shown that the promoter activation was cell type specific, it turned out that radiation responsive promoters could be obtained for a different type of cells by using another set of transcription factor binding sequences, suggesting that the method would be feasible to obtain promoters functioning in any type of cells. Radiation reactivity of obtained promoters could be improved by techniques such as random introduction of point mutations. The improved promoters significantly enhanced expression of the luciferase gene connected downstream in response to radiation even in vivo, in addition, a gene cassette composed of one such promoter and the fcy::fur gene was confirmed useful for suicide gene therapy as shown in vitro simulation experiment, suggesting possible clinical application. (author)
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Host genetic variation influences gene expression response to rhinovirus infection.
Directory of Open Access Journals (Sweden)
Minal Çalışkan
2015-04-01
Full Text Available Rhinovirus (RV is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs, namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5 and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3. The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.
Host genetic variation influences gene expression response to rhinovirus infection.
Çalışkan, Minal; Baker, Samuel W; Gilad, Yoav; Ober, Carole
2015-04-01
Rhinovirus (RV) is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs) from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs) in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs), namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5) and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3). The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.
Diurnal oscillations of soybean circadian clock and drought responsive genes.
Directory of Open Access Journals (Sweden)
Juliana Marcolino-Gomes
Full Text Available Rhythms produced by the endogenous circadian clock play a critical role in allowing plants to respond and adapt to the environment. While there is a well-established regulatory link between the circadian clock and responses to abiotic stress in model plants, little is known of the circadian system in crop species like soybean. This study examines how drought impacts diurnal oscillation of both drought responsive and circadian clock genes in soybean. Drought stress induced marked changes in gene expression of several circadian clock-like components, such as LCL1-, GmELF4- and PRR-like genes, which had reduced expression in stressed plants. The same conditions produced a phase advance of expression for the GmTOC1-like, GmLUX-like and GmPRR7-like genes. Similarly, the rhythmic expression pattern of the soybean drought-responsive genes DREB-, bZIP-, GOLS-, RAB18- and Remorin-like changed significantly after plant exposure to drought. In silico analysis of promoter regions of these genes revealed the presence of cis-elements associated both with stress and circadian clock regulation. Furthermore, some soybean genes with upstream ABRE elements were responsive to abscisic acid treatment. Our results indicate that some connection between the drought response and the circadian clock may exist in soybean since (i drought stress affects gene expression of circadian clock components and (ii several stress responsive genes display diurnal oscillation in soybeans.
Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki
2011-01-01
The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847
Evolution and Stress Responses of Gossypium hirsutum SWEET Genes.
Li, Wei; Ren, Zhongying; Wang, Zhenyu; Sun, Kuan; Pei, Xiaoyu; Liu, Yangai; He, Kunlun; Zhang, Fei; Song, Chengxiang; Zhou, Xiaojian; Zhang, Wensheng; Ma, Xiongfeng; Yang, Daigang
2018-03-08
The SWEET (sugars will eventually be exported transporters) proteins are sugar efflux transporters containing the MtN3_saliva domain, which affects plant development as well as responses to biotic and abiotic stresses. These proteins have not been functionally characterized in the tetraploid cotton, Gossypium hirsutum , which is a widely cultivated cotton species. In this study, we comprehensively analyzed the cotton SWEET gene family. A total of 55 putative G. hirsutum SWEET genes were identified. The GhSWEET genes were classified into four clades based on a phylogenetic analysis and on the examination of gene structural features. Moreover, chromosomal localization and an analysis of homologous genes in Gossypium arboreum , Gossypium raimondii , and G. hirsutum suggested that a whole-genome duplication, several tandem duplications, and a polyploidy event contributed to the expansion of the cotton SWEET gene family, especially in Clade III and IV. Analyses of cis -acting regulatory elements in the promoter regions, expression profiles, and artificial selection revealed that the GhSWEET genes were likely involved in cotton developmental processes and responses to diverse stresses. These findings may clarify the evolution of G. hirsutum SWEET gene family and may provide a foundation for future functional studies of SWEET proteins regarding cotton development and responses to abiotic stresses.
Lenka, Sangram K; Lohia, Bikash; Kumar, Abhay; Chinnusamy, Viswanathan; Bansal, Kailash C
2009-02-01
Abscisic acid (ABA), the popular plant stress hormone, plays a key role in regulation of sub-set of stress responsive genes. These genes respond to ABA through specific transcription factors which bind to cis-regulatory elements present in their promoters. We discovered the ABA Responsive Element (ABRE) core (ACGT) containing CGMCACGTGB motif as over-represented motif among the promoters of ABA responsive co-expressed genes in rice. Targeted gene prediction strategy using this motif led to the identification of 402 protein coding genes potentially regulated by ABA-dependent molecular genetic network. RT-PCR analysis of arbitrarily chosen 45 genes from the predicted 402 genes confirmed 80% accuracy of our prediction. Plant Gene Ontology (GO) analysis of ABA responsive genes showed enrichment of signal transduction and stress related genes among diverse functional categories.
Faba bean drought responsive gene identification and validation
Directory of Open Access Journals (Sweden)
Megahed H. Ammar
2017-01-01
Full Text Available This study was carried out to identify drought-responsive genes in a drought tolerant faba bean variety (Hassawi 2 using a suppressive subtraction hybridization approach (SSH. A total of 913 differentially expressed clones were sequenced from a differential cDNA library that resulted in a total of 225 differentially expressed ESTs. The genes of mitochondrial and chloroplast origin were removed, and the remaining 137 EST sequences were submitted to the gene bank EST database (LIBEST_028448. A sequence analysis identified 35 potentially drought stress-related ESTs that regulate ion channels, kinases, and energy production and utilization and transcription factors. Quantitative PCR on Hassawi 2 genotype confirmed that more than 65% of selected drought-responsive genes were drought-related. Among these induced genes, the expression levels of eight highly up-regulated unigenes were further analyzed across 38 selected faba bean genotypes that differ in their drought tolerance levels. These unigenes included ribulose 1,5-bisphosphate carboxylase (rbcL gene, non-LTR retroelement reverse related, probable cyclic nucleotide-gated ion channel, polyubiquitin, potassium channel, calcium-dependent protein kinase and putative respiratory burst oxidase-like protein C and a novel unigene. The expression patterns of these unigenes were variable across 38 genotypes however, it was found to be very high in tolerant genotype. The up-regulation of these unigenes in majority of tolerant genotypes suggests their possible role in drought tolerance. The identification of possible drought responsive candidate genes in Vicia faba reported here is an important step toward the development of drought-tolerant genotypes that can cope with arid environments.
Plant Core Environmental Stress Response Genes Are Systemically Coordinated during Abiotic Stresses
Directory of Open Access Journals (Sweden)
Kenneth W. Berendzen
2013-04-01
Full Text Available Studying plant stress responses is an important issue in a world threatened by global warming. Unfortunately, comparative analyses are hampered by varying experimental setups. In contrast, the AtGenExpress abiotic stress experiment displays intercomparability. Importantly, six of the nine stresses (wounding, genotoxic, oxidative, UV-B light, osmotic and salt can be examined for their capacity to generate systemic signals between the shoot and root, which might be essential to regain homeostasis in Arabidopsis thaliana. We classified the systemic responses into two groups: genes that are regulated in the non-treated tissue only are defined as type I responsive and, accordingly, genes that react in both tissues are termed type II responsive. Analysis of type I and II systemic responses suggest distinct functionalities, but also significant overlap between different stresses. Comparison with salicylic acid (SA and methyl-jasmonate (MeJA responsive genes implies that MeJA is involved in the systemic stress response. Certain genes are predominantly responding in only one of the categories, e.g., WRKY genes respond mainly non-systemically. Instead, genes of the plant core environmental stress response (PCESR, e.g., ZAT10, ZAT12, ERD9 or MES9, are part of different response types. Moreover, several PCESR genes switch between the categories in a stress-specific manner.
Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.
Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H
2009-05-01
Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.
Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.
Directory of Open Access Journals (Sweden)
Marinus F van Batenburg
2010-01-01
Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.
Cooperative adaptive responses in gene regulatory networks with many degrees of freedom.
Inoue, Masayo; Kaneko, Kunihiko
2013-04-01
Cells generally adapt to environmental changes by first exhibiting an immediate response and then gradually returning to their original state to achieve homeostasis. Although simple network motifs consisting of a few genes have been shown to exhibit such adaptive dynamics, they do not reflect the complexity of real cells, where the expression of a large number of genes activates or represses other genes, permitting adaptive behaviors. Here, we investigated the responses of gene regulatory networks containing many genes that have undergone numerical evolution to achieve high fitness due to the adaptive response of only a single target gene; this single target gene responds to changes in external inputs and later returns to basal levels. Despite setting a single target, most genes showed adaptive responses after evolution. Such adaptive dynamics were not due to common motifs within a few genes; even without such motifs, almost all genes showed adaptation, albeit sometimes partial adaptation, in the sense that expression levels did not always return to original levels. The genes split into two groups: genes in the first group exhibited an initial increase in expression and then returned to basal levels, while genes in the second group exhibited the opposite changes in expression. From this model, genes in the first group received positive input from other genes within the first group, but negative input from genes in the second group, and vice versa. Thus, the adaptation dynamics of genes from both groups were consolidated. This cooperative adaptive behavior was commonly observed if the number of genes involved was larger than the order of ten. These results have implications in the collective responses of gene expression networks in microarray measurements of yeast Saccharomyces cerevisiae and the significance to the biological homeostasis of systems with many components.
Directory of Open Access Journals (Sweden)
Xiangshu Dong
Full Text Available Genome-wide dissection of the heat stress response (HSR is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5- 4 h at 45°C (high temperature, HT: 5.2% (2,142 genes in Chiifu and 3.7% (1,535 genes in Kenshin. The most enriched GO (Gene Ontology items included 'response to heat', 'response to reactive oxygen species (ROS', 'response to temperature stimulus', 'response to abiotic stimulus', and 'MAPKKK cascade'. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps and heat shock factor (Hsf-like proteins such as HsfB2A (Bra029292, whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853, protein kinases, and phosphatases. Among heat stress (HS marker genes in Arabidopsis, only exportin 1A (XPO1A (Bra008580, Bra006382 can be applied to B. rapa for basal thermotolerance (BT and short-term acquired thermotolerance (SAT gene. CYP707A3 (Bra025083, Bra021965, which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF genes, including DREB2A (Bra005852, were involved in HS tolerance in both lines, Bra024224 (MYB41 and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1] were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a
Directory of Open Access Journals (Sweden)
Hettne Kristina M
2013-01-01
Full Text Available Abstract Background Availability of chemical response-specific lists of genes (gene sets for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM, and that these can be used with gene set analysis (GSA methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human and 588 (mouse gene sets from the Comparative Toxicogenomics Database (CTD. We tested for significant differential expression (SDE (false discovery rate -corrected p-values Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Conclusions Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect.
Computational method for discovery of estrogen responsive genes
DEFF Research Database (Denmark)
Tang, Suisheng; Tan, Sin Lam; Ramadoss, Suresh Kumar
2004-01-01
Estrogen has a profound impact on human physiology and affects numerous genes. The classical estrogen reaction is mediated by its receptors (ERs), which bind to the estrogen response elements (EREs) in target gene's promoter region. Due to tedious and expensive experiments, a limited number of hu...
Essack, Magbubah
2012-10-26
Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first
Essack, Magbubah; MacPherson, Cameron Ross; Schmeier, Sebastian; Bajic, Vladimir B.
2012-01-01
Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first
Contribution of electrostatics to the binding of pancreatic-type ribonucleases to membranes.
Sundlass, Nadia K; Eller, Chelcie H; Cui, Qiang; Raines, Ronald T
2013-09-17
Pancreatic-type ribonucleases show clinical promise as chemotherapeutic agents but are limited in efficacy by the inefficiency of their uptake by human cells. Cellular uptake can be increased by the addition of positive charges to the surface of ribonucleases, either by site-directed mutagenesis or by chemical modification. This observation has led to the hypothesis that ribonuclease uptake by cells depends on electrostatics. Here, we use a combination of experimental and computational methods to ascertain the contribution of electrostatics to the cellular uptake of ribonucleases. We focus on three homologous ribonucleases: Onconase (frog), ribonuclease A (cow), and ribonuclease 1 (human). Our results support the hypothesis that electrostatics are necessary for the cellular uptake of Onconase. In contrast, specific interactions with cell-surface components likely contribute more to the cellular uptake of ribonuclease A and ribonuclease 1 than do electrostatics. These findings provide insight for the design of new cytotoxic ribonucleases.
2013-01-01
Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the
Gene expression of corals in response to macroalgal competitors.
Directory of Open Access Journals (Sweden)
Tonya L Shearer
Full Text Available As corals decline and macroalgae proliferate on coral reefs, coral-macroalgal competition becomes more frequent and ecologically important. Whether corals are damaged by these interactions depends on susceptibility of the coral and traits of macroalgal competitors. Investigating changes in gene expression of corals and their intracellular symbiotic algae, Symbiodinium, in response to contact with different macroalgae provides insight into the biological processes and cellular pathways affected by competition with macroalgae. We evaluated the gene expression profiles of coral and Symbiodinium genes from two confamilial corals, Acropora millepora and Montipora digitata, after 6 h and 48 h of contact with four common macroalgae that differ in their allelopathic potency to corals. Contacts with macroalgae affected different biological pathways in the more susceptible (A. millepora versus the more resistant (M. digitata coral. Genes of coral hosts and of their associated Symbiodinium also responded in species-specific and time-specific ways to each macroalga. Changes in number and expression intensity of affected genes were greater after 6 h compared to 48 h of contact and were greater following contact with Chlorodesmis fastigiata and Amphiroa crassa than following contact with Galaxaura filamentosa or Turbinaria conoides. We documented a divergence in transcriptional responses between two confamilial corals and their associated Symbiodinium, as well as a diversity of dynamic responses within each coral species with respect to the species of macroalgal competitor and the duration of exposure to that competitor. These responses included early initiation of immune processes by Montipora, which is more resistant to damage after long-term macroalgal contact. Activation of the immune response by corals that better resist algal competition is consistent with the hypothesis that some macroalgal effects on corals may be mediated by microbial pathogens.
Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response
Directory of Open Access Journals (Sweden)
Nasrine Bendjilali
2017-01-01
Full Text Available Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen.
Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response.
Bendjilali, Nasrine; MacLeon, Samuel; Kalra, Gurmannat; Willis, Stephen D; Hossian, A K M Nawshad; Avery, Erica; Wojtowicz, Olivia; Hickman, Mark J
2017-01-05
Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq) analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR) analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR) consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen. Copyright © 2017 Bendjilali et al.
Memory responses of jasmonic acid-associated Arabidopsis genes to a repeated dehydration stress.
Liu, Ning; Staswick, Paul E; Avramova, Zoya
2016-11-01
Dehydration stress activates numerous genes co-regulated by diverse signaling pathways. Upon repeated exposures, however, a subset of these genes does not respond maintaining instead transcription at their initial pre-stressed levels ('revised-response' genes). Most of these genes are involved in jasmonic acid (JA) biosynthesis, JA-signaling and JA-mediated stress responses. How these JA-associated genes are regulated to provide different responses to similar dehydration stresses is an enigma. Here, we investigate molecular mechanisms that contribute to this transcriptional behavior. The memory-mechanism is stress-specific: one exposure to dehydration stress or to abscisic acid (ABA) is required to prevent transcription in the second. Both ABA-mediated and JA-mediated pathways are critical for the activation of these genes, but the two signaling pathways interact differently during a single or multiple encounters with dehydration stress. Synthesis of JA during the first (S1) but not the second dehydration stress (S2) accounts for the altered transcriptional responses. We propose a model for these memory responses, wherein lack of MYC2 and of JA synthesis in S2 is responsible for the lack of expression of downstream genes. The similar length of the memory displayed by different memory-type genes suggests biological relevance for transcriptional memory as a gene-regulating mechanism during recurring bouts of drought. © 2016 John Wiley & Sons Ltd.
Dynamic gene expression response to altered gravity in human T cells.
Thiel, Cora S; Hauschild, Swantje; Huge, Andreas; Tauber, Svantje; Lauber, Beatrice A; Polzer, Jennifer; Paulsen, Katrin; Lier, Hartwin; Engelmann, Frank; Schmitz, Burkhard; Schütte, Andreas; Layer, Liliana E; Ullrich, Oliver
2017-07-12
We investigated the dynamics of immediate and initial gene expression response to different gravitational environments in human Jurkat T lymphocytic cells and compared expression profiles to identify potential gravity-regulated genes and adaptation processes. We used the Affymetrix GeneChip® Human Transcriptome Array 2.0 containing 44,699 protein coding genes and 22,829 non-protein coding genes and performed the experiments during a parabolic flight and a suborbital ballistic rocket mission to cross-validate gravity-regulated gene expression through independent research platforms and different sets of control experiments to exclude other factors than alteration of gravity. We found that gene expression in human T cells rapidly responded to altered gravity in the time frame of 20 s and 5 min. The initial response to microgravity involved mostly regulatory RNAs. We identified three gravity-regulated genes which could be cross-validated in both completely independent experiment missions: ATP6V1A/D, a vacuolar H + -ATPase (V-ATPase) responsible for acidification during bone resorption, IGHD3-3/IGHD3-10, diversity genes of the immunoglobulin heavy-chain locus participating in V(D)J recombination, and LINC00837, a long intergenic non-protein coding RNA. Due to the extensive and rapid alteration of gene expression associated with regulatory RNAs, we conclude that human cells are equipped with a robust and efficient adaptation potential when challenged with altered gravitational environments.
Dose response relationship in anti-stress gene regulatory networks.
Zhang, Qiang; Andersen, Melvin E
2007-03-02
To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products) in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear) depends on changes in the specific values of local response coefficients (gains) distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear, and depending on
Dose response relationship in anti-stress gene regulatory networks.
Directory of Open Access Journals (Sweden)
Qiang Zhang
2007-03-01
Full Text Available To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear depends on changes in the specific values of local response coefficients (gains distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear
Hettne, K.M.; Boorsma, A.; Dartel, D.A. van; Goeman, J.J.; Jong, E. de; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.
2013-01-01
BACKGROUND: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set
Hettne, K.M.; Boorsma, A.; Dartel, van D.A.M.; Goeman, J.J.; Jong, de E.; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.
2013-01-01
Background: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set
Role of X-ray-inducible genes and proteins in adaptive survival responses
International Nuclear Information System (INIS)
Meyers, M.; Schea, R.A.; Petrowski, A.E.; Seabury, H.; McLaughlin, P.W.; Lee, I.; Lee, S.W.; Boothman, D.A.
1992-01-01
Certain X-ray-inducible genes and their corresponding protein products, appearing following low priming doses of ionizing radiation may subsequently give rise to an adaptive survival response, ultimately leading to increased radioresistance. Further, this adaptive radioresistance may be due to increased DNA repair (or misrepair) processes. Ultimately, the function of low-dose-induced cDNA clones within the cell is hoped to elucidate to follow the effects of specific gene turn-off on adaptive responses. Future research must determine the various functions of adaptive response gene products so that the beneficial or deleterious consequences of adaptive responses, which increases resistance to ionizing radiation, can be determined. (author). 19 refs., 1 fig
Global SUMO proteome responses guide gene regulation, mRNA biogenesis, and plant stress responses
Directory of Open Access Journals (Sweden)
Magdalena eMazur
2012-09-01
Full Text Available Small-ubiquitin-like MOdifier (SUMO is a key regulator of abiotic stress, disease resistance and development in plants. The identification of >350 plant SUMO targets has revealed many processes modulated by SUMO and potential consequences of SUMO on its targets. Importantly, highly related proteins are SUMO-modified in plants, yeast, and metazoans. Overlapping SUMO targets include heat-shock proteins, transcription regulators, histones, histone-modifying enzymes, proteins involved in DNA damage repair, but also proteins involved in mRNA biogenesis and nucleo-cytoplasmic transport. Proteomics studies indicate key roles for SUMO in gene repression by controlling histone (deacetylation activity at genomic loci. The responsible heavily sumoylated transcriptional repressor complexes are recruited by EAR (Ethylene-responsive element binding factor [ERF]-associated Amphiphilic Repression-motif containing transcription factors in plants. These transcription factors are not necessarily themselves a SUMO target. Conversely, SUMO acetylation prevents binding of downstream partners by preventing binding of SIMs (SUMO-interaction peptide motifs presents in these partners, while SUMO acetylation has emerged as mechanism to recruit specifically bromodomains; bromodomain are generally linked with gene activation. These findings strengthen the idea of a bidirectional sumo-/acetylation switch in gene regulation. Quantitative proteomics has highlighted that global sumoylation provides a dynamic response to protein damage involving SUMO chain-mediated protein degradation, but also SUMO E3 ligase-dependent transcription of HSP (Heat-shock protein genes. With these insights in SUMO function and novel technical advancements, we can now study SUMO dynamics in responses to (abiotic stress in plants.
Superoxide-responsive gene expression in Arabidopsis thaliana and Zea mays.
Xu, Junhuan; Tran, Thu; Padilla Marcia, Carmen S; Braun, David M; Goggin, Fiona L
2017-08-01
Superoxide (O 2 - ) and other reactive oxygen species (ROS) are generated in response to numerous biotic and abiotic stresses. Different ROS have been reported to elicit different transcriptional responses in plants, and so ROS-responsive marker genes and promoter::reporter gene fusions have been proposed as indirect means of detecting ROS and discriminating among different species. However, further information about the specificity of transcriptional responses to O 2 - is needed in order to assess potential markers for this critical stress-responsive signaling molecule. Using qRT-PCR, the expression of 12 genes previously reported to be upregulated by O 2 - was measured in Arabidopsis thaliana plants exposed to elicitors of common stress-responsive ROS: methyl viologen (an inducer of O 2 - ), rose bengal (an inducer of singlet oxygen, 1 ΔO 2 ), and exogenous hydrogen peroxide (H 2 O 2 ). Surprisingly, Zinc-Finger Protein 12 (AtZAT12), which had previously been used as a reporter for H 2 O 2 , responded more strongly to O 2 - than to H 2 O 2 ; moreover, the expression of an AtZAT12 promoter-reporter fusion (AtZAT12::Luc) was enhanced by diethyldithiocarbamate, which inhibits dismutation of O 2 - to H 2 O 2 . These results suggest that AtZAT12 is transcriptionally upregulated in response to O 2 - , and that AtZAT12::Luc may be a useful biosensor for detecting O 2 - generation in vivo. In addition, transcripts encoding uncoupling proteins (AtUCPs) showed selectivity for O 2 - in Arabidopsis, and an AtUCP homolog upregulated by methyl viologen was also identified in maize (Zea mays L.), indicating that there are O 2 - -responsive members of this family in monocots. These results expand our limited knowledge of ROS-responsive gene expression in monocots, as well as O 2 - -selective responses in dicots. Copyright © 2017 The Authors. Published by Elsevier Masson SAS.. All rights reserved.
Directory of Open Access Journals (Sweden)
Fernanda M Rodríguez-Tornos
Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.
Immunoglobulin gene usage in the human anti-pathogen response.
Newkirk, M M; Rioux, J D
1995-09-01
The human antibody response to foreign pathogens is generated to a relatively small number of target surface proteins and carbohydrates that nonetheless have an extensive array of epitopes. The study of human monoclonal antibodies to different pathogens shows that there are a diversity of mechanisms used to generate a sufficient repertoire of antibodies to combat the invading pathogens. Although many different immunoglobulin gene elements are used to construct the anti-pathogen response, some elements are used more often than would be expected if all elements were used randomly. For example, the immune response to Haemophilus influenzae polysaccharide appears to be quite narrow, being restricted primarily to a specific heavy-chain gene, 3-15, and a lambda light-chain family II member, 4A. In contrast, for the immune response to cytomegalovirus proteins, a wider group of gene elements is needed. It is also surprising that despite an investigator bias for IgG- rather than IgM-secreting immortal B cells (because of their high affinity and neutralizing abilities), 26% of light chains and 13% of heavy chains showed a very low level of somatic mutation, equivalent to an IgM molecule that has not undergone affinity maturation. Although some highly mutated IgG molecules are present in the anti-pathogen response, most of the monoclonal antibodies specific for viruses or bacteria have a level of somatic hypermutation similar to that of the adult IgM repertoire. A number of studies have shown that there are similarities in the antibody responses to pathogens and to self (autoantibodies).(ABSTRACT TRUNCATED AT 250 WORDS)
Study of the Genes and Mechanism Involved in the Radioadaptive Response
Dasgupta, Pushan R.
2009-01-01
The radioadaptive response is a phenomenon where exposure to a prior low dose of radiation reduces the level of damage induced by a subsequent high radiation dose. The molecular mechanism behind this is still not well understood. Learning more about the radioadaptive response is critical for long duration spaceflight since astronauts are exposed to low levels of cosmic radiation. The micronucleus assay was used to measure the level of damage caused by radiation. Although cells which were not washed with phosphate buffered saline (PBS) after a low priming dose of 5cGy did not show adaptation to the challenge dose, washing the cells with PBS and giving the cells fresh media after the low dose did allow radioadaptation to occur. This is consistent with the results of a previous publication by another research group. In the present study, genes involved in DNA damage signaling and the oxidative stress response were studied using RT PCR techniques in order to look at changes in expression level after the low dose with or without washing. Our preliminary results indicate that upregulation of oxidative stress response genes ANGPTL7, NCF2, TTN, and SRXN1 may be involved in the radioadaptive response. The low dose of radiation alone was found to activate the oxidative stress response genes GPR156 and MTL5, whereas, washing the cells alone caused relatively robust upregulation of the oxidative stress response genes DUSP1 and PTGS2. Washing after the priming dose showed some changes in the expression level of several DNA damage signaling genes. In addition, we studied whether washing the cells after the priming dose has an effect on the level of nitric oxide in both the media and cells, since nitric oxide levels are known to increase in the media of the cells after a high dose of radiation only if the cells were already exposed to a low priming dose. Based on this preliminary study, we propose that washing the cells after priming exposure actually eliminates some factor
K.M. Hettne (Kristina); J. Boorsma (Jeffrey); D.A.M. van Dartel (Dorien A M); J.J. Goeman (Jelle); E.C. de Jong (Esther); A.H. Piersma (Aldert); R.H. Stierum (Rob); J. Kleinjans (Jos); J.A. Kors (Jan)
2013-01-01
textabstractBackground: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with
Tetteh, Antonia Y; Sun, Katherine H; Hung, Chiu-Yueh; Kittur, Farooqahmed S; Ibeanu, Gordon C; Williams, Daniel; Xie, Jiahua
2014-01-01
Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se(0)), but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3) treatment and then used quantitative real-time PCR (qRT-PCR) to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys) biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼ 50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼ 30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF) whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S) metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process.
Regulation of the E. coli SOS response by the lexA gene product
International Nuclear Information System (INIS)
Brent, R.
1983-01-01
In an Escherichia coli that is growing normally, transcription of many genes is repressed by the product of the lexA gene. If cellular DNA is damaged, proteolytically competent recA protein (recA protease) inactivates lexA protein and these genes are induced. Many of the cellular phenomena observed during the cellular response to DNA damage (the SOS response) are the consequence of the expression of these lexA-prepressed genes. Since the SOS response of E. coli has recently been the subject of a comprehensive review, in this paper I would like to concentrate on some modifications to the picture based on new data. 12 references, 2 figures
Bhargava, Apurva; Clabaugh, Ivory; To, Jenn P; Maxwell, Bridey B; Chiang, Yi-Hsuan; Schaller, G Eric; Loraine, Ann; Kieber, Joseph J
2013-05-01
Cytokinins are N(6)-substituted adenine derivatives that play diverse roles in plant growth and development. We sought to define a robust set of genes regulated by cytokinin as well as to query the response of genes not represented on microarrays. To this end, we performed a meta-analysis of microarray data from a variety of cytokinin-treated samples and used RNA-seq to examine cytokinin-regulated gene expression in Arabidopsis (Arabidopsis thaliana). Microarray meta-analysis using 13 microarray experiments combined with empirically defined filtering criteria identified a set of 226 genes differentially regulated by cytokinin, a subset of which has previously been validated by other methods. RNA-seq validated about 73% of the up-regulated genes identified by this meta-analysis. In silico promoter analysis indicated an overrepresentation of type-B Arabidopsis response regulator binding elements, consistent with the role of type-B Arabidopsis response regulators as primary mediators of cytokinin-responsive gene expression. RNA-seq analysis identified 73 cytokinin-regulated genes that were not represented on the ATH1 microarray. Representative genes were verified using quantitative reverse transcription-polymerase chain reaction and NanoString analysis. Analysis of the genes identified reveals a substantial effect of cytokinin on genes encoding proteins involved in secondary metabolism, particularly those acting in flavonoid and phenylpropanoid biosynthesis, as well as in the regulation of redox state of the cell, particularly a set of glutaredoxin genes. Novel splicing events were found in members of some gene families that are known to play a role in cytokinin signaling or metabolism. The genes identified in this analysis represent a robust set of cytokinin-responsive genes that are useful in the analysis of cytokinin function in plants.
Oxytocin receptor gene variation predicts subjective responses to MDMA.
Bershad, Anya K; Weafer, Jessica J; Kirkpatrick, Matthew G; Wardle, Margaret C; Miller, Melissa A; de Wit, Harriet
2016-12-01
3,4-Methylenedioxymethamphetamine (MDMA, "ecstasy") enhances desire to socialize and feelings of empathy, which are thought to be related to increased oxytocin levels. Thus, variation in the oxytocin receptor gene (OXTR) may influence responses to the drug. Here, we examined the influence of a single OXTR nucleotide polymorphism (SNP) on responses to MDMA in humans. Based on findings that carriers of the A allele at rs53576 exhibit reduced sensitivity to oxytocin-induced social behavior, we hypothesized that these individuals would show reduced subjective responses to MDMA, including sociability. In this three-session, double blind, within-subjects study, healthy volunteers with past MDMA experience (N = 68) received a MDMA (0, 0.75 mg/kg, and 1.5 mg/kg) and provided self-report ratings of sociability, anxiety, and drug effects. These responses were examined in relation to rs53576. MDMA (1.5 mg/kg) did not increase sociability in individuals with the A/A genotype as it did in G allele carriers. The genotypic groups did not differ in responses at the lower MDMA dose, or in cardiovascular or other subjective responses. These findings are consistent with the idea that MDMA-induced sociability is mediated by oxytocin, and that variation in the oxytocin receptor gene may influence responses to the drug.
Gene expression in epithelial cells in response to pneumovirus infection
Directory of Open Access Journals (Sweden)
Rosenberg Helene F
2001-05-01
Full Text Available Abstract Respiratory syncytial virus (RSV and pneumonia virus of mice (PVM are viruses of the family Paramyxoviridae, subfamily pneumovirus, which cause clinically important respiratory infections in humans and rodents, respectively. The respiratory epithelial target cells respond to viral infection with specific alterations in gene expression, including production of chemoattractant cytokines, adhesion molecules, elements that are related to the apoptosis response, and others that remain incompletely understood. Here we review our current understanding of these mucosal responses and discuss several genomic approaches, including differential display reverse transcription-polymerase chain reaction (PCR and gene array strategies, that will permit us to unravel the nature of these responses in a more complete and systematic manner.
Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo
2014-09-17
DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.
Macrophage Expression of Inflammatory Genes in Response to EMCV Infection
Directory of Open Access Journals (Sweden)
Zachary R. Shaheen
2015-08-01
Full Text Available The expression and production of type 1 interferon is the classic cellular response to virus infection. In addition to this antiviral response, virus infection also stimulates the production of proinflammatory mediators. In this review, the pathways controlling the induction of inflammatory genes and the roles that these inflammatory mediators contribute to host defense against viral pathogens will be discussed. Specific focus will be on the role of the chemokine receptor CCR5, as a signaling receptor controlling the activation of pathways leading to virus-induced inflammatory gene expression.
Liu, Qiu-Ning; Zhu, Bao-Jian; Wang, Lei; Wei, Guo-Qing; Dai, Li-Shang; Lin, Kun-Zhang; Sun, Yu; Qiu, Jian-Feng; Fu, Wei-Wei; Liu, Chao-Liang
2013-11-01
Insects possess an innate immune system that responds to invading microorganisms. In this study, a subtractive cDNA library was constructed to screen for immune response-related genes in the fat bodies of Antheraea pernyi (Lepidoptera: Saturniidae) pupa challenged with Escherichia coli. Four hundred putative EST clones were identified by suppression subtractive hybridization (SSH), including 50 immune response-related genes, three cytoskeleton genes, eight cell cycle and apoptosis genes, five respiration and energy metabolism genes, five transport genes, 40 metabolism genes, ten stress response genes, four transcription and translation regulation genes and 77 unknown genes. To verify the reliability of the SSH data, the transcription of a set of randomly selected immune response-related genes were confirmed by semi-quantitative reverse transcription-PCR (RT-PCR) and real-time quantitative reverse transcription-PCR (qRT-PCR). These identified immune response-related genes provide insight into understanding the innate immunity in A. pernyi. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Antonia Y. Tetteh
2014-01-01
Full Text Available Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se0, but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3 treatment and then used quantitative real-time PCR (qRT-PCR to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process.
Stress, and pathogen response gene expression in modeled microgravity
Sundaresan, Alamelu; Pellis, Neal R.
2006-01-01
Purpose: Immune suppression in microgravity has been well documented. With the advent of human exploration and long-term space travel, the immune system of the astronaut must be optimally maintained. It is important to investigate the expression patterns of cytokine genes, because they are directly related to immune response. Heat shock proteins (HSPs), also called stress proteins, are a group of proteins that are present in the cells of every life form. These proteins are induced when a cell responds to stressors such as heat, cold and oxygen deprivation. Microgravity is another stressor that may regulate HSPs. Heat shock proteins trigger immune response through activities that occur both inside the cell (intracellular) and outside the cell (extracellular). Knowledge about these two gene groups could lead to establishment of a blueprint of the immune response and adaptation-related genes in the microgravity environment. Methods: Human peripheral blood cells were cultured in 1g (T flask) and modeled microgravity (MMG, rotating-wall vessel) for 24 and 72 hours. Cell samples were collected and subjected to gene array analysis using the Affymetrix HG_U95 array. Data was collected and subjected to a two-way analysis of variance. The genes related to immune and stress responses were analyzed. Results and Conclusions: HSP70 was up-regulated by more than two fold in microgravity culture, while HSP90 was significantly down-regulated. HSP70 is not typically expressed in all kinds of cells, but it is expressed at high levels in stress conditions. HSP70 participates in translation, protein translocation, proteolysis and protein folding, suppressing aggregation and reactivating denatured proteins. Increased serum HSP70 levels correlate with a better outcome for heat-stroke or severe trauma patients. At the same time, elevated serum levels of HSP70 have been detected in patients with peripheral or renal vascular disease. HSP90 has been identified in the cytosol, nucleus and
Development of chimeric gene promoters responsive to hypoxia and ionizing radiation
International Nuclear Information System (INIS)
Zheng Aiqing; Yu Jinming
2004-01-01
The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy
Yazaki, Junshi; Kikuchi, Shoshi
2005-01-01
We now have the various genomics tools for monocot (Oryza sativa) and a dicot (Arabidopsis thaliana) plant. Plant is not only a very important agricultural resource but also a model organism for biological research. It is important that the interaction between ABA and GA is investigated for controlling the transition from embryogenesis to germination in seeds using genomics tools. These studies have investigated the relationship between dormancy and germination using genomics tools. Genomics tools identified genes that had never before been annotated as ABA- or GA-responsive genes in plant, detected new interactions between genes responsive to the two hormones, comprehensively characterized cis-elements of hormone-responsive genes, and characterized cis-elements of rice and Arabidopsis. In these research, ABA- and GA-regulated genes have been classified as functional proteins (proteins that probably function in stress or PR tolerance) and regulatory proteins (protein factors involved in further regulation of signal transduction). Comparison between ABA and/or GA-responsive genes in rice and those in Arabidopsis has shown that the cis-element has specificity in each species. cis-Elements for the dehydration-stress response have been specified in Arabidopsis but not in rice. cis-Elements for protein storage are remarkably richer in the upstream regions of the rice gene than in those of Arabidopsis.
International Nuclear Information System (INIS)
Vadas, M.A.
1982-01-01
A heterogeneity in the capacity of strains of mice to mount eosinophilia is described. BALB/c and C3H are eosinophil high responder strains (EO-HR) and CBA and A/J are eosinophil low responder strains (EO-LR), judged by the response of blood eosinophils to Ascaris suum, and the response of blood, bone marrow, and spleen eosinophils to keyhole limpet hemocyanin given 2 days after 150 mg/kg cyclophosphamide. Some of the gene(s) for high responsiveness appear to be dominant because (EO-HR x EO-LR)F 1 mice were intermediate to high responders. This gene is expressed in bone marrow-derived cells because radiation chimeras of the type EO-HR→F 1 were high responders and EO-LR→F 1 were low responders. This description of a genetic control of eosinophilia in mice may be useful in understanding the role of this cell in parasite immunity and allergy
A core filamentation response network in Candida albicans is restricted to eight genes.
Directory of Open Access Journals (Sweden)
Ronny Martin
Full Text Available Although morphological plasticity is a central virulence trait of Candida albicans, the number of filament-associated genes and the interplay of mechanisms regulating their expression remain unknown. By correlation-based network modeling of the transcriptional response to different defined external stimuli for morphogenesis we identified a set of eight genes with highly correlated expression patterns, forming a core filamentation response. This group of genes included ALS3, ECE1, HGT2, HWP1, IHD1 and RBT1 which are known or supposed to encode for cell- wall associated proteins as well as the Rac1 guanine nucleotide exchange factor encoding gene DCK1 and the unknown function open reading frame orf19.2457. The validity of network modeling was confirmed using a dataset of advanced complexity that describes the transcriptional response of C. albicans during epithelial invasion as well as comparing our results with other previously published transcriptome studies. Although the set of core filamentation response genes was quite small, several transcriptional regulators are involved in the control of their expression, depending on the environmental condition.
A rice gene of de novo origin negatively regulates pathogen-induced defense response.
Directory of Open Access Journals (Sweden)
Wenfei Xiao
Full Text Available How defense genes originated with the evolution of their specific pathogen-responsive traits remains an important problem. It is generally known that a form of duplication can generate new genes, suggesting that a new gene usually evolves from an ancestral gene. However, we show that a new defense gene in plants may evolve by de novo origination, resulting in sophisticated disease-resistant functions in rice. Analyses of gene evolution showed that this new gene, OsDR10, had homologs only in the closest relative, Leersia genus, but not other subfamilies of the grass family; therefore, it is a rice tribe-specific gene that may have originated de novo in the tribe. We further show that this gene may evolve a highly conservative rice-specific function that contributes to the regulation difference between rice and other plant species in response to pathogen infections. Biologic analyses including gene silencing, pathologic analysis, and mutant characterization by transformation showed that the OsDR10-suppressed plants enhanced resistance to a broad spectrum of Xanthomonas oryzae pv. oryzae strains, which cause bacterial blight disease. This enhanced disease resistance was accompanied by increased accumulation of endogenous salicylic acid (SA and suppressed accumulation of endogenous jasmonic acid (JA as well as modified expression of a subset of defense-responsive genes functioning both upstream and downstream of SA and JA. These data and analyses provide fresh insights into the new biologic and evolutionary processes of a de novo gene recruited rapidly.
Expression profile of immune response genes in patients with Severe Acute Respiratory Syndrome
Directory of Open Access Journals (Sweden)
Tai Dessmon
2005-01-01
Full Text Available Abstract Background Severe acute respiratory syndrome (SARS emerged in later February 2003, as a new epidemic form of life-threatening infection caused by a novel coronavirus. However, the immune-pathogenesis of SARS is poorly understood. To understand the host response to this pathogen, we investigated the gene expression profiles of peripheral blood mononuclear cells (PBMCs derived from SARS patients, and compared with healthy controls. Results The number of differentially expressed genes was found to be 186 under stringent filtering criteria of microarray data analysis. Several genes were highly up-regulated in patients with SARS, such as, the genes coding for Lactoferrin, S100A9 and Lipocalin 2. The real-time PCR method verified the results of the gene array analysis and showed that those genes that were up-regulated as determined by microarray analysis were also found to be comparatively up-regulated by real-time PCR analysis. Conclusions This differential gene expression profiling of PBMCs from patients with SARS strongly suggests that the response of SARS affected patients seems to be mainly an innate inflammatory response, rather than a specific immune response against a viral infection, as we observed a complete lack of cytokine genes usually triggered during a viral infection. Our study shows for the first time how the immune system responds to the SARS infection, and opens new possibilities for designing new diagnostics and treatments for this new life-threatening disease.
Rice Yellow Mottle Virus stress responsive genes from susceptible and tolerant rice genotypes
Directory of Open Access Journals (Sweden)
Siré Christelle
2008-03-01
Full Text Available Abstract Background The effects of viral infection involve concomitant plant gene variations and cellular changes. A simple system is required to assess the complexity of host responses to viral infection. The genome of the Rice yellow mottle virus (RYMV is a single-stranded RNA with a simple organisation. It is the most well-known monocotyledon virus model. Several studies on its biology, structure and phylogeography have provided a suitable background for further genetic studies. 12 rice chromosome sequences are now available and provide strong support for genomic studies, particularly physical mapping and gene identification. Results The present data, obtained through the cDNA-AFLP technique, demonstrate differential responses to RYMV of two different rice cultivars, i.e. susceptible IR64 (Oryza sativa indica, and partially resistant Azucena (O. s. japonica. This RNA profiling provides a new original dataset that will enable us to gain greater insight into the RYMV/rice interaction and the specificity of the host response. Using the SIM4 subroutine, we took the intron/exon structure of the gene into account and mapped 281 RYMV stress responsive (RSR transcripts on 12 rice chromosomes corresponding to 234 RSR genes. We also mapped previously identified deregulated proteins and genes involved in partial resistance and thus constructed the first global physical map of the RYMV/rice interaction. RSR transcripts on rice chromosomes 4 and 10 were found to be not randomly distributed. Seven genes were identified in the susceptible and partially resistant cultivars, and transcripts were colocalized for these seven genes in both cultivars. During virus infection, many concomitant plant gene expression changes may be associated with host changes caused by the infection process, general stress or defence responses. We noted that some genes (e.g. ABC transporters were regulated throughout the kinetics of infection and differentiated susceptible and
MicroRNA-target gene responses to lead-induced stress in cotton (Gossypium hirsutum L.).
He, Qiuling; Zhu, Shuijin; Zhang, Baohong
2014-09-01
MicroRNAs (miRNAs) play key roles in plant responses to various metal stresses. To investigate the miRNA-mediated plant response to heavy metals, cotton (Gossypium hirsutum L.), the most important fiber crop in the world, was exposed to different concentrations (0, 25, 50, 100, and 200 µM) of lead (Pb) and then the toxicological effects were investigated. The expression patterns of 16 stress-responsive miRNAs and 10 target genes were monitored in cotton leaves and roots by quantitative real-time PCR (qRT-PCR); of these selected genes, several miRNAs and their target genes are involved in root development. The results show a reciprocal regulation of cotton response to lead stress by miRNAs. The characterization of the miRNAs and the associated target genes in response to lead exposure would help in defining the potential roles of miRNAs in plant adaptation to heavy metal stress and further understanding miRNA regulation in response to abiotic stress.
Local and global responses in complex gene regulation networks
Tsuchiya, Masa; Selvarajoo, Kumar; Piras, Vincent; Tomita, Masaru; Giuliani, Alessandro
2009-04-01
An exacerbated sensitivity to apparently minor stimuli and a general resilience of the entire system stay together side-by-side in biological systems. This apparent paradox can be explained by the consideration of biological systems as very strongly interconnected network systems. Some nodes of these networks, thanks to their peculiar location in the network architecture, are responsible for the sensitivity aspects, while the large degree of interconnection is at the basis of the resilience properties of the system. One relevant feature of the high degree of connectivity of gene regulation networks is the emergence of collective ordered phenomena influencing the entire genome and not only a specific portion of transcripts. The great majority of existing gene regulation models give the impression of purely local ‘hard-wired’ mechanisms disregarding the emergence of global ordered behavior encompassing thousands of genes while the general, genome wide, aspects are less known. Here we address, on a data analysis perspective, the discrimination between local and global scale regulations, this goal was achieved by means of the examination of two biological systems: innate immune response in macrophages and oscillating growth dynamics in yeast. Our aim was to reconcile the ‘hard-wired’ local view of gene regulation with a global continuous and scalable one borrowed from statistical physics. This reconciliation is based on the network paradigm in which the local ‘hard-wired’ activities correspond to the activation of specific crucial nodes in the regulation network, while the scalable continuous responses can be equated to the collective oscillations of the network after a perturbation.
2017-02-01
affecting the function of Fanconi Anemia (FA) genes ( FANCA /B/C/D2/E/F/G/I/J/L/M, PALB2) or DNA damage response genes involved in HR 5 (ATM, ATR...Award Number: W81XWH-10-1-0585 TITLE: A Gene Expression Profile of BRCAness That Predicts for Responsiveness to Platinum and PARP Inhibitors...To) 15 July 2010 – 2 Nov.2016 4. TITLE AND SUBTITLE A Gene Expression Profile of BRCAness That Predicts for Responsiveness to Platinum and PARP
Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro
Bortell, Nikki; Basova, Liana; Semenova, Svetlana; Fox, Howard S.; Ravasi, Timothy; Marcondes, Maria Cecilia G.
2017-01-01
BackgroundAstrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use.MethodsWe developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders.ResultsWe identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes.ConclusionsGene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.
Astrocyte-specific overexpressed gene signatures in response to methamphetamine exposure in vitro
Bortell, Nikki
2017-03-09
BackgroundAstrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use.MethodsWe developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders.ResultsWe identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes.ConclusionsGene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.
Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S
2005-07-15
A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.
Directory of Open Access Journals (Sweden)
Hai-Ting Hao
Full Text Available Some plant growth-promoting rhizobacteria (PGPR regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE profiling of different growth stages (seedling and mature and tissues (leaves and roots. Compared with the control, 1,507 and 820 differentially expressed genes (DEGs were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response
Directory of Open Access Journals (Sweden)
Kehua Wang
2017-06-01
Full Text Available Perennial ryegrass (Lolium perenne is one of the most widely used forage and turf grasses in the world due to its desirable agronomic qualities. However, as a cool-season perennial grass species, high temperature is a major factor limiting its performance in warmer and transition regions. In this study, a de novo transcriptome was generated using a cDNA library constructed from perennial ryegrass leaves subjected to short-term heat stress treatment. Then the expression profiling and identification of perennial ryegrass heat response genes by digital gene expression analyses was performed. The goal of this work was to produce expression profiles of high temperature stress responsive genes in perennial ryegrass leaves and further identify the potentially important candidate genes with altered levels of transcript, such as those genes involved in transcriptional regulation, antioxidant responses, plant hormones and signal transduction, and cellular metabolism. The de novo assembly of perennial ryegrass transcriptome in this study obtained more total and annotated unigenes compared to previously published ones. Many DEGs identified were genes that are known to respond to heat stress in plants, including HSFs, HSPs, and antioxidant related genes. In the meanwhile, we also identified four gene candidates mainly involved in C4 carbon fixation, and one TOR gene. Their exact roles in plant heat stress response need to dissect further. This study would be important by providing the gene resources for improving heat stress tolerance in both perennial ryegrass and other cool-season perennial grass plants.
Snapshot of iron response in Shewanella oneidensis by gene network reconstruction
Energy Technology Data Exchange (ETDEWEB)
Yang, Yunfeng; Harris, Daniel P.; Luo, Feng; Xiong, Wenlu; Joachimiak, Marcin; Wu, Liyou; Dehal, Paramvir; Jacobsen, Janet; Yang, Zamin; Palumbo, Anthony V.; Arkin, Adam P.; Zhou, Jizhong
2008-10-09
Background: Iron homeostasis of Shewanella oneidensis, a gamma-proteobacterium possessing high iron content, is regulated by a global transcription factor Fur. However, knowledge is incomplete about other biological pathways that respond to changes in iron concentration, as well as details of the responses. In this work, we integrate physiological, transcriptomics and genetic approaches to delineate the iron response of S. oneidensis. Results: We show that the iron response in S. oneidensis is a rapid process. Temporal gene expression profiles were examined for iron depletion and repletion, and a gene co-expression network was reconstructed. Modules of iron acquisition systems, anaerobic energy metabolism and protein degradation were the most noteworthy in the gene network. Bioinformatics analyses suggested that genes in each of the modules might be regulated by DNA-binding proteins Fur, CRP and RpoH, respectively. Closer inspection of these modules revealed a transcriptional regulator (SO2426) involved in iron acquisition and ten transcriptional factors involved in anaerobic energy metabolism. Selected genes in the network were analyzed by genetic studies. Disruption of genes encoding a putative alcaligin biosynthesis protein (SO3032) and a gene previously implicated in protein degradation (SO2017) led to severe growth deficiency under iron depletion conditions. Disruption of a novel transcriptional factor (SO1415) caused deficiency in both anaerobic iron reduction and growth with thiosulfate or TMAO as an electronic acceptor, suggesting that SO1415 is required for specific branches of anaerobic energy metabolism pathways. Conclusions: Using a reconstructed gene network, we identified major biological pathways that were differentially expressed during iron depletion and repletion. Genetic studies not only demonstrated the importance of iron acquisition and protein degradation for iron depletion, but also characterized a novel transcriptional factor (SO1415) with a
Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response.
Watson, Emma; MacNeil, Lesley T; Arda, H Efsun; Zhu, Lihua Julie; Walhout, Albertha J M
2013-03-28
Expression profiles are tailored according to dietary input. However, the networks that control dietary responses remain largely uncharacterized. Here, we combine forward and reverse genetic screens to delineate a network of 184 genes that affect the C. elegans dietary response to Comamonas DA1877 bacteria. We find that perturbation of a mitochondrial network composed of enzymes involved in amino acid metabolism and the TCA cycle affects the dietary response. In humans, mutations in the corresponding genes cause inborn diseases of amino acid metabolism, most of which are treated by dietary intervention. We identify several transcription factors (TFs) that mediate the changes in gene expression upon metabolic network perturbations. Altogether, our findings unveil a transcriptional response system that is poised to sense dietary cues and metabolic imbalances, illustrating extensive communication between metabolic networks in the mitochondria and gene regulatory networks in the nucleus. Copyright © 2013 Elsevier Inc. All rights reserved.
The 'warrior gene' and the Mãori people: the responsibility of the geneticists.
Perbal, Laurence
2013-09-01
The 'gene of' is a teleosemantic expression that conveys a simplistic and linear relationship between a gene and a phenotype. Throughout the 20th century, geneticists studied these genes of traits. The studies were often polemical when they concerned human traits: the 'crime gene', 'poverty gene', 'IQ gene', 'gay gene' or 'gene of alcoholism'. Quite recently, a controversy occurred in 2006 in New Zealand that started with the claim that a 'warrior gene' exists in the Mãori community. This claim came from a geneticist working on the MAOA gene. This article is interested in the responsibility of that researcher regarding the origin of the controversy. Several errors were made: overestimation of results, abusive use of the 'gene of' kind of expression, poor communication with the media and a lack of scientific culture. The issues of the debate were not taken into account sufficiently, either from the political, social, ethical or even the genetic points of view. After more than 100 years of debates around 'genes of' all kinds (here, the 'warrior gene'), geneticists may not hide themselves behind the media when a controversy occurs. Responsibilities have to be assumed. © 2012 John Wiley & Sons Ltd.
Expression analysis of MYC genes from Tamarix hispida in response to different abiotic stresses.
Ji, Xiaoyu; Wang, Yucheng; Liu, Guifeng
2012-01-01
The MYC genes are a group of transcription factors containing both bHLH and ZIP motifs that play important roles in the regulation of abscisic acid (ABA)-responsive genes. In the present study, to investigate the roles of MYC genes under NaCl, osmotic and ABA stress conditions, nine MYC genes were cloned from Tamarix hispida. Real-time reverse-transcriptase (RT)-PCR showed that all nine MYC genes were expressed in root, stem and leaf tissues, but that the levels of the transcripts of these genes in the various tissues differed notably. The MYC genes were highly induced in the roots in response to ABA, NaCl and osmotic stresses after 3 h; however, in the stem and leaf tissues, MYC genes were highly induced only when exposed to these stresses for 6 h. In addition, most of these MYC genes were highly expressed in roots in comparison with stems and leaves. Furthermore, the MYC genes were more highly induced in roots than in stem and leaf tissues, indicating that these genes may play roles in stress responses mainly in the roots rather than the stems and leaves. The results of this present study suggest that MYCs are involved in salt and osmotic stress tolerances and are controlled by the ABA signal transduction pathway.
Transcriptome Analysis of ABA/JA-Dual Responsive Genes in Rice Shoot and Root.
Kim, Jin-Ae; Bhatnagar, Nikita; Kwon, Soon Jae; Min, Myung Ki; Moon, Seok-Jun; Yoon, In Sun; Kwon, Taek-Ryoun; Kim, Sun Tae; Kim, Beom-Gi
2018-01-01
The phytohormone abscisic acid (ABA) enables plants to adapt to adverse environmental conditions through the modulation of metabolic pathways and of growth and developmental programs. We used comparative microarray analysis to identify genes exhibiting ABA-dependent expression and other hormone-dependent expression among them in Oryza sativa shoot and root. We identified 854 genes as significantly up- or down-regulated in root or shoot under ABA treatment condition. Most of these genes had similar expression profiles in root and shoot under ABA treatment condition, whereas 86 genes displayed opposite expression responses in root and shoot. To examine the crosstalk between ABA and other hormones, we compared the expression profiles of the ABA-dependently regulated genes under several different hormone treatment conditions. Interestingly, around half of the ABA-dependently expressed genes were also regulated by jasmonic acid based on microarray data analysis. We searched the promoter regions of these genes for cis-elements that could be responsible for their responsiveness to both hormones, and found that ABRE and MYC2 elements, among others, were common to the promoters of genes that were regulated by both ABA and JA. These results show that ABA and JA might have common gene expression regulation system and might explain why the JA could function for both abiotic and biotic stress tolerance.
Gene Expression Dynamics Accompanying the Sponge Thermal Stress Response.
Guzman, Christine; Conaco, Cecilia
2016-01-01
Marine sponges are important members of coral reef ecosystems. Thus, their responses to changes in ocean chemistry and environmental conditions, particularly to higher seawater temperatures, will have potential impacts on the future of these reefs. To better understand the sponge thermal stress response, we investigated gene expression dynamics in the shallow water sponge, Haliclona tubifera (order Haplosclerida, class Demospongiae), subjected to elevated temperature. Using high-throughput transcriptome sequencing, we show that these conditions result in the activation of various processes that interact to maintain cellular homeostasis. Short-term thermal stress resulted in the induction of heat shock proteins, antioxidants, and genes involved in signal transduction and innate immunity pathways. Prolonged exposure to thermal stress affected the expression of genes involved in cellular damage repair, apoptosis, signaling and transcription. Interestingly, exposure to sublethal temperatures may improve the ability of the sponge to mitigate cellular damage under more extreme stress conditions. These insights into the potential mechanisms of adaptation and resilience of sponges contribute to a better understanding of sponge conservation status and the prediction of ecosystem trajectories under future climate conditions.
Gutiérrez, Rodrigo A; Stokes, Trevor L; Thum, Karen; Xu, Xiaodong; Obertello, Mariana; Katari, Manpreet S; Tanurdzic, Milos; Dean, Alexis; Nero, Damion C; McClung, C Robertson; Coruzzi, Gloria M
2008-03-25
Understanding how nutrients affect gene expression will help us to understand the mechanisms controlling plant growth and development as a function of nutrient availability. Nitrate has been shown to serve as a signal for the control of gene expression in Arabidopsis. There is also evidence, on a gene-by-gene basis, that downstream products of nitrogen (N) assimilation such as glutamate (Glu) or glutamine (Gln) might serve as signals of organic N status that in turn regulate gene expression. To identify genome-wide responses to such organic N signals, Arabidopsis seedlings were transiently treated with ammonium nitrate in the presence or absence of MSX, an inhibitor of glutamine synthetase, resulting in a block of Glu/Gln synthesis. Genes that responded to organic N were identified as those whose response to ammonium nitrate treatment was blocked in the presence of MSX. We showed that some genes previously identified to be regulated by nitrate are under the control of an organic N-metabolite. Using an integrated network model of molecular interactions, we uncovered a subnetwork regulated by organic N that included CCA1 and target genes involved in N-assimilation. We validated some of the predicted interactions and showed that regulation of the master clock control gene CCA1 by Glu or a Glu-derived metabolite in turn regulates the expression of key N-assimilatory genes. Phase response curve analysis shows that distinct N-metabolites can advance or delay the CCA1 phase. Regulation of CCA1 by organic N signals may represent a novel input mechanism for N-nutrients to affect plant circadian clock function.
Directory of Open Access Journals (Sweden)
Wei-Sheng Wu
2008-01-01
Full Text Available Unicellular organisms such as yeasts have evolved mechanisms to respond to environmental stresses by rapidly reorganizing the gene expression program. Although many stress-response genes in yeast have been discovered by DNA microarrays, the stress-response transcription factors (TFs that regulate these stress-response genes remain to be investigated. In this study, we use a dynamic system model of gene regulation to describe the mechanism of how TFs may control a gene’s expression. Then, based on the dynamic system model, we develop the Stress Regulator Identification Algorithm (SRIA to identify stress-response TFs for six kinds of stresses. We identified some general stress-response TFs that respond to various stresses and some specific stress-response TFs that respond to one specifi c stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs is probably suffi cient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the response mechanisms to different stresses may have a bow-tie structure. Second, there may be regulatory cross-talks among different stress responses. In conclusion, this study proposes a network of stress-response regulators and the details of their actions.
Directory of Open Access Journals (Sweden)
Zorica Zivkovic
2009-01-01
Full Text Available The genus Anaplasma (Rickettsiales: Anaplasmataceae includes obligate tick-transmitted intracellular organisms, Anaplasma phagocytophilum and Anaplasma marginale that multiply in both vertebrate and tick host cells. Recently, we showed that A. marginale affects the expression of tick genes that are involved in tick survival and pathogen infection and multiplication. However, the gene expression profile in A. phagocytophilum-infected tick cells is currently poorly characterized. The objectives of this study were to characterize tick gene expression profile in Ixodes scapularis ticks and cultured ISE6 cells in response to infection with A. phagocypthilum and to compare tick gene expression responses in A. phagocytophilum- and A. marginale-infected tick cells by microarray and real-time RT-PCR analyses. The results of these studies demonstrated modulation of tick gene expression by A. phagocytophilum and provided evidence of different gene expression responses in tick cells infected with A. phagocytophilum and A. marginale. These differences in Anaplasma-tick interactions may reflect differences in pathogen life cycle in the tick cells.
Expression Analysis of MYC Genes from Tamarix hispida in Response to Different Abiotic Stresses
Directory of Open Access Journals (Sweden)
Guifeng Liu
2012-01-01
Full Text Available The MYC genes are a group of transcription factors containing both bHLH and ZIP motifs that play important roles in the regulation of abscisic acid (ABA-responsive genes. In the present study, to investigate the roles of MYC genes under NaCl, osmotic and ABA stress conditions, nine MYC genes were cloned from Tamarix hispida. Real-time reverse-transcriptase (RT-PCR showed that all nine MYC genes were expressed in root, stem and leaf tissues, but that the levels of the transcripts of these genes in the various tissues differed notably. The MYC genes were highly induced in the roots in response to ABA, NaCl and osmotic stresses after 3 h; however, in the stem and leaf tissues, MYC genes were highly induced only when exposed to these stresses for 6 h. In addition, most of these MYC genes were highly expressed in roots in comparison with stems and leaves. Furthermore, the MYC genes were more highly induced in roots than in stem and leaf tissues, indicating that these genes may play roles in stress responses mainly in the roots rather than the stems and leaves. The results of this present study suggest that MYCs are involved in salt and osmotic stress tolerances and are controlled by the ABA signal transduction pathway.
Mutual information and the fidelity of response of gene regulatory models
International Nuclear Information System (INIS)
Tabbaa, Omar P; Jayaprakash, C
2014-01-01
We investigate cellular response to extracellular signals by using information theory techniques motivated by recent experiments. We present results for the steady state of the following gene regulatory models found in both prokaryotic and eukaryotic cells: a linear transcription-translation model and a positive or negative auto-regulatory model. We calculate both the information capacity and the mutual information exactly for simple models and approximately for the full model. We find that (1) small changes in mutual information can lead to potentially important changes in cellular response and (2) there are diminishing returns in the fidelity of response as the mutual information increases. We calculate the information capacity using Gillespie simulations of a model for the TNF-α-NF-κ B network and find good agreement with the measured value for an experimental realization of this network. Our results provide a quantitative understanding of the differences in cellular response when comparing experimentally measured mutual information values of different gene regulatory models. Our calculations demonstrate that Gillespie simulations can be used to compute the mutual information of more complex gene regulatory models, providing a potentially useful tool in synthetic biology. (paper)
Rapid and preferential activation of the c-jun gene during the mammalian UV response
International Nuclear Information System (INIS)
Devary, Y.; Gottlieb, R.A.; Lau, L.F.; Karin, M.
1991-01-01
Exposure of mammalian cells to DNA-damaging agents leads to activation of a genetic response known as the UV response. Because several previously identified UV-inducible genes contain AP-1 binding sites within their promoters, we investigated the induction of AP-1 activity by DNA-damaging agents. We found that expression of both c-jun and c-fos, which encode proteins that participate in formation of the AP-1 complex, is rapidly induced by two different DNA-damaging agents: UV and H2O2. Interestingly, the c-jun gene is far more responsive to UV than any other immediate-early gene that was examined, including c-fos. Other jun and fos genes were only marginally affected by UV or H2O2. Furthermore, UV is a much more efficient inducer of c-jun than phorbol esters, the standard inducers of c-jun expression. This preferential response of the c-jun gene is mediated by its 5' control region and requires the TPA response element, suggesting that this element also serves as an early target for the signal transduction pathway elicited by DNA damage. Both UV and H2O2 lead to a long-lasting increase in AP-1 binding activity, suggesting that AP-1 may mediate the induction of other damage-inducible genes such as human collagenase
International Nuclear Information System (INIS)
Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.
2005-01-01
Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes
Responses of human cells to ZnO nanoparticles: a gene transcription study†
Moos, Philip J.; Olszewski, Kyle; Honeggar, Matthew; Cassidy, Pamela; Leachman, Sancy; Woessner, David; Cutler, N. Shane; Veranth, John M.
2013-01-01
The gene transcript profile responses to metal oxide nanoparticles was studied using human cell lines derived from the colon and skin tumors. Much of the research on nanoparticle toxicology has focused on models of inhalation and intact skin exposure, and effects of ingestion exposure and application to diseased skin are relatively unknown. Powders of nominally nanosized SiO2, TiO2, ZnO and Fe2O3 were chosen because these substances are widely used in consumer products. The four oxides were evaluated using colon-derived cell lines, RKO and CaCo-2, and ZnO and TiO2 were evaluated further using skin-derived cell lines HaCaT and SK Mel-28. ZnO induced the most notable gene transcription changes, even though this material was applied at the lowest concentration. Nano-sized and conventional ZnO induced similar responses suggesting common mechanisms of action. The results showed neither a non-specific response pattern common to all substances nor synergy of the particles with TNF-α cotreatment. The response to ZnO was not consistent with a pronounced proinflammatory signature, but involved changes in metal metabolism, chaperonin proteins, and protein folding genes. This response was observed in all cell lines when ZnO was in contact with the human cells. When the cells were exposed to soluble Zn, the genes involved in metal metabolism were induced but the genes involved in protein refoldling were unaffected. This provides some of the first data on the effects of commercial metal oxide nanoparticles on human colon-derived and skin-derived cells. PMID:21769377
Mina, Lida; Soule, Sharon E; Badve, Sunil; Baehner, Fredrick L; Baker, Joffre; Cronin, Maureen; Watson, Drew; Liu, Mei-Lan; Sledge, George W; Shak, Steve; Miller, Kathy D
2007-06-01
Primary chemotherapy provides an ideal opportunity to correlate gene expression with response to treatment. We used paraffin-embedded core biopsies from a completed phase II trial to identify genes that correlate with response to primary chemotherapy. Patients with newly diagnosed stage II or III breast cancer were treated with sequential doxorubicin 75 mg/M2 q2 wks x 3 and docetaxel 40 mg/M2 weekly x 6; treatment order was randomly assigned. Pretreatment core biopsy samples were interrogated for genes that might correlate with pathologic complete response (pCR). In addition to the individual genes, the correlation of the Oncotype DX Recurrence Score with pCR was examined. Of 70 patients enrolled in the parent trial, core biopsies samples with sufficient RNA for gene analyses were available from 45 patients; 9 (20%) had inflammatory breast cancer (IBC). Six (14%) patients achieved a pCR. Twenty-two of the 274 candidate genes assessed correlated with pCR (p < 0.05). Genes correlating with pCR could be grouped into three large clusters: angiogenesis-related genes, proliferation related genes, and invasion-related genes. Expression of estrogen receptor (ER)-related genes and Recurrence Score did not correlate with pCR. In an exploratory analysis we compared gene expression in IBC to non-inflammatory breast cancer; twenty-four (9%) of the genes were differentially expressed (p < 0.05), 5 were upregulated and 19 were downregulated in IBC. Gene expression analysis on core biopsy samples is feasible and identifies candidate genes that correlate with pCR to primary chemotherapy. Gene expression in IBC differs significantly from noninflammatory breast cancer.
Gene expression profiles responses to aphid feeding in chrysanthemum (Chrysanthemum morifolium).
Xia, Xiaolong; Shao, Yafeng; Jiang, Jiafu; Ren, Liping; Chen, Fadi; Fang, Weimin; Guan, Zhiyong; Chen, Sumei
2014-12-02
Chrysanthemum is an important ornamental plant all over the world. It is easily attacked by aphid, Macrosiphoniella sanbourni. The molecular mechanisms of plant defense responses to aphid are only partially understood. Here, we investigate the gene expression changes in response to aphid feeding in chrysanthemum leaf by RNA-Seq technology. Three libraries were generated from pooled leaf tissues of Chrysanthemum morifolium 'nannongxunzhang' that were collected at different time points with (Y) or without (CK) aphid infestations and mock puncture treatment (Z), and sequenced using an Illumina HiSeqTM 2000 platform. A total of 7,363,292, 7,215,860 and 7,319,841 clean reads were obtained in library CK, Y and Z, respectively. The proportion of clean reads was >97.29% in each library. Approximately 76.35% of the clean reads were mapped to a reference gene database including all known chrysanthemum unigene sequences. 1,157, 527 and 340 differentially expressed genes (DEGs) were identified in the comparison of CK-VS-Y, CK-VS-Z and Z-VS-Y, respectively. These DEGs were involved in phytohormone signaling, cell wall biosynthesis, photosynthesis, reactive oxygen species (ROS) pathway and transcription factor regulatory networks, and so on. Changes in gene expression induced by aphid feeding are shown to be multifaceted. There are various forms of crosstalk between different pathways those genes belonging to, which would allow plants to fine-tune its defense responses.
Directory of Open Access Journals (Sweden)
David Haase
Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.
Liu, Ning; Ding, Yong; Fromm, Michael; Avramova, Zoya
2014-05-01
Plants that have experienced several exposures to dehydration stress show increased resistance to future exposures by producing faster and/or stronger reactions, while many dehydration stress responding genes in Arabidopsis thaliana super-induce their transcription as a 'memory' from the previous encounter. A previously unknown, rather unusual, memory response pattern is displayed by a subset of the dehydration stress response genes. Despite robustly responding to a first stress, these genes return to their initial, pre-stressed, transcript levels during the watered recovery; surprisingly, they do not respond further to subsequent stresses of similar magnitude and duration. This transcriptional behavior defines the 'revised-response' memory genes. Here, we investigate the molecular mechanisms regulating this transcription memory behavior. Potential roles of abscisic acid (ABA), of transcription factors (TFs) from the ABA signaling pathways (ABF2/3/4 and MYC2), and of histone modifications (H3K4me3 and H3K27me3) as factors in the revised-response transcription memory patterns are elucidated. We identify the TF MYC2 as the critical component for the memory behavior of a specific subset of MYC2-dependent genes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
[Regulation of heat shock gene expression in response to stress].
Garbuz, D G
2017-01-01
Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS
Function of the auxin-responsive gene TaSAUR75 under salt and drought stress
Directory of Open Access Journals (Sweden)
Yuan Guo
2018-04-01
Full Text Available Small auxin-upregulated RNAs (SAURs are genes regulated by auxin and environmental factors. In this study, we identified a SAUR gene in wheat, TaSAUR75. Under salt stress, TaSAUR75 is downregulated in wheat roots. Subcellular localization revealed that TaSAUR75 was localized in both the cytoplasm and nucleus. Overexpression of TaSAUR75 increased drought and salt tolerance in Arabidopsis. Transgenic lines showed higher root length and survival rate and higher expression of some stress-responsive genes than control plants under salt and drought stress. Less H2O2 accumulated in transgenic lines than in control plants under drought stress. Our findings reveal a positive regulatory role of the auxin-responsive gene TaSAUR75 in plant responses to drought and salt stress and provide a candidate gene for improvement of abiotic stress tolerance in crop breeding.
Directory of Open Access Journals (Sweden)
Paules Richard S
2007-11-01
Full Text Available Abstract Background A common observation in the analysis of gene expression data is that many genes display similarity in their expression patterns and therefore appear to be co-regulated. However, the variation associated with microarray data and the complexity of the experimental designs make the acquisition of co-expressed genes a challenge. We developed a novel method for Extracting microarray gene expression Patterns and Identifying co-expressed Genes, designated as EPIG. The approach utilizes the underlying structure of gene expression data to extract patterns and identify co-expressed genes that are responsive to experimental conditions. Results Through evaluation of the correlations among profiles, the magnitude of variation in gene expression profiles, and profile signal-to-noise ratio's, EPIG extracts a set of patterns representing co-expressed genes. The method is shown to work well with a simulated data set and microarray data obtained from time-series studies of dauer recovery and L1 starvation in C. elegans and after ultraviolet (UV or ionizing radiation (IR-induced DNA damage in diploid human fibroblasts. With the simulated data set, EPIG extracted the appropriate number of patterns which were more stable and homogeneous than the set of patterns that were determined using the CLICK or CAST clustering algorithms. However, CLICK performed better than EPIG and CAST with respect to the average correlation between clusters/patterns of the simulated data. With real biological data, EPIG extracted more dauer-specific patterns than CLICK. Furthermore, analysis of the IR/UV data revealed 18 unique patterns and 2661 genes out of approximately 17,000 that were identified as significantly expressed and categorized to the patterns by EPIG. The time-dependent patterns displayed similar and dissimilar responses between IR and UV treatments. Gene Ontology analysis applied to each pattern-related subset of co-expressed genes revealed underlying
Conservation of the response regulator gene gacA in Pseudomonas species
Souza, J.T.; Mazzola, M.; Raaijmakers, J.M.
2003-01-01
The response regulator gene gacA influences the production of several secondary metabolites in both pathogenic and beneficial Pseudomonas spp. In this study, we developed primers and a probe for the gacA gene of Pseudomonas species and sequenced a 425 bp fragment of gacA from ten Pseudomonas strains
Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection
Directory of Open Access Journals (Sweden)
Yiming Wang
2014-12-01
Full Text Available Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L. in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10 by RT-PCR, and phytoalexins (sakuranetin and momilactone A with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05 in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.
Nomikou, N; Feichtinger, G A; Saha, S; Nuernberger, S; Heimel, P; Redl, H; McHale, A P
2018-01-01
Gene-activated matrix (GAM)-based therapeutics for tissue regeneration are limited by efficacy, the lack of spatiotemporal control and availability of target cells, all of which impact negatively on their translation to the clinic. Here, an advanced ultrasound-responsive GAM is described containing target cells that facilitates matrix-assisted sonoporation (MAS) to induce osteogenic differentiation. Ultrasound-responsive GAMs consisting of fibrin/collagen hybrid-matrices containing microbubbles, bone morphogenetic protein BMP2/7 coexpression plasmids together with C2C12 cells were treated with ultrasound either in vitro or following parenteral intramuscular implantation in vivo. Using direct measurement for alkaline phosphatase activity, von Kossa staining and immunohistochemical analysis for osteocalcin expression, MAS-stimulated osteogenic differentiation was confirmed in the GAMs in vitro 7 days after treatment with ultrasound. At day 30 post-treatment with ultrasound, ectopic osteogenic differentiation was confirmed in vivo using X-ray microcomputed tomography and histological analysis. Osteogenic differentiation was indicated by the presence of ectopic bone structures in all animals treated with MAS. In addition, bone volumes in this group were statistically greater than those in the control groups. This novel approach of incorporating a MAS capability into GAMs could be exploited to facilitate ex vivo gene transfer with subsequent surgical implantation or alternatively provide a minimally invasive means of stimulating in situ transgene delivery for osteoinductive gene-based therapies. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Wu, Jian; Wang, Feiyan; Cheng, Lin; Kong, Fuling; Peng, Zhen; Liu, Songyu; Yu, Xiaolin; Lu, Gang
2011-11-01
Auxin response factors (ARFs) encode transcriptional factors that bind specifically to the TGTCTC-containing auxin response elements found in the promoters of primary/early auxin response genes that regulate plant development. In this study, investigation of the tomato genome revealed 21 putative functional ARF genes (SlARFs), a number comparable to that found in Arabidopsis (23) and rice (25). The full cDNA sequences of 15 novel SlARFs were isolated and delineated by sequencing of PCR products. A comprehensive genome-wide analysis of this gene family is presented, including the gene structures, chromosome locations, phylogeny, and conserved motifs. In addition, a comparative analysis between ARF family genes in tomato and maize was performed. A phylogenetic tree generated from alignments of the full-length protein sequences of 21 OsARFs, 23 AtARFs, 31 ZmARFs, and 21 SlARFs revealed that these ARFs were clustered into four major groups. However, we could not find homologous genes in rice, maize, or tomato with AtARF12-15 and AtARF20-23. The expression patterns of tomato ARF genes were analyzed by quantitative real-time PCR. Our comparative analysis will help to define possible functions for many of these newly isolated ARF-family genes in plant development.
Moderation of antidepressant response by the serotonin transporter gene
DEFF Research Database (Denmark)
Huezo-Diaz, Patricia; Uher, Rudolf; Smith, Rebecca
2009-01-01
Background: There have been conflicting reports on whether the length polymorphism in the promoter of the serotonin transporter gene (5-HTTLPR) moderates the antidepressant effects of selective serotonin reuptake inhibitors (SSRIs). We hypothesised that the pharmacogenetic effect of 5-HTTLPR...... the serotonin transporter gene were genotyped in 795 adults with moderate-to-severe depression treated with escitalopram or nortriptyline in the Genome Based Therapeutic Drugs for Depression (GENDEP) project. Results: The 5-HTTLPR moderated the response to escitalopram, with long-allele carriers improving more...
Functional pathway analysis of genes associated with response to treatment for chronic hepatitis C.
Birerdinc, A; Afendy, A; Stepanova, M; Younossi, I; Manyam, G; Baranova, A; Younossi, Z M
2010-10-01
Chronic hepatitis C (CH-C) is among the most common causes of chronic liver disease. Approximately 50% of patients with CH-C treated with pegylated interferon-α and ribavirin (PEG-IFN-α + RBV) achieve a sustained virological response (SVR). Several factors such as genotype 1, African American (AA) race, obesity and the absence of an early virological response (EVR) are associated with low SVR. This study elucidates molecular pathways deregulated in patients with CH-C with negative predictors of response to antiviral therapy. Sixty-eight patients with CH-C who underwent a full course of treatment with PEG-IFN-α + RBV were included in the study. Pretreatment blood samples were collected in PAXgene™ RNA tubes. EVR, complete EVR (cEVR), and SVR rates were 76%, 57% and 41%, respectively. Total RNA was extracted from pretreatment peripheral blood mononuclear cells, quantified and used for one-step RT-PCR to profile 154 mRNAs. The expression of mRNAs was normalized with six 'housekeeping' genes. Differentially expressed genes were separated into up and downregulated gene lists according to the presence or absence of a risk factor and subjected to KEGG Pathway Painter which allows high-throughput visualization of the pathway-specific changes in expression profiles. The genes were consolidated into the networks associated with known predictors of response. Before treatment, various genes associated with core components of the JAK/STAT pathway were activated in the cohorts least likely to achieve SVR. Genes related to focal adhesion and TGF-β pathways were activated in some patients with negative predictors of response. Pathway-centred analysis of gene expression profiles from treated patients with CH-C points to the Janus kinase-signal transducers and activators of transcription signalling cascade as the major pathogenetic component responsible for not achieving SVR. In addition, focal adhesion and TGF-β pathways are associated with some predictors of response.
Tailoring the Immune Response via Customization of Pathogen Gene Expression.
Runco, Lisa M; Stauft, Charles B; Coleman, J Robert
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.
Directory of Open Access Journals (Sweden)
Thomas R. Aunins
2018-03-01
Full Text Available Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under
Aunins, Thomas R; Erickson, Keesha E; Prasad, Nripesh; Levy, Shawn E; Jones, Angela; Shrestha, Shristi; Mastracchio, Rick; Stodieck, Louis; Klaus, David; Zea, Luis; Chatterjee, Anushree
2018-01-01
Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under extreme stress
Aunins, Thomas R.; Erickson, Keesha E.; Prasad, Nripesh; Levy, Shawn E.; Jones, Angela; Shrestha, Shristi; Mastracchio, Rick; Stodieck, Louis; Klaus, David; Zea, Luis; Chatterjee, Anushree
2018-01-01
Bacteria grown in space experiments under microgravity conditions have been found to undergo unique physiological responses, ranging from modified cell morphology and growth dynamics to a putative increased tolerance to antibiotics. A common theory for this behavior is the loss of gravity-driven convection processes in the orbital environment, resulting in both reduction of extracellular nutrient availability and the accumulation of bacterial byproducts near the cell. To further characterize the responses, this study investigated the transcriptomic response of Escherichia coli to both microgravity and antibiotic concentration. E. coli was grown aboard International Space Station in the presence of increasing concentrations of the antibiotic gentamicin with identical ground controls conducted on Earth. Here we show that within 49 h of being cultured, E. coli adapted to grow at higher antibiotic concentrations in space compared to Earth, and demonstrated consistent changes in expression of 63 genes in response to an increase in drug concentration in both environments, including specific responses related to oxidative stress and starvation response. Additionally, we find 50 stress-response genes upregulated in response to the microgravity when compared directly to the equivalent concentration in the ground control. We conclude that the increased antibiotic tolerance in microgravity may be attributed not only to diminished transport processes, but also to a resultant antibiotic cross-resistance response conferred by an overlapping effect of stress response genes. Our data suggest that direct stresses of nutrient starvation and acid-shock conveyed by the microgravity environment can incidentally upregulate stress response pathways related to antibiotic stress and in doing so contribute to the increased antibiotic stress tolerance observed for bacteria in space experiments. These results provide insights into the ability of bacteria to adapt under extreme stress
Directory of Open Access Journals (Sweden)
delphine efaugaret
2014-12-01
Full Text Available The formation of granulomas is associated with the resolution of Q fever, a zoonosis due to Coxiella burnetii; however the molecular mechanisms of granuloma formation remain poorly understood. We generated human granulomas with peripheral blood mononuclear cells and beads coated with C. burnetii, using BCG extracts as controls. A microarray analysis showed dramatic changes in gene expression in granuloma cells of which more than 50% were commonly modulated genes in response to C. burnetii and BCG. They included M1-related genes and genes related to chemotaxis. The inhibition of the chemokines, CCL2 and CCL5, directly interfered with granuloma formation. C. burnetii granulomas also expressed a specific transcriptional profile that was essentially enriched in genes associated with type I interferon response. Our results showed that granuloma formation is associated with a core of transcriptional response based on inflammatory genes. The specific granulomatous response to C. burnetii is characterized by the activation of type I interferon pathway.
Caarls, Lotte; Van der Does, Dieuwertje; Hickman, Richard; Jansen, Wouter; Verk, Marcel C Van; Proietti, Silvia; Lorenzo, Oscar; Solano, Roberto; Pieterse, Corné M J; Van Wees, Saskia C M
2017-02-01
Salicylic acid (SA) and jasmonic acid (JA) cross-communicate in the plant immune signaling network to finely regulate induced defenses. In Arabidopsis, SA antagonizes many JA-responsive genes, partly by targeting the ETHYLENE RESPONSE FACTOR (ERF)-type transcriptional activator ORA59. Members of the ERF transcription factor family typically bind to GCC-box motifs in the promoters of JA- and ethylene-responsive genes, thereby positively or negatively regulating their expression. The GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Here, we investigated whether SA-induced ERF-type transcriptional repressors, which may compete with JA-induced ERF-type activators for binding at the GCC-box, play a role in SA/JA antagonism. We selected ERFs that are transcriptionally induced by SA and/or possess an EAR transcriptional repressor motif. Several of the 16 ERFs tested suppressed JA-dependent gene expression, as revealed by enhanced JA-induced PDF1.2 or VSP2 expression levels in the corresponding erf mutants, while others were involved in activation of these genes. However, SA could antagonize JA-induced PDF1.2 or VSP2 in all erf mutants, suggesting that the tested ERF transcriptional repressors are not required for SA/JA cross-talk. Moreover, a mutant in the co-repressor TOPLESS, that showed reduction in repression of JA signaling, still displayed SA-mediated antagonism of PDF1.2 and VSP2. Collectively, these results suggest that SA-regulated ERF transcriptional repressors are not essential for antagonism of JA-responsive gene expression by SA. We further show that de novo SA-induced protein synthesis is required for suppression of JA-induced PDF1.2, pointing to SA-stimulated production of an as yet unknown protein that suppresses JA-induced transcription. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Sumit Ghosh
Full Text Available Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS, ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process.
Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis
2013-01-01
Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759
Growth rate regulated genes and their wide involvement in the Lactococcus lactis stress responses
Directory of Open Access Journals (Sweden)
Redon Emma
2008-07-01
Full Text Available Abstract Background The development of transcriptomic tools has allowed exhaustive description of stress responses. These responses always superimpose a general response associated to growth rate decrease and a specific one corresponding to the stress. The exclusive growth rate response can be achieved through chemostat cultivation, enabling all parameters to remain constant except the growth rate. Results We analysed metabolic and transcriptomic responses of Lactococcus lactis in continuous cultures at different growth rates ranging from 0.09 to 0.47 h-1. Growth rate was conditioned by isoleucine supply. Although carbon metabolism was constant and homolactic, a widespread transcriptomic response involving 30% of the genome was observed. The expression of genes encoding physiological functions associated with biogenesis increased with growth rate (transcription, translation, fatty acid and phospholipids metabolism. Many phages, prophages and transposon related genes were down regulated as growth rate increased. The growth rate response was compared to carbon and amino-acid starvation transcriptomic responses, revealing constant and significant involvement of growth rate regulations in these two stressful conditions (overlap 27%. Two regulators potentially involved in the growth rate regulations, llrE and yabB, have been identified. Moreover it was established that genes positively regulated by growth rate are preferentially located in the vicinity of replication origin while those negatively regulated are mainly encountered at the opposite, thus indicating the relationship between genes expression and their location on chromosome. Although stringent response mechanism is considered as the one governing growth deceleration in bacteria, the rigorous comparison of the two transcriptomic responses clearly indicated the mechanisms are distinct. Conclusion This work of integrative biology was performed at the global level using transcriptomic analysis
Gene expression responses of HeLa cells to chemical species generated by an atmospheric plasma flow
International Nuclear Information System (INIS)
Yokoyama, Mayo; Johkura, Kohei; Sato, Takehiko
2014-01-01
Highlights: • Response of HeLa cells to a plasma-irradiated medium was revealed by DNA microarray. • Gene expression pattern was basically different from that in a H 2 O 2 -added medium. • Prominently up-/down-regulated genes were partly shared by the two media. • Gene ontology analysis showed both similar and different responses in the two media. • Candidate genes involved in response to ROS were detected in each medium. - Abstract: Plasma irradiation generates many factors able to affect the cellular condition, and this feature has been studied for its application in the field of medicine. We previously reported that hydrogen peroxide (H 2 O 2 ) was the major cause of HeLa cell death among the chemical species generated by high level irradiation of a culture medium by atmospheric plasma. To assess the effect of plasma-induced factors on the response of live cells, HeLa cells were exposed to a medium irradiated by a non-lethal plasma flow level, and their gene expression was broadly analyzed by DNA microarray in comparison with that in a corresponding concentration of 51 μM H 2 O 2 . As a result, though the cell viability was sufficiently maintained at more than 90% in both cases, the plasma-medium had a greater impact on it than the H 2 O 2 -medium. Hierarchical clustering analysis revealed fundamentally different cellular responses between these two media. A larger population of genes was upregulated in the plasma-medium, whereas genes were downregulated in the H 2 O 2 -medium. However, a part of the genes that showed prominent differential expression was shared by them, including an immediate early gene ID2. In gene ontology analysis of upregulated genes, the plasma-medium showed more diverse ontologies than the H 2 O 2 -medium, whereas ontologies such as “response to stimulus” were common, and several genes corresponded to “response to reactive oxygen species.” Genes of AP-1 proteins, e.g., JUN and FOS, were detected and notably elevated in
Gene expression responses of HeLa cells to chemical species generated by an atmospheric plasma flow
Energy Technology Data Exchange (ETDEWEB)
Yokoyama, Mayo, E-mail: yokoyama@plasma.ifs.tohoku.ac.jp [Institute of Fluid Science, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Johkura, Kohei, E-mail: kohei@shinshu-u.ac.jp [Department of Histology and Embryology, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan); Sato, Takehiko, E-mail: sato@ifs.tohoku.ac.jp [Institute of Fluid Science, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan)
2014-08-08
Highlights: • Response of HeLa cells to a plasma-irradiated medium was revealed by DNA microarray. • Gene expression pattern was basically different from that in a H{sub 2}O{sub 2}-added medium. • Prominently up-/down-regulated genes were partly shared by the two media. • Gene ontology analysis showed both similar and different responses in the two media. • Candidate genes involved in response to ROS were detected in each medium. - Abstract: Plasma irradiation generates many factors able to affect the cellular condition, and this feature has been studied for its application in the field of medicine. We previously reported that hydrogen peroxide (H{sub 2}O{sub 2}) was the major cause of HeLa cell death among the chemical species generated by high level irradiation of a culture medium by atmospheric plasma. To assess the effect of plasma-induced factors on the response of live cells, HeLa cells were exposed to a medium irradiated by a non-lethal plasma flow level, and their gene expression was broadly analyzed by DNA microarray in comparison with that in a corresponding concentration of 51 μM H{sub 2}O{sub 2}. As a result, though the cell viability was sufficiently maintained at more than 90% in both cases, the plasma-medium had a greater impact on it than the H{sub 2}O{sub 2}-medium. Hierarchical clustering analysis revealed fundamentally different cellular responses between these two media. A larger population of genes was upregulated in the plasma-medium, whereas genes were downregulated in the H{sub 2}O{sub 2}-medium. However, a part of the genes that showed prominent differential expression was shared by them, including an immediate early gene ID2. In gene ontology analysis of upregulated genes, the plasma-medium showed more diverse ontologies than the H{sub 2}O{sub 2}-medium, whereas ontologies such as “response to stimulus” were common, and several genes corresponded to “response to reactive oxygen species.” Genes of AP-1 proteins, e.g., JUN
Epigenetic modulation of gene expression governs the brain's response to injury.
Simon, Roger P
2016-06-20
Mild stress from ischemia, seizure, hypothermia, or infection can produce a transient neuroprotected state in the brain. In the neuroprotected state, the brain responds differently to a severe stress and sustains less injury. At the genomic level, the response of the neuroprotected brain to a severe stress is characterized by widespread differential regulation of genes with diverse functions. This reprogramming of gene expression observed in the neuroprotected brain in response to a stress is consistent with an epigenetic model of regulation mediated by changes in DNA methylation and histone modification. Here, we summarize our evolving understanding of the molecular basis for endogenous neuroprotection and review recent findings that implicate DNA methylation and protein mediators of histone modification as epigenetic regulators of the brain's response to injury. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Construction and comparison of gene co-expression networks shows complex plant immune responses
Directory of Open Access Journals (Sweden)
Luis Guillermo Leal
2014-10-01
Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.
Directory of Open Access Journals (Sweden)
Aaron R Wolen
Full Text Available Individual differences in initial sensitivity to ethanol are strongly related to the heritable risk of alcoholism in humans. To elucidate key molecular networks that modulate ethanol sensitivity we performed the first systems genetics analysis of ethanol-responsive gene expression in brain regions of the mesocorticolimbic reward circuit (prefrontal cortex, nucleus accumbens, and ventral midbrain across a highly diverse family of 27 isogenic mouse strains (BXD panel before and after treatment with ethanol.Acute ethanol altered the expression of ~2,750 genes in one or more regions and 400 transcripts were jointly modulated in all three. Ethanol-responsive gene networks were extracted with a powerful graph theoretical method that efficiently summarized ethanol's effects. These networks correlated with acute behavioral responses to ethanol and other drugs of abuse. As predicted, networks were heavily populated by genes controlling synaptic transmission and neuroplasticity. Several of the most densely interconnected network hubs, including Kcnma1 and Gsk3β, are known to influence behavioral or physiological responses to ethanol, validating our overall approach. Other major hub genes like Grm3, Pten and Nrg3 represent novel targets of ethanol effects. Networks were under strong genetic control by variants that we mapped to a small number of chromosomal loci. Using a novel combination of genetic, bioinformatic and network-based approaches, we identified high priority cis-regulatory candidate genes, including Scn1b, Gria1, Sncb and Nell2.The ethanol-responsive gene networks identified here represent a previously uncharacterized intermediate phenotype between DNA variation and ethanol sensitivity in mice. Networks involved in synaptic transmission were strongly regulated by ethanol and could contribute to behavioral plasticity seen with chronic ethanol. Our novel finding that hub genes and a small number of loci exert major influence over the ethanol
Molecular responses and expression analysis of genes in a ...
African Journals Online (AJOL)
Haloxylon ammodendron (C.A Mey.) Bunge is a xero-halophytic desert shrub with excellent drought resistance and salt tolerance. To decipher the molecular responses involved in its drought resistance, the cDNA-AFLP (amplified fragment length polymorphism) technique was employed to identify genes expressed ...
Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis.
Furlan, Larissa Lazzarini; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia; Salomão Junior, João Batista; Souza, Dorotéia Rossi Silva; Marson, Fernando Augusto Lima
Interleukin 8 protein promotes inflammatory responses, even in airways. The presence of interleukin 8 gene variants causes altered inflammatory responses and possibly varied responses to inhaled bronchodilators. Thus, this study analyzed the interleukin 8 variants (rs4073, rs2227306, and rs2227307) and their association with the response to inhaled bronchodilators in cystic fibrosis patients. Analysis of interleukin 8 gene variants was performed by restriction fragment length polymorphism of polymerase chain reaction. The association between spirometry markers and the response to inhaled bronchodilators was evaluated by Mann-Whitney and Kruskal-Wallis tests. The analysis included all cystic fibrosis patients, and subsequently patients with two mutations in the cystic fibrosis transmembrane conductance regulator gene belonging to classes I to III. This study included 186 cystic fibrosis patients. There was no association of the rs2227307 variant with the response to inhaled bronchodilators. The rs2227306 variant was associated with FEF 50% in the dominant group and in the group with two identified mutations in the cystic fibrosis transmembrane conductance regulator gene. The rs4073 variant was associated with spirometry markers in four genetic models: co-dominant (FEF 25-75% and FEF 75% ), dominant (FEV 1 , FEF 50% , FEF 75% , and FEF 25-75% ), recessive (FEF 75% and FEF 25-75% ), and over-dominant (FEV 1 /FVC). This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.
Transcriptional profiling uncovers a network of cholesterol-responsive atherosclerosis target genes.
Directory of Open Access Journals (Sweden)
Josefin Skogsberg
2008-03-01
Full Text Available Despite the well-documented effects of plasma lipid lowering regimes halting atherosclerosis lesion development and reducing morbidity and mortality of coronary artery disease and stroke, the transcriptional response in the atherosclerotic lesion mediating these beneficial effects has not yet been carefully investigated. We performed transcriptional profiling at 10-week intervals in atherosclerosis-prone mice with human-like hypercholesterolemia and a genetic switch to lower plasma lipoproteins (Ldlr(-/-Apo(100/100Mttp(flox/flox Mx1-Cre. Atherosclerotic lesions progressed slowly at first, then expanded rapidly, and plateaued after advanced lesions formed. Analysis of lesion expression profiles indicated that accumulation of lipid-poor macrophages reached a point that led to the rapid expansion phase with accelerated foam-cell formation and inflammation, an interpretation supported by lesion histology. Genetic lowering of plasma cholesterol (e.g., lipoproteins at this point all together prevented the formation of advanced plaques and parallel transcriptional profiling of the atherosclerotic arterial wall identified 37 cholesterol-responsive genes mediating this effect. Validation by siRNA-inhibition in macrophages incubated with acetylated-LDL revealed a network of eight cholesterol-responsive atherosclerosis genes regulating cholesterol-ester accumulation. Taken together, we have identified a network of atherosclerosis genes that in response to plasma cholesterol-lowering prevents the formation of advanced plaques. This network should be of interest for the development of novel atherosclerosis therapies.
Stochastic biological response to radiation. Comprehensive analysis of gene expression
International Nuclear Information System (INIS)
Inoue, Tohru; Hirabayashi, Yoko
2012-01-01
Authors explain that the radiation effect on biological system is stochastic along the law of physics, differing from chemical effect, using instances of Cs-137 gamma-ray (GR) and benzene (BZ) exposures to mice and of resultant comprehensive analyses of gene expression. Single GR irradiation is done with Gamma Cell 40 (CSR) to C57BL/6 or C3H/He mouse at 0, 0.6 and 3 Gy. BE is given orally at 150 mg/kg/day for 5 days x 2 weeks. Bone marrow cells are sampled 1 month after the exposure. Comprehensive gene expression is analyzed by Gene Chip Mouse Genome 430 2.0 Array (Affymetrix) and data are processed by programs like case normalization, statistics, network generation, functional analysis etc. GR irradiation brings about changes of gene expression, which are classifiable in common genes variable commonly on the dose change and stochastic genes variable stochastically within each dose: e.g., with Welch-t-test, significant differences are between 0/3 Gy (dose-specific difference, 455 pbs (probe set), in stochastic 2113 pbs), 0/0.6 Gy (267 in 1284 pbs) and 0.6/3 Gy (532 pbs); and with one-way analysis of variation (ANOVA) and hierarchial/dendrographic analyses, 520 pbs are shown to involve the dose-dependent 226 and dose-specific 294 pbs. It is also shown that at 3 Gy, expression of common genes are rather suppressed, including those related to the proliferation/apoptosis of B/T cells, and of stochastic genes, related to cell division/signaling. Ven diagram of the common genes of above 520 pbs, stochastic 2113 pbs at 3 Gy and 1284 pbs at 0.6 Gy shows the overlapping genes 29, 2 and 4, respectively, indicating only 35 pbs are overlapping in total. Network analysis of changes by GR shows the rather high expression of genes around hub of cAMP response element binding protein (CREB) at 0.6 Gy, and rather variable expression around CREB hub/suppressed expression of kinesin hub at 3 Gy; in the network by BZ exposure, unchanged or low expression around p53 hub and suppression
Directory of Open Access Journals (Sweden)
David J. Burks
2016-12-01
Full Text Available The Auxin Response Factor (ARF family of transcription factors is an important regulator of environmental response and symbiotic nodulation in the legume Medicago truncatula. While previous studies have identified members of this family, a recent spurt in gene expression data coupled with genome update and reannotation calls for a reassessment of the prevalence of ARF genes and their interaction networks in M. truncatula. We performed a comprehensive analysis of the M. truncatula genome and transcriptome that entailed search for novel ARF genes and the co-expression networks. Our investigation revealed 8 novel M. truncatula ARF (MtARF genes, of the total 22 identified, and uncovered novel gene co-expression networks as well. Furthermore, the topological clustering and single enrichment analysis of several network models revealed the roles of individual members of the MtARF family in nitrogen regulation, nodule initiation, and post-embryonic development through a specialized protein packaging and secretory pathway. In summary, this study not just shines new light on an important gene family, but also provides a guideline for identification of new members of gene families and their functional characterization through network analyses.
Reddy, Bhaskar; Singh, Krishna M; Patel, Amrutlal K; Antony, Ancy; Panchasara, Harshad J; Joshi, Chaitanya G
2014-10-01
Buffalo rumen microbiota experience variety of diets and represents a huge reservoir of mobilome, resistome and stress responses. However, knowledge of metagenomic responses to such conditions is still rudimentary. We analyzed the metagenomes of buffalo rumen in the liquid and solid phase of the rumen biomaterial from river buffalo adapted to varying proportion of concentrate to green or dry roughages, using high-throughput sequencing to know the occurrence of antibiotics resistance genes, genetic exchange between bacterial population and environmental reservoirs. A total of 3914.94 MB data were generated from all three treatments group. The data were analysed with Metagenome rapid annotation system tools. At phyla level, Bacteroidetes were dominant in all the treatments followed by Firmicutes. Genes coding for functional responses to stress (oxidative stress and heat shock proteins) and resistome genes (resistance to antibiotics and toxic compounds, phages, transposable elements and pathogenicity islands) were prevalent in similar proportion in liquid and solid fraction of rumen metagenomes. The fluoroquinolone resistance, MDR efflux pumps and Methicillin resistance genes were broadly distributed across 11, 9, and 14 bacterial classes, respectively. Bacteria responsible for phages replication and prophages and phage packaging and rlt-like streptococcal phage genes were mostly assigned to phyla Bacteroides, Firmicutes and proteaobacteria. Also, more reads matching the sigma B genes were identified in the buffalo rumen. This study underscores the presence of diverse mechanisms of adaptation to different diet, antibiotics and other stresses in buffalo rumen, reflecting the proportional representation of major bacterial groups.
Two-stage gene regulation of the superoxide stress response soxRS system in Escherichia coli.
Nunoshiba, T
1996-01-01
All organisms have adapted to environmental changes by acquiring various functions controlled by gene regulation. In bacteria, a number of specific responses have been found to confer cell survival in various nutrient-limited conditions, and under physiological stresses such as high or low temperature, extreme pH, radiation, and oxidation (for review, see Neidhardt et al., 1987). In this article, I introduce an Escherichia coli (E. coli) global response induced by superoxide stress, the soxRS regulon. The functions controlled by this system consist of a wide variety of enzymes such as manganese-containing SOD (Mn-SOD); glucose 6-phosphate dehydrogenase (G6PD), the DNA repair enzyme endonuclease IV, fumarase C, NADPH:ferredoxin oxidoreductase, and aconitase. This response is positively regulated by a two-stage control system in which SoxR iron-sulfur protein senses exposure to superoxide and nitric oxide, and then activates transcription of the soxS gene, whose product stimulates the expression of the regulon genes. Our recent finding indicates that soxS transcription is initiated in a manner dependent on the rpoS gene encoding RNA polymerase sigma factor, theta s, in response to entering the stationary phase of growth. With this information, mechanisms for prokaryotic coordinating gene expression in response to superoxide stress and in stationary phase are discussed.
Wang, Yijun; Deng, Dexiang; Shi, Yating; Miao, Nan; Bian, Yunlong; Yin, Zhitong
2012-03-01
Auxin response factors (ARFs), member of the plant-specific B3 DNA binding superfamily, target specifically to auxin response elements (AuxREs) in promoters of primary auxin-responsive genes and heterodimerize with Aux/IAA proteins in auxin signaling transduction cascade. In previous research, we have isolated and characterized maize Aux/IAA genes in whole-genome scale. Here, we report the comprehensive analysis of ARF genes in maize. A total of 36 ARF genes were identified and validated from the B73 maize genome through an iterative strategy. Thirty-six maize ARF genes are distributed in all maize chromosomes except chromosome 7. Maize ARF genes expansion is mainly due to recent segmental duplications. Maize ARF proteins share one B3 DNA binding domain which consists of seven-stranded β sheets and two short α helixes. Twelve maize ARFs with glutamine-rich middle regions could be as activators in modulating expression of auxin-responsive genes. Eleven maize ARF proteins are lack of homo- and heterodimerization domains. Putative cis-elements involved in phytohormones and light signaling responses, biotic and abiotic stress adaption locate in promoters of maize ARF genes. Expression patterns vary greatly between clades and sister pairs of maize ARF genes. The B3 DNA binding and auxin response factor domains of maize ARF proteins are primarily subjected to negative selection during selective sweep. The mixed selective forces drive the diversification and evolution of genomic regions outside of B3 and ARF domains. Additionally, the dicot-specific proliferation of ARF genes was detected. Comparative genomics analysis indicated that maize, sorghum and rice duplicate chromosomal blocks containing ARF homologs are highly syntenic. This study provides insights into the distribution, phylogeny and evolution of ARF gene family.
The Role of Osteopontin and Its Gene on Glucocorticoid Response in Myasthenia Gravis
Directory of Open Access Journals (Sweden)
Yanchen Xie
2017-05-01
Full Text Available Biomarkers that assess treatment response for patients with the autoimmune disorder, myasthenia gravis (MG, have not been evaluated to a significant extent. We hypothesized the pro-inflammatory cytokine, osteopontin (OPN, may be associated with variability of response to glucocorticoids (GCs in patients with MG. A cohort of 250 MG patients treated with standardized protocol of GCs was recruited, and plasma OPN and polymorphisms of its gene, secreted phosphoprotein 1 (SPP1, were evaluated. Mean OPN levels were higher in patients compared to healthy controls. Carriers of rs11728697*T allele (allele definition: one of two or more alternative forms of a gene were more frequent in the poorly GC responsive group compared to the GC responsive group indicating an association of rs11728697*T allele with GC non-responsiveness. One risk haplotype (AGTACT was identified associated with GC non-responsiveness compared with GC responsive MG group. Genetic variations of SPP1 were found associated with the response to GC among MG patients.
Mössner, R; Schumacher, A; Wagner, M; Lennertz, L; Steinbrecher, A; Quednow, Boris B; Rujescu, D; Rietschel, M; Maier, W
2012-01-01
Genetic factors determining the response to antipsychotic treatment in schizophrenia are poorly understood. A new schizophrenia susceptibility gene, the zinc-finger gene ZNF804A, has recently been identified. To assess the pharmacogenetic importance of this gene, we treated 144 schizophrenia patients and assessed the response of positive and negative symptoms by PANSS. Patients homozygous for the ZNF804A risk allele for schizophrenia (rs1344706 AA) showed poorer improvement of positive sympto...
Machado, Vilmar; Serrano, Jose; Galián, Jose
2016-01-01
The fall armyworm (Spodoptera frugiperda, Noctuidae, Lepidoptera) is one of the most important crop pests in the Americas, causing significant damage to maize, rice and sorghum. The mechanisms that determine its defences against pathogens are particularly relevant for the development of management and control strategies. We used an in silico approach to identify and characterize pathogen response genes (repat) present in different tissue libraries of S. fugiperda. The analyses revealed complete cDNA for nine repat genes; of these, repat15 and repat39 were found in libraries from a specific tissue--the midgut of larvae fed with xenobiotic substances. High expression levels of some genes were found in different libraries: 39 hits in repat30 in challenged hemocytes, 16 hits in repat31 in fat body, 10 hits in repat32 in fat body and 10 in challenged hemocytes, and 10 hits in repat38 in midgut of non-treated larvae and midgut of larvae fed with natural and xenobiotic substances. The genes corresponded to two ontology categories, stress response and immune response, and their phylogenetic relationships, nucleotide similarity, number of amino acid residues and molecular weights agree with what has been described for repat genes. It is noteworthy that proteins encoded by the repat genes of S. frugiperda have important defence functions in other tissues beyond midgut and that their functional categories are likely diverse, as they are related to cell envelope structure, energy metabolism, transport and binding.
Transcriptional response of stress genes to metal exposure in zebra mussel larvae and adults
International Nuclear Information System (INIS)
Navarro, Anna; Faria, Melissa; Barata, Carlos; Pina, Benjamin
2011-01-01
Development of stress markers for the invader freshwater zebra mussel (Dreissena polymorpha) is of great interest for both conservation and biomonitoring purposes. Gene expression profiles of several putative or already established gene expression stress markers (Metallothionein, Superoxide dismutase, Catalase, Glutathione S transferase, Glutathione peroxidase, Cytochrome c oxidase, the multixenobiotic resistance P-gp1, and heat shock proteins HSP70 and HSP90) were analyzed by quantitative Real-Time PCR in adults and pediveliger larvae after exposure to metals (Hg, Cu, Cd). A defined pattern of coordinated responses to metal exposure and, presumably, to oxidative stress was observed in gills and digestive gland from adults. A similar, albeit partial response was observed in larvae, indicating an early development of stress-related gene responses in zebra mussel. The tools developed in this study may be useful both for future control strategies and for the use of zebra mussel as sentinel species in water courses with stable populations. - Coordinated expression of stress genes in zebra mussel.
Transcriptional response of stress genes to metal exposure in zebra mussel larvae and adults
Energy Technology Data Exchange (ETDEWEB)
Navarro, Anna; Faria, Melissa; Barata, Carlos [Institute of Environmental Assessment and Water Research (IDAEA-CSIC), Jordi Girona 18, 08034 Barcelona (Spain); Pina, Benjamin, E-mail: bpcbmc@cid.csic.e [Institute of Environmental Assessment and Water Research (IDAEA-CSIC), Jordi Girona 18, 08034 Barcelona (Spain)
2011-01-15
Development of stress markers for the invader freshwater zebra mussel (Dreissena polymorpha) is of great interest for both conservation and biomonitoring purposes. Gene expression profiles of several putative or already established gene expression stress markers (Metallothionein, Superoxide dismutase, Catalase, Glutathione S transferase, Glutathione peroxidase, Cytochrome c oxidase, the multixenobiotic resistance P-gp1, and heat shock proteins HSP70 and HSP90) were analyzed by quantitative Real-Time PCR in adults and pediveliger larvae after exposure to metals (Hg, Cu, Cd). A defined pattern of coordinated responses to metal exposure and, presumably, to oxidative stress was observed in gills and digestive gland from adults. A similar, albeit partial response was observed in larvae, indicating an early development of stress-related gene responses in zebra mussel. The tools developed in this study may be useful both for future control strategies and for the use of zebra mussel as sentinel species in water courses with stable populations. - Coordinated expression of stress genes in zebra mussel.
Directory of Open Access Journals (Sweden)
Tetu Bernard
2008-02-01
Full Text Available Abstract Background Chemotherapy (CT resistance in ovarian cancer (OC is broad and encompasses diverse unrelated drugs, suggesting more than one mechanism of resistance. To better understand the molecular mechanisms controlling the immediate response of OC cells to CT exposure, we have performed gene expression profiling in spheroid cultures derived from six OC cell lines (OVCAR3, SKOV3, TOV-112, TOV-21, OV-90 and TOV-155, following treatment with 10,0 μM cisplatin, 2,5 μM paclitaxel or 5,0 μM topotecan for 72 hours. Results Exposure of OC spheroids to these CT drugs resulted in differential expression of genes associated with cell growth and proliferation, cellular assembly and organization, cell death, cell cycle control and cell signaling. Genes, functionally involved in DNA repair, DNA replication and cell cycle arrest were mostly overexpressed, while genes implicated in metabolism (especially lipid metabolism, signal transduction, immune and inflammatory response, transport, transcription regulation and protein biosynthesis, were commonly suppressed following all treatments. Cisplatin and topotecan treatments triggered similar alterations in gene and pathway expression patterns, while paclitaxel action was mainly associated with induction of genes and pathways linked to cellular assembly and organization (including numerous tubulin genes, cell death and protein synthesis. The microarray data were further confirmed by pathway and network analyses. Conclusion Most alterations in gene expression were directly related to mechanisms of the cytotoxics actions in OC spheroids. However, the induction of genes linked to mechanisms of DNA replication and repair in cisplatin- and topotecan-treated OC spheroids could be associated with immediate adaptive response to treatment. Similarly, overexpression of different tubulin genes upon exposure to paclitaxel could represent an early compensatory effect to this drug action. Finally, multicellular
Gene expression profile of the fibrotic response in the peritoneal cavity.
Le, S J; Gongora, M; Zhang, B; Grimmond, S; Campbell, G R; Campbell, J H; Rolfe, B E
2010-01-01
The cellular response to materials implanted in the peritoneal cavity has been utilised to produce tissue for grafting to hollow smooth muscle organs (blood vessels, bladder, uterus and vas deferens). To gain insight into the regulatory mechanisms involved in encapsulation of a foreign object, and subsequent differentiation of encapsulating cells, the present study used microarray technology and real-time RT-PCR to identify the temporal changes in gene expression associated with tissue development. Immunohistochemical analysis showed that 3-7 days post-implantation of foreign objects (cubes of boiled egg white) into rats, they were encapsulated by tissue comprised primarily of haemopoietic (CD45(+)) cells, mainly macrophages (CD68(+), CCR1(+)). By day 14, tissue capsule cells no longer expressed CD68, but were positive for myofibroblast markers alpha-smooth muscle (SM) actin and SM22. In accordance with these results, gene expression data showed that early capsule (days 3-7) development was dominated by the expression of monocyte/macrophage-specific genes (CD14, CSF-1, CSF-1R, MCP-1) and pro-inflammatory mediators such as transforming growth factor (TGF-beta). As tissue capsule development progressed (days 14-21), myofibroblast-associated and pro-fibrotic genes (associated with TGF-beta and Wnt/beta-catenin signalling pathways, including Wnt 4, TGFbetaRII, connective tissue growth factor (CTGF), SMADs-1, -2, -4 and collagen-1 subunits) were significantly up-regulated. The up-regulation of genes associated with Cardiovascular and Skeletal and Muscular System Development at later time-points suggests the capacity of cells within the tissue capsule for further differentiation to smooth muscle, and possibly other cell types. The identification of key regulatory pathways and molecules associated with the fibrotic response to implanted materials has important applications not only for optimising tissue engineering strategies, but also to control deleterious fibrotic
Richter, Catherine A.; Garcia-Reyero, Natàlia; Martyniuk, Chris; Knoebl, Iris; Pope, Marie; Wright-Osment, Maureen K.; Denslow, Nancy D.; Tillitt, Donald E.
2011-01-01
Methylmercury (MeHg) is a potent neurotoxicant and endocrine disruptor that accumulates in aquatic systems. Previous studies have shown suppression of hormone levels in both male and female fish, suggesting effects on gonadotropin regulation in the brain. The gene expression profile in adult female zebrafish whole brain induced by acute (96 h) MeHg exposure was investigated. Fish were exposed by injection to 0 or 0.5(mu or u)g MeHg/g. Gene expression changes in the brain were examined using a 22,000-feature zebrafish microarray. At a significance level of p0.01, 79 genes were up-regulated and 76 genes were down-regulated in response to MeHg exposure. Individual genes exhibiting altered expression in response to MeHg exposure implicate effects on glutathione metabolism in the mechanism of MeHg neurotoxicity. Gene ontology (GO) terms significantly enriched among altered genes included protein folding, cell redox homeostasis, and steroid biosynthetic process. The most affected biological functions were related to nervous system development and function, as well as lipid metabolism and molecular transport. These results support the involvement of oxidative stress and effects on protein structure in the mechanism of action of MeHg in the female brain. Future studies will compare the gene expression profile induced in response to MeHg with that induced by other toxicants and will investigate responsive genes as potential biomarkers of MeHg exposure.
Leptospira interrogans serovar copenhageni harbors two lexA genes involved in SOS response.
Directory of Open Access Journals (Sweden)
Luciane S Fonseca
Full Text Available Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2 one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence.
Li, Donghua; Liu, Pan; Yu, Jingyin; Wang, Linhai; Dossa, Komivi; Zhang, Yanxin; Zhou, Rong; Wei, Xin; Zhang, Xiurong
2017-09-11
Sesame (Sesamum indicum L.) is one of the world's most important oil crops. However, it is susceptible to abiotic stresses in general, and to waterlogging and drought stresses in particular. The molecular mechanisms of abiotic stress tolerance in sesame have not yet been elucidated. The WRKY domain transcription factors play significant roles in plant growth, development, and responses to stresses. However, little is known about the number, location, structure, molecular phylogenetics, and expression of the WRKY genes in sesame. We performed a comprehensive study of the WRKY gene family in sesame and identified 71 SiWRKYs. In total, 65 of these genes were mapped to 15 linkage groups within the sesame genome. A phylogenetic analysis was performed using a related species (Arabidopsis thaliana) to investigate the evolution of the sesame WRKY genes. Tissue expression profiles of the WRKY genes demonstrated that six SiWRKY genes were highly expressed in all organs, suggesting that these genes may be important for plant growth and organ development in sesame. Analysis of the SiWRKY gene expression patterns revealed that 33 and 26 SiWRKYs respond strongly to waterlogging and drought stresses, respectively. Changes in the expression of 12 SiWRKY genes were observed at different times after the waterlogging and drought treatments had begun, demonstrating that sesame gene expression patterns vary in response to abiotic stresses. In this study, we analyzed the WRKY family of transcription factors encoded by the sesame genome. Insight was gained into the classification, evolution, and function of the SiWRKY genes, revealing their putative roles in a variety of tissues. Responses to abiotic stresses in different sesame cultivars were also investigated. The results of our study provide a better understanding of the structures and functions of sesame WRKY genes and suggest that manipulating these WRKYs could enhance resistance to waterlogging and drought.
Gene expression response to EWS–FLI1 in mouse embryonic cartilage
Directory of Open Access Journals (Sweden)
Miwa Tanaka
2014-12-01
Full Text Available Ewing's sarcoma is a rare bone tumor that affects children and adolescents. We have recently succeeded to induce Ewing's sarcoma-like small round cell tumor in mice by expression of EWS–ETS fusion genes in murine embryonic osteochondrogenic progenitors. The Ewing's sarcoma precursors are enriched in embryonic superficial zone (eSZ cells of long bone. To get insights into the mechanisms of Ewing's sarcoma development, gene expression profiles between EWS–FLI1-sensitive eSZ cells and EWS–FLI1-resistant embryonic growth plate (eGP cells were compared using DNA microarrays. Gene expression of eSZ and eGP cells (total, 30 samples was evaluated with or without EWS–FLI1 expression 0, 8 or 48 h after gene transduction. Our data provide useful information for gene expression responses to fusion oncogenes in human sarcoma.
Directory of Open Access Journals (Sweden)
Hui Peng
2014-08-01
Full Text Available Calmodulin, a ubiquitous calcium sensor, plays an important role in decoding stress-triggered intracellular calcium changes and regulates the functions of numerous target proteins involved in various plant physiological responses. To determine the functions of calmodulin in fleshy fruit, expression studies were performed on a family of six calmodulin genes (SlCaMs in mature-green stage tomato fruit in response to mechanical injury and Botrytis cinerea infection. Both wounding and pathogen inoculation triggered expression of all those genes, with SlCaM2 being the most responsive one to both treatments. Furthermore, all calmodulin genes were upregulated by salicylic acid and methyl jasmonate, two signaling molecules involved in plant immunity. In addition to SlCaM2, SlCaM1 was highly responsive to salicylic acid and methyl jasmonate. However, SlCaM2 exhibited a more rapid and stronger response than SlCaM1. Overexpression of SlCaM2 in tomato fruit enhanced resistance to Botrytis-induced decay, whereas reducing its expression resulted in increased lesion development. These results indicate that calmodulin is a positive regulator of plant defense in fruit by activating defense pathways including salicylate- and jasmonate-signaling pathways, and SlCaM2 is the major calmodulin gene responsible for this event.
Directory of Open Access Journals (Sweden)
Gökhan Sadi
Full Text Available This study was conducted to elucidate the genome-wide gene expression profile in streptozotocin induced diabetic rat liver tissues in response to resveratrol treatment and to establish differentially expressed transcription regulation networks with microarray technology. In addition to measure the expression levels of several antioxidant and detoxification genes, real-time quantitative polymerase chain reaction (qRT-PCR was also used to verify the microarray results. Moreover, gene and protein expressions as well as enzymatic activities of main antioxidant enzymes; superoxide dismutase (SOD-1 and SOD-2 and glutathione S-transferase (GST-Mu were analyzed. Diabetes altered 273 genes significantly and 90 of which were categorized functionally which suggested that genes in cellular catalytic activities, oxidation-reduction reactions, co-enzyme binding and terpenoid biosynthesis were dominated by up-regulated expression in diabetes. Whereas; genes responsible from cellular carbohydrate metabolism, regulation of transcription, cell signal transduction, calcium independent cell-to-cell adhesion and lipid catabolism were down-regulated. Resveratrol increased the expression of 186 and decreased the expression of 494 genes in control groups. While cellular and extracellular components, positive regulation of biological processes, biological response to stress and biotic stimulants, and immune response genes were up-regulated, genes responsible from proteins present in nucleus and nucleolus were mainly down-regulated. The enzyme assays showed a significant decrease in diabetic SOD-1 and GST-Mu activities. The qRT-PCR and Western-blot results demonstrated that decrease in activity is regulated at gene expression level as both mRNA and protein expressions were also suppressed. Resveratrol treatment normalized the GST activities towards the control values reflecting a post-translational effect. As a conclusion, global gene expression in the liver tissues is
International Nuclear Information System (INIS)
Anaganti, Narasimha; Basu, Bhakti; Apte, Shree Kumar
2015-01-01
Deinococcus radiodurans is an extremophile that withstands lethal doses of several DNA damaging agents such as gamma irradiation, UV rays, desiccation and chemical mutagens. The organism responds to DNA damage by inducing expression of several DNA repair genes. At least 25 radiation inducible gene promoters harbour a 17 bp palindromic sequence known as radiation and desiccation response motif (RDRM) implicated in gamma radiation inducible gene expression. However, mechanistic details of gamma radiation-responsive up-regulation in gene expression remain enigmatic. The promoters of highly radiation induced genes ddrB (DR0070), gyrB (DR0906), gyrA (DR1913), a hypothetical gene (DR1143) and recA (DR2338) from D. radiodurans were cloned in a green fluorescence protein (GFP)-based promoter probe shuttle vector pKG and their promoter activity was assessed in both E. coli as well as in D. radiodurans. The gyrA, gyrB and DR1143 gene promoters were active in E. coli although ddrB and recA promoters showed very weak activity. In D. radiodurans, all the five promoters were induced several fold following 6 kGy gamma irradiation. Highest induction was observed for ddrB promoter (25 fold), followed by DR1143 promoter (15 fold). The induction in the activity of gyrB, gyrA and recA promoters was 5, 3 and 2 fold, respectively. To assess the role of RDRM, the 17 bp palindromic sequence was deleted from these promoters. The promoters devoid of RDRM sequence displayed increase in the basal expression activity, but the radiation-responsive induction in promoter activity was completely lost. The substitution of two conserved bases of RDRM sequence yielded decreased radiation induction of PDR0070 promoter. Deletion of 5 bases from 5'-end of PDR0070 RDRM increased basal promoter activity, but radiation induction was completely abolished. Replacement of RDRM with non specific sequence of PDR0070 resulted in loss of basal expression and radiation induction. The results demonstrate that
Stat1-independent regulation of gene expression in response to IFN-γ
Ramana, Chilakamarti V.; Gil, M. Pilar; Han, Yulong; Ransohoff, Richard M.; Schreiber, Robert D.; Stark, George R.
2001-01-01
Although Stat1 is essential for cells to respond fully to IFN-γ, there is substantial evidence that, in the absence of Stat1, IFN-γ can still regulate the expression of some genes, induce an antiviral state and affect cell growth. We have now identified many genes that are regulated by IFN-γ in serum-starved Stat1-null mouse fibroblasts. The proteins induced by IFN-γ in Stat1-null cells can account for the substantial biological responses that remain. Some genes are induced in both wild-type and Stat1-null cells and thus are truly Stat1-independent. Others are subject to more complex regulation in response to IFN-γ, repressed by Stat1 in wild-type cells and activated in Stat1-null cells. Many genes induced by IFN-γ in Stat1-null fibroblasts also are induced by platelet-derived growth factor in wild-type cells and thus are likely to be involved in cell proliferation. In mouse cells expressing the docking site mutant Y440F of human IFN-γ receptor subunit 1, the mouse Stat1 is not phosphorylated in response to human IFN-γ, but c-myc and c-jun are still induced, showing that the Stat1 docking site is not required for Stat1-independent signaling. PMID:11390994
Molecular responses and expression analysis of genes in a ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... Molecular responses and expression analysis of genes in a xerophytic desert shrub Haloxylon ammodendron .... physiological determination and cDNA-AFLP analysis, three groups of seeds were sowed in pots with sand and .... HaDR27. U. 234. PDR-like ABC transporter. AT1G59870. HaDR28. U. 135.
Loss of prion protein induces a primed state of type I interferon-responsive genes
DEFF Research Database (Denmark)
Malachin, Giulia; Reiten, Malin R.; Salvesen, Øyvind
2017-01-01
The cellular prion protein (PrPC) has been extensively studied because of its pivotal role in prion diseases; however, its functions remain incompletely understood. A unique line of goats has been identified that carries a nonsense mutation that abolishes synthesis of PrPC. In these animals, the Pr...... genotypes. About 70% of these were classified as interferon-responsive genes. In goats without PrPC, the majority of type I interferon-responsive genes were in a primed, modestly upregulated state, with fold changes ranging from 1.4 to 3.7. Among these were ISG15, DDX58 (RIG-1), MX1, MX2, OAS1, OAS2...... and DRAM1, all of which have important roles in pathogen defense, cell proliferation, apoptosis, immunomodulation and DNA damage response. Our data suggest that PrPC contributes to the fine-tuning of resting state PBMCs expression level of type I interferon-responsive genes. The molecular mechanism...
Ma, Jianchao; Lu, Jing; Xu, Jianmei; Duan, Bingbing; He, Xiaodong; Liu, Jianquan
2015-01-01
WRKY transcription factors play important roles in plant development and responses to various stresses in plants. However, little is known about the evolution of the WRKY genes in the desert poplar species Populus euphratica, which is highly tolerant of salt stress. In this study, we identified 107 PeWRKY genes from the P. euphratica genome and examined their evolutionary relationships with the WRKY genes of the salt-sensitive congener Populus trichocarpa. Ten PeWRKY genes are specific to P. euphratica, and five of these showed altered expression under salt stress. Furthermore, we found that two pairs of orthologs between the two species showed evidence of positive evolution, with dN/dS ratios>1 (nonsynonymous/synonymous substitutions), and both of them altered their expression in response to salinity stress. These findings suggested that both the development of new genes and positive evolution in some orthologs of the WRKY gene family may have played an important role in the acquisition of high salt tolerance by P. euphratica.
Epigenetic modulation of gene expression governs the brain’s response to injury
Simon, Roger P.
2016-01-01
Mild stress from ischemia, seizure, hypothermia, or infection can produce a transient neuroprotected state in the brain. In the neuroprotected state, the brain responds differently to a severe stress and sustains less injury. At the genomic level, the response of the neuroprotected brain to a severe stress is characterized by widespread differential regulation of genes with diverse functions. This reprogramming of gene expression observed in the neuroprotected brain in response to a stress is consistent with an epigenetic model of regulation mediated by changes in DNA methylation and histone modification. Here, we summarize our evolving understanding of the molecular basis for endogenous neuroprotection and review recent findings that implicate DNA methylation and protein mediators of histone modification as epigenetic regulators of the brain’s response to injury. PMID:26739198
Wang, Z; Halbert, C L; Lee, D; Butts, T; Tapscott, S J; Storb, R; Miller, A D
2014-04-01
Animal and human gene therapy studies utilizing AAV vectors have shown that immune responses to AAV capsid proteins can severely limit transgene expression. The main source of capsid antigen is that associated with the AAV vectors, which can be reduced by stringent vector purification. A second source of AAV capsid proteins is that expressed from cap genes aberrantly packaged into AAV virions during vector production. This antigen source can be eliminated by the use of a cap gene that is too large to be incorporated into an AAV capsid, such as a cap gene containing a large intron (captron gene). Here, we investigated the effects of elimination of cap gene transfer and of vector purification by CsCl gradient centrifugation on AAV vector immunogenicity and expression following intramuscular injection in dogs. We found that both approaches reduced vector immunogenicity and that combining the two produced the lowest immune responses and highest transgene expression. This combined approach enabled the use of a relatively mild immunosuppressive regimen to promote robust micro-dystrophin gene expression in Duchenne muscular dystrophy-affected dogs. Our study shows the importance of minimizing AAV cap gene impurities and indicates that this improvement in AAV vector production may benefit human applications.
Nutritional Effect on Androgen-Response Gene Expression and Prostate Tumor Growth
National Research Council Canada - National Science Library
Wang, Zhou
2001-01-01
.... The dietary influence on ventral prostate weight does not seem to involve androgen action axis because dietary components did not influence the expression of several androgen-response genes, serum testosterone...
Strafella, Elisabetta; Bracci, Massimo; Staffolani, Sara; Manzella, Nicola; Giantomasi, Daniele; Valentino, Matteo; Amati, Monica; Tomasetti, Marco; Santarelli, Lory
2013-01-01
Objective The aim of this study was to evaluate the expression of a panel of genes involved in toxicology in response to styrene exposure at levels below the occupational standard setting. Methods Workers in a fiber glass boat industry were evaluated for a panel of stress- and toxicity-related genes and associated with biochemical parameters related to hepatic injury. Urinary styrene metabolites (MA+PGA) of subjects and environmental sampling data collected for air at workplace were used to estimate styrene exposure. Results Expression array analysis revealed massive upregulation of genes encoding stress-responsive proteins (HSPA1L, EGR1, IL-6, IL-1β, TNSF10 and TNFα) in the styrene-exposed group; the levels of cytokines released were further confirmed in serum. The exposed workers were then stratified by styrene exposure levels. EGR1 gene upregulation paralleled the expression and transcriptional protein levels of IL-6, TNSF10 and TNFα in styrene exposed workers, even at low level. The activation of the EGR1 pathway observed at low-styrene exposure was associated with a slight increase of hepatic markers found in highly exposed subjects, even though they were within normal range. The ALT and AST levels were not affected by alcohol consumption, and positively correlated with urinary styrene metabolites as evaluated by multiple regression analysis. Conclusion The pro-inflammatory cytokines IL-6 and TNFα are the primary mediators of processes involved in the hepatic injury response and regeneration. Here, we show that styrene induced stress responsive genes involved in cytoprotection and cytotoxicity at low-exposure, that proceed to a mild subclinical hepatic toxicity at high-styrene exposure. PMID:24086524
Regulation of radiation-induced apoptosis by early growth response-1 gene in solid tumors
International Nuclear Information System (INIS)
Ahmed, M.
2003-01-01
Ionizing radiation exposure is associated with activation of certain immediate-early genes that function as transcription factors. These include members of jun or fos and early growth response (EGR) gene families. In particular, the functional role of EGR-1 in radiation-induced signaling is pivotal since the promoter of EGR-1 contains radiation-inducible CArG DNA sequences. The Egr-1 gene belongs to a family of Egr genes that includes EGR-2, EGR-3, EGR-4, EGR-α and the tumor suppressor, Wilms' tumor gene product, WT1. The Egr-1 gene product, EGR-1, is a nuclear protein that contains three zinc fingers of the C 2 H 2 subtype. The EGR-1 GC-rich consensus target sequence, 5'-GCGT/GGGGCG-3' or 5'-TCCT/ACCTCCTCC-3', has been identified in the promoter regions of transcription factors, growth factors, receptors, cell cycle regulators and pro-apoptotic genes. The gene targets mediated by Egr-1 in response to ionizing radiation include TNF-α , p53, Rb and Bax, all these are effectors of apoptosis. Based on these targets, Egr-1 is a pivotal gene that initiates early signal transduction events in response to ionizing radiation leading to either growth arrest or cell death in tumor cells. There are two potential application of Egr-1 gene in therapy of cancer. First, the Egr-1 promoter contains information for appropriate spatial and temporal expression in-vivo that can be regulated by ionizing radiation to control transcription of genes that have pro-apoptotic and suicidal function. Secondly, EGR-1 protein can eliminate 'induced-radiation resistance' by inhibiting the functions of radiation-induced pro-survival genes (NFκB activity and bcl-2 expression) and activate pro-apoptotic genes (such as bax) to confer a significant radio-sensitizing effect. Together, the reported findings from my laboratory demonstrate clearly that EGR-1 is an early central gene that confers radiation sensitivity and its pro-apoptotic functions are synergized by abrogation of induced radiation
Djami-Tchatchou, A T; Ntushelo, K
2017-01-01
Pectobacterium carotovorum subsp. carotovorum (Pcc) is a soft rot bacterium which upon entry into the plant macerates plant tissues by producing plant cell wall degrading enzymes. It has a wide host range which includes carrot, potato, tomato, leafy greens, squash and other cucurbits, onion, green peppers and cassava. During plant-microbe interactions, one of the ways of plant response to pathogen infection is through the small RNA silencing mechanism. Under pathogen attack the plant utilizes microRNAs to regulate gene expression by means of mediating gene silencing at transcriptional and post-transcriptional level. This study aims to assess for the first time, the expression profile of some stress-responsive miRNA and differential expression pattern of their target genes in Arabidopsis thaliana inoculated with Pcc. Leaves of five weeks old Arabidopsis thaliana plants were infected with Pcc and the quantitative real time-PCR, was used to investigate after 0, 24, 48 and 72 h post infection, the expression profiling of the stress-responsive miRNAs which include: miR156, miR159, miR169, miR393, miR396 miR398, miR399 and miR408 along with their target genes which include: Squamosa promoter-binding-like protein, myb domain protein 101, nuclear factor Y subunit A8, concanavalin A-like lectin protein kinase, growth regulating factor 4, copper superoxide dismutase, ubiquitin-protein ligase and plantacyanin respectively. The findings showed that the overexpression of 6 miRNAs at 24, 48 and 72 h after infection resulted in the repression of their target genes and the expression of 2 miRNAs didn't affect their target genes. These results provide the first indication of the miRNAs role in response to the infection of Pcc in A. thaliana and open new vistas for a better understanding of miRNA regulation of plant response to Pcc.
Meta-analysis of the effect of overexpression of CBF/DREB family genes on drought stress response
Transcription factors C-repeat/dehydration-responsive element binding proteins (CBF/DREB) play an important role in plant response to abiotic stresses. Over-expression of various CBF/DREB genes in diverse plants have been reported, but inconsistency of gene donor, recipient genus, parameters used i...
Gene up-regulation in response to predator kairomones in the water flea, Daphnia pulex
Directory of Open Access Journals (Sweden)
Okada Yasukazu
2010-04-01
Full Text Available Abstract Background Numerous cases of predator-induced polyphenisms, in which alternate phenotypes are produced in response to extrinsic stimuli, have been reported in aquatic taxa to date. The genus Daphnia (Branchiopoda, Cladocera provides a model experimental system for the study of the developmental mechanisms and evolutionary processes associated with predator-induced polyphenisms. In D. pulex, juveniles form neckteeth in response to predatory kairomones released by Chaoborus larvae (Insecta, Diptera. Results Previous studies suggest that the timing of the sensitivity to kairomones in D. pulex can generally be divided into the embryonic and postembryonic developmental periods. We therefore examined which of the genes in the embryonic and first-instar juvenile stages exhibit different expression levels in the presence or absence of predator kairomones. Employing a candidate gene approach and identifying differentially-expressed genes revealed that the morphogenetic factors, Hox3, extradenticle and escargot, were up-regulated by kairomones in the postembryonic stage and may potentially be responsible for defense morph formation. In addition, the juvenile hormone pathway genes, JHAMT and Met, and the insulin signaling pathway genes, InR and IRS-1, were up-regulated in the first-instar stage. It is well known that these hormonal pathways are involved in physiological regulation following morphogenesis in many insect species. During the embryonic stage when morphotypes were determined, one of the novel genes identified by differential display was up-regulated, suggesting that this gene may be related to morphotype determination. Biological functions of the up-regulated genes are discussed in the context of defense morph formation. Conclusions It is suggested that, following the reception of kairomone signals, the identified genes are involved in a series of defensive phenotypic alterations and the production of a defensive phenotype.
The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses
Directory of Open Access Journals (Sweden)
Yuling Bai
2018-06-01
Full Text Available In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.
GENE RESPONSE OF THE GASTROCNEMIUS AND SOLEUS MUSCLES TO AN ACUTE AEROBIC RUN IN RATS
Directory of Open Access Journals (Sweden)
Michael J. McKenzie
2011-06-01
Full Text Available Genes can be activated or inhibited by signals within the tissues in response to an acute bout of exercise. It is unclear how a particular aerobic exercise bout may influence two muscles with similar actions to the activity. Therefore, the purposes of this investigation was to determine the gene response of selected genes involved in the "stress" response of the gastrocnemius (fast-twitch and soleus (slow-twitch muscles to a single two hour aerobic exercise bout in female Sprague-Dawley Rats at the 1 hour time point after the exercise. Exercised rats were run (n=8 for 2 hours at 20 m.min-1 and one hour after the completion of the bout had their soleus (S and gastrocnemius (G muscles removed. Age and timed matched sedentary control rats had both S and G muscles removed also. RNA was isolated from all muscles. Real-time PCR analysis was performed on the following genes: NFκB, TNFα, and Atf3. GAPDH was used as the housekeeping gene for both muscles. S muscle showed more genes altered (n = 52 vs G (n = 26. NFκB gene expression was 0.83 ± 0.14 in the exercised S but was + 1.36 ± 0.58 in the exercised G and was not significantly different between the muscles. TNFα was altered 1.30 ± 0. 34 in the exercised S and 1.36 ± 0.71 in the exercised G and was not significantly different between the muscles. The gene Atf3 was significantly altered at 4.97 ± 1.01 in the exercised S, while it was not significantly altered in the exercised G (0.70 ± 0.55. This study demonstrates that an acute bout of aerobic exercise can alter gene expression to a different extent in both the S and G muscles. It is highly likely that muscle recruitment was a factor which influenced the gene expression in theses muscles. It is interesting to note that some genes were similarly activated in these two muscles but other genes may demonstrate a varied response to the same exercise bout depending on the type of muscle
Nagaraju, Kanneboyina; Ghimbovschi, Svetlana; Rayavarapu, Sree; Phadke, Aditi; Rider, Lisa G; Hoffman, Eric P; Miller, Frederick W
2016-09-01
To identify muscle gene expression patterns that predict rituximab responses and assess the effects of rituximab on muscle gene expression in PM and DM. In an attempt to understand the molecular mechanism of response and non-response to rituximab therapy, we performed Affymetrix gene expression array analyses on muscle biopsy specimens taken before and after rituximab therapy from eight PM and two DM patients in the Rituximab in Myositis study. We also analysed selected muscle-infiltrating cell phenotypes in these biopsies by immunohistochemical staining. Partek and Ingenuity pathway analyses assessed the gene pathways and networks. Myeloid type I IFN signature genes were expressed at higher levels at baseline in the skeletal muscle of rituximab responders than in non-responders, whereas classic non-myeloid IFN signature genes were expressed at higher levels in non-responders at baseline. Also, rituximab responders have a greater reduction of the myeloid and non-myeloid type I IFN signatures than non-responders. The decrease in the type I IFN signature following administration of rituximab may be associated with the decreases in muscle-infiltrating CD19(+) B cells and CD68(+) macrophages in responders. Our findings suggest that high levels of myeloid type I IFN gene expression in skeletal muscle predict responses to rituximab in PM/DM and that rituximab responders also have a greater decrease in the expression of these genes. These data add further evidence to recent studies defining the type I IFN signature as both a predictor of therapeutic responses and a biomarker of myositis disease activity. Published by Oxford University Press on behalf British Society for Rheumatology 2016. This work is written by US Government employees and is in the public domain in the US.
Epigenetic modulation of gene expression governs the brain���s response to injury
Simon, Roger P.
2015-01-01
Mild stress from ischemia, seizure, hypothermia, or infection can produce a transient neuroprotected state in the brain. In the neuroprotected state, the brain responds differently to a severe stress and sustains less injury. At the genomic level, the response of the neuroprotected brain to a severe stress is characterized by widespread differential regulation of genes with diverse functions. This reprogramming of gene expression observed in the neuroprotected brain in response to a stress is...
Caarls, Lotte; van der Does, Adriana; Hickman, Richard; Jansen, Wouter; van Verk, Marcel; Proietti, Silvia; Lorenzo, Oscar; Solano, Roberto; Pieterse, Corné M J; Van Wees, Saskia C M
2017-01-01
Salicylic acid (SA) and jasmonic acid (JA) cross-communicate in the plant immune signaling network to finely regulate induced defenses. In Arabidopsis, SA antagonizes many JA-responsive genes, partly by targeting the ETHYLENE RESPONSE FACTOR (ERF)-type transcriptional activator ORA59. Members of the
Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael
2008-04-16
The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.
Directory of Open Access Journals (Sweden)
Andrade-Garda José
2008-04-01
Full Text Available Abstract Background The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. Results We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Conclusion Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.
The Tyrosyl-DNA Phosphodiesterase 1β (Tdp1β Gene Discloses an Early Response to Abiotic Stresses
Directory of Open Access Journals (Sweden)
Maria Elisa Sabatini
2017-11-01
Full Text Available Tyrosyl-DNA phosphodiesterase 1 (Tdp1 is involved in DNA repair pathways as it mends the topoisomerase I—DNA covalent complexes. In plants, a small Tdp1 gene family, composed by Tdp1α and Tdp1β genes, was identified, but the roles of these genes in abiotic stress responses are not fully understood. To investigate their specific stress response patterns, the present study made use of bioinformatic and molecular tools to look into the Tdp1β gene function, so far described only in the plant kingdom, and compare it with Tdp1α gene coding for the canonical, highly conserved α isoform. The expression profiles of Tdp1α and Tdp1β genes were examined under abiotic stress conditions (cold, heat, high osmolarity, salt, and UV-B in two model species, Arabidopsis thaliana and Medicago truncatula. The two isoforms of topoisomerase I (TOP1α and TOP1β were also taken into consideration in view of their known roles in DNA metabolism and cell proliferation. Data relative to gene expression in Arabidopsis were retrieved from the AtGenExpress microarray dataset, while quantitative Real-Time PCR was carried out to evaluate the stress response in M. truncatula cell cultures. These analyses revealed that Tdp1β gene expression was enhanced during the first hour of treatment, whereas Tdp1α enhanced expression succeeded at subsequent timepoints. In agreement with the gene-specific responses to abiotic stress conditions, the promoter regions of Tdp1α and Tdp1β genes are well equipped with stress-related cis-elements. An in-depth bioinformatic characterization of the HIRAN motif, a distinctive feature of the Tdp1β protein, showed its wide distribution in chromatin remodeling and DNA repair proteins. The reported data suggests that Tdp1β functions in the early response to abiotic stresses.
Liu, Xiaoming; Yang, Jiasheng; Zhang, Yi; Fang, Yun; Wang, Fayou; Wang, Jun; Zheng, Xiaoqi; Yang, Jialiang
2016-03-01
We have studied drug-response associated (DRA) gene expressions by applying a systems biology framework to the Cancer Cell Line Encyclopedia data. More than 4,000 genes are inferred to be DRA for at least one drug, while the number of DRA genes for each drug varies dramatically from almost 0 to 1,226. Functional enrichment analysis shows that the DRA genes are significantly enriched in genes associated with cell cycle and plasma membrane. Moreover, there might be two patterns of DRA genes between genders. There are significantly shared DRA genes between male and female for most drugs, while very little DRA genes tend to be shared between the two genders for a few drugs targeting sex-specific cancers (e.g., PD-0332991 for breast cancer and ovarian cancer). Our analyses also show substantial difference for DRA genes between young and old samples, suggesting the necessity of considering the age effects for personalized medicine in cancers. Lastly, differential module and key driver analyses confirm cell cycle related modules as top differential ones for drug sensitivity. The analyses also reveal the role of TSPO, TP53, and many other immune or cell cycle related genes as important key drivers for DRA network modules. These key drivers provide new drug targets to improve the sensitivity of cancer therapy.
A gene expression profile indicative of early stage HER2 targeted therapy response.
O'Neill, Fiona; Madden, Stephen F; Clynes, Martin; Crown, John; Doolan, Padraig; Aherne, Sinéad T; O'Connor, Robert
2013-07-01
Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor.Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents.
Ramirez-Córdova, Jesús; Drnevich, Jenny; Madrigal-Pulido, Jaime Alberto; Arrizon, Javier; Allen, Kirk; Martínez-Velázquez, Moisés; Alvarez-Maya, Ikuri
2012-08-01
During ethanol fermentation, yeast cells are exposed to stress due to the accumulation of ethanol, cell growth is altered and the output of the target product is reduced. For Agave beverages, like tequila, no reports have been published on the global gene expression under ethanol stress. In this work, we used microarray analysis to identify Saccharomyces cerevisiae genes involved in the ethanol response. Gene expression of a tequila yeast strain of S. cerevisiae (AR5) was explored by comparing global gene expression with that of laboratory strain S288C, both after ethanol exposure. Additionally, we used two different culture conditions, cells grown in Agave tequilana juice as a natural fermentation media or grown in yeast-extract peptone dextrose as artificial media. Of the 6368 S. cerevisiae genes in the microarray, 657 genes were identified that had different expression responses to ethanol stress due to strain and/or media. A cluster of 28 genes was found over-expressed specifically in the AR5 tequila strain that could be involved in the adaptation to tequila yeast fermentation, 14 of which are unknown such as yor343c, ylr162w, ygr182c, ymr265c, yer053c-a or ydr415c. These could be the most suitable genes for transforming tequila yeast to increase ethanol tolerance in the tequila fermentation process. Other genes involved in response to stress (RFC4, TSA1, MLH1, PAU3, RAD53) or transport (CYB2, TIP20, QCR9) were expressed in the same cluster. Unknown genes could be good candidates for the development of recombinant yeasts with ethanol tolerance for use in industrial tequila fermentation.
Bortell, Nikki; Basova, Liana; Semenova, Svetlana; Fox, Howard; Ravasi, Timothy; Marcondes, Maria
2017-01-01
Abstract Background Astrocyte activation is one of the earliest findings in the brain of methamphetamine (Meth) abusers. Our goal in this study was to identify the characteristics of the astrocytic acute response to the drug, which may be critical in pathogenic outcomes secondary to the use. Methods We developed an integrated analysis of gene expression data to study the acute gene changes caused by the direct exposure to Meth treatment of astrocytes in vitro, and to better understand how astrocytes respond, what are the early molecular markers associated with this response. We examined the literature in search of similar changes in gene signatures that are found in central nervous system disorders. Results We identified overexpressed gene networks represented by genes of an inflammatory and immune nature and that are implicated in neuroactive ligand-receptor interactions. The overexpressed networks are linked to molecules that were highly upregulated in astrocytes by all doses of methamphetamine tested and that could play a role in the central nervous system. The strongest overexpressed signatures were the upregulation of MAP2K5, GPR65, and CXCL5, and the gene networks individually associated with these molecules. Pathway analysis revealed that these networks are involved both in neuroprotection and in neuropathology. We have validated several targets associated to these genes. Conclusions Gene signatures for the astrocytic response to Meth were identified among the upregulated gene pool, using an in vitro system. The identified markers may participate in dysfunctions of the central nervous system but could also provide acute protection to the drug exposure. Further in vivo studies are necessary to establish the role of these gene networks in drug abuse pathogenesis.
Identification of heat-responsive genes in carnation (Dianthus caryophyllus L. by RNA-seq
Directory of Open Access Journals (Sweden)
Xueli eWan
2015-07-01
Full Text Available Carnation (Dianthus caryophyllus L. is an important flower crop, having substantial commercial value as a cut-flower due to the long vase-life and wide array of flower colours and forms. Standard carnation varieties perform well under cool climates but are very susceptible to high temperatures which adversely affect the yield and the quality of the cut-flowers. Despite several studies of carnation contributing to the number of expressed sequence tags (ESTs, transcriptomic information of this species remains very limited, particularly regarding abiotic stress-related genes. Here, transcriptome analysis was performed to generate expression profiles of heat stress (HS-responsive genes in carnation. We sequenced a cDNA library constructed with mixed RNA from carnation leaves subjected to 42oC HS (0, 0.5, 1 and 2 h and 46oC HS (0.5, 1 and 2 h, and obtained 45,604,882 high quality paired-end reads. After de novo assembly and quantitative assessment, 99,255 contigs were generated with an average length of 1053bp. We then obtained functional annotations by aligning contigs with public protein databases including NR, SwissProt, KEGG and COG. Using the above carnation transcriptome as the reference, we compared the effects of high temperature treatments (42oC: duration 0.5, 2 or 12h delivered to aseptic carnation seedlings, relative to untreated controls, using the FPKM metric. Overall, 11,471 genes were identified which showed a significant response to one or more of the three HS treatment times. In addition, based on GO and metabolic pathway enrichment analyses, a series of candidate genes involved in thermo-tolerance responses were selected and characterized. This study represents the first expression profiling analysis of D. caryophyllus under heat stress treatments. Numerous genes were found to be induced in response to HS, the study of which may advance our understanding of heat response of carnation.
Directory of Open Access Journals (Sweden)
Nancy Bueno Figueiredo
2014-01-01
Full Text Available It has been well established that estrogen plays an important role in the progression and treatment of breast cancer. However, the role of triiodothyronine (T3 remains controversial. We have previously shown its capacity to stimulate the development of positive estrogen receptor breast carcinoma, induce the expression of genes (PR, TGF-alpha normally stimulated by estradiol (E2, and suppress genes (TGF-beta normally inhibited by E2. Since T3 regulates growth hormones, metabolism, and differentiation, it is important to verify its action on other genes normally induced by E2. Therefore, we used DNA microarrays to compare gene expression patterns in MCF-7 breast adenocarcinoma cells treated with E2 and T3. Several genes were modulated by both E2 and T3 in MCF-7 cells (Student’s t-test, P 2.0, pFDR < 0.05. We confirmed our microarray results by real-time PCR. Our findings reveal that certain genes in MCF-7 cells can be regulated by both E2 and T3.
A nucleotide metabolite controls stress-responsive gene expression and plant development.
Directory of Open Access Journals (Sweden)
Hao Chen
Full Text Available Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1 protein is a negative regulator of stress and abscisic acid (ABA signaling and exhibits both an inositol polyphosphatase and a 3',5'-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3'-phosphoadenosine-5'-phosphate (PAP, yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3'-phosphoadenosine-5'-phosphosulfate (PAPS, we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt
A nucleotide metabolite controls stress-responsive gene expression and plant development
Chen, Hao
2011-10-19
Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1) protein is a negative regulator of stress and abscisic acid (ABA) signaling and exhibits both an inositol polyphosphatase and a 3?,5?-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3?-phosphoadenosine-5?-phosphate (PAP), yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3?-phosphoadenosine-5?-phosphosulfate (PAPS), we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt toxicity target
Directory of Open Access Journals (Sweden)
Barloy-Hubler Frédérique
2008-12-01
Full Text Available Abstract Background Oxidative stress is a common stress encountered by living organisms and is due to an imbalance between intracellular reactive oxygen and nitrogen species (ROS, RNS and cellular antioxidant defence. To defend themselves against ROS/RNS, bacteria possess a subsystem of detoxification enzymes, which are classified with regard to their substrates. To identify such enzymes in prokaryotic genomes, different approaches based on similarity, enzyme profiles or patterns exist. Unfortunately, several problems persist in the annotation, classification and naming of these enzymes due mainly to some erroneous entries in databases, mistake propagation, absence of updating and disparity in function description. Description In order to improve the current annotation of oxidative stress subsystems, an innovative platform named OxyGene has been developed. It integrates an original database called OxyDB, holding thoroughly tested anchor-based signatures associated to subfamilies of oxidative stress enzymes, and a new anchor-driven annotator, for ab initio detection of ROS/RNS response genes. All complete Bacterial and Archaeal genomes have been re-annotated, and the results stored in the OxyGene repository can be interrogated via a Graphical User Interface. Conclusion OxyGene enables the exploration and comparative analysis of enzymes belonging to 37 detoxification subclasses in 664 microbial genomes. It proposes a new classification that improves both the ontology and the annotation of the detoxification subsystems in prokaryotic whole genomes, while discovering new ORFs and attributing precise function to hypothetical annotated proteins. OxyGene is freely available at: http://www.umr6026.univ-rennes1.fr/english/home/research/basic/software
Directory of Open Access Journals (Sweden)
Henrik Bjørn Nielsen
2007-08-01
Full Text Available The systematic comparison of transcriptional responses of organisms is a powerful tool in functional genomics. For example, mutants may be characterized by comparing their transcript profiles to those obtained in other experiments querying the effects on gene expression of many experimental factors including treatments, mutations and pathogen infections. Similarly, drugs may be discovered by the relationship between the transcript profiles effectuated or impacted by a candidate drug and by the target disease. The integration of such data enables systems biology to predict the interplay between experimental factors affecting a biological system. Unfortunately, direct comparisons of gene expression profiles obtained in independent, publicly available microarray experiments are typically compromised by substantial, experiment-specific biases. Here we suggest a novel yet conceptually simple approach for deriving 'Functional Association(s by Response Overlap' (FARO between microarray gene expression studies. The transcriptional response is defined by the set of differentially expressed genes independent from the magnitude or direction of the change. This approach overcomes the limited comparability between studies that is typical for methods that rely on correlation in gene expression. We apply FARO to a compendium of 242 diverse Arabidopsis microarray experimental factors, including phyto-hormones, stresses and pathogens, growth conditions/stages, tissue types and mutants. We also use FARO to confirm and further delineate the functions of Arabidopsis MAP kinase 4 in disease and stress responses. Furthermore, we find that a large, well-defined set of genes responds in opposing directions to different stress conditions and predict the effects of different stress combinations. This demonstrates the usefulness of our approach for exploiting public microarray data to derive biologically meaningful associations between experimental factors. Finally, our
Directory of Open Access Journals (Sweden)
Christopher Ian Cazzonelli
2014-10-01
Full Text Available Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3, which encodes a calmodulin-like protein (CML12. The gene neighbouring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.
Cazzonelli, Christopher I; Nisar, Nazia; Roberts, Andrea C; Murray, Kevin D; Borevitz, Justin O; Pogson, Barry J
2014-01-01
Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3), which encodes a calmodulin-like protein (CML12). The gene neighboring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.
Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.
Directory of Open Access Journals (Sweden)
Eneour Puill-Stephan
Full Text Available Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals.Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR. Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria during winnowing processes as symbioses are fine-tuned.Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are
Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.
Puill-Stephan, Eneour; Seneca, François O; Miller, David J; van Oppen, Madeleine J H; Willis, Bette L
2012-01-01
Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are needed to further
Temporal Gene Expression of the Cyanobacterium Arthrospira in Response to Gamma Rays
Badri, Hanène; Monsieurs, Pieter; Coninx, Ilse; Nauts, Robin; Wattiez, Ruddy; Leys, Natalie
2015-01-01
The edible cyanobacterium Arthrospira is resistant to ionising radiation. The cellular mechanisms underlying this radiation resistance are, however, still largely unknown. Therefore, additional molecular analysis was performed to investigate how these cells can escape from, protect against, or repair the radiation damage. Arthrospira cells were shortly exposed to different doses of 60Co gamma rays and the dynamic response was investigated by monitoring its gene expression and cell physiology at different time points after irradiation. The results revealed a fast switch from an active growth state to a kind of 'survival modus' during which the cells put photosynthesis, carbon and nitrogen assimilation on hold and activate pathways for cellular protection, detoxification, and repair. The higher the radiation dose, the more pronounced this global emergency response is expressed. Genes repressed during early response, suggested a reduction of photosystem II and I activity and reduced tricarboxylic acid (TCA) and Calvin-Benson-Bassham (CBB) cycles, combined with an activation of the pentose phosphate pathway (PPP). For reactive oxygen species detoxification and restoration of the redox balance in Arthrospira cells, the results suggested a powerful contribution of the antioxidant molecule glutathione. The repair mechanisms of Arthrospira cells that were immediately switched on, involve mainly proteases for damaged protein removal, single strand DNA repair and restriction modification systems, while recA was not induced. Additionally, the exposed cells showed significant increased expression of arh genes, coding for a novel group of protein of unknown function, also seen in our previous irradiation studies. This observation confirms our hypothesis that arh genes are key elements in radiation resistance of Arthrospira, requiring further investigation. This study provides new insights into phasic response and the cellular pathways involved in the radiation resistance of
Temporal Gene Expression of the Cyanobacterium Arthrospira in Response to Gamma Rays.
Directory of Open Access Journals (Sweden)
Hanène Badri
Full Text Available The edible cyanobacterium Arthrospira is resistant to ionising radiation. The cellular mechanisms underlying this radiation resistance are, however, still largely unknown. Therefore, additional molecular analysis was performed to investigate how these cells can escape from, protect against, or repair the radiation damage. Arthrospira cells were shortly exposed to different doses of 60Co gamma rays and the dynamic response was investigated by monitoring its gene expression and cell physiology at different time points after irradiation. The results revealed a fast switch from an active growth state to a kind of 'survival modus' during which the cells put photosynthesis, carbon and nitrogen assimilation on hold and activate pathways for cellular protection, detoxification, and repair. The higher the radiation dose, the more pronounced this global emergency response is expressed. Genes repressed during early response, suggested a reduction of photosystem II and I activity and reduced tricarboxylic acid (TCA and Calvin-Benson-Bassham (CBB cycles, combined with an activation of the pentose phosphate pathway (PPP. For reactive oxygen species detoxification and restoration of the redox balance in Arthrospira cells, the results suggested a powerful contribution of the antioxidant molecule glutathione. The repair mechanisms of Arthrospira cells that were immediately switched on, involve mainly proteases for damaged protein removal, single strand DNA repair and restriction modification systems, while recA was not induced. Additionally, the exposed cells showed significant increased expression of arh genes, coding for a novel group of protein of unknown function, also seen in our previous irradiation studies. This observation confirms our hypothesis that arh genes are key elements in radiation resistance of Arthrospira, requiring further investigation. This study provides new insights into phasic response and the cellular pathways involved in the radiation
Genome-Wide Identification and Analysis of Drought-Responsive Genes and MicroRNAs in Tobacco
Directory of Open Access Journals (Sweden)
Fuqiang Yin
2015-03-01
Full Text Available Drought stress response is a complex trait regulated at transcriptional and post-transcriptional levels in tobacco. Since the 1990s, many studies have shown that miRNAs act in many ways to regulate target expression in plant growth, development and stress response. The recent draft genome sequence of Nicotiana benthamiana has provided a framework for Digital Gene Expression (DGE and small RNA sequencing to understand patterns of transcription in the context of plant response to environmental stress. We sequenced and analyzed three Digital Gene Expression (DGE libraries from roots of normal and drought-stressed tobacco plants, and four small RNA populations from roots, stems and leaves of control or drought-treated tobacco plants, respectively. We identified 276 candidate drought responsive genes (DRGs with sequence similarities to 64 known DRGs from other model plant crops, 82 were transcription factors (TFs including WRKY, NAC, ERF and bZIP families. Of these tobacco DRGs, 54 differentially expressed DRGs included 21 TFs, which belonged to 4 TF families such as NAC (6, MYB (4, ERF (10, and bZIP (1. Additionally, we confirmed expression of 39 known miRNA families (122 members and five conserved miRNA families, which showed differential regulation under drought stress. Targets of miRNAs were further surveyed based on a recently published study, of which ten targets were DRGs. An integrated gene regulatory network is proposed for the molecular mechanisms of tobacco root response to drought stress using differentially expressed DRGs, the changed expression profiles of miRNAs and their target transcripts. This network analysis serves as a reference for future studies on tobacco response stresses such as drought, cold and heavy metals.
GSHR, a Web-Based Platform Provides Gene Set-Level Analyses of Hormone Responses in Arabidopsis
Directory of Open Access Journals (Sweden)
Xiaojuan Ran
2018-01-01
Full Text Available Phytohormones regulate diverse aspects of plant growth and environmental responses. Recent high-throughput technologies have promoted a more comprehensive profiling of genes regulated by different hormones. However, these omics data generally result in large gene lists that make it challenging to interpret the data and extract insights into biological significance. With the rapid accumulation of theses large-scale experiments, especially the transcriptomic data available in public databases, a means of using this information to explore the transcriptional networks is needed. Different platforms have different architectures and designs, and even similar studies using the same platform may obtain data with large variances because of the highly dynamic and flexible effects of plant hormones; this makes it difficult to make comparisons across different studies and platforms. Here, we present a web server providing gene set-level analyses of Arabidopsis thaliana hormone responses. GSHR collected 333 RNA-seq and 1,205 microarray datasets from the Gene Expression Omnibus, characterizing transcriptomic changes in Arabidopsis in response to phytohormones including abscisic acid, auxin, brassinosteroids, cytokinins, ethylene, gibberellins, jasmonic acid, salicylic acid, and strigolactones. These data were further processed and organized into 1,368 gene sets regulated by different hormones or hormone-related factors. By comparing input gene lists to these gene sets, GSHR helped to identify gene sets from the input gene list regulated by different phytohormones or related factors. Together, GSHR links prior information regarding transcriptomic changes induced by hormones and related factors to newly generated data and facilities cross-study and cross-platform comparisons; this helps facilitate the mining of biologically significant information from large-scale datasets. The GSHR is freely available at http://bioinfo.sibs.ac.cn/GSHR/.
Directory of Open Access Journals (Sweden)
Arjun Sham
Full Text Available Plants have evolved with intricate mechanisms to cope with multiple environmental stresses. To adapt with biotic and abiotic stresses, plant responses involve changes at the cellular and molecular levels. The current study was designed to investigate the effects of combinations of different environmental stresses on the transcriptome level of Arabidopsis genome using public microarray databases. We investigated the role of cyclopentenones in mediating plant responses to environmental stress through TGA (TGACG motif-binding factor transcription factor, independently from jasmonic acid. Candidate genes were identified by comparing plants inoculated with Botrytis cinerea or treated with heat, salt or osmotic stress with non-inoculated or non-treated tissues. About 2.5% heat-, 19% salinity- and 41% osmotic stress-induced genes were commonly upregulated by B. cinerea-treatment; and 7.6%, 19% and 48% of genes were commonly downregulated by B. cinerea-treatment, respectively. Our results indicate that plant responses to biotic and abiotic stresses are mediated by several common regulatory genes. Comparisons between transcriptome data from Arabidopsis stressed-plants support our hypothesis that some molecular and biological processes involved in biotic and abiotic stress response are conserved. Thirteen of the common regulated genes to abiotic and biotic stresses were studied in detail to determine their role in plant resistance to B. cinerea. Moreover, a T-DNA insertion mutant of the Responsive to Dehydration gene (rd20, encoding for a member of the caleosin (lipid surface protein family, showed an enhanced sensitivity to B. cinerea infection and drought. Overall, the overlapping of plant responses to abiotic and biotic stresses, coupled with the sensitivity of the rd20 mutant, may provide new interesting programs for increased plant resistance to multiple environmental stresses, and ultimately increases its chances to survive. Future research
Directory of Open Access Journals (Sweden)
Deyholos Michael K
2006-10-01
Full Text Available Abstract Background Roots are an attractive system for genomic and post-genomic studies of NaCl responses, due to their primary importance to agriculture, and because of their relative structural and biochemical simplicity. Excellent genomic resources have been established for the study of Arabidopsis roots, however, a comprehensive microarray analysis of the root transcriptome following NaCl exposure is required to further understand plant responses to abiotic stress and facilitate future, systems-based analyses of the underlying regulatory networks. Results We used microarrays of 70-mer oligonucleotide probes representing 23,686 Arabidopsis genes to identify root transcripts that changed in relative abundance following 6 h, 24 h, or 48 h of hydroponic exposure to 150 mM NaCl. Enrichment analysis identified groups of structurally or functionally related genes whose members were statistically over-represented among up- or down-regulated transcripts. Our results are consistent with generally observed stress response themes, and highlight potentially important roles for underappreciated gene families, including: several groups of transporters (e.g. MATE, LeOPT1-like; signalling molecules (e.g. PERK kinases, MLO-like receptors, carbohydrate active enzymes (e.g. XTH18, transcription factors (e.g. members of ZIM, WRKY, NAC, and other proteins (e.g. 4CL-like, COMT-like, LOB-Class 1. We verified the NaCl-inducible expression of selected transcription factors and other genes by qRT-PCR. Conclusion Micorarray profiling of NaCl-treated Arabidopsis roots revealed dynamic changes in transcript abundance for at least 20% of the genome, including hundreds of transcription factors, kinases/phosphatases, hormone-related genes, and effectors of homeostasis, all of which highlight the complexity of this stress response. Our identification of these transcriptional responses, and groups of evolutionarily related genes with either similar or divergent
Influence of the gene xthA in the activation of SOS response of Escherichia coli
International Nuclear Information System (INIS)
Dominguez M, V.
2013-01-01
The SOS response is one of the strategies that has Escherichia coli to counteract the lesions in the genetic material. The response is integrated for approximately 60 genes that when are activated they provide to the cell a bigger opportunity to survive. For the activation of this system is necessary that DNA regions of simple chain are generated, in such a way that most of the lesions should be processed, to be able to induce this answer. Some genes that intervene in this procedure, as recO, recB and recJ are recognized since when being exposed to the radiation, their activity SOS is smaller than in a wild strain. In previous works has been studied that to inactivate the genes that are involves in the lesions processing to generate DNA of simple chain, the SOS induction level diminishes with regard to a wild strain, but that when eliminating the genes that are involves directly in the repair, the SOS response increases. In this work a strain with defects in the gene xthA was built, which encodes for an endonuclease AP that participates in the repair mechanism by base excision and was evaluated their sensibility as the activity of the SOS response when exposing it to UV light and gamma radiation. The results showed that the lethality of the strain with the defect is very similar to the wild strain; while the activation level of the SOS response is bigger in comparison with the wild strain when being exposed to UV light; suggesting the existence of an enzyme that recognizes the lesions that produces this radiation, however, is not this the main repair channel, since the survival is similar to that of the wild strain. On the contrary, the results obtained with gamma radiation showed that the lethality diminishes in comparison to that of the wild strain, like the SOS activity; due surely to that the gene product intervenes in the repair for base excision, participating in the formation of the previous substrate to the activation of the SOS response. (Author)
Oloriz, María I; Gil, Víctor; Rojas, Luis; Portal, Orelvis; Izquierdo, Yovanny; Jiménez, Elio; Höfte, Monica
2012-05-01
Brown rust caused by the fungus Puccinia melanocephala is a major disease of sugarcane (Saccharum spp.). A sugarcane mutant, obtained by chemical mutagenesis of the susceptible variety B4362, showed a post-haustorial hypersensitive response (HR)-mediated resistance to the pathogen and was used to identify genes differentially expressed in response to P. melanocephala via suppression subtractive hybridization (SSH). Tester cDNA was derived from the brown rust-resistant mutant after inoculation with P. melanocephala, while driver cDNAs were obtained from the non-inoculated resistant mutant and the inoculated susceptible donor variety B4362. Database comparisons of the sequences of the SSH recombinant clones revealed that, of a subset of 89 non-redundant sequences, 88% had similarity to known functional genes, while 12% were of unknown function. Thirteen genes were selected for transcript profiling in the resistant mutant and the susceptible donor variety. Genes involved in glycolysis and C4 carbon fixation were up-regulated in both interactions probably due to disturbance of sugarcane carbon metabolism by the pathogen. Genes related with the nascent polypeptide associated complex, post-translational proteome modulation and autophagy were transcribed at higher levels in the compatible interaction. Up-regulation of a putative L-isoaspartyl O-methyltransferase S-adenosylmethionine gene in the compatible interaction may point to fungal manipulation of the cytoplasmatic methionine cycle. Genes coding for a putative no apical meristem protein, S-adenosylmethionine decarboxylase, non-specific lipid transfer protein, and GDP-L-galactose phosphorylase involved in ascorbic acid biosynthesis were up-regulated in the incompatible interaction at the onset of haustorium formation, and may contribute to the HR-mediated defense response in the rust-resistant mutant.
Network-based association of hypoxia-responsive genes with cardiovascular diseases
International Nuclear Information System (INIS)
Wang, Rui-Sheng; Oldham, William M; Loscalzo, Joseph
2014-01-01
Molecular oxygen is indispensable for cellular viability and function. Hypoxia is a stress condition in which oxygen demand exceeds supply. Low cellular oxygen content induces a number of molecular changes to activate regulatory pathways responsible for increasing the oxygen supply and optimizing cellular metabolism under limited oxygen conditions. Hypoxia plays critical roles in the pathobiology of many diseases, such as cancer, heart failure, myocardial ischemia, stroke, and chronic lung diseases. Although the complicated associations between hypoxia and cardiovascular (and cerebrovascular) diseases (CVD) have been recognized for some time, there are few studies that investigate their biological link from a systems biology perspective. In this study, we integrate hypoxia genes, CVD genes, and the human protein interactome in order to explore the relationship between hypoxia and cardiovascular diseases at a systems level. We show that hypoxia genes are much closer to CVD genes in the human protein interactome than that expected by chance. We also find that hypoxia genes play significant bridging roles in connecting different cardiovascular diseases. We construct a hypoxia-CVD bipartite network and find several interesting hypoxia-CVD modules with significant gene ontology similarity. Finally, we show that hypoxia genes tend to have more CVD interactors in the human interactome than in random networks of matching topology. Based on these observations, we can predict novel genes that may be associated with CVD. This network-based association study gives us a broad view of the relationships between hypoxia and cardiovascular diseases and provides new insights into the role of hypoxia in cardiovascular biology. (paper)
Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V
2017-12-28
Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the
Zhang, Ye; Rohde, Larry; Wu, Honglu
Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have demonstrated that genes with up-regulated expression induced by IR may play important roles in DNA damage sensing, cell cycle checkpoint and chromosomal repair, the relationship between the regulation of gene expression by IR and its impact on cytogenetic responses to ionizing radiation has not been systematically studied. Here, the expression of 25 genes selected based on their transcriptional changes in response to IR or from their known DNA repair roles were individually knocked down by siRNA transfection in human fibroblast cells. Chromosome aberrations (CA) and micronuclei (MN) formation were measured as the cytogenetic endpoints. Our results showed that the yields of MN and/or CA formation were significantly increased by suppressed expression of some of the selected genes in DSB and other DNA repair pathways. Knocked-down expression of other genes showed significant impact on cell cycle progression, possibly because of severe impairment of DNA damage repair. Of these 11 genes that affected the cytogenetic response, 9 were up-regulated in the cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulating the biological consequences after IR. Failure to express these IR-responsive genes, such as by gene mutation, could seriously change the outcome of the post IR scenario and lead to carcinogenesis.
Simmons, Leigh W; Lovegrove, Maxine
2017-08-30
There is considerable evidence that males will increase the number of sperm ejaculated in response to sperm competition risk. However, whether they have the capacity to adjust seminal fluid components of the ejaculate has received less attention. Male crickets ( Teleogryllus oceanicus ) have been shown to adjust the viability of sperm in their ejaculate in response to sperm competition risk. Here we show that socially mediated plasticity in sperm viability is probably due, at least in part, to male adjustments in the protein composition of the seminal fluid. Seven seminal fluid protein genes were found to have an increased expression in males exposed to rival calls. Increased expression of these genes was correlated with increased sperm viability in whole ejaculates, and gene knockdown confirmed that at least one of these proteins promotes sperm viability. Our results lend support for recent theoretical models that predict complex responses in male allocation to seminal fluid composition in response to sperm competition risk. © 2017 The Author(s).
Gene expression profiling in response to the histone deacetylase inhibitor BL1521 in neuroblastoma
International Nuclear Information System (INIS)
Ruijter, Annemieke J.M. de; Meinsma, Rutger J.; Bosma, Peter; Kemp, Stephan; Caron, Huib N.; Kuilenburg, Andre B.P. van
2005-01-01
Neuroblastoma is a childhood tumor with a poor survival in advanced stage disease despite intensive chemotherapeutic regimes. The new histone deacetylase (HDAC) inhibitor BL1521 has shown promising results in neuroblastoma. Inhibition of HDAC resulted in a decrease in proliferation and metabolic activity, induction of apoptosis and differentiation of neuroblastoma cells. In order to elucidate the mechanism mediating the effects of BL1521 on neuroblastoma cells, we investigated the gene expression profile of an MYCN single copy (SKNAS) and an MYCN amplified (IMR32) neuroblastoma cell line after treatment with BL1521 using the Affymetrix oligonucleotide array U133A. An altered expression of 255 genes was observed in both neuroblastoma cell lines. The majority of these genes were involved in gene expression, cellular metabolism, and cell signaling. We observed changes in the expression of vital genes belonging to the cell cycle (cyclin D1 and CDK4) and apoptosis (BNIP3, BID, and BCL2) pathway in response to BL1521. The expression of 37 genes was altered by both BL1521 and Trichostatin A, which could indicate a common gene set regulated by different HDAC inhibitors. BL1521 treatment changed the expression of a number of MYCN-associated genes. Several genes in the Wnt and the Delta/Notch pathways were changed in response to BL1521 treatment, suggesting that BL1521 is able to induce the differentiation of neuroblastoma cells into a more mature phenotype
LENUS (Irish Health Repository)
O’Neill, Fiona
2012-06-18
AbstractBackgroundLapatinib, a tyrosine kinase inhibitor of HER2 and EGFR and is approved, in combination with capecitabine, for the treatment of trastuzumab-refractory metastatic breast cancer. In order to establish a possible gene expression response to lapatinib, a panel of breast cancer cell lines with varying sensitivity to lapatinib were analysed using a combination of microarray and qPCR profiling.MethodsCo-inertia analysis (CIA), a data integration technique, was used to identify transcription factors associated with the lapatinib response on a previously published dataset of 96 microarrays. RNA was extracted from BT474, SKBR3, EFM192A, HCC1954, MDAMB453 and MDAMB231 breast cancer cell lines displaying a range of lapatinib sensitivities and HER2 expression treated with 1 μM of lapatinib for 12 hours and quantified using Taqman RT-PCR. A fold change ≥ ± 2 was considered significant.ResultsA list of 421 differentially-expressed genes and 8 transcription factors (TFs) whose potential regulatory impact was inferred in silico, were identified as associated with lapatinib response. From this group, a panel of 27 genes (including the 8 TFs) were selected for qPCR validation. 5 genes were determined to be significantly differentially expressed following the 12 hr treatment of 1 μM lapatinib across all six cell lines. Furthermore, the expression of 4 of these genes (RB1CC1, FOXO3A, NR3C1 and ERBB3) was directly correlated with the degree of sensitivity of the cell line to lapatinib and their expression was observed to “switch” from up-regulated to down-regulated when the cell lines were arranged in a lapatinib-sensitive to insensitive order. These included the novel lapatinib response-associated genes RB1CC1 and NR3C1. Additionally, Cyclin D1 (CCND1), a common regulator of the other four proteins, was also demonstrated to observe a proportional response to lapatinib exposure.ConclusionsA panel of 5 genes were determined to be differentially
International Nuclear Information System (INIS)
Hong, J.-H.; Chiang, C.-S.; Tsao, C.-Y.; Lin, P.-Y.; Wu, C.-J.; McBride, William H.
2001-01-01
Purpose: To investigate the effects of short-term administration of dexamethasone (DEX) on radiation-induced responses in the mouse lung, focusing on expression of pro-inflammatory cytokine and related genes. Methods and Materials: At indicated times after thoracic irradiation and/or drug treatment, mRNA expression levels of cytokines (mTNF-α, mIL-1α, mIL-1β, mIL-2, mIL-3, mIL-4, mIL-5, mIL-6, mIFN-γ) and related genes in the lungs of C3H/HeN mice were measured by RNase protection assay. Results: Radiation-induced pro-inflammatory cytokine mRNA expression levels in lung peak at 6 h after thoracic irradiation. DEX (5 mg/kg) suppresses both basal cytokine mRNA levels and this early response when given immediately after irradiation. However, by 24 h, in mice treated with DEX alone or DEX plus radiation, there was a strong rebound effect that lasted up to 3 days. Modification of the early radiation-induced response by DEX did not change the second wave of cytokine gene expression in the lung that occurs at 1 to 2 weeks, suggesting that early cytokine gene induction might not determine subsequent molecular events. A single dose of DEX attenuated, but did not completely suppress, increases in cytokine mRNA levels induced by lipopolysaccharide (2.5 mg/kg) treatment, but, unlike with radiation, no significant rebound effect was seen. Five days of dexamethasone treatment in the pneumonitic phase also inhibited pro-inflammatory cytokine gene expression and, again, there was a rebound effect after withdrawal of the drug. Conclusions: Our findings suggest that short-term use of dexamethasone can temporarily suppress radiation-induced pro-inflammatory cytokine gene expression, but there may be a rebound after drug withdrawal and the drug does little to change the essence and course of the pneumonitic process
Identification of water-deficit responsive genes in maritime pine (Pinus pinaster Ait.) roots.
Dubos, Christian; Plomion, Christophe
2003-01-01
Root adaptation to soil environmental factors is very important to maritime pine, the main conifer species used for reforestation in France. The range of climates in the sites where this species is established varies from flooded in winter to drought-prone in summer. No studies have yet focused on the morphological, physiological or molecular variability of the root system to adapt its growth to such an environment. We developed a strategy to isolate drought-responsive genes in the root tissue in order to identify the molecular mechanisms that trees have evolved to cope with drought (the main problem affecting wood productivity), and to exploit this information to improve drought stress tolerance. In order to provide easy access to the root system, seedlings were raised in hydroponic solution. Polyethylene glycol was used as an osmoticum to induce water deficit. Using the cDNA-AFLP technique, we screened more than 2500 transcript derived fragments, of which 33 (1.2%) showed clear variation in presence/absence between non stressed and stressed medium. The relative abundance of these transcripts was then analysed by reverse northern. Only two out of these 33 genes showed significant opposite behaviour between both techniques. The identification and characterization of water-deficit responsive genes in roots provide the emergence of physiological understanding of the patterns of gene expression and regulation involved in the drought stress response of maritime pine.
Identification of late O{sub 3}-responsive genes in Arabidopsis thaliana by cDNA microarray analysis
Energy Technology Data Exchange (ETDEWEB)
D' Haese, D. [Univ. of Antwerp, Dept. of Biology, Antwerp (BE) and Univ. of Newcastle, School of Biology and Psychology, Div. of Biology, Newcastle-Upon-Tyne (United Kingdom); Horemans, N.; Coen, W. De; Guisez, Y. [Univ. of Antwerp, Dept. of Biology, Antwerp (Belgium)
2006-09-15
To better understand the response of a plant to 0{sub 3} stress, an integrated microarray analysis was performed on Arabidopsis plants exposed during 2 days to purified air or 150 nl l{sup -1} O{sub 3}, 8 h day-l. Agilent Arabidopsis 2 Oligo Microarrays were used of which the reliability was confirmed by quantitative real-time PCR of nine randomly selected genes. We confirmed the O{sub 3} responsiveness of heat shock proteins (HSPs), glutathione-S-tranferases and genes involved in cell wall stiffening and microbial defence. Whereas, a previous study revealed that during an early stage of the O{sub 3} stress response, gene expression was strongly dependent on jasmonic acid and ethylene, we report that at a later stage (48 h) synthesis of jasrnonic acid and ethylene was downregulated. In addition, we observed the simultaneous induction of salicylic acid synthesis and genes involved in programmed cell death and senescence. Also typically, the later stage of the response to O{sub 3} appeared to be the induction of the complete pathway leading to the biosynthesis of anthocyanin diglucosides and the induction of thioredoxin-based redox control. Surprisingly absent in the list of induced genes were genes involved in ASC-dependent antioxidation, few of which were found to be induced after 12 h of 0{sub 3} exposure in another study. We discuss these and other particular results of the microarray analysis and provide a map depicting significantly affected genes and their pathways highlighting their interrelationships and subcellular localization. (au)
Guthke, Reinhard; Möller, Ulrich; Hoffmann, Martin; Thies, Frank; Töpfer, Susanne
2005-04-15
The immune response to bacterial infection represents a complex network of dynamic gene and protein interactions. We present an optimized reverse engineering strategy aimed at a reconstruction of this kind of interaction networks. The proposed approach is based on both microarray data and available biological knowledge. The main kinetics of the immune response were identified by fuzzy clustering of gene expression profiles (time series). The number of clusters was optimized using various evaluation criteria. For each cluster a representative gene with a high fuzzy-membership was chosen in accordance with available physiological knowledge. Then hypothetical network structures were identified by seeking systems of ordinary differential equations, whose simulated kinetics could fit the gene expression profiles of the cluster-representative genes. For the construction of hypothetical network structures singular value decomposition (SVD) based methods and a newly introduced heuristic Network Generation Method here were compared. It turned out that the proposed novel method could find sparser networks and gave better fits to the experimental data. Reinhard.Guthke@hki-jena.de.
Directory of Open Access Journals (Sweden)
Arainga Mariluz
2012-03-01
Full Text Available Abstract Background Bovine leukemia virus (BLV is associated with enzootic bovine leukosis and is closely related to human T-cell leukemia virus type I. The Tax protein of BLV is a transcriptional activator of viral replication and a key contributor to oncogenic potential. We previously identified interesting mutant forms of Tax with elevated (TaxD247G or reduced (TaxS240P transactivation effects on BLV replication and propagation. However, the effects of these mutations on functions other than transcriptional activation are unknown. In this study, to identify genes that play a role in the cascade of signal events regulated by wild-type and mutant Tax proteins, we used a large-scale host cell gene-profiling approach. Results Using a microarray containing approximately 18,400 human mRNA transcripts, we found several alterations after the expression of Tax proteins in genes involved in many cellular functions such as transcription, signal transduction, cell growth, apoptosis, stress response, and immune response, indicating that Tax protein has multiple biological effects on various cellular environments. We also found that TaxD247G strongly regulated more genes involved in transcription, signal transduction, and cell growth functions, contrary to TaxS240P, which regulated fewer genes. In addition, the expression of genes related to stress response significantly increased in the presence of TaxS240P as compared to wild-type Tax and TaxD247G. By contrast, the largest group of downregulated genes was related to immune response, and the majority of these genes belonged to the interferon family. However, no significant difference in the expression level of downregulated genes was observed among the Tax proteins. Finally, the expression of important cellular factors obtained from the human microarray results were validated at the RNA and protein levels by real-time quantitative reverse transcription-polymerase chain reaction and western blotting
Role of NPR1 dependent and NPR1 independent genes in response to Salicylic acid
Directory of Open Access Journals (Sweden)
Neha Agarwal
2017-10-01
Full Text Available NPR1 (Nonexpressor of pathogenesis-related gene is a transcription coactivator and central regulator of systemic acquired resistance (SAR pathway. It controls wide range of pathogenesis related genes involved in various defense responses, acts by sensing SAR signal molecule, Salicylic acid (SA. Mutation in NPR1 results in increased susceptibility to pathogen infection and less expression of pathogenesis related genes. The present study aimed to identify the role of NPR1 in gene expression after the Salicylic acid induction. For this RNA-seq was performed in Arabidopsis thaliana Col-0 and npr1-1 in response to Salicylic acid. RNA-seq analysis revealed a total of 3811 differentially expressed gene in which 2109 genes are up-regulated and 1702 genes are down-regulated. We have divided these genes in 6 categories SA induced (SI, SA repressed (SR, NPR1 dependent SI (ND-SI, NPR1 dependent SR (ND-SR, NPR1 independent SI (NI-SI, NPR1 independent SR (NI-SR. Further, Gene ontology and MapMan pathway analysis of differentially expressed genes suggested variety of biological processes and metabolic pathways that are enriched during SAR defense pathway. These results contribute to shed light on importance of both NPR1-dependent (ND and NPR1-independent (NI gene acting downstream to Salicylic acid induction in SAR pathway. The present study aimed to identify the role of NPR1 in gene expression after the Salicylic acid induction.
Directory of Open Access Journals (Sweden)
Sandra M Mathioni
Full Text Available Plants and animals have evolved a first line of defense response to pathogens called innate or basal immunity. While basal defenses in these organisms are well studied, there is almost a complete lack of understanding of such systems in fungal species, and more specifically, how they are able to detect and mount a defense response upon pathogen attack. Hence, the goal of the present study was to understand how fungi respond to biotic stress by assessing the transcriptional profile of the rice blast pathogen, Magnaporthe oryzae, when challenged with the bacterial antagonist Lysobacter enzymogenes. Based on microscopic observations of interactions between M. oryzae and wild-type L. enzymogenes strain C3, we selected early and intermediate stages represented by time-points of 3 and 9 hours post-inoculation, respectively, to evaluate the fungal transcriptome using RNA-seq. For comparative purposes, we also challenged the fungus with L. enzymogenes mutant strain DCA, previously demonstrated to be devoid of antifungal activity. A comparison of transcriptional data from fungal interactions with the wild-type bacterial strain C3 and the mutant strain DCA revealed 463 fungal genes that were down-regulated during attack by C3; of these genes, 100 were also found to be up-regulated during the interaction with DCA. Functional categorization of genes in this suite included those with roles in carbohydrate metabolism, cellular transport and stress response. One gene in this suite belongs to the CFEM-domain class of fungal proteins. Another CFEM class protein called PTH11 has been previously characterized, and we found that a deletion in this gene caused advanced lesion development by C3 compared to its growth on the wild-type fungus. We discuss the characterization of this suite of 100 genes with respect to their role in the fungal defense response.
Linda S. Adair; David L. Andrews; John Cairney; Edward A. Funkhouser; Ronald J. Newton; Earl F. Aldon
1992-01-01
New techniques in molecular biology can be used to characterize genes whose expression is induced by drought stress. These techniques can be used to understand responses of range plants to environmental stresses at the biochemical and molecular level. For example, they can be used to characterize genes that respond to drought stress conditions in the native shrub
Norman-Setterblad, C; Vidal, S; Palva, E T
2000-04-01
We have characterized the role of salicylic acid (SA)-independent defense signaling in Arabidopsis thaliana in response to the plant pathogen Erwinia carotovora subsp. carotovora. Use of pathway-specific target genes as well as signal mutants allowed us to elucidate the role and interactions of ethylene, jasmonic acid (JA), and SA signal pathways in this response. Gene expression studies suggest a central role for both ethylene and JA pathways in the regulation of defense gene expression triggered by the pathogen or by plant cell wall-degrading enzymes (CF) secreted by the pathogen. Our results suggest that ethylene and JA act in concert in this regulation. In addition, CF triggers another, strictly JA-mediated response inhibited by ethylene and SA. SA does not appear to have a major role in activating defense gene expression in response to CF. However, SA may have a dual role in controlling CF-induced gene expression, by enhancing the expression of genes synergistically induced by ethylene and JA and repressing genes induced by JA alone.
DEFF Research Database (Denmark)
Vestergaard, Anna L; Knudsen, Ulla B; Munk, Torben
2011-01-01
Endometriosis is a painful chronic female disease defined by the presence of endometrial tissue implants in ectopic locations. The pathogenesis is much debated, and type I interferons could be involved. The expression of genes of the type I interferon response were profiled by a specific PCR Array...... of RNA obtained from ectopic and eutopic endometrium collected from 9 endometriosis patients and 9 healthy control women. Transcriptional expression levels of selected interferon-regulated and housekeeping genes were investigated by real-time quantitative reverse transcriptase PCR (qRT-PCR). Stably...... expressed housekeeping genes for valid normalization of transcriptional studies of endometrium and endometriosis have not yet been published. Here, seven housekeeping genes were evaluated for stability using the GeNorm and NormFinder software. A normalization factor based on HMBS, TBP, and YWHAZ expression...
Zheng, Lei; Liu, Guifeng; Meng, Xiangnan; Liu, Yujia; Ji, Xiaoyu; Li, Yanbang; Nie, Xianguang; Wang, Yucheng
2013-07-01
WRKY transcription factors are involved in various biological processes, such as development, metabolism and responses to stress. However, their exact roles in abiotic stress tolerance are largely unknown. Here, we demonstrated a working model for the function of a WRKY gene (ThWRKY4) from Tamarix hispida in the stress response. ThWRKY4 is highly induced by abscisic acid (ABA), salt and drought in the early period of stress (stress for 3, 6, or 9 h), which can be regulated by ABF (ABRE binding factors) and Dof (DNA binding with one finger), and also can be crossregulated by other WRKYs and autoregulated as well. Overexpression of ThWRKY4 conferred tolerance to salt, oxidative and ABA treatment in transgenic plants. ThWRKY4 can improve the tolerance to salt and ABA treatment by improving activities of superoxide dismutase and peroxidase, decreasing levels of O2 (-) and H2O2, reducing electrolyte leakage, keeping the loss of chlorophyll, and protecting cells from death. Microarray analyses showed that overexpression of ThWRKY4 in Arabidopsis leads to 165 and 100 genes significantly up- and downregulated, respectively. Promoter scanning analysis revealed that ThWRKY4 regulates the gene expression via binding to W-box motifs present in their promoter regions. This study shows that ThWRKY4 functions as a transcription factor to positively modulate abiotic stress tolerances, and is involved in modulating reactive oxygen species.
Salt and drought stress and ABA responses related to bZIP genes from V. radiata and V. angularis.
Wang, Lanfen; Zhu, Jifeng; Li, Xiaoming; Wang, Shumin; Wu, Jing
2018-04-20
Mung bean and adzuki bean are warm-season legumes widely cultivated in China. However, bean production in major producing regions is limited by biotic and abiotic stress, such as drought and salt stress. Basic leucine zipper (bZIP) genes play key roles in responses to various biotic and abiotic stresses. However, only several bZIP genes involved in drought and salt stress in legumes, especially Vigna radiata and Vigna angularis, have been identified. In this study, we identified 54 and 50 bZIP proteins from whole-genome sequences of V. radiata and V. angularis, respectively. First, we comprehensively surveyed the characteristics of all bZIP genes, including their gene structure, chromosome distribution and motif composition. Phylogenetic trees showed that VrbZIP and VabZIP proteins were divided into ten clades comprising nine known and one unknown subgroup. The results of the nucleotide substitution rate of the orthologous gene pairs showed that bZIP proteins have undergone strong purifying selection: V. radiata and V. angularis diverged 1.25 million years ago (mya) to 9.20 mya (average of 4.95 mya). We also found that many cis-acting regulatory elements (CAREs) involved in abiotic stress and plant hormone responses were detected in the putative promoter regions of the bZIP genes. Finally, using the quantitative real-time PCR (qRT-PCR) method, we performed expression profiling of the bZIP genes in response to drought, salt and abscisic acid (ABA). We identified several bZIP genes that may be involved in drought and salt responses. Generally, our results provided useful and rich resources of VrbZIP and VabZIP genes for the functional characterization and understanding of bZIP transcription factors (TFs) in warm-season legumes. In addition, our results revealed important and interesting data - a subset of VrbZIP and VabZIP gene expression profiles in response to drought, salt and ABA stress. These results provide gene expression evidence for the selection of
Variants in the interleukin 8 gene and the response to inhaled bronchodilators in cystic fibrosis
Directory of Open Access Journals (Sweden)
Larissa Lazzarini Furlan
2017-11-01
Conclusions: This study highlighted the importance of the rs4073 variant of the interleukin 8 gene, regarding response to inhaled bronchodilators, and of the assessment of mutations in the cystic fibrosis transmembrane conductance regulator gene.
Vasil'eva, S V; Makhova, E V; Moshkovskaia, E Iu
1999-04-01
The expression of genes belonging to the Ada regulon of Escherichia coli under the action of mono- and bifunctional alkylating agents--high-efficiency antitumor HMM, ACNU, and BCNU preparations--was studied. The functional specificity of the alkA, alkB, and aidB1 genes concerning both the structure and volume of DNA alkylation and the specificity of cell preadaptation was revealed. Additional experimental evidence for the role of the aidB1 gene as a unique "hazard gene", a component of the E. coli ada operon, was obtained. A phenomenon of positive interference between alternative SOS and Ada responses was observed for the first time upon gene expression.
Wang, Haibo; Zou, Zhurong; Wang, Shasha; Gong, Ming
2013-01-01
Jatropha curcas L., also called the Physic nut, is an oil-rich shrub with multiple uses, including biodiesel production, and is currently exploited as a renewable energy resource in many countries. Nevertheless, because of its origin from the tropical MidAmerican zone, J. curcas confers an inherent but undesirable characteristic (low cold resistance) that may seriously restrict its large-scale popularization. This adaptive flaw can be genetically improved by elucidating the mechanisms underlying plant tolerance to cold temperatures. The newly developed Illumina Hiseq™ 2000 RNA-seq and Digital Gene Expression (DGE) are deep high-throughput approaches for gene expression analysis at the transcriptome level, using which we carefully investigated the gene expression profiles in response to cold stress to gain insight into the molecular mechanisms of cold response in J. curcas. In total, 45,251 unigenes were obtained by assembly of clean data generated by RNA-seq analysis of the J. curcas transcriptome. A total of 33,363 and 912 complete or partial coding sequences (CDSs) were determined by protein database alignments and ESTScan prediction, respectively. Among these unigenes, more than 41.52% were involved in approximately 128 known metabolic or signaling pathways, and 4,185 were possibly associated with cold resistance. DGE analysis was used to assess the changes in gene expression when exposed to cold condition (12°C) for 12, 24, and 48 h. The results showed that 3,178 genes were significantly upregulated and 1,244 were downregulated under cold stress. These genes were then functionally annotated based on the transcriptome data from RNA-seq analysis. This study provides a global view of transcriptome response and gene expression profiling of J. curcas in response to cold stress. The results can help improve our current understanding of the mechanisms underlying plant cold resistance and favor the screening of crucial genes for genetically enhancing cold resistance
He, Zhangjiang; Zhao, Xin; Lu, Zhuoyue; Wang, Huifang; Liu, Pengfei; Zeng, Fanqin; Zhang, Yongjun
2018-01-01
Sensing, responding, and adapting to the surrounding environment are crucial for all living organisms to survive, proliferate, and differentiate in their biological niches. Beauveria bassiana is an economically important insect-pathogenic fungus which is widely used as a biocontrol agent to control a variety of insect pests. The fungal pathogen unavoidably encounters a variety of adverse environmental stresses and defense response from the host insects during application of the fungal agents. However, few are known about the transcription response of the fungus to respond or adapt varied adverse stresses. Here, we comparatively analyzed the transcriptome of B. bassiana in globe genome under the varied stationary-phase stresses including osmotic agent (0.8 M NaCl), high temperature (32 °C), cell wall-perturbing agent (Congo red), and oxidative agents (H 2 O 2 or menadione). Total of 12,412 reads were obtained, and mapped to the 6767 genes of the B. bassiana. All of these stresses caused transcription responses involved in basal metabolism, cell wall construction, stress response or cell rescue/detoxification, signaling transduction and gene transcription regulation, and likely other cellular processes. An array of genes displayed similar transcription patterns in response to at least two of the five stresses, suggesting a shared transcription response to varied adverse stresses. Gene co-expression network analysis revealed that mTOR signaling pathway, but not HOG1 MAP kinase pathway, played a central role in regulation the varied adverse stress responses, which was verified by RNAi-mediated knockdown of TOR1. Our findings provided an insight of transcription response and gene co-expression network of B. bassiana in adaptation to varied environments. Copyright © 2017 Elsevier Inc. All rights reserved.
Bedi, Sonia; Sengupta, Sourabh; Ray, Anagh; Nag Chaudhuri, Ronita
2016-09-01
ABI3, originally discovered as a seed-specific transcription factor is now implicated to act beyond seed physiology, especially during abiotic stress. In non-seed plants, ABI3 is known to act in desiccation stress signaling. Here we show that ABI3 plays a role in dehydration stress response in Arabidopsis. ABI3 gene was upregulated during dehydration stress and its expression was maintained during subsequent stress recovery phases. Comparative gene expression studies in response to dehydration stress and stress recovery were done with genes which had potential ABI3 binding sites in their upstream regulatory regions. Such studies showed that several genes including known seed-specific factors like CRUCIFERIN1, CRUCIFERIN3 and LEA-group of genes like LEA76, LEA6, DEHYDRIN LEA and LEA-LIKE got upregulated in an ABI3-dependent manner, especially during the stress recovery phase. ABI3 got recruited to regions upstream to the transcription start site of these genes during dehydration stress response through direct or indirect DNA binding. Interestingly, ABI3 also binds to its own promoter region during such stress signaling. Nucleosomes covering potential ABI3 binding sites in the upstream sequences of the above-mentioned genes alter positions, and show increased H3 K9 acetylation during stress-induced transcription. ABI3 thus mediates dehydration stress signaling in Arabidopsis through regulation of a group of genes that play a role primarily during stress recovery phase. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Feng Ding
Full Text Available Neonatal feeding problems are observed in several genetic diseases including Prader-Willi syndrome (PWS. Later in life, individuals with PWS develop hyperphagia and obesity due to lack of appetite control. We hypothesized that failure to thrive in infancy and later-onset hyperphagia are related and could be due to a defect in the hypothalamus. In this study, we performed gene expression microarray analysis of the hypothalamic response to maternal deprivation in neonatal wild-type and Snord116del mice, a mouse model for PWS in which a cluster of imprinted C/D box snoRNAs is deleted. The neonatal starvation response in both strains was dramatically different from that reported in adult rodents. Genes that are affected by adult starvation showed no expression change in the hypothalamus of 5 day-old pups after 6 hours of maternal deprivation. Unlike in adult rodents, expression levels of Nanos2 and Pdk4 were increased, and those of Pgpep1, Ndp, Brms1l, Mett10d, and Snx1 were decreased after neonatal deprivation. In addition, we compared hypothalamic gene expression profiles at postnatal days 5 and 13 and observed significant developmental changes. Notably, the gene expression profiles of Snord116del deletion mice and wild-type littermates were very similar at all time points and conditions, arguing against a role of Snord116 in feeding regulation in the neonatal period.
De-La-Peña, Clelia; Rangel-Cano, Alicia; Alvarez-Venegas, Raúl
2012-05-01
Genes in eukaryotic organisms function within the context of chromatin, and the mechanisms that modulate the structure of chromatin are defined as epigenetic. In Arabidopsis, pathogen infection induces the expression of at least one histone deacetylase, suggesting that histone acetylation/deacetylation has an important role in the pathogenic response in plants. How/whether histone methylation affects gene response to pathogen infection is unknown. To gain a better understanding of the epigenetic mechanisms regulating the interaction between Pseudomonas syringae and Arabidopsis thaliana, we analysed three different Arabidopsis ash1-related (absent, small or homeotic discs 1) mutants. We found that the loss of function of ASHH2 and ASHR1 resulted in faster hypersensitive responses (HRs) to both mutant (hrpA) and pathogenic (DC3000) strains of P. syringae, whereas control (Col-0) and ashr3 mutants appeared to be more resistant to the infection after 2 days. Furthermore, we showed that, in the ashr3 background, the PR1 gene (PATHOGENESIS-RELATED GENE 1) displayed the highest expression levels on infection with DC3000, correlating with increased resistance against this pathogen. Our results show that, in both the ashr1 and ashh2 backgrounds, the histone H3 lysine 4 dimethylation (H3K4me2) levels decreased at the promoter region of PR1 on infection with the DC3000 strain, suggesting that an epigenetically regulated PR1 expression is involved in the plant defence. Our results suggest that histone methylation in response to pathogen infection may be a critical component in the signalling and defence processes occurring between plants and microbes. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.
Zhang, Ye; Rohde, Larry H.; Emami, Kamal; Hammond, Dianne; Mehta, Satish K.; Jeevarajan, Antony S.; Pierson, Duane L.; Wu, Honglu
2009-01-01
Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have shown that genes up-regulated by IR may play important roles in DNA damage repair, the relationship between the regulation of gene expression by IR, particularly genes not known for their roles in double-strand break (DSB) repair, and its impact on cytogenetic responses has not been well studied. The purpose of this study is to identify new roles of IR inducible genes in radiation-induced chromosome aberrations and micronuclei formation. In the study, the expression of 25 genes selected on the basis of their transcriptional changes in response to IR was individually knocked down by small interfering RNA in human fibroblast cells. Frequencies of micronuclei (MN) formation and chromosome aberrations were measured to determine the efficiency of cytogenetic repair, and the fraction of bi-nucleated cells in the MN analysis was used as a marker for cell cycle progression. In response to gamma radiation, the formation of MN was significantly increased by suppressed expression of five genes: Ku70 (DSB repair pathway), XPA (nucleotide excision repair pathway), RPA1 (mismatch repair pathway), RAD17 and RBBP8 (cell cycle control). Knocked-down expression of four genes (MRE11A, RAD51 in the DSB pathway, SESN1, and SUMO1) significantly inhibited cell cycle progression, possibly because of severe impairment of DNA damage repair. Moreover, decreased XPA, p21, or MLH1 expression resulted in both significantly enhanced cell cycle progression and increased yields of chromosome aberrations, indicating that these gene products modulate both cell cycle control and DNA damage repair. Nine of these eleven genes, whose knock-down expression affected cytogenetic repair, were up-regulated in cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulate IR
Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István
2016-07-01
A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hermans, Christian; Vuylsteke, Marnik; Coppens, Frederik; Craciun, Adrian; Inzé, Dirk; Verbruggen, Nathalie
2010-07-01
*Plant growth and development ultimately depend on environmental variables such as the availability of essential minerals. Unravelling how nutrients affect gene expression will help to understand how they regulate plant growth. *This study reports the early transcriptomic response to magnesium (Mg) deprivation in Arabidopsis. Whole-genome transcriptome was studied in the roots and young mature leaves 4, 8 and 28 h after the removal of Mg from the nutrient solution. *The highest number of regulated genes was first observed in the roots. Contrary to other mineral deficiencies, Mg depletion did not induce a higher expression of annotated genes in Mg uptake. Remarkable responses include the perturbation of the central oscillator of the circadian clock in roots and the triggering of abscisic acid (ABA) signalling, with half of the up-regulated Mg genes in leaves being ABA-responsive. However, no change in ABA content was observed. *The specificity of the response of some Mg-regulated genes was challenged by studying their expression after other mineral deficiencies and environmental stresses. The possibility to develop markers for Mg incipient deficiency is discussed here.
Early Involvement of Immune/Inflammatory Response Genes in Retinal Degeneration in DBA/2J Mice
Directory of Open Access Journals (Sweden)
W. Fan
2010-01-01
Full Text Available Purpose The DBA/2J (D2 mouse carries mutations in two of its genes, Tyrp1 and Gpnmb. These alterations result in the development of an immune response in the iris, leading to iris atrophy and pigment dispersion. The development of elevated intraocular pressure (IOP in this model of glaucoma is considered to be a significant factor leading to the death of retinal ganglion cells (RGCs. Changes in gene expression in the retina have already been correlated with the appearance of elevated IOP in the D2 mouse. The purpose of the present study was to determine if any changes in gene expression occur prior to the development of IOP. Methods The IOP was measured monthly using a rebound tonometer in D2 and age-matched C57/BL6 (B6 mice (normal controls. D2 animals with normal IOP at 2 and 4 M were used. In addition, mice at the age of 6–7 M were included to look for any trends in gene expression that might develop during the progression of the disease. Separate RNA samples were prepared from each of three individual retinas for each age, and gene expression profiles were determined with the aid of mouse oligonucleotide arrays (Agilent. A subset of genes was examined with the aid of real-time PCR. Immunocytochemistry was used to visualize changes in the retina for some of the gene-products. Results Four hundred and thirteen oligonucleotide probes were differentially expressed in the retinas of 4 M versus 2 M old D2 mice. The most significantly up-regulated genes (181 were associated with immune responses including interferon signaling, the complement system and the antigen presentation pathway, whereas the down-regulated genes (232 were linked to pathways related to cell death and known neurological diseases/disorders. These particular changes were not revealed in the age-matched B6 mice. By 6 M, when IOP started to increase in many of the D2 mice, more robust changes of these same genes were observed. Changes in the levels of selected genes
Early Involvement of Immune/Inflammatory Response Genes in Retinal Degeneration in DBA/2J Mice
Directory of Open Access Journals (Sweden)
W. Fan
2010-03-01
Full Text Available Purpose: The DBA/2J (D2 mouse carries mutations in two of its genes, Tyrp1 and Gpnmb. These alterations result in the development of an immune response in the iris, leading to iris atrophy and pigment dispersion. The development of elevated intraocular pressure (IOP in this model of glaucoma is considered to be a significant factor leading to the death of retinal ganglion cells (RGCs. Changes in gene expression in the retina have already been correlated with the appearance of elevated IOP in the D2 mouse. The purpose of the present study was to determine if any changes in gene expression occur prior to the development of IOP. Methods: The IOP was measured monthly using a rebound tonometer in D2 and age-matched C57/BL6 (B6 mice (normal controls. D2 animals with normal IOP at 2 and 4 M were used. In addition, mice at the age of 6–7 M were included to look for any trends in gene expression that might develop during the progression of the disease. Separate RNA samples were prepared from each of three individual retinas for each age, and gene expression profiles were determined with the aid of mouse oligonucleotide arrays (Agilent. A subset of genes was examined with the aid of real-time PCR. Immunocytochemistry was used to visualize changes in the retina for some of the gene-products. Results: Four hundred and thirteen oligonucleotide probes were differentially expressed in the retinas of 4 M versus 2 M old D2 mice. The most significantly up-regulated genes (181 were associated with immune responses including interferon signaling, the complement system and the antigen presentation pathway, whereas the down-regulated genes (232 were linked to pathways related to cell death and known neurological diseases/disorders. These particular changes were not revealed in the age-matched B6 mice. By 6 M, when IOP started to increase in many of the D2 mice, more robust changes of these same genes were observed. Changes in the levels of selected genes
He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui
2017-07-03
Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.
Directory of Open Access Journals (Sweden)
2006-01-01
Full Text Available BACKGROUND: Inadequate oxygen (hypoxia triggers a multifaceted cellular response that has important roles in normal physiology and in many human diseases. A transcription factor, hypoxia-inducible factor (HIF, plays a central role in the hypoxia response; its activity is regulated by the oxygen-dependent degradation of the HIF-1alpha protein. Despite the ubiquity and importance of hypoxia responses, little is known about the variation in the global transcriptional response to hypoxia among different cell types or how this variation might relate to tissue- and cell-specific diseases. METHODS AND FINDINGS: We analyzed the temporal changes in global transcript levels in response to hypoxia in primary renal proximal tubule epithelial cells, breast epithelial cells, smooth muscle cells, and endothelial cells with DNA microarrays. The extent of the transcriptional response to hypoxia was greatest in the renal tubule cells. This heightened response was associated with a uniquely high level of HIF-1alpha RNA in renal cells, and it could be diminished by reducing HIF-1alpha expression via RNA interference. A gene-expression signature of the hypoxia response, derived from our studies of cultured mammary and renal tubular epithelial cells, showed coordinated variation in several human cancers, and was a strong predictor of clinical outcomes in breast and ovarian cancers. In an analysis of a large, published gene-expression dataset from breast cancers, we found that the prognostic information in the hypoxia signature was virtually independent of that provided by the previously reported wound signature and more predictive of outcomes than any of the clinical parameters in current use. CONCLUSIONS: The transcriptional response to hypoxia varies among human cells. Some of this variation is traceable to variation in expression of the HIF1A gene. A gene-expression signature of the cellular response to hypoxia is associated with a significantly poorer prognosis
Kim, Eunha; Tyagi, Richa; Lee, Joo-Young; Park, Jina; Kim, Young-ran; Beon, Jiyoon; Chen, Po Yu; Cha, Jiyoung Y.; Snyder, Solomon H.; Kim, Seyun
2013-01-01
Inositol polyphosphate multikinase (IPMK) is a notably pleiotropic protein. It displays both inositol phosphate kinase and phosphatidylinositol kinase catalytic activities. Noncatalytically, IPMK stabilizes the mammalian target of rapamycin complex 1 and acts as a transcriptional coactivator for CREB-binding protein/E1A binding protein p300 and tumor suppressor protein p53. Serum response factor (SRF) is a major transcription factor for a wide range of immediate early genes. We report that IPMK, in a noncatalytic role, is a transcriptional coactivator for SRF mediating the transcription of immediate early genes. Stimulation by serum of many immediate early genes is greatly reduced by IPMK deletion. IPMK stimulates expression of these genes, an influence also displayed by catalytically inactive IPMK. IPMK acts by binding directly to SRF and thereby enhancing interactions of SRF with the serum response element of diverse genes. PMID:24248338
Directory of Open Access Journals (Sweden)
Maria Jesus Iglesias
Full Text Available Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS.To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches--gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII, which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF, was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines, was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/-LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40% was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at
Directory of Open Access Journals (Sweden)
Changwei Li
Full Text Available Serum and glucocorticoid regulated kinase (SGK plays a critical role in the regulation of renal sodium transport. We examined the association between SGK genes and salt sensitivity of blood pressure (BP using single-marker and gene-based association analysis.A 7-day low-sodium (51.3 mmol sodium/day followed by a 7-day high-sodium intervention (307.8 mmol sodium/day was conducted among 1,906 Chinese participants. BP measurements were obtained at baseline and each intervention using a random-zero sphygmomanometer. Additive associations between each SNP and salt-sensitivity phenotypes were assessed using a mixed linear regression model to account for family dependencies. Gene-based analyses were conducted using the truncated p-value method. The Bonferroni-method was used to adjust for multiple testing in all analyses.In single-marker association analyses, SGK1 marker rs2758151 was significantly associated with diastolic BP (DBP response to high-sodium intervention (P = 0.0010. DBP responses (95% confidence interval to high-sodium intervention for genotypes C/C, C/T, and T/T were 2.04 (1.57 to 2.52, 1.79 (1.42 to 2.16, and 0.85 (0.30 to 1.41 mmHg, respectively. Similar trends were observed for SBP and MAP responses although not significant (P = 0.15 and 0.0026, respectively. In addition, gene-based analyses demonstrated significant associations between SGK1 and SBP, DBP and MAP responses to high sodium intervention (P = 0.0002, 0.0076, and 0.00001, respectively. Neither SGK2 nor SGK3 were associated with the salt-sensitivity phenotypes in single-maker or gene-based analyses.The current study identified association of the SGK1 gene and BP salt-sensitivity in the Han Chinese population. Further studies are warranted to identify causal SGK1 gene variants.
Institute of Scientific and Technical Information of China (English)
ZHOU; Bin(周斌); PENG; Kaiman(彭开蔓); CHU; Zhaohui(储昭晖); WANG; Shiping(王石平); ZHANG; Qifa(张启发)
2002-01-01
Despite large numbers of studies about defense response, processes involved in the resistance of plants to incompatible pathogens are still largely uncharacterized. The objective of this study was to identify genes involved in defense response by cDNA array analysis and to gain knowledge about the functions of the genes involved in defense response. Approximately 20000 rice cDNA clones were arrayed on nylon filters. RNA samples isolated from different rice lines after infection with incompatible strains or isolates of Xanthomonas oryzae pv. oryzae or Pyricularia grisea, respectively, were used to synthesize cDNA as probes for screening the cDNA arrays. A total of 100 differentially expressed unique sequences were identified from 5 pathogen-host combinations. Fifty-three sequences were detected as showing enhanced expression and 47 sequences were detected as showing repressed expression after pathogen infection. Sequence analysis revealed that most of the 100 sequences had various degrees of homology with genes in databases which encode or putatively encode transcription regulating proteins, translation regulating proteins, transport proteins, kinases, metabolic enzymes, and proteins involved in other functions. Most of the genes have not been previously reported as being involved in the disease resistance response in rice. The results from cDNA arrays, reverse transcription-polymerase chain reaction, and RNA gel blot analysis suggest that activation or repression of most of these genes might occur commonly in the defense response.
Genistein-induced alterations of radiation-responsive gene expression
Energy Technology Data Exchange (ETDEWEB)
Grace, M.B. [Armed Forces Radiobiology Research Institute, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F.; Landauer, M.R. [Armed Forces Radiobiology Research Institute, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)
2007-07-15
In order to clarify the molecular mechanism of radioprotection and understand biological dosimetry in the presence of medical countermeasure-radioprotectants, their effects on ionizing radiation (IR)-responsive molecular biomarkers must be examined. We used genistein in a radiation model system and measured gene expression by multiplex QRT-PCR assay in drug-treated healthy human blood cultures. Genistein has been demonstrated to be a radiosensitizer of malignant cells and a radioprotector against IR-induced lethality in a mouse model. Whole-blood cultures were supplemented with 50, 100, and 200{mu}M concentrations of genistein, 16 h prior to receiving a 2-Gy ({sup 60}Co-{gamma} rays, 10 cGy/min) dose of IR. Total RNA was isolated from whole blood 24 h postirradiation for assessments. Combination treatments of genistein and IR resulted in no significant genistein effects on ddb2 and bax downstream transcripts to p53, or proliferating cell-nuclear antigen, pcna, necessary for DNA synthesis and cell-cycle progression. Use of these radiation-responsive targets would be recommended for dose-assessment applications. We also observed decreased expression of pro-survival transcript, bcl-2. Genistein and IR-increased expression of cdkn1a and gadd45a, showing that genistein also stimulates p53 transcriptional activity. These results confirm published molecular signatures for genistein in numerous in vitro models. Evaluation of gene biomarkers may be further exploited for devising novel radiation countermeasure and/or therapeutic strategies.
Directory of Open Access Journals (Sweden)
Irene Moy
Full Text Available Aromatase inhibitors (AIs are the most effective class of drugs in the endocrine treatment of breast cancer, with an approximate 50% treatment response rate. Our objective was to determine whether intratumoral expression levels of estrogen-related genes are predictive of AI responsiveness in postmenopausal women with breast cancer. Primary breast carcinomas were obtained from 112 women who received AI therapy after failing adjuvant tamoxifen therapy and developing recurrent breast cancer. Tumor ERα and PR protein expression were analyzed by immunohistochemistry (IHC. Messenger RNA (mRNA levels of 5 estrogen-related genes-AKR1C3, aromatase, ERα, and 2 estradiol/ERα target genes, BRCA1 and PR-were measured by real-time PCR. Tumor protein and mRNA levels were compared with breast cancer progression rates to determine predictive accuracy. Responsiveness to AI therapy-defined as the combined complete response, partial response, and stable disease rates for at least 6 months-was 51%; rates were 56% in ERα-IHC-positive and 14% in ERα-IHC-negative tumors. Levels of ERα, PR, or BRCA1 mRNA were independently predictive for responsiveness to AI. In cross-validated analyses, a combined measurement of tumor ERα and PR mRNA levels yielded a more superior specificity (36% and identical sensitivity (96% to the current clinical practice (ERα/PR-IHC. In patients with ERα/PR-IHC-negative tumors, analysis of mRNA expression revealed either non-significant trends or statistically significant positive predictive values for AI responsiveness. In conclusion, expression levels of estrogen-related mRNAs are predictive for AI responsiveness in postmenopausal women with breast cancer, and mRNA expression analysis may improve patient selection.
Identification of formaldehyde-responsive genes by suppression subtractive hybridization
International Nuclear Information System (INIS)
Lee, Min-Ho; Kim, Young-Ae; Na, Tae-Young; Kim, Sung-Hye; Shin, Young Kee; Lee, Byung-Hoon; Shin, Ho-Sang; Lee, Mi-Ock
2008-01-01
Formaldehyde is frequently used in indoor household and occupational environments. Inhalation of formaldehyde invokes an inflammatory response, including a variety of allergic signs and symptoms. Therefore, formaldehyde has been considered as the most prevalent cause of sick building syndrome, which has become a major social problem, especially in developing urban areas. Further formaldehyde is classified as a genotoxicant in the respiratory tract of rats and humans. To better understand the molecular mechanisms involved in formaldehyde intoxication, we sought differentially regulated genes by formaldehyde exposure to Hs 680.Tr human trachea cells, using polymerase chain reaction (PCR)-based suppression subtractive hybridization. We identified 27 different formaldehyde-inducible genes, including those coding for the major histocompatibility complex, class IA, calcyclin, glutathione S-transferase pi, mouse double minute 2 (MDM2), platelet-derived growth factor receptor alpha, and which are known to be associated with cell proliferation and differentiation, immunity and inflammation, and detoxification. Induction of these genes by formaldehyde treatment was confirmed by reverse transcription PCR and western blot analysis. Further, the expression of calcyclin, glutathione S-transferase pi, PDGFRA and MDM2 were significantly induced in the tracheal epithelium of Sprague Dawley rats after formaldehyde inhalation. Our results suggest that the elevated levels of these genes may be associated with the formaldehyde-induced toxicity, and that they deserve evaluation as potential biomarkers for formaldehyde intoxication
Global gene response in Saccharomyces cerevisiae exposed to silver nanoparticles.
Niazi, Javed H; Sang, Byoung-In; Kim, Yeon Seok; Gu, Man Bock
2011-08-01
Silver nanoparticles (AgNPs), exhibiting a broad size range and morphologies with highly reactive facets, which are widely applicable in real-life but not fully verified for biosafety and ecotoxicity, were subjected to report transcriptome profile in yeast Saccharomyces cerevisiae. A large number of genes accounted for ∼3% and ∼5% of the genome affected by AgNPs and Ag-ions, respectively. Principal component and cluster analysis suggest that the different physical forms of Ag were the major cause in differential expression profile. Among 90 genes affected by both AgNPs and Ag-ions, metalloprotein mediating high resistance to copper (CUP1-1 and CUP1-2) were strongly induced by AgNPs (∼45-folds) and Ag-ions (∼22-folds), respectively. A total of 17 genes, responsive to chemical stimuli, stress, and transport processes, were differentially induced by AgNPs. The differential expression was also seen with Ag-ions that affected 73 up- and 161 down-regulating genes, and most of these were involved in ion transport and homeostasis. This study provides new information on the knowledge for impact of nanoparticles on living microorganisms that can be extended to other nanoparticles.
Phenotypic and gene expression responses of E. coli to antibiotics during spaceflight
Zea, Luis
Bacterial susceptibility to antibiotics has been shown in vitro to be reduced during spaceflight; however, the underlying mechanisms responsible for this outcome are not fully understood. In particular, it is not yet clear whether this observed response is due to increased drug resistance (a microbial defense response) or decreased drug efficacy (a microgravity biophysical mass transport effect). To gain insight into the differentiation between these two potential causes, an investigation was undertaken onboard the International Space Station (ISS) in 2014 termed Antibiotic Effectiveness in Space-1 (AES-1). For this purpose, E. coli was challenged with two antibiotics, Gentamicin Sulfate and Colistin Sulfate, at concentrations higher than those needed to inhibit growth on Earth. Phenotypic parameters (cell size, cell envelope thickness, population density and lag phase duration) and gene expression were compared between the spaceflight samples and ground controls cultured in varying levels of drug concentration. It was observed that flight samples proliferated in antibiotic concentrations that were inhibitory on Earth, growing on average to a 13-fold greater concentration than matched 1g controls. Furthermore, at the highest drug concentrations in space, E. coli cells were observed to aggregate into visible clusters. In spaceflight, cell size was significantly reduced, translating to a decrease in cell surface area to about one half of the ground controls. Smaller cell surface area can in turn proportionally reduce the rate of antibiotic molecules reaching the cell. Additionally, it was observed that genes --- in some cases more than 2000 --- were overexpressed in space with respect to ground controls. Up-regulated genes include poxB, which helps catabolize glucose into organic acids that alter acidity around and inside the cell, and the gadABC family genes, which confer resistance to extreme acid conditions. The next step is to characterize the mechanisms behind
Directory of Open Access Journals (Sweden)
Qari Muhammad Imran
2016-11-01
Full Text Available Exposure of plants to different biotic and abiotic stress condition instigates significant change in the cellular redox status; resulting in the elevation of reactive nitrogen species that play signaling role in mediating defense responses. Heavy metal associated (HMA domain containing genes are required for spatio-temporal transportation of metal ions that bind with various enzymes and co-factors within the cell. To uncover the underlying mechanisms mediated by AtHMA genes, we identified 14 Arabidopsis HMA genes that were differentially expressed in response to nitrosative stress through RNA-seq analysis. Of those 14 genes, the expression of eight HMA genes was significantly increased, whereas that of six genes was significantly reduced. We further validated the RNA-seq results through quantitative real-time PCR analysis. Gene ontology analysis revealed the involvement of these genes in biological processes such as hemostasis and transport. The majority of these nitric oxide (NO-responsive AtHMA gene products are carrier/transport proteins. AtHMAD1 (At1g51090 showed the highest fold change to S-nitrosocystein. We therefore, further investigated its role in oxidative and nitrosative mediated stress conditions and found that AtHMAD1 has antagonistic role in shoot and root growth. Characterization of AtHMAD1 through functional genomics showed that the knock out mutant athmad1 plants were resistant to virulent Pseudomonas syringae (DC3000 and showed early induction and high transcript accumulation of pathogenesis related gene. Furthermore, inoculation of athamd1 with avirulent strain of the same bacteria showed negative regulation of R-gene mediated resistance. These results were supported by hypersensitive cell death response and cell death induced electrolyte leakage. AtHMAD1 was also observed to negatively regulate systemic acquired resistance SAR as the KO mutant showed induction of SAR marker genes. Overall, these results imply that NO-responsive
Gene expression during different periods of the handling-stress response in Pampus argenteus
Sun, Peng; Tang, Baojun; Yin, Fei
2017-11-01
Common aquaculture practices subject fish to a variety of acute and chronic stressors. Such stressors are inherent in aquaculture production but can adversely affect survival, growth, immune response, reproductive capacity, and behavior. Understanding the biological mechanisms underlying stress responses helps with methods to alleviate the negative effects through better aquaculture practices, resulting in improved animal welfare and production efficiency. In the present study, transcriptome sequencing of liver and kidney was performed in silver pomfret (Pampus argenteus) subjected to handling stress versus controls. A total of 162.19 million clean reads were assembled to 30 339 unigenes. The quality of the assembly was high, with an N50 length of 2 472 bases. For function classification and pathway assignment, the unigenes were categorized into three GO (gene ontology) categories, twenty-six clusters of eggNOG (evolutionary genealogy of genes: non-supervised orthologous groups) function categories, and thirty-eight KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways. Stress affected different functional groups of genes in the tissues studied. Differentially expressed genes were mainly involved in metabolic pathways (carbohydrate metabolism, lipid metabolism, amino-acid metabolism, uptake of cofactors and vitamins, and biosynthesis of other secondary metabolites), environmental information processing (signaling molecules and their interactions), organismal systems (endocrine system, digestive system), and disease (immune, neurodegenerative, endocrine and metabolic diseases). This is the first reported analysis of genome-wide transcriptome in P. argenteus, and the findings expand our understanding of the silver pomfret genome and gene expression in association with stress. The results will be useful to future analyses of functional genes and studies of healthy artificial breeding in P. argenteus and other related fish species.
Directory of Open Access Journals (Sweden)
Nina M. Soares-Cavalcanti
2012-01-01
Full Text Available Plants experience various environmental stresses, but tolerance to these adverse conditions is a very complex phenomenon. The present research aimed to evaluate a set of genes involved in osmotic response, comparing soybean and medicago with the well-described Arabidopsis thaliana model plant. Based on 103 Arabidopsis proteins from 27 categories of osmotic stress response, comparative analyses against Genosoja and Medicago truncatula databases allowed the identification of 1,088 soybean and 1,210 Medicago sequences. The analysis showed a high number of sequences and high diversity, comprising genes from all categories in both organisms. Genes with unknown function were among the most representative, followed by transcription factors, ion transport proteins, water channel, plant defense, protein degradation, cellular structure, organization & biogenesis and senescence. An analysis of sequences with unknown function allowed the annotation of 174 soybean and 217 Medicago sequences, most of them concerning transcription factors. However, for about 30% of the sequences no function could be attributed using in silico procedures. The establishment of a gene set involved in osmotic stress responses in soybean and barrel medic will help to better understand the survival mechanisms for this type of stress condition in legumes.
Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción
2015-10-24
NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.
Directory of Open Access Journals (Sweden)
Capilla eMata-Pérez
2015-03-01
Full Text Available Linolenic acid (Ln released from chloroplast membrane galactolipids is a precursor of the phytohormone jasmonic acid (JA. The involvement of this hormone in different plant biological processes, such as responses to biotic stress conditions, has been extensively studied. However, the role of Ln in the regulation of gene expression during abiotic stress situations mediated by cellular redox changes and/or by oxidative stress processes remains poorly understood. An RNA-seq approach has increased our knowledge of the interplay among Ln, oxidative stress and ROS signalling that mediates abiotic stress conditions. Transcriptome analysis with the aid of RNA-seq in the absence of oxidative stress revealed that the incubation of Arabidopsis thaliana cell suspension cultures (ACSC with Ln resulted in the modulation of 7525 genes, of which 3034 genes had a 2 fold-change, being 533 up- and 2501 down-regulated genes, respectively. Thus, RNA-seq data analysis showed that an important set of these genes were associated with the jasmonic acid biosynthetic pathway including lypoxygenases (LOXs and Allene oxide cyclases (AOCs. In addition, several transcription factor families involved in the response to biotic stress conditions (pathogen attacks or herbivore feeding, such as WRKY, JAZ, MYC and LRR were also modified in response to Ln. However, this study also shows that Ln has the capacity to modulate the expression of genes involved in the response to abiotic stress conditions, particularly those mediated by ROS signalling. In this regard, we were able to identify new targets such as galactinol synthase 1 (GOLS1, methionine sulfoxide reductase (MSR and alkenal reductase in ACSC. It is therefore possible to suggest that, in the absence of any oxidative stress, Ln is capable of modulating new sets of genes involved in the signalling mechanism mediated by additional abiotic stresses (salinity, UV and high light intensity and especially in stresses mediated by ROS.
Effect of water pollution on expression of immune response genes of ...
African Journals Online (AJOL)
STORAGESEVER
2008-05-16
May 16, 2008 ... response genes of Solea aegyptiaca in Lake Qarun ... value of 37.8 g/l while the chloride content was 14.3 g/l on average. ... bacterial count (TVBC) ranged from 103 colony forming unit (CFU) in the middle of the Lake to 107 ...
Gálvez, José Héctor; Tai, Helen H; Lagüe, Martin; Zebarth, Bernie J; Strömvik, Martina V
2016-05-19
Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha(-1) was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency.
Thamm, Markus; Scheiner, Ricarda
2014-06-01
Division of labor is a hallmark of social insects. In honey bees, division of labor involves transition of female workers from one task to the next. The most distinct tasks are nursing (providing food for the brood) and foraging (collecting pollen and nectar). The brain mechanisms regulating this form of behavioral plasticity have largely remained elusive. Recently, it was suggested that division of labor is based on nutrition-associated signaling pathways. One highly conserved gene associated with food-related behavior across species is the foraging gene, which encodes a cyclic guanosine monophosphate (cGMP)-dependent protein kinase (PKG). Our analysis of this gene reveals the presence of alternative splicing in the honey bee. One isoform is expressed in the brain. Expression of this isoform is most pronounced in the mushroom bodies, the subesophageal ganglion, and the corpora allata. Division of labor and sucrose responsiveness in honey bees correlate significantly with foraging gene expression in distinct brain regions. Activating PKG selectively increases sucrose responsiveness in nurse bees to the level of foragers, whereas the same treatment does not affect responsiveness to light. These findings demonstrate a direct link between PKG signaling in distinct brain areas and division of labor. Furthermore, they demonstrate that the difference in sensory responsiveness between nurse bees and foragers can be compensated for by activating PKG. Our findings on the function of PKG in regulating specific sensory responsiveness and social organization offer valuable indications for the function of the cGMP/PKG pathway in many other insects and vertebrates. Copyright © 2013 Wiley Periodicals, Inc.
Ahmed, Nasar Uddin; Jung, Hee-Jeong; Park, Jong-In; Cho, Yong-Gu; Hur, Yoonkang; Nou, Ill-Sup
2015-01-10
Cold and freezing stress is a major environmental constraint to the production of Brassica crops. Enhancement of tolerance by exploiting cold and freezing tolerance related genes offers the most efficient approach to address this problem. Cold-induced transcriptional profiling is a promising approach to the identification of potential genes related to cold and freezing stress tolerance. In this study, 99 highly expressed genes were identified from a whole genome microarray dataset of Brassica rapa. Blast search analysis of the Brassica oleracea database revealed the corresponding homologous genes. To validate their expression, pre-selected cold tolerant and susceptible cabbage lines were analyzed. Out of 99 BoCRGs, 43 were differentially expressed in response to varying degrees of cold and freezing stress in the contrasting cabbage lines. Among the differentially expressed genes, 18 were highly up-regulated in the tolerant lines, which is consistent with their microarray expression. Additionally, 12 BoCRGs were expressed differentially after cold stress treatment in two contrasting cabbage lines, and BoCRG54, 56, 59, 62, 70, 72 and 99 were predicted to be involved in cold regulatory pathways. Taken together, the cold-responsive genes identified in this study provide additional direction for elucidating the regulatory network of low temperature stress tolerance and developing cold and freezing stress resistant Brassica crops. Copyright © 2014 Elsevier B.V. All rights reserved.
Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.
Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L
2016-02-19
Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.
Li, Cong; Yue, Jing; Wu, Xiaowei; Xu, Cong; Yu, Jingjuan
2014-01-01
The DREB (dehydration-responsive element binding)-type transcription factors regulate the expression of stress-inducible genes by binding the DRE/CRT cis-elements in promoter regions. The upstream transcription factors that regulate the transcription of DREB transcription factors have not been clearly defined, although the function of DREB transcription factors in abiotic stress is known. In this study, an abscisic acid (ABA)-responsive DREB-binding protein gene (SiARDP) was cloned from foxta...
Dong, Shaowei; Adams, Keith L
2011-06-01
Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Haibo Wang
Full Text Available BACKGROUND: Jatropha curcas L., also called the Physic nut, is an oil-rich shrub with multiple uses, including biodiesel production, and is currently exploited as a renewable energy resource in many countries. Nevertheless, because of its origin from the tropical MidAmerican zone, J. curcas confers an inherent but undesirable characteristic (low cold resistance that may seriously restrict its large-scale popularization. This adaptive flaw can be genetically improved by elucidating the mechanisms underlying plant tolerance to cold temperatures. The newly developed Illumina Hiseq™ 2000 RNA-seq and Digital Gene Expression (DGE are deep high-throughput approaches for gene expression analysis at the transcriptome level, using which we carefully investigated the gene expression profiles in response to cold stress to gain insight into the molecular mechanisms of cold response in J. curcas. RESULTS: In total, 45,251 unigenes were obtained by assembly of clean data generated by RNA-seq analysis of the J. curcas transcriptome. A total of 33,363 and 912 complete or partial coding sequences (CDSs were determined by protein database alignments and ESTScan prediction, respectively. Among these unigenes, more than 41.52% were involved in approximately 128 known metabolic or signaling pathways, and 4,185 were possibly associated with cold resistance. DGE analysis was used to assess the changes in gene expression when exposed to cold condition (12°C for 12, 24, and 48 h. The results showed that 3,178 genes were significantly upregulated and 1,244 were downregulated under cold stress. These genes were then functionally annotated based on the transcriptome data from RNA-seq analysis. CONCLUSIONS: This study provides a global view of transcriptome response and gene expression profiling of J. curcas in response to cold stress. The results can help improve our current understanding of the mechanisms underlying plant cold resistance and favor the screening of
Avramova, Zoya
2015-07-01
Drought, salinity, extreme temperature variations, pathogen and herbivory attacks are recurring environmental stresses experienced by plants throughout their life. To survive repeated stresses, plants provide responses that may be different from their response during the first encounter with the stress. A different response to a similar stress represents the concept of 'stress memory'. A coordinated reaction at the organismal, cellular and gene/genome levels is thought to increase survival chances by improving the plant's tolerance/avoidance abilities. Ultimately, stress memory may provide a mechanism for acclimation and adaptation. At the molecular level, the concept of stress memory indicates that the mechanisms responsible for memory-type transcription during repeated stresses are not based on repetitive activation of the same response pathways activated by the first stress. Some recent advances in the search for transcription 'memory factors' are discussed with an emphasis on super-induced dehydration stress memory response genes in Arabidopsis. © 2015 The Author The Plant Journal © 2015 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Herlânder Azevedo
2016-03-01
Full Text Available Deficiency of the micronutrient zinc is a widespread condition in agricultural soils, causing a negative impact on crop quality and yield. Nevertheless, there is an insufficient knowledge on the regulatory and molecular mechanisms underlying the plant response to inadequate zinc nutrition [1]. This information should contribute to the development of plant-based solutions with improved nutrient-use-efficiency traits in crops. Previously, the transcription factors bZIP19 and bZIP23 were identified as essential regulators of the response to zinc deficiency in Arabidopsis thaliana [2]. A microarray experiment comparing gene expression between roots of wild-type and the mutant bzip19 bzip23, exposed to zinc deficiency, led to the identification of differentially expressed genes related with zinc homeostasis, namely its transport and plant internal translocation [2]. Here, we provide the detailed methodology, bioinformatics analysis and quality controls related to the microarray gene expression profiling published by Assunção and co-workers [2]. Most significantly, the present dataset comprises new experimental variables, including analysis of shoot tissue, and zinc sufficiency and excess supply. Thus, it expands from 8 to 42 microarrays hybridizations, which have been deposited at the Gene Expression Omnibus (GEO under the accession number GSE77286. Overall, it provides a resource for research on the molecular basis and regulatory events of the plant response to zinc supply, emphasizing the importance of Arabidopsis bZIP19 and bZIP23 transcription factors. Keywords: Microarray, Micronutrient, Zinc deficiency, Arabidopsis, bZIP
Influence of Immune Responses in Gene/Stem Cell Therapies for Muscular Dystrophies
Directory of Open Access Journals (Sweden)
Andrea Farini
2014-01-01
Full Text Available Muscular dystrophies (MDs are a heterogeneous group of diseases, caused by mutations in different components of sarcolemma, extracellular matrix, or enzymes. Inflammation and innate or adaptive immune response activation are prominent features of MDs. Various therapies under development are directed toward rescuing the dystrophic muscle damage using gene transfer or cell therapy. Here we discussed current knowledge about involvement of immune system responses to experimental therapies in MDs.
Directory of Open Access Journals (Sweden)
Venkata Suresh Bonthala
Full Text Available Bambara groundnut (Vigna subterranea (L. Verdc. is an African legume and is a promising underutilized crop with good seed nutritional values. Low temperature stress in a number of African countries at night, such as Botswana, can effect the growth and development of bambara groundnut, leading to losses in potential crop yield. Therefore, in this study we developed a computational pipeline to identify and analyze the genes and gene modules associated with low temperature stress responses in bambara groundnut using the cross-species microarray technique (as bambara groundnut has no microarray chip coupled with network-based analysis. Analyses of the bambara groundnut transcriptome using cross-species gene expression data resulted in the identification of 375 and 659 differentially expressed genes (p<0.01 under the sub-optimal (23°C and very sub-optimal (18°C temperatures, respectively, of which 110 genes are commonly shared between the two stress conditions. The construction of a Highest Reciprocal Rank-based gene co-expression network, followed by its partition using a Heuristic Cluster Chiseling Algorithm resulted in 6 and 7 gene modules in sub-optimal and very sub-optimal temperature stresses being identified, respectively. Modules of sub-optimal temperature stress are principally enriched with carbohydrate and lipid metabolic processes, while most of the modules of very sub-optimal temperature stress are significantly enriched with responses to stimuli and various metabolic processes. Several transcription factors (from MYB, NAC, WRKY, WHIRLY & GATA classes that may regulate the downstream genes involved in response to stimulus in order for the plant to withstand very sub-optimal temperature stress were highlighted. The identified gene modules could be useful in breeding for low-temperature stress tolerant bambara groundnut varieties.
International Nuclear Information System (INIS)
Bugel, Sean M.; Bonventre, Josephine A.; White, Lori A.; Tanguay, Robert L.; Cooper, Keith R.
2014-01-01
Highlights: • Reproductive biomarker genes in Newark Bay killifish are desensitized to estrogen. • Gene desensitization indicates pre-transcriptional effects on estrogen signaling. • Desensitization does not have a metabolic or epigenetic basis (gene methylation). • Modulation of vitellogenin and choriogenin genes correlates with reproductive impacts. • Choriogenin L appears less prone to false negatives and may be a sensitive biomarker. - Abstract: Reproductive and endocrine disruption is commonly reported in aquatic species exposed to complex contaminant mixtures. We previously reported that Atlantic killifish (Fundulus heteroclitus) from the chronically contaminated Newark Bay, NJ, exhibit multiple endocrine disrupting effects, including inhibition of vitellogenesis (yolk protein synthesis) in females and false negative vitellogenin biomarker responses in males. Here, we characterized the effects on estrogen signaling and the transcriptional regulation of estrogen-responsive genes in this model population. First, a dose–response study tested the hypothesis that reproductive biomarkers (vtg1, vtg2, chg H, chg Hm, chg L) in Newark Bay killifish are relatively less sensitive to 17β-estradiol at the transcriptional level, relative to a reference (Tuckerton, NJ) population. The second study assessed expression for various metabolism (cyp1a, cyp3a30, mdr) and estrogen receptor (ER α, ER βa, ER βb) genes under basal and estrogen treatment conditions in both populations. Hepatic metabolism of 17β-estradiol was also evaluated in vitro as an integrated endpoint for adverse effects on metabolism. In the third study, gene methylation was evaluated for promoters of vtg1 (8 CpGs) and vtg2 (10 CpGs) in both populations, and vtg1 promoter sequences were examined for single nucleotide polymorphism (SNPs). Overall, these studies show that multi-chemical exposures at Newark Bay have desensitized all reproductive biomarkers tested to estrogen. For example, at 10 ng
Energy Technology Data Exchange (ETDEWEB)
Bugel, Sean M., E-mail: Sean.Bugel@oregonstate.edu [Department of Environmental and Molecular Toxicology, Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); Bonventre, Josephine A. [Department of Environmental and Molecular Toxicology, Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); White, Lori A. [Department of Biochemistry and Microbiology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901 (United States); Tanguay, Robert L. [Department of Environmental and Molecular Toxicology, Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); Cooper, Keith R. [Department of Biochemistry and Microbiology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901 (United States)
2014-07-01
Highlights: • Reproductive biomarker genes in Newark Bay killifish are desensitized to estrogen. • Gene desensitization indicates pre-transcriptional effects on estrogen signaling. • Desensitization does not have a metabolic or epigenetic basis (gene methylation). • Modulation of vitellogenin and choriogenin genes correlates with reproductive impacts. • Choriogenin L appears less prone to false negatives and may be a sensitive biomarker. - Abstract: Reproductive and endocrine disruption is commonly reported in aquatic species exposed to complex contaminant mixtures. We previously reported that Atlantic killifish (Fundulus heteroclitus) from the chronically contaminated Newark Bay, NJ, exhibit multiple endocrine disrupting effects, including inhibition of vitellogenesis (yolk protein synthesis) in females and false negative vitellogenin biomarker responses in males. Here, we characterized the effects on estrogen signaling and the transcriptional regulation of estrogen-responsive genes in this model population. First, a dose–response study tested the hypothesis that reproductive biomarkers (vtg1, vtg2, chg H, chg Hm, chg L) in Newark Bay killifish are relatively less sensitive to 17β-estradiol at the transcriptional level, relative to a reference (Tuckerton, NJ) population. The second study assessed expression for various metabolism (cyp1a, cyp3a30, mdr) and estrogen receptor (ER α, ER βa, ER βb) genes under basal and estrogen treatment conditions in both populations. Hepatic metabolism of 17β-estradiol was also evaluated in vitro as an integrated endpoint for adverse effects on metabolism. In the third study, gene methylation was evaluated for promoters of vtg1 (8 CpGs) and vtg2 (10 CpGs) in both populations, and vtg1 promoter sequences were examined for single nucleotide polymorphism (SNPs). Overall, these studies show that multi-chemical exposures at Newark Bay have desensitized all reproductive biomarkers tested to estrogen. For example, at 10 ng
Directory of Open Access Journals (Sweden)
Kaspar René Nielsen
Full Text Available Malignant B-cell clones are affected by both acquired genetic alterations and by inherited genetic variations changing the inflammatory tumour microenvironment.We investigated 50 inflammatory response gene polymorphisms in 355 B-cell non-Hodgkin's lymphoma (B-NHL samples encompassing 216 diffuse large B cell lymphoma (DLBCL and 139 follicular lymphoma (FL and 307 controls. The effect of single genes and haplotypes were investigated and gene-expression analysis was applied for selected genes. Since interaction between risk genes can have a large impact on phenotype, two-way gene-gene interaction analysis was included.We found inherited SNPs in genes critical for inflammatory pathways; TLR9, IL4, TAP2, IL2RA, FCGR2A, TNFA, IL10RB, GALNT12, IL12A and IL1B were significantly associated with disease risk and SELE, IL1RN, TNFA, TAP2, MBL2, IL5, CX3CR1, CHI3L1 and IL12A were, associated with overall survival (OS in specific diagnostic entities of B-NHL. We discovered noteworthy interactions between DLBCL risk alleles on IL10 and IL4RA and FL risk alleles on IL4RA and IL4. In relation to OS, a highly significant interaction was observed in DLBCL for IL4RA (rs1805010 * IL10 (rs1800890 (HR = 0.11 (0.02-0.50. Finally, we explored the expression of risk genes from the gene-gene interaction analysis in normal B-cell subtypes showing a different expression of IL4RA, IL10, IL10RB genes supporting a pathogenetic effect of these interactions in the germinal center.The present findings support the importance of inflammatory genes in B-cell lymphomas. We found association between polymorphic sites in inflammatory response genes and risk as well as outcome in B-NHL and suggest an effect of gene-gene interactions during the stepwise oncogenesis.
Yousfi, Fatma-Ezzahra; Makhloufi, Emna; Marande, William; Ghorbel, Abdel W; Bouzayen, Mondher; Bergès, Hélène
2016-01-01
WRKY transcription factors are involved in multiple aspects of plant growth, development and responses to biotic stresses. Although they have been found to play roles in regulating plant responses to environmental stresses, these roles still need to be explored, especially those pertaining to crops. Durum wheat is the second most widely produced cereal in the world. Complex, large and unsequenced genomes, in addition to a lack of genomic resources, hinder the molecular characterization of tolerance mechanisms. This paper describes the isolation and characterization of five TdWRKY genes from durum wheat ( Triticum turgidum L . ssp. durum ). A PCR-based screening of a T. turgidum BAC genomic library using primers within the conserved region of WRKY genes resulted in the isolation of five BAC clones. Following sequencing fully the five BACs, fine annotation through Triannot pipeline revealed 74.6% of the entire sequences as transposable elements and a 3.2% gene content with genes organized as islands within oceans of TEs. Each BAC clone harbored a TdWRKY gene. The study showed a very extensive conservation of genomic structure between TdWRKYs and their orthologs from Brachypodium, barley, and T. aestivum . The structural features of TdWRKY proteins suggested that they are novel members of the WRKY family in durum wheat. TdWRKY1/2/4, TdWRKY3, and TdWRKY5 belong to the group Ia, IIa, and IIc, respectively. Enrichment of cis -regulatory elements related to stress responses in the promoters of some TdWRKY genes indicated their potential roles in mediating plant responses to a wide variety of environmental stresses. TdWRKY genes displayed different expression patterns in response to salt stress that distinguishes two durum wheat genotypes with contrasting salt stress tolerance phenotypes. TdWRKY genes tended to react earlier with a down-regulation in sensitive genotype leaves and with an up-regulation in tolerant genotype leaves. The TdWRKY transcripts levels in roots
Directory of Open Access Journals (Sweden)
Yan eWang
2016-01-01
Full Text Available Heat shock factors (Hsfs are important regulators of stress-response in plants. However, our understanding of Hsf genes and their responses to temperature stresses in two Pooideae cool-season grasses, Festuca arundinacea and Lolium perenne, is limited. Here we conducted comparative transcriptome analyses of plant leaves exposed to heat or cold stress for 10 h. Approximately, 30% and 25% of the genes expressed in the two species showed significant changes under heat and cold stress respectively, including subsets of Hsfs and their target genes. We uncovered 74 Hsfs in F. arundinacea and 52 Hsfs in L. perenne, and categorized these genes into three subfamilies, HsfA, HsfB, and HsfC based on protein sequence homology to known Hsf members in model organisms. The Hsfs showed a strong response to heat and/or cold stress. The expression of HsfAs was elevated under heat stress, especially in class HsfA2, which exhibited the most dramatic responses. HsfBs were upregulated by the both temperature conditions, and HsfCs mainly showed an increase in expression under cold stress. The target genes of Hsfs, such as heat shock protein (HSP, ascorbate peroxidase (APX, inositol-3-phosphate synthase (IPS, and galactinol synthase (GOLS1, showed strong and unique responses to different stressors. We comprehensively detected Hsfs and their target genes in F. arundinacea and L. perenne, providing a foundation for future gene function studies and genetic engineering to improve stress tolerance in grasses and other crops.
Wang, Cheng; Yu, Jie; Kallen, Caleb B
2008-01-01
The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.
Influence of the xonA gene of Escherichia coli in response to radiation
International Nuclear Information System (INIS)
Ponce M, J.; Serment G, J.; Brena V, M.
2003-01-01
The Escherichia coli bacteria has a repair and tolerance system known as SOS that works when there is damage in the DNA. However it is necessary that this damage modifies before the system is activated. For this it has intended to the enzymes that degrade DNA like responsible for generating this modifications. It has already been identified to the product of the gene recJ and according to the results that here are presented that of the gene xonA has similar activity. When both genes fail, not alone the activity SOS is inhibited but rather the mortality increases, for ionizing radiation. The above mentioned reinforces the importance of these genes in the recovery to the damage caused to the genome. (Author)
Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A
2008-05-01
Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor
Nerve Growth Factor Gene Therapy Activates Neuronal Responses in Alzheimer’s Disease
Tuszynski, Mark H.; Yang, Jennifer H.; Barba, David; U, H S.; Bakay, Roy; Pay, Mary M.; Masliah, Eliezer; Conner, James M.; Kobalka, Peter; Roy, Subhojit; Nagahara, Alan H.
2016-01-01
IMPORTANCE Alzheimer’s disease (AD) is the most common neurodegenerative disorder, and lacks effective disease modifying therapies. In 2001 we initiated a clinical trial of Nerve Growth Factor (NGF) gene therapy in AD, the first effort at gene delivery in an adult neurodegenerative disorder. This program aimed to determine whether a nervous system growth factor prevents or reduces cholinergic neuronal degeneration in AD patients. We present post-mortem findings in 10 subjects with survival times ranging from 1 to 10 years post-treatment. OBJECTIVE To determine whether degenerating neurons in AD retain an ability to respond to a nervous system growth factor delivered after disease onset. DESIGN, SETTING, AND PARTICIPANTS 10 patients with early AD underwent NGF gene therapy using either ex vivo or in vivo gene transfer. The brains of all eight patients in the first Phase 1 ex vivo trial and two patients in a subsequent Phase 1 in vivo trial were examined. MAIN OUTCOME MEASURES Brains were immunolabeled to evaluate in vivo gene expression, cholinergic neuronal responses to NGF, and activation of NGF-related cell signaling. In two cases, NGF protein levels were measured by ELISA. RESULTS Degenerating neurons in the AD brain respond to NGF. All patients exhibited a trophic response to NGF, in the form of axonal sprouting toward the NGF source. Comparing treated and non-treated sides of the brain in three patients that underwent unilateral gene transfer, cholinergic neuronal hypertrophy occurred on the NGF-treated side (P>0.05). Activation of cellular signaling and functional markers were present in two patients that underwent AAV2-mediated NGF gene transfer. Neurons exhibiting tau pathology as well as neurons free of tau expressed NGF, indicating that degenerating cells can be infected with therapeutic genes with resulting activation of cell signaling. No adverse pathological effects related to NGF were observed. CONCLUSIONS AND RELEVANCE These findings indicate that
Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation
International Nuclear Information System (INIS)
Anstett, A.
2005-09-01
Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)
Transcriptomic analysis of salt stress responsive genes in Rhazya stricta.
Directory of Open Access Journals (Sweden)
Nahid H Hajrah
Full Text Available Rhazya stricta is an evergreen shrub that is widely distributed across Western and South Asia, and like many other members of the Apocynaceae produces monoterpene indole alkaloids that have anti-cancer properties. This species is adapted to very harsh desert conditions making it an excellent system for studying tolerance to high temperatures and salinity. RNA-Seq analysis was performed on R. stricta exposed to severe salt stress (500 mM NaCl across four time intervals (0, 2, 12 and 24 h to examine mechanisms of salt tolerance. A large number of transcripts including genes encoding tetrapyrroles and pentatricopeptide repeat (PPR proteins were regulated only after 12 h of stress of seedlings grown in controlled greenhouse conditions. Mechanisms of salt tolerance in R. stricta may involve the upregulation of genes encoding chaperone protein Dnaj6, UDP-glucosyl transferase 85a2, protein transparent testa 12 and respiratory burst oxidase homolog protein b. Many of the highly-expressed genes act on protecting protein folding during salt stress and the production of flavonoids, key secondary metabolites in stress tolerance. Other regulated genes encode enzymes in the porphyrin and chlorophyll metabolic pathway with important roles during plant growth, photosynthesis, hormone signaling and abiotic responses. Heme biosynthesis in R. stricta leaves might add to the level of salt stress tolerance by maintaining appropriate levels of photosynthesis and normal plant growth as well as by the participation in reactive oxygen species (ROS production under stress. We speculate that the high expression levels of PPR genes may be dependent on expression levels of their targeted editing genes. Although the results of PPR gene family indicated regulation of a large number of transcripts under salt stress, PPR actions were independent of the salt stress because their RNA editing patterns were unchanged.
Energy Technology Data Exchange (ETDEWEB)
Behrendt, Lars [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States); Joensson, Maria E. [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States); Department of Environmental Toxicology, Uppsala University (Sweden); Goldstone, Jared V. [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Redfield 352 MS-32, Woods Hole Oceanographic Institution, 45 Water Street, Woods Hole, MA 02543 (United States)
2010-06-01
Ultraviolet (UV) radiation damages cell molecules, and has been suggested to up-regulate mammalian cytochrome P4501 (CYP1) genes through an aryl hydrocarbon receptor (AHR) mediated mechanism. In this study, embryos and larvae of zebrafish (Danio rerio) were exposed to UV to determine the effects on expression of CYP1 and stress response genes in vivo in these fish. Zebrafish embryos were exposed for varying times to UV on two consecutive days, with exposure beginning at 24 and 48 h post-fertilization (hpf). Embryos exposed for 2, 4 or 6 h twice over 2 days to UVB (0.62 W/m{sup 2}; 8.9-26.7 kJ/m{sup 2}) plus UVA (2.05 W/m{sup 2}; 29.5-144.6 kJ/m{sup 2}) had moderately (2.4 {+-} 0.8-fold) but significantly up-regulated levels of CYP1A. UVA alone had no effect on CYP1A expression. Proliferating cellular nuclear antigen (PCNA) and Cu-Zn superoxide dismutase (SOD1) transcript levels were induced (2.1 {+-} 0.2 and 2.3 {+-} 0.5-fold, respectively) in embryos exposed to two 6-h pulses of 0.62 W/m{sup 2} UVB (26.8 kJ/m{sup 2}). CYP1A was induced also in embryos exposed to higher intensity UVB (0.93 W/m{sup 2}) for two 3-h or two 4-h pulses (20.1 or 26.8 kJ/m{sup 2}). CYP1B1, SOD1 and PCNA expression was induced by the two 3-h pulses of the higher intensity UVB, but not after two 4-h pulses of the higher intensity UVB, possibly due to impaired condition of surviving embryos, reflected in a mortality of 34% at that UVB dose. A single 8-h long exposure of zebrafish larvae (8 dpf) to UVB at 0.93 W/m{sup 2} (26.8 kJ/m{sup 2}) significantly induced CYP1A and CYP1B1 expression, but other CYP1 genes (CYP1C1, CYP1C2 and CYP1D1) showed no significant increase. The results show that UVB can induce expression of CYP1 genes as well stress response genes in developing zebrafish, and that UVB intensity and duration influence the responses.
Directory of Open Access Journals (Sweden)
Michael J McCarthy
Full Text Available Circadian rhythm abnormalities in bipolar disorder (BD have led to a search for genetic abnormalities in circadian "clock genes" associated with BD. However, no significant clock gene findings have emerged from genome-wide association studies (GWAS. At least three factors could account for this discrepancy: complex traits are polygenic, the organization of the clock is more complex than previously recognized, and/or genetic risk for BD may be shared across multiple illnesses. To investigate these issues, we considered the clock gene network at three levels: essential "core" clock genes, upstream circadian clock modulators, and downstream clock controlled genes. Using relaxed thresholds for GWAS statistical significance, we determined the rates of clock vs. control genetic associations with BD, and four additional illnesses that share clinical features and/or genetic risk with BD (major depression, schizophrenia, attention deficit/hyperactivity. Then we compared the results to a set of lithium-responsive genes. Associations with BD-spectrum illnesses and lithium-responsiveness were both enriched among core clock genes but not among upstream clock modulators. Associations with BD-spectrum illnesses and lithium-responsiveness were also enriched among pervasively rhythmic clock-controlled genes but not among genes that were less pervasively rhythmic or non-rhythmic. Our analysis reveals previously unrecognized associations between clock genes and BD-spectrum illnesses, partly reconciling previously discordant results from past GWAS and candidate gene studies.
No association between the PREP gene and lithium responsive bipolar disorder
Directory of Open Access Journals (Sweden)
Grof Paul
2007-02-01
Full Text Available Abstract Background Bipolar disorder (BD is a major psychiatric condition that commonly requires prophylactic and episodic treatment. Lithium (Li has been used for over 40 years now as an effective prophylactic agent. Response to Li treatment seems to be, at least in part, genetically determined. Although we ignore how Li specifically prevents mood episodes, it has previously been suggested that Li exerts an effect on the phosphoinositide pathway, and more recently, it has been proposed that Li may modulate prolyl endopeptidase (PREP. Methods In this study we carried out an association study looking at the PREP gene, located on ch 6q22. Five intronic single nucleotide polymorphisms (SNP, three coding SNPs and one SNP in the 5' UTR were investigated for their frequency in a BD sample of 180 excellent Li responders, 69 Li nonresponders and 126 controls. Genotyping was carried out using the SNaPshot reaction from Applied Biosystems, which is a modified fluorescent single base pair extension procedure. Results Following correction for multiple testing, no significant genotypic, allelic or estimated haplotypic differences were found between responders and nonresponders or between BD patients and controls. Conclusion PREP is an interesting candidate gene to investigate in genetic studies of BD, but our findings do not support the hypothesis that genetic variation in this gene plays a major role in the etiology of BD or Li response.
Global Analysis of WRKY Genes and Their Response to Dehydration and Salt Stress in Soybean.
Song, Hui; Wang, Pengfei; Hou, Lei; Zhao, Shuzhen; Zhao, Chuanzhi; Xia, Han; Li, Pengcheng; Zhang, Ye; Bian, Xiaotong; Wang, Xingjun
2016-01-01
WRKY proteins are plant specific transcription factors involved in various developmental and physiological processes, especially in biotic and abiotic stress resistance. Although previous studies suggested that WRKY proteins in soybean (Glycine max var. Williams 82) involved in both abiotic and biotic stress responses, the global information of WRKY proteins in the latest version of soybean genome (Wm82.a2v1) and their response to dehydration and salt stress have not been reported. In this study, we identified 176 GmWRKY proteins from soybean Wm82.a2v1 genome. These proteins could be classified into three groups, namely group I (32 proteins), group II (120 proteins), and group III (24 proteins). Our results showed that most GmWRKY genes were located on Chromosome 6, while chromosome 11, 12, and 20 contained the least number of this gene family. More GmWRKY genes were distributed on the ends of chromosomes to compare with other regions. The cis-acting elements analysis suggested that GmWRKY genes were transcriptionally regulated upon dehydration and salt stress. RNA-seq data analysis indicated that three GmWRKY genes responded negatively to dehydration, and 12 genes positively responded to salt stress at 1, 6, and 12 h, respectively. We confirmed by qRT-PCR that the expression of GmWRKY47 and GmWRKY 58 genes was decreased upon dehydration, and the expression of GmWRKY92, 144 and 165 genes was increased under salt treatment.
Genes Responsive to Low-Intensity Pulsed Ultrasound in MC3T3-E1 Preosteoblast Cells
Directory of Open Access Journals (Sweden)
Yoshiaki Tabuchi
2013-11-01
Full Text Available Although low-intensity pulsed ultrasound (LIPUS has been shown to enhance bone fracture healing, the underlying mechanism of LIPUS remains to be fully elucidated. Here, to better understand the molecular mechanism underlying cellular responses to LIPUS, we investigated gene expression profiles in mouse MC3T3-E1 preosteoblast cells exposed to LIPUS using high-density oligonucleotide microarrays and computational gene expression analysis tools. Although treatment of the cells with a single 20-min LIPUS (1.5 MHz, 30 mW/cm2 did not affect the cell growth or alkaline phosphatase activity, the treatment significantly increased the mRNA level of Bglap. Microarray analysis demonstrated that 38 genes were upregulated and 37 genes were downregulated by 1.5-fold or more in the cells at 24-h post-treatment. Ingenuity pathway analysis demonstrated that the gene network U (up contained many upregulated genes that were mainly associated with bone morphology in the category of biological functions of skeletal and muscular system development and function. Moreover, the biological function of the gene network D (down, which contained downregulated genes, was associated with gene expression, the cell cycle and connective tissue development and function. These results should help to further clarify the molecular basis of the mechanisms of the LIPUS response in osteoblast cells.
TaWRKY68 responses to biotic stresses are revealed by the orthologous genes from major cereals
Directory of Open Access Journals (Sweden)
Bo Ding
2014-01-01
Full Text Available WRKY transcription factors have been extensively characterized in the past 20 years, but in wheat, studies onWRKY genes and their function are lagging behind many other species. To explore the function of wheat WRKY genes, we identified a TaWRKY68 gene from a common wheat cultivar. It encodes a protein comprising 313 amino acids which harbors 19 conserved motifs or active sites. Gene expression patterns were determined by analyzing microarray data of TaWRKY68 in wheat and of orthologous genes from maize, rice and barley using Genevestigator. TaWRKY68 orthologs were identified and clustered using DELTA-BLAST and COBALT programs available at NCBI. The results showed that these genes, which are expressed in all tissues tested, had relatively higher levels in the roots and were up-regulated in response to biotic stresses. Bioinformatics results were confirmed by RT-PCR experiments using wheat plants infected by Agrobacterium tumefaciens and Blumeria graminis, or treated with Deoxynivalenol, a Fusarium graminearum-induced mycotoxin in wheat or barley. In summary,TaWRKY68 functions differ during plant developmental stages and might be representing a hub gene function in wheat responses to various biotic stresses. It was also found that including data from major cereal genes in the bioinformatics analysis gave more accurate and comprehensive predictions of wheat gene functions.
Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.
2009-01-01
Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510
Cárdenas-Guerra, Rosa Elena; Figueroa-Angulo, Elisa Elvira; Puente-Rivera, Jonathan; Zamudio-Prieto, Olga; Ortega-López, Jaime
2015-01-01
We focus on the iron response of Trichomonas vaginalis to gene family products such as the cysteine proteinases (CPs) involved in virulence properties. In particular, we examined the effect of iron on the gene expression regulation and function of cathepsin L-like and asparaginyl endopeptidase-like CPs as virulence factors. We addressed some important aspects about CPs genomic organization and we offer possible explanations to the fact that only few members of this large gene family are expressed at the RNA and protein levels and the way to control their proteolytic activity. We also summarized all known iron regulations of CPs at transcriptional, posttranscriptional, and posttranslational levels along with new insights into the possible epigenetic and miRNA processes. PMID:26090464
Nerve Growth Factor Gene Therapy: Activation of Neuronal Responses in Alzheimer Disease.
Tuszynski, Mark H; Yang, Jennifer H; Barba, David; U, Hoi-Sang; Bakay, Roy A E; Pay, Mary M; Masliah, Eliezer; Conner, James M; Kobalka, Peter; Roy, Subhojit; Nagahara, Alan H
2015-10-01
Alzheimer disease (AD) is the most common neurodegenerative disorder and lacks effective disease-modifying therapies. In 2001, we initiated a clinical trial of nerve growth factor (NGF) gene therapy in AD, the first effort at gene delivery in an adult neurodegenerative disorder. This program aimed to determine whether a nervous system growth factor prevents or reduces cholinergic neuronal degeneration in patients with AD. We present postmortem findings in 10 patients with survival times ranging from 1 to 10 years after treatment. To determine whether degenerating neurons in AD retain an ability to respond to a nervous system growth factor delivered after disease onset. Patients in this anatomicopathological study were enrolled in clinical trials from March 2001 to October 2012 at the University of California, San Diego, Medical Center in La Jolla. Ten patients with early AD underwent NGF gene therapy using ex vivo or in vivo gene transfer. The brains of all 8 patients in the first phase 1 ex vivo trial and of 2 patients in a subsequent phase 1 in vivo trial were examined. Brains were immunolabeled to evaluate in vivo gene expression, cholinergic neuronal responses to NGF, and activation of NGF-related cell signaling. In 2 patients, NGF protein levels were measured by enzyme-linked immunosorbent assay. Among 10 patients, degenerating neurons in the AD brain responded to NGF. All patients exhibited a trophic response to NGF in the form of axonal sprouting toward the NGF source. Comparing treated and nontreated sides of the brain in 3 patients who underwent unilateral gene transfer, cholinergic neuronal hypertrophy occurred on the NGF-treated side (P < .05). Activation of cellular signaling and functional markers was present in 2 patients who underwent adeno-associated viral vectors (serotype 2)-mediated NGF gene transfer. Neurons exhibiting tau pathology and neurons free of tau expressed NGF, indicating that degenerating cells can be infected with therapeutic
Directory of Open Access Journals (Sweden)
Kathie-Anne Walters
Full Text Available Pulmonary exposure to Francisella tularensis is associated with severe lung pathology and a high mortality rate. The lack of induction of classical inflammatory mediators, including IL1-β and TNF-α, during early infection has led to the suggestion that F. tularensis evades detection by host innate immune surveillance and/or actively suppresses inflammation. To gain more insight into the host response to Francisella infection during the acute stage, transcriptomic analysis was performed on lung tissue from mice exposed to virulent (Francisella tularensis ssp tularensis SchuS4. Despite an extensive transcriptional response in the lungs of animals as early as 4 hrs post-exposure, Francisella tularensis was associated with an almost complete lack of induction of immune-related genes during the initial 24 hrs post-exposure. This broad subversion of innate immune responses was particularly evident when compared to the pulmonary inflammatory response induced by other lethal (Yersinia pestis and non-lethal (Legionella pneumophila, Pseudomonas aeruginosa pulmonary infections. However, the unique induction of a subset of inflammation-related genes suggests a role for dysregulation of lymphocyte function and anti-inflammatory pathways in the extreme virulence of Francisella. Subsequent activation of a classical inflammatory response 48 hrs post-exposure was associated with altered abundance of Francisella-specific transcripts, including those associated with bacterial surface components. In summary, virulent Francisella induces a unique pulmonary inflammatory response characterized by temporal regulation of innate immune pathways correlating with altered bacterial gene expression patterns. This study represents the first simultaneous measurement of both host and Francisella transcriptome changes that occur during in vivo infection and identifies potential bacterial virulence factors responsible for regulation of host inflammatory pathways.
Tani, Shuji; Yuki, Shota; Kunitake, Emi; Sumitani, Jun-Ichi; Kawaguchi, Takashi
2017-06-01
We screened for factors involved in the cellulose-responsive induction of cellulose biomass-degrading enzyme genes from approximately 12,000 Aspergillus aculeatus T-DNA insertion mutants harboring a transcriptional fusion between the FIII-avicelase gene (cbhI) promoter and the orotidine 5'-monophosphate decarboxylase gene. Analysis of 5-fluoroorodic acid (5-FOA) sensitivity, cellulose utilization, and cbhI expression of the mutants revealed that a mutant harboring T-DNA at the dipeptidyl peptidase IV (dppIV) locus had acquired 5-FOA resistance and was deficient in cellulose utilization and cbhI expression. The deletion of dppIV resulted in a significant reduction in the cellulose-responsive expression of both cbhI as well as genes controlled by XlnR-independent and XlnR-dependent signaling pathways at an early phase in A. aculeatus. In contrast, the dppIV deletion did not affect the xylose-responsive expression of genes under the control of XlnR. These results demonstrate that DppIV participates in cellulose-responsive induction in A. aculeatus.
Directory of Open Access Journals (Sweden)
Molenaar Douwe
2010-11-01
Full Text Available Abstract Background Modulation of the immune system is one of the most plausible mechanisms underlying the beneficial effects of probiotic bacteria on human health. Presently, the specific probiotic cell products responsible for immunomodulation are largely unknown. In this study, the genetic and phenotypic diversity of strains of the Lactobacillus plantarum species were investigated to identify genes of L. plantarum with the potential to influence the amounts of cytokines interleukin 10 (IL-10 and IL-12 and the ratio of IL-10/IL-12 produced by peripheral blood mononuclear cells (PBMCs. Results A total of 42 Lactobacillus plantarum strains isolated from diverse environmental and human sources were evaluated for their capacity to stimulate cytokine production in PBMCs. The L. plantarum strains induced the secretion of the anti-inflammatory cytokine IL-10 over an average 14-fold range and secretion of the pro-inflammatory cytokine IL-12 over an average 16-fold range. Comparisons of the strain-specific cytokine responses of PBMCs to comparative genome hybridization profiles obtained with L. plantarum WCFS1 DNA microarrays (also termed gene-trait matching resulted in the identification of 6 candidate genetic loci with immunomodulatory capacities. These loci included genes encoding an N-acetyl-glucosamine/galactosamine phosphotransferase system, the LamBDCA quorum sensing system, and components of the plantaricin (bacteriocin biosynthesis and transport pathway. Deletion of these genes in L. plantarum WCFS1 resulted in growth phase-dependent changes in the PBMC IL-10 and IL-12 cytokine profiles compared with wild-type cells. Conclusions The altered PBMC cytokine profiles obtained with the L. plantarum WCFS1 mutants were in good agreement with the predictions made by gene-trait matching for the 42 L. plantarum strains. This study therefore resulted in the identification of genes present in certain strains of L. plantarum which might be responsible for
Jiang, Chunmiao; Shen, Qingxi J; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan
2017-01-01
Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, pWRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight.
Herpesvirus of turkeys: microarray analysis of host gene responses to infection
International Nuclear Information System (INIS)
Karaca, Gamze; Anobile, Jonathan; Downs, Danielle; Burnside, Joan; Schmidt, Carl J.
2004-01-01
Herpesvirus of turkeys (HVT) provides an economically important live vaccine for prevention of Marek's disease (MD) of chickens. MD, characterized by both immunosuppression and T-cell lymphoma, is caused by another herpesvirus termed Marek's disease virus (MDV). Microarrays were used to investigate the response of chicken embryonic fibroblasts (CEF) to infection with HVT. Genes responding to HVT infection include several induced by interferon along with others modulating signal transduction, transcription, scaffolding proteins, and the cytoskeleton. Results are compared with earlier studies examining the responses of CEF cells to infection with MDV
Wathugala, Deepthi L; Hemsley, Piers A; Moffat, Caroline S; Cremelie, Pieter; Knight, Marc R; Knight, Heather
2012-07-01
• Arabidopsis SENSITIVE TO FREEZING6 (SFR6) controls cold- and drought-inducible gene expression and freezing- and osmotic-stress tolerance. Its identification as a component of the MEDIATOR transcriptional co-activator complex led us to address its involvement in other transcriptional responses. • Gene expression responses to Pseudomonas syringae, ultraviolet-C (UV-C) irradiation, salicylic acid (SA) and jasmonic acid (JA) were investigated in three sfr6 mutant alleles by quantitative real-time PCR and susceptibility to UV-C irradiation and Pseudomonas infection were assessed. • sfr6 mutants were more susceptible to both Pseudomonas syringae infection and UV-C irradiation. They exhibited correspondingly weaker PR (pathogenesis-related) gene expression than wild-type Arabidopsis following these treatments or after direct application of SA, involved in response to both UV-C and Pseudomonas infection. Other genes, however, were induced normally in the mutants by these treatments. sfr6 mutants were severely defective in expression of plant defensin genes in response to JA; ectopic expression of defensin genes was provoked in wild-type but not sfr6 by overexpression of ERF5. • SFR6/MED16 controls both SA- and JA-mediated defence gene expression and is necessary for tolerance of Pseudomonas syringae infection and UV-C irradiation. It is not, however, a universal regulator of stress gene transcription and is likely to mediate transcriptional activation of specific regulons only. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.
Kidokoro, Satoshi; Watanabe, Keitaro; Ohori, Teppei; Moriwaki, Takashi; Maruyama, Kyonoshin; Mizoi, Junya; Myint Phyu Sin Htwe, Nang; Fujita, Yasunari; Sekita, Sachiko; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2015-02-01
Soybean (Glycine max) is a globally important crop, and its growth and yield are severely reduced by abiotic stresses, such as drought, heat, and cold. The cis-acting element DRE (dehydration-responsive element)/CRT plays an important role in activating gene expression in response to these stresses. The Arabidopsis DREB1/CBF genes that encode DRE-binding proteins function as transcriptional activators in the cold stress responsive gene expression. In this study, we identified 14 DREB1-type transcription factors (GmDREB1s) from a soybean genome database. The expression of most GmDREB1 genes in soybean was strongly induced by a variety of abiotic stresses, such as cold, drought, high salt, and heat. The GmDREB1 proteins activated transcription via DREs (dehydration-responsive element) in Arabidopsis and soybean protoplasts. Transcriptome analyses using transgenic Arabidopsis plants overexpressing GmDREB1s indicated that many of the downstream genes are cold-inducible and overlap with those of Arabidopsis DREB1A. We then comprehensively analyzed the downstream genes of GmDREB1B;1, which is closely related to DREB1A, using a transient expression system in soybean protoplasts. The expression of numerous genes induced by various abiotic stresses were increased by overexpressing GmDREB1B;1 in soybean, and DREs were the most conserved element in the promoters of these genes. The downstream genes of GmDREB1B;1 included numerous soybean-specific stress-inducible genes that encode an ABA receptor family protein, GmPYL21, and translation-related genes, such as ribosomal proteins. We confirmed that GmDREB1B;1 directly activates GmPYL21 expression and enhances ABRE-mediated gene expression in an ABA-independent manner. These results suggest that GmDREB1 proteins activate the expression of numerous soybean-specific stress-responsive genes under diverse abiotic stress conditions. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Rafi Shaik
Full Text Available Plants are simultaneously exposed to multiple stresses resulting in enormous changes in the molecular landscape within the cell. Identification and characterization of the synergistic and antagonistic components of stress response mechanisms contributing to the cross talk between stresses is of high priority to explore and enhance multiple stress responses. To this end, we performed meta-analysis of drought (abiotic, bacterial (biotic stress response in rice and Arabidopsis by analyzing a total of 386 microarray samples belonging to 20 microarray studies and identified approximately 3100 and 900 DEGs in rice and Arabidopsis, respectively. About 38.5% (1214 and 28.7% (272 DEGs were common to drought and bacterial stresses in rice and Arabidopsis, respectively. A majority of these common DEGs showed conserved expression status in both stresses. Gene ontology enrichment analysis clearly demarcated the response and regulation of various plant hormones and related biological processes. Fatty acid metabolism and biosynthesis of alkaloids were upregulated and, nitrogen metabolism and photosynthesis was downregulated in both stress conditions. WRKY transcription family genes were highly enriched in all upregulated gene sets while 'CO-like' TF family showed inverse relationship of expression between drought and bacterial stresses. Weighted gene co-expression network analysis divided DEG sets into multiple modules that show high co-expression and identified stress specific hub genes with high connectivity. Detection of consensus modules based on DEGs common to drought and bacterial stress revealed 9 and 4 modules in rice and Arabidopsis, respectively, with conserved and reversed co-expression patterns.
Energy Technology Data Exchange (ETDEWEB)
Adebambo, Oluwadamilare A. [Department of Biological Sciences, North Carolina State University (United States); Ray, Paul D. [Department of Environmental Sciences and Engineering, Gillings School of Global Public Health, University of North Carolina, Chapel Hill (United States); Shea, Damian [Department of Biological Sciences, North Carolina State University (United States); Fry, Rebecca C., E-mail: rfry@unc.edu [Department of Environmental Sciences and Engineering, Gillings School of Global Public Health, University of North Carolina, Chapel Hill (United States)
2015-12-15
Exposure to elevated levels of the toxic metals inorganic arsenic (iAs) and cadmium (Cd) represents a major global health problem. These metals often occur as mixtures in the environment, creating the potential for interactive or synergistic biological effects different from those observed in single exposure conditions. In the present study, environmental mixtures collected from two waste sites in China and comparable mixtures prepared in the laboratory were tested for toxicogenomic response in placental JEG-3 cells. These cells serve as a model for evaluating cellular responses to exposures during pregnancy. One of the mixtures was predominated by iAs and one by Cd. Six gene biomarkers were measured in order to evaluate the effects from the metal mixtures using dose and time-course experiments including: heme oxygenase 1 (HO-1) and metallothionein isoforms (MT1A, MT1F and MT1G) previously shown to be preferentially induced by exposure to either iAs or Cd, and metal transporter genes aquaporin-9 (AQP9) and ATPase, Cu{sup 2+} transporting, beta polypeptide (ATP7B). There was a significant increase in the mRNA expression levels of ATP7B, HO-1, MT1A, MT1F, and MT1G in mixture-treated cells compared to the iAs or Cd only-treated cells. Notably, the genomic responses were observed at concentrations significantly lower than levels found at the environmental collection sites. These data demonstrate that metal mixtures increase the expression of gene biomarkers in placental JEG-3 cells in a synergistic manner. Taken together, the data suggest that toxic metals that co-occur may induce detrimental health effects that are currently underestimated when analyzed as single metals. - Highlights: • Toxicogenomic responses of environmental metal mixtures assessed • Induction of ATP7B, HO-1, MT1A, MT1F and MT1G by metal mixtures observed in placental cells • Higher gene induction in response to metal mixtures versus single metal treatments.
International Nuclear Information System (INIS)
Adebambo, Oluwadamilare A.; Ray, Paul D.; Shea, Damian; Fry, Rebecca C.
2015-01-01
Exposure to elevated levels of the toxic metals inorganic arsenic (iAs) and cadmium (Cd) represents a major global health problem. These metals often occur as mixtures in the environment, creating the potential for interactive or synergistic biological effects different from those observed in single exposure conditions. In the present study, environmental mixtures collected from two waste sites in China and comparable mixtures prepared in the laboratory were tested for toxicogenomic response in placental JEG-3 cells. These cells serve as a model for evaluating cellular responses to exposures during pregnancy. One of the mixtures was predominated by iAs and one by Cd. Six gene biomarkers were measured in order to evaluate the effects from the metal mixtures using dose and time-course experiments including: heme oxygenase 1 (HO-1) and metallothionein isoforms (MT1A, MT1F and MT1G) previously shown to be preferentially induced by exposure to either iAs or Cd, and metal transporter genes aquaporin-9 (AQP9) and ATPase, Cu 2+ transporting, beta polypeptide (ATP7B). There was a significant increase in the mRNA expression levels of ATP7B, HO-1, MT1A, MT1F, and MT1G in mixture-treated cells compared to the iAs or Cd only-treated cells. Notably, the genomic responses were observed at concentrations significantly lower than levels found at the environmental collection sites. These data demonstrate that metal mixtures increase the expression of gene biomarkers in placental JEG-3 cells in a synergistic manner. Taken together, the data suggest that toxic metals that co-occur may induce detrimental health effects that are currently underestimated when analyzed as single metals. - Highlights: • Toxicogenomic responses of environmental metal mixtures assessed • Induction of ATP7B, HO-1, MT1A, MT1F and MT1G by metal mixtures observed in placental cells • Higher gene induction in response to metal mixtures versus single metal treatments
Energy Technology Data Exchange (ETDEWEB)
Milan, Massimo; Pauletto, Marianna; Patarnello, Tomaso; Bargelloni, Luca [Department of Comparative Biomedicine and Food Science, University of Padova, Viale dell' Universita 16, Legnaro (Padova) (Italy); Marin, Maria Gabriella [Department of Biology, University of Padova, Via Ugo Bassi 58/B, 35131 Padova (Italy); Matozzo, Valerio, E-mail: matozzo@bio.unipd.it [Department of Biology, University of Padova, Via Ugo Bassi 58/B, 35131 Padova (Italy)
2013-01-15
Pharmaceuticals are a class of emerging environmental contaminants that continuously enter aquatic environments. Presently, little information is available about the effects of these substances on non-target organisms, such as bivalves. We investigated the effects of ibuprofen (IBU) on the clam Ruditapes philippinarum. Clams were exposed for 1, 3, 5 and 7 days to 0, 100 and 1000 {mu}g IBU/L, and established biomarker responses (haemolymph lysozyme, gill acetylcholinesterase and digestive gland superoxide dismutase activities) as well as digestive gland transcriptome were evaluated. A two-way ANOVA revealed significant effects of both 'IBU concentration' and 'exposure duration' on biomarker responses. Overall, the enzyme activities were generally lower in IBU-exposed clams than in controls. Although limited knowledge of the mollusc transcriptome makes it difficult to interpret the effects of IBU on clams, the gene transcription analysis using DNA microarrays enabled the identification of the putative molecular mode of action of the IBU. The functional analysis of differentially transcribed genes suggests that IBU can interfere with various signalling pathways in clams, such as arachidonic acid metabolism, apoptosis, peroxisomal proliferator-activated receptors, and nuclear factor-kappa B. In addition, several genes involved in the metabolism of xenobiotics (e.g., glutathione S-transferase, sulfotransferase, cytochrome P450) were also found to be significantly affected by IBU exposure. In summary, the integrated approach of gene transcription analysis and biomarker responses facilitated the elucidation of the putative mechanisms of action of IBU in non-target species.
International Nuclear Information System (INIS)
Milan, Massimo; Pauletto, Marianna; Patarnello, Tomaso; Bargelloni, Luca; Marin, Maria Gabriella; Matozzo, Valerio
2013-01-01
Pharmaceuticals are a class of emerging environmental contaminants that continuously enter aquatic environments. Presently, little information is available about the effects of these substances on non-target organisms, such as bivalves. We investigated the effects of ibuprofen (IBU) on the clam Ruditapes philippinarum. Clams were exposed for 1, 3, 5 and 7 days to 0, 100 and 1000 μg IBU/L, and established biomarker responses (haemolymph lysozyme, gill acetylcholinesterase and digestive gland superoxide dismutase activities) as well as digestive gland transcriptome were evaluated. A two-way ANOVA revealed significant effects of both “IBU concentration” and “exposure duration” on biomarker responses. Overall, the enzyme activities were generally lower in IBU-exposed clams than in controls. Although limited knowledge of the mollusc transcriptome makes it difficult to interpret the effects of IBU on clams, the gene transcription analysis using DNA microarrays enabled the identification of the putative molecular mode of action of the IBU. The functional analysis of differentially transcribed genes suggests that IBU can interfere with various signalling pathways in clams, such as arachidonic acid metabolism, apoptosis, peroxisomal proliferator-activated receptors, and nuclear factor-kappa B. In addition, several genes involved in the metabolism of xenobiotics (e.g., glutathione S-transferase, sulfotransferase, cytochrome P450) were also found to be significantly affected by IBU exposure. In summary, the integrated approach of gene transcription analysis and biomarker responses facilitated the elucidation of the putative mechanisms of action of IBU in non-target species.
Li, Cong; Yue, Jing; Wu, Xiaowei; Xu, Cong; Yu, Jingjuan
2014-10-01
The DREB (dehydration-responsive element binding)-type transcription factors regulate the expression of stress-inducible genes by binding the DRE/CRT cis-elements in promoter regions. The upstream transcription factors that regulate the transcription of DREB transcription factors have not been clearly defined, although the function of DREB transcription factors in abiotic stress is known. In this study, an abscisic acid (ABA)-responsive DREB-binding protein gene (SiARDP) was cloned from foxtail millet (Setaria italica). The transcript level of SiARDP increased not only after drought, high salt, and low temperature stresses, but also after an ABA treatment in foxtail millet seedlings. Two ABA-responsive elements (ABRE1: ACGTGTC; ABRE2: ACGTGGC) exist in the promoter of SiARDP. Further analyses showed that two ABA-responsive element binding (AREB)-type transcription factors, SiAREB1 and SiAREB2, could physically bind to the ABRE core element in vitro and in vivo. The constitutive expression of SiARDP in Arabidopsis thaliana enhanced drought and salt tolerance during seed germination and seedling development, and overexpression of SiARDP in foxtail millet improved drought tolerance. The expression levels of target genes of SiARDP were upregulated in transgenic Arabidopsis and foxtail millet. These results reveal that SiARDP, one of the target genes of SiAREB, is involved in ABA-dependent signal pathways and plays a critical role in the abiotic stress response in plants. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Directory of Open Access Journals (Sweden)
Manoj Kulkarni
2017-12-01
Full Text Available Abiotic stresses such as, drought, heat, salinity, and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as, DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as, ERF (ethylene response factors, DREB (dehydration responsive element binding, ZFP (zinc finger proteins, WRKY, and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize, and/or Arabidopsis. The overall aim of this review is to provide an overview of candidate genes that have been identified as regulators of drought response in plants. The lack of a reference genome sequence for wheat and non-transgenic approaches for manipulation of gene functions in wheat in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a
Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G.; Kagale, Sateesh
2017-12-01
Abiotic stresses such as drought, heat, salinity and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as ERF (ethylene response factors), DREB (dehydration responsive element binding), ZFP (zinc finger proteins), WRKY and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize and/or Arabidopsis. The overall aim of this review was to provide an overview of candidate genes that have been tested as regulators of drought response in plants. The lack of a reference genome sequence for wheat and nontransgenic approaches for manipulation of gene functions in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a gold-standard reference genome
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Overexpression of stress-related genes in Cuscuta campestris in response to host defense reactions
Directory of Open Access Journals (Sweden)
Hamed Rezaei
2017-07-01
Full Text Available Herb dodder ( Cuscuta spp. is one of the most important parasitic plants that can severely affect crop yields in the world. So far, interactions of this parasitic plant with hosts were not investigated adequately. Here, we conducted a differential expression analyzes and identified a number of genes that were differentially expressed in haustorium tissue compared with the stem of Cuscuta campestris growing on Alfalfa. We obtained 439 cDNA fragments from haustoria (parasite-host connection zone and stems (25 cm away from connections zones using the cDNA-AFLP (Amplified Fragment Length Polymorphism method with eight different primer combinations. Of 439 transcript-derived fragments (TDFs that were detected, 145 fragments were identified as differentially expressed genes. Five TDF sequences were similar to known functional genes involved in signal transduction, metabolism, respiration, and stress responses. Genes encoding DEAD-box ATP-dependent RNA helicase, potential heme-binding protein, lysine-specific demethylase 5A were selected for qRT-PCR. The qRT-PCR analyzes confirmed the results obtained using cDNA-AFLP. Our findings shed light on the elicitation of dodder defense responses in the connection zone to overcome plant defense reactions.
Kojima, Misaki; Masui, Toshimitsu; Nemoto, Kiyomitsu; Degawa, Masakuni
2004-12-01
Changes in the gene expressions of hepatic enzymes responsible for cholesterol homeostasis were examined during the process of lead nitrate (LN)-induced development of hypercholesterolemia in male rats. Total cholesterol levels in the liver and serum were significantly increased at 3-72 h and 12-72 h, respectively, after LN-treatment (100 micromol/kg, i.v.). Despite the development of hypercholesterolemia, the genes for hepatic 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and other enzymes (FPPS, farnesyl diphosphate synthase; SQS, squalene synthase; CYP51, lanosterol 14alpha-demethylase) responsible for cholesterol biosynthesis were activated at 3-24 h and 12-18 h, respectively. On the other hand, the gene expression of cholesterol 7alpha-hydroxylase (CYP7A1), a catabolic enzyme of cholesterol, was remarkably suppressed at 3-72 h. The gene expression levels of cytokines interleukin-1beta (IL-1beta) and TNF-alpha, which activate the HMGR gene and suppress the CYP7A1 gene, were significantly increased at 1-3 h and 3-24 h, respectively. Furthermore, gene activation of SREBP-2, a gene activator of several cholesterogenic enzymes, occurred before the gene activations of FPPS, SQS and CYP51. This is the first report demonstrating sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis in LN-treated male rats. The mechanisms for the altered-gene expressions of hepatic enzymes in LN-treated rats are discussed.
Directory of Open Access Journals (Sweden)
Daejin Hyung
Full Text Available Cross-species translation of genomic information may play a pivotal role in applying biological knowledge gained from relatively simple model system to other less studied, but related, genomes. The information of abiotic stress (ABS-responsive genes in Arabidopsis was identified and translated into the legume model system, Medicago truncatula. Various data resources, such as TAIR/AtGI DB, expression profiles and literatures, were used to build a genome-wide list of ABS genes. tBlastX/BlastP similarity search tools and manual inspection of alignments were used to identify orthologous genes between the two genomes. A total of 1,377 genes were finally collected and classified into 18 functional criteria of gene ontology (GO. The data analysis according to the expression cues showed that there was substantial level of interaction among three major types (i.e., drought, salinity and cold stress of abiotic stresses. In an attempt to translate the ABS genes between these two species, genomic locations for each gene were mapped using an in-house-developed comparative analysis platform. The comparative analysis revealed that fragmental colinearity, represented by only 37 synteny blocks, existed between Arabidopsis and M. truncatula. Based on the combination of E-value and alignment remarks, estimated translation rate was 60.2% for this cross-family translation. As a prelude of the functional comparative genomic approaches, in-silico gene network/interactome analyses were conducted to predict key components in the ABS responses, and one of the sub-networks was integrated with corresponding comparative map. The results demonstrated that core members of the sub-network were well aligned with previously reported ABS regulatory networks. Taken together, the results indicate that network-based integrative approaches of comparative and functional genomics are important to interpret and translate genomic information for complex traits such as abiotic stresses.
Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y
1995-08-01
We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.
Directory of Open Access Journals (Sweden)
Cheng Wang
Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.
Directory of Open Access Journals (Sweden)
Renesh Bedre
Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.
Leptin responsiveness to energy restriction: genetic variation in the leptin receptor gene.
Mars, Monica; van Rossum, Caroline T M; de Graaf, Cees; Hoebee, Barbara; De Groot, Lisette C P G M; Kok, Frans J
2004-03-01
Serum leptin concentrations are an important afferent signal in energy balance homeostasis. It has been speculated that the leptin responsiveness to energy restriction is affected by the functionality of the leptin receptor. The purpose of this analysis was to explore the effect of polymorphisms in the LEPR gene on the acute decline in leptin after 4 days of 65% energy restriction. Leptin concentrations of the study group (n = 44; all men) declined by 2.3 +/- 1.5 micro g/L [-39.4% (95% confidence interval: -43.6 to -34.9)]. Leptin responses did not statistically differ between noncarriers and carriers of three mutant variants of the polymorphisms: Lys109/Lys109 (-41.4%) vs. Arg109/+ (-37.0%) (p = 0.33); Gln223/Gln223 (-41.5%) vs. Arg223/+ (-37.8%) (p = 0.40); Lys656/Lys656 (-39.5%) vs. Asn656/+ (-39.3%) (p = 0.96). No effect of the assessed polymorphisms in the LEPR gene on the acute decline in leptin after energy restriction was observed. Power calculations are provided for future studies on the leptin responsiveness to energy restriction.
Yu, Xiang; Takebayashi, Arika; Demura, Taku; Ohtani, Misato
2017-09-01
Knowledge on the responses of woody plants to abiotic stress can inform strategies to breed improved tree varieties and to manage tree species for environmental conservation and the production of lignocellulosic biomass. In this study, we examined the expression patterns of poplar (Populus trichocarpa) genes encoding members of the sucrose nonfermenting1-related protein kinase 2 (SnRK2) family, which are core components of the abiotic stress response. The P. trichocarpa genome contains twelve SnRK2 genes (PtSnRK2.1- PtSnRK2.12) that can be divided into three subclasses (I-III) based on the structures of their encoded kinase domains. We found that PtSnRK2s are differentially expressed in various organs. In MS medium-grown plants, all of the PtSnRK2 genes were significantly upregulated in response to abscisic acid (ABA) treatment, whereas osmotic and salt stress treatments induced only some (four and seven, respectively) of the PtSnRK2 genes. By contrast, soil-grown plants showed increased expression of most PtSnRK2 genes under drought and salt treatments, but not under ABA treatment. In soil-grown plants, drought stress induced SnRK2 subclass II genes in all tested organs (leaves, stems, and roots), whereas subclass III genes tended to be upregulated in leaves only. These results suggest that the PtSnRK2 genes are involved in abiotic stress responses, are at least partially activated by ABA, and show organ-specific responses.
Doostparast Torshizi, Abolfazl; Petzold, Linda R
2018-01-01
Data integration methods that combine data from different molecular levels such as genome, epigenome, transcriptome, etc., have received a great deal of interest in the past few years. It has been demonstrated that the synergistic effects of different biological data types can boost learning capabilities and lead to a better understanding of the underlying interactions among molecular levels. In this paper we present a graph-based semi-supervised classification algorithm that incorporates latent biological knowledge in the form of biological pathways with gene expression and DNA methylation data. The process of graph construction from biological pathways is based on detecting condition-responsive genes, where 3 sets of genes are finally extracted: all condition responsive genes, high-frequency condition-responsive genes, and P-value-filtered genes. The proposed approach is applied to ovarian cancer data downloaded from the Human Genome Atlas. Extensive numerical experiments demonstrate superior performance of the proposed approach compared to other state-of-the-art algorithms, including the latest graph-based classification techniques. Simulation results demonstrate that integrating various data types enhances classification performance and leads to a better understanding of interrelations between diverse omics data types. The proposed approach outperforms many of the state-of-the-art data integration algorithms. © The Author 2017. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com
DEFF Research Database (Denmark)
Azevedo, Herlânder; Azinheiro, Sarah Gaspar; Muñoz-Mérida, Antonio
2016-01-01
Deficiency of the micronutrient zinc is a widespread condition in agricultural soils, causing a negative impact on crop quality and yield. Nevertheless, there is an insufficient knowledge on the regulatory and molecular mechanisms underlying the plant response to inadequate zinc nutrition [1......]. This information should contribute to the development of plant-based solutions with improved nutrient-use-efficiency traits in crops. Previously, the transcription factors bZIP19 and bZIP23 were identified as essential regulators of the response to zinc deficiency in Arabidopsis thaliana [2]. A microarray...... experiment comparing gene expression between roots of wild-type and the mutant bzip19 bzip23, exposed to zinc deficiency, led to the identification of differentially expressed genes related with zinc homeostasis, namely its transport and plant internal translocation [2]. Here, we provide the detailed...
Directory of Open Access Journals (Sweden)
Swati Almeida-Dalmet
2018-01-01
Full Text Available Haloarchaea that inhabit Great Salt Lake (GSL, a thalassohaline terminal lake, must respond to the fluctuating climate conditions of the elevated desert of Utah. We investigated how shifting environmental factors, specifically salinity and temperature, affected gene expression in the GSL haloarchaea, NA6-27, which we isolated from the hypersaline north arm of the lake. Combined data from cultivation, microscopy, lipid analysis, antibiotic sensitivity, and 16S rRNA gene alignment, suggest that NA6-27 is a member of the Haloarcula genus. Our prior study demonstrated that archaea in the Haloarcula genus were stable in the GSL microbial community over seasons and years. In this study, RNA arbitrarily primed PCR (RAP-PCR was used to determine the transcriptional responses of NA6-27 grown under suboptimal salinity and temperature conditions. We observed alteration of the expression of genes related to general stress responses, such as transcription, translation, replication, signal transduction, and energy metabolism. Of the ten genes that were expressed differentially under stress, eight of these genes responded in both conditions, highlighting this general response. We also noted gene regulation specific to salinity and temperature conditions, such as osmoregulation and transport. Taken together, these data indicate that the GSL Haloarcula strain, NA6-27, demonstrates both general and specific responses to salinity and/or temperature stress, and suggest a mechanistic model for homeostasis that may explain the stable presence of this genus in the community as environmental conditions shift.
Gene expression patterns of the coral Acropora millepora in response to contact with macroalgae
Shearer, T. L.; Rasher, D. B.; Snell, T. W.; Hay, M. E.
2012-12-01
Contact with macroalgae often causes coral mortality, but the roles of abrasion versus shading versus allelopathy in these interactions are rarely clear, and effects on gene expression are unknown. Identification of gene expression changes within corals in response to contact with macroalgae can provide insight into the mode of action of allelochemicals, as well as reveal transcriptional strategies of the coral that mitigate damage from this competitive interaction, enabling the coral to survive. Gene expression responses of the coral Acropora millepora after long-term (20 days) direct contact with macroalgae ( Chlorodesmis fastigiata, Dictyota bartayresiana, Galaxaura filamentosa, and Turbinaria conoides) and short-term (1 and 24 h) exposure to C. fastigiata thalli and their hydrophobic extract were assessed. After 20 days of exposure, T. conoides thalli elicited no significant change in visual bleaching or zooxanthellae PSII quantum yield within A. millepora nubbins, but stimulated the greatest alteration in gene expression of all treatments. Chlorodesmis fastigiata, D. bartayresiana, and G. filamentosa caused significant visual bleaching of coral nubbins and reduced the PSII quantum yield of associated zooxanthellae after 20 days, but elicited fewer changes in gene expression relative to T. conoides at day 20. To evaluate initial molecular processes leading to reduction of zooxanthella PSII quantum yield, visual bleaching, and coral death, short-term exposures to C. fastigiata thalli and hydrophobic extracts were conducted; these interactions revealed protein degradation and significant changes in catalytic and metabolic activity within 24 h of contact. These molecular responses are consistent with the hypothesis that allelopathic interactions lead to alteration of signal transduction and an imbalance between reactive oxidant species production and antioxidant capabilities within the coral holobiont. This oxidative imbalance results in rapid protein degradation
DEFF Research Database (Denmark)
Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.
2011-01-01
challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... Ontology categories were involved in immune-related processes and over-represented in infected fish: (i) stress and defense response, (ii) NFkappaB signal transduction, (iii) response to non-self, (iv) antigen processing and presentation, and (v) proteasome complexes. The first four categories were also...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...
Directory of Open Access Journals (Sweden)
Davey Jennifer C
2007-12-01
Full Text Available Abstract Background Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Results Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT. The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. Conclusion The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for
Empuku, Shinichiro; Nakajima, Kentaro; Akagi, Tomonori; Kaneko, Kunihiko; Hijiya, Naoki; Etoh, Tsuyoshi; Shiraishi, Norio; Moriyama, Masatsugu; Inomata, Masafumi
2016-05-01
Preoperative chemoradiotherapy (CRT) for locally advanced rectal cancer not only improves the postoperative local control rate, but also induces downstaging. However, it has not been established how to individually select patients who receive effective preoperative CRT. The aim of this study was to identify a predictor of response to preoperative CRT for locally advanced rectal cancer. This study is additional to our multicenter phase II study evaluating the safety and efficacy of preoperative CRT using oral fluorouracil (UMIN ID: 03396). From April, 2009 to August, 2011, 26 biopsy specimens obtained prior to CRT were analyzed by cyclopedic microarray analysis. Response to CRT was evaluated according to a histological grading system using surgically resected specimens. To decide on the number of genes for dividing into responder and non-responder groups, we statistically analyzed the data using a dimension reduction method, a principle component analysis. Of the 26 cases, 11 were responders and 15 non-responders. No significant difference was found in clinical background data between the two groups. We determined that the optimal number of genes for the prediction of response was 80 of 40,000 and the functions of these genes were analyzed. When comparing non-responders with responders, genes expressed at a high level functioned in alternative splicing, whereas those expressed at a low level functioned in the septin complex. Thus, an 80-gene expression set that predicts response to preoperative CRT for locally advanced rectal cancer was identified using a novel statistical method.
Fletcher, Jason M
2014-01-01
This article uses a gene-environment interaction framework to examine the differential responses to an objective external stressor based on genetic variation in the production of depressive symptoms. This article advances the literature by utilizing a quasi-experimental environmental exposure design, as well as a regression discontinuity design, to control for seasonal trends, which limit the potential for gene-environment correlation and allow stronger causal claims. Replications are attempted for two prominent genes (5-HTT and MAOA), and three additional genes are explored (DRD2, DRD4, and DAT1). This article provides evidence of a main effect of 9/11 on reports of feelings of sadness and fails to replicate a common finding of interaction using 5-HTT but does show support for interaction with MAOA in men. It also provides new evidence that variation in the DRD4 gene modifies an individual's response to the exposure, with individuals with no 7-repeats found to have a muted response.
Directory of Open Access Journals (Sweden)
Mohammad Rashed Hossain
2016-05-01
Full Text Available Stress responsive gene expression is commonly profiled in a comparative manner involving different stress conditions or genotypes with contrasting reputation of tolerance/resistance. In contrast, this research exploited a wide natural variation in terms of taxonomy, origin and salt sensitivity in eight genotypes of rice to identify the trait specific patterns of gene expression under salt stress. Genome wide transcptomic responses were interrogated by the weighted continuous morpho-physiological trait responses using modified Significance Analysis of Microarrays. More number of genes was found to be differentially expressed under salt stressed compared to that of under unstressed conditions. Higher numbers of genes were observed to be differentially expressed for the traits shoot Na+/K+, shoot Na+, root K+, biomass and shoot Cl-, respectively. The results identified around sixty genes to be involved in Na+, K+ and anion homeostasis, transport and transmembrane activity under stressed conditions. Gene Ontology (GO enrichment analysis identified 1.36% (578 genes of the entire transcriptome to be involved in the major molecular functions such as signal transduction (>150 genes, transcription factor (81 genes and translation factor activity (62 genes etc. under salt stress. Chromosomal mapping of the genes suggests that majority of the genes are located on chromosomes 1, 2, 3, 6 & 7. The gene network analysis showed that the transcription factors and translation initiation factors formed the major gene networks and are mostly active in nucleus, cytoplasm and mitochondria whereas the membrane and vesicle bound proteins formed a secondary network active in plasma membrane and vacuoles. The novel genes and the genes with unknown functions thus identified provide picture of a synergistic salinity response representing the potentially fundamental mechanisms that are active in the wide natural genetic background of rice and will be of greater use once
Kouzai, Yusuke; Kimura, Mamiko; Yamanaka, Yurie; Watanabe, Megumi; Matsui, Hidenori; Yamamoto, Mikihiro; Ichinose, Yuki; Toyoda, Kazuhiro; Onda, Yoshihiko; Mochida, Keiichi; Noutoshi, Yoshiteru
2016-03-02
Brachypodium distachyon is a promising model plants for grasses. Infections of Brachypodium by various pathogens that severely impair crop production have been reported, and the species accordingly provides an alternative platform for investigating molecular mechanisms of pathogen virulence and plant disease resistance. To date, we have a broad picture of plant immunity only in Arabidopsis and rice; therefore, Brachypodium may constitute a counterpart that displays the commonality and uniqueness of defence systems among plant species. Phytohormones play key roles in plant biotic stress responses, and hormone-responsive genes are used to qualitatively and quantitatively evaluate disease resistance responses during pathogen infection. For these purposes, defence-related phytohormone marker genes expressed at time points suitable for defence-response monitoring are needed. Information about their expression profiles over time as well as their response specificity is also helpful. However, useful marker genes are still rare in Brachypodium. We selected 34 candidates for Brachypodium marker genes on the basis of protein-sequence similarity to known marker genes used in Arabidopsis and rice. Brachypodium plants were treated with the defence-related phytohormones salicylic acid, jasmonic acid and ethylene, and their transcription levels were measured 24 and 48 h after treatment. Two genes for salicylic acid, 7 for jasmonic acid and 2 for ethylene were significantly induced at either or both time points. We then focused on 11 genes encoding pathogenesis-related (PR) 1 protein and compared their expression patterns with those of Arabidopsis and rice. Phylogenetic analysis suggested that Brachypodium contains several PR1-family genes similar to rice genes. Our expression profiling revealed that regulation patterns of some PR1 genes as well as of markers identified for defence-related phytohormones are closely related to those in rice. We propose that the Brachypodium immune
Directory of Open Access Journals (Sweden)
Stefan Boedi
2016-07-01
Full Text Available Fusarium graminearum is an opportunistic pathogen of cereals where it causes severe yield losses and concomitant mycotoxin contamination of the grains. The pathogen has mixed biotrophic and necrotrophic (saprophytic growth phases during infection and the regulatory networks associated with these phases have so far always been analyzed together. In this study we compared the transcriptomes of fungal cells infecting a living, actively defending plant representing the mixed live style (pathogenic growth on living flowering wheat heads to the response of the fungus infecting identical, but dead plant tissues (cold-killed flowering wheat heads representing strictly saprophytic conditions. We found that the living plant actively suppressed fungal growth and promoted much higher toxin production in comparison to the identical plant tissue without metabolism suggesting that molecules signaling secondary metabolite induction are not pre-existing or not stable in the plant in sufficient amounts before infection. Differential gene expression analysis was used to define gene sets responding to the active or the passive plant as main impact factor and driver for gene expression. We correlated our results to the published F. graminearum transcriptomes, proteomes and secretomes and found that only a limited number of in planta- expressed genes require the living plant for induction but the majority uses simply the plant tissue as signal. Many secondary metabolite (SM gene clusters show a heterogeneous expression pattern within the cluster indicating that different genetic or epigenetic signals govern the expression of individual genes within a physically linked cluster. Our bioinformatic approach also identified fungal genes which were actively repressed by signals derived from the active plant and may thus represent direct targets of the plant defense against the invading pathogen.
Wang, Xia; Feng, Jianhua; Huang, Aiyou; He, Linwen; Niu, Jianfeng; Wang, Guangce
2017-11-01
Pyropia haitanensis has prominent stress-resistance characteristics and is endemic to China. Studies into the stress responses in these algae could provide valuable information on the stress-response mechanisms in the intertidal Rhodophyta. Here, the effects of salinity and light intensity on the quantum yield of photosystem II in Py. haitanensis were investigated using pulse-amplitude-modulation fluorometry. Total RNA and genomic DNA of the samples under different stress conditions were isolated. By normalizing to the genomic DNA quantity, the RNA content in each sample was evaluated. The cDNA was synthesized and the expression levels of seven potential internal control genes were evaluated using qRT-PCR method. Then, we used geNorm, a common statistical algorithm, to analyze the qRT-PCR data of seven reference genes. Potential genes that may constantly be expressed under different conditions were selected, and these genes showed stable expression levels in samples under a salinity treatment, while tubulin, glyceraldehyde-3-phosphate dehydrogenase and actin showed stability in samples stressed by strong light. Based on the results of the pulse amplitude-modulation fluorometry, an absolute quantification was performed to obtain gene copy numbers in certain stress-treated samples. The stably expressed genes as determined by the absolute quantification in certain samples conformed to the results of the geNorm screening. Based on the results of the software analysis and absolute quantification, we proposed that elongation factor 3 and 18S ribosomal RNA could be used as internal control genes when the Py. haitanensis blades were subjected to salinity stress, and that α-tubulin and 18S ribosomal RNA could be used as the internal control genes when the stress was from strong light. In general, our findings provide a convenient reference for the selection of internal control genes when designing experiments related to stress responses in Py. haitanensis.
Vieira, Dayse Drielly Sousa Santana; Emiliani, Giovanni; Bartolini, Paola; Podda, Alessandra; Centritto, Mauro; Luro, François; Carratore, Renata Del; Morillon, Raphaël; Gesteira, Abelmon; Maserti, Biancaelena
2017-11-01
Combination of biotic and abiotic stress is a major challenge for crop and fruit production. Thus, identification of genes involved in cross-response to abiotic and biotic stress is of great importance for breeding superior genotypes. Lectins are glycan-binding proteins with a functions in the developmental processes as well as in the response to biotic and abiotic stress. In this work, a lectin like gene, namely ClLectin1, was characterized in Volkamer lemon and its expression was studied in plants exposed to either water stress, hormonal elicitors (JA, SA, ABA) or wounding to understand whether this gene may have a function in the response to multiple stress combination. Results showed that ClLectin1 has 100% homology with a L-type lectin gene from C. sinensis and the in silico study of the 5'UTR region showed the presence of cis-responsive elements to SA, DRE2 and ABA. ClLectin1 was rapidly induced by hormonal treatments and wounding, at local and systemic levels, suggesting an involvement in defence signalling pathways and a possible role as fast detection biomarker of biotic stress. On the other hand, the induction of ClLectin1 by water stress pointed out a role of the gene in the response to drought. The simultaneous response of ClLectin1 expression to water stress and SA treatment could be further investigated to assess whether a moderate drought stress may be useful to improve citrus performance by stimulating the SA-dependent response to biotic stress. Copyright © 2017 Elsevier GmbH. All rights reserved.
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...
Evaluation of gene expression profile of keratinocytes in response to JP-8 jet fuel
International Nuclear Information System (INIS)
Espinoza, Luis A.; Li Peijun; Lee, Richard Y.; Wang Yue; Boulares, A. Hamid; Clarke, Robert; Smulson, Mark E.
2004-01-01
The skin is the principal barrier against any environmental insult. Therefore, there is a high risk for a large number of military and civilian personnel exposed to jet fuel JP-8 to suffer percutaneous absorption of this fuel. This paper reports the use of cDNA microarray to identify the gene expression profile in normal human epidermal keratinocytes exposed to JP-8 for 24-h and 7-day periods. The effects of JP-8 exposure on keratinocytes at these two different periods induced a set of genes with altered expression in response to this type of insult. Microarray data were visualized using a novel algorithm based on simple statistical analyses to reduce data dimensionality and identify subsets of discriminant genes. Predictive neural networks were built using a multiplayer perceptron to carry out a proper classification task in microarray data in the untreated versus JP-8-treated samples. The pattern of expressions in response to JP-8 provides evidences that detoxificant-related and cell growth regulator genes with the most variability in the level of expression may be useful genetic markers in adverse health effects of personnel exposed to JP-8. The approaches in our analysis provide a simple, safe, novel, and effective method that is reliable in identifying and analyzing gene expression in samples treated with JP-8 or over potential toxic agents. Gene expression data from these studies can be used to build accurate predictive models that separate different molecular profiles. The data establish the use and effectiveness of these approaches for future prospective studies
Gianni, Luca; Zambetti, Milvia; Clark, Kim; Baker, Joffre; Cronin, Maureen; Wu, Jenny; Mariani, Gabriella; Rodriguez, Jaime; Carcangiu, Marialuisa; Watson, Drew; Valagussa, Pinuccia; Rouzier, Roman; Symmans, W Fraser; Ross, Jeffrey S; Hortobagyi, Gabriel N; Pusztai, Lajos; Shak, Steven
2005-10-10
We sought to identify gene expression markers that predict the likelihood of chemotherapy response. We also tested whether chemotherapy response is correlated with the 21-gene Recurrence Score assay that quantifies recurrence risk. Patients with locally advanced breast cancer received neoadjuvant paclitaxel and doxorubicin. RNA was extracted from the pretreatment formalin-fixed paraffin-embedded core biopsies. The expression of 384 genes was quantified using reverse transcriptase polymerase chain reaction and correlated with pathologic complete response (pCR). The performance of genes predicting for pCR was tested in patients from an independent neoadjuvant study where gene expression was obtained using DNA microarrays. Of 89 assessable patients (mean age, 49.9 years; mean tumor size, 6.4 cm), 11 (12%) had a pCR. Eighty-six genes correlated with pCR (unadjusted P < .05); pCR was more likely with higher expression of proliferation-related genes and immune-related genes, and with lower expression of estrogen receptor (ER) -related genes. In 82 independent patients treated with neoadjuvant paclitaxel and doxorubicin, DNA microarray data were available for 79 of the 86 genes. In univariate analysis, 24 genes correlated with pCR with P < .05 (false discovery, four genes) and 32 genes showed correlation with P < .1 (false discovery, eight genes). The Recurrence Score was positively associated with the likelihood of pCR (P = .005), suggesting that the patients who are at greatest recurrence risk are more likely to have chemotherapy benefit. Quantitative expression of ER-related genes, proliferation genes, and immune-related genes are strong predictors of pCR in women with locally advanced breast cancer receiving neoadjuvant anthracyclines and paclitaxel.
Yu, Hong; Soler, Marçal; Mila, Isabelle; San Clemente, Hélène; Savelli, Bruno; Dunand, Christophe; Paiva, Jorge A. P.; Myburg, Alexander A.; Bouzayen, Mondher; Grima-Pettenati, Jacqueline; Cassan-Wang, Hua
2014-01-01
Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF) are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation. PMID:25269088
Directory of Open Access Journals (Sweden)
Hong Yu
Full Text Available Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation.
Bencke-Malato, Marta; Cabreira, Caroline; Wiebke-Strohm, Beatriz; Bücker-Neto, Lauro; Mancini, Estefania; Osorio, Marina B; Homrich, Milena S; Turchetto-Zolet, Andreia Carina; De Carvalho, Mayra C C G; Stolf, Renata; Weber, Ricardo L M; Westergaard, Gastón; Castagnaro, Atílio P; Abdelnoor, Ricardo V; Marcelino-Guimarães, Francismar C; Margis-Pinheiro, Márcia; Bodanese-Zanettini, Maria Helena
2014-09-10
Many previous studies have shown that soybean WRKY transcription factors are involved in the plant response to biotic and abiotic stresses. Phakopsora pachyrhizi is the causal agent of Asian Soybean Rust, one of the most important soybean diseases. There are evidences that WRKYs are involved in the resistance of some soybean genotypes against that fungus. The number of WRKY genes already annotated in soybean genome was underrepresented. In the present study, a genome-wide annotation of the soybean WRKY family was carried out and members involved in the response to P. pachyrhizi were identified. As a result of a soybean genomic databases search, 182 WRKY-encoding genes were annotated and 33 putative pseudogenes identified. Genes involved in the response to P. pachyrhizi infection were identified using superSAGE, RNA-Seq of microdissected lesions and microarray experiments. Seventy-five genes were differentially expressed during fungal infection. The expression of eight WRKY genes was validated by RT-qPCR. The expression of these genes in a resistant genotype was earlier and/or stronger compared with a susceptible genotype in response to P. pachyrhizi infection. Soybean somatic embryos were transformed in order to overexpress or silence WRKY genes. Embryos overexpressing a WRKY gene were obtained, but they were unable to convert into plants. When infected with P. pachyrhizi, the leaves of the silenced transgenic line showed a higher number of lesions than the wild-type plants. The present study reports a genome-wide annotation of soybean WRKY family. The participation of some members in response to P. pachyrhizi infection was demonstrated. The results contribute to the elucidation of gene function and suggest the manipulation of WRKYs as a strategy to increase fungal resistance in soybean plants.
Jaouannet, Maëlle; Morris, Jenny A.; Hedley, Peter E.; Bos, Jorunn I. B.
2015-01-01
Aphids are economically important pests that display exceptional variation in host range. The determinants of diverse aphid host ranges are not well understood, but it is likely that molecular interactions are involved. With significant progress being made towards understanding host responses upon aphid attack, the mechanisms underlying non-host resistance remain to be elucidated. Here, we investigated and compared Arabidopsis thaliana host and non-host responses to aphids at the transcriptional level using three different aphid species, Myzus persicae, Myzus cerasi and Rhopalosiphum pisum. Gene expression analyses revealed a high level of overlap in the overall gene expression changes during the host and non-host interactions with regards to the sets of genes differentially expressed and the direction of expression changes. Despite this overlap in transcriptional responses across interactions, there was a stronger repression of genes involved in metabolism and oxidative responses specifically during the host interaction with M. persicae. In addition, we identified a set of genes with opposite gene expression patterns during the host versus non-host interactions. Aphid performance assays on Arabidopsis mutants that were selected based on our transcriptome analyses identified novel genes contributing to host susceptibility, host defences during interactions with M. persicae as well to non-host resistance against R. padi. Understanding how plants respond to aphid species that differ in their ability to infest plant species, and identifying the genes and signaling pathways involved, is essential for the development of novel and durable aphid control in crop plants. PMID:25993686
Adenuga, David; Woolhiser, Michael R; Gollapudi, B Bhaskar; Boverhof, Darrell R
2012-04-01
Genomic approaches have the potential to enhance the specificity and predictive accuracy of existing toxicology endpoints, including those for chemical sensitization. The present study was conducted to determine whether gene expression responses can distinguish contact sensitizers (1-chloro-2,4-dinitrobenzene [DNCB] and hexyl cinnamic aldehyde [HCA]), respiratory sensitizers (ortho-phthalaldehyde and trimellitic anhydride [TMA]), and nonsensitizing irritants (methyl salicylate [MS] and nonanoic acid [NA]) in the local lymph node assay (LLNA). Female Balb/c mice received doses of each chemical as per the standard LLNA dosing regimen on days 1, 2, and 3. Auricular lymph nodes were analyzed for tritiated thymidine ((3)HTdR) incorporation on day 6 and for gene expression responses on days 6 and 10. All chemicals induced dose-dependent increases in stimulation index, which correlated strongly with the number of differentially expressed genes. A majority of genes modulated by the irritants were similarly altered by the sensitizers, consistent with the irritating effects of the sensitizers. However, a select number of responses involved with immune-specific functions, such as dendritic cell activation, were unique to the sensitizers and may offer the ability to distinguish sensitizers from irritants. Genes for the mast cell proteases 1 and 8, Lgals7, Tim2, Aicda, Il4, and Akr1c18 were more strongly regulated by respiratory sensitizers compared with contact sensitizers and may represent potential biomarkers for discriminating between contact and respiratory sensitizers. Collectively, these data suggest that gene expression responses may serve as useful biomarkers to distinguish between respiratory and contact sensitizers and nonsensitizing irritants in the LLNA.
Directory of Open Access Journals (Sweden)
Sonia Podvin
Full Text Available By virtue of its ability to regulate the composition of cerebrospinal fluid (CSF, the choroid plexus (CP is ideally suited to instigate a rapid response to traumatic brain injury (TBI by producing growth regulatory proteins. For example, Esophageal Cancer Related Gene-4 (Ecrg4 is a tumor suppressor gene that encodes a hormone-like peptide called augurin that is present in large concentrations in CP epithelia (CPe. Because augurin is thought to regulate senescence, neuroprogenitor cell growth and differentiation in the CNS, we evaluated the kinetics of Ecrg4 expression and augurin immunoreactivity in CPe after CNS injury. Adult rats were injured with a penetrating cortical lesion and alterations in augurin immunoreactivity were examined by immunohistochemistry. Ecrg4 gene expression was characterized by in situ hybridization. Cell surface augurin was identified histologically by confocal microscopy and biochemically by sub-cellular fractionation. Both Ecrg4 gene expression and augurin protein levels were decreased 24-72 hrs post-injury but restored to uninjured levels by day 7 post-injury. Protein staining in the supraoptic nucleus of the hypothalamus, used as a control brain region, did not show a decrease of auguin immunoreactivity. Ecrg4 gene expression localized to CPe cells, and augurin protein to the CPe ventricular face. Extracellular cell surface tethering of 14 kDa augurin was confirmed by cell surface fractionation of primary human CPe cells in vitro while a 6-8 kDa fragment of augurin was detected in conditioned media, indicating release from the cell surface by proteolytic processing. In rat CSF however, 14 kDa augurin was detected. We hypothesize the initial release and proteolytic processing of augurin participates in the activation phase of injury while sustained Ecrg4 down-regulation is dysinhibitory during the proliferative phase. Accordingly, augurin would play a constitutive inhibitory function in normal CNS while down
International Nuclear Information System (INIS)
Solis, Mayra; Wilkinson, Peter; Romieu, Raphaelle; Hernandez, Eduardo; Wainberg, Mark A.; Hiscott, John
2006-01-01
Dendritic cells (DC) are among the first targets of human immunodeficiency virus type-1 (HIV-1) infection and in turn play a crucial role in viral transmission to T cells and in the regulation of the immune response. The major group of HIV-1 has diversified genetically based on variation in env sequences and comprise at least 11 subtypes. Because little is known about the host response elicited against different HIV-1 clade isolates in vivo, we sought to use gene expression profiling to identify genes regulated by HIV-1 subtypes B, C, and A/E upon de novo infection of primary immature monocyte-derived DC (iMDDCs). A total of 3700 immune-related genes were subjected to a significance analysis of microarrays (SAM); 656 genes were selected as significant and were further divided into 8 functional categories. Regardless of the time of infection, 20% of the genes affected by HIV-1 were involved in signal transduction, followed by 14% of the genes identified as transcription-related genes, and 7% were classified as playing a role in cell proliferation and cell cycle. Furthermore, 7% of the genes were immune response genes. By 72 h postinfection, genes upregulated by subtype B included the inhibitor of the matrix metalloproteinase TIMP2 and the heat shock protein 40 homolog (Hsp40) DNAJB1, whereas the IFN inducible gene STAT1, the MAPK1/ERK2 kinase regulator ST5, and the chemokine CXCL3 and SHC1 genes were induced by subtypes C and A/E. These analyses distinguish a temporally regulated host response to de novo HIV-1 infection in primary dendritic cells
International Nuclear Information System (INIS)
Feng Hongqing; Wang Ruixue; Sun Peng; Wu Haiyan; Liu Qi; Li Fangting; Fang Jing; Zhang Jue; Zhu Weidong
2010-01-01
The mechanisms of eukaryotic cell response to cold plasma are studied. A series of single gene mutants of eukaryotic model organism Saccharomyces cerevisiae are used to compare their sensitivity to plasma treatment with the wild type. We examined 12 mutants in the oxidative stress pathway and the cell cycle pathway, in which 8 are found to be hypersensitive to plasma processing. The mutated genes' roles in the two pathways are analyzed to understand the biological response mechanisms of plasma treatment. The results demonstrate that genes from both pathways are needed for the eukaryotic cells to survive the complex plasma treatment.
Directory of Open Access Journals (Sweden)
Deyholos Michael K
2009-06-01
Full Text Available Abstract Background Members of plant WRKY transcription factor families are widely implicated in defense responses and various other physiological processes. For canola (Brassica napus L., no WRKY genes have been described in detail. Because of the economic importance of this crop, and its evolutionary relationship to Arabidopsis thaliana, we sought to characterize a subset of canola WRKY genes in the context of pathogen and hormone responses. Results In this study, we identified 46 WRKY genes from canola by mining the expressed sequence tag (EST database and cloned cDNA sequences of 38 BnWRKYs. A phylogenetic tree was constructed using the conserved WRKY domain amino acid sequences, which demonstrated that BnWRKYs can be divided into three major groups. We further compared BnWRKYs to the 72 WRKY genes from Arabidopsis and 91 WRKY from rice, and we identified 46 presumptive orthologs of AtWRKY genes. We examined the subcellular localization of four BnWRKY proteins using green fluorescent protein (GFP and we observed the fluorescent green signals in the nucleus only. The responses of 16 selected BnWRKY genes to two fungal pathogens, Sclerotinia sclerotiorum and Alternaria brassicae, were analyzed by quantitative real time-PCR (qRT-PCR. Transcript abundance of 13 BnWRKY genes changed significantly following pathogen challenge: transcripts of 10 WRKYs increased in abundance, two WRKY transcripts decreased after infection, and one decreased at 12 h post-infection but increased later on (72 h. We also observed that transcript abundance of 13/16 BnWRKY genes was responsive to one or more hormones, including abscisic acid (ABA, and cytokinin (6-benzylaminopurine, BAP and the defense signaling molecules jasmonic acid (JA, salicylic acid (SA, and ethylene (ET. We compared these transcript expression patterns to those previously described for presumptive orthologs of these genes in Arabidopsis and rice, and observed both similarities and differences in
Innate immune responses: Crosstalk of signaling and regulation of gene transcription
International Nuclear Information System (INIS)
Zhong Bo; Tien Po; Shu Hongbing
2006-01-01
Innate immune responses to pathogens such as bacteria and viruses are triggered by recognition of specific structures of invading pathogens called pathogen-associated molecular patterns (PAMPs) by cellular pattern recognition receptors (PRRs) that are located at plasma membrane or inside cells. Stimulation of different PAMPs activates Toll-like receptor (TLR)-dependent and -independent signaling pathways that lead to activation of transcription factors nuclear factor-κB (NF-κB), interferon regulatory factor 3/7 (IRF3/7) and/or activator protein-1 (AP-1), which collaborate to induce transcription of a large number of downstream genes. This review focuses on the rapid progress that has recently improved our understanding of the crosstalk among the pathways and the precise regulation of transcription of the downstream genes
Directory of Open Access Journals (Sweden)
Paniego Norma
2008-01-01
Full Text Available Abstract Background Considering that sunflower production is expanding to arid regions, tolerance to abiotic stresses as drought, low temperatures and salinity arises as one of the main constrains nowadays. Differential organ-specific sunflower ESTs (expressed sequence tags were previously generated by a subtractive hybridization method that included a considerable number of putative abiotic stress associated sequences. The objective of this work is to analyze concerted gene expression profiles of organ-specific ESTs by fluorescence microarray assay, in response to high sodium chloride concentration and chilling treatments with the aim to identify and follow up candidate genes for early responses to abiotic stress in sunflower. Results Abiotic-related expressed genes were the target of this characterization through a gene expression analysis using an organ-specific cDNA fluorescence microarray approach in response to high salinity and low temperatures. The experiment included three independent replicates from leaf samples. We analyzed 317 unigenes previously isolated from differential organ-specific cDNA libraries from leaf, stem and flower at R1 and R4 developmental stage. A statistical analysis based on mean comparison by ANOVA and ordination by Principal Component Analysis allowed the detection of 80 candidate genes for either salinity and/or chilling stresses. Out of them, 50 genes were up or down regulated under both stresses, supporting common regulatory mechanisms and general responses to chilling and salinity. Interestingly 15 and 12 sequences were up regulated or down regulated specifically in one stress but not in the other, respectively. These genes are potentially involved in different regulatory mechanisms including transcription/translation/protein degradation/protein folding/ROS production or ROS-scavenging. Differential gene expression patterns were confirmed by qRT-PCR for 12.5% of the microarray candidate sequences. Conclusion
Patterson, Rachel A.; Juarez, Michelle T.; Hermann, Anita; Sasik, Roman; Hardiman, Gary; McGinnis, William
2013-01-01
After injury to the animal epidermis, a variety of genes are transcriptionally activated in nearby cells to regenerate the missing cells and facilitate barrier repair. The range and types of diffusible wound signals that are produced by damaged epidermis and function to activate repair genes during epidermal regeneration remains a subject of very active study in many animals. In Drosophila embryos, we have discovered that serine protease function is locally activated around wound sites, and is also required for localized activation of epidermal repair genes. The serine protease trypsin is sufficient to induce a striking global epidermal wound response without inflicting cell death or compromising the integrity of the epithelial barrier. We developed a trypsin wounding treatment as an amplification tool to more fully understand the changes in the Drosophila transcriptome that occur after epidermal injury. By comparing our array results with similar results on mammalian skin wounding we can see which evolutionarily conserved pathways are activated after epidermal wounding in very diverse animals. Our innovative serine protease-mediated wounding protocol allowed us to identify 8 additional genes that are activated in epidermal cells in the immediate vicinity of puncture wounds, and the functions of many of these genes suggest novel genetic pathways that may control epidermal wound repair. Additionally, our data augments the evidence that clean puncture wounding can mount a powerful innate immune transcriptional response, with different innate immune genes being activated in an interesting variety of ways. These include puncture-induced activation only in epidermal cells in the immediate vicinity of wounds, or in all epidermal cells, or specifically in the fat body, or in multiple tissues. PMID:23637905
Liu, Qian; Wen, Chi-Kuang
2012-01-01
The ethylene response is negatively regulated by a family of five ethylene receptor genes in Arabidopsis (Arabidopsis thaliana). The five members of the ethylene receptor family can physically interact and form complexes, which implies that cooperativity for signaling may exist among the receptors. The ethylene receptor gene mutations etr1-1(C65Y)(for ethylene response1-1), ers1-1(I62P) (for ethylene response sensor1-1), and ers1C65Y are dominant, and each confers ethylene insensitivity. In this study, the repression of the ethylene response by these dominant mutant receptor genes was examined in receptor-defective mutants to investigate the functional significance of receptor cooperativity in ethylene signaling. We showed that etr1-1(C65Y), but not ers1-1(I62P), substantially repressed various ethylene responses independent of other receptor genes. In contrast, wild-type receptor genes differentially supported the repression of ethylene responses by ers1-1(I62P); ETR1 and ETHYLENE INSENSITIVE4 (EIN4) supported ers1-1(I62P) functions to a greater extent than did ERS2, ETR2, and ERS1. The lack of both ETR1 and EIN4 almost abolished the repression of ethylene responses by ers1C65Y, which implied that ETR1 and EIN4 have synergistic effects on ers1C65Y functions. Our data indicated that a dominant ethylene-insensitive receptor differentially repressed ethylene responses when coupled with a wild-type ethylene receptor, which supported the hypothesis that the formation of a variety of receptor complexes may facilitate differential receptor signal output, by which ethylene responses can be repressed to different extents. We hypothesize that plants can respond to a broad ethylene concentration range and exhibit tissue-specific ethylene responsiveness with differential cooperation of the multiple ethylene receptors. PMID:22227969
Directory of Open Access Journals (Sweden)
Hosein Norozian
2016-02-01
Full Text Available Background: Hepatitis C virus (HCV is a worldwide health problem, which associated with cirrhosis and hepatocellular carcinoma. Interferon-α and Ribavirin are only acceptable treatment regimen for these patients. These regimen are effective only on 50% of the patients. The aim of this study was to evaluate the response to treatment with interferon gamma gene polymorphism in patients with hepatitis C. Materials and Methods: In this study, a cross - sectional study, response or lack of response to treatment in 78 patients treated with interferon gamma gene polymorphism were studied at Shiraz Namazi Hospital from 2011-2012 . DNA samples extract by salt (salting out and interferon gamma gene polymorphism (+874T/A IFN–gamma was evaluate with ARMS-PCR technique. Data were analyzed using EPI Info2000 and SPSS 16 software (chi-square test. Results: Results showed that 39 patients (50% out of 78 studied patients had TT alleles, 11 patients (1.14% had AA alleles and 28 patients (9.39% had TA alleles. 49 patients (62.82% responded to treatment. TT genotype and allele frequencies between the studied groups showed significant differencey (P=0.002. Conclusion: Interferon gamma is a key cytokine in the immune response against hepatitis C. Polymorphism in the interferon-gamma gene is (+874T/AIFN–gamma One of the most important factors interferes with treatment response in hepatitis C patients.
Directory of Open Access Journals (Sweden)
Léa Campos de Oliveira
2011-09-01
Full Text Available Objective: To present the frequency of single nucleotide polymorphismsof a few immune response genes in a population sample from SãoPaulo City (SP, Brazil. Methods: Data on allele frequencies ofknown polymorphisms of innate and acquired immunity genes werepresented, the majority with proven impact on gene function. Datawere gathered from a sample of healthy individuals, non-HLA identicalsiblings of bone marrow transplant recipients from the Hospital dasClínicas da Faculdade de Medicina da Universidade de São Paulo,obtained between 1998 and 2005. The number of samples variedfor each single nucleotide polymorphism analyzed by polymerasechain reaction followed by restriction enzyme cleavage. Results:Allele and genotype distribution of 41 different gene polymorphisms,mostly cytokines, but also including other immune response genes,were presented. Conclusion: We believe that the data presentedhere can be of great value for case-control studies, to define whichpolymorphisms are present in biologically relevant frequencies and toassess targets for therapeutic intervention in polygenic diseases witha component of immune and inflammatory responses.
Directory of Open Access Journals (Sweden)
Jill A. McKay
2016-10-01
Full Text Available Growing evidence supports the hypothesis that the in utero environment can have profound implications for fetal development and later life offspring health. Current theory suggests conditions experienced in utero prepare, or “programme”, the fetus for its anticipated post-natal environment. The mechanisms responsible for these programming events are poorly understood but are likely to involve gene expression changes. Folate is essential for normal fetal development and inadequate maternal folate supply during pregnancy has long term adverse effects for offspring. We tested the hypothesis that folate depletion during pregnancy alters offspring programming through altered gene expression. Female C57BL/6J mice were fed diets containing 2 mg or 0.4 mg folic acid/kg for 4 weeks before mating and throughout pregnancy. At 17.5 day gestation, genome-wide gene expression was measured in male fetal livers and placentas. In the fetal liver, 989 genes were expressed differentially (555 up-regulated, 434 down-regulated in response to maternal folate depletion, with 460 genes expressed differentially (250 up-regulated, 255 down-regulated in the placenta. Only 25 differentially expressed genes were common between organs. Maternal folate intake during pregnancy influences fetal gene expression in a highly organ specific manner which may reflect organ-specific functions.
McKay, Jill A; Xie, Long; Adriaens, Michiel; Evelo, Chris T; Ford, Dianne; Mathers, John C
2016-10-22
Growing evidence supports the hypothesis that the in utero environment can have profound implications for fetal development and later life offspring health. Current theory suggests conditions experienced in utero prepare, or "programme", the fetus for its anticipated post-natal environment. The mechanisms responsible for these programming events are poorly understood but are likely to involve gene expression changes. Folate is essential for normal fetal development and inadequate maternal folate supply during pregnancy has long term adverse effects for offspring. We tested the hypothesis that folate depletion during pregnancy alters offspring programming through altered gene expression. Female C57BL/6J mice were fed diets containing 2 mg or 0.4 mg folic acid/kg for 4 weeks before mating and throughout pregnancy. At 17.5 day gestation, genome-wide gene expression was measured in male fetal livers and placentas. In the fetal liver, 989 genes were expressed differentially (555 up-regulated, 434 down-regulated) in response to maternal folate depletion, with 460 genes expressed differentially (250 up-regulated, 255 down-regulated) in the placenta. Only 25 differentially expressed genes were common between organs. Maternal folate intake during pregnancy influences fetal gene expression in a highly organ specific manner which may reflect organ-specific functions.
Directory of Open Access Journals (Sweden)
Kristian Ovaska
Full Text Available Identification of responsive genes to an extra-cellular cue enables characterization of pathophysiologically crucial biological processes. Deep sequencing technologies provide a powerful means to identify responsive genes, which creates a need for computational methods able to analyze dynamic and multi-level deep sequencing data. To answer this need we introduce here a data-driven algorithm, SPINLONG, which is designed to search for genes that match the user-defined hypotheses or models. SPINLONG is applicable to various experimental setups measuring several molecular markers in parallel. To demonstrate the SPINLONG approach, we analyzed ChIP-seq data reporting PolII, estrogen receptor α (ERα, H3K4me3 and H2A.Z occupancy at five time points in the MCF-7 breast cancer cell line after estradiol stimulus. We obtained 777 ERa early responsive genes and compared the biological functions of the genes having ERα binding within 20 kb of the transcription start site (TSS to genes without such binding site. Our results show that the non-genomic action of ERα via the MAPK pathway, instead of direct ERa binding, may be responsible for early cell responses to ERα activation. Our results also indicate that the ERα responsive genes triggered by the genomic pathway are transcribed faster than those without ERα binding sites. The survival analysis of the 777 ERα responsive genes with 150 primary breast cancer tumors and in two independent validation cohorts indicated the ATAD3B gene, which does not have ERα binding site within 20 kb of its TSS, to be significantly associated with poor patient survival.
Wang, Ronghua; Mei, Yi; Xu, Liang; Zhu, Xianwen; Wang, Yan; Guo, Jun; Liu, Liwang
2018-03-01
Heat stress (HS) causes detrimental effects on plant morphology, physiology, and biochemistry that lead to drastic reduction in plant biomass production and economic yield worldwide. To date, little is known about HS-responsive genes involved in thermotolerance mechanism in radish. In this study, a total of 6600 differentially expressed genes (DEGs) from the control and Heat24 cDNA libraries of radish were isolated by high-throughput sequencing. With Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, some genes including MAPK, DREB, ERF, AP2, GST, Hsf, and Hsp were predominantly assigned in signal transductions, metabolic pathways, and biosynthesis and abiotic stress-responsive pathways. These pathways played significant roles in reducing stress-induced damages and enhancing heat tolerance in radish. Expression patterns of 24 candidate genes were validated by reverse-transcription quantitative PCR (RT-qPCR). Based mainly on the analysis of DEGs combining with the previous miRNAs analysis, the schematic model of HS-responsive regulatory network was proposed. To counter the effects of HS, a rapid response of the plasma membrane leads to the opening of specific calcium channels and cytoskeletal reorganization, after which HS-responsive genes are activated to repair damaged proteins and ultimately facilitate further enhancement of thermotolerance in radish. These results could provide fundamental insight into the regulatory network underlying heat tolerance in radish and facilitate further genetic manipulation of thermotolerance in root vegetable crops.
Muscle Contraction Induces Acute Hydroxymethylation of the Exercise-Responsive Gene Nr4a3
DEFF Research Database (Denmark)
Pattamaprapanont, Pattarawan; Garde, Christian; Fabre, Odile
2016-01-01
stimulated over time is required to determine whether contraction-induced demethylation is preceded by changes in the hydroxymethylcytosine level. Here, we established an acute skeletal muscle contraction model to mimic the effects of acute exercise on gene expression. We used this model to investigate...... promoters. Exercise induces dynamic DNA demethylation at gene promoters; however, the contribution of the demethylation precursor hydroxymethylcytosine is unknown. Given the evanescent nature of hydroxymethylcytosine, a muscle contraction model that allows for the collection of samples that are repeatedly...... the effect of muscle contraction on DNA demethylation and hydroxymethylation. First, we performed an acute exercise study in healthy humans to identify an exercise-responsive gene that we could study in culture. We identified the nuclear receptor subfamily 4 group A member 3 (Nr4a3) gene with the highest...
Morimoto, Shimpei; Yahara, Koji
2018-03-01
Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes ( ADC17 and KIN1 ) that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning) that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after accounting for potential
Sharma, Niharika; Dang, Trang Minh; Singh, Namrata; Ruzicic, Slobodan; Mueller-Roeber, Bernd; Baumann, Ute; Heuer, Sigrid
2018-01-08
Flooding during seasonal monsoons affects millions of hectares of rice-cultivated areas across Asia. Submerged rice plants die within a week due to lack of oxygen, light and excessive elongation growth to escape the water. Submergence tolerance was first reported in an aus-type rice landrace, FR13A, and the ethylene-responsive transcription factor (TF) gene SUB1A-1 was identified as the major tolerance gene. Intolerant rice varieties generally lack the SUB1A gene but some intermediate tolerant varieties, such as IR64, carry the allelic variant SUB1A-2. Differential effects of the two alleles have so far not been addressed. As a first step, we have therefore quantified and compared the expression of nearly 2500 rice TF genes between IR64 and its derived tolerant near isogenic line IR64-Sub1, which carries the SUB1A-1 allele. Gene expression was studied in internodes, where the main difference in expression between the two alleles was previously shown. Nineteen and twenty-six TF genes were identified that responded to submergence in IR64 and IR64-Sub1, respectively. Only one gene was found to be submergence-responsive in both, suggesting different regulatory pathways under submergence in the two genotypes. These differentially expressed genes (DEGs) mainly included MYB, NAC, TIFY and Zn-finger TFs, and most genes were downregulated upon submergence. In IR64, but not in IR64-Sub1, SUB1B and SUB1C, which are also present in the Sub1 locus, were identified as submergence responsive. Four TFs were not submergence responsive but exhibited constitutive, genotype-specific differential expression. Most of the identified submergence responsive DEGs are associated with regulatory hormonal pathways, i.e. gibberellins (GA), abscisic acid (ABA), and jasmonic acid (JA), apart from ethylene. An in-silico promoter analysis of the two genotypes revealed the presence of allele-specific single nucleotide polymorphisms, giving rise to ABRE, DRE/CRT, CARE and Site II cis-elements, which
International Nuclear Information System (INIS)
Konlechner, Cornelia; Türktaş, Mine; Langer, Ingrid; Vaculík, Marek; Wenzel, Walter W.; Puschenreiter, Markus; Hauser, Marie-Theres
2013-01-01
Salix caprea is well suited for phytoextraction strategies. In a previous survey we showed that genetically distinct S. caprea plants isolated from metal-polluted and unpolluted sites differed in their zinc (Zn) and cadmium (Cd) tolerance and accumulation abilities. To determine the molecular basis of this difference we examined putative homologues of genes involved in heavy metal responses and identified over 200 new candidates with a suppression subtractive hybridization (SSH) screen. Quantitative expression analyses of 20 genes in leaves revealed that some metallothioneins and cell wall modifying genes were induced irrespective of the genotype's origin and metal uptake capacity while a cysteine biosynthesis gene was expressed constitutively higher in the metallicolous genotype. The third and largest group of genes was only induced in the metallicolous genotype. These data demonstrate that naturally adapted woody non-model species can help to discover potential novel molecular mechanisms for metal accumulation and tolerance. -- Highlights: ► The transcriptional Zn/Cd response of the willow Salix caprea was quantified. ► Two genotypes from a highly contaminated and a control environment were compared. ► In addition to candidate genes an SSH library revealed over 200 metal induced genes. ► Constitutive upregulation and isolate-specific induction of genes were revealed. ► Willows adapt to environmental Zn/Cd contamination on the transcriptional level. -- Expression analyzes reveal different responses to Cd and Zn exposure of S. caprea genotypes with different heavy metal accumulation abilities
Gil, Fátima N; Becker, Jörg D; Viegas, Cristina A
2014-06-11
Pyrimethanil is a fungicide mostly applied in vineyards. When misused, residue levels detected in grape must or in the environment may be of concern. The present work aimed to analyze mechanisms underlying response to deleterious effects of pyrimethanil in the eukaryotic model Saccharomyces cerevisiae. Pyrimethanil concentration-dependent effects at phenotypic (inhibition of growth) and transcriptomic levels were examined. For transcriptional profiling, analysis focused on two sublethal exposure conditions that inhibited yeast growth by 20% or 50% compared with control cells not exposed to the fungicide. Gene expression modifications increased with the magnitude of growth inhibition, in numbers and fold-change of differentially expressed genes and in diversity of over-represented functional categories. These included mostly biosynthesis of arginine and sulfur amino acids metabolism, as well as energy conservation, antioxidant response, and multidrug transport. Several pyrimethanil-responsive genes encoded proteins sharing significant homology with proteins from phytopathogenic fungi and ecologically relevant higher eukaryotes.
Lee, M O; Liu, Y; Zhang, X K
1995-01-01
The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...
Directory of Open Access Journals (Sweden)
Hütter Gero
2011-10-01
Full Text Available Abstract Background The natural function of the C-C chemokine receptor type 5 (CCR5 is poorly understood. A 32 base pair deletion in the CCR5 gene (CCR5-delta32 located on chromosome 3 results in a non-functional protein. It is supposed that this deletion causes an alteration in T-cell response to inflammation. For example, the presence of the CCR5-delta32 allele in recipients of allografts constitutes as an independent and protective factor associated with a decreased risk of graft-versus-host disease (GVHD and graft rejection. However, the mechanism of this beneficial effect of the deletion regarding GVHD is unknown. In this survey we searched for a CCR5-delta32 associated regulation of critical genes involved in the immune response and the development of GVHD. Methods We examined CD34+ hematopoietic progenitor cells derived from bone marrow samples from 19 healthy volunteers for the CCR5-delta32 deletion with a genomic PCR using primers flanking the site of the deletion. Results 12 individuals were found to be homozygous for CCR5 WT and 7 carried the CCR5-delta32 deletion heterozygously. Global gene expression analysis led to the identification of 11 differentially regulated genes. Six of them are connected with mechanisms of immune response and control: LRG1, CXCR2, CCRL2, CD6, CD7, WD repeat domain, and CD30L. Conclusions Our data indicate that the CCR5-delta32 mutation may be associated with differential gene expression. Some of these genes are critical for immune response, in the case of CD30L probably protective in terms of GVHD.
Savci-Heijink, Cemile Dilara; Halfwerk, Hans; Koster, Jan; van de Vijver, Marc Joan
2017-01-01
Background: To better predict the likelihood of response to chemotherapy, we have conducted a study comparing the gene expression patterns of primary tumours with their corresponding response to systemic chemotherapy in the metastatic setting. Methods: mRNA expression profiles of breast carcinomas
Sánchez Timm, Eduardo; Hidalgo Pardo, Lisette; Pacheco Coello, Ricardo; Chávez Navarrete, Tatiana; Navarrete Villegas, Oscar; Santos Ordóñez, Efrén
2016-01-01
Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession 'Calcutta-4' has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in 'Calcutta-4' might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession 'Calcutta-4'. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in 'Calcutta-4' when compared to 'Williams' after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of 'Calcutta-4' to Black Sigatoka
Directory of Open Access Journals (Sweden)
Eduardo Sánchez Timm
Full Text Available Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession 'Calcutta-4' has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in 'Calcutta-4' might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession 'Calcutta-4'. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in 'Calcutta-4' when compared to 'Williams' after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of 'Calcutta-4' to
Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H
1997-03-14
Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.
Ishibashi, Naoki; Himeno, Kohei; Masuda, Yoshimitsu; Perez, Rodney Honrada; Iwatani, Shun; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji
2014-01-01
Enterococcus faecium NKR-5-3, isolated from Thai fermented fish, is characterized by the unique ability to produce five bacteriocins, namely, enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z). Genetic analysis with a genome library revealed that the bacteriocin structural genes (enkA [ent53A], enkC [ent53C], enkD [ent53D], and enkZ [ent53Z]) that encode these peptides (except for Ent53B) are located in close proximity to each other. This NKR-5-3ACDZ (Ent53ACDZ) enterocin gene cluster (approximately 13 kb long) includes certain bacteriocin biosynthetic genes such as an ABC transporter gene (enkT), two immunity genes (enkIaz and enkIc), a response regulator (enkR), and a histidine protein kinase (enkK). Heterologous-expression studies of enkT and ΔenkT mutant strains showed that enkT is responsible for the secretion of Ent53A, Ent53C, Ent53D, and Ent53Z, suggesting that EnkT is a wide-range ABC transporter that contributes to the effective production of these bacteriocins. In addition, EnkIaz and EnkIc were found to confer self-immunity to the respective bacteriocins. Furthermore, bacteriocin induction assays performed with the ΔenkRK mutant strain showed that EnkR and EnkK are regulatory proteins responsible for bacteriocin production and that, together with Ent53D, they constitute a three-component regulatory system. Thus, the Ent53ACDZ gene cluster is essential for the biosynthesis and regulation of NKR-5-3 enterocins, and this is, to our knowledge, the first report that demonstrates the secretion of multiple bacteriocins by an ABC transporter. PMID:25149515
Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.
Directory of Open Access Journals (Sweden)
Cheng Zou
2009-07-01
Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.
Directory of Open Access Journals (Sweden)
Anastasia V. Ponasenko
2017-01-01
Full Text Available Infective endocarditis (IE is a septic inflammation of the endocardium. Recognition of microbial patterns, cytokine and acute phase responses, hemostasis features, and alterations in plasma lipid and calcium profile all have been reported to affect pathogenesis and clinical course of IE. Having recruited 123 patients with IE and 300 age-, sex-, and ethnicity-matched healthy blood donors, we profiled their genomic DNA for 35 functionally significant polymorphisms within the 22 selected genes involved in the abovementioned pathways, with the further genetic association analysis. We found that the G/A genotype of the rs1143634 polymorphism within the IL1B gene, the G/T genotype of the rs3212227 polymorphism within the IL12B gene, the A/G genotype of the rs1130864 polymorphism within the CRP gene, and the G allele of the rs1801197 polymorphism within the CALCR gene were associated with a decreased risk of IE whereas the T/T genotype of the rs1205 polymorphism within the CRP gene was associated with a higher risk of IE. Furthermore, heterozygous genotypes of the rs1143634 and rs3212227 polymorphisms were associated with the higher plasma levels of IL-1β and IL-12, respectively. Our results indicate that inherited variation in the cytokine, acute phase response, and calcium metabolism pathways may be linked to IE.
Rutkovskaya, Natalia V.; Kondyukova, Natalia V.; Odarenko, Yuri N.; Kazachek, Yana V.; Tsepokina, Anna V.; Barbarash, Leonid S.
2017-01-01
Infective endocarditis (IE) is a septic inflammation of the endocardium. Recognition of microbial patterns, cytokine and acute phase responses, hemostasis features, and alterations in plasma lipid and calcium profile all have been reported to affect pathogenesis and clinical course of IE. Having recruited 123 patients with IE and 300 age-, sex-, and ethnicity-matched healthy blood donors, we profiled their genomic DNA for 35 functionally significant polymorphisms within the 22 selected genes involved in the abovementioned pathways, with the further genetic association analysis. We found that the G/A genotype of the rs1143634 polymorphism within the IL1B gene, the G/T genotype of the rs3212227 polymorphism within the IL12B gene, the A/G genotype of the rs1130864 polymorphism within the CRP gene, and the G allele of the rs1801197 polymorphism within the CALCR gene were associated with a decreased risk of IE whereas the T/T genotype of the rs1205 polymorphism within the CRP gene was associated with a higher risk of IE. Furthermore, heterozygous genotypes of the rs1143634 and rs3212227 polymorphisms were associated with the higher plasma levels of IL-1β and IL-12, respectively. Our results indicate that inherited variation in the cytokine, acute phase response, and calcium metabolism pathways may be linked to IE. PMID:28659664
Hassan, Saima; Esch, Amanda; Liby, Tiera; Gray, Joe W; Heiser, Laura M
2017-12-01
Effective treatment of patients with triple-negative (ER-negative, PR-negative, HER2-negative) breast cancer remains a challenge. Although PARP inhibitors are being evaluated in clinical trials, biomarkers are needed to identify patients who will most benefit from anti-PARP therapy. We determined the responses of three PARP inhibitors (veliparib, olaparib, and talazoparib) in a panel of eight triple-negative breast cancer cell lines. Therapeutic responses and cellular phenotypes were elucidated using high-content imaging and quantitative immunofluorescence to assess markers of DNA damage (53BP1) and apoptosis (cleaved PARP). We determined the pharmacodynamic changes as percentage of cells positive for 53BP1, mean number of 53BP1 foci per cell, and percentage of cells positive for cleaved PARP. Inspired by traditional dose-response measures of cell viability, an EC 50 value was calculated for each cellular phenotype and each PARP inhibitor. The EC 50 values for both 53BP1 metrics strongly correlated with IC 50 values for each PARP inhibitor. Pathway enrichment analysis identified a set of DNA repair and cell cycle-associated genes that were associated with 53BP1 response following PARP inhibition. The overall accuracy of our 63 gene set in predicting response to olaparib in seven breast cancer patient-derived xenograft tumors was 86%. In triple-negative breast cancer patients who had not received anti-PARP therapy, the predicted response rate of our gene signature was 45%. These results indicate that 53BP1 is a biomarker of response to anti-PARP therapy in the laboratory, and our DNA damage response gene signature may be used to identify patients who are most likely to respond to PARP inhibition. Mol Cancer Ther; 16(12); 2892-901. ©2017 AACR . ©2017 American Association for Cancer Research.
Directory of Open Access Journals (Sweden)
Wei Xu
2016-06-01
Full Text Available Plant-specific GRAS transcription factors play important roles in regulating growth, development, and stress responses. Castor beans (Ricinus communis are important non-edible oilseed plants, cultivated worldwide for its seed oils and its adaptability to growth conditions. In this study, we identified and characterized a total of 48 GRAS genes based on the castor bean genome. Combined with phylogenetic analysis, the castor bean GRAS members were divided into 13 distinct groups. Functional divergence analysis revealed the presence of mostly Type-I functional divergence. The gene structures and conserved motifs, both within and outside the GRAS domain, were characterized. Gene expression analysis, performed in various tissues and under a range of abiotic stress conditions, uncovered the potential functions of GRAS members in regulating plant growth development and stress responses. The results obtained from this study provide valuable information toward understanding the potential molecular mechanisms of GRAS proteins in castor beans. These findings also serve as a resource for identifying the genes that allow castor beans to grow in stressful conditions and to enable further breeding and genetic improvements in agriculture.
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
Directory of Open Access Journals (Sweden)
Benli Chai
Full Text Available Sphingomonas wittichii strain RW1 (RW1 is one of the few strains that can grow on dibenzo-p-dioxin (DD. We conducted a transcriptomic study of RW1 using RNA-Seq to outline transcriptional responses to DD, dibenzofuran (DF, and the smectite clay mineral saponite with succinate as carbon source. The ability to grow on DD is rare compared to growth on the chemically similar DF even though the same initial dioxygenase may be involved in oxidation of both substrates. Therefore, we hypothesized the reason for this lies beyond catabolic pathways and may concern genes involved in processes for cell-substrate interactions such as substrate recognition, transport, and detoxification. Compared to succinate (SUC as control carbon source, DF caused over 240 protein-coding genes to be differentially expressed, whereas more than 300 were differentially expressed with DD. Stress response genes were up-regulated in response to both DD and DF. This effect was stronger with DD than DF, suggesting a higher toxicity of DD compared to DF. Both DD and DF caused changes in expression of genes involved in active cross-membrane transport such as TonB-dependent receptor proteins, but the patterns of change differed between the two substrates. Multiple transcription factor genes also displayed expression patterns distinct to DD and DF growth. DD and DF induced the catechol ortho- and the salicylate/gentisate pathways, respectively. Both DD and DF induced the shared down-stream aliphatic intermediate compound pathway. Clay caused category-wide down-regulation of genes for cell motility and chemotaxis, particularly those involved in the synthesis, assembly and functioning of flagella. This is an environmentally important finding because clay is a major component of soil microbes' microenvironment influencing local chemistry and may serve as a geosorbent for toxic pollutants. Similar to clay, DD and DF also affected expression of genes involved in motility and chemotaxis.
Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought
Directory of Open Access Journals (Sweden)
Pei eXu
2015-10-01
Full Text Available Asparagus bean (Vigna unguiculata ssp. sesquipedalis is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS. Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding.
Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought
Xu, Pei; Moshelion, Menachem; Wu, XiaoHua; Halperin, Ofer; Wang, BaoGen; Luo, Jie; Wallach, Rony; Wu, Xinyi; Lu, Zhongfu; Li, Guojing
2015-01-01
Asparagus bean (Vigna unguiculata ssp. sesquipedalis) is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS). Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between different genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding. PMID:26579145
Mazzoni, C; Santori, F; Saliola, M; Falcone, C
2000-01-01
KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.
An auxin responsive CLE gene regulates shoot apical meristem development in Arabidopsis
Directory of Open Access Journals (Sweden)
Hongyan eGuo
2015-05-01
Full Text Available Plant hormone auxin regulates most, if not all aspects of plant growth and development, including lateral root formation, organ pattering, apical dominance and tropisms. Peptide hormones are peptides with hormone activities. Some of the functions of peptide hormones in regulating plant growth and development are similar to that of auxin, however, the relationship between auxin and peptide hormones remains largely unknown. Here we report the identification of OsCLE48, a rice (Oryza sativa CLE (CLAVATA3/ENDOSPERM SURROUNDING REGION gene, as an auxin response gene, and the functional characterization of OsCLE48 in Arabidopsis and rice. OsCLE48 encodes a CLE peptide hormone that is similar to Arabidopsis CLEs. RT-PCR analysis showed that OsCLE48 was induced by exogenously application of IAA (indole-3-acetic acid, a naturally occurred auxin. Expression of integrated OsCLE48p:GUS reporter gene in transgenic Arabidopsis plants was also induced by exogenously IAA treatment. These results indicate that OsCLE48 is an auxin responsive gene. Histochemical staining showed that GUS activity was detected in all the tissue and organs of the OsCLE48p:GUS transgenic Arabidopsis plants. Expression of OsCLE48 under the control of the 35S promoter in Arabidopsis inhibited shoot apical meristem development. Expression of OsCLE48 under the control of the CLV3 native regulatory elements almost completely complemented clv3-2 mutant phenotypes, suggesting that OsCLE48 is functionally similar to CLV3. On the other hand, expression of OsCLE48 under the control of the 35S promoter in Arabidopsis has little, if any effects on root apical meristem development, and transgenic rice plants overexpressing OsCLE48 are morphologically indistinguishable from wild type plants, suggesting that the functions of some CLE peptides may not be fully conserved in Arabidopsis and rice.
Differential response of two somatolactin genes to zinc or estrogen in pituitary of Cyprinus carpio.
Valenzuela, G E; Perez, A; Navarro, M; Romero, A; Figueroa, J; Kausel, G
2015-05-01
Environmental changes affect gene expression that we addressed in the pituitary, a central regulatory organ at the interface between the central nervous system and the endocrine system. With the aim to reveal effects of changes in the aquatic environment on the expression of hypothalamo-hypophyseal factors, we characterized somatolactin (SL) in Cyprinus carpio. SL, a fish specific pituitary hormone belonging to the prolactin (PRL) superfamily, is involved in background adaptation, osmoregulation, reproduction and fatty acid metabolism. Two sl genes, α and β, were discovered in carp and transcripts of both were detected in pituitaries. Clearly, expression of slα and slβ was modulated significantly in pituitary of male adult carp in response to treatment with ZnCl2 (Zn), but only slβ responded to 17β-estrogen (E2), relative to control carp as shown by RT-qPCR analyses. Furthermore, the amount of mRNA of related factors was assessed revealing variable effects on prl, growth hormone (gh), and factors involved in sl regulation: the pituitary transcription factor pit1 and hypothalamic pituitary adenylase cyclase activating peptide (pacap). In parallel, the physiological response of the experimental animals to Zn or E2 was confirmed by showing a significant increase of metallothionein (mt) or vitellogenin (vg) gene expression in liver, classical sentinels for exposure to heavy metal or estrogens. These data suggest that the sl genes seem to be involved in the response to Zn, as well as to estrogen, and could contribute to evaluate biological relevant changes in the aquatic environment. Copyright © 2014 Elsevier Inc. All rights reserved.
Global gene expression response to telomerase in bovine adrenocortical cells
International Nuclear Information System (INIS)
Perrault, Steven D.; Hornsby, Peter J.; Betts, Dean H.
2005-01-01
The infinite proliferative capability of most immortalized cells is dependent upon the presence of the enzyme telomerase and its ability to maintain telomere length and structure. However, telomerase may be involved in a greater system than telomere length regulation, as recent evidence has shown it capable of increasing wound healing in vivo, and improving cellular proliferation rate and survival from apoptosis in vitro. Here, we describe the global gene expression response to ectopic telomerase expression in an in vitro bovine adrenocortical cell model. Telomerase-immortalized cells showed an increased ability for proliferation and survival in minimal essential medium above cells transgenic for GFP. cDNA microarray analyses revealed an altered cell state indicative of increased adrenocortical cell proliferation regulated by the IGF2 pathway and alterations in members of the TGF-B family. As well, we identified alterations in genes associated with development and wound healing that support a model that high telomerase expression induces a highly adaptable, progenitor-like state
Zhang, Jinfeng; Zhao, Wenjuan; Fu, Rong; Fu, Chenglin; Wang, Lingxia; Liu, Huainian; Li, Shuangcheng; Deng, Qiming; Wang, Shiquan; Zhu, Jun; Liang, Yueyang; Li, Ping; Zheng, Aiping
2018-05-05
Rhizoctonia solani causes rice sheath blight, an important disease affecting the growth of rice (Oryza sativa L.). Attempts to control the disease have met with little success. Based on transcriptional profiling, we previously identified more than 11,947 common differentially expressed genes (TPM > 10) between the rice genotypes TeQing and Lemont. In the current study, we extended these findings by focusing on an analysis of gene co-expression in response to R. solani AG1 IA and identified gene modules within the networks through weighted gene co-expression network analysis (WGCNA). We compared the different genes assigned to each module and the biological interpretations of gene co-expression networks at early and later modules in the two rice genotypes to reveal differential responses to AG1 IA. Our results show that different changes occurred in the two rice genotypes and that the modules in the two groups contain a number of candidate genes possibly involved in pathogenesis, such as the VQ protein. Furthermore, these gene co-expression networks provide comprehensive transcriptional information regarding gene expression in rice in response to AG1 IA. The co-expression networks derived from our data offer ideas for follow-up experimentation that will help advance our understanding of the translational regulation of rice gene expression changes in response to AG1 IA.
Directory of Open Access Journals (Sweden)
Pablo Palma
Full Text Available Preoperative chemoradiation significantly improves oncological outcome in locally advanced rectal cancer. However there is no effective method of predicting tumor response to chemoradiation in these patients. Peripheral blood mononuclear cells have emerged recently as pathology markers of cancer and other diseases, making possible their use as therapy predictors. Furthermore, the importance of the immune response in radiosensivity of solid organs led us to hypothesized that microarray gene expression profiling of peripheral blood mononuclear cells could identify patients with response to chemoradiation in rectal cancer. Thirty five 35 patients with locally advanced rectal cancer were recruited initially to perform the study. Peripheral blood samples were obtained before neaodjuvant treatment. RNA was extracted and purified to obtain cDNA and cRNA for hybridization of microarrays included in Human WG CodeLink bioarrays. Quantitative real time PCR was used to validate microarray experiment data. Results were correlated with pathological response, according to Mandard´s criteria and final UICC Stage (patients with tumor regression grade 1-2 and downstaging being defined as responders and patients with grade 3-5 and no downstaging as non-responders. Twenty seven out of 35 patients were finally included in the study. We performed a multiple t-test using Significance Analysis of Microarrays, to find those genes differing significantly in expression, between responders (n = 11 and non-responders (n = 16 to CRT. The differently expressed genes were: BC 035656.1, CIR, PRDM2, CAPG, FALZ, HLA-DPB2, NUPL2, and ZFP36. The measurement of FALZ (p = 0.029 gene expression level determined by qRT-PCR, showed statistically significant differences between the two groups. Gene expression profiling reveals novel genes in peripheral blood samples of mononuclear cells that could predict responders and non-responders to chemoradiation in patients with
Directory of Open Access Journals (Sweden)
José A G Agúndez
Full Text Available UNLABELLED: Non-steroidal anti-inflammatory drugs (NSAIDs are the drugs most frequently involved in hypersensitivity drug reactions. Histamine is released in the allergic response to NSAIDs and is responsible for some of the clinical symptoms. The aim of this study is to analyze clinical association of functional polymorphisms in the genes coding for enzymes involved in histamine homeostasis with hypersensitivity response to NSAIDs. We studied a cohort of 442 unrelated Caucasian patients with hypersensitivity to NSAIDs. Patients who experienced three or more episodes with two or more different NSAIDs were included. If this requirement was not met diagnosis was established by challenge. A total of 414 healthy unrelated controls ethnically matched with patients and from the same geographic area were recruited. Analyses of the SNPs rs17740607, rs2073440, rs1801105, rs2052129, rs10156191, rs1049742 and rs1049793 in the HDC, HNMT and DAO genes were carried out by means of TaqMan assays. The detrimental DAO 16 Met allele (rs10156191, which causes decreased metabolic capacity, is overrepresented among patients with crossed-hypersensitivity to NSAIDs with an OR = 1.7 (95% CI = 1.3-2.1; Pc = 0.0003 with a gene-dose effect (P = 0.0001. The association was replicated in two populations from different geographic areas (Pc = 0.008 and Pc = 0.004, respectively. CONCLUSIONS AND IMPLICATIONS: The DAO polymorphism rs10156191 which causes impaired metabolism of circulating histamine is associated with the clinical response in crossed-hypersensitivity to NSAIDs and could be used as a biomarker of response.
Plant responses to environmental stress: regulation and functions of the Arabidopsis TCH genes
Braam, J.; Sistrunk, M. L.; Polisensky, D. H.; Xu, W.; Purugganan, M. M.; Antosiewicz, D. M.; Campbell, P.; Johnson, K. A.; McIntire, L. V. (Principal Investigator)
1997-01-01
Expression of the Arabidopsis TCH genes is markedly upregulated in response to a variety of environmental stimuli including the seemingly innocuous stimulus of touch. Understanding the mechanism(s) and factors that control TCH gene regulation will shed light on the signaling pathways that enable plants to respond to environmental conditions. The TCH proteins include calmodulin, calmodulin-related proteins and a xyloglucan endotransglycosylase. Expression analyses and localization of protein accumulation indicates that the potential sites of TCH protein function include expanding cells and tissues under mechanical strain. We hypothesize that at least a subset of the TCH proteins may collaborate in cell wall biogenesis.
Directory of Open Access Journals (Sweden)
Markus Müller
Full Text Available Despite the ecological and economic importance of European beech (Fagus sylvatica L. genomic resources of this species are still limited. This hampers an understanding of the molecular basis of adaptation to stress. Since beech will most likely be threatened by the consequences of climate change, an understanding of adaptive processes to climate change-related drought stress is of major importance. Here, we used RNA-seq to provide the first drought stress-related transcriptome of beech. In a drought stress trial with beech saplings, 50 samples were taken for RNA extraction at five points in time during a soil desiccation experiment. De novo transcriptome assembly and analysis of differential gene expression revealed 44,335 contigs, and 662 differentially expressed genes between the stress and normally watered control group. Gene expression was specific to the different time points, and only five genes were significantly differentially expressed between the stress and control group on all five sampling days. GO term enrichment showed that mostly genes involved in lipid- and homeostasis-related processes were upregulated, whereas genes involved in oxidative stress response were downregulated in the stressed seedlings. This study gives first insights into the genomic drought stress response of European beech, and provides new genetic resources for adaptation research in this species.
Breitling, R.; Armengaud, P.; Amtmann, A.
2005-01-01
Background Gene expression studies increasingly compare expression responses between different experimental backgrounds (genetic, physiological, or phylogenetic). By focusing on dynamic responses rather than a direct comparison of static expression levels, this type of study allows a finer
Directory of Open Access Journals (Sweden)
Hao-li MA
2010-03-01
Full Text Available Ethylene response factors (ERFs play important roles in response to plant biotic and abiotic stresses. In this study, a gene encoding a putative AP2/ERF domain-containing protein was isolated by screening a SSH cDNA library from rice and designated as Oryza sativa AP2/ERF-like protein (OsAP2LP gene. OsAP2LP is 1491 bp in length, interrupted by seven introns, and encodes a putative protein of 348 amino acids. Temporal and spatial expression analysis showed that the OsAP2LP gene was preferentially expressed in roots, panicles, mature embryos and seeds in rice. Real-time quantitative PCR analysis indicated that the expression levels of the OsAP2LP gene were increased under the treatments of drought and gibberellin but decreased under the treatments of low temperature, salt, abscisic acid (ABA and zeatin. Taken together, these results suggest that OsAP2LP might be involved in stress responses, and probably plays roles as a transcription regulator when plants response to cold, salt and drought stresses through ABA and gibberellin pathways.
DEFF Research Database (Denmark)
Olsen, Helle G; Skovgaard, Kerstin; Nielsen, Ole L
2013-01-01
Serum amyloid A (SAA) is a prominent acute phase protein. Although its biological functions are debated, the wide species distribution of highly homologous SAA proteins and their uniform behavior in response to injury or inflammation in itself suggests a significant role for this protein. The pig...... is increasingly being used as a model for the study of inflammatory reactions, yet only little is known about how specific SAA genes are regulated in the pig during acute phase responses and other responses induced by pro-inflammatory host mediators. We designed SAA gene specific primers and quantified the gene...... expression of porcine SAA1, SAA2, SAA3, and SAA4 by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) in liver, spleen, and lung tissue from pigs experimentally infected with the Gram-negative swine specific bacterium Actinobacillus pleuropneumoniae, as well as from pigs experimentally...
Directory of Open Access Journals (Sweden)
Ying Dong
2014-10-01
Full Text Available The sea cucumber (Apostichopus japonicus occupies a basal position during the evolution of deuterostomes and is also an important aquaculture species. In order to identify more immune effectors, transcriptome sequencing of A. japonicus coelomocytes in response to lipopolysaccharide (LPS challenge was performed using the Illumina HiSeq™ 2000 platform. One hundred and seven differentially expressed genes were selected and divided into four functional categories including pathogen recognition (25 genes, reorganization of cytoskeleton (27 genes, inflammation (41 genes and apoptosis (14 genes. They were analyzed to elucidate the mechanisms of host-pathogen interactions and downstream signaling transduction. Quantitative real-time polymerase chain reactions (qRT-PCRs of 10 representative genes validated the accuracy and reliability of RNA sequencing results with the correlation coefficients from 0.88 to 0.98 and p-value <0.05. Expression analysis of immune-related genes after LPS challenge will be useful in understanding the immune response mechanisms of A. japonicus against pathogen invasion and developing strategies for resistant markers selection.
Malmendal, Anders; Sørensen, Jesper Givskov; Overgaard, Johannes; Holmstrup, Martin; Nielsen, Niels Chr.; Loeschcke, Volker
2013-05-01
We investigated the global metabolite response to artificial selection for tolerance to stressful conditions such as cold, heat, starvation, and desiccation, and for longevity in Drosophila melanogaster. Our findings were compared to data from other levels of biological organization, including gene expression, physiological traits, and organismal stress tolerance phenotype. Overall, we found that selection for environmental stress tolerance changes the metabolomic 1H NMR fingerprint largely in a similar manner independent of the trait selected for, indicating that experimental evolution led to a general stress selection response at the metabolomic level. Integrative analyses across data sets showed little similarity when general correlations between selection effects at the level of the metabolome and gene expression were compared. This is likely due to the fact that the changes caused by these selection regimes were rather mild and/or that the dominating determinants for gene expression and metabolite levels were different. However, expression of a number of genes was correlated with the metabolite data. Many of the identified genes were general stress response genes that are down-regulated in response to selection for some of the stresses in this study. Overall, the results illustrate that selection markedly alters the metabolite profile and that the coupling between different levels of biological organization indeed is present though not very strong for stress selection at this level. The results highlight the extreme complexity of environmental stress adaptation and the difficulty of extrapolating and interpreting responses across levels of biological organization.
Syed, Naeem H; Prince, Silvas J; Mutava, Raymond N; Patil, Gunvant; Li, Song; Chen, Wei; Babu, Valliyodan; Joshi, Trupti; Khan, Saad; Nguyen, Henry T
2015-12-01
Circadian clocks are a great evolutionary innovation and provide competitive advantage during the day/night cycle and under changing environmental conditions. The circadian clock mediates expression of a large proportion of genes in plants, achieving a harmonious relationship between energy metabolism, photosynthesis, and biotic and abiotic stress responses. Here it is shown that multiple paralogues of clock genes are present in soybean (Glycine max) and mediate flooding and drought responses. Differential expression of many clock and SUB1 genes was found under flooding and drought conditions. Furthermore, natural variation in the amplitude and phase shifts in PRR7 and TOC1 genes was also discovered under drought and flooding conditions, respectively. PRR3 exhibited flooding- and drought-specific splicing patterns and may work in concert with PRR7 and TOC1 to achieve energy homeostasis under flooding and drought conditions. Higher expression of TOC1 also coincides with elevated levels of abscisic acid (ABA) and variation in glucose levels in the morning and afternoon, indicating that this response to abiotic stress is mediated by ABA, endogenous sugar levels, and the circadian clock to fine-tune photosynthesis and energy utilization under stress conditions. It is proposed that the presence of multiple clock gene paralogues with variation in DNA sequence, phase, and period could be used to screen exotic germplasm to find sources for drought and flooding tolerance. Furthermore, fine tuning of multiple clock gene paralogues (via a genetic engineering approach) should also facilitate the development of flooding- and drought-tolerant soybean varieties. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
M.C. Barros Filho
2010-12-01
Full Text Available In breast cancer patients submitted to neoadjuvant chemotherapy (4 cycles of doxorubicin and cyclophosphamide, AC, expression of groups of three genes (gene trio signatures could distinguish responsive from non-responsive tumors, as demonstrated by cDNA microarray profiling in a previous study by our group. In the current study, we determined if the expression of the same genes would retain the predictive strength, when analyzed by a more accessible technique (real-time RT-PCR. We evaluated 28 samples already analyzed by cDNA microarray, as a technical validation procedure, and 14 tumors, as an independent biological validation set. All patients received neoadjuvant chemotherapy (4 AC. Among five trio combinations previously identified, defined by nine genes individually investigated (BZRP, CLPTM1,MTSS1, NOTCH1, NUP210, PRSS11, RPL37A, SMYD2, and XLHSRF-1, the most accurate were established by RPL37A, XLHSRF-1based trios, with NOTCH1 or NUP210. Both trios correctly separated 86% of tumors (87% sensitivity and 80% specificity for predicting response, according to their response to chemotherapy (82% in a leave-one-out cross-validation method. Using the pre-established features obtained by linear discriminant analysis, 71% samples from the biological validation set were also correctly classified by both trios (72% sensitivity; 66% specificity. Furthermore, we explored other gene combinations to achieve a higher accuracy in the technical validation group (as a training set. A new trio, MTSS1, RPL37 and SMYD2, correctly classified 93% of samples from the technical validation group (95% sensitivity and 80% specificity; 86% accuracy by the cross-validation method and 79% from the biological validation group (72% sensitivity and 100% specificity. Therefore, the combined expression of MTSS1, RPL37 and SMYD2, as evaluated by real-time RT-PCR, is a potential candidate to predict response to neoadjuvant doxorubicin and cyclophosphamide in breast cancer
Energy Technology Data Exchange (ETDEWEB)
Last, Jerold A [Pulmonary and Critical Care Medicine, School of Medicine, Toxic Substances Program, 1131 Surge I, University of California, Davis, CA 95616-8723 (United States); Gohil, Kishorchandra [Pulmonary and Critical Care Medicine, School of Medicine, Toxic Substances Program, 1131 Surge I, University of California, Davis, CA 95616-8723 (United States); Mathrani, Vivek C [Pulmonary and Critical Care Medicine, School of Medicine, Toxic Substances Program, 1131 Surge I, University of California, Davis, CA 95616-8723 (United States); Kenyon, Nicholas J [Pulmonary and Critical Care Medicine, School of Medicine, Toxic Substances Program, 1131 Surge I, University of California, Davis, CA 95616-8723 (United States)
2005-10-15
Rats or mice acutely exposed to high concentrations of ozone show an immediate and significant weight loss, even when allowed free access to food and water. The mechanisms underlying this systemic response to ozone have not been previously elucidated. We have applied the technique of global gene expression analysis to the livers of C57BL mice acutely exposed to ozone. Mice lost up to 14% of their original body weight, with a 42% decrease in total food consumption. We previously had found significant up-regulation of genes encoding proliferative enzymes, proteins related to acute phase reactions and cytoskeletal functions, and other biomarkers of a cachexia-like inflammatory state in lungs of mice exposed to ozone. These results are consistent with a general up-regulation of different gene families responsive to NF-{kappa}B in the lungs of the exposed mice. In the present study, we observed significant down-regulation of different families of mRNAs in the livers of the exposed mice, including genes related to lipid and fatty acid metabolism, and to carbohydrate metabolism in this tissue, consistent with a systemic cachexic response. Several interferon-dependent genes were down-regulated in the liver, suggesting a possible role for interferon as a signaling molecule between lung and liver. In addition, transcription of several mRNAs encoding enzymes of xenobiotic metabolism in the livers of mice exposed to ozone was decreased, suggesting cytokine-mediated suppression of cytochrome P450 expression. This finding may explain a previously controversial report from other investigators more than 20 years ago of prolongation of pentobarbital sleeping time in mice exposed to ozone.
International Nuclear Information System (INIS)
Last, Jerold A.; Gohil, Kishorchandra; Mathrani, Vivek C.; Kenyon, Nicholas J.
2005-01-01
Rats or mice acutely exposed to high concentrations of ozone show an immediate and significant weight loss, even when allowed free access to food and water. The mechanisms underlying this systemic response to ozone have not been previously elucidated. We have applied the technique of global gene expression analysis to the livers of C57BL mice acutely exposed to ozone. Mice lost up to 14% of their original body weight, with a 42% decrease in total food consumption. We previously had found significant up-regulation of genes encoding proliferative enzymes, proteins related to acute phase reactions and cytoskeletal functions, and other biomarkers of a cachexia-like inflammatory state in lungs of mice exposed to ozone. These results are consistent with a general up-regulation of different gene families responsive to NF-κB in the lungs of the exposed mice. In the present study, we observed significant down-regulation of different families of mRNAs in the livers of the exposed mice, including genes related to lipid and fatty acid metabolism, and to carbohydrate metabolism in this tissue, consistent with a systemic cachexic response. Several interferon-dependent genes were down-regulated in the liver, suggesting a possible role for interferon as a signaling molecule between lung and liver. In addition, transcription of several mRNAs encoding enzymes of xenobiotic metabolism in the livers of mice exposed to ozone was decreased, suggesting cytokine-mediated suppression of cytochrome P450 expression. This finding may explain a previously controversial report from other investigators more than 20 years ago of prolongation of pentobarbital sleeping time in mice exposed to ozone
Zago, Elisa; Morsa, Stijn; Dat, James F.; Alard, Philippe; Ferrarini, Alberto; Inzé, Dirk; Delledonne, Massimo; Van Breusegem, Frank
2006-01-01
Nitric oxide (NO) and hydrogen peroxide (H2O2) are regulatory molecules in various developmental processes and stress responses. Tobacco (Nicotiana tabacum) leaves exposed to moderate high light dramatically potentiated NO-mediated cell death in catalase-deficient (CAT1AS) but not in wild-type plants, providing genetic evidence for a partnership between NO and H2O2 during the induction of programmed cell death. With this experimental model system, the specific impact on gene expression was characterized by either NO or H2O2 alone or both molecules combined. By means of genome-wide cDNA-amplified fragment length polymorphism analysis, transcriptional changes were compared in high light-treated CAT1AS and wild-type leaves treated with or without the NO donor sodium nitroprusside. Differential gene expression was detected for 214 of the approximately 8,000 transcript fragments examined. For 108 fragments, sequence analysis revealed homology to genes with a role in signal transduction, defense response, hormone interplay, proteolysis, transport, and metabolism. Surprisingly, only 16 genes were specifically induced by the combined action of NO and H2O2, whereas the majority were regulated by either of them alone. At least seven transcription factors were mutually up-regulated, indicating significant overlap between NO and H2O2 signaling pathways. These results consolidate significant cross-talk between NO and H2O2, provide new insight into the early transcriptional response of plants to increased NO and H2O2 levels, and identify target genes of the combined action of NO and H2O2 during the induction of plant cell death. PMID:16603664
Kim, Bung-Nyun; Kim, Jae-Won; Cummins, Tarrant D R; Bellgrove, Mark A; Hawi, Ziarih; Hong, Soon-Beom; Yang, Young-Hui; Kim, Hyo-Jin; Shin, Min-Sup; Cho, Soo-Churl; Kim, Ji-Hoon; Son, Jung-Woo; Shin, Yun-Mi; Chung, Un-Sun; Han, Doug-Hyun
2013-06-01
Noradrenergic dysfunction may be associated with cognitive impairments in attention-deficit/hyperactivity disorder (ADHD), including increased response time variability, which has been proposed as a leading endophenotype for ADHD. The aim of this study was to examine the relationship between polymorphisms in the α-2A-adrenergic receptor (ADRA2A) and norepinephrine transporter (SLC6A2) genes and attentional performance in ADHD children before and after pharmacological treatment.One hundred one medication-naive ADHD children were included. All subjects were administered methylphenidate (MPH)-OROS for 12 weeks. The subjects underwent a computerized comprehensive attention test to measure the response time variability at baseline before MPH treatment and after 12 weeks. Additive regression analyses controlling for ADHD symptom severity, age, sex, IQ, and final dose of MPH examined the association between response time variability on the comprehensive attention test measures and allelic variations in single-nucleotide polymorphisms of the ADRA2A and SLC6A2 before and after MPH treatment.Increasing possession of an A allele at the G1287A polymorphism of SLC6A2 was significantly related to heightened response time variability at baseline in the sustained (P = 2.0 × 10) and auditory selective attention (P = 1.0 × 10) tasks. Response time variability at baseline increased additively with possession of the T allele at the DraI polymorphism of the ADRA2A gene in the auditory selective attention task (P = 2.0 × 10). After medication, increasing possession of a G allele at the MspI polymorphism of the ADRA2A gene was associated with increased MPH-related change in response time variability in the flanker task (P = 1.0 × 10).Our study suggested an association between norepinephrine gene variants and response time variability measured at baseline and after MPH treatment in children with ADHD. Our results add to a growing body of evidence, suggesting that response time
Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B
1995-01-01
Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.
Directory of Open Access Journals (Sweden)
Clara Pons
Full Text Available Peach fruits subjected for long periods of cold storage are primed to develop chilling injury once fruits are shelf ripened at room temperature. Very little is known about the molecular changes occurring in fruits during cold exposure. To get some insight into this process a transcript profiling analyses was performed on fruits from a PopDG population segregating for chilling injury CI responses. A bulked segregant gene expression analysis based on groups of fruits showing extreme CI responses indicated that the transcriptome of peach fruits was modified already during cold storage consistently with eventual CI development. Most peach cold-responsive genes have orthologs in Arabidopsis that participate in cold acclimation and other stresses responses, while some of them showed expression patterns that differs in fruits according to their susceptibility to develop mealiness. Members of ICE1, CBF1/3 and HOS9 regulons seem to have a prominent role in differential cold responses between low and high sensitive fruits. In high sensitive fruits, an alternative cold response program is detected. This program is probably associated with dehydration/osmotic stress and regulated by ABA, auxins and ethylene. In addition, the observation that tolerant siblings showed a series of genes encoding for stress protective activities with higher expression both at harvest and during cold treatment, suggests that preprogrammed mechanisms could shape fruit ability to tolerate postharvest cold-induced stress. A number of genes differentially expressed were validated and extended to individual genotypes by medium-throughput RT-qPCR. Analyses presented here provide a global view of the responses of peach fruits to cold storage and highlights new peach genes that probably play important roles in the tolerance/sensitivity to cold storage. Our results provide a roadmap for further experiments and would help to develop new postharvest protocols and gene directed breeding
Pons, Clara; Martí, Cristina; Forment, Javier; Crisosto, Carlos H; Dandekar, Abhaya M; Granell, Antonio
2014-01-01
Peach fruits subjected for long periods of cold storage are primed to develop chilling injury once fruits are shelf ripened at room temperature. Very little is known about the molecular changes occurring in fruits during cold exposure. To get some insight into this process a transcript profiling analyses was performed on fruits from a PopDG population segregating for chilling injury CI responses. A bulked segregant gene expression analysis based on groups of fruits showing extreme CI responses indicated that the transcriptome of peach fruits was modified already during cold storage consistently with eventual CI development. Most peach cold-responsive genes have orthologs in Arabidopsis that participate in cold acclimation and other stresses responses, while some of them showed expression patterns that differs in fruits according to their susceptibility to develop mealiness. Members of ICE1, CBF1/3 and HOS9 regulons seem to have a prominent role in differential cold responses between low and high sensitive fruits. In high sensitive fruits, an alternative cold response program is detected. This program is probably associated with dehydration/osmotic stress and regulated by ABA, auxins and ethylene. In addition, the observation that tolerant siblings showed a series of genes encoding for stress protective activities with higher expression both at harvest and during cold treatment, suggests that preprogrammed mechanisms could shape fruit ability to tolerate postharvest cold-induced stress. A number of genes differentially expressed were validated and extended to individual genotypes by medium-throughput RT-qPCR. Analyses presented here provide a global view of the responses of peach fruits to cold storage and highlights new peach genes that probably play important roles in the tolerance/sensitivity to cold storage. Our results provide a roadmap for further experiments and would help to develop new postharvest protocols and gene directed breeding strategies to better
Transcriptional feedback regulation of YUCCA genes in response to auxin levels in Arabidopsis.
Suzuki, Masashi; Yamazaki, Chiaki; Mitsui, Marie; Kakei, Yusuke; Mitani, Yuka; Nakamura, Ayako; Ishii, Takahiro; Soeno, Kazuo; Shimada, Yukihisa
2015-08-01
The IPyA pathway, the major auxin biosynthesis pathway, is transcriptionally regulated through a negative feedback mechanism in response to active auxin levels. The phytohormone auxin plays an important role in plant growth and development, and levels of active free auxin are determined by biosynthesis, conjugation, and polar transport. Unlike conjugation and polar transport, little is known regarding the regulatory mechanism of auxin biosynthesis. We discovered that expression of genes encoding indole-3-pyruvic acid (IPyA) pathway enzymes is regulated by elevated or reduced active auxin levels. Expression levels of TAR2, YUC1, YUC2, YUC4, and YUC6 were downregulated in response to synthetic auxins [1-naphthaleneacetic acid (NAA) and 2,4-dichlorophenoxyacetic acid (2,4-D)] exogenously applied to Arabidopsis thaliana L. seedlings. Concomitantly, reduced levels of endogenous indole-3-acetic acid (IAA) were observed. Alternatively, expression of these YUCCA genes was upregulated by the auxin biosynthetic inhibitor kynurenine in Arabidopsis seedlings, accompanied by reduced IAA levels. These results indicate that expression of YUCCA genes is regulated by active auxin levels. Similar results were also observed in auxin-overproduction and auxin-deficient mutants. Exogenous application of IPyA to Arabidopsis seedlings preincubated with kynurenine increased endogenous IAA levels, while preincubation with 2,4-D reduced endogenous IAA levels compared to seedlings exposed only to IPyA. These results suggest that in vivo conversion of IPyA to IAA was enhanced under reduced auxin levels, while IPyA to IAA conversion was depressed in the presence of excess auxin. Based on these results, we propose that the IPyA pathway is transcriptionally regulated through a negative feedback mechanism in response to active auxin levels.
Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo
2014-12-01
HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of
Lee, M O; Liu, Y; Zhang, X K
1995-08-01
The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene
Nimmanee, Panjaphorn; Tam, Emily W T; Woo, Patrick C Y; Vanittanakom, Pramote; Vanittanakom, Nongnuch
2017-04-01
Stress-activated MAPK pathways are systems used to regulate the stress adaptation of most fungi. It has been shown that in Talaromyces marneffei (Penicillium marneffei), a pathogenic dimorphic fungus, the sakA gene is involved, not only in tolerance against oxidative and heat stresses, but also in playing a role in asexual development, yeast cell generation in vitro and survival inside macrophage cell lines. In this study, the role of the T. marneffei sakA gene on the nitrosative stress response and the regulation of gene expression were investigated. The susceptibility of the sakA mutant to NaNO2 was investigated using drop dilution assay and the expression of genes of interest were determined by RT-PCR, comparing them to the wild-type and complemented strains. The results demonstrated that the T. marneffei sakA gene played a role in the stress response to NaNO2, the expression of genes functioning in conidial development (brlA, abaA and wetA) and red pigment biosynthesis (pks3, rp1, rp2 and rp3). These findings suggest that T. marneffei sakA is broadly involved in a wide variety of cell activities, including stress response, cell morphogenesis, asexual development and pigmentation. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Fan, Xinqi; Guo, Qi; Xu, Peng; Gong, YuanYong; Shu, Hongmei; Yang, Yang; Ni, Wanchao; Zhang, Xianggui; Shen, Xinlian
2015-01-01
WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs) in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III), as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.
Directory of Open Access Journals (Sweden)
Xinqi Fan
Full Text Available WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III, as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.
Chowdhary, Surabhi; Kainth, Amoldeep S; Gross, David S
2017-12-15
Three-dimensional (3D) chromatin organization is important for proper gene regulation, yet how the genome is remodeled in response to stress is largely unknown. Here, we use a highly sensitive version of chromosome conformation capture in combination with fluorescence microscopy to investigate Heat Shock Protein ( HSP ) gene conformation and 3D nuclear organization in budding yeast. In response to acute thermal stress, HSP genes undergo intense intragenic folding interactions that go well beyond 5'-3' gene looping previously described for RNA polymerase II genes. These interactions include looping between upstream activation sequence (UAS) and promoter elements, promoter and terminator regions, and regulatory and coding regions (gene "crumpling"). They are also dynamic, being prominent within 60 s, peaking within 2.5 min, and attenuating within 30 min, and correlate with HSP gene transcriptional activity. With similarly striking kinetics, activated HSP genes, both chromosomally linked and unlinked, coalesce into discrete intranuclear foci. Constitutively transcribed genes also loop and crumple yet fail to coalesce. Notably, a missense mutation in transcription factor TFIIB suppresses gene looping, yet neither crumpling nor HSP gene coalescence is affected. An inactivating promoter mutation, in contrast, obviates all three. Our results provide evidence for widespread, transcription-associated gene crumpling and demonstrate the de novo assembly and disassembly of HSP gene foci. Copyright © 2017 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Shimpei Morimoto
2018-03-01
Full Text Available Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes (ADC17 and KIN1 that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after
Directory of Open Access Journals (Sweden)
Dingfeng Wang
Full Text Available Isaria cateniannulata is a very important and virulent entomopathogenic fungus that infects many insect pest species. Although I. cateniannulata is commonly exposed to extreme environmental temperature conditions, little is known about its molecular response mechanism to temperature stress. Here, we sequenced and de novo assembled the transcriptome of I. cateniannulata in response to high and low temperature stresses using Illumina RNA-Seq technology. Our assembly encompassed 17,514 unigenes (mean length = 1,197 bp, in which 11,445 unigenes (65.34% showed significant similarities to known sequences in NCBI non-redundant protein sequences (Nr database. Using digital gene expression analysis, 4,483 differentially expressed genes (DEGs were identified after heat treatment, including 2,905 up-regulated genes and 1,578 down-regulated genes. Under cold stress, 1,927 DEGs were identified, including 1,245 up-regulated genes and 682 down-regulated genes. The expression patterns of 18 randomly selected candidate DEGs resulting from quantitative real-time PCR (qRT-PCR were consistent with their transcriptome analysis results. Although DEGs were involved in many pathways, we focused on the genes that were involved in endocytosis: In heat stress, the pathway of clathrin-dependent endocytosis (CDE was active; however at low temperature stresses, the pathway of clathrin-independent endocytosis (CIE was active. Besides, four categories of DEGs acting as temperature sensors were observed, including cell-wall-major-components-metabolism-related (CWMCMR genes, heat shock protein (Hsp genes, intracellular-compatible-solutes-metabolism-related (ICSMR genes and glutathione S-transferase (GST. These results enhance our understanding of the molecular mechanisms of I. cateniannulata in response to temperature stresses and provide a valuable resource for the future investigations.
Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah
2017-02-01
Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.
Zhang, Xinyan; Li, Bingzong; Han, Huiying; Song, Sha; Xu, Hongxia; Hong, Yating; Yi, Nengjun; Zhuang, Wenzhuo
2018-05-10
Multiple myeloma (MM), like other cancers, is caused by the accumulation of genetic abnormalities. Heterogeneity exists in the patients' response to treatments, for example, bortezomib. This urges efforts to identify biomarkers from numerous molecular features and build predictive models for identifying patients that can benefit from a certain treatment scheme. However, previous studies treated the multi-level ordinal drug response as a binary response where only responsive and non-responsive groups are considered. It is desirable to directly analyze the multi-level drug response, rather than combining the response to two groups. In this study, we present a novel method to identify significantly associated biomarkers and then develop ordinal genomic classifier using the hierarchical ordinal logistic model. The proposed hierarchical ordinal logistic model employs the heavy-tailed Cauchy prior on the coefficients and is fitted by an efficient quasi-Newton algorithm. We apply our hierarchical ordinal regression approach to analyze two publicly available datasets for MM with five-level drug response and numerous gene expression measures. Our results show that our method is able to identify genes associated with the multi-level drug response and to generate powerful predictive models for predicting the multi-level response. The proposed method allows us to jointly fit numerous correlated predictors and thus build efficient models for predicting the multi-level drug response. The predictive model for the multi-level drug response can be more informative than the previous approaches. Thus, the proposed approach provides a powerful tool for predicting multi-level drug response and has important impact on cancer studies.
Coelho-Borges, Silvia; Cheinquer, Hugo; Wolff, Fernando Herz; Cheinquer, Nelson; Krug, Luciano; Ashton-Prolla, Patricia
2012-01-01
Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2) and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week) and ribavirin (1.000 mg, daily) for 24 weeks. Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis) and BclI (H63D mutation analysis) in 16 (37%) patients, all heterozygous (11 H63D, 2 C282Y and 3 both). Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41%) of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test). Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.
Directory of Open Access Journals (Sweden)
Boran Altincicek
Full Text Available Beetles (Coleoptera are the most diverse animal group on earth and interact with numerous symbiotic or pathogenic microbes in their environments. The red flour beetle Tribolium castaneum is a genetically tractable model beetle species and its whole genome sequence has recently been determined. To advance our understanding of the molecular basis of beetle immunity here we analyzed the whole transcriptome of T. castaneum by high-throughput next generation sequencing technology. Here, we demonstrate that the Illumina/Solexa sequencing approach of cDNA samples from T. castaneum including over 9.7 million reads with 72 base pairs (bp length (approximately 700 million bp sequence information with about 30× transcriptome coverage confirms the expression of most predicted genes and enabled subsequent qualitative and quantitative transcriptome analysis. This approach recapitulates our recent quantitative real-time PCR studies of immune-challenged and naïve T. castaneum beetles, validating our approach. Furthermore, this sequencing analysis resulted in the identification of 73 differentially expressed genes upon immune-challenge with statistical significance by comparing expression data to calculated values derived by fitting to generalized linear models. We identified up regulation of diverse immune-related genes (e.g. Toll receptor, serine proteinases, DOPA decarboxylase and thaumatin and of numerous genes encoding proteins with yet unknown functions. Of note, septic-injury resulted also in the elevated expression of genes encoding heat-shock proteins or cytochrome P450s supporting the view that there is crosstalk between immune and stress responses in T. castaneum. The present study provides a first comprehensive overview of septic-injury responsive genes in T. castaneum beetles. Identified genes advance our understanding of T. castaneum specific gene expression alteration upon immune-challenge in particular and may help to understand beetle immunity
Cotugno, Nicola; De Armas, Lesley; Pallikkuth, Suresh; Rinaldi, Stefano; Issac, Biju; Cagigi, Alberto; Rossi, Paolo; Palma, Paolo; Pahwa, Savita
2017-01-01
Despite effective antiretroviral therapy (ART), HIV-infected individuals with apparently similar clinical and immunological characteristics can vary in responsiveness to vaccinations. However, molecular mechanisms responsible for such impairment, as well as biomarkers able to predict vaccine responsiveness in HIV-infected children, remain unknown. Following the hypothesis that a B cell qualitative impairment persists in HIV-infected children (HIV) despite effective ART and phenotypic B cell immune reconstitution, the aim of the current study was to investigate B cell gene expression of HIV compared to age-matched healthy controls (HCs) and to determine whether distinct gene expression patterns could predict the ability to respond to influenza vaccine. To do so, we analyzed prevaccination transcriptional levels of a 96-gene panel in equal numbers of sort-purified B cell subsets (SPBS) isolated from peripheral blood mononuclear cells using multiplexed RT-PCR. Immune responses to H1N1 antigen were determined by hemaglutination inhibition and memory B cell ELISpot assays following trivalent-inactivated influenza vaccination (TIV) for all study participants. Although there were no differences in terms of cell frequencies of SPBS between HIV and HC, the groups were distinguishable based upon gene expression analyses. Indeed, a 28-gene signature, characterized by higher expression of genes involved in the inflammatory response and immune activation was observed in activated memory B cells (CD27 + CD21 - ) from HIV when compared to HC despite long-term viral control (>24 months). Further analysis, taking into account H1N1 responses after TIV in HIV participants, revealed that a 25-gene signature in resting memory (RM) B cells (CD27 + CD21 + ) was able to distinguish vaccine responders from non-responders (NR). In fact, prevaccination RM B cells of responders showed a higher expression of gene sets involved in B cell adaptive immune responses ( APRIL, BTK, BLIMP1 ) and
2011-01-01
Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1) gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA), Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i) some cationic liposomes may not be suitable for functional studies on hsp promoters, ii) lipofection may cause unintended changes in global gene expression in the transfected cells. PMID:21663599
Directory of Open Access Journals (Sweden)
Lisowska Katarzyna Marta
2011-06-01
Full Text Available Abstract Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1 gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA, Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i some cationic liposomes may not be suitable for functional studies on hsp promoters, ii lipofection may cause unintended changes in global gene expression in the transfected cells.
Cheng, Robert Y S; Zhao, Ailian; Alvord, W Gregory; Powell, Douglas A; Bare, Robert M; Masuda, Akira; Takahashi, Takashi; Anderson, Lucy M; Kasprzak, Kazimierz S
2003-08-15
Occupational exposure to nickel compounds is associated with lung cancer risk; both genotoxic and epigenetic mechanisms have been proposed. For comprehensive examination of the acute effects of nickel(II) acetate on gene expression in cultured human peripheral lung epithelial HPL1D cells, microarray analyses were carried out with cDNA chips (approximately 8000 cDNAs). Cells were exposed for 24 h to nontoxic (50, 100, and 200 microM) or toxic (400, 800, and 1600 microM) nickel(II) concentrations. Cluster analysis was applied to the 868 genes with > or = 2-fold change at any concentration. Two main clusters showed marked up- or down-regulation at the highest, toxic concentrations. The data further subdivided into 10 highly cohesive clusters with high probability, and of these only 2 had the same response trend at low nontoxic as at high concentrations, an observation of clear relevance to the process of high- to low-dose extrapolation in risk assessment. There were 113 genes showing > or = 2-fold change at the three lower nontoxic concentrations, those most relevant to in vivo carcinogenesis. In addition to expected responses of metallothionein, ferritin, and heat-shock proteins, the results revealed for the first time changed expression of some potential cancer-related genes in response to low-dose Ni(II): RhoA, dyskerin, interferon regulatory factor 1, RAD21 homologue, and tumor protein, translationally controlled. Overall, most of the genes impacted by nontoxic concentrations of nickel(II) acetate related to gene transcription, protein synthesis and stability, cytoskeleton, signaling, metabolism, cell membrane, and extracellular matrix.
Richards, Jennifer S; Arias Vásquez, Alejandro; van Rooij, Daan; van der Meer, Dennis; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Faraone, Stephen V; Hartman, Catharina A; Buitelaar, Jan K
2017-06-01
Impaired inhibitory control is a key feature of attention-deficit/hyperactivity disorder (ADHD). We investigated gene-environment interaction (GxE) as a possible contributing factor to response inhibition variation in context of the differential susceptibility theory. This states individuals carrying plasticity gene variants will be more disadvantaged in negative, but more advantaged in positive environments. Behavioural and neural measures of response inhibition were assessed during a Stop-signal task in participants with (N = 197) and without (N = 295) ADHD, from N = 278 families (age M = 17.18, SD =3.65). We examined GxE between candidate plasticity genes (DAT1, 5-HTT, DRD4) and social environments (maternal expressed emotion, peer affiliation). A DRD4 × Positive peer affiliation interaction was found on the right fusiform gyrus (rFG) activation during successful inhibition. Further, 5-HTT short allele carriers showed increased rFG activation during failed inhibitions. Maternal warmth and positive peer affiliation were positively associated with right inferior frontal cortex activation during successful inhibition. Deviant peer affiliation was positively related to the error rate. While a pattern of differential genetic susceptibility was found, more clarity on the role of the FG during response inhibition is warranted before firm conclusions can be made. Positive and negative social environments were related to inhibitory control. This extends previous research emphasizing adverse environments.
Sun, Qing-Ming; Zhou, Rong-Hua; Gao, Li-Feng; Zhao, Guang-Yao; Jia, Ji-Zeng
2009-04-01
The frequency and distribution of the major vernalization requirement genes and their effects on growth habits were studied. Of the 551 bread wheat genotypes tested, seven allelic combinations of the three Vrn-1 genes were found to be responsible for the spring habit, three for the facultative habit and one for the winter habit. The three Vrn-1 genes behaved additively with the dominant allele of Vrn-A1 exerting the strongest effect. The allele combinations of the facultative genotypes and the discovery of spring genotypes with "winter" allele of Vrn-1 implied the presence of as yet unidentified alleles/genes for vernalization response. The dominant alleles of the three Vrn-1 genes were found in all ten ecological regions where wheat is cultivated in China, with Vrn-D1 as the most common allele in nine and Vrn-A1 in one. The combination of vrn-A1vrn-B1Vrn-D1 was the predominant genotype in seven of the regions. Compared with landraces, improved varieties contain a higher proportion of the spring type. This was attributed by a higher frequency of the dominant Vrn-A1 and Vrn-B1 alleles in the latter. Correlations between Vrn-1 allelic constitutions and heading date, spike length, plant type as well as cold tolerance were established.
DEFF Research Database (Denmark)
Nielsen, Henrik Bjørn; Mundy, J.; Willenbrock, Hanni
2007-01-01
The systematic comparison of transcriptional responses of organisms is a powerful tool in functional genomics. For example, mutants may be characterized by comparing their transcript profiles to those obtained in other experiments querying the effects on gene expression of many experimental facto...
Directory of Open Access Journals (Sweden)
Ravi Goyal
Full Text Available In humans and other species, long-term hypoxia (LTH during pregnancy can lead to intrauterine growth restriction with reduced body/brain weight, dysregulation of cerebral blood flow (CBF, and other problems. To identify the signal transduction pathways and critical molecules, which may be involved in acclimatization to high altitude LTH, we conducted microarray with advanced bioinformatic analysis on carotid arteries (CA from the normoxic near-term ovine fetus at sea-level and those acclimatized to high altitude for 110+ days during gestation. In response to LTH acclimatization, in fetal CA we identified mRNA from 38 genes upregulated >2 fold (P2-fold (P<0.05. The major genes with upregulated mRNA were SLC1A3, Insulin-like growth factor (IGF binding protein 3, IGF type 2 receptor, transforming growth factor (TGF Beta-3, and genes involved in the AKT and BCL2 signal transduction networks. Most genes with upregulated mRNA have a common motif for Pbx/Knotted homeobox in the promoter region, and Sox family binding sites in the 3' un translated region (UTR. Genes with downregulated mRNA included those involved in the P53 pathway and 5-lipoxygenase activating proteins. The promoter region of all genes with downregulated mRNA, had a common 49 bp region with a binding site for DOT6 and TOD6, components of the RPD3 histone deacetylase complex RPD3C(L. We also identified miRNA complementary to a number of the altered genes. Thus, the present study identified molecules in the ovine fetus, which may play a role in the acclimatization response to high-altitude associated LTH.
GST(phi) gene from Macrophyte Lemna minor is involved in cadmium exposure responses
Institute of Scientific and Technical Information of China (English)
CHEN Shihua; CHEN Xin; DOU Weihong; WANG Liang; YIN Haibo; GUO Shanli
2016-01-01
Reactive oxygen species (ROS) scavengers,including ascorbate peroxidase,superoxide dismutase,catalase and peroxidase,are the most commonly used biomarkers in assessing an organisms' response to many biotic and abiotic stresses.In this study,we cloned an 866 bp GST(phi) gene in Lemna minor and investigated its characteristics,expression and enzymatic activities under 75 μmol/L cadmium concentrations in comparison with other ROS scavengers.GST(phi) gene expression patterns were similar to those of other scavengers of ROS.This suggests that GST(phi) might be involved in responding to heavy metal (cadmium) stress and that its expression level could be used as a bio-indicator in monitoring cadmium pollution.
GST ( phi) gene from Macrophyte Lemna minor is involved in cadmium exposure responses
Chen, Shihua; Chen, Xin; Dou, Weihong; Wang, Liang; Yin, Haibo; Guo, Shanli
2016-03-01
Reactive oxygen species (ROS) scavengers, including ascorbate peroxidase, superoxide dismutase, catalase and peroxidase, are the most commonly used biomarkers in assessing an organisms' response to many biotic and abiotic stresses. In this study, we cloned an 866 bp GST ( phi) gene in Lemna minor and investigated its characteristics, expression and enzymatic activities under 75 μmol/L cadmium concentrations in comparison with other ROS scavengers. GST ( phi) gene expression patterns were similar to those of other scavengers of ROS. This suggests that GST ( phi) might be involved in responding to heavy metal (cadmium) stress and that its expression level could be used as a bio-indicator in monitoring cadmium pollution.
Rudžianskienė, Milda; Inčiūra, Arturas; Gerbutavičius, Rolandas; Dambrauskienė, Rūta; Rudžianskas, Viktoras; Juozaitytė, Elona
2016-01-01
Background: Previous researches have demonstrated, that the severity of pain perception and it’s response to analgesia is highly dependent on gene polymorphism encoding for cytokines. We evaluated 12 single nucleotide polymorphisms (SNP) in 6 genes encoding for cytokines in multiple myeloma patients (n = 81) and assessed their influence on pain severity and response to palliative radiotherapy. Methods: Pain intensity was assessed by Visual Analogue Scale. The total dose of opioids was convert...
Cellular Stress Response Gene Expression During Upper and Lower Body High Intensity Exercises.
Kochanowicz, Andrzej; Sawczyn, Stanisław; Niespodziński, Bartłomiej; Mieszkowski, Jan; Kochanowicz, Kazimierz; Żychowska, Małgorzata
2017-01-01
The aim was to compare the effect of upper and lower body high-intensity exercise on chosen genes expression in athletes and non-athletes. Fourteen elite male artistic gymnasts (EAG) aged 20.6 ± 3.3 years and 14 physically active men (PAM) aged 19.9 ± 1.0 years performed lower and upper body 30 s Wingate Tests. Blood samples were collected before, 5 and 30 minutes after each effort to assess gene expression via PCR. Significantly higher mechanical parameters after lower body exercise was observed in both groups, for relative power (8.7 ± 1.2 W/kg in gymnasts, 7.2 ± 1.2 W/kg in controls, p = 0.01) and mean power (6.7 ± 0.7 W/kg in gymnasts, 5.4 ± 0.8 W/kg in controls, p = 0.01). No differences in lower versus upper body gene expression were detected for all tested genes as well as between gymnasts and physical active man. For IL-6 m-RNA time-dependent effect was observed. Because of no significant differences in expression of genes associated with cellular stress response the similar adaptive effect to exercise may be obtained so by lower and upper body exercise.
The landscape of human genes involved in the immune response to parasitic worms
Directory of Open Access Journals (Sweden)
Fumagalli Matteo
2010-08-01
Full Text Available Abstract Background More than 2 billion individuals worldwide suffer from helminth infections. The highest parasite burdens occur in children and helminth infection during pregnancy is a risk factor for preterm delivery and reduced birth weight. Therefore, helminth infections can be regarded as a strong selective pressure. Results Here we propose that candidate susceptibility genes for parasitic worm infections can be identified by searching for SNPs that display a strong correlation with the diversity of helminth species/genera transmitted in different geographic areas. By a genome-wide search we identified 3478 variants that correlate with helminth diversity. These SNPs map to 810 distinct human genes including loci involved in regulatory T cell function and in macrophage activation, as well as leukocyte integrins and co-inhibitory molecules. Analysis of functional relationships among these genes identified complex interaction networks centred around Th2 cytokines. Finally, several genes carrying candidate targets for helminth-driven selective pressure also harbour susceptibility alleles for asthma/allergy or are involved in airway hyper-responsiveness, therefore expanding the known parallelism between these conditions and parasitic infections. Conclusions Our data provide a landscape of human genes that modulate susceptibility to helminths and indicate parasitic worms as one of the major selective forces in humans.
Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M
2004-02-01
The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.
Directory of Open Access Journals (Sweden)
Ang Cui
Full Text Available Gene expression-based signatures help identify pathways relevant to diseases and treatments, but are challenging to construct when there is a diversity of disease mechanisms and treatments in patients with complex diseases. To overcome this challenge, we present a new application of an in silico gene expression deconvolution method, ISOpure-S1, and apply it to identify a common gene expression signature corresponding to response to treatment in 33 juvenile idiopathic arthritis (JIA patients. Using pre- and post-treatment gene expression profiles only, we found a gene expression signature that significantly correlated with a reduction in the number of joints with active arthritis, a measure of clinical outcome (Spearman rho = 0.44, p = 0.040, Bonferroni correction. This signature may be associated with a decrease in T-cells, monocytes, neutrophils and platelets. The products of most differentially expressed genes include known biomarkers for JIA such as major histocompatibility complexes and interleukins, as well as novel biomarkers including α-defensins. This method is readily applicable to expression datasets of other complex diseases to uncover shared mechanistic patterns in heterogeneous samples.
International Nuclear Information System (INIS)
Chadderton, Naomi; Cowen, Rachel L.; Sheppard, Freda C.D.; Robinson, Suzanne; Greco, Olga; Scott, Simon D.; Stratford, Ian J.; Patterson, Adam V.; Williams, Kaye J.
2005-01-01
Purpose: Tumor hypoxia is unequivocally linked to poor radiotherapy outcome. This study aimed to identify enhancer sequences that respond maximally to a combination of radiation and hypoxia for use in genetic radiotherapy approaches. Methods and materials: The influence of radiation (5 Gy) and hypoxia (1% O 2 ) on reporter-gene expression driven by hypoxia (HRE) and radiation (Egr-1) responsive elements was evaluated in tumor cells grown as monolayers or multicellular spheroids. Hypoxia-inducible factor-1α (HIF-1α) and HIF-2α protein expression was monitored in parallel. Results: Of the sequences tested, an HRE from the phosphoglycerate kinase-1 gene (PGK-18[5+]) was maximally induced in response to hypoxia plus radiation in all 5 cell lines tested. The additional radiation treatment afforded a significant increase in the induction of PGK-18[5+] compared with hypoxia alone in 3 cell lines. HIF-1α/2α were induced by radiation but combined hypoxia/radiation treatment did not yield a further increase. The dual responsive nature of HREs was maintained when spheroids were irradiated after delivery of HRE constructs in a replication-deficient adenovirus. Conclusions: Hypoxia-responsive enhancer element sequences are dually responsive to combined radiation and hypoxic treatment. Their use in genetic radiotherapy in vivo could maximize expression in the most radio-resistant population at the time of radiation and also exploit microenvironmental changes after radiotherapy to yield additional switch-on
DEFF Research Database (Denmark)
Nilsson, Birgitte; Jakobsen, Hans Henrik; Stief, Peter
2017-01-01
is problematic for calanoid copepod species like Acartia tonsa. In the present study, we evaluated the response of copepods experiencing stress under high-density conditions by assessing the acute stress level of A. tonsa. Control density was at 100 ind. L−1 while the treatments were increased stepwise up to 10......,000 ind. L−1. Three biological/physiological end-points were studied: swimming behavior, respiration rate and expression level of stress-related genes. None of the elevated densities caused any significant change in swimming behavior, respiration rate or gene expression level. This study suggests...... that adults of A. tonsa do not exhibit any measurable acute stress response when exposed to high culture densities for 12 h....
Swathy, Babu; Banerjee, Moinak
2017-01-01
Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects. SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study. Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in neurotransmission
Directory of Open Access Journals (Sweden)
Babu Swathy
Full Text Available Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects.SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study.Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in
Maternal programming of defensive responses through sustained effects on gene expression.
Zhang, Tie-Yuan; Bagot, Rose; Parent, Carine; Nesbitt, Cathy; Bredy, Timothy W; Caldji, Christian; Fish, Eric; Anisman, Hymie; Szyf, Moshe; Meaney, Michael J
2006-07-01
There are profound maternal effects on individual differences in defensive responses and reproductive strategies in species ranging literally from plants to insects to birds. Maternal effects commonly reflect the quality of the environment and are most likely mediated by the quality of the maternal provision (egg, propagule, etc.), which in turn determines growth rates and adult phenotype. In this paper we review data from the rat that suggest comparable forms of maternal effects on defensive responses stress, which are mediated by the effects of variations in maternal behavior on gene expression. Under conditions of environmental adversity maternal effects enhance the capacity for defensive responses in the offspring. In mammals, these effects appear to 'program' emotional, cognitive and endocrine systems towards increased sensitivity to adversity. In environments with an increased level of adversity, such effects can be considered adaptive, enhancing the probability of offspring survival to sexual maturity; the cost is that of an increased risk for multiple forms of pathology in later life.
Directory of Open Access Journals (Sweden)
Shigekazu Higuchi
Full Text Available BACKGROUND: Melanopsin-containing intrinsically photosensitive retinal ganglion cells (ipRGCs play an important role in non-image forming responses to light, such as circadian photoentrainment, light-induced melatonin suppression, and pupillary light response. Although it is known that there are some single nucleotide polymorphisms (SNPs in the melanopsin (OPN4 gene in humans, the associations of the SNPs with non-image forming responses to light remains unclear. In the present study, we examined the associations of melanopsin gene polymorphisms with pupillary light response. METHODS: Japanese university students (mean age: 21.0 ± 1.7 years with the genotypes of TT (n = 38, TC (n = 28 and CC (n = 7 at rs1079610 (I394T located in the coding region participated in the present study. They were matched by age and sex ratio. Dark-adapted pupil size (<1 lx was first measured. Then steady-state pupil size was measured during exposure to five lighting conditions (10 lx, 100 lx, 1000 lx, 3000 lx, 6000 lx in the vertical direction at eye level. RESULTS: Significant interaction between the genotype of I394T (TT versus TC+CC and luminance levels was found in pupil size. Under high illuminance levels (1000 lx, 3000 lx and 6000 lx, pupil sizes in subjects with the C allele were significantly smaller than those in subjects with the TT genotype. On the other hand, pupil size in subjects with the C allele under low illuminance (<1 lx was significantly larger than that in subjects with the TT genotype. Percentages of pupil constriction under high illuminance levels were significantly greater in subjects with the C allele than in subjects with the TT genotype. CONCLUSIONS: Human melanopsin gene polymorphism I394T interacted with irradiance in association with pupil size. This is the first evidence suggesting a functional connection between melanopsin gene polymorphism and pupillary light response as an index of non-image forming response to light.
Repnik, Katja; Koder, Silvo; Skok, Pavel; Ferkolj, Ivan; Potočnik, Uroš
2016-08-01
Tumor necrosis factor α inhibitors (anti-TNF) have improved treatment of several complex diseases, including Crohn's disease (CD). However, the effect varies and approximately one-third of the patients do not respond. Since blood parameters as well as genetic factors have shown a great potential to predict response during treatment, the aim of the study was to evaluate response to anti-TNF treatment with adalimumab (ADA) between genes HFE and TF and haematological parameters in Slovenian refractory CD patients. Single nucleotide polymorphisms (SNPs) rs1799852 in gene TF and rs2071303 in gene HFE were genotyped in 68 refractory CD patients for which response has been measured using inflammatory bowel disease questionnaire (IBDQ) index. Haematological parameters and IBDQ index were determined before therapy and after 4, 12, 20 and 30 weeks. We found novel strong association between SNP rs2071303 in gene HFE and response to ADA treatment, particularly patients with G allele comparing to A allele had better response after 20 weeks (p = 0.008). Further, we found strong association between transferrin level at baseline and treatment response after 12, 20 and 30 weeks, where average transferrin level before therapy was lower in responders (2.38 g/L) compared to non-responders (2.89 g/L, p = 0.005). Association was found between transferrin level in week 30 and SNP rs1799852 (p = 0.023), and between MCHC level before treatment and SNP rs2071303 (p = 0.007). Our results suggest that SNP in gene HFE as well as haematological markers serve as promising prognostic markers of response to anti-TNF treatment in CD patients.
Derambure, C; Dzangue-Tchoupou, G; Berard, C; Vergne, N; Hiron, M; D'Agostino, M A; Musette, P; Vittecoq, O; Lequerré, T
2017-05-25
In the current context of personalized medicine, one of the major challenges in the management of rheumatoid arthritis (RA) is to identify biomarkers that predict drug responsiveness. From the European APPRAISE trial, our main objective was to identify a gene expression profile associated with responsiveness to abatacept (ABA) + methotrexate (MTX) and to understand the involvement of this signature in the pathophysiology of RA. Whole human genome microarrays (4 × 44 K) were performed from a first subset of 36 patients with RA. Data validation by quantitative reverse-transcription (qRT)-PCR was performed from a second independent subset of 32 patients with RA. Gene Ontology and WikiPathways database allowed us to highlight the specific biological mechanisms involved in predicting response to ABA/MTX. From the first subset of 36 patients with RA, a combination including 87 transcripts allowed almost perfect separation between responders and non-responders to ABA/MTX. Next, the second subset of patients 32 with RA allowed validation by qRT-PCR of a minimal signature with only four genes. This latter signature categorized 81% of patients with RA with 75% sensitivity, 85% specificity and 85% negative predictive value. This combination showed a significant enrichment of genes involved in electron transport chain (ETC) pathways. Seven transcripts from ETC pathways (NDUFA6, NDUFA4, UQCRQ, ATP5J, COX7A2, COX7B, COX6A1) were significantly downregulated in responders versus non-responders to ABA/MTX. Moreover, dysregulation of these genes was independent of inflammation and was specific to ABA response. Pre-silencing of ETC genes is associated with future response to ABA/MTX and might be a crucial key to susceptibility to ABA response.
DEFF Research Database (Denmark)
Keers, R.; Uher, R.; Huezo-Diaz, P.
2011-01-01
, and several polymorphisms in the serotonin transporter gene (SLC6A4) have been genotyped including the serotonin transporter-linked polymorphic region (5-HTTLPR). Stressful life events were shown to predict a significantly better response to escitalopram but had no effect on response to nortriptyline...
Directory of Open Access Journals (Sweden)
Woods Donald E
2009-12-01
Full Text Available Abstract Background Rhamnolipids are surface active molecules composed of rhamnose and β-hydroxydecanoic acid. These biosurfactants are produced mainly by Pseudomonas aeruginosa and have been thoroughly investigated since their early discovery. Recently, they have attracted renewed attention because of their involvement in various multicellular behaviors. Despite this high interest, only very few studies have focused on the production of rhamnolipids by Burkholderia species. Results Orthologs of rhlA, rhlB and rhlC, which are responsible for the biosynthesis of rhamnolipids in P. aeruginosa, have been found in the non-infectious Burkholderia thailandensis, as well as in the genetically similar important pathogen B. pseudomallei. In contrast to P. aeruginosa, both Burkholderia species contain these three genes necessary for rhamnolipid production within a single gene cluster. Furthermore, two identical, paralogous copies of this gene cluster are found on the second chromosome of these bacteria. Both Burkholderia spp. produce rhamnolipids containing 3-hydroxy fatty acid moieties with longer side chains than those described for P. aeruginosa. Additionally, the rhamnolipids produced by B. thailandensis contain a much larger proportion of dirhamnolipids versus monorhamnolipids when compared to P. aeruginosa. The rhamnolipids produced by B. thailandensis reduce the surface tension of water to 42 mN/m while displaying a critical micelle concentration value of 225 mg/L. Separate mutations in both rhlA alleles, which are responsible for the synthesis of the rhamnolipid precursor 3-(3-hydroxyalkanoyloxyalkanoic acid, prove that both copies of the rhl gene cluster are functional, but one contributes more to the total production than the other. Finally, a double ΔrhlA mutant that is completely devoid of rhamnolipid production is incapable of swarming motility, showing that both gene clusters contribute to this phenotype. Conclusions Collectively, these
Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather
2014-01-01
The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced.
Directory of Open Access Journals (Sweden)
Chevalier Frédéric
2012-01-01
Full Text Available Abstract Background Wolbachia are vertically transmitted bacteria known to be the most widespread endosymbiont in arthropods. They induce various alterations of the reproduction of their host, including feminization of genetic males in isopod crustaceans. In the pill bug Armadillidium vulgare, the presence of Wolbachia is also associated with detrimental effects on host fertility and lifespan. Deleterious effects have been demonstrated on hemocyte density, phenoloxidase activity, and natural hemolymph septicemia, suggesting that infected individuals could have defective immune capacities. Since nothing is known about the molecular mechanisms involved in Wolbachia-A. vulgare interactions and its secondary immunocompetence modulation, we developed a transcriptomics strategy and compared A. vulgare gene expression between Wolbachia-infected animals (i.e., “symbiotic” animals and uninfected ones (i.e., “asymbiotic” animals as well as between animals challenged or not challenged by a pathogenic bacteria. Results Since very little genetic data is available on A. vulgare, we produced several EST libraries and generated a total of 28 606 ESTs. Analyses of these ESTs revealed that immune processes were over-represented in most experimental conditions (responses to a symbiont and to a pathogen. Considering canonical crustacean immune pathways, these genes encode antimicrobial peptides or are involved in pathogen recognition, detoxification, and autophagy. By RT-qPCR, we demonstrated a general trend towards gene under-expression in symbiotic whole animals and ovaries whereas the same gene set tends to be over-expressed in symbiotic immune tissues. Conclusion This study allowed us to generate the first reference transcriptome ever obtained in the Isopoda group and to identify genes involved in the major known crustacean immune pathways encompassing cellular and humoral responses. Expression of immune-related genes revealed a modulation of host
Energy Technology Data Exchange (ETDEWEB)
Soetaert, Anneleen [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)]. E-mail: anneleen.soetaert@ua.ac.be; Vandenbrouck, Tine [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Ven, Karlijn van der [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Maras, Marleen [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Remortel, Piet van [Department of Mathematics and Informatics, Intelligent Systems Laboratory, University of Antwerp, Middelheimlaan 1, B-2020 Antwerp (Belgium); Blust, Ronny [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Coen, Wim M. de [Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)
2007-07-20
DNA microarrays offer great potential in revealing insight into mechanistic toxicity of contaminants. The aim of the present study was (i) to gain insight in concentration- and time-dependent cadmium-induced molecular responses by using a customized Daphnia magna microarray, and (ii) to compare the gene expression profiles with effects at higher levels of biological organization (e.g. total energy budget and growth). Daphnids were exposed to three cadmium concentrations (nominal value of 10, 50, 100 {mu}g/l) for two time intervals (48 and 96 h). In general, dynamic expression patterns were obtained with a clear increase of gene expression changes at higher concentrations and longer exposure duration. Microarray analysis revealed cadmium affected molecular pathways associated with processes such as digestion, oxygen transport, cuticula metabolism and embryo development. These effects were compared with higher-level effects (energy budgets and growth). For instance, next to reduced energy budgets due to a decline in lipid, carbohydrate and protein content, we found an up-regulated expression of genes related to digestive processes (e.g. {alpha}-esterase, cellulase, {alpha}-amylase). Furthermore, cadmium affected the expression of genes coding for proteins involved in molecular pathways associated with immune response, stress response, cell adhesion, visual perception and signal transduction in the present study.
Directory of Open Access Journals (Sweden)
Bo Liu
Full Text Available BACKGROUND: Although cold shock responses and the roles of cold shock proteins in microorganisms containing multiple cold shock protein genes have been well characterized, related studies on bacteria possessing a single cold shock protein gene have not been reported. Thermoanaerobacter tengcongensis MB4, a thermophile harboring only one known cold shock protein gene (TtescpC, can survive from 50° to 80 °C, but has poor natural competence under cold shock at 50 °C. We therefore examined cold shock responses and their effect on natural competence in this bacterium. RESULTS: The transcriptomes of T. tengcongensis before and after cold shock were analyzed by RNA-seq and over 1200 differentially expressed genes were successfully identified. These genes were involved in a wide range of biological processes, including modulation of DNA replication, recombination, and repair; energy metabolism; production of cold shock protein; synthesis of branched amino acids and branched-chain fatty acids; and sporulation. RNA-seq analysis also suggested that T. tengcongensis initiates cell wall and membrane remodeling processes, flagellar assembly, and sporulation in response to low temperature. Expression profiles of TtecspC and failed attempts to produce a TtecspC knockout strain confirmed the essential role of TteCspC in the cold shock response, and also suggested a role of this protein in survival at optimum growth temperature. Repression of genes encoding ComEA and ComEC and low energy metabolism levels in cold-shocked cells are the likely basis of poor natural competence at low temperature. CONCLUSION: Our study demonstrated changes in global gene expression under cold shock and identified several candidate genes related to cold shock in T. tengcongensis. At the same time, the relationship between cold shock response and poor natural competence at low temperature was preliminarily elucidated. These findings provide a foundation for future studies on genetic
Ryan, James C; Morey, Jeanine S; Bottein, Marie-Yasmine Dechraoui; Ramsdell, John S; Van Dolah, Frances M
2010-08-26
Ciguatoxins (CTXs) are polyether marine neurotoxins and potent activators of voltage-gated sodium channels. This toxin is carried by multiple reef-fish species and human consumption of ciguatoxins can result in an explosive gastrointestinal/neurologic illness. This study characterizes the global transcriptional response in mouse brain to a symptomatic dose of the highly toxic Pacific ciguatoxin P-CTX-1 and additionally compares this data to transcriptional profiles from liver and whole blood examined previously. Adult male C57/BL6 mice were injected with 0.26 ng/g P-CTX-1 while controls received only vehicle. Animals were sacrificed at 1, 4 and 24 hrs and transcriptional profiling was performed on brain RNA with Agilent whole genome microarrays. RT-PCR was used to independently validate gene expression and the web tool DAVID was used to analyze gene ontology (GO) and molecular pathway enrichment of the gene expression data. A pronounced 4°C hypothermic response was recorded in these mice, reaching a minimum at 1 hr and lasting for 8 hrs post toxin exposure. Ratio expression data were filtered by intensity, fold change and p-value, with the resulting data used for time course analysis, K-means clustering, ontology classification and KEGG pathway enrichment. Top GO hits for this gene set included acute phase response and mono-oxygenase activity. Molecular pathway analysis showed enrichment for complement/coagulation cascades and metabolism of xenobiotics. Many immediate early genes such as Fos, Jun and Early Growth Response isoforms were down-regulated although others associated with stress such as glucocorticoid responsive genes were up-regulated. Real time PCR confirmation was performed on 22 differentially expressed genes with a correlation of 0.9 (Spearman's Rho, p < 0.0001) with microarray results. Many of the genes differentially expressed in this study, in parallel with the hypothermia, figure prominently in protection against neuroinflammation. Pathologic
DEFF Research Database (Denmark)
Nielsen, Kaspar René; Rodrigo-Domingo, Maria; Steffensen, Rudi
2017-01-01
The origin of multiple myeloma depends on interactions with stromal cells in the course of normal B-cell differentiation and evolution of immunity. The concept of the present study is that genes involved in MM pathogenesis, such as immune response genes, can be identified by screening for single......3L1 gene promoters. The occurrence of single polymorphisms, haplotypes and SNP-SNP interactions were statistically analyzed for association with disease risk and outcome following high-dose therapy. Identified genes that carried SNPs or haplotypes that were identified as risk or prognostic factors......= .005). The 'risk genes' were analyzed for expression in normal B-cell subsets (N = 6) from seven healthy donors and we found TNFA and IL-6 expressed both in naïve and in memory B cells when compared to preBI, II, immature and plasma cells. The 'prognosis genes' CHI3L1, IL-6 and IL-10 were differential...
Zhao, Ge; Song, Yun; Wang, Caixiang; Butt, Hamama Islam; Wang, Qianhua; Zhang, Chaojun; Yang, Zuoren; Liu, Zhao; Chen, Eryong; Zhang, Xueyan; Li, Fuguang
2016-12-01
Jasmonates control many aspects of plant biological processes. They are important for regulating plant responses to various biotic and abiotic stresses, including drought, which is one of the most serious threats to sustainable agricultural production. However, little is known regarding how jasmonate ZIM-domain (JAZ) proteins mediate jasmonic acid signals to improve stress tolerance in cotton. This represents the first comprehensive comparative study of TIFY transcription factors in both diploid A, D and tetraploid AD cotton species. In this study, we identified 21 TIFY family members in the genome of Gossypium arboretum, 28 members from Gossypium raimondii and 50 TIFY genes in Gossypium hirsutum. The phylogenetic analyses indicated the TIFY gene family could be divided into the following four subfamilies: TIFY, PPD, ZML, and JAZ subfamilies. The cotton TIFY genes have expanded through tandem duplications and segmental duplications compared with other plant species. Gene expression profile revealed temporal and tissue specificities for TIFY genes under simulated drought conditions in Gossypium arboretum. The JAZ subfamily members were the most highly expressed genes, suggesting that they have a vital role in responses to drought stress. Over-expression of GaJAZ5 gene decreased water loss, stomatal openings, and the accumulation of H 2 O 2 in Arabidopsis thaliana. Additionally, the results of drought tolerance assays suggested that this subfamily might be involved in increasing drought tolerance. Our study provides new data regarding the genome-wide analysis of TIFY gene families and their important roles in drought tolerance in cotton species. These data may form the basis of future studies regarding the relationship between drought and jasmonic acid.
Directory of Open Access Journals (Sweden)
Silvia Coelho-Borges
2012-03-01
Full Text Available CONTEXT: Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. OBJECTIVE: To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. METHODS: A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2 and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week and ribavirin (1.000 mg, daily for 24 weeks. RESULTS: Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis and BclI (H63D mutation analysis in 16 (37% patients, all heterozygous (11 H63D, 2 C282Y and 3 both. Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41% of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test. CONCLUSION: Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.
Wang, Haiying; Molina, Julian; Jiang, John; Ferber, Matthew; Pruthi, Sandhya; Jatkoe, Timothy; Derecho, Carlo; Rajpurohit, Yashoda; Zheng, Jian; Wang, Yixin
2013-11-01
Circulating tumor cells (CTCs) have recently attracted attention due to their potential as prognostic and predictive markers for the clinical management of metastatic breast cancer patients. The isolation of CTCs from patients may enable the molecular characterization of these cells, which may help establish a minimally invasive assay for the prediction of metastasis and further optimization of treatment. Molecular markers of proven clinical value may therefore be useful in predicting disease aggressiveness and response to treatment. In our earlier study, we identified a gene signature in breast cancer that appears to be significantly associated with bone metastasis. Among the genes that constitute this signature, trefoil factor 1 (TFF1) was identified as the most differentially expressed gene associated with bone metastasis. In this study, we investigated 25 candidate gene markers in the CTCs of metastatic breast cancer patients with different metastatic sites. The panel of the 25 markers was investigated in 80 baseline samples (first blood draw of CTCs) and 30 follow-up samples. In addition, 40 healthy blood donors (HBDs) were analyzed as controls. The assay was performed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) with RNA extracted from CTCs captured by the CellSearch system. Our study indicated that 12 of the genes were uniquely expressed in CTCs and 10 were highly expressed in the CTCs obtained from patients compared to those obtained from HBDs. Among these genes, the expression of keratin 19 was highly correlated with the CTC count. The TFF1 expression in CTCs was a strong predictor of bone metastasis and the patients with a high expression of estrogen receptor β in CTCs exhibited a better response to hormonal treatment. Molecular characterization of these genes in CTCs may provide a better understanding of the mechanism underlying tumor metastasis and identify gene markers in CTCs for predicting disease progression and
Podetz-Pedersen, Kelly M.; Vezys, Vaiva; Somia, Nikunj V.; Russell, Stephen J.
2014-01-01
Abstract The Sleeping Beauty (SB) transposon system has been shown to mediate new gene sequence integration resulting in long-term expression. Here the effectiveness of hyperactive SB100X transposase was tested, and we found that hydrodynamic co-delivery of a firefly luciferase transposon (pT2/CaL) along with SB100X transposase (pCMV-SB100X) resulted in remarkably sustained, high levels of luciferase expression. However, after 4 weeks there was a rapid, animal-by-animal loss of luciferase expression that was not observed in immunodeficient mice. We hypothesized that this sustained, high-level luciferase expression achieved using the SB100X transposase elicits an immune response in pT2/CaL co-administered mice, which was supported by the rapid loss of luciferase expression upon challenge of previously treated animals and in naive animals adoptively transferred with splenocytes from previously treated animals. Specificity of the immune response to luciferase was demonstrated by increased cytokine expression in splenocytes after exposure to luciferase peptide in parallel with MHC I–luciferase peptide tetramer binding. This anti-luciferase immune response observed following continuous, high-level luciferase expression in vivo clearly impacts its use as an in vivo reporter. As both an immunogen and an extremely sensitive reporter, luciferase is also a useful model system for the study of immune responses following in vivo gene transfer and expression. PMID:25093708
Life in a changing world: TCH gene regulation of expression and responses to environmental signals
Braam, J.; Sistrunk, M. L.; Polisensky, D. H.; Xu, W.; Purugganan, M. M.; Antosiewicz, D. M.; Campbell, P.; Johnson, K. A.
1996-01-01
The Arabidopsis TCH genes were discovered as a consequence of their marked upregulation of expression in response to seemingly innocuous stimuli such as touch. Further analyses have indicated that these genes are upregulated by a variety of diverse stimuli. Understanding the mechanism(s) and factors that control TCH gene regulation will shed light on the signaling pathways that enable plants to respond to changing environmental conditions. The TCH proteins include calmodulin, calmodulin-related proteins and a xyloglucan endotransglycosylase. Expression analyses and localization of protein accumulation indicate that the potential sites of TCH protein function include expanding cells and tissues under mechanical strain. We hypothesize that the TCH proteins may collaborate in cell wall biogenesis.
Koder, Silvo; Repnik, Katja; Ferkolj, Ivan; Pernat, Cvetka; Skok, Pavel; Weersma, Rinse K.; Potocnik, Uros
2015-01-01
Aim: To see if SNPs could help predict response to biological therapy using adalimumab (ADA) in Crohn's disease (CD). Materials & methods: IBDQ index and CRP levels were used to monitor therapy response. We genotyped 31 CD-associated genes in 102 Slovenian CD patients. Results: The strongest
A novel role for pigment genes in the stress response in rainbow trout (Oncorhynchus mykiss)
Khan, Uniza Wahid; Ø verli, Ø yvind; Hinkle, Patricia M.; Pasha, Farhan Ahmad; Johansen, Ida Beitnes; Berget, Ingunn; Silva, Patricia I. M.; Kittilsen, Silje; Hö glund, Erik; Omholt, Stig W.; Vå ge, Dag Inge
2016-01-01
pigmentation gene, melanocyte stimulating hormone receptor (MC1R), is strongly associated with distinct differences in steroidogenic melanocortin 2 receptor (MC2R) mRNA expression between high- (HR) and low-responsive (LR) rainbow trout (Oncorhynchus mykiss
Directory of Open Access Journals (Sweden)
Adugna Abdi Woldesemayat
Full Text Available Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations.In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO, Trait Ontology (TO, Plant Ontology (PO, Growth Ontology (GRO and Environment Ontology (EO were used to semantically integrate drought related information.Target genes linked to Quantitative Trait Loci (QTLs controlling yield and stress tolerance in sorghum (Sorghum bicolor (L. Moench and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%, salt (32%, cold (20%, heat (8% and oxidative stress (25% were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs
Fomenko, Dmitri E.; Koc, Ahmet; Agisheva, Natalia; Jacobsen, Michael; Kaya, Alaattin; Malinouski, Mikalai; Rutherford, Julian C.; Siu, Kam-Leung; Jin, Dong-Yan; Winge, Dennis R.; Gladyshev, Vadim N.
2011-01-01
Hydrogen peroxide is thought to regulate cellular processes by direct oxidation of numerous cellular proteins, whereas antioxidants, most notably thiol peroxidases, are thought to reduce peroxides and inhibit H2O2 response. However, thiol peroxidases have also been implicated in activation of transcription factors and signaling. It remains unclear if these enzymes stimulate or inhibit redox regulation and whether this regulation is widespread or limited to a few cellular components. Herein, we found that Saccharomyces cerevisiae cells lacking all eight thiol peroxidases were viable and withstood redox stresses. They transcriptionally responded to various redox treatments, but were unable to activate and repress gene expression in response to H2O2. Further studies involving redox transcription factors suggested that thiol peroxidases are major regulators of global gene expression in response to H2O2. The data suggest that thiol peroxidases sense and transfer oxidative signals to the signaling proteins and regulate transcription, whereas a direct interaction between H2O2 and other cellular proteins plays a secondary role. PMID:21282621
The recX gene product is involved in the SOS response in Herbaspirillum seropedicae
International Nuclear Information System (INIS)
Galvao, C.W.; Pedrosa, F.O.; Souza, E.M.; Yates, M.G.; Chubatsu, L.S.; Steffens, M.B.R.
2003-01-01
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable σ 70 -dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response. (author)
The recX gene product is involved in the SOS response in Herbaspirillum seropedicae
Energy Technology Data Exchange (ETDEWEB)
Galvao, C.W.; Pedrosa, F.O.; Souza, E.M.; Yates, M.G.; Chubatsu, L.S.; Steffens, M.B.R. [Univ. Federal do Parana, Dept. of Biochemistry and Molecular Biology, Curitiba (Brazil)]. E-mail: steffens@bioufpr.br
2003-02-15
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable {sigma}{sup 70}-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response. (author)
The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.
Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R
2003-02-01
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.
Wang, Wenlei; Wu, Xiaojie; Wang, Chao; Jia, Zhaojun; He, Linwen; Wei, Yifan; Niu, Jianfeng; Wang, Guangce
2014-07-01
To screen the stable expression genes related to the stress (strong light, dehydration and temperature shock) we applied Absolute real-time PCR technology to determine the transcription numbers of the selected test genes in P orphyra yezoensis, which has been regarded as a potential model species responding the stress conditions in the intertidal. Absolute real-time PCR technology was applied to determine the transcription numbers of the selected test genes in P orphyra yezoensis, which has been regarded as a potential model species in stress responding. According to the results of photosynthesis parameters, we observed that Y(II) and F v/ F m were significantly affected when stress was imposed on the thalli of P orphyra yezoensis, but underwent almost completely recovered under normal conditions, which were collected for the following experiments. Then three samples, which were treated with different grade stresses combined with salinity, irradiation and temperature, were collected. The transcription numbers of seven constitutive expression genes in above samples were determined after RNA extraction and cDNA synthesis. Finally, a general insight into the selection of internal control genes during stress response was obtained. We found that there were no obvious effects in terms of salinity stress (at salinity 90) on transcription of most genes used in the study. The 18S ribosomal RNA gene had the highest expression level, varying remarkably among different tested groups. RPS8 expression showed a high irregular variance between samples. GAPDH presented comparatively stable expression and could thus be selected as the internal control. EF-1α showed stable expression during the series of multiple-stress tests. Our research provided available references for the selection of internal control genes for transcripts determination of P. yezoensis.
Jin, Hee; Jeon, Seulgi; Kang, Ga-Young; Lee, Hae-June; Cho, Jaeho; Lee, Yun-Sil
2017-02-01
The molecular effects of focal exposure of limited lung volumes to high-dose per fraction irradiation (HDFR) such as stereotactic body radiotherapy (SBRT) have not been fully characterized. In this study, we used such an irradiation system and identified the genes and proteins after HDFR to mouse lung, similar to those associated with human therapy. High focal radiation (90 Gy) was applied to a 3-mm volume of the left lung of C57BL6 mice using a small-animal stereotactic irradiator. As well as histological examination for lungs, a cDNA micro array using irradiated lung tissues and a protein array of sera were performed until 4 weeks after irradiation, and radiation-responsive genes and proteins were identified. For comparison, the long-term effects (12 months) of 20 Gy radiation wide-field dose to the left lung were also investigated. The genes ermap, epb4.2, cd200r3 (up regulation) and krt15, hoxc4, gdf2, cst9, cidec, and bnc1 (down-regulation) and the proteins of AIF, laminin, bNOS, HSP27, β-amyloid (upregulation), and calponin (downregulation) were identified as being responsive to 90 Gy HDFR. The gdf2, cst9, and cidec genes also responded to 20 Gy, suggesting that they are universal responsive genes in irradiated lungs. No universal proteins were identified in both 90 Gy and 20 Gy. Calponin, which was downregulated in protein antibody array analysis, showed a similar pattern in microarray data, suggesting a possible HDFR responsive serum biomarker that reflects gene alteration of irradiated lung tissue. These genes and proteins also responded to the lower doses of 20 Gy and 50 Gy HDFR. These results suggest that identified candidate genes and proteins are HDFR-specifically expressed in lung damage induced by HDFR relevant to SBRT in humans.
HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses
International Nuclear Information System (INIS)
Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan
2004-01-01
Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus
Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng
2017-04-01
The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com
International Nuclear Information System (INIS)
Naqvi, S.M.S.; Mahmood, T.
2005-01-01
Plants respond to a number of environmental stimuli by modulating expression of genes. One such family of genes is now known as germin/germin-like protein genes (Glps). In order to detect any Glp gene response in rice, a pair of degenerate primers was designed based on consensus region from Glp sequences in Genbank. Using these primers a DNA fragment of about 550 bp was obtained by PCR amplification from genomic template. This 550 bp DNA was used as probe in Northern analysis. These studies provided evidence pointing to differential response of Glp expression to salt stress. RNA obtained from the roots was used for synthesis of cDNA. This cDNA was amplifiable with sense primer (RGLP1) from above mentioned pair and oligo-(dt) yielding a fragment of approx. 800 bp. Restriction analysis revealed that the PCR product was heterogeneous. After establishing that 800 bp fragment was the desired product, it was cloned in pCRII-TOPO. Five clones were picked up and analyzed by restriction analysis and sequencing. Two different Glp cDNAs were represented by these partial clones. Remaining sequence of the 5' end for clone 4 and 16 was obtained by Rapid Amplification of cDNA ends (RACE). The resultant sequences have been submitted to Genbank as Oryza sativa Rice Germin-like Protein 1 and 2 (osRGLP1 and 2). When full length genes corresponding to these sequences were amplified from genomic templates, resulting fragments were nearly 150 by larger than cDNAs. Cloning of structural genes for osRGLP1 revealed presence of a 162 bp intron in the coding region near 3' end. Preliminary evidence shows that expression of both osRGLP1 and 2 is severely reduced during salt stress. Another approach to establish both osRGLP1 and 2 genes involvement in stress tolerance is to study the ability of their promotor regions to drive expression of some reporter gene during stress. Promotor regions of about 1100 bp has been amplified and cloned and has been confirmed by restriction analysis and nested
An Interactive Database of Cocaine-Responsive Gene Expression
Directory of Open Access Journals (Sweden)
Willard M. Freeman
2002-01-01
Full Text Available The postgenomic era of large-scale gene expression studies is inundating drug abuse researchers and many other scientists with findings related to gene expression. This information is distributed across many different journals, and requires laborious literature searches. Here, we present an interactive database that combines existing information related to cocaine-mediated changes in gene expression in an easy-to-use format. The database is limited to statistically significant changes in mRNA or protein expression after cocaine administration. The Flash-based program is integrated into a Web page, and organizes changes in gene expression based on neuroanatomical region, general function, and gene name. Accompanying each gene is a description of the gene, links to the original publications, and a link to the appropriate OMIM (Online Mendelian Inheritance in Man entry. The nature of this review allows for timely modifications and rapid inclusion of new publications, and should help researchers build second-generation hypotheses on the role of gene expression changes in the physiology and behavior of cocaine abuse. Furthermore, this method of organizing large volumes of scientific information can easily be adapted to assist researchers in fields outside of drug abuse.
Directory of Open Access Journals (Sweden)
Amanda Vansan Marangon
2013-01-01
Full Text Available The genetic variability of the host contributes to the risk of human papillomavirus (HPV-related cervical disease. Immune response genes to HPV must be investigated to define patients with the highest risk of developing malignant disease. The aim of this study was to investigate the association of polymorphic immune response genes, namely KIR, HLA class I and II, and single-nucleotide polymorphisms (SNPs of cytokines with HPV-related cervical disease. We selected 79 non-related, admixed Brazilian women from the state of Paraná, southern region of Brazil, who were infected with high carcinogenic risk HPV and present cervical intraepithelial neoplasia grade 3 (CIN3, and 150 HPV-negative women from the same region matched for ethnicity. KIR genes were genotyped using an in-house PCR-SSP. HLA alleles were typed using a reverse sequence-specific oligonucleotide technique. SNPs of TNF −308G>A, IL6 −174G>C, IFNG +874T>A, TGFB1 +869T>C +915G>C, and IL10 −592C>A −819C>T −1082G>A were evaluated using PCR-SSP. The KIR genes were not associated with HPV, although some pairs of i(inhibitoryKIR-ligands occurred more frequently in patients, supporting a role for NK in detrimental chronic inflammatory and carcinogenesis. Some HLA haplotypes were associated with HPV. The associations of INFG and IL10 SNPs potentially reflect impaired or invalid responses in advanced lesions.
Marangon, Amanda Vansan; Guelsin, Gláucia Andreia Soares; Visentainer, Jeane Eliete Laguila; Borelli, Sueli Donizete; Watanabe, Maria Angélica Ehara; Consolaro, Márcia Edilaine Lopes; Caleffi-Ferracioli, Katiany Rizzieri; Rudnick, Cristiane Conceição Chagas; Sell, Ana Maria
2013-01-01
The genetic variability of the host contributes to the risk of human papillomavirus (HPV)-related cervical disease. Immune response genes to HPV must be investigated to define patients with the highest risk of developing malignant disease. The aim of this study was to investigate the association of polymorphic immune response genes, namely KIR, HLA class I and II, and single-nucleotide polymorphisms (SNPs) of cytokines with HPV-related cervical disease. We selected 79 non-related, admixed Brazilian women from the state of Paraná, southern region of Brazil, who were infected with high carcinogenic risk HPV and present cervical intraepithelial neoplasia grade 3 (CIN3), and 150 HPV-negative women from the same region matched for ethnicity. KIR genes were genotyped using an in-house PCR-SSP. HLA alleles were typed using a reverse sequence-specific oligonucleotide technique. SNPs of TNF −308G>A, IL6 −174G>C, IFNG +874T>A, TGFB1 +869T>C +915G>C, and IL10 −592C>A −819C>T −1082G>A were evaluated using PCR-SSP. The KIR genes were not associated with HPV, although some pairs of i(inhibitory)KIR-ligands occurred more frequently in patients, supporting a role for NK in detrimental chronic inflammatory and carcinogenesis. Some HLA haplotypes were associated with HPV. The associations of INFG and IL10 SNPs potentially reflect impaired or invalid responses in advanced lesions. PMID:23936772
Dolder, Patrick C.; Grünblatt, Edna; Müller, Felix; Borgwardt, Stefan J.; Liechti, Matthias E.
2017-01-01
Rationale: Renewed interest has been seen in the use of lysergic acid diethylamide (LSD) in psychiatric research and practice. The repeated use of LSD leads to tolerance that is believed to result from serotonin (5-HT) 5-HT2A receptor downregulation. In rats, daily LSD administration for 4 days decreased frontal cortex 5-HT2A receptor binding. Additionally, a single dose of LSD acutely increased expression of the early growth response genes EGR1 and EGR2 in rat and mouse brains through 5-HT2A receptor stimulation. No human data on the effects of LSD on gene expression has been reported. Therefore, we investigated the effects of single-dose LSD administration on the expression of the 5-HT2A receptor gene (HTR2A) and EGR1-3 genes. Methods: mRNA expression levels were analyzed in whole blood as a peripheral biomarker in 15 healthy subjects before and 1.5 and 24 h after the administration of LSD (100 μg) and placebo in a randomized, double-blind, placebo-controlled, cross-over study. Results: LSD did not alter the expression of the HTR2A or EGR1-3 genes 1.5 and 24 h after administration compared with placebo. Conclusion: No changes were observed in the gene expression of LSD’s primary target receptor gene or genes that are implicated in its downstream effects. Remaining unclear is whether chronic LSD administration alters gene expression in humans. PMID:28701958
DEFF Research Database (Denmark)
Vallejo, R L; Rexroad III, C E; Silverstein, J T
2009-01-01
As a first step toward the genetic mapping of QTL affecting stress response variation in rainbow trout, we performed complex segregation analyses (CSA) fitting mixed inheritance models of plasma cortisol by using Bayesian methods in large full-sib families of rainbow trout. To date, no studies have...... been conducted to determine the mode of inheritance of stress response as measured by plasma cortisol response when using a crowding stress paradigm and CSA in rainbow trout. The main objective of this study was to determine the mode of inheritance of plasma cortisol after a crowding stress....... The results from fitting mixed inheritance models with Bayesian CSA suggest that 1 or more major genes with dominant cortisol-decreasing alleles and small additive genetic effects of a large number of independent genes likely underlie the genetic variation of plasma cortisol in the rainbow trout families...
DEFF Research Database (Denmark)
Schøler, Lone Vedel; Møller, Tine Hørning; Nørgaard, Steffen
2012-01-01
The soil nematode Caenorhabditis elegans has become a popular genetic model organism used to study a broad range of complex biological processes, including development, aging, apoptosis, and DNA damage responses. Many genetic tools and tricks have been developed in C. elegans including knock down...... of gene expression via RNA interference (RNAi). In C. elegans RNAi can effectively be administrated via feeding the nematodes bacteria expressing double-stranded RNA targeting the gene of interest. Several commercial C. elegans RNAi libraries are available and hence gene inactivation using RNAi can...
Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario
2017-04-01
Lactobacillus plantarum is a lactic acid bacterium that can degrade food tannins by the successive action of tannase and gallate decarboxylase enzymes. In the L. plantarum genome, the gene encoding the catalytic subunit of gallate decarboxylase ( lpdC , or lp_2945 ) is only 6.5 kb distant from the gene encoding inducible tannase ( L. plantarum tanB [ tanB Lp ], or lp_2956 ). This genomic context suggests concomitant activity and regulation of both enzymatic activities. Reverse transcription analysis revealed that subunits B ( lpdB , or lp_0271 ) and D ( lpdD , or lp_0272 ) of the gallate decarboxylase are cotranscribed, whereas subunit C ( lpdC , or lp_2945 ) is cotranscribed with a gene encoding a transport protein ( gacP , or lp_2943 ). In contrast, the tannase gene is transcribed as a monocistronic mRNA. Investigation of knockout mutations of genes located in this chromosomal region indicated that only mutants of the gallate decarboxylase (subunits B and C), tannase, GacP transport protein, and TanR transcriptional regulator ( lp_2942 ) genes exhibited altered tannin metabolism. The expression profile of genes involved in tannin metabolism was also analyzed in these mutants in the presence of methyl gallate and gallic acid. It is noteworthy that inactivation of tanR suppresses the induction of all genes overexpressed in the presence of methyl gallate and gallic acid. This transcriptional regulator was also induced in the presence of other phenolic compounds, such as kaempferol and myricetin. This study complements the catalog of L. plantarum expression profiles responsive to phenolic compounds, which enable this bacterium to adapt to a plant food environment. IMPORTANCE Lactobacillus plantarum is a bacterial species frequently found in the fermentation of vegetables when tannins are present. L. plantarum strains degrade tannins to the less-toxic pyrogallol by the successive action of tannase and gallate decarboxylase enzymes. The genes encoding these enzymes are
International Nuclear Information System (INIS)
Kontunen-Soppela, Sari; Parviainen, Juha; Ruhanen, Hanna; Brosche, Mikael; Keinaenen, Markku; Thakur, Ramesh C.; Kolehmainen, Mikko; Kangasjaervi, Jaakko; Oksanen, Elina; Karnosky, David F.; Vapaavuori, Elina
2010-01-01
Gene expression responses of paper birch (Betula papyrifera) leaves to elevated concentrations of CO 2 and O 3 were studied with microarray analyses from three time points during the summer of 2004 at Aspen FACE. Microarray data were analyzed with clustering techniques, self-organizing maps, K-means clustering and Sammon's mappings, to detect similar gene expression patterns within sampling times and treatments. Most of the alterations in gene expression were caused by O 3 , alone or in combination with CO 2 . O 3 induced defensive reactions to oxidative stress and earlier leaf senescence, seen as decreased expression of photosynthesis- and carbon fixation-related genes, and increased expression of senescence-associated genes. The effects of elevated CO 2 reflected surplus of carbon that was directed to synthesis of secondary compounds. The combined CO 2 + O 3 treatment resulted in differential gene expression than with individual gas treatments or in changes similar to O 3 treatment, indicating that CO 2 cannot totally alleviate the harmful effects of O 3 . - Clustering analysis of birch leaf gene expression data reveals differential responses to O 3 and CO 2 .
Directory of Open Access Journals (Sweden)
Hirata Yoko
2010-11-01
Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a
Thierry, Magalie; Pasquis, Bruno; Buteau, Bénédicte; Fourgeux, Cynthia; Dembele, Doulaye; Leclere, Laurent; Gambert-Nicot, Ségolène; Acar, Niyazi; Bron, Alain M; Creuzot-Garcher, Catherine P; Bretillon, Lionel
2015-06-01
The lack of plasticity of neurons to respond to dietary changes, such as high fat and high fructose diets, by modulating gene and protein expression has been associated with functional and behavioral impairments that can have detrimental consequences. The inhibition of high fat-induced rewiring of hypothalamic neurons induced obesity. Feeding rodents with high fructose is a recognized and widely used model to trigger obesity and metabolic syndrome. However the adaptive response of the retina to short term feeding with high fructose is poorly documented. We therefore aimed to characterize both the functional and gene expression changes in the neurosensory retina of Brown Norway rats fed during 3 and 8 days with a 60%-rich fructose diet (n = 16 per diet and per time point). Glucose, insulin, leptin, triacylglycerols, total cholesterol, HDL-cholesterol, LDL-cholesterol and fructosamine were quantified in plasma (n = 8 in each group). Functionality of the inner retina was studied using scotopic single flash electroretinography (n = 8 in each group) and the individual response of rod and cone photoreceptors was determined using 8.02 Hz Flicker electroretinography (n = 8 in each group). Analysis of gene expression in the neurosensory retina was performed by Affymetrix genechips, and confirmed by RT-qPCR (n = 6 in each group). Elevated glycemia (+13%), insulinemia (+83%), and leptinemia (+172%) was observed after 8 days of fructose feeding. The cone photoreceptor response was altered at day 8 in high fructose fed rats (Δ = 0.5 log unit of light stimulus intensity). Affymetrix analysis of gene expression highlighted significant modulation of the pathways of eIF2 signaling and endoplasmic reticulum stress, regulation of eIF4 and p70S6K signaling, as well as mTOR signaling and mitochondrial dysfunction. RT-qPCR analysis confirmed the down regulation of Crystallins, Npy, Nid1 and Optc genes after 3 days of fructose feeding, and up regulation of End2. Meanwhile, a trend
Sherif , S. M.; Shukla, M. R.; Murch, S. J.; Bernier, L.; Saxena, P. K.
2016-01-01
Dutch elm disease (DED), caused by three fungal species in the genus Ophiostoma, is the most devastating disease of both native European and North American elm trees. Although many tolerant cultivars have been identified and released, the tolerance mechanisms are not well understood and true resistance has not yet been achieved. Here we show that the expression of disease-responsive genes in reactions leading to tolerance or susceptibility is significantly differentiated within the first 144 hours post-inoculation (hpi). Analysis of the levels of endogenous plant defense molecules such as jasmonic acid (JA) and salicylic acid (SA) in tolerant and susceptible American elm saplings suggested SA and methyl-jasmonate as potential defense response elicitors, which was further confirmed by field observations. However, the tolerant phenotype can be best characterized by a concurrent induction of JA and disease-responsive genes at 96 hpi. Molecular investigations indicated that the expression of fungal genes (i.e. cerato ulmin) was also modulated by endogenous SA and JA and this response was unique among aggressive and non-aggressive fungal strains. The present study not only provides better understanding of tolerance mechanisms to DED, but also represents a first, verified template for examining simultaneous transcriptomic changes during American elm-fungus interactions. PMID:26902398
Begara-Morales, Juan C; Sánchez-Calvo, Beatriz; Luque, Francisco; Leyva-Pérez, María O; Leterrier, Marina; Corpas, Francisco J; Barroso, Juan B
2014-06-01
S-Nitrosoglutathione (GSNO) is a nitric oxide-derived molecule that can regulate protein function by a post-translational modification designated S-nitrosylation. GSNO has also been detected in different plant organs under physiological and stress conditions, and it can also modulate gene expression. Thirty-day-old Arabidopsis plants were grown under hydroponic conditions, and exogenous 1 mM GSNO was applied to the root systems for 3 h. Differential gene expression analyses were carried out both in roots and in leaves by RNA sequencing (RNA-seq). A total of 3,263 genes were identified as being modulated by GSNO. Most of the genes identified were associated with the mechanism of protection against stress situations, many of these having previously been identified as target genes of GSNO by array-based methods. However, new genes were identified, such as that for methionine sulfoxide reductase (MSR) in leaves or different miscellaneous RNA (miscRNA) genes in Arabidopsis roots. As a result, 1,945 GSNO-responsive genes expressed differently in leaves and roots were identified, and 114 of these corresponded exclusively to one of these organs. In summary, it is demonstrated that RNA-seq extends our knowledge of GSNO as a signaling molecule which differentially modulates gene expression in roots and leaves under non-stress conditions. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Rode, Tone Mari; Berget, Ingunn; Langsrud, Solveig; Møretrø, Trond; Holck, Askild
2009-07-01
Microorganisms are constantly exposed to new and altered growth conditions, and respond by changing gene expression patterns. Several methods for studying gene expression exist. During the last decade, the analysis of microarrays has been one of the most common approaches applied for large scale gene expression studies. A relatively new method for gene expression analysis is MassARRAY, which combines real competitive-PCR and MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry. In contrast to microarray methods, MassARRAY technology is suitable for analysing a larger number of samples, though for a smaller set of genes. In this study we compare the results from MassARRAY with microarrays on gene expression responses of Staphylococcus aureus exposed to acid stress at pH 4.5. RNA isolated from the same stress experiments was analysed using both the MassARRAY and the microarray methods. The MassARRAY and microarray methods showed good correlation. Both MassARRAY and microarray estimated somewhat lower fold changes compared with quantitative real-time PCR (qRT-PCR). The results confirmed the up-regulation of the urease genes in acidic environments, and also indicated the importance of metal ion regulation. This study shows that the MassARRAY technology is suitable for gene expression analysis in prokaryotes, and has advantages when a set of genes is being analysed for an organism exposed to many different environmental conditions.
Directory of Open Access Journals (Sweden)
Andrea D McCue
2012-02-01
Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs
Aguado, Ana; Capote, Nieves; Romero, Fernando; Dodd, Ian C; Colmenero-Flores, José M
2014-10-01
To investigate effects of soil moisture heterogeneity on plant physiology and gene expression in roots and leaves, three treatments were implemented in sunflower plants growing with roots split between two compartments: a control (C) treatment supplying 100% of plant evapotranspiration, and two treatments receiving 50% of plant evapotranspiration, either evenly distributed to both compartments (deficit irrigation - DI) or unevenly distributed to ensure distinct wet and dry compartments (partial rootzone drying - PRD). Plants receiving the same amount of water responded differently under the two irrigation systems. After 3 days, evapotranspiration was similar in C and DI, but 20% less in PRD, concomitant with decreased leaf water potential (Ψleaf) and increased leaf xylem ABA concentration. Six water-stress responsive genes were highly induced in roots growing in the drying soil compartment of PRD plants, and their expression was best correlated with local soil water content. On the other hand, foliar gene expression differed significantly from that of the root and correlated better with xylem ABA concentration and Ψleaf. While the PRD irrigation strategy triggered stronger physiological and molecular responses, suggesting a more intense and systemic stress reaction due to local dehydration of the dry compartment of PRD plants, the DI strategy resulted in similar water savings without strongly inducing these responses. Correlating physiological and molecular responses in PRD/DI plants may provide insights into the severity and location of water deficits and may enable a better understanding of long-distance signalling mechanisms. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Peng, Maoxiao; Niu, Donghong; Wang, Fei; Chen, Zhiyi; Li, Jiale
2016-08-01
Complement component 3 (C3) is central to the complement system, playing an important role in immune defense, immune regulation and immune pathology. Several C3 genes have been characterized in invertebrates but very few in shellfish. The C3 gene was identified from the razor clam Sinonovacula constricta, referred to here as Sc-C3. It was found to be highly homologous with the C3 gene of Ruditapes decussatus. All eight model motifs of the C3 gene were found to be included in the thiolester bond and the C345C region. Sc-C3 was widely expressed in all healthy tissues with expression being highest in hemolymph. A significant difference in expression was revealed at the umbo larvae development stage. The expression of Sc-C3 was highly regulated in the hemolymph and liver, with a distinct response pattern being noted after a challenge with Micrococcus lysodeikticus and Vibrio parahemolyticus. It is therefore suggested that a complicated and unique response pathway may be present in S. constricta. Further, serum of S. constricta containing Sc-C3 was extracted. This was activated by LPS or bacterium for verification for function. The more obvious immune function of Sc-C3 was described as an effective membrane rupture in hemocyte cells of rabbit, V. parahemolyticus and Vibrio anguillarum. Thus, Sc-C3 plays an essential role in the immune defense of S. constricta. Copyright © 2016 Elsevier Ltd. All rights reserved.
Pan, Ya-Jie; Liu, Jia; Guo, Xiao-Rui; Zu, Yuan-Gang; Tang, Zhong-Hua
2015-05-01
Research on transcriptional regulation of terpenoid indole alkaloid (TIA) biosynthesis of the medicinal plant, Catharanthus roseus, has largely been focused on gene function and not clustering analysis of multiple genes at the transcript level. Here, more than ten key genes encoding key enzyme of alkaloid synthesis in TIA biosynthetic pathways were chosen to investigate the integrative responses to exogenous elicitor ethylene and copper (Cu) at both transcriptional and metabolic levels. The ethylene-induced gene transcripts in leaves and roots, respectively, were subjected to principal component analysis (PCA) and the results showed the overall expression of TIA pathway genes indicated as the Q value followed a standard normal distribution after ethylene treatments. Peak gene expression was at 15-30 μM of ethephon, and the pre-mature leaf had a higher Q value than the immature or mature leaf and root. Treatment with elicitor Cu found that Cu up-regulated overall TIA gene expression more in roots than in leaves. The combined effects of Cu and ethephon on TIA gene expression were stronger than their separate effects. It has been documented that TIA gene expression is tightly regulated by the transcriptional factor (TF) ethylene responsive factor (ERF) and mitogen-activated protein kinase (MAPK) cascade. The loading plot combination with correlation analysis for the genes of C. roseus showed that expression of the MPK gene correlated with strictosidine synthase (STR) and strictosidine b-D-glucosidase(SGD). In addition, ERF expression correlated with expression of secologanin synthase (SLS) and tryptophan decarboxylase (TDC), specifically in roots, whereas MPK and myelocytomatosis oncogene (MYC) correlated with STR and SGD genes. In conclusion, the ERF regulates the upstream pathway genes in response to heavy metal Cu mainly in C. roseus roots, while the MPK mainly participates in regulating the STR gene in response to ethylene in pre-mature leaf. Interestingly, the
International Nuclear Information System (INIS)
Zhang, Zheng; Jin, Bo; Jin, Yaqiong; Huang, Shengquan; Niu, Xiaohua; Mao, Zebin; Xin, Dianqi
2017-01-01
Androgens (AR) play an important role in initiation and progression of prostate cancer. It has been shown that AR exert their effects mainly through the androgen-activated AR which binds to androgen response elements (AREs) in the regulatory regions of target genes to regulate the transcription of androgen-responsive genes, thus, identification of AR downstream target gene is critical to understand androgen function in prostate cancer. In this study, our results showed that androgen treatment of LNCaP cells induced PTTG1 expression, which was blocked by the androgen receptor antagonist, Casodex. Bioinformatics analysis and experiments using PTTG1 promoter deletion mutants showed that the PTTG1 promoter contains a putative androgen response element (ARE), which localizes in the −851 to −836 region of the promoter. Androgen activated androgen receptor (AR) binding to this ARE was confirmed by Chromatin immunoprecipitation (ChIP) assay. Furthermore, Knockdown of PTTG1 expression using short hairpin RNA significantly reduced androgen-induced LNCaP cell growth and invasion. In addition, we showed PTTG1 is highly expressed in metastasis prostate cancer tissue. These results suggest that PTTG1 is a novel downstream target gene of androgen receptor and take part in prostate cancer proliferation and metastasis. - Highlights: • Androgen treatment of LNCaP cells induced PTTG1 expression. • Knockdown of PTTG1 expression significantly reduced androgen-induced LNCaP cell growth and invasion. • PTTG1 is highly expressed in metastasis prostate cancer tissue. • PTTG1 is a novel downstream target gene of androgen receptor.
Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao
2015-05-01
Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue. Copyright © 2015 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Vigeland, Magnus D; Spannagl, Manuel; Asp, Torben
2013-01-01
Adaptation to temperate environments is common in the grass subfamily Pooideae, suggesting an ancestral origin of cold climate adaptation. Here, we investigated substitution rates of genes involved in low-temperature-induced (LTI) stress responses to test the hypothesis that adaptive molecular...... evolution of LTI pathway genes was important for Pooideae evolution. Substitution rates and signatures of positive selection were analyzed using 4330 gene trees including three warm climate-adapted species (maize (Zea mays), sorghum (Sorghum bicolor), and rice (Oryza sativa)) and five temperate Pooideae...... species (Brachypodium distachyon, wheat (Triticum aestivum), barley (Hordeum vulgare), Lolium perenne and Festuca pratensis). Nonsynonymous substitution rate differences between Pooideae and warm habitat-adapted species were elevated in LTI trees compared with all trees. Furthermore, signatures...
Peng, Hui; Yang, Tianbao; Jurick, Wayne M.
2014-01-01
Calmodulin, a ubiquitous calcium sensor, plays an important role in decoding stress-triggered intracellular calcium changes and regulates the functions of numerous target proteins involved in various plant physiological responses. To determine the functions of calmodulin in fleshy fruit, expression studies were performed on a family of six calmodulin genes (SlCaMs) in mature-green stage tomato fruit in response to mechanical injury and Botrytis cinerea infection. Both wounding and pathogen in...
Ng, Tsz Wai; Chan, Wing Lam; Lai, Ka Man
2017-12-01
Other than the needs for infection control to investigate the survival and inactivation of airborne bacterial pathogens, there has been a growing interest in exploring bacterial communities in the air and the effect of environmental variables on them. However, the innate biological mechanism influencing the bacterial viability is still unclear. In this study, a mutant-based approach, using Escherichia coli as a model, was used to prove the concept that common stress-response genes are important for airborne survival of bacteria. Mutants with a single gene knockout that are known to respond to general stress (rpoS) and oxidative stress (oxyR, soxR) were selected in the study. Low relative humidity (RH), 30-40% was more detrimental to the bacteria than high RH, >90%. The log reduction of ∆rpoS was always higher than that of the parental strain at all RH levels but the ∆oxyR had a higher log reduction than the parental strain at intermediate RH only. ∆soxR had the same viability compared to the parental strain at all RH levels. The results hint that although different types and levels of stress are produced under different RH conditions, stress-response genes always play a role in the bacterial viability. This study is the first reporting the association between stress-response genes and viability of airborne bacteria.
Lee, Sang Yoon; Nam, Yoon Kwon
2016-11-01
A novel metallothionein (MT) gene from the Pacific abalone H. discus hannai was characterized and its mRNA expression patterns (tissue distribution, developmental expression and differential expression in responsive to various in vivo stimulatory treatments) were examined. Abalone MT shares conserved structural features with previously known gastropod orthologs at both genomic (i.e., tripartite organization) and amino acid (conserved Cys motifs) levels. The 5'-flanking regulatory region of abalone MT gene displayed various transcription factor binding motifs particularly including ones related with metal regulation and stress/immune responses. Tissue distribution and basal expression patterns of MT mRNAs indicated a potential association between ovarian MT expression and sexual maturation. Developmental expression pattern suggested the maternal contribution of MT mRNAs to embryonic and early larval developments. Abalone MT mRNAs could be significantly induced by various heavy metals in different tissues (gill, hepatopancreas, muscle and hemocyte) in a tissue- and/or metal-dependent fashion. In addition, the abalone MT gene was highly modulated in responsive to other non-metal, stimulatory treatments such as immune challenge (LPS, polyI:C and bacterial injections), hypoxia (decrease from normoxia 8 ppm-2 ppm), thermal elevation (increase from 20 °C to 30 °C), and xenobiotic exposure (250 ppb of 17α-ethynylestradiol and 0.25 ppb of 2,3,7,8-tetrachlorodibenzodioxin) where differential expression patterns were toward either up- or down-regulation depending on types of stimulations and tissues examined. Taken together, our results highlight that MT is a multifunctional effector playing in wide criteria of cellular pathways especially associated with development and stress responses in this abalone species. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ohira, Tomotaka; Ohira, Takashi; Kawano, F.; Shibaguchi, T.; Okabe, H.; Ohno, Y.; Nakai, N.; Ochiai, T.; Goto, K.; Ohira, Y.
2013-02-01
Neck muscles are known to play important roles in the maintenance of head posture against gravity. However, it is not known how the properties of neck muscle are influenced by gravity. Therefore, the current study was performed to investigate the responses of neck muscle (rhomboideus capitis) in mice to inhibition of gravity and/or increase to 2-G for 3 months to test the hypothesis that the properties of neck muscles are regulated in response to the level of mechanical load applied by the gravitational load. Three male wild type C57BL/10J mice (8 weeks old) were launched by space shuttle Discovery (STS-128) and housed in Japanese Experimental Module “KIBO” on the International Space Station in mouse drawer system (MDS) project, which was organized by Italian Space Agency. Only 1 mouse returned to the Earth alive after 3 months by space shuttle Atlantis (STS-129). Neck muscles were sampled from both sides within 3 hours after landing. Cage and laboratory control experiments were also performed on the ground. Further, 3-month ground-based control experiments were performed with 6 groups, i.e. pre-experiment, 3-month hindlimb suspension, 2-G exposure by using animal centrifuge, and vivarium control (n=5 each group). Five mice were allowed to recover from hindlimb suspension (including 5 cage control) for 3 months in the cage. Neck muscles were sampled bilaterally before and after 3-month suspension and 2-G exposure, and at the end of 3-month ambulation recovery. Spaceflight-associated shift of myosin heavy chain phenotype from type I to II and atrophy of type I fibers were observed. In response to spaceflight, 17 genes were up-regulated and 13 genes were down-regulated vs. those in the laboratory control. Expression of 6 genes were up-regulated and that of 88 genes were down-regulated by 3-month exposure to 2-G vs. the age-matched cage control. In response to chronic hindlimb suspension, 4 and 20 genes were up- or down-regulated. Further, 98 genes responded
Itzhaki, H; Maxson, J M; Woodson, W R
1994-09-13
The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.
Adebambo, Oluwadamilare A.; Ray, Paul D.; Shea, Damian; Fry, Rebecca C.
2016-01-01
Exposure to elevated levels of the toxic metals inorganic arsenic (iAs) and cadmium (Cd) represents a major global health problem. These metals often occur as mixtures in the environment, creating the potential for interactive or synergistic biological effects different from those observed in single exposure conditions. In the present study, environmental mixtures collected from two waste sites in China and comparable mixtures prepared in the laboratory were tested for toxicogenomic response in placental JEG-3 cells. These cells serve as a model for evaluating cellular responses to exposures during pregnancy. One of the mixtures was predominated by iAs and one by Cd. Six gene biomarkers were measured in order to evaluate the effects from the metals mixtures using dose and time-course experiments including: heme oxygenase 1 (HO-1) and metallothionein isoforms (MT1A, MT1F and MT1G) previously shown to be preferentially induced by exposure to either iAs or Cd, and metal transporter genes aquaporin-9 (AQP9) and ATPase, Cu2+ transporting, beta polypeptide (ATP7B). There was a significant increase in the mRNA expression levels of ATP7B, HO-1, MT1A, MT1F, and MT1G in mixture-treated cells compared to the iAs or Cd only-treated cells. Notably, the genomic responses were observed at concentrations significantly lower than levels found at the environmental collection sites. These data demonstrate that metal mixtures increase the expression of gene biomarkers in placental JEG-3 cells in a synergistic manner. Taken together, the data suggest that toxic metals that co-occur may induce detrimental health effects that are currently underestimated when analyzed as single metals. PMID:26472158
Directory of Open Access Journals (Sweden)
Charanpreet eKaur
2015-09-01
Full Text Available Methylglyoxal (MG is a toxic metabolite produced primarily as a byproduct of glycolysis. Being a potent glycating agent, it can readily bind macromolecules like DNA, RNA or proteins, modulating their expression and activity. In plants, despite the known inhibitory effects of MG on growth and development, still limited information is available about the molecular mechanisms and response pathways elicited upon elevation in MG levels. To gain insight into the molecular basis of MG response, we have investigated changes in global gene expression profiles in rice upon exposure to exogenous MG using GeneChip microarrays. Initially, growth of rice seedlings was monitored in response to increasing MG concentrations which could retard plant growth in a dose-dependent manner. Upon exposure to 10 mM concentration of MG, a total of 1685 probe sets were up- or down-regulated by more than 1.5-fold in shoot tissues within 16 h. These were classified into ten functional categories. The genes involved in signal transduction such as, protein kinases and transcription factors, were significantly over-represented in the perturbed transcriptome, of which several are known to be involved in abiotic and biotic stress response indicating a cross-talk between MG-responsive and stress-responsive signal transduction pathways. Through in silico studies, we could predict 7-8 bp long conserved motif as a possible MG-responsive element (MGRE in the 1 kb upstream region of genes that were more than ten-fold up- or down-regulated in the analysis. Since several perturbations were found in signaling cascades in response to MG, we hereby suggest that it plays an important role in signal transduction probably acting as a stress signal molecule.
Parrott, Roxanne; Smith, Rachel A
2014-01-01
Evidence supports mixed attributions aligned with personal and/or clinical control and gene expression for health in this era of genomic science and health care. We consider variance in these attributions and possible relationships to individual mind sets associated with essentialist beliefs that genes determine health versus threat beliefs that genes increase susceptibility for disease and severity linked to gene-environment interactions. Further, we contribute to theory and empirical research to evaluate the use of metaphors to define genes. Participants (N = 324) read a message that varied the introduction by providing a definition of genes that used either an "instruction" metaphor or a "blueprint" metaphor. The "instruction" metaphor compared to the "blueprint" metaphor promoted stronger threat perceptions, which aligned with both belief in the response efficacy of genetic research for health and perceived behavioral control linked to genes and health. The "blueprint" metaphor compared to the "instruction" metaphor promoted stronger essentialist beliefs, which aligned with more intense positive regard for the efficacy of genetic research and human health. Implications for health communicators include societal effects aligned with stigma and discrimination that such findings portend.
Directory of Open Access Journals (Sweden)
Ryan James C
2010-08-01
Full Text Available Abstract Background Ciguatoxins (CTXs are polyether marine neurotoxins and potent activators of voltage-gated sodium channels. This toxin is carried by multiple reef-fish species and human consumption of ciguatoxins can result in an explosive gastrointestinal/neurologic illness. This study characterizes the global transcriptional response in mouse brain to a symptomatic dose of the highly toxic Pacific ciguatoxin P-CTX-1 and additionally compares this data to transcriptional profiles from liver and whole blood examined previously. Adult male C57/BL6 mice were injected with 0.26 ng/g P-CTX-1 while controls received only vehicle. Animals were sacrificed at 1, 4 and 24 hrs and transcriptional profiling was performed on brain RNA with Agilent whole genome microarrays. RT-PCR was used to independently validate gene expression and the web tool DAVID was used to analyze gene ontology (GO and molecular pathway enrichment of the gene expression data. Results A pronounced 4°C hypothermic response was recorded in these mice, reaching a minimum at 1 hr and lasting for 8 hrs post toxin exposure. Ratio expression data were filtered by intensity, fold change and p-value, with the resulting data used for time course analysis, K-means clustering, ontology classification and KEGG pathway enrichment. Top GO hits for this gene set included acute phase response and mono-oxygenase activity. Molecular pathway analysis showed enrichment for complement/coagulation cascades and metabolism of xenobiotics. Many immediate early genes such as Fos, Jun and Early Growth Response isoforms were down-regulated although others associated with stress such as glucocorticoid responsive genes were up-regulated. Real time PCR confirmation was performed on 22 differentially expressed genes with a correlation of 0.9 (Spearman's Rho, p Conclusions Many of the genes differentially expressed in this study, in parallel with the hypothermia, figure prominently in protection against
Tao, Jian-Jun; Wei, Wei; Pan, Wen-Jia; Lu, Long; Li, Qing-Tian; Ma, Jin-Biao; Zhang, Wan-Ke; Ma, Biao; Chen, Shou-Yi; Zhang, Jin-Song
2018-02-09
Alfin-like (AL) is a small plant-specific gene family with prominent roles in root growth and abiotic stress response. Here, we aimed to identify novel stress tolerance AL genes from the stress-tolerant species Atriplex hortensis. Totally, we isolated four AhAL genes, all encoding nuclear-localized proteins with cis-element-binding and transrepression activities. Constitutive expression of AhAL1 in Arabidopsis facilitated plants to survive under saline condition, while expressing anyone of the other three AhAL genes led to salt-hypersensitive response, indicating functional divergence of AhAL family. AhAL1 also conferred enhanced drought tolerance, as judged from enhanced survival, improved growth, decreased malonaldehyde (MDA) content and reduced water loss in AhAL1-expressing plants compared to WT. In addition, abscisic acid (ABA)-mediated stomatal closure and inhibition of seed germination and primary root elongation were enhanced in AhAL1-transgenic plants. Further analysis demonstrated that AhAL1 could bind to promoter regions of GRF7, DREB1C and several group-A PP2C genes and repress their expression. Correspondingly, the expression levels of positive stress regulator genes DREB1A, DREB2A and three ABFs were all increased in AhAL1-expressing plants. Based on these results, AhAL1 was identified as a novel candidate gene for improving abiotic stress tolerance of crop plants.
Pacheco Coello, Ricardo; Chávez Navarrete, Tatiana; Navarrete Villegas, Oscar; Santos Ordóñez, Efrén
2016-01-01
Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession ‘Calcutta-4’ has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in ‘Calcutta-4’ might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession ‘Calcutta-4’. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in ‘Calcutta-4’ when compared to ‘Williams’ after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of ‘Calcutta-4
DEFF Research Database (Denmark)
Halappanavar, Sabina; Jackson, Petra; Williams, Andrew
2011-01-01
with acute phase, inflammation and immune response 5 days post exposure with concomitant changes in several miRNAs. The role of these miRNAs in pulmonary response to inhaled particles is unknown and warrants further research. Environ. Mol. Mutagen., 2011. © 2011 Wiley‐Liss, Inc....... in increased levels of mRNA for acute phase markers serum amyloid A‐1 (Saa1) and serum amyloid A‐3 (Saa3), several C‐X‐C and C‐C motif chemokines, and cytokine tumor necrosis factor genes. Protein analysis of Saa1 and 3 showed selective upregulation of Saa3 in lung tissues. Sixteen miRNAs were induced by more...... than 1.2‐fold (adjusted P‐value changes in the expression of genes associated...
Directory of Open Access Journals (Sweden)
James eReynolds
2015-03-01
Full Text Available Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here we explored the transcriptional response of genes associated with polycomb repressor complex (PRC 1 (Ring1A and Ring1B and Bmi1 and PRC2 (Ezh1, Ezh2 and Suz12, as well as additional transcriptional regulators Sirt1, Yy1 and Yy2, in a mouse model of status epilepticus. Findings were contrasted to changes after status epilepticus in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed status epilepticus prompted an early (1 h increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4 , 8 and 24 h. Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12 and Yy2 relative to the normal injury response to status epilepticus. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes polycomb group gene expression following status epilepticus and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.
DEFF Research Database (Denmark)
Ohnuma, Takayuki; Numata, Tomoyuki; Osawa, Takuo
2011-01-01
Expression of a class V chitinase gene (At4g19810, AtChiC) in Arabidopsis thaliana was examined by quantitative real-time PCR and by analyzing microarray data available at Genevestigator. The gene expression was induced by the plant stress-related hormones abscisic acid (ABA) and jasmonic acid (JA......, the amino acid residues responsible for substrate binding were found to be well conserved when compared with those of the class V chitinase from Nicotiana tabacum (NtChiV). All of the structural and functional properties of AtChiC are quite similar to those obtained for NtChiV, and seem to be common...
Li, Honglei; Thiyagarajan, Vengatesen; Qian, Pei Yuan
2010-01-01
Quantitative real-time PCR was used to further our understanding of the molecular processes involved in the attachment and metamorphosis of larval barnacles. We report the effects of natural settlement cues (microbial biofilms and conspecific settlement-inducing factor) on the expression profiles of six barnacle cyprid specific (bcs) genes in cyprids of the barnacle Balanus (=Amphibalanus) amphitrite Darwin. Genes bcs-1 to bcs-5 all showed marked decreases in their expression between initial cyprid attachment and the completion of metamorphosis, whereas bcs-6 showed significant up-regulation. Generally, settlement cues exerted no significant effect on the decreasing trend of bcs-1 to bcs-5 expression during attachment and metamorphosis. However, the expression of bcs-6 increased prior to cyprid attachment in response to both settlement cues. This elevated expression of bcs-6 gene indicates the importance and key regulatory role of this specific gene to larval attachment and metamorphosis in this barnacle species. © 2010 Elsevier B.V. All rights reserved.
Li, Honglei
2010-06-01
Quantitative real-time PCR was used to further our understanding of the molecular processes involved in the attachment and metamorphosis of larval barnacles. We report the effects of natural settlement cues (microbial biofilms and conspecific settlement-inducing factor) on the expression profiles of six barnacle cyprid specific (bcs) genes in cyprids of the barnacle Balanus (=Amphibalanus) amphitrite Darwin. Genes bcs-1 to bcs-5 all showed marked decreases in their expression between initial cyprid attachment and the completion of metamorphosis, whereas bcs-6 showed significant up-regulation. Generally, settlement cues exerted no significant effect on the decreasing trend of bcs-1 to bcs-5 expression during attachment and metamorphosis. However, the expression of bcs-6 increased prior to cyprid attachment in response to both settlement cues. This elevated expression of bcs-6 gene indicates the importance and key regulatory role of this specific gene to larval attachment and metamorphosis in this barnacle species. © 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ida Casorelli
Full Text Available BACKGROUND: The Mutyh DNA glycosylase is involved in the repair of oxidized DNA bases. Mutations in the human MUTYH gene are responsible for colorectal cancer in familial adenomatous polyposis. Since defective DNA repair genes might contribute to the increased cancer risk associated with inflammatory bowel diseases, we compared the inflammatory response of wild-type and Mutyh(-/- mice to oxidative stress. METHODOLOGY/PRINCIPAL FINDINGS: The severity of colitis, changes in expression of genes involved in DNA repair and inflammation, DNA 8-oxoguanine levels and microsatellite instability were analysed in colon of mice treated with dextran sulfate sodium (DSS. The Mutyh(-/- phenotype was associated with a significant accumulation of 8-oxoguanine in colon DNA of treated mice. A single DSS cycle induced severe acute ulcerative colitis in wild-type mice, whereas lesions were modest in Mutyh(-/- mice, and this was associated with moderate variations in the expression of several cytokines. Eight DSS cycles caused chronic colitis in both wild-type and Mutyh(-/- mice. Lymphoid hyperplasia and a significant reduction in Foxp3(+ regulatory T cells were observed only in Mutyh(-/- mice. CONCLUSIONS: The findings indicate that, in this model of ulcerative colitis, Mutyh plays a major role in maintaining intestinal integrity by affecting the inflammatory response.
Zhou, Aimin; Ma, Hongping; Liu, Enhui; Jiang, Tongtong; Feng, Shuang; Gong, Shufang; Wang, Jingang
2017-04-17
Dianthus spiculifolius , a perennial herbaceous flower and a member of the Caryophyllaceae family, has strong resistance to cold and drought stresses. To explore the transcriptional responses of D. spiculifolius to individual and combined stresses, we performed transcriptome sequencing of seedlings under normal conditions or subjected to cold treatment (CT), simulated drought treatment (DT), or their combination (CTDT). After de novo assembly of the obtained reads, 112,015 unigenes were generated. Analysis of differentially expressed genes (DEGs) showed that 2026, 940, and 2346 genes were up-regulated and 1468, 707, and 1759 were down-regulated in CT, DT, and CTDT samples, respectively. Among all the DEGs, 182 up-regulated and 116 down-regulated genes were identified in all the treatment groups. Analysis of metabolic pathways and regulatory networks associated with the DEGs revealed overlaps and cross-talk between cold and drought stress response pathways. The expression profiles of the selected DEGs in CT, DT, and CTDT samples were characterized and confirmed by quantitative RT-PCR. These DEGs and metabolic pathways may play important roles in the response of D. spiculifolius to the combined stress. Functional characterization of these genes and pathways will provide new targets for enhancement of plant stress tolerance through genetic manipulation.
Directory of Open Access Journals (Sweden)
Aili Li
Full Text Available Hydrogen peroxide (H(2O(2 plays important roles in plant biotic and abiotic stress responses. However, the effect of H(2O(2 stress on the bread wheat transcriptome is still lacking. To investigate the cellular and metabolic responses triggered by H(2O(2, we performed an mRNA tag analysis of wheat seedlings under 10 mM H(2O(2 treatment for 6 hour in one powdery mildew (PM resistant (PmA and two susceptible (Cha and Han lines. In total, 6,156, 6,875 and 3,276 transcripts were found to be differentially expressed in PmA, Han and Cha respectively. Among them, 260 genes exhibited consistent expression patterns in all three wheat lines and may represent a subset of basal H(2O(2 responsive genes that were associated with cell defense, signal transduction, photosynthesis, carbohydrate metabolism, lipid metabolism, redox homeostasis, and transport. Among genes specific to PmA, 'transport' activity was significantly enriched in Gene Ontology analysis. MapMan classification showed that, while both up- and down- regulations were observed for auxin, abscisic acid, and brassinolides signaling genes, the jasmonic acid and ethylene signaling pathway genes were all up-regulated, suggesting H(2O(2-enhanced JA/Et functions in PmA. To further study whether any of these genes were involved in wheat PM response, 19 H(2O(2-responsive putative defense related genes were assayed in wheat seedlings infected with Blumeria graminis f. sp. tritici (Bgt. Eight of these genes were found to be co-regulated by H(2O(2 and Bgt, among which a fatty acid desaturase gene TaFAD was then confirmed by virus induced gene silencing (VIGS to be required for the PM resistance. Together, our data presents the first global picture of the wheat transcriptome under H(2O(2 stress and uncovers potential links between H(2O(2 and Bgt responses, hence providing important candidate genes for the PM resistance in wheat.
Terabayashi, Yasunobu; Sano, Motoaki; Yamane, Noriko; Marui, Junichiro; Tamano, Koichi; Sagara, Junichi; Dohmoto, Mitsuko; Oda, Ken; Ohshima, Eiji; Tachibana, Kuniharu; Higa, Yoshitaka; Ohashi, Shinichi; Koike, Hideaki; Machida, Masayuki
2010-12-01
Kojic acid is produced in large amounts by Aspergillus oryzae as a secondary metabolite and is widely used in the cosmetic industry. Glucose can be converted to kojic acid, perhaps by only a few steps, but no genes for the conversion have thus far been revealed. Using a DNA microarray, gene expression profiles under three pairs of conditions significantly affecting kojic acid production were compared. All genes were ranked using an index parameter reflecting both high amounts of transcription and a high induction ratio under producing conditions. After disruption of nine candidate genes selected from the top of the list, two genes of unknown function were found to be responsible for kojic acid biosynthesis, one having an oxidoreductase motif and the other a transporter motif. These two genes are closely associated in the genome, showing typical characteristics of genes involved in secondary metabolism. Copyright © 2010 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hei Tom K
2010-07-01
Full Text Available Abstract Background The existence of a radiation bystander effect, in which non-irradiated cells respond to signals from irradiated cells, is well established. To understand early signaling and gene regulation in bystander cells, we used a bio-informatics approach, measuring global gene expression at 30 minutes and signaling pathways between 30 minutes and 4 hours after exposure to α-particles in IMR-90 fibroblasts. Methods We used whole human genome microarrays and real time quantitative PCR to measure and validate gene expression. Microarray analysis was done using BRB-Array Tools; pathway and ontology analyses were done using Ingenuity Pathway Analysis and PANTHER, respectively. We studied signaling in irradiated and bystander cells using immunoblotting and semi-quantitative image analysis. Results Gene ontology suggested signal transduction and transcriptional regulation responding 30 minutes after treatment affected cell structure, motility and adhesion, and interleukin synthesis. We measured time-dependent expression of genes controlled by the NF-κB pathway; matrix metalloproteinases 1 and 3; chemokine ligands 2, 3 and 5 and interleukins 1β, 6 and 33. There was an increased response of this set of genes 30 minutes after treatment and another wave of induction at 4 hours. We investigated AKT-GSK3β signaling and found both AKT and GSK3β are hyper-phosphorylated 30 minutes after irradiation and this effect is maintained through 4 hours. In bystander cells, a similar response was seen with a delay of 30 minutes. We proposed a network model where the observed decrease in phosphorylation of β-catenin protein after GSK3β dependent inactivation can trigger target gene expression at later times after radiation exposure Conclusions These results are the first to show that the radiation induced bystander signal induces a widespread gene expression response at 30 minutes after treatment and these changes are accompanied by modification of
Órpez-Zafra, Teresa; Pinto-Medel, María Jesús; Oliver-Martos, Begoña; Ortega-Pinazo, Jesús; Arnáiz, Carlos; Guijarro-Castro, Cristina; Varadé, Jezabel; Álvarez-Lafuente, Roberto; Urcelay, Elena; Sánchez-Jiménez, Francisca
2013-01-01
TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO) and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10−4, pc = 0.048, OR = 0.30). This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A), a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells) were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS. PMID:23658636
Directory of Open Access Journals (Sweden)
Carlos López-Gómez
Full Text Available TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10(-4, pc = 0.048, OR = 0.30. This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A, a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS.
Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong
2017-10-19
Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.
Directory of Open Access Journals (Sweden)
O. V. Blazhenko
2014-02-01
Full Text Available In a previous study we cloned GSH2 gene, encoding γ-glutamylcysteine synthetase (γGCS in the yeast Hansenula рolymorpha. In this study an analysis of molecular organisation of the H. рolymorpha GSH2 gene promoter was conducted and the potential binding sites of Yap1, Skn7, Creb/Atf1, and Cbf1 transcription factors were detected. It was established that full regulation of GSH2 gene expression in the response to cadmium and oxidative stress requires the length of GSH2 promoter to be longer than 450 bp from the start of translation initiation. To study the transcriptional regulation of H. polymorpha GSH2 gene recombinant strain, harbouring a reporter system, in which 1.832 kb regulatory region of GSH2 gene was fused to structural and terminatory regions of alcohol oxidase gene, was constructed. It was shown that maximum increase in H. polymorpha GSH2 gene transcription by 33% occurs in the rich medium under four-hour incubation with 1 μM concentration of cadmium ions. In the minimal medium the GSH2 gene expression does not correlate with the increased total cellular glutathione levels under cadmium ion treatment. We assume that the increased content of total cellular glutathione under cadmium stress in the yeast H. polymorpha probably is not controlled on the level of GSH2 gene transcription.
Sood, Archit; Jaiswal, Varun; Chanumolu, Sree Krishna; Malhotra, Nikhil; Pal, Tarun; Chauhan, Rajinder Singh
2014-11-01
Jatropha (Jatropha curcas L.) and Castor bean (Ricinus communis) are oilseed crops of family Euphorbiaceae with the potential of producing high quality biodiesel and having industrial value. Both the bioenergy plants are becoming susceptible to various biotic stresses directly affecting the oil quality and content. No report exists as of today on analysis of Nucleotide Binding Site-Leucine Rich Repeat (NBS-LRR) gene repertoire and defense response transcription factors in both the plant species. In silico analysis of whole genomes and transcriptomes identified 47 new NBS-LRR genes in both the species and 122 and 318 defense response related transcription factors in Jatropha and Castor bean, respectively. The identified NBS-LRR genes and defense response transcription factors were mapped onto the respective genomes. Common and unique NBS-LRR genes and defense related transcription factors were identified in both the plant species. All NBS-LRR genes in both the species were characterized into Toll/interleukin-1 receptor NBS-LRRs (TNLs) and coiled-coil NBS-LRRs (CNLs), position on contigs, gene clusters and motifs and domains distribution. Transcript abundance or expression values were measured for all NBS-LRR genes and defense response transcription factors, suggesting their functional role. The current study provides a repertoire of NBS-LRR genes and transcription factors which can be used in not only dissecting the molecular basis of disease resistance phenotype but also in developing disease resistant genotypes in Jatropha and Castor bean through transgenic or molecular breeding approaches.
Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante
2015-11-01
Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.
Mechanisms of radiation-induced gene responses
International Nuclear Information System (INIS)
Woloschak, G.E.; Paunesku, T.
1996-01-01
In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5' region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3' region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts; however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process
Directory of Open Access Journals (Sweden)
Sadegh Mousavi
Full Text Available Almond (Prunus dulcis Mill., one of the most important nut crops, requires chilling during winter to develop fruiting buds. However, early spring chilling and late spring frost may damage the reproductive tissues leading to reduction in the rate of productivity. Despite the importance of transcriptional changes and regulation, little is known about the almond's transcriptome under the cold stress conditions. In the current research, we used RNA-seq technique to study the response of the reproductive tissues of almond (anther and ovary to frost stress. RNA sequencing resulted in more than 20 million reads from anther and ovary tissues of almond, individually. About 40,000 contigs were assembled and annotated de novo in each tissue. Profile of gene expression in ovary showed significant alterations in 5,112 genes, whereas in anther 6,926 genes were affected by freezing stress. Around two thousands of these genes were common altered genes in both ovary and anther libraries. Gene ontology indicated the involvement of differentially expressed (DE genes, responding to freezing stress, in metabolic and cellular processes. qRT-PCR analysis verified the expression pattern of eight genes randomly selected from the DE genes. In conclusion, the almond gene index assembled in this study and the reported DE genes can provide great insights on responses of almond and other Prunus species to abiotic stresses. The obtained results from current research would add to the limited available information on almond and Rosaceae. Besides, the findings would be very useful for comparative studies as the number of DE genes reported here is much higher than that of any previous reports in this plant.
Mousavi, Sadegh; Alisoltani, Arghavan; Shiran, Behrouz; Fallahi, Hossein; Ebrahimie, Esameil; Imani, Ali; Houshmand, Saadollah
2014-01-01
Almond (Prunus dulcis Mill.), one of the most important nut crops, requires chilling during winter to develop fruiting buds. However, early spring chilling and late spring frost may damage the reproductive tissues leading to reduction in the rate of productivity. Despite the importance of transcriptional changes and regulation, little is known about the almond's transcriptome under the cold stress conditions. In the current research, we used RNA-seq technique to study the response of the reproductive tissues of almond (anther and ovary) to frost stress. RNA sequencing resulted in more than 20 million reads from anther and ovary tissues of almond, individually. About 40,000 contigs were assembled and annotated de novo in each tissue. Profile of gene expression in ovary showed significant alterations in 5,112 genes, whereas in anther 6,926 genes were affected by freezing stress. Around two thousands of these genes were common altered genes in both ovary and anther libraries. Gene ontology indicated the involvement of differentially expressed (DE) genes, responding to freezing stress, in metabolic and cellular processes. qRT-PCR analysis verified the expression pattern of eight genes randomly selected from the DE genes. In conclusion, the almond gene index assembled in this study and the reported DE genes can provide great insights on responses of almond and other Prunus species to abiotic stresses. The obtained results from current research would add to the limited available information on almond and Rosaceae. Besides, the findings would be very useful for comparative studies as the number of DE genes reported here is much higher than that of any previous reports in this plant.
Ezaki, Bunichi; Suzuki, Masakatsu; Motoda, Hirotoshi; Kawamura, Masako; Nakashima, Susumu; Matsumoto, Hideaki
2004-01-01
The gene expression of two Al-induced Arabidopsis glutathione S-transferase genes, AtGST1 and AtGST11, was analyzed to investigate the mechanism underlying the response to Al stress. An approximately 1-kb DNA fragment of the 5′-upstream region of each gene was fused to a β-glucuronidase (GUS) reporter gene (pAtGST1::GUS and pAtGST11::GUS) and introduced into Arabidopsis ecotype Landsberg erecta. The constructed transgenic lines showed a time-dependent gene expression to a different degree in the root and/or leaf by Al stress. The pAtGST1::GUS gene was induced after a short Al treatment (maximum expression after a 2-h exposure), while the pAtGST11::GUS gene was induced by a longer Al treatment (approximately 8 h for maximum expression). Since the gene expression was observed in the leaf when only the root was exposed to Al stress, a signaling system between the root and shoot was suggested in Al stress. A GUS staining experiment using an adult transgenic line carrying the pAtGST11::GUS gene supported this suggestion. Furthermore, Al treatment simultaneously with various Ca depleted conditions in root region enhanced the gene expression of the pAtGST11::GUS in the shoot region. This result suggested that the degree of Al toxicity in the root reflects the gene response of pAtGST11::GUS in the shoot via the deduced signaling system. Both transgenic lines also showed an increase of GUS activity after cold stress, heat stress, metal toxicity, and oxidative damages, suggesting a common induction mechanism in response to the tested stresses including Al stress. PMID:15047894
Identifying key genes in rheumatoid arthritis by weighted gene co-expression network analysis.
Ma, Chunhui; Lv, Qi; Teng, Songsong; Yu, Yinxian; Niu, Kerun; Yi, Chengqin
2017-08-01
This study aimed to identify rheumatoid arthritis (RA) related genes based on microarray data using the WGCNA (weighted gene co-expression network analysis) method. Two gene expression profile datasets GSE55235 (10 RA samples and 10 healthy controls) and GSE77298 (16 RA samples and seven healthy controls) were downloaded from Gene Expression Omnibus database. Characteristic genes were identified using metaDE package. WGCNA was used to find disease-related networks based on gene expression correlation coefficients, and module significance was defined as the average gene significance of all genes used to assess the correlation between the module and RA status. Genes in the disease-related gene co-expression network were subject to functional annotation and pathway enrichment analysis using Database for Annotation Visualization and Integrated Discovery. Characteristic genes were also mapped to the Connectivity Map to screen small molecules. A total of 599 characteristic genes were identified. For each dataset, characteristic genes in the green, red and turquoise modules were most closely associated with RA, with gene numbers of 54, 43 and 79, respectively. These genes were enriched in totally enriched in 17 Gene Ontology terms, mainly related to immune response (CD97, FYB, CXCL1, IKBKE, CCR1, etc.), inflammatory response (CD97, CXCL1, C3AR1, CCR1, LYZ, etc.) and homeostasis (C3AR1, CCR1, PLN, CCL19, PPT1, etc.). Two small-molecule drugs sanguinarine and papaverine were predicted to have a therapeutic effect against RA. Genes related to immune response, inflammatory response and homeostasis presumably have critical roles in RA pathogenesis. Sanguinarine and papaverine have a potential therapeutic effect against RA. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.
International Nuclear Information System (INIS)
Longo, D.L.; Schwartz, R.H.
1980-01-01
The cellular requirements for immune response (Ir) gene expression in a T cell proliferative response under dual Ir gene control were examined with radiation-induced bone marrow chimeras. The response to poly(Glu55Lys36Phe9)n (GLphi) requires two responder alleles that in the [B10.A x B10.A(18R)]F1 map in I-Ab and I-Ek/Cd. Chimeras in which a mixture of the nonresponder B10.A parental cells and the nonresponder B10.A(18R) parental cells were allowed to mature in a responder F1 environment did not respond to GLphi. When T cells from such A + 18R leads to F1 chimeras were primed in the presence of responder antigen-presenting cells (APC), the chimeric T cells responded to GLphi. When bone marrow cells from (B10.A X B10)F1 responder animals were allowed to mature in a low-responder B10 of B10.A parental environment, neither chimera could respond to GLphi. This demonstrated that the presence of high-responder APC, which derive from the donar bone marrow, was not sufficient to generate a GLphi response. Finally, B10.A(4R) T cells, which possess neither Ir-GLphi responder allele, could be educated to mount a GLphi-proliferative response provided that they matured in a responder environment and were primed with APC expressing both responder alleles. Therefore, the gene products of the complementing Ir-GLphi responder alleles appear to function as a single restriction element at the level of the APC
Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude
2014-01-01
A large inter-individual variability in the plasma triglyceride (TG) response to an omega-3 polyunsaturated fatty acid (n-3 PUFA) supplementation has been observed. The objective was to examine gene-diet interaction effects on the plasma TG response after a fish oil supplementation, between single-nucleotide polymorphisms (SNPs) within genes involved in fatty acid β-oxidation and dietary fat intakes. Two hundred and eight (208) participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9–2.2 g EPA and 1.1 g DHA). Dietary fat intakes were measured using three-day food records. SNPs within RXRA, CPT1A, ACADVL, ACAA2, ABCD2, ACOX1 and ACAA1 genes were genotyped using TAQMAN methodology. Gene-diet interaction effects on the plasma TG response were observed for SNPs within RXRA (rs11185660, rs10881576 and rs12339187) and ACOX1 (rs17583163) genes. For rs11185660, fold changes in RXRA gene expression levels were different depending on SFA intakes for homozygotes T/T. Gene-diet interaction effects of SNPs within genes involved in fatty acid β-oxidation and dietary fat intakes may be important in understanding the inter-individual variability in plasma TG levels and in the plasma TG response to a fish oil supplementation. PMID:24647074
Directory of Open Access Journals (Sweden)
Annie Bouchard-Mercier
2014-03-01
Full Text Available A large inter-individual variability in the plasma triglyceride (TG response to an omega-3 polyunsaturated fatty acid (n-3 PUFA supplementation has been observed. The objective was to examine gene-diet interaction effects on the plasma TG response after a fish oil supplementation, between single-nucleotide polymorphisms (SNPs within genes involved in fatty acid β-oxidation and dietary fat intakes. Two hundred and eight (208 participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9–2.2 g EPA and 1.1 g DHA. Dietary fat intakes were measured using three-day food records. SNPs within RXRA, CPT1A, ACADVL, ACAA2, ABCD2, ACOX1 and ACAA1 genes were genotyped using TAQMAN methodology. Gene-diet interaction effects on the plasma TG response were observed for SNPs within RXRA (rs11185660, rs10881576 and rs12339187 and ACOX1 (rs17583163 genes. For rs11185660, fold changes in RXRA gene expression levels were different depending on SFA intakes for homozygotes T/T. Gene-diet interaction effects of SNPs within genes involved in fatty acid β-oxidation and dietary fat intakes may be important in understanding the inter-individual variability in plasma TG levels and in the plasma TG response to a fish oil supplementation.
Directory of Open Access Journals (Sweden)
Borie Dominic C
2006-03-01
Full Text Available Abstract Background The use of porcine cells and organs as a source of xenografts for human patients would vastly increase the donor pool; however, both humans and Old World primates vigorously reject pig tissues due to xenoantibodies that react with the polysaccharide galactose α (1,3 galactose (αGal present on the surface of many porcine cells. We previously examined the xenoantibody response in patients exposed to porcine hepatocytes via treatment(s with bioartficial liver devices (BALs, composed of porcine cells in a support matrix. We determined that xenoantibodies in BAL-treated patients are predominantly directed at porcine αGal carbohydrate epitopes, and are encoded by a small number of germline heavy chain variable region (VH immunoglobulin genes. The studies described in this manuscript were designed to identify whether the xenoantibody responses and the IgVH genes encoding antibodies to porcine hepatocytes in non-human primates used as preclinical models are similar to those in humans. Adult non-immunosuppressed rhesus monkeys (Macaca mulatta were injected intra-portally with porcine hepatocytes or heterotopically transplanted with a porcine liver lobe. Peripheral blood leukocytes and serum were obtained prior to and at multiple time points after exposure, and the immune response was characterized, using ELISA to evaluate the levels and specificities of circulating xenoantibodies, and the production of cDNA libraries to determine the genes used by B cells to encode those antibodies. Results Xenoantibodies produced following exposure to isolated hepatocytes and solid organ liver grafts were predominantly encoded by genes in the VH3 family, with a minor contribution from the VH4 family. Immunoglobulin heavy-chain gene (VH cDNA library screening and gene sequencing of IgM libraries identified the genes as most closely-related to the IGHV3-11 and IGHV4-59 germline progenitors. One of the genes most similar to IGHV3-11, VH3-11cyno, has
Directory of Open Access Journals (Sweden)
Rehman Iqra
2017-01-01
Full Text Available Cotton Leaf Curl Disease (CLCuD is one of the threatening constrains of cotton production in Pakistan for which no adequate remedy is available until now. Local variety of Gossypium hirsutum (FH-142 was grown in field and infected naturally by CLCuV under variable range of temperature and humidity. Plants showed thickening of veins in lower leaf surface at 34°C and 60% relative humidity at 15days post infection (dpi and curling of leaf margins at 33°C with 58% relative humidity at 30dpi. Remarkable leaf darkening was observed with reduced boll formation at 45dpi at 26°C and 41% relative humidity. Enation developed, severe thickening and curling of leaves intensified and plants showed dwarf growth at 60dpi at 24°C with 52% relative humidity. PCR amplification of Rep associated gene confirmed the presence of CLCuD-associated begomovirus in the infected samples. Quantitative RT-PCR confirmed the amplification and differential expression of a number of pathogen stress responsive genes at different levels of temperature and humidity. This observation predicts that Cotton Leaf Curl Virus (CLCuV interacts with several host genes that are upregulated to make plants susceptible or suppress other genes to overcome host defense responses.
Cruz, Aline Fernanda; de Resende, Renata Gonçalves; de Lacerda, Júlio César Tanos; Pereira, Núbia Braga; Melo, Leonardo Augusto; Diniz, Marina Gonçalves; Gomes, Carolina Cavalieri; Gomez, Ricardo Santiago
2018-01-01
The oral lichen planus is a chronic inflammatory disease. Although its aetiology is not well understood, the role of T lymphocytes in its inflammatory events is recognised. Identifying the epigenetic mechanisms involved in the pathogenesis of this immune-mediated condition is fundamental for understanding the inflammatory reaction that occurs in the disease. The purpose of this work was to evaluate the methylation pattern of 21 immune response-related genes in the different clinical forms of oral lichen planus. A cross-sectional study was performed to analyse the DNA methylation patterns in three distinct groups of oral lichen planus: (i) reticular/plaque lesions; (ii) erosive lesions; (iii) normal oral mucosa (control group). After DNA extraction from biopsies, the samples were submitted to digestions by methylation-sensitive and methylation-dependent enzymes and double digestion. The relative percentage of methylated DNA for each gene was provided using real-time polymerase chain reaction arrays. Hypermethylation of the STAT5A gene was observed only in the control group (59.0%). A higher hypermethylation of the ELANE gene was found in reticular/plaque lesions (72.1%) compared to the erosive lesions (50.0%). Our results show variations in the methylation profile of immune response-related genes, according to the clinical type of oral lichen planus after comparing with the normal oral mucosa. Further studies are necessary to validate these findings using gene expression analysis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Blechingberg, Jenny; Luo, Yonglun; Bolund, Lars
2012-01-01
The FET family of proteins is composed of FUS/TLS, EWS/EWSR1, and TAF15 and possesses RNA- and DNA-binding capacities. The FET-proteins are involved in transcriptional regulation and RNA processing, and FET-gene deregulation is associated with development of cancer and protein granule formations...... in amyotrophic lateral sclerosis, frontotemporal lobar degeneration, and trinucleotide repeat expansion diseases. We here describe a comparative characterization of FET-protein localization and gene regulatory functions. We show that FUS and TAF15 locate to cellular stress granules to a larger extend than EWS....... FET-proteins have no major importance for stress granule formation and cellular stress responses, indicating that FET-protein stress granule association most likely is a downstream response to cellular stress. Gene expression analyses showed that the cellular response towards FUS and TAF15 reduction...
Singh, L C; Chakraborty, Anurupa; Mishra, Ashwani K; Devi, Thoudam Regina; Sugandhi, Nidhi; Chintamani, Chintamani; Bhatnagar, Dinesh; Kapur, Sujala; Saxena, Sunita
2012-06-01
Locally advanced breast cancer (LABC) remains a clinical challenge as the majority of patients with this diagnosis develop distant metastases despite appropriate therapy. We analyzed expression of steroid and growth hormone receptor genes as well as gene associated with metabolism of chemotherapeutic drugs in locally advanced breast cancer before and after neoadjuvant chemotherapy (NACT) to study whether there is a change in gene expression induced by chemotherapy and whether such changes are associated with tumor response or non-response. Fifty patients were included with locally advanced breast cancer treated with cyclophosphamide, adriamycin, 5-fluorouracil (CAF)-based neoadjuvant chemotherapy before surgery. Total RNA was extracted from 50 match samples of pre- and post-NACT tumor tissues. RNA expression levels of epidermal growth factor receptor family genes including EGFR, ERBB2, ERBB3, androgen receptor (AR), and multidrug-resistance gene 1 (MDR1) were determined by quantitative real-time reverse transcriptase-polymerase chain reaction. Responders show significantly high levels of pre-NACT AR gene expression (P = 0.016), which reduces following NACT (P = 0.008), and hence can serve as a useful tool for the prediction of the success of neoadjuvant chemotherapy in individual cancer patients with locally advanced breast carcinoma. Moreover, a significant post-therapeutic increase in the expression levels of EGFR and MDR1 gene in responders (P = 0.026 and P < 0.001) as well as in non-responders (P = 0.055, P = 0.001) suggests that expression of these genes changes during therapy but they do not have any impact on tumor response, whereas a post-therapeutic reduction was observed in AR in responders. This indicates an independent predictive role of AR with response to NACT.
Huang, Jianzi; Lu, Xiang; Yan, Hao; Chen, Shouyi; Zhang, Wanke; Huang, Rongfeng; Zheng, Yizhi
2012-04-01
Semi-mangroves form a group of transitional species between glycophytes and halophytes, and hold unique potential for learning molecular mechanisms underlying plant salt tolerance. Millettia pinnata is a semi-mangrove plant that can survive a wide range of saline conditions in the absence of specialized morphological and physiological traits. By employing the Illumina sequencing platform, we generated ~192 million short reads from four cDNA libraries of M. pinnata and processed them into 108,598 unisequences with a high depth of coverage. The mean length and total length of these unisequences were 606 bp and 65.8 Mb, respectively. A total of 54,596 (50.3%) unisequences were assigned Nr annotations. Functional classification revealed the involvement of unisequences in various biological processes related to metabolism and environmental adaptation. We identified 23,815 candidate salt-responsive genes with significantly differential expression under seawater and freshwater treatments. Based on the reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR analyses, we verified the changes in expression levels for a number of candidate genes. The functional enrichment analyses for the candidate genes showed tissue-specific patterns of transcriptome remodelling upon salt stress in the roots and the leaves. The transcriptome of M. pinnata will provide valuable gene resources for future application in crop improvement. In addition, this study sets a good example for large-scale identification of salt-responsive genes in non-model organisms using the sequencing-based approach.
Directory of Open Access Journals (Sweden)
Fang Qi
2010-09-01
Full Text Available Abstract Background The relationships between parasitoids and their insect hosts have attracted attention at two levels. First, the basic biology of host-parasitoid interactions is of fundamental interest. Second, parasitoids are widely used as biological control agents in sustainable agricultural programs. Females of the gregarious endoparasitoid Pteromalus puparum (Hymenoptera: Pteromalidae inject venom along with eggs into their hosts. P. puparum does not inject polydnaviruses during oviposition. For this reason, P. puparum and its pupal host, the small white butterfly Pieris rapae (Lepidoptera: Pieridae, comprise an excellent model system for studying the influence of an endoparasitoid venom on the biology of the pupal host. P. puparum venom suppresses the immunity of its host, although the suppressive mechanisms are not fully understood. In this study, we tested our hypothesis that P. puparum venom influences host gene expression in the two main immunity-conferring tissues, hemocytes and fat body. Results At 1 h post-venom injection, we recorded significant decreases in transcript levels of 217 EST clones (revealing 113 genes identified in silico, including 62 unknown contigs derived from forward subtractive libraries of host hemocytes and in transcript levels of 288 EST clones (221 genes identified in silico, including 123 unknown contigs from libraries of host fat body. These genes are related to insect immune response, cytoskeleton, cell cycle and apoptosis, metabolism, transport, stress response and transcriptional and translational regulation. We verified the reliability of the suppression subtractive hybridization (SSH data with semi-quantitative RT-PCR analysis of a set of randomly selected genes. This analysis showed that most of the selected genes were down-regulated after venom injection. Conclusions Our findings support our hypothesis that P. puparum venom influences gene expression in host hemocytes and fat body. Specifically
Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K
1993-01-01
The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene d...
Molecular characterization and expression profiling of cd-responsive genes in triticum durum
Cebeci, Özge; Cebeci, Ozge
2006-01-01
Cadmium (Cd) is a toxic heavy metal which has detrimental effects both in plants and human. There is a lack of knowledge on the molecular mechanisms of Cd toxicity in crop plants. The objective of this study was to identify and clone expressed Cd-responsive genes from two Triticum durum cvs. Balcah-85 and Balcah-2000 using mRNA differential display technique. We identified 10 cDNA clones whose level of expression significantly changed upon Cd exposure and thus isolated for further characteriz...
Gene expression profiling--Opening the black box of plant ecosystem responses to global change
Energy Technology Data Exchange (ETDEWEB)
Leakey, A.D.B.; Ainsworth, E.A.; Bernard, S.M.; Markelz, R.J.C.; Ort, D.R.; Placella, S.A.P.; Rogers, A.; Smith, M.D.; Sudderth, E.A.; Weston, D.J.; Wullschleger, S.D.; Yuan, S.
2009-11-01
The use of genomic techniques to address ecological questions is emerging as the field of genomic ecology. Experimentation under environmentally realistic conditions to investigate the molecular response of plants to meaningful changes in growth conditions and ecological interactions is the defining feature of genomic ecology. Since the impact of global change factors on plant performance are mediated by direct effects at the molecular, biochemical and physiological scales, gene expression analysis promises important advances in understanding factors that have previously been consigned to the 'black box' of unknown mechanism. Various tools and approaches are available for assessing gene expression in model and non-model species as part of global change biology studies. Each approach has its own unique advantages and constraints. A first generation of genomic ecology studies in managed ecosystems and mesocosms have provided a testbed for the approach and have begun to reveal how the experimental design and data analysis of gene expression studies can be tailored for use in an ecological context.
Xie, Zeyi; Zhou, Zhilin; Li, Hongmin; Yu, Jingjing; Jiang, Jiaojiao; Tang, Zhonghou; Ma, Daifu; Zhang, Baohong; Han, Yonghua; Li, Zongyun
2018-05-21
Sweetpotato (Ipomoea batatas L.) is a globally important economic food crop. It belongs to Convolvulaceae family and origins in the tropics; however, sweetpotato is sensitive to cold stress during storage. In this study, we performed transcriptome sequencing to investigate the sweetpotato response to chilling stress during storage. A total of 110,110 unigenes were generated via high-throughput sequencing. Differentially expressed genes (DEGs) analysis showed that 18,681 genes were up-regulated and 21,983 genes were down-regulated in low temperature condition. Many DEGs were related to the cell membrane system, antioxidant enzymes, carbohydrate metabolism, and hormone metabolism, which are potentially associated with sweetpotato resistance to low temperature. The existence of DEGs suggests a molecular basis for the biochemical and physiological consequences of sweetpotato in low temperature storage conditions. Our analysis will provide a new target for enhancement of sweetpotato cold stress tolerance in postharvest storage through genetic manipulation. Copyright © 2018. Published by Elsevier Inc.
Zeng, Zhu; Zuo, Fanglei; Yu, Rui; Zhang, Bo; Ma, Huiqin; Chen, Shangwu
2017-09-01
A novel lactose-responsive promoter of the ATP-binding cassette (ABC) transporter gene Lba1680 of Lactobacillus acidophilus strain 05-172 isolated from a traditionally fermented dairy product koumiss was characterized. In L. acidophilus 05-172, expression of Lba1680 was induced by lactose, with lactose-induced transcription of Lba1680 being 6.1-fold higher than that induced by glucose. This is in contrast to L. acidophilus NCFM, a strain isolated from human feces, in which expression of Lba1680 and Lba1679 is induced by glucose. Both gene expression and enzyme activity assays in L. paracasei transformed with a vector containing the inducible Lba1680 promoter (PLba1680) of strain 05-172 and a heme-dependent catalase gene as reporter confirmed that PLba1680 is specifically induced by lactose. Its regulatory expression could not be repressed by glucose, and was independent of cAMP receptor protein. This lactose-responsive promoter might be used in the expression of functional genes in L. paracasei incorporated into a lactose-rich environment, such as dairy products. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Leib Stephen L
2011-04-01
Full Text Available Abstract Background The kynurenine (KYN pathway has been shown to be altered in several diseases which compromise the central nervous system (CNS including infectious diseases such as bacterial meningitis (BM. The aim of this study was to assess single nucleotide polymorphisms (SNPs in four genes of KYN pathway in patients with meningitis and their correlation with markers of immune response in BM. Methods One hundred and one individuals were enrolled in this study to investigate SNPs in the following genes: indoleamine-2,3-dioxygenase (IDO1 gene, kynureninase (KYNU gene, kynurenine aminotransferase I (CCBL1 gene, and kynurenine aminotransferase II (AADAT gene. SNP analyses were performed by primer-introduced restriction analysis-PCR (PIRA-PCR followed by RFLP. Cytokines were measured using multiplex bead assay while immunoglobulins (IG by immunodiffusion plates and NF-kappaB and c-Jun by dot blot assay. Results The variant allele of SNP AADAT+401C/T showed prevalent frequency in patients with BM. A significant decrease (p AADAT+401C/T. Furthermore, a significant (p p KYNU+715G/A was found with low frequency in the groups, and the SNPs in IDO1+434T/G, KYNU+693G/A, CCBL1+164T/C, and AADAT+650C/T had no frequency in this population. Conclusions This study is the first report of an association of SNP AADAT+401C/T with the host immune response to BM, suggesting that this SNP may affect the host ability in recruitment of leukocytes to the infection site. This finding may contribute to identifying potential targets for pharmacological intervention as adjuvant therapy for BM.
Fister, Andrew S; Mejia, Luis C; Zhang, Yufan; Herre, Edward Allen; Maximova, Siela N; Guiltinan, Mark J
2016-05-17
The pathogenesis-related (PR) group of proteins are operationally defined as polypeptides that increase in concentration in plant tissues upon contact with a pathogen. To date, 17 classes of highly divergent proteins have been described that act through multiple mechanisms of pathogen resistance. Characterizing these families in cacao, an economically important tree crop, and comparing the families to those in other species, is an important step in understanding cacao's immune response. Using publically available resources, all members of the 17 recognized pathogenesis-related gene families in the genome of Theobroma cacao were identified and annotated resulting in a set of ~350 members in both published cacao genomes. Approximately 50 % of these genes are organized in tandem arrays scattered throughout the genome. This feature was observed in five additional plant taxa (three dicots and two monocots), suggesting that tandem duplication has played an important role in the evolution of the PR genes in higher plants. Expression profiling captured the dynamics and complexity of PR genes expression at basal levels and after induction by two cacao pathogens (the oomycete, Phytophthora palmivora, and the fungus, Colletotrichum theobromicola), identifying specific genes within families that are more responsive to pathogen challenge. Subsequent qRT-PCR validated the induction of several PR-1, PR-3, PR-4, and PR-10 family members, with greater than 1000 fold induction detected for specific genes. We describe candidate genes that are likely to be involved in cacao's defense against Phytophthora and Colletotrichum infection and could be potentially useful for marker-assisted selection for breeding of disease resistant cacao varieties. The data presented here, along with existing cacao-omics resources, will enable targeted functional genetic screening of defense genes likely to play critical functions in cacao's defense against its pathogens.
International Nuclear Information System (INIS)
Taylor, Daisy A.; Thompson, Emma L.; Nair, Sham V.; Raftos, David A.
2013-01-01
Environmental contamination by metals is a serious threat to the biological sustainability of coastal ecosystems. Our current understanding of the potential biological effects of metals in these ecosystems is limited. This study tested the transcriptional expression of immune- and stress-response genes in Sydney Rock oysters (Saccostrea glomerata). Oysters were exposed to four metals (cadmium, copper, lead and zinc) commonly associated with anthropogenic pollution in coastal waterways. Seven target genes (superoxide dismutase, ferritin, ficolin, defensin, HSP70, HSP90 and metallothionein) were selected. Quantitative (real-time) PCR analyses of the transcript expression of these genes showed that each of the different metals elicited unique transcriptional profiles. Significant changes in transcription were found for 18 of the 28 combinations tested (4 metals × 7 genes). Of these, 16 reflected down-regulation of gene transcription. HSP90 was the only gene significantly up-regulated by metal contamination (cadmium and zinc only), while defensin expression was significantly down-regulated by exposure to all four metals. This inhibition could have a significant negative effect on the oyster immune system, promoting susceptibility to opportunistic infections and disease. -- Highlights: ► Oysters were exposed to Cd, Cu, Pb or Zn, all commonly associated with coastal pollution. ► qPCR identified significant down-regulation in stress- and immune-response genes in oysters exposed to these metals. ► qPCR showed that each of the different metals elicited unique transcriptional profiles. ► The genes identified have the potential to lead to increased disease susceptibility in oysters. -- qPCR identified significant down-regulation in stress- and immune-response genes in oysters exposed to metals, which could lead to increased disease susceptibility
Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.
Busk, P K; Jensen, A B; Pagès, M
1997-06-01
The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.
DEFF Research Database (Denmark)
Jonavičienė, Kristina; Studer, Bruno; Asp, Torben
2012-01-01
In order to characterize the response of selected grasses to water stress, relative water content (RWC) in leaves and quantum efficiency of photosystem 2 (Fv/Fm) were measured in Phleum pratense L., P. bertolonii DC. and P. phleoides H. Karst. during 6 d of water stress. The results indicated...... differential responses to water stress among the three Phleum species with higher water deficit sensitivity of P. pratense and P. bertolonii than that of P. phleoides. The cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique was applied to identify differentially expressed genes responding...... to water stress in P. pratense. Cloned and sequenced differentially expressed fragments (DEFs) were used for primer design in order to identify orthologous genes in Lolium perenne L. Twelve genes orthologous to P. pratense DEFs were mapped in the L. perenne mapping population VrnA based on a high...
Directory of Open Access Journals (Sweden)
Martin Hampel
Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.
Singh, Sangeeta; Chand, Suresh; Singh, N. K.; Sharma, Tilak Raj
2015-01-01
The resistance (R) genes and defense response (DR) genes have become very important resources for the development of disease resistant cultivars. In the present investigation, genome-wide identification, expression, phylogenetic and synteny analysis was done for R and DR-genes across three species of rice viz: Oryza sativa ssp indica cv 93-11, Oryza sativa ssp japonica and wild rice species, Oryza brachyantha. We used the in silico approach to identify and map 786 R -genes and 167 DR-genes, 672 R-genes and 142 DR-genes, 251 R-genes and 86 DR-genes in the japonica, indica and O. brachyanth a genomes, respectively. Our analysis showed that 60.5% and 55.6% of the R-genes are tandemly repeated within clusters and distributed over all the rice chromosomes in indica and japonica genomes, respectively. The phylogenetic analysis along with motif distribution shows high degree of conservation of R- and DR-genes in clusters. In silico expression analysis of R-genes and DR-genes showed more than 85% were expressed genes showing corresponding EST matches in the databases. This study gave special emphasis on mechanisms of gene evolution and duplication for R and DR genes across species. Analysis of paralogs across rice species indicated 17% and 4.38% R-genes, 29% and 11.63% DR-genes duplication in indica and Oryza brachyantha, as compared to 20% and 26% duplication of R-genes and DR-genes in japonica respectively. We found that during the course of duplication only 9.5% of R- and DR-genes changed their function and rest of the genes have maintained their identity. Syntenic relationship across three genomes inferred that more orthology is shared between indica and japonica genomes as compared to brachyantha genome. Genome wide identification of R-genes and DR-genes in the rice genome will help in allele mining and functional validation of these genes, and to understand molecular mechanism of disease resistance and their evolution in rice and related species. PMID:25902056
Gupta, Rashmi; Michaud, Henri-Alexandre; Zeng, Xue; Debbaneh, Maya; Arron, Sarah T; Jones, R Brad; Ormsby, Christopher E; Nixon, Douglas F; Liao, Wilson
2014-09-16
Psoriasis is a multifactorial, chronic disease of skin affecting 2-3% of the world's population. Genetic studies of psoriasis have identified a number of susceptibility genes that are involved in anti-viral immunity. Furthermore, physiological studies have also found an increase in anti-viral proteins in psoriatic skin. These findings suggest the presence of an anti-viral state in psoriatic skin. However, the triggers for this anti-viral cascade and its consequences for host immunity are not known. Endogenous retroviruses have previously been described in many autoimmune diseases including psoriasis. In the present study we examined the humoral immune response against human endogenous retrovirus-K (HERV-K) proteins and the cutaneous expression levels of multiple HERV-K genes in psoriasis patients and healthy controls. In psoriatic sera we observed a significant decrease in IgM response against three HERV-K proteins: Env surface unit (SU), Env transmembrane protein (TM), and Gag capsid (CA) in comparison to sera obtained from blood bank healthy controls. A decrease in IgG response was also observed against CA. Furthermore, using quantitative RT-PCR we observed a decrease in the expression of HERV-K Env, Gag, Pol and Rec as well as ERV-9 genes in lesional psoriatic skin as compared to healthy skin. Together, our results suggest that the pro-inflammatory, anti-viral state in psoriasis is associated with diminished expression of HERV-K gene transcripts and a concomitant decrease in humoral responses to HERV-K. Our results indicate that a simple model where continuous, minimally changing HERV-K expression serves as an antigenic trigger in psoriasis might not be correct and further studies are needed to decipher the possible relationship between psoriasis and HERVs.
Directory of Open Access Journals (Sweden)
Jinlong Zhang
2016-12-01
Full Text Available Soil alkalinity is a major abiotic constraint to crop productivity and quality. Wild soybean (Glycine soja is considered to be more stress-tolerant than cultivated soybean (G. max, and has considerable genetic variation for increasing alkalinity tolerance of soybean. In this study, we analyzed the transcriptome profile in the roots of an alkalinity tolerant wild soybean variety N24852 at 12 and 24 h after 90 mM NaHCO3 stress by RNA-sequencing. Compared with the controls, a total of 449 differentially expressed genes (DEGs were identified, including 95 and 140 up-regulated genes, and 108 and 135 down-regulated genes at 12 and 24 h after NaHCO3 treatment, respectively. Quantitative RT-PCR analysis of 14 DEGs showed a high consistency with their expression profiles by RNA-sequencing. Gene Ontology (GO terms related to transcription factors and transporters were significantly enriched in the up-regulated genes at 12 and 24 h after NaHCO3 stress, respectively. Nuclear Factor Y subunit A (NF-YA transcription factors were enriched at 12 h after NaHCO3 stress, and high percentages of basic helix-loop-helix (bHLH, ethylene-responsive factor (ERF, Trihelix and zinc finger (C2H2, C3H transcription factors were found at both 12 and 24 h after NaHCO3 stress. Genes related to ion transporters such as ABC transporter, aluminum activated malate transporter (ALMT, glutamate receptor (GLR, nitrate transporter (NRT / proton dependent oligopeptide (POT family, and S-type anion channel (SLAH were enriched in up-regulated DEGs at 24 h after NaHCO3 treatment, implying their roles in maintaining ion homeostasis in soybean roots under alkalinity. KEGG pathway enrichment analysis showed phenylpropanoid biosynthesis and phenylalanine metabolism pathways might participate in soybean response to alkalinity. This study provides a foundation to further investigate the functions of NaHCO3 stress-responsive genes and the molecular basis of soybean tolerance to alkalinity.
Su, Li-Na; Lei, Feng-Ying; Huang, Wei-Fang; Zhao, Yan-Jun
2011-01-01
Background The results from the published studies on the association between angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and the treatment response to steroid in Asian children with idiopathic nephrotic syndrome (INS) is still conflicting. This meta-analysis was performed to evaluate the relation between ACE I/D gene polymorphism and treatment response to steroid in Asian children and to explore whether ACE D allele or DD genotype could become a predictive marker for steroid responsiveness. Methodology/Principal Findings Association studies were identified from the databases of PubMed, Embase, Cochrane Library and CBM-disc (China Biological Medicine Database) as of September 1, 2010, and eligible investigations were synthesized using meta-analysis method. Five investigations were identified for the analysis of association between ACE I/D gene polymorphism and steroid-resistant nephrotic syndrome (SRNS) risk in Asian children and seven studies were included to explore the relationship between ACE I/D gene polymorphism and steroid-sensitive nephrotic syndrome (SSNS) susceptibility. Five investigations were recruited to explore the difference of ACE I/D gene distribution between SRNS and SSNS. There was no a markedly association between D allele or DD genotype and SRNS susceptibility or SSNS risk, and the gene distribution differences of ACE between SRNS and SSNS were not statistically significant. II genotype might play a positive role against SRNS onset but not for SSNS (OR = 0.51, P = 0.02; OR = 0.95, P = 0.85; respectively), however, the result for the association of II genotype with SRNS risk was not stable. Conclusions/Significance Our results indicate that D allele or DD homozygous can't become a significant genetic molecular marker to predict the treatment response to steroid in Asian children with INS. PMID:21611163
Chen, Er-Hu; Hou, Qiu-Li; Wei, Dan-Dan; Jiang, Hong-Bo; Wang, Jin-Jun
2017-08-17
Diet composition (yeast:carbohydrate ratio) is an important determinant of growth, development, and reproduction. Recent studies have shown that decreased yeast intake elicits numerous transcriptomic changes and enhances somatic maintenance and lifespan, which in turn reduces reproduction in various insects. However, our understanding of the responses leading to a decrease in yeast ratio to 0% is limited. In the present study, we investigated the effects of a sugar-only diet (SD) on the gene expression patterns of the oriental fruit fly, Bactrocera dorsalis (Hendel), one of the most economically important pests in the family Tephritidae. RNA sequencing analyses showed that flies reared on an SD induced significant changes in the expression levels of genes associated with specific metabolic as well as cell growth and death pathways. Moreover, the observed upregulated genes in energy production and downregulated genes associated with reproduction suggested that SD affects somatic maintenance and reproduction in B. dorsalis. As expected, we observed that SD altered B. dorsalis phenotypes by significantly increasing stress (starvation and desiccation) resistance, decreasing reproduction, but did not extend lifespan compared to those that received a normal diet (ND) regime. In addition, administration of an SD resulted in a reduction in antioxidant enzyme activities and an increase in MDA concentrations, thereby suggesting that antioxidants cannot keep up with the increase in oxidative damage induced by SD regime. The application of an SD diet induces changes in phenotypes, antioxidant responses, and gene expressions in B. dorsalis. Previous studies have associated extended lifespan with reduced fecundity. The current study did not observe a prolongation of lifespan in B. dorsalis, which instead incurred oxidative damage. The findings of the present study improve our understanding of the molecular, biochemical, and phenotypic response of B. dorsalis to an SD diet.
Tumor Suppressor Genes within Common Fragile Sites Are Active Players in the DNA Damage Response.
Directory of Open Access Journals (Sweden)
Idit Hazan
2016-12-01
Full Text Available The role of common fragile sites (CFSs in cancer remains controversial. Two main views dominate the discussion: one suggests that CFS loci are hotspots of genomic instability leading to inactivation of genes encoded within them, while the other view proposes that CFSs are functional units and that loss of the encoded genes confers selective pressure, leading to cancer development. The latter view is supported by emerging evidence showing that expression of a given CFS is associated with genome integrity and that inactivation of CFS-resident tumor suppressor genes leads to dysregulation of the DNA damage response (DDR and increased genomic instability. These two viewpoints of CFS function are not mutually exclusive but rather coexist; when breaks at CFSs are not repaired accurately, this can lead to deletions by which cells acquire growth advantage because of loss of tumor suppressor activities. Here, we review recent advances linking some CFS gene products with the DDR, genomic instability, and carcinogenesis and discuss how their inactivation might represent a selective advantage for cancer cells.
International Nuclear Information System (INIS)
Husain, Mainul; Kyjovska, Zdenka O.; Bourdon-Lacombe, Julie; Saber, Anne T.; Jensen, Keld A.; Jacobsen, Nicklas R.; Williams, Andrew; Wallin, Håkan; Halappanavar, Sabina; Vogel, Ulla; Yauk, Carole L.
2015-01-01
Inhalation of carbon black nanoparticles (CBNPs) causes pulmonary inflammation; however, time course data to evaluate the detailed evolution of lung inflammatory responses are lacking. Here we establish a time-series of lung inflammatory response to CBNPs. Female C57BL/6 mice were intratracheally instilled with 162 μg CBNPs alongside vehicle controls. Lung tissues were examined 3 h, and 1, 2, 3, 4, 5, 14, and 42 days (d) post-exposure. Global gene expression and pulmonary inflammation were assessed. DNA damage was evaluated in bronchoalveolar lavage (BAL) cells and lung tissue using the comet assay. Increased neutrophil influx was observed at all time-points. DNA strand breaks were increased in BAL cells 3 h post-exposure, and in lung tissues 2–5 d post-exposure. Approximately 2600 genes were differentially expressed (± 1.5 fold; p ≤ 0.05) across all time-points in the lungs of exposed mice. Altered transcript levels were associated with immune-inflammatory response and acute phase response pathways, consistent with the BAL profiles and expression changes found in common respiratory infectious diseases. Genes involved in DNA repair, apoptosis, cell cycle regulation, and muscle contraction were also differentially expressed. Gene expression changes associated with inflammatory response followed a biphasic pattern, with initial changes at 3 h post-exposure declining to base-levels by 3 d, increasing again at 14 d, and then persisting to 42 d post-exposure. Thus, this single CBNP exposure that was equivalent to nine 8-h working days at the current Danish occupational exposure limit induced biphasic inflammatory response in gene expression that lasted until 42 d post-exposure, raising concern over the chronic effects of CBNP exposure. - Highlights: • A single exposure to CBNPs induced expression changes in over 2600 genes in mouse lungs. • Altered genes were associated with immune-inflammatory and acute phase responses. • Several genes were involved in DNA
Energy Technology Data Exchange (ETDEWEB)
Husain, Mainul, E-mail: mainul.husain@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, ON (Canada); Kyjovska, Zdenka O., E-mail: zky@nrcwe.dk [National Research Centre for the Working Environment, Copenhagen (Denmark); Bourdon-Lacombe, Julie, E-mail: julie.bourdon-lacombe@hc-sc.gc.ca [Water and Air Quality Bureau, Safe Environments Directorate, HECSB, Health Canada, Ottawa, ON (Canada); Saber, Anne T., E-mail: ats@nrcwe.dk [National Research Centre for the Working Environment, Copenhagen (Denmark); Jensen, Keld A., E-mail: kaj@arbejdsmiljoforskning.dk [National Research Centre for the Working Environment, Copenhagen (Denmark); Jacobsen, Nicklas R., E-mail: nrj@nrcwe.dk [National Research Centre for the Working Environment, Copenhagen (Denmark); Williams, Andrew, E-mail: andrew.williams@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, ON (Canada); Wallin, Håkan, E-mail: hwa@nrcwe.dk [National Research Centre for the Working Environment, Copenhagen (Denmark); Institute of Public Health, University of Copenhagen (Denmark); Halappanavar, Sabina, E-mail: sabina.halappanavar@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, ON (Canada); Vogel, Ulla, E-mail: ubv@nrcwe.dk [National Research Centre for the Working Environment, Copenhagen (Denmark); Institute of Micro- and Nanotechnology, Technical University of Denmark, Lyngby (Denmark); Yauk, Carole L., E-mail: carole.yauk@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, ON (Canada)
2015-12-15
Inhalation of carbon black nanoparticles (CBNPs) causes pulmonary inflammation; however, time course data to evaluate the detailed evolution of lung inflammatory responses are lacking. Here we establish a time-series of lung inflammatory response to CBNPs. Female C57BL/6 mice were intratracheally instilled with 162 μg CBNPs alongside vehicle controls. Lung tissues were examined 3 h, and 1, 2, 3, 4, 5, 14, and 42 days (d) post-exposure. Global gene expression and pulmonary inflammation were assessed. DNA damage was evaluated in bronchoalveolar lavage (BAL) cells and lung tissue using the comet assay. Increased neutrophil influx was observed at all time-points. DNA strand breaks were increased in BAL cells 3 h post-exposure, and in lung tissues 2–5 d post-exposure. Approximately 2600 genes were differentially expressed (± 1.5 fold; p ≤ 0.05) across all time-points in the lungs of exposed mice. Altered transcript levels were associated with immune-inflammatory response and acute phase response pathways, consistent with the BAL profiles and expression changes found in common respiratory infectious diseases. Genes involved in DNA repair, apoptosis, cell cycle regulation, and muscle contraction were also differentially expressed. Gene expression changes associated with inflammatory response followed a biphasic pattern, with initial changes at 3 h post-exposure declining to base-levels by 3 d, increasing again at 14 d, and then persisting to 42 d post-exposure. Thus, this single CBNP exposure that was equivalent to nine 8-h working days at the current Danish occupational exposure limit induced biphasic inflammatory response in gene expression that lasted until 42 d post-exposure, raising concern over the chronic effects of CBNP exposure. - Highlights: • A single exposure to CBNPs induced expression changes in over 2600 genes in mouse lungs. • Altered genes were associated with immune-inflammatory and acute phase responses. • Several genes were involved in DNA
Directory of Open Access Journals (Sweden)
Ashleigh R. Currie
2017-08-01
Full Text Available Marine ecosystems are exposed to a range of human-induced climate stressors, in particular changing carbonate chemistry and elevated sea surface temperatures as a consequence of climate change. More research effort is needed to reduce uncertainties about the effects of global-scale warming and acidification for benthic microbial communities, which drive sedimentary biogeochemical cycles. In this research, mesocosm experiments were set up using muddy and sandy coastal sediments to investigate the independent and interactive effects of elevated carbon dioxide concentrations (750 ppm CO2 and elevated temperature (ambient +4°C on the abundance of taxonomic and functional microbial genes. Specific quantitative PCR primers were used to target archaeal, bacterial, and cyanobacterial/chloroplast 16S rRNA in both sediment types. Nitrogen cycling genes archaeal and bacterial ammonia monooxygenase (amoA and bacterial nitrite reductase (nirS were specifically targeted to identify changes in microbial gene abundance and potential impacts on nitrogen cycling. In muddy sediment, microbial gene abundance, including amoA and nirS genes, increased under elevated temperature and reduced under elevated CO2 after 28 days, accompanied by shifts in community composition. In contrast, the combined stressor treatment showed a non-additive effect with lower microbial gene abundance throughout the experiment. The response of microbial communities in the sandy sediment was less pronounced, with the most noticeable response seen in the archaeal gene abundances in response to environmental stressors over time. 16S rRNA genes (amoA and nirS were lower in abundance in the combined stressor treatments in sandy sediments. Our results indicated that marine benthic microorganisms, especially in muddy sediments, are susceptible to changes in ocean carbonate chemistry and seawater temperature, which ultimately may have an impact upon key benthic biogeochemical cycles.
Hemsley, Piers A.; Hurst, Charlotte H.; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R.; De Cothi, Elizabeth A.; Steele, John F.; Knight, Heather
2014-01-01
The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation–induced freezing tolerance. In addition, these three subunits are required for low temperature–induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced. PMID:24415770
Wagner, R Doug; Johnson, Shemedia J
2012-06-20
Vaginal epithelial cells have receptors, signal transduction mechanisms, and cytokine secretion capabilities to recruit host defenses against Candida albicans infections. This research evaluates how probiotic lactobacilli affect the defensive epithelial response. This study used quantitative reverse transcription-polymerase chain reaction assay (qRT-PCR), flow cytometry, and a multiplex immunoassay to observe changes in the regulation of gene expression related to cytokine responses in the VK2 (E6/E7) vaginal epithelial cell line treated with 17β-estradiol, exposed to probiotic Lactobacillus rhamnosus GR-1® and Lactobacillus reuteri RC-14® and challenged with C. albicans. Data were statistically evaluated by repeated measures analysis of variance and paired t-tests where appropriate. C. albicans induced mRNA expression of genes related to inflammatory cytokine responses associated with nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) signal transduction pathways. 17β-estradiol suppressed expression of interleukin-1α (IL-1α), IL-6, IL-8, and tumor necrosis factor alpha (TNFα) mRNA. Probiotic lactobacilli suppressed C. albicans-induced nuclear factor-kappa B inhibitor kinase kinase alpha (Iκκα), Toll-like receptor-2 (TLR2), TLR6, IL-8, and TNFα, also suggesting inhibition of NF-κB signaling. The lactobacilli induced expression of IL-1α, and IL-1β mRNA, which was not inhibited by curcumin, suggesting that they induce an alternate inflammatory signal transduction pathway to NF-κB, such as the mitogen activated protein kinase and activator protein-1 (MAPK/AP-1) signal transduction pathway. Curcumin inhibited IL-13 secretion, suggesting that expression of this cytokine is mainly regulated by NF-κB signaling in VK2 cells. The results suggest that C. albicans infection induces pro-inflammatory responses in vaginal epithelial cells, and estrogen and lactobacilli suppress expression of NF-κB-related inflammatory genes. Probiotic