WorldWideScience

Sample records for oncology group phase

  1. Phase 2 trial design in neuro-oncology revisited: a report from the RANO group.

    Science.gov (United States)

    Galanis, Evanthia; Wu, Wenting; Cloughesy, Timothy; Lamborn, Kathleen; Mann, Bhupinder; Wen, Patrick Y; Reardon, David A; Wick, Wolfgang; Macdonald, David; Armstrong, Terri S; Weller, Michael; Vogelbaum, Michael; Colman, Howard; Sargent, Daniel J; van den Bent, Martin J; Gilbert, Mark; Chang, Susan

    2012-05-01

    Advances in the management of gliomas, including the approval of agents such as temozolomide and bevacizumab, have created an evolving therapeutic landscape in glioma treatment, thus affecting our ability to reliably use historical controls to comparatively assess the activity of new therapies. Furthermore, the increasing availability of novel, targeted agents--which are competing for a small patient population, in view of the low incidence of primary brain tumours--draws attention to the need to improve the efficiency of phase 2 clinical testing in neuro-oncology to expeditiously transition the most promising of these drugs or combinations to potentially practice-changing phase 3 trials. In this report from the Response Assessment in Neurooncology (RANO) group, we review phase 2 trial designs that can address these challenges and capitalise on scientific and clinical advances in brain tumour treatment in neuro-oncology to accelerate and optimise the selection of drugs deserving further testing in phase 3 trials. Although there is still a small role for single-arm and non-comparative phase 2 designs, emphasis is placed on the potential role that comparative randomised phase 2 designs--such as screening designs, selection designs, discontinuation designs, and adaptive designs, including seamless phase 2/3 designs--can have. The rational incorporation of these designs, as determined by the specific clinical setting and the trial's endpoints or goals, has the potential to substantially advance new drug development in neuro-oncology.

  2. A phase II trial of CPT-11 in recurrent squamous carcinoma of the cervix: a gynecologic oncology group study.

    Science.gov (United States)

    Look, K Y; Blessing, J A; Levenback, C; Kohler, M; Chafe, W; Roman, L D

    1998-09-01

    To determine the response rate and associated toxicity of weekly CPT-11 in squamous carcinoma of the cervix. From October 1994 to May 1996, the Gynecologic Oncology Group (GOG) conducted a Phase II trial in patients with recurrent squamous cervix carcinoma. The schedule employed weekly x4 intravenous CPT-11 at 125 mg/m2 followed with a 2-week rest, to be repeated until disease progression or unacceptable toxicity. Eligibility criteria were a GOG performance status of 0-2, adequate bone marrow reserve, adequate liver function, and serum creatinine OFFis schedule of CPT-11 exhibits modest activity with moderate toxicity in patients with recurrent squamous carcinoma of the cervix. Copyright 1998 Academic Press.

  3. A phase II study of amifostine in children with myelodysplastic syndrome: a report from the Children's Oncology Group study (AAML0121).

    Science.gov (United States)

    Mathew, Prasad; Gerbing, Robert; Alonzo, Todd A; Wallas, Tanya; Gong, Jerald Z; Jasty, Rama; Jorstad, Dean T; Raimondi, Susana C; Chavez, Cathy M; Eisenberg, Nancy L; Hirsch, Betsy; Gamis, Alan; Smith, Franklin O; Arceci, Robert J

    2011-12-15

    Based on its potential role in adult myelodysplastic syndrome (MDS), the Children's Oncology Group (COG) embarked on a phase II study using amifostine in pediatric MDS (WHO 2001 criteria) patients. Responses were evaluated after two cycles. Ten patients were enrolled; five were deemed ineligible, and four withdrew after the first course. Only one patient completed two courses, and was found to be in complete remission. The study was closed after being open for 2 years due to slow accrual. Studying a rare disease like MDS may pose insurmountable obstacles even in a large clinical trials group such as COG, in part because of the changing definitions of MDS and the rarity of adult type MDS in children. The role of amifostine in pediatric MDS was not known at the time of study.

  4. Southwest Oncology Group S0008: A Phase III Trial of High-Dose Interferon Alfa-2b Versus Cisplatin, Vinblastine, and Dacarbazine, Plus Interleukin-2 and Interferon in Patients With High-Risk Melanoma—An Intergroup Study of Cancer and Leukemia Group B, Children's Oncology Group, Eastern Cooperative Oncology Group, and Southwest Oncology Group

    Science.gov (United States)

    Flaherty, Lawrence E.; Othus, Megan; Atkins, Michael B.; Tuthill, Ralph J.; Thompson, John A.; Vetto, John T.; Haluska, Frank G.; Pappo, Alberto S.; Sosman, Jeffrey A.; Redman, Bruce G.; Moon, James; Ribas, Antoni; Kirkwood, John M.; Sondak, Vernon K.

    2014-01-01

    Purpose High-dose interferon (IFN) for 1 year (HDI) is the US Food and Drug Administration–approved adjuvant therapy for patients with high-risk melanoma. Efforts to modify IFN dose and schedule have not improved efficacy. We sought to determine whether a shorter course of biochemotherapy would be more effective. Patients and Methods S0008 (S0008: Chemotherapy Plus Biological Therapy in Treating Patients With Melanoma) was an Intergroup phase III trial that enrolled high-risk patients (stage IIIA-N2a through IIIC-N3), randomly assigning them to receive either HDI or biochemotherapy consisting of dacarbazine, cisplatin, vinblastine, interleukin-2, IFN alfa-2b (IFN-α-2b) and granulocyte colony-stimulating factor given every 21 days for three cycles. Coprimary end points were relapse-free survival (RFS) and overall survival (OS). Results In all, 432 patients were enrolled. Grade 3 and 4 adverse events occurred in 57% and 7% of HDI patients and 36% and 40% of biochemotherapy patients, respectively. At a median follow-up of 7.2 years, biochemotherapy improved RFS (hazard ratio [HR], 0.75; 95% CI, 0.58 to 0.97; P = .015), with a median RFS of 4.0 years (95% CI, 1.9 years to not reached [NR]) versus 1.9 years for HDI (95% CI, 1.2 to 2.8 years) and a 5-year RFS of 48% versus 39%. Median OS was not different (HR, 0.98; 95% CI, 0.74 to 1.31; P = .55), with a median OS of 9.9 years (95% CI, 4.62 years to NR) for biochemotherapy versus 6.7 years (95% CI, 4.5 years to NR) for HDI and a 5-year OS of 56% for both arms. Conclusion Biochemotherapy is a shorter, alternative adjuvant treatment for patients with high-risk melanoma that provides statistically significant improvement in RFS but no difference in OS and more toxicity compared with HDI. PMID:25332243

  5. Phase I/II Study of Temozolomide Plus Nimustine Chemotherapy for Recurrent Malignant Gliomas: Kyoto Neuro-oncology Group

    Science.gov (United States)

    AOKI, Tomokazu; ARAKAWA, Yoshiki; UEBA, Tetsuya; ODA, Masashi; NISHIDA, Namiko; AKIYAMA, Yukinori; TSUKAHARA, Tetsuya; IWASAKI, Koichi; MIKUNI, Nobuhiro; MIYAMOTO, Susumu

    2017-01-01

    The objective of this phase I/II study was to examine the efficacy and toxicity profile of temozolomide (TMZ) plus nimustine (ACNU). Patients who had received a standard radiotherapy with one or two previous chemo-regimens were enrolled. In phase I, the maximum-tolerated dose (MTD) by TMZ (150 mg/m2/day) (Day 1–5) plus various doses of ACNU (30, 35, 40, 45 mg/m2/day) (Day 15) per 4 weeks was defined on a standard 3 + 3 design. In phase II, these therapeutic activity and safety of this regimen were evaluated. Forty-nine eligible patients were enrolled. The median age was 50 years-old. Eighty percent had a KPS of 70–100. Histologies were glioblastoma (73%), anaplastic astrocytoma (22%), anaplastic oligodendroglioma (4%). In phase I, 15 patients were treated at four cohorts by TMZ plus ACNU. MTD was TMZ (150 mg/m2) plus ACNU (40 mg/m2). In phase II, 40 patients were treated at the dose of cohort 3 (MTD). Thirty-five percent of patients experienced grade 3 or 4 toxicities, mainly hematologic. The overall response rate was 11% (4/37). Sixty-eight percent (25/37) had stable disease. Twenty-two percent (8/37) showed progression. Progression-free survival (PFS) rates at 6 and 12 months were 24% (95% CI, 12–35%) and 8% (95% CI, 4–15%). Median PFS was 13 months (95% CI, 9.2–17.2 months). Overall survival (OS) at 6 and 12 were 78% (95% CI, 67–89%) and 49% (95% CI, 33–57%). Median OS was 11.8 months (95% CI, 8.2–14.5 months). This phase I/II study showed a moderate toxicity in hematology and may has a promising efficacy in OS, without inferiority in PFS. PMID:27725524

  6. Moral justification of Phase 1 oncology trials.

    Science.gov (United States)

    Dubov, Alex

    2014-06-01

    This article attempts to answer the following normative questions: Can one consider the design of Phase 1 trials ethically appropriate due to the unfavorable ratio of risks and benefits? What are some ethical safeguards for Phase 1 oncology research? A comparative review of literature contributed to the consolidation of the proposed ethical framework for Phase 1 oncology trials. This framework gives a special attention to issues of therapeutic misconception and vulnerability. The benefits and dangers associated with the enrollment in trials are described as well as the absence of alternatives, treatment-specific optimism, and vagueness in factual presentation during the informed consent process. The notion of therapeutic misconception is contrasted with optimism despite realism that stems from psychological, cultural, and religious factors and not necessarily from the lack of information. Close attention is given to the possible ways in which the inherent uncertainty and resulting cognitive biases may affect the informed consent process and the definition of therapeutic misconception. The article ends with recommendations for an ethical way of enrolling palliative patients in early stages of oncology research, giving special attention to provision of adequate consent, protection of vulnerability, and avoidance of therapeutic misconception.

  7. Phase 2 Study of Temozolomide-Based Chemoradiation Therapy for High-Risk Low-Grade Gliomas: Preliminary Results of Radiation Therapy Oncology Group 0424

    Energy Technology Data Exchange (ETDEWEB)

    Fisher, Barbara J., E-mail: barbara.fisher@lhsc.on.ca [London Regional Cancer Program, London, Ontario (Canada); Hu, Chen [Radiation Therapy Oncology Group-Statistical Center, Philadelphia, Pennsylvania (United States); Macdonald, David R. [London Regional Cancer Program, London, Ontario (Canada); Lesser, Glenn J. [Wake Forest University Baptist Medical Center, Winston-Salem, North Carolina (United States); Coons, Stephen W. [Barrow Neurological Institute, Phoenix, Arizona (United States); Brachman, David G. [Arizona Oncology Services Foundation, Phoenix, Arizona (United States); Ryu, Samuel [Henry Ford Hospital, Detroit, Michigan (United States); Werner-Wasik, Maria [Thomas Jefferson University Hospital Center, Philadelphia, Pennsylvania (United States); Bahary, Jean-Paul [Centre Hospitalier de l' Université de Montréal-Notre Dame, Montreal, Quebec (Canada); Liu, Junfeng [GCE Solutions, Inc., Bloomington, Illinois (United States); Chakravarti, Arnab [The Ohio State University, The James, Columbus, Ohio (United States); Mehta, Minesh [University of Maryland Medical Systems, Baltimore, Maryland (United States)

    2015-03-01

    Purpose: Radiation Therapy Oncology Group (RTOG) 0424 was a phase 2 study of a high-risk low-grade glioma (LGG) population who were treated with temozolomide (TMZ) and radiation therapy (RT), and outcomes were compared to those of historical controls. This study was designed to detect a 43% increase in median survival time (MST) from 40.5 to 57.9 months and a 20% improvement in 3-year overall survival (OS) rate from 54% to 65% at a 10% significance level (1-sided) and 96% power. Methods and Materials: Patients with LGGs with 3 or more risk factors for recurrence (age ≥40 years, astrocytoma histology, bihemispherical tumor, preoperative tumor diameter of ≥6 cm, or a preoperative neurological function status of >1) were treated with RT (54 Gy in 30 fractions) and concurrent and adjuvant TMZ. Results: From 2005 to 2009, 129 evaluable patients (75 males and 54 females) were accrued. Median age was 49 years; 91% had a Zubrod score of 0 or 1; and 69%, 25%, and 6% of patients had 3, 4, and 5 risk factors, respectively. Patients had median and minimum follow-up examinations of 4.1 years and 3 years, respectively. The 3-year OS rate was 73.1% (95% confidence interval: 65.3%-80.8%), which was significantly improved compared to that of prespecified historical control values (P<.001). Median survival time has not yet been reached. Three-year progression-free survival was 59.2%. Grades 3 and 4 adverse events occurred in 43% and 10% of patients, respectively. One patient died of herpes encephalitis. Conclusions: The 3-year OS rate of 73.1% for RTOG 0424 high-risk LGG patients is higher than that reported for historical controls (P<.001) and the study-hypothesized rate of 65%.

  8. A Phase 1 Trial of Imetelstat in Children with Refractory or Recurrent Solid Tumors: A Children’s Oncology Group Phase 1 Consortium Study (ADVL1112)

    Science.gov (United States)

    Thompson, Patrick A.; Drissi, Rachid; Muscal, Jodi A.; Panditharatna, Eshini; Fouladi, Maryam; Ingle, Ashish M.; Ahern, Charlotte H.; Reid, Joel M.; Lin, Tong; Weigel, Brenda J.; Blaney, Susan M.

    2014-01-01

    Purpose Imetelstat is a covalently-lipidated 13-mer thiophosphoramidate oligonucleotide that acts as a potent specific inhibitor of telomerase. It binds with high affinity to the template region of the RNA component of human telomerase (hTERC ) and is a competitive inhibitor of telomerase enzymatic activity. The purpose of this study was to determine the recommended phase 2 dose of imetelstat in children with recurrent or refractory solid tumors. Experimental Design Imetelstat was administered intravenously over two hours on days 1 and 8, every 21 days. Dose levels of 225, 285, and 360 mg/m2 were evaluated, using the rolling-six design. Imetelstat pharmacokinetic and correlative biology studies were also performed during the first cycle. Results Twenty subjects were enrolled (median age 14 yrs; range 3–21). Seventeen were evaluable for toxicity. The most common toxicities were neutropenia, thrombocytopenia, and lymphopenia, with dose-limiting myelosuppression in two of six patients at 360 mg/m2. Pharmacokinetics were dose dependent with a lower clearance at the highest dose level. Telomerase inhibition was observed in peripheral blood mononuclear cells at 285 and 360 mg/m2. Two confirmed partial responses osteosarcoma (n=1) and Ewing sarcoma (n=1) were observed. Conclusions The recommended phase 2 dose of imetelstat given on days 1 and 8 of 21-day cycle is 285 mg/m2. PMID:24097866

  9. Phase II Study of Accelerated High-Dose Radiotherapy With Concurrent Chemotherapy for Patients With Limited Small-Cell Lung Cancer: Radiation Therapy Oncology Group Protocol 0239

    Energy Technology Data Exchange (ETDEWEB)

    Komaki, Ritsuko, E-mail: rkomaki@mdanderson.org [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Paulus, Rebecca [Radiation Therapy Oncology Group Statistical Center, Philadelphia, Pennsylvania (United States); Ettinger, David S. [Department of Oncology, Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Baltimore, Maryland (United States); Videtic, Gregory M.M. [Department of Radiation Oncology, Cleveland Clinic, Cleveland, Ohio (United States); Bradley, Jeffrey D. [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Glisson, Bonnie S. [Department of Thoracic/Head and Neck Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Langer, Corey J. [Thoracic Oncology, Abramson Cancer Center, University of Pennsylvania, Philadelphia, Pennsylvania (United States); Sause, William T. [Radiation Center, LDS Hospital, Salt Lake City, Utah (United States); Curran, Walter J. [Department of Radiation Oncology, Jefferson Medical College, Philadelphia, Pennsylvania (United States); Choy, Hak [Department of Radiation Oncology, University of Texas Southwestern Medical Center at Dallas, Dallas, Texas (United States)

    2012-07-15

    Purpose: To investigate whether high-dose thoracic radiation given twice daily during cisplatin-etoposide chemotherapy for limited small-cell lung cancer (LSCLC) improves survival, acute esophagitis, and local control rates relative to findings from Intergroup trial 0096 (47%, 27%, and 64%). Patients and Methods: Patients were accrued over a 3-year period from 22 US and Canadian institutions. Patients with LSCLC and good performance status were given thoracic radiation to 61.2 Gy over 5 weeks (daily 1.8-Gy fractions on days 1-22, then twice-daily 1.8-Gy fractions on days 23-33). Cisplatin (60 mg/m{sup 2} IV) was given on day 1 and etoposide (120 mg/m{sup 2} IV) on days 1-3 and days 22-24, followed by 2 cycles of cisplatin plus etoposide alone. Patients who achieved complete response were offered prophylactic cranial irradiation. Endpoints included overall and progression-free survival; severe esophagitis (Common Toxicity Criteria v 2.0) and treatment-related fatalities; response (Response Evaluation Criteria in Solid Tumors); and local control. Results: Seventy-two patients were accrued from June 2003 through May 2006; 71 were evaluable (median age 63 years; 52% female; 58% Zubrod 0). Median survival time was 19 months; at 2 years, the overall survival rate was 36.6% (95% confidence interval [CI] 25.6%-47.7%), and progression-free survival 19.7% (95% CI 11.4%-29.6%). Thirteen patients (18%) experienced severe acute esophagitis, and 2 (3%) died of treatment-related causes; 41% achieved complete response, 39% partial response, 10% stable disease, and 6% progressive disease. The local control rate was 73%. Forty-three patients (61%) received prophylactic cranial irradiation. Conclusions: The overall survival rate did not reach the projected goal; however, rates of esophagitis were lower, and local control higher, than projected. This treatment strategy is now one of three arms of a prospective trial of chemoradiation for LSCLC (Radiation Therapy Oncology Group 0538

  10. Phase II trial of the combination of bryostatin-1 and cisplatin in advanced or recurrent carcinoma of the cervix: a New York Gynecologic Oncology Group study.

    Science.gov (United States)

    Nezhat, Farr; Wadler, Scott; Muggia, Franco; Mandeli, John; Goldberg, Gary; Rahaman, Jamal; Runowicz, Carolyn; Murgo, Anthony J; Gardner, Ginger J

    2004-04-01

    Bryostatin-1 is a macrocyclic lactone that has been shown to regulate protein kinase C (PKC) activity and thereby potentially inhibit tumor invasion, angiogenesis, cell adhesion, and multidrug resistance. In preclinical experiments, bryostatin-1 induces tumor growth inhibition and enhances cytotoxicity when combined with other agents including cisplatin in cervical cancer cells. It was therefore anticipated that combination bryostatin-1-cisplatin therapy would be effective in patients with cervical cancer. The current study was conducted to evaluate this therapeutic approach in patients with recurrent or advanced-stage cervical carcinoma. An IRB-approved New York Gynecologic Oncology Group (NYGOG) trial was activated for patients with a histological diagnosis of metastatic cervical cancer or in patients with recurrent disease not eligible for surgery or radiation. Enrolled patients received bryostatin-1 (50-65 microg/m(2)) as a 1-h infusion followed by cisplatin (50 mg/m(2)). The combined treatment was administered every 21 days. Fourteen patients were enrolled. The majority of patients had squamous cell carcinoma. Ten out of fourteen patients had recurrent disease. Fifty percent of the patients received bryostatin at 50 microg/m(2) and 50% received bryostatin at 65 microg/m(2). Seventy-one percent completed two cycles of treatment. The most common grade II-III toxicities were myalgia, anemia, and nausea or vomiting. One patient developed a hypersensitivity reaction and one developed grade III nephrotoxicity. Seventy-one percent (10/14) of patients were evaluated for tumor response. Eight out of ten (80%) of patients had progressive disease and 2/10 (20%) had stable disease. There were no treatment responses. Despite promising preclinical data, this clinical trial indicates that the combination of cisplatin and bryostatin-1 at the doses and schedule used is not effective in patients with advanced-stage or recurrent cervical cancer. There is even the possibility of

  11. Prognostic significance of the S-phase fraction of light-chain-restricted cytoplasmic immunoglobulin (cIg) positive plasma cells in patients with newly diagnosed multiple myeloma enrolled on Eastern Cooperative Oncology Group treatment trial E9486.

    Science.gov (United States)

    Trendle, M C; Leong, T; Kyle, R A; Katzmann, J A; Oken, M M; Kay, N E; Van Ness, B G; Greipp, P R

    1999-08-01

    The bone marrow plasma cell labeling index (PCLI) as measured by bromodeoxyuridine uptake is a well-established independent prognostic factor for patients with newly diagnosed multiple myeloma, but the test is not easily done in most laboratories. The purpose of this study was to determine if the proliferative activity (% S-phase) as determined by two-color flow cytometry for cytoplasmic immunoglobulin (cIg) light chain and DNA content also had prognostic significance. As part of Eastern Cooperative Oncology Group clinical trial E9486, 500 patients had successful performance of the bone marrow PCLI. Of 349 patients who had flow cIg and DNA content cytometry, 210 had adequate data to reliably calculate S-phase %. Patients with low % S-phase fraction (/=2%), median survivals 4.1 vs. 2.9 years (P = 0.032). Measurement of the S-phase % by flow cytometry gives significant prognostic information in patients with newly diagnosed myeloma. However, in multivariate analysis, S-phase % did not add prognostic information when PCLI was in the model. S-phase % added prognostic information only when all cases with flow measurement of S-phase % were included, and when PCLI was excluded from the model. Discriminating a population of only cIg positive cells proved difficult in patients with a low percentage of bone marrow plasma cells. Methodology to measure S-phase % in patients with a low percent plasma cells is needed before this technique can be used for diagnosis and prognosis in myeloma. Copyright 1999 Wiley-Liss, Inc.

  12. Historical time to disease progression and progression-free survival in patients with recurrent/refractory neuroblastoma treated in the modern era on Children's Oncology Group early-phase trials.

    Science.gov (United States)

    London, Wendy B; Bagatell, Rochelle; Weigel, Brenda J; Fox, Elizabeth; Guo, Dongjing; Van Ryn, Collin; Naranjo, Arlene; Park, Julie R

    2017-09-08

    Early-phase trials in patients with recurrent neuroblastoma historically used an objective "response" of measureable disease (Response Evaluation Criteria In Solid Tumors [RECIST], without bone/bone marrow assessment) to select agents for further study. Historical cohorts may be small and potentially biased; to the authors' knowledge, disease recurrence studies from international registries are outdated. Using a large recent cohort of patients with recurrent/refractory neuroblastoma from Children's Oncology Group (COG) modern-era early-phase trials, the authors determined outcome and quantified parameters for designing future studies. The first early-phase COG trial enrollment (sequential) of 383 distinct patients with recurrent/refractory neuroblastoma on 23 phase 1, 3 phase 1/2, and 9 phase 2 trials (August 2002 to January 2014) was analyzed for progression-free survival (PFS), overall survival (OS), and time to disease progression (TTP). Planned frontline therapy for patients with high-risk neuroblastoma included hematopoietic stem cell transplantation (approximately two-thirds of patients underwent ≥1 hematopoietic stem cell transplantation); 13.2% of patients received dinutuximab. From the time of the patient's first early-phase trial enrollment (383 patients), the 1-year and 4-year PFS rates ( ± standard error) were 21% ± 2% and 6% ± 1%, respectively, whereas the 1-year and 4-year OS rates were 57% ± 3% and 20% ± 2%, respectively. The median TTP was 58 days (interquartile range, 31-183 days [350 patients]); the median follow-up was 25.3 months (33 patients were found to be without disease recurrence/progression). The median time from diagnosis to first disease recurrence/progression was 18.7 months (range, 1.4-64.8 months) (176 patients). MYCN amplification and 11q loss of heterozygosity were prognostic of worse PFS and OS (P = .003 and Pphase trial enrollment. This recent COG cohort of patients with recurrent

  13. Phase I Study of Valspodar (PSC-833) with Mitoxantrone and Etoposide in Refractory and Relapsed Pediatric Acute Leukemia: A Report from the Children’s Oncology Group

    Science.gov (United States)

    O’Brien, Maureen M.; Lacayo, Norman J.; Lum, Bert L.; Kshirsagar, Smita; Buck, Steven; Ravindranath, Yaddanapudi; Bernstein, Mark; Weinstein, Howard; Chang, Myron N.; Arceci, Robert J.; Sikic, Branimir I.; Dahl, Gary V.

    2009-01-01

    Background Valspodar, a non-immunosuppressive analog of cylosporine, is a potent P-glycoprotein (MDR1) inhibitor. As MDR1-mediated efflux of chemotherapeutic agents from leukemic blasts may contribute to drug resistance, a phase 1 study of valspodar combined with mitoxantrone and etoposide in pediatric patients with relapsed or refractory leukemias was performed. Procedure Patients received a valspodar loading dose (2 mg/kg) followed by a five-day continuous valspodar infusion (8, 10, 12.5 or 15 mg/kg/day) combined with lower than standard doses of mitoxantrone and etoposide. The valspodar dose was escalated using a standard 3 + 3 phase I design. Results 21 patients were evaluable for toxicity and 20 for response. The maximum tolerated dose (MTD) of valspodar was 12.5 mg/kg/day, combined with 50% dose-reduced mitoxantrone and etoposide. The clearance of mitoxantrone and etoposide was decreased by 64% and 60%, respectively, when combined with valspodar. Dose-limiting toxicities included stomatitis, ataxia, and bone marrow aplasia. Three of 11 patients with acute lymphoblastic leukemia (ALL) had complete responses while no patient with acute myeloid leukemia (AML) had an objective response. In vitro studies demonstrated P-glycoprotein expression on the blasts of five of 14 patients, although only one had inhibition of rhodamine efflux by valspodar. Conclusions While this regimen was tolerable, responses in this heavily pretreated population were limited to a subset of patients with ALL. PMID:20209646

  14. A Phase 2 Trial of Radiation Therapy With Concurrent Paclitaxel Chemotherapy After Surgery in Patients With High-Risk Endometrial Cancer: A Korean Gynecologic Oncologic Group Study

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Hanbyoul [Department of Obstetrics and Gynecology, Gangnam Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Institute of Women' s Life Medical Science, Yonsei University College of Medicine, Seoul (Korea, Republic of); Nam, Byung-Ho [Cancer Biostatistics Branch, Research Institute for National Cancer Control and Evaluation, National Cancer Center, Goyang (Korea, Republic of); Kim, Seok Mo [Department of Obstetrics and Gynecology, Chonnam National University School of Medicine, Gwangju (Korea, Republic of); Cho, Chi-Heum [Department of Obstetrics and Gynecology, Keimyung University School of Medicine, Daegu (Korea, Republic of); Kim, Byoung Gie [Department of Obstetrics and Gynecology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of); Ryu, Hee-Sug [Department of Obstetrics and Gynecology, Ajou University School of Medicine, Suwon (Korea, Republic of); Kang, Soon Beom [Department of Obstetrics and Gynecology, Konkuk University School of Medicine, Seoul (Korea, Republic of); Kim, Jae-Hoon, E-mail: jaehoonkim@yuhs.ac [Department of Obstetrics and Gynecology, Gangnam Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Institute of Women' s Life Medical Science, Yonsei University College of Medicine, Seoul (Korea, Republic of)

    2014-09-01

    Purpose: A phase 2 study was completed by the Korean Gynecologic Oncologic Group to evaluate the efficacy and toxicity of concurrent chemoradiation with weekly paclitaxel in patients with high-risk endometrial cancer. Methods and Materials: Pathologic requirements included endometrial endometrioid adenocarcinoma stages III and IV. Radiation therapy consisted of a total dose of 4500 to 5040 cGy in 5 fractions per week for 6 weeks. Paclitaxel 60 mg/m{sup 2} was administered once weekly for 5 weeks during radiation therapy. Results: Fifty-seven patients were enrolled between January 2006 and March 2008. The median follow-up time was 60.0 months (95% confidence interval [CI], 51.0-58.2). All grade 3/4 toxicities were hematologic and usually self-limited. There was no life-threatening toxicity. The cumulative incidence of intrapelvic recurrence sites was 1.9% (1/52), and the cumulative incidence of extrapelvic recurrence sites was 34.6% (18/52). The estimated 5-year disease-free and overall survival rates were 63.5% (95% CI, 50.4-76.5) and 82.7% (95% CI, 72.4-92.9), respectively. Conclusions: Concurrent chemoradiation with weekly paclitaxel is well tolerated and seems to be effective for high-risk endometrioid endometrial cancers. This approach appears reasonable to be tested for efficacy in a prospective, randomized controlled study.

  15. Report of a Phase I Evaluation of Dose and Schedule of Interleukin-1 Alpha and Cyclophosphamide in Patients with Advanced Tumors: An Eastern Cooperative Oncology Group Study (PX990) and Review of IL-1-Based Studies of Hematopoietic Reconstitution

    Science.gov (United States)

    Neuberg, Donna; Atkins, Michael B.; Tester, William J.; Wadler, Scott; Stewart, James A.; Chachoua, Abraham; Schuchter, Lynn M.

    2014-01-01

    Interleukin-1 (IL-1) is a cytokine critical to inflammation, immunological activation, response to infection, and bone marrow hematopoiesis. Cyclophosphamide downmodulates immune suppressor cells and is cytotoxic to a variety of tumors. A phase I trial of IL-1 and cyclophosphamide was conducted by the Eastern Cooperative Oncology Group. This study evaluated 3 dose levels and 3 schedules in patients with solid tumors. The goal was to evaluate the hematopoietic supportive care effect and possible antitumor effect. Toxicity was fever, chills, hypotension, nausea/emesis, hepatic, and neutropenia. Toxicity increased with dose increases of interleukin-1. Treatment at all dose levels resulted in significant increases in total white blood cell (WBC) counts above baseline. Nadir WBC and nadir absolute neutrophil counts were not significantly different by dose level of IL-1 or schedule of IL-1. Toxicity due to IL-1 at higher doses prohibited further evaluation of this agent for hematopoietic support, particularly in view of the activity and tolerability of more lineage-specific hematopoietic cytokines. Therapeutic interventions in the role of IL-1 in inflammatory conditions and cancer may be further informed by our definition of its clinical and biological effects in this evaluation of dose and schedule. PMID:24433038

  16. A phase II clinical trial of endoscopic submucosal dissection for early gastric cancer of undifferentiated type: Japan Clinical Oncology Group study JCOG1009/1010.

    Science.gov (United States)

    Takizawa, Kohei; Takashima, Atsuo; Kimura, Aya; Mizusawa, Junki; Hasuike, Noriaki; Ono, Hiroyuki; Terashima, Masanori; Muto, Manabu; Boku, Narikazu; Sasako, Mitsuru; Fukuda, Haruhiko

    2013-01-01

    A Phase II clinical trial has been initiated to evaluate the efficacy and safety of endoscopic submucosal dissection for intramucosal (cT1a) gastric cancer of undifferentiated type. Patients with cT1a gastric cancer with undifferentiated-type adenocarcinoma are eligible for the study. The tumor size should be 2 cm or less without ulceration. The study will enroll a total of 325 patients from 51 institutions over a 4-year period. The primary endpoint is proportion of 5-year overall survival (% 5-year overall survival) in patients with undifferentiated dominant type. The secondary endpoints are overall survival, relapse-free survival, distant metastasis-free survival, % 5-year overall survival without either recurrence or gastrectomy, % en-bloc resection with endoscopic submucosal dissection, % pathological curative resection with endoscopic submucosal dissection, % 5-year overall survival in patients with differentiated dominant type, % 5-year overall survival in patients with pathologically curative resection with endoscopic submucosal dissection and adverse events.

  17. A randomized phase II study of carboplatin plus pegylated liposomal doxorubicin versus carboplatin plus paclitaxel in platinum sensitive ovarian cancer patients: a Hellenic Cooperative Oncology Group study

    Directory of Open Access Journals (Sweden)

    Briasoulis Evangelos

    2010-01-01

    Full Text Available Abstract Background Platinum-based combinations are the standard second-line treatment for platinum-sensitive ovarian cancer (OC. This randomized phase II study was undertaken in order to compare the combination of carboplatin and pegylated liposomal doxorubicin (LD with carboplatin and paclitaxel (CP in this setting. Methods Patients with histologically confirmed recurrent OC, at the time of or more than 6 months after platinum-based chemotherapy, were randomized to six cycles of CP (carboplatin AUC5 + paclitaxel 175 mg/m2, d1q21 or CLD (carboplatin AUC5 + pegylated LD 45 mg/m2, d1q28. Results A total of 189 eligible patients (CP 96, CLD 93, with a median age of 63 years, median Performance Status (PS 0 and a median platinum free interval (PFI of 16.5 months, entered the study. Discontinuation due to toxicity was higher in the CP patients (13.5% versus 3%, P = 0.016. The overall response rate was similar: CP 58% versus CLD 51%, P = 0.309 (Complete Response; CR 34% versus 23% and there was no statistical difference in time-to-progression (TTP or overall survival (OS; TTP 10.8 months CP versus 11.8 CLD, P = 0.904; OS 29.4 months CP versus 24.7 CLD, P = 0.454. No toxic deaths were recorded. Neutropenia was the most commonly seen severe toxicity (CP 30% versus CLD 35%. More frequent in CLD were severe thrombocytopenia (11% versus 2%, P = 0.016, skin toxicity and Palmar-plantar erythrodysesthesia (PPE grade 1-2 (38% versus 9%, PP = 0.029, 20% versus 5%, P = 0.003. PS and PFI were independent prognostic factors for TTP and OS. Conclusions The combination of pegylated LD with carboplatin is effective, showing less neurotoxicity and alopecia than paclitaxel-carboplatin. It thus warrants a further phase III evaluation as an alternative treatment option for platinum-sensitive OC patients. Trial Registration Australian New Zealand Clinical Trials Registry: ACTRN12609000436279

  18. Risk factors for GI adverse events in a phase III randomized trial of bevacizumab in first-line therapy of advanced ovarian cancer: A Gynecologic Oncology Group Study.

    Science.gov (United States)

    Burger, Robert A; Brady, Mark F; Bookman, Michael A; Monk, Bradley J; Walker, Joan L; Homesley, Howard D; Fowler, Jeffrey; Greer, Benjamin E; Boente, Matthew; Fleming, Gini F; Lim, Peter C; Rubin, Stephen C; Katsumata, Noriyuki; Liang, Sharon X

    2014-04-20

    To evaluate risk factors for GI adverse events (AEs) within a phase III trial of bevacizumab in first-line ovarian cancer therapy. Women with previously untreated advanced disease after surgery were randomly allocated to six cycles of platinum-taxane chemotherapy plus placebo cycles (C)2 to C22 (R1); chemotherapy plus bevacizumab C2 to C6 plus placebo C7 to C22 (R2); or chemotherapy plus bevacizumab C2 to C22 (R3). Patients were evaluated for history or on-study development of potential risk factors for GI AEs defined as grade ≥ 2 perforation, fistula, necrosis, or hemorrhage. Of 1,873 patients enrolled, 1,759 (94%) were evaluable, and 2.8% (50 of 1,759) experienced a GI AE: 10 of 587 (1.7%, R1), 20 of 587 (3.4%, R2), and 20 of 585 (3.4%, R3). Univariable analyses indicated that previous treatment of inflammatory bowel disease (IBD; P = .005) and small bowel resection (SBR; P = .032) or large bowel resection (LBR; P = .012) at primary surgery were significantly associated with a GI AE. The multivariable estimated relative odds of a GI AE were 13.4 (95% CI, 3.44 to 52.3; P GI AEs in patients receiving first-line platinum-taxane chemotherapy for advanced ovarian cancer. After accounting for these risk factors, concurrent bevacizumab doubles the odds of a GI AE, but is not appreciably increased by continuation beyond chemotherapy.

  19. A randomized phase I/II study of ABT-888 in combination with temozolomide in recurrent temozolomide resistant glioblastoma: an NRG oncology RTOG group study.

    Science.gov (United States)

    Robins, H Ian; Zhang, Peixin; Gilbert, Mark R; Chakravarti, Arnab; de Groot, John F; Grimm, Sean A; Wang, Fen; Lieberman, Frank S; Krauze, Andra; Trotti, Andy M; Mohile, Nimish; Kee, Andrew Y J; Colman, Howard; Cavaliere, Robert; Kesari, Santosh; Chmura, Steven J; Mehta, Minesh

    2016-01-01

    This study tested the hypothesis that ABT-888 (velparib), a poly (ADP-ribose) polymerase (PARP) inhibitor, can modulate temozolomide (TMZ) resistance in recurrent TMZ refractory glioblastoma patients. The combination regimen (TMZ/ABT-888) was tested using two randomized schedules (5 vs. 21 days), with 6-month progression free survival (PFS6) as the primary endpoint. The maximum tolerated dose (MTD) for TMZ using the 21 day of 28 TMZ schedule, in concert with 40 mg BID ABT-888 was determined in a phase I portion of this study, and previously reported to be 75 mg/m(2) (arm1). The MTD for ABT-888 (40 mg BID) and the 5 of 28 day TMZ (150-200 mg/m(2)) schedule was known from prior trials (arm2). Two cohorts were studied: bevacizumab (BEV) naïve (n = 151), and BEV refractory (n = 74). Overall ten patients were ineligible. The incidence rate of grade 3/4 myelosuppression over all was 20.0 %. For the BEV refractory cohort, the PFS 6 was 4.4 %; for the BEV naïve cohort, PFS6 was 17 %. Overall survival was similar for both arms in both the BEV naïve [median survival time (MST) 10.3 M; 95 % CI 8.4-12] and BEV refractory cohort (MST 4.7 M; 95 %CI 3.5-5.6). The median PFS was essentially the same for both arms and both cohorts at ~2.0 M (95 % CI 1.9-2.1).

  20. About the Community Oncology and Prevention Trials Research Group | Division of Cancer Prevention

    Science.gov (United States)

    The Community Oncology and Prevention Trials Research Group supports clinical oncology trials in cancer prevention and control in community settings. The group also supports investigator-initiated research projects in supportive, palliative and end-of-life care, and coordinates clinical oncology research projects with other NCI programs to be done in the community setting. |

  1. A Phase 3 Trial of Whole Brain Radiation Therapy and Stereotactic Radiosurgery Alone Versus WBRT and SRS With Temozolomide or Erlotinib for Non-Small Cell Lung Cancer and 1 to 3 Brain Metastases: Radiation Therapy Oncology Group 0320

    Energy Technology Data Exchange (ETDEWEB)

    Sperduto, Paul W., E-mail: psperduto@mropa.com [Metro MN CCOP, Minneapolis, Minnesota (United States); Wang, Meihua [RTOG Statistical Center, Philadelphia, Pennsylvania (United States); Robins, H. Ian [University of Wisconsin Medical School Cancer Center, Madison, Wisconsin (United States); Schell, Michael C. [Wilmot Cancer Center, University of Rochester, Rochester, New York (United States); Werner-Wasik, Maria [Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Komaki, Ritsuko [University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Souhami, Luis [McGill University, Montreal, Quebec (Canada); Buyyounouski, Mark K. [Fox Chase Cancer Center, Philadelphia, Pennsylvania (United States); Khuntia, Deepak [University of Wisconsin Hospital, Madison, Wisconsin (United States); Demas, William [Akron City Hospital, Akron, Ohio (United States); Shah, Sunjay A. [Christiana Care Health Services, Inc, CCOP, Newark, Delaware (United States); Nedzi, Lucien A. [University of Texas Southwestern Medical School, Dallas, Texas (United States); Perry, Gad [The Ottawa Hospital Cancer Centre, Ottawa, Ontario (Canada); Suh, John H. [Cleveland Clinic Foundation, Cleveland, Ohio (United States); Mehta, Minesh P. [Northwestern Memorial Hospital, Chicago, Illinois (United States)

    2013-04-01

    Background: A phase 3 Radiation Therapy Oncology Group (RTOG) study subset analysis demonstrated improved overall survival (OS) with the addition of stereotactic radiosurgery (SRS) to whole brain radiation therapy (WBRT) in non-small cell lung cancer (NSCLC) patients with 1 to 3 brain metastases. Because temozolomide (TMZ) and erlotinib (ETN) cross the blood-brain barrier and have documented activity in NSCLC, a phase 3 study was designed to test whether these drugs would improve the OS associated with WBRT + SRS. Methods and Materials: NSCLC patients with 1 to 3 brain metastases were randomized to receive WBRT (2.5 Gy × 15 to 37.5 Gy) and SRS alone, versus WBRT + SRS + TMZ (75 mg/m{sup 2}/day × 21 days) or ETN (150 mg/day). ETN (150 mg/day) or TMZ (150-200 mg/m{sup 2}/day × 5 days/month) could be continued for as long as 6 months after WBRT + SRS. The primary endpoint was OS. Results: After 126 patients were enrolled, the study closed because of accrual limitations. The median survival times (MST) for WBRT + SRS, WBRT + SRS + TMZ, and WBRT + SRS + ETN were qualitatively different (13.4, 6.3, and 6.1 months, respectively), although the differences were not statistically significant. Time to central nervous system progression and performance status at 6 months were better in the WBRT + SRS arm. Grade 3 to 5 toxicity was 11%, 41%, and 49% in arms 1, 2, and 3, respectively (P<.001). Conclusion: The addition of TMZ or ETN to WBRT + SRS in NSCLC patients with 1 to 3 brain metastases did not improve survival and possibly had a deleterious effect. Because the analysis is underpowered, these data suggest but do not prove that increased toxicity was the cause of inferior survival in the drug arms.

  2. Dispositional Optimism and Therapeutic Expectations in Early Phase Oncology Trials

    Science.gov (United States)

    Jansen, Lynn A.; Mahadevan, Daruka; Appelbaum, Paul S.; Klein, William MP; Weinstein, Neil D.; Mori, Motomi; Daffé, Racky; Sulmasy, Daniel P.

    2016-01-01

    Purpose Prior research has identified unrealistic optimism as a bias that might impair informed consent among patient-subjects in early phase oncology trials. Optimism, however, is not a unitary construct – it can also be defined as a general disposition, or what is called dispositional optimism. We assessed whether dispositional optimism would be related to high expectations for personal therapeutic benefit reported by patient-subjects in these trials but not to the therapeutic misconception. We also assessed how dispositional optimism related to unrealistic optimism. Methods Patient-subjects completed questionnaires designed to measure expectations for therapeutic benefit, dispositional optimism, unrealistic optimism, and the therapeutic misconception. Results Dispositional optimism was significantly associated with higher expectations for personal therapeutic benefit (Spearman r=0.333, poptimism was weakly associated with unrealistic optimism (Spearman r=0.215, p=0.005). In multivariate analysis, both dispositional optimism (p=0.02) and unrealistic optimism (poptimism (p=.0001), but not dispositional optimism, was independently associated with the therapeutic misconception. Conclusion High expectations for therapeutic benefit among patient-subjects in early phase oncology trials should not be assumed to result from misunderstanding of specific information about the trials. Our data reveal that these expectations are associated with either a dispositionally positive outlook on life or biased expectations about specific aspects of trial participation. Not all manifestations of optimism are the same, and different types of optimism likely have different consequences for informed consent in early phase oncology research. PMID:26882017

  3. Early phase Technology Assessment of nanotechnology in oncology.

    Science.gov (United States)

    Retèl, Valesca P; Hummel, Marjan J M; van Harten, Willem H

    2008-01-01

    To perform early Technology Assessment (TA) of nanotechnology in oncology. The possibilities of nanotechnology for detection (imaging), diagnosis and treatment of cancer are subject of different research programs where major investments are concerned. As a range of bio- nanotechnologies is expected to enter the oncology field it is relevant to consider the various aspects involved in especially early TA. This article provides two cases of early assessment of (predecessors of) nanotechnologies: Microarray Analysis and Photodynamic Therapy implementation, which methodology can be extrapolated to other nanotechnologies in oncology. Constructive Technology Assessment (CTA) is used for the introduction of technologies that are still in a dynamic phase of development or in an early stage of diffusion. The selection of studied aspects in CTA is based on: clinical aspects (safety, efficacy, and effectiveness), economic (cost-effectiveness), patient related (QoL, ethical/juridical and psychosocial), organizational aspects (diffusion and adoption) and scenario drafting. The features of the technology and the phase of implementation are decisive for choices and timing of the specific aspects to be studied. A framework was drafted to decide on the relevant aspects. In the first case, early implementation of Microarray Analysis; clinical effectiveness, logistics, patient centeredness and scenario drafting were given priority. Related to the diffusion-phase of Photodynamic Therapy however other aspects were evaluated, such as early cost-effectiveness analysis for possible reimbursement. Often CTA will result in a mixed method design. Especially scenario drafting is a powerful instrument to predict possible developments that can be anticipated upon in the assessment. CTA is appropriate for the study of early implementation of new technologies in oncology. In early TA small series often necessitate a mix of quantitative and qualitative methods. The features of nanotechnology

  4. A Phase 3 Trial of 2 Years of Androgen Suppression and Radiation Therapy With or Without Adjuvant Chemotherapy for High-Risk Prostate Cancer: Final Results of Radiation Therapy Oncology Group Phase 3 Randomized Trial NRG Oncology RTOG 9902

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, Seth A., E-mail: rosents@sutterhealth.org [Radiation Oncology, Sutter Cancer Centers, Roseville, California (United States); Hunt, Daniel [NRG Oncology Statistics and Data Management Center, Philadelphia, Pennsylvania (United States); Sartor, A. Oliver [Tulane University Medical Center, New Orleans, Louisiana (United States); Pienta, Kenneth J. [Johns Hopkins School of Medicine, Baltimore, Maryland (United States); Gomella, Leonard [Thomas Jefferson University Hospital, Philadelphia, Pennsylvania (United States); Grignon, David [Indiana University, Bloomington, Indiana (United States); Rajan, Raghu [McGill University, Montreal, Quebec (Canada); Kerlin, Kevin J. [Community Clinical Oncology Program, Southeast Cancer Control Consortium, Inc, Winston-Salem, North Carolina (United States); Jones, Christopher U. [Radiation Oncology, Sutter Cancer Centers, Roseville, California (United States); Radiological Associates of Sacramento, Sacramento, California (United States); Dobelbower, Michael [University of Alabama at Birmingham Medical Center, Birmingham, Alabama (United States); Shipley, William U. [Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts (United States); Zeitzer, Kenneth [Albert Einstein Medical Center, Bronx, New York (United States); Hamstra, Daniel A. [University of Michigan Medical Center, Ann Arbor, Michigan (United States); Donavanik, Viroon [Christiana Care Health Services, Inc, Wilmington, Delaware (United States); Rotman, Marvin [State University of New York Health Science Center–Brooklyn, Brooklyn, New York (United States); Hartford, Alan C. [Dartmouth Hitchcock Medical Center, Lebanon, New Hampshire (United States); Michalski, Jeffrey [Washington University, St. Louis, Missouri (United States); Seider, Michael [Akron City Hospital, Akron, Ohio (United States); Kim, Harold [Wayne State University, Detroit, Michigan (United States); and others

    2015-10-01

    Purpose: Long-term (LT) androgen suppression (AS) with radiation therapy (RT) is a standard treatment of high-risk, localized prostate cancer (PCa). Radiation Therapy Oncology Group 9902 was a randomized trial testing the hypothesis that adjuvant combination chemotherapy (CT) with paclitaxel, estramustine, and oral etoposide plus LT AS plus RT would improve overall survival (OS). Methods and Materials: Patients with high-risk PCa (prostate-specific antigen 20-100 ng/mL and Gleason score [GS] ≥7 or clinical stage ≥T2 and GS ≥8) were randomized to RT and AS (AS + RT) alone or with adjuvant CT (AS + RT + CT). CT was given as four 21-day cycles, delivered beginning 28 days after 70.2 Gy of RT. AS was given as luteinizing hormone-releasing hormone for 24 months, beginning 2 months before RT plus an oral antiandrogen for 4 months before and during RT. The study was designed based on a 6% improvement in OS from 79% to 85% at 5 years, with 90% power and a 2-sided alpha of 0.05. Results: A total of 397 patients (380 eligible) were randomized. The patients had high-risk PCa, 68% with GS 8 to 10 and 34% T3 to T4 tumors, and median prostate-specific antigen of 22.6 ng/mL. The median follow-up period was 9.2 years. The trial closed early because of excess thromboembolic toxicity in the CT arm. The 10-year results for all randomized patients revealed no significant difference between the AS + RT and AS + RT + CT arms in OS (65% vs 63%; P=.81), biochemical failure (58% vs 54%; P=.82), local progression (11% vs 7%; P=.09), distant metastases (16% vs 14%; P=.42), or disease-free survival (22% vs 26%; P=.61). Conclusions: NRG Oncology RTOG 9902 showed no significant differences in OS, biochemical failure, local progression, distant metastases, or disease-free survival with the addition of adjuvant CT to LT AS + RT. The trial results provide valuable data regarding the natural history of high-risk PCa treated with LT AS + RT and have implications for

  5. Nine-year change in statistical design, profile, and success rates of Phase II oncology trials.

    Science.gov (United States)

    Ivanova, Anastasia; Paul, Barry; Marchenko, Olga; Song, Guochen; Patel, Neerali; Moschos, Stergios J

    2016-01-01

    We investigated nine-year trends in statistical design and other features of Phase II oncology clinical trials published in 2005, 2010, and 2014 in five leading oncology journals: Cancer, Clinical Cancer Research, Journal of Clinical Oncology, Annals of Oncology, and Lancet Oncology. The features analyzed included cancer type, multicenter vs. single-institution, statistical design, primary endpoint, number of treatment arms, number of patients per treatment arm, whether or not statistical methods were well described, whether the drug was found effective based on rigorous statistical testing of the null hypothesis, and whether the drug was recommended for future studies.

  6. Immunotherapy Response Assessment in Neuro-Oncology (iRANO): A Report of the RANO Working Group

    Science.gov (United States)

    Okada, Hideho; Weller, Michael; Huang, Raymond; Finocchiaro, Gaetano; Gilbert, Mark R.; Wick, Wolfgang; Ellingson, Benjamin M.; Hashimoto, Naoya; Pollack, Ian F.; Brandes, Alba A.; Franceschi, Enrico; Herold-Mende, Christel; Nayak, Lakshmi; Panigrahy, Ashok; Pope, Whitney B.; Prins, Robert; Sampson, John H.; Wen, Patrick Y.; Reardon, David A.

    2015-01-01

    Immunotherapy represents a promising area of therapy among neuro-oncology patients. However, early phase studies reveal unique challenges associated with assessment of radiological changes reflecting delayed responses or therapy-induced inflammation. Clinical benefit, including long-term survival and tumor regression, can still occur following initial apparent progression or appearance of new lesions. Refinement of response assessment criteria for neuro-oncology patients undergoing immunotherapy is therefore warranted. A multinational and multidisciplinary panel of neuro-oncology immunotherapy experts describes immunotherapy response assessment for neuro-oncology (iRANO) criteria that are based on guidance for determination of tumor progression outlined by the immune-related response criteria (irRC) and the response assessment in neuro-oncology (RANO) working group. Among patients who demonstrate imaging findings meeting RANO criteria for progressive disease (PD) within six months of initiating immunotherapy including the development of new lesions, confirmation of radiographic progression on follow-up imaging is recommended provided that the patient is not significantly worse clinically. The proposed criteria also include guidelines for use of corticosteroids. The role of advanced imaging techniques and measurement of clinical benefit endpoints including neurologic and immunologic functions are reviewed. The iRANO guidelines put forth herein will evolve successively to improve their utility as further experience from immunotherapy trials in neuro-oncology accumulate. PMID:26545842

  7. Addition of bevacizumab to chemotherapy in acute myeloid leukemia at older age : a randomized phase 2 trial of the Dutch-Belgian Cooperative Trial Group for Hemato-Oncology (HOVON) and the Swiss Group for Clinical Cancer Research (SAKK)

    NARCIS (Netherlands)

    Ossenkoppele, Gert J; Stussi, Georg; Maertens, Johan; van Montfort, Kees; Biemond, Bart J; Breems, Dimitri; Ferrant, August; Graux, Carlos; de Greef, Georgine E; Halkes, C J M; Hoogendoorn, Mels; Hollestein, Rene M; Jongen-Lavrencic, Mojca; Levin, Mark D; van de Loosdrecht, Arjan A; van Marwijk Kooij, Marinus; van Norden, Yvette; Pabst, Thomas; Schouten, Harry C; Vellenga, Edo; Verhoef, Gregor E G; de Weerdt, Okke; Wijermans, Pierre; Passweg, Jakob R; Löwenberg, Bob

    2012-01-01

    An urgent need for new treatment modalities is emerging in elderly patients with acute myeloid leukemia (AML). We hypothesized that targeting VEGF might furnish an effective treatment modality in this population. Elderly patients with AML were randomly assigned in this phase 2 study (n = 171) to rec

  8. Addition of bevacizumab to chemotherapy in acute myeloid leukemia at older age: A randomized phase 2 trial of the Dutch-Belgian Cooperative Trial Group for Hemato-Oncology (HOVON) and the Swiss Group for Clinical Cancer Research (SAKK)

    NARCIS (Netherlands)

    G.J. Ossenkoppele (Gert); G. Stussi (Georg); J. Maertens (Johan); C.A.G.M. Montfort (Kees); B.J. Biemond (Bart); D.A. Breems (Dimitri); A. Ferrant (Augustin); C. Graux (Carlos); G.E. de Greef (Georgine); C.J.M. Halkes (Constantijn ); M. Hoogendoorn (Mels); L.M. Hollestein (Loes); M. Jongen-Lavrencic (Mojca); M.-D. Levin (Mark-David); A.A. van de Loosdrecht (Arjan); M. Van Marwijk Kooij (Marinus); Y. van Norden (Yvette); T. Pabst (Thomas); H. Schouten (Harry); E. Vellenga (Edo); G.E.G. Verhoef (Gregor); O. de Weerdt (O.); P.W. Wijermans (Pierre); J. Passweg (Jakob Robert); B. Löwenberg (Bob)

    2012-01-01

    textabstractAn urgent need for new treatment modalities is emerging in elderly patients with acute myeloid leukemia (AML). We hypothesized that targeting VEGF might furnish an effective treatment modality in this population. Elderly patients with AML were randomly assigned in this phase 2 study (n =

  9. Past and present achievements, and future direction of the Gastrointestinal Oncology Study Group (GIOSG), a Division of Japan Clinical Oncology Group (JCOG).

    Science.gov (United States)

    Boku, Narikazu

    2011-12-01

    Initially, Gastrointestinal Study Group in Japan Clinical Oncology Group (GIOSG/JCOG) focused on gastric cancer. In 1980s, fluoropyrimidine, cisplatin and mitomycin C were key drugs. A randomized Phase II trial (JCOG8501) comparing futrafur plus mitomycin C and uracil plus futrafur and mitomycin C showed a higher response rate of uracil plus futrafur and mitomycin C than futrafur plus mitomycin C. From the results of two Phase II trials of etoposide, adriamycin and cisplatin, and cisplatin plus 5-fluorouracil, uracil plus futrafur and mitomycin C and cisplatin plus 5-fluorouracil were adopted for the test arms of the Phase III trial (JCOG9205) comparing with continuous infusion of 5-fluorouracil as a control arm. Neither cisplatin plus 5-fluorouracil nor uracil plus futrafur and mitomycin C showed a survival benefit over continuous infusion of 5-fluorouracil. In late 1990s, new agents, irinotecan and S-1, were developed for gastric cancer in Japan. GIOSG conducted a Phase III trial (JCOG9912) investigating superiority of irinotecan plus cisplatin and non-inferiority of monotherapy with S-1 compared with continuous infusion of 5-fluorouracil, and S-1 succeeded in showing non-inferiority. Then, SPIRITS trial showed a survival benefit of S-1 plus cisplatin over S-1, resulting in the establishment of a standard care for advanced gastric cancer in Japan. GIOSG have merged with Gastric Cancer Study Group as the Stomach Cancer Study Group (SCSG) from 2011. Recent progress in the development of new drugs has been remarkable. From the point of the roles shared with many other study groups for clinical trials, including registration trials of new drugs conducted by pharmaceutical companies, SCSG should recognize its role and conduct clinical trials with high quality for establishing new standard treatment.

  10. Phase 0 clinical trials in oncology new drug development.

    Science.gov (United States)

    Gupta, Umesh Chandra; Bhatia, Sandeep; Garg, Amit; Sharma, Amit; Choudhary, Vaibhav

    2011-01-01

    Research focus of pharmaceutical industry has expanded to a larger extent in last few decades putting many more new molecules, particularly targeted agents, for the clinical development. On the other hand, researchers are facing serious challenges due to high failure rates of new molecules in clinical studies. The United States Food and Drug Administration (FDA) in combination with academia and industry experts identified many factors responsible for failures of new molecules, and with a vision of taking traditional drug development model toward an innovative paradigm shift, issued regulatory guidance on conduct of exploratory investigational new drug (exploratory IND) studies, often called as phase 0 clinical trials, requiring reduced preclinical testing, which has special relevance to life-threatening diseases such as cancer. Phase 0 trials, utilizing much lower drug doses, provide an opportunity to explore the clinical behavior of new molecules very early in the drug development pathway, helping to identify the promising candidates and eliminating non-promising molecules, thus improving the efficiency of overall drug development with significant savings of resources. Being non-therapeutic in nature, these studies, however, pose certain ethical challenges requiring careful study designing and informed consent process. This article reviews the insights and perspectives for the feasibility, utility, planning, designing and conduct of phase 0 clinical trials, in addition to ethical issues and industrial perspective focused at oncology new drug development.

  11. Phase 0 clinical trials in oncology new drug development

    Directory of Open Access Journals (Sweden)

    Umesh Chandra Gupta

    2011-01-01

    Full Text Available Research focus of pharmaceutical industry has expanded to a larger extent in last few decades putting many more new molecules, particularly targeted agents, for the clinical development. On the other hand, researchers are facing serious challenges due to high failure rates of new molecules in clinical studies. The United States Food and Drug Administration (FDA in combination with academia and industry experts identified many factors responsible for failures of new molecules, and with a vision of taking traditional drug development model toward an innovative paradigm shift, issued regulatory guidance on conduct of exploratory investigational new drug (exploratory IND studies, often called as phase 0 clinical trials, requiring reduced preclinical testing, which has special relevance to life-threatening diseases such as cancer. Phase 0 trials, utilizing much lower drug doses, provide an opportunity to explore the clinical behavior of new molecules very early in the drug development pathway, helping to identify the promising candidates and eliminating non-promising molecules, thus improving the efficiency of overall drug development with significant savings of resources. Being non-therapeutic in nature, these studies, however, pose certain ethical challenges requiring careful study designing and informed consent process. This article reviews the insights and perspectives for the feasibility, utility, planning, designing and conduct of phase 0 clinical trials, in addition to ethical issues and industrial perspective focused at oncology new drug development.

  12. Merging Children's Oncology Group Data with an External Administrative Database Using Indirect Patient Identifiers: A Report from the Children's Oncology Group.

    Directory of Open Access Journals (Sweden)

    Yimei Li

    Full Text Available Clinical trials data from National Cancer Institute (NCI-funded cooperative oncology group trials could be enhanced by merging with external data sources. Merging without direct patient identifiers would provide additional patient privacy protections. We sought to develop and validate a matching algorithm that uses only indirect patient identifiers.We merged the data from two Phase III Children's Oncology Group (COG trials for de novo acute myeloid leukemia (AML with the Pediatric Health Information Systems (PHIS. We developed a stepwise matching algorithm that used indirect identifiers including treatment site, gender, birth year, birth month, enrollment year and enrollment month. Results from the stepwise algorithm were compared against the direct merge method that used date of birth, treatment site, and gender. The indirect merge algorithm was developed on AAML0531 and validated on AAML1031.Of 415 patients enrolled on the AAML0531 trial at PHIS centers, we successfully matched 378 (91.1% patients using the indirect stepwise algorithm. Comparison to the direct merge result suggested that 362 (95.7% matches identified by the indirect merge algorithm were concordant with the direct merge result. When validating the indirect stepwise algorithm using the AAML1031 trial, we successfully matched 157 out of 165 patients (95.2% and 150 (95.5% of the indirectly merged matches were concordant with the directly merged matches.These data demonstrate that patients enrolled on COG clinical trials can be successfully merged with PHIS administrative data using a stepwise algorithm based on indirect patient identifiers. The merged data sets can be used as a platform for comparative effectiveness and cost effectiveness studies.

  13. Dummy Run of Quality Assurance Program in a Phase 3 Randomized Trial Investigating the Role of Internal Mammary Lymph Node Irradiation in Breast Cancer Patients: Korean Radiation Oncology Group 08-06 Study

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Yoonsun [Department of Radiation Oncology, Yonsei Cancer Center, Yonsei University College of Medicine, Seoul (Korea, Republic of); Kim, Jun Won [Department of Radiation Oncology, Gangnam Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Shin, Kyung Hwan [Department of Radiation Oncology, Proton Therapy Center, Research Institute and Hospital, National Cancer Center, Goyang (Korea, Republic of); Kim, Su Ssan [Department of Radiation Oncology, Asan Medical Center, University of Ulsan, College of Medicine, Seoul (Korea, Republic of); Ahn, Sung-Ja [Department of Radiation Oncology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Park, Won [Department of Radiation Oncology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of); Lee, Hyung-Sik [Department of Radiation Oncology, Dong-A University Hospital, Dong-A University School of Medicine, Busan (Korea, Republic of); Kim, Dong Won [Department of Radiation Oncology, Pusan National University Hospital, Pusan National University School of Medicine, Busan (Korea, Republic of); Lee, Kyu Chan [Department of Radiation Oncology, Gachon University Gil Medical Center, Incheon (Korea, Republic of); Suh, Hyun Suk [Department of Radiation Oncology, Ewha Womans University Mokdong Hospital, Seoul (Korea, Republic of); Kim, Jin Hee [Department of Radiation Oncology, Dongsan Medical Center, Keimyung University School of Medicine, Daegu (Korea, Republic of); Shin, Hyun Soo [Department of Radiation Oncology, Bundang CHA Hospital, School of Medicine, CHA University, Seongnam (Korea, Republic of); Kim, Yong Bae, E-mail: ybkim3@yuhs.ac [Department of Radiation Oncology, Yonsei Cancer Center, Yonsei University College of Medicine, Seoul (Korea, Republic of); Suh, Chang-Ok [Department of Radiation Oncology, Yonsei Cancer Center, Yonsei University College of Medicine, Seoul (Korea, Republic of)

    2015-02-01

    Purpose: The Korean Radiation Oncology Group (KROG) 08-06 study protocol allowed radiation therapy (RT) technique to include or exclude breast cancer patients from receiving radiation therapy to the internal mammary lymph node (IMN). The purpose of this study was to assess dosimetric differences between the 2 groups and potential influence on clinical outcome by a dummy run procedure. Methods and Materials: All participating institutions were asked to produce RT plans without irradiation (Arm 1) and with irradiation to the IMN (Arm 2) for 1 breast-conservation treatment case (breast-conserving surgery [BCS]) and 1 mastectomy case (modified radical mastectomy [MRM]) whose computed tomography images were provided. We assessed interinstitutional variations in IMN delineation and evaluated the dose-volume histograms of the IMN and normal organs. A reference IMN was delineated by an expert panel group based on the study guidelines. Also, we analyzed the potential influence of actual dose variation observed in this study on patient survival. Results: Although physicians intended to exclude the IMN within the RT field, the data showed almost 59.0% of the prescribed dose was delivered to the IMN in Arm 1. However, the mean doses covering the IMN in Arm 1 and Arm 2 were significantly different for both cases (P<.001). Due to the probability of overdose in Arm 1, the estimated gain in 7-year disease-free survival rate would be reduced from 10% to 7.9% for BCS cases and 7.1% for MRM cases. The radiation doses to the ipsilateral lung, heart, and coronary artery were lower in Arm 1 than in Arm 2. Conclusions: Although this dummy run study indicated that a substantial dose was delivered to the IMN, even in the nonirradiation group, the dose differences between the 2 groups were statistically significant. However, this dosimetric profile should be studied further with actual patient samples and be taken into consideration when analyzing clinical outcomes according to IMN

  14. [An art education programme for groups in the psycho-oncological after-care].

    Science.gov (United States)

    Geue, Kristina; Buttstädt, Marianne; Richter, Robert; Böhler, Ursula; Singer, Susanne

    2011-03-01

    In this paper the formal and contentual structure of the outpatient art education programme for oncological patients is presented. The group intervention was comprised of 22 separate sessions. The course consisted of 3 phases. The first unit helped to foster mutual understanding and to learn various experimental drawing techniques using a given topic. The second unit merged into the shaping of personal thoughts and feelings with the aim of encouraging self-perception and reflection. The aim in the third phase is to create a personal book. The effects of the intervention for the participants were examined in studies. The art therapist as well as the supervisor sees development of better coping strategies, contact with other patients and enhancement of scope of action through the regular activities as main effects. Participants reported the enlargement of means of expression, emotional stabilization, coping with illness, personal growth and contacts with other patients as meanings. This art education course enlarges the field of psycho-oncological interventions in outpatient care with a low-treshhold and resource-oriented creative programme.

  15. Phase II Trial Assessing the Ability of Neoadjuvant Chemotherapy With or Without Second-Look Surgery to Eliminate Measurable Disease for Nongerminomatous Germ Cell Tumors: A Children's Oncology Group Study.

    Science.gov (United States)

    Goldman, Stewart; Bouffet, Eric; Fisher, Paul G; Allen, Jeffrey C; Robertson, Patricia L; Chuba, Paul J; Donahue, Bernadine; Kretschmar, Cynthia S; Zhou, Tianni; Buxton, Allen B; Pollack, Ian F

    2015-08-01

    This phase II trial evaluated the effect of neoadjuvant chemotherapy with or without second-look surgery before craniospinal irradiation on response rates and survival outcomes in children with newly diagnosed non-germinomatous germ cell tumors. Induction chemotherapy consisted of six cycles of carboplatin/etoposide alternating with ifosfamide/etoposide. Patients demonstrating less than complete response after induction chemotherapy were encouraged to undergo second-look surgery. Patients who did not achieve complete response or partial response after chemotherapy with or without second-look surgery proceeded to high-dose chemotherapy with thiotepa and etoposide and autologous peripheral blood stem-cell rescue before craniospinal irradiation. The study included 102 patients treated between January 2004 and July 2008. Median age was 12 years, and 76% were male; 53.9% had pineal region masses, and 23.5% had suprasellar lesions. Sixty-nine percent of patients achieved complete response or partial response with neoadjuvant chemotherapy. At 5 years, event-free survival was 84% ± 4% (SE) and overall survival was 93% ± 3%. During the median follow-up of 5.1 years, 16 patients recurred or progressed, with seven deaths after relapse. No deaths were attributed to therapy-related toxicity. Relapse occurred at the site of primary disease in 10 patients, at a distant site in three patients, or both in one patient. In two patients, progression was detected by marker increase alone. Increased serum α-fetoprotein was a negative prognostic variable. Histologic subtype and increase of beta-human chorionic gonadotropin were not significantly correlated with worse outcomes. Neoadjuvant chemotherapy with or without second-look surgery achieved high response rates contributing to excellent survival outcomes in children with newly diagnosed non-germinomatous germ cell tumors. This regimen should be included as a backbone for further studies. © 2015 by American Society of Clinical

  16. Phase 3 Oncology Clinical Trials in South Africa: Experimentation or Therapeutic Misconception?

    Science.gov (United States)

    Malan, Tina; Moodley, Keymanthri

    2016-02-01

    Although clinical research in oncology is vital to improve current understanding of cancer and to validate new treatment options, voluntary informed consent is a critical component. Oncology research participants are a particularly vulnerable population; hence, therapeutic misconception often leads to ethical and legal challenges. We conducted a qualitative study administering semi-structured questionnaires on 29 adult, Phase 3, oncology clinical trial participants at three different private oncology clinical trial sites in South Africa. A descriptive content analysis was performed to identify perceptions of these participants regarding Phase 3 clinical trials. We found that most participants provided consent to be included in the trial for self-benefit. More than half of the participants had a poor understanding of Phase 3 clinical trials, and almost half the participants believed the clinical trial did not pose any significant risk to them. The word "hope" was used frequently by participants, displaying clear optimism with regard to the clinical trial and its outcome. This indicated that therapeutic misconception does occur in the South African oncology research setting and has the potential to lead to underestimation of the risks of a Phase 3 clinical trial. Emphasizing the experimental nature of a clinical trial during the consent process is critical to address therapeutic misconception in oncology research.

  17. Early phase Technology Assessment of nanotechnology in oncology

    NARCIS (Netherlands)

    Retèl, Valesca P.; Hummel, Marjan J.M.; Harten, van Willem H.

    2008-01-01

    To perform early Technology Assessment (TA) of nanotechnology in oncology. The possibilities of nanotechnology for detection (imaging), diagnosis and treatment of cancer are subject of different research programs where major investments are concerned. As a range of bio- nanotechnologies is expected

  18. Group Therapy with Patients in the Waiting Room of an Oncology Clinic.

    Science.gov (United States)

    Arnowitz, Edward; And Others

    1983-01-01

    Describes a therapy group for cancer patients, conducted by cotherapists in an oncology waiting room. Group members provided mutual support and shared concerns and coping methods. Medical staff members became more involved and were more able to address the affective needs of the patients and their families. (JAC)

  19. Conducting Nursing Intervention Research in a Cooperative Group Setting – A Gynecologic Oncology Group (GOG) Experience

    Science.gov (United States)

    Donovan, Heidi S.; Nolte, Susan; Edwards, Robert P.; Wenzel, Lari

    2014-01-01

    Objectives To provide a history on nursing science within the Gynecology Oncology Group (GOG); to discuss challenges and facilitators of nursing science in the cooperative group (CG) using a current nurse-led protocol (GOG-0259) as an exemplar; and to propose recommendations aimed at advancing nursing science in the CG setting. Data Source GOG reports and protocol databases, online databases of indexed citations, and experiences from the development and implementation of GOG-0259. Conclusions Benefits of CG research include opportunities for inter-disciplinary collaboration and ability to rapidly accrue large national samples. Challenges include limited financial resources to support non-treatment trials, a cumbersome protocol approval process, and lack of experience with nursing/quality of life intervention studies. Formal structures within GOG need to be created to encourage nurse scientists to become active members; promote collaboration between experienced GOG advanced practice nurses and new nurse scientists to identify nursing research priorities; and consider innovative funding structures to support pilot intervention studies. Implications for Nursing Practice Understanding the CG research process is critical for nurse scientists. A multi-disciplinary team of CG leaders can help investigators navigate a complex research environment and can increase awareness of the value of nursing research. PMID:24559780

  20. Postgraduate Training in Clinical Oncology. Report on a WHO Working Group (The Hague, The Netherlands, December 6-8, 1978).

    Science.gov (United States)

    World Health Organization, Copenhagen (Denmark). Regional Office for Europe.

    The 1978 report of the Working Group of Postgraduate Training in Clinical Oncology, convened by the World Health Organization (WHO) Regional Office for Europe in collaboration with the government of The Netherlands, is presented. The groups analyzed models of postgraduate training in clinical oncology and evaluated their suitability in relation to…

  1. Phase I Oncology Studies: Evidence That in the Era of Targeted Therapies, Patients on Lower Doses Do Not Fare Worse

    Science.gov (United States)

    Jain, Rajul K.; Lee, J. Jack; Hong, David; Markman, Maurie; Gong, Jing; Naing, Aung; Wheler, Jennifer; Kurzrock, Razelle

    2009-01-01

    PURPOSE To safely assess new drugs, cancer patients in initial cohorts of phase I oncology studies receive low drug doses. Doses are successively increased until the maximum tolerated dose (MTD) is determined. Since traditional chemotherapy is often more effective near the MTD, ethical concerns have been raised regarding administration of low drug doses to phase I patients. However, a substantial portion of oncology trials now investigate targeted agents, which may have different dose-response relationships than cytotoxic chemotherapies. EXPERIMENTAL DESIGN Twenty-four consecutive trials treating 683 patients between 10-01-2004 and 6-30-2008 at MD Anderson Cancer Center were analyzed. Patients were assigned to a low-dose (≤25% MTD), medium-dose (25–75% MTD), or high-dose (≥75% MTD) group, and groups were compared for response rate, time-to-treatment-failure, progression-free survival, overall survival, and toxicity. To remove negatively biasing data from the high-dose group, in a second analysis patients treated above the MTD were excluded (high-dose group = 75–100% MTD). 97.7% of patients received targeted agents. RESULTS Even when excluding patients above the MTD, there was an early trend favoring the low- versus high-dose group in time-to-treatment-failure, with 32.9% versus 25.2% of patients on therapy at 3 months (p=0.08). Additionally, the low-dose group fared at least as well as the other groups in all other outcomes, including response rate, progression-free survival, overall survival, and toxicity. CONCLUSIONS These data may help alleviate concerns that patients who receive low drug doses on contemporary phase I oncology trials fare worse, and suggest targeted agents may have different dose-response relationships than cytotoxic chemotherapies. PMID:20145187

  2. Control group design, contamination and drop-out in exercise oncology trials: a systematic review.

    Science.gov (United States)

    Steins Bisschop, Charlotte N; Courneya, Kerry S; Velthuis, Miranda J; Monninkhof, Evelyn M; Jones, Lee W; Friedenreich, Christine; van der Wall, Elsken; Peeters, Petra H M; May, Anne M

    2015-01-01

    Important considerations for exercise trials in cancer patients are contamination and differential drop-out among the control group members that might jeopardize the internal validity. This systematic review provides an overview of different control groups design characteristics of exercise-oncology trials and explores the association with contamination and drop-out rates. Randomized controlled exercise-oncology trials from two Cochrane reviews were included. Additionally, a computer-aided search using Medline (Pubmed), Embase and CINAHL was conducted after completion date of the Cochrane reviews. Eligible studies were classified according to three control group design characteristics: the exercise instruction given to controls before start of the study (exercise allowed or not); and the intervention the control group was offered during (any (e.g., education sessions or telephone contacts) or none) or after (any (e.g., cross-over or exercise instruction) or none) the intervention period. Contamination (yes or no) and excess drop-out rates (i.e., drop-out rate of the control group minus the drop-out rate exercise group) were described according to the three design characteristics of the control group and according to the combinations of these three characteristics; so we additionally made subgroups based on combinations of type and timing of instructions received. 40 exercise-oncology trials were included based on pre-specified eligibility criteria. The lowest contamination (7.1% of studies) and low drop-out rates (excess drop-out rate -4.7±9.2) were found in control groups offered an intervention after the intervention period. When control groups were offered an intervention both during and after the intervention period, contamination (0%) and excess drop-out rates (-10.0±12.8%) were even lower. Control groups receiving an intervention during and after the study intervention period have lower contamination and drop-out rates. The present findings can be

  3. Innovations for phase I dose-finding designs in pediatric oncology clinical trials.

    Science.gov (United States)

    Doussau, Adelaide; Geoerger, Birgit; Jiménez, Irene; Paoletti, Xavier

    2016-03-01

    Phase I oncology clinical trials are designed to identify the optimal dose that will be recommended for phase II trials. In pediatric oncology, the conduct of those trials raises specific challenges, as the disease is rare with limited therapeutic options. In addition, the tolerance profile is known from adult trials. This paper provides a review of the major recent developments in the design of these trials, inspired by the need to cope with the specific challenges of dose finding in cancer pediatric oncology. We reviewed simulation studies comparing designs dedicated to address these challenges. We also reviewed the design used in published dose-finding trials in pediatric oncology over the period 2009-2014. Three main fields of innovation were identified. First, designs that were developed in order to relax the rules for more flexible inclusions. Second, methods to incorporate data emerging from adult studies. Third, designs accounting for toxicity evaluation at repeated cycles in pediatric oncology. In addition to this overview, we propose some further directions for designing pediatric dose-finding trials.

  4. Patient satisfaction with inpatient care provided by the Sydney Gynecological Oncology Group

    Directory of Open Access Journals (Sweden)

    Vivek Arora

    2010-11-01

    Full Text Available Vivek Arora, Shannon Philp, Kathryn Nattress, Selvan Pather, Christopher Dalrymple, Kenneth Atkinson, Sofia Smirnova, Stephen Cotterell, Jonathan CarterSydney Gynecological Oncology Group, Royal Prince Alfred Hospital, University of Sydney, Sydney, AustraliaPurpose: Patient satisfaction with the provision of hospital oncology services can have a significant impact on their overall treatment experience.Aims: To assess patient satisfaction with the inpatient hospital services in the gynecological oncology setting using the IN-PATSAT32 questionnaire developed by the European Organization for Research and Treatment of Cancer (EORTC.Methods: A modified version of the IN-PATSAT32 questionnaire with additional 16 items was administered to 52 adult surgical inpatients admitted with the Sydney Gynecological Oncology Group. All participants were provided with an information leaflet regarding the survey and written consent obtained.Results: A high response rate (100% from patients with varied social, ethnic, and educational backgrounds confirmed the acceptability of the survey. Standard of medical care provided, frequency of doctors’ visits, exchange of information with doctors, friendliness of the staff, and state of the room ranked highly (>95% on the patient satisfaction scales. Problems were identified with ease of access to and within the hospital, quality of food, and exchange of information with other hospital staff.Conclusions: Overall the satisfaction with inpatient care was rated very highly in most areas. Deficiencies in certain elements of provision of medical care to the patients were identified and steps have been taken to improve upon these shortcomings.Keywords: patient satisfaction, EORTC, IN-PATSAT32, gynecological oncology, survey

  5. Response of chronic myelogenous leukemia patients to COAP-splenectomy. A Southwest Oncology Group study.

    Science.gov (United States)

    Hester, J P; Waddell, C C; Coltman, C A; Morrison, F S; Stephens, R L; Balcerzak, S P; Baker, L H; Chen, T T

    1984-11-01

    Eighty-seven patients from 18 institutions with a confirmed diagnosis of chronic myelogenous leukemia were registered on a Southwest Oncology Group protocol for multiagent induction and single-agent maintenance chemotherapy, with randomization to an immunotherapy arm. Elective surgical splenectomy was performed for 42 patients at the completion of 3 months of induction therapy. Final analysis of the study revealed statistically significant survival advantages were correlated with age, splenectomy, the absence of hepatic leukemic infiltrate at the time of splenectomy, and race.

  6. Informed consent in oncology clinical trials: A Brown University Oncology Research Group prospective cross-sectional pilot study

    Science.gov (United States)

    Schumacher, Andrew; Sikov, William M.; Quesenberry, Matthew I.; Safran, Howard; Khurshid, Humera; Mitchell, Kristen M.

    2017-01-01

    Background Informed consent forms (ICFs) for oncology clinical trials have grown increasingly longer and more complex. We evaluated objective understanding of critical components of informed consent among patients enrolling in contemporary trials of conventional or novel biologic/targeted therapies. Methods We evaluated ICFs for cancer clinical trials for length and readability, and patients registered on those studies were asked to complete a validated 14-question survey assessing their understanding of key characteristics of the trial. Mean scores were compared in groups defined by trial and patient characteristics. Results Fifty patients, of whom half participated in trials of immunotherapy or biologic/targeted agents and half in trials of conventional therapy, completed the survey. On average, ICFs for industry-originated trials (N = 9 trials) were significantly longer (P < .0001) and had lower Flesch ease-of-reading scores (P = .003) than investigator-initiated trials (N = 11). At least 80% of patients incorrectly responded to three key questions which addressed the experimental nature of their trial therapy, its purported efficacy and potential risks relative to alternative treatments. The mean objective understanding score was 76.9±8.8, but it was statistically significantly lower for patients who had not completed high school (P = .011). The scores did not differ significantly by type of cancer therapy (P = .12) or trial sponsor (P = .38). Conclusions Many participants enrolled on cancer trials had poor understanding of essential elements of their trial. In order to ensure true informed consent, innovative approaches, such as expanded in-person counseling adapted to the patient’s education level or cultural characteristics should be evaluated across socio-demographic groups. Trial registration Clinicaltrials.gov NCT01772511 PMID:28235011

  7. Design, development of water tank-type lung phantom and dosimetric verification in institutions participating in a phase I study of stereotactic body radiation therapy in patients with T2N0M0 non-small cell lung cancer: Japan Clinical Oncology Group trial (JCOG0702).

    Science.gov (United States)

    Nishio, Teiji; Shirato, Hiroki; Ishikawa, Masayori; Miyabe, Yuki; Kito, Satoshi; Narita, Yuichirou; Onimaru, Rikiya; Ishikura, Satoshi; Ito, Yoshinori; Hiraoka, Masahiro

    2014-05-01

    A domestic multicenter phase I study of stereotactic body radiotherapy (SBRT) for T2N0M0 non-small cell lung cancer in inoperable patients or elderly patients who refused surgery was initiated as the Japan Clinical Oncology Group trial (JCOG0702) in Japan. Prior to the clinical study, the accuracy of dose calculation in radiation treatment-planning systems was surveyed in participating institutions, and differences in the irradiating dose between the institutions were investigated. We developed a water tank-type lung phantom appropriate for verification of the exposure dose in lung SBRT. Using this water tank-type lung phantom, the dose calculated in the radiation treatment-planning system and the measured dose using a free air ionization chamber and dosimetric film were compared in a visiting survey of the seven institutions participating in the clinical study. In all participating institutions, differences between the calculated and the measured dose in the irradiation plan were as follows: the accuracy of the absolute dose in the center of the simulated tumor measured using a free air ionization chamber was within 2%, the mean gamma value was ≤ 0.47 on gamma analysis following the local dose criteria, and the pass rate was >87% for 3%/3 mm from measurement of dose distribution with dosimetric film. These findings confirmed the accuracy of delivery doses in the institutions participating in the clinical study, so that a study with integration of the institutions could be initiated.

  8. Phase III trial to confirm the superiority of pelvic and para-aortic lymphadenectomy to pelvic lymphadenectomy alone for endometrial cancer: Japan Clinical Oncology Group Study 1412 (SEPAL-P3).

    Science.gov (United States)

    Watari, Hidemichi; Katayama, Hiroshi; Shibata, Taro; Ushijima, Kimio; Satoh, Toyomi; Onda, Takashi; Aoki, Daisuke; Fukuda, Haruhiko; Yaegashi, Nobuo; Sakuragi, Noriaki

    2017-10-01

    To prospectively investigate the survival benefit of para-aortic lymphadenectomy, we launched a new study, the JCOG1412. This is a randomized Phase III trial to confirm the superiority of pelvic and para-aortic lymphadenectomy to pelvic lymphadenectomy alone. Patients corresponding to possible FIGO Stage IB, II, IIIA, IIIB, and a part of IIIC1 are eligible for the first registration before surgery. Next, those patients without evidence of para-aortic lymph node metastasis and multiple pelvic lymph node metastasis during surgery will be included in the second registration and randomized to either the pelvic lymphadenectomy alone arm or the pelvic and para-aortic lymphadenectomy arm. After the initial surgery, patients with post-operative recurrence risks receive adjuvant chemotherapy. The primary endpoint is overall survival. Secondary endpoints include relapse-free survival, short-term surgical outcomes, adverse events related to adjuvant chemotherapy and recurrence patterns. This trial has been registered at the UMIN Clinical Trials Registry [http://www.umin.ac.jp/ctr/index.htm] as UMIN000025399. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Impact of liposomal doxorubicin-based adjuvant chemotherapy on autonomy in women over 70 with hormone-receptor-negative breast carcinoma: A French Geriatric Oncology Group (GERICO) phase II multicentre trial.

    Science.gov (United States)

    Brain, Etienne G C; Mertens, Cécile; Girre, Véronique; Rousseau, Frédérique; Blot, Emmanuel; Abadie, Sophie; Uwer, Lionel; Bourbouloux, Emmanuelle; Van Praagh-Doreau, Isabelle; Mourey, Loic; Kirscher, Sylvie; Laguerre, Brigitte; Fourme, Emmanuelle; Luneau, Sylvia; Genève, Jean; Debled, Marc

    2011-10-01

    Breast cancer is a disease of ageing. Functional independence in elderly patients, measured with the Katz activities of daily living (ADL) scale, predicts overall survival and the need for welfare support. Few prospective studies have examined the feasibility of adjuvant chemotherapy and its impact on autonomy in women over 70 years of age with high-risk breast cancer. This multicentre phase II trial was designed to assess the impact of adjuvant anthracycline-based chemotherapy on these patients' autonomy. In a two-stage Fleming design, women aged ≥70 years with histologically proven hormone-receptor-negative early breast cancer and a significant risk of recurrence (pN+ or "high risk" pN0) received 4 cycles of nonpegylated liposomal doxorubicin 60 mg/m(2) and cyclophosphamide 600 mg/m(2) every 3 weeks postoperatively, on an outpatient basis. The primary endpoint was the change in the ADL score during chemotherapy. Secondary endpoints include comprehensive geriatric, quality-of-life and acceptability assessments, tolerability, and long-term outcome. The results for the primary endpoint and other scales at completion of adjuvant chemotherapy are reported here, while long-term follow-up is not yet complete. Forty patients (median age 75 [70-82]) were enrolled between February 2006 and November 2007. Chemotherapy had no deleterious impact on ADL, cognition, mental status, or the frequency of comorbidities. In contrast, the number of patients at risk of malnutrition, based on the Mini Nutritional Assessment, more than doubled between baseline and the end of chemotherapy, rising from 15% to 38%. Quality-of-life deteriorated in terms of social and role functioning, likely owing to fatigue, loss of appetite, nausea and vomiting. Treatment acceptability was good. The main adverse effect was neutropenia, 15% of the patients experiencing febrile neutropenia. No cardiac toxicity or toxic deaths occurred. This study demonstrates the feasibility of an adjuvant chemotherapy

  10. A randomized phase III trial of adjuvant chemotherapy with irinotecan, leucovorin and fluorouracil versus leucovorin and fluorouracil for stage II and III colon cancer: A Hellenic Cooperative Oncology Group study

    Directory of Open Access Journals (Sweden)

    Efstratiou Ioannis

    2011-01-01

    Full Text Available Abstract Background Colon cancer is a public health problem worldwide. Adjuvant chemotherapy after surgical resection for stage III colon cancer has been shown to improve both progression-free and overall survival, and is currently recommended as standard therapy. However, its value for patients with stage II disease remains controversial. When this study was designed 5-fluorouracil (5FU plus leucovorin (LV was standard adjuvant treatment for colon cancer. Irinotecan (CPT-11 is a topoisomerase I inhibitor with activity in metastatic disease. In this multicenter adjuvant phase III trial, we evaluated the addition of irinotecan to weekly 5FU plus LV in patients with stage II or III colon cancer. Methods The study included 873 eligible patients. The treatment consisted of weekly administration of irinotecan 80 mg/m2 intravenously (IV, LV 200 mg/m2 and 5FU 450 mg/m2 bolus (Arm A versus LV 200 mg/m2 and 5FU 500 mg/m2 IV bolus (Arm B. In Arm A, treatments were administered weekly for four consecutive weeks, followed by a two-week rest, for a total of six cycles, while in Arm B treatments were administered weekly for six consecutive weeks, followed by a two-week rest, for a total of four cycles. The primary end-point was disease-free survival (DFS at three years. Results The probability of overall survival (OS at three years was 0.88 for patients in Arm A and 0.86 for those in Arm B, while the five-year OS probability was 0.78 and 0.76 for patients in Arm A and Arm B, respectively (P = 0.436. Furthermore, the probability of DFS at three years was 0.78 and 0.76 for patients in Arm A and Arm B, respectively (P = 0.334. With the exception of leucopenia and neutropenia, which were higher in patients in Arm A, there were no significant differences in Grades 3 and 4 toxicities between the two regimens. The most frequently recorded Grade 3/4 toxicity was diarrhea in both treatment arms. Conclusions Irinotecan added to weekly bolus 5FU plus LV did not result

  11. Adjuvant low-dose interleukin-2 (IL-2) plus interferon-α (IFN-α) in operable renal cell carcinoma (RCC): a phase III, randomized, multicentre trial of the Italian Oncology Group for Clinical Research (GOIRC).

    Science.gov (United States)

    Passalacqua, Rodolfo; Caminiti, Caterina; Buti, Sebastiano; Porta, Camillo; Camisa, Roberta; Braglia, Luca; Tomasello, Gianluca; Vaglio, Augusto; Labianca, Roberto; Rondini, Ermanno; Sabbatini, Roberto; Nastasi, Giuseppe; Artioli, Fabrizio; Prati, Andrea; Potenzoni, Michele; Pezzuolo, Debora; Oliva, Elena; Alberici, Federico; Buzio, Carlo

    2014-01-01

    There is currently no standard therapy to reduce the recurrence rate after surgery for renal cell carcinoma (RCC). The aim of this study was to assess efficacy and safety of adjuvant treatment with low doses of interleukin-2 (IL-2)+interferon-α (IFN-α) in operable RCC. The patients were randomized 1:1 to receive a 4-week cycle of low-dose IL-2+IFN-α or observation after primary surgery for RCC. Treatment cycles were repeated every 4 months for the first 2 years and every 6 months for the subsequent 3 years. The primary endpoint was recurrence-free survival (RFS); safety; and overall survival (OS) were secondary endpoints. ClinicalTrials.gov registration number was NCT00502034. 303/310 randomized patients (156 in the immunotherapy arm and 154 in the observation group) were evaluable at the intention-to-treat analyses. The 2 arms were well balanced. At a median follow-up of 52 months (range, 12-151 mo), RFS, and OS were similar, with an estimated hazard ratio (HR) of 0.84 [95% confidence interval (CI), 0.54-1.31; P=0.44] and of 1.07 (95% CI, 0.64-1.79; P=0.79), respectively in the 2 groups. Unplanned, subgroup analysis showed a positive effect of the treatment for patients with age 60 years and younger, pN0, tumor grades 1-2, and pT3a stage. Among patients with the combined presence of ≥ 2 of these factors, immunotherapy had a positive effect on RFS (HR=0.44; 95% CI, 0.24-0.82; P ≤ 0.01), whereas patients with <2 factors in the treatment arm exhibited a significant poorer OS (HR=2.27; 95% CI, 1.03-5.03 P=0.037). Toxicity of immunotherapy was mild and limited to World Health Organization grade 1-2 in most cases. Adjuvant immunotherapy with IL-2+IFN-α showed no RFS or OS improvement in RCC patients who underwent radical surgery. The results of subset analysis here presented are only hypothesis generating.

  12. Patterns of Relapse From a Phase 3 Study of Response-Based Therapy for Intermediate-Risk Hodgkin Lymphoma (AHOD0031): A Report From the Children's Oncology Group

    Energy Technology Data Exchange (ETDEWEB)

    Dharmarajan, Kavita V. [Mount Sinai Medical Center, New York, New York (United States); Friedman, Debra L. [Vanderbilt University, Nashville, Tennessee (United States); Schwartz, Cindy L. [MD Anderson Cancer Center, Houston, Texas (United States); Chen, Lu [Children' s Oncology Group, Arcadia, California (United States); FitzGerald, T.J. [Quality Assurance Review Center, Lincoln, Rhode Island (United States); McCarten, Kathleen M. [Rhode Island Hospital/Warren Alpert Medical School at Brown University, Providence, Rhode Island (United States); Kessel, Sandy K.; Iandoli, Matt [Quality Assurance Review Center, Lincoln, Rhode Island (United States); Constine, Louis S. [University of Rochester Medical Center, Rochester, New York (United States); Wolden, Suzanne L., E-mail: woldens@mskcc.org [Memorial Sloan-Kettering Cancer Center, New York, New York (United States)

    2015-05-01

    Purpose: The study was designed to determine whether response-based therapy improves outcomes in intermediate-risk Hodgkin lymphoma. We examined patterns of first relapse in the study. Patients and Methods: From September 2002 to July 2010, 1712 patients <22 years old with stage I-IIA with bulk, I-IIAE, I-IIB, and IIIA-IVA with or without doxorubicin, bleomycin, vincristine, etoposide, prednisone, and cyclophosphamide were enrolled. Patients were categorized as rapid (RER) or slow early responders (SER) after 2 cycles of doxorubicin, bleomycin, vincristine, etoposide, prednisone, and cyclophosphamide (ABVE-PC). The SER patients were randomized to 2 additional ABVE-PC cycles or augmented chemotherapy with 21 Gy involved field radiation therapy (IFRT). RER patients were stipulated to undergo 2 additional ABVE-PC cycles and were then randomized to 21 Gy IFRT or no further treatment if complete response (CR) was achieved. RER without CR patients were non-randomly assigned to 21 Gy IFRT. Relapses were characterized without respect to site (initial, new, or both; and initial bulk or initial nonbulk), and involved field radiation therapy field (in-field, out-of-field, or both). Patients were grouped by treatment assignment (SER; RER/no CR; RER/CR/IFRT; and RER/CR/no IFRT). Summary statistics were reported. Results: At 4-year median follow-up, 244 patients had experienced relapse, 198 of whom were fully evaluable for review. Those who progressed during treatment (n=30) or lacked relapse imaging (n=16) were excluded. The median time to relapse was 12.8 months. Of the 198 evaluable patients, 30% were RER/no CR, 26% were SER, 26% were RER/CR/no IFRT, 16% were RER/CR/IFRT, and 2% remained uncategorized. The 74% and 75% relapses involved initially bulky and nonbulky sites, respectively. First relapses rarely occurred at exclusively new or out-of-field sites. By contrast, relapses usually occurred at nodal sites of initial bulky and nonbulky disease. Conclusion: Although

  13. Young patients', parents', and survivors' communication preferences in paediatric oncology: Results of online focus groups

    Directory of Open Access Journals (Sweden)

    Kamps Willem A

    2007-11-01

    Full Text Available Abstract Background Guidelines in paediatric oncology encourage health care providers to share relevant information with young patients and parents to enable their active participation in decision making. It is not clear to what extent this mirrors patients' and parents' preferences. This study investigated communication preferences of childhood cancer patients, parents, and survivors of childhood cancer. Methods Communication preferences were examined by means of online focus groups. Seven patients (aged 8–17, 11 parents, and 18 survivors (aged 8–17 at diagnosis participated. Recruitment took place by consecutive inclusion in two Dutch university oncological wards. Questions concerned preferences regarding interpersonal relationships, information exchange and participation in decision making. Results Participants expressed detailed and multi-faceted views regarding their needs and preferences in communication in paediatric oncology. They agreed on the importance of several interpersonal and informational aspects of communication, such as honesty, support, and the need to be fully informed. Participants generally preferred a collaborative role in medical decision making. Differences in views were found regarding the desirability of the patient's presence during consultations. Patients differed in their satisfaction with their parents' role as managers of the communication. Conclusion Young patients' preferences mainly concur with current guidelines of providing them with medical information and enabling their participation in medical decision making. Still, some variation in preferences was found, which faces health care providers with the task of balancing between the sometimes conflicting preferences of young cancer patients and their parents.

  14. Research Biopsies in the Context of Early Phase Oncology Studies: Clinical and Ethical Considerations

    OpenAIRE

    Matilde Saggese; Divyanshu Dua; Emily Simmons; Charlotte Lemech; Hendrik-Tobias Arkenau

    2013-01-01

    The Personalized Medicine approach in oncology is a direct result of an improved understanding of complex tumor biology and advances in diagnostic technologies. In recent years, there has been an increased demand for archival and fresh tumor analysis in early clinical trials to foster proof-of-concept biomarker development, to understand resistance mechanisms, and ultimately to assess biological response. Although phase I studies are aimed at defining drug safety, pharmacokinetics, and to rec...

  15. A strategy for young members within national radiation oncology societies: the Italian experience (AIRO Giovani group).

    Science.gov (United States)

    Filippi, Andrea Riccardo; Alongi, Filippo; Ciammella, Patrizia; De Bari, Berardino; Franco, Pierfrancesco; Livi, Lorenzo

    2012-09-01

    To briefly review history, structure, past events and future projects of AIRO (Associazione Italiana Radioterapia Oncologica) young group (AIRO Giovani), focusing on its specific commitment to multidisciplnary networking among junior clinical oncologists at a national and international level. AIRO Giovani is a part of AIRO composed by members under 40 years old. Its main activities are scientific and educational meetings dedicated to young Italian radiation oncologists and collaborative research projects. AIRO Giovani structure, events organized and supported by AIRO giovani as well as scientific activities are here reported from its creation in 2007 up to current days. AIRO Giovani group was able to create a consolidated network between Italian junior radiation oncologists, while opening the possibility to collaborate with junior groups of other national scientific societies in the field of oncology and with ESTRO young members. Scientific projects carried out by the group have been successful and will be further implemented in next years. AIRO Giovani is still in its infancy, but its early positive experience supports the creation and development of young groups within national radiation oncology societies.

  16. A strategy for young members within national radiation oncology societies: the Italian experience (AIRO Giovani group)

    Science.gov (United States)

    Filippi, Andrea Riccardo; Alongi, Filippo; Ciammella, Patrizia; De Bari, Berardino; Franco, Pierfrancesco; Livi, Lorenzo

    2012-01-01

    Aim To briefly review history, structure, past events and future projects of AIRO (Associazione Italiana Radioterapia Oncologica) young group (AIRO Giovani), focusing on its specific commitment to multidisciplnary networking among junior clinical oncologists at a national and international level. Background AIRO Giovani is a part of AIRO composed by members under 40 years old. Its main activities are scientific and educational meetings dedicated to young Italian radiation oncologists and collaborative research projects. Materials and Methods AIRO Giovani structure, events organized and supported by AIRO giovani as well as scientific activities are here reported from its creation in 2007 up to current days. Results AIRO Giovani group was able to create a consolidated network between Italian junior radiation oncologists, while opening the possibility to collaborate with junior groups of other national scientific societies in the field of oncology and with ESTRO young members. Scientific projects carried out by the group have been successful and will be further implemented in next years. Conclusions AIRO Giovani is still in its infancy, but its early positive experience supports the creation and development of young groups within national radiation oncology societies. PMID:24669305

  17. First-in-Human Phase 1 Studies in Oncology: The New Challenge for Investigative Sites

    Directory of Open Access Journals (Sweden)

    Marc Salzberg

    2012-04-01

    Full Text Available Phase 1 first-in-human studies with anti-cancer products differ from other phase 1 studies in that they are evaluated in patients rather than healthy volunteers. The rationale design of targeted drugs triggers changes in the design of these studies. Patient populations are more precisely defined and pose a challenge to the efficient inclusion of study patients. Objectives shift from the definition of a maximum tolerated dose to the evaluation of a recommended phase 2 dose. Other challenges related to the efficacy and safety profile of novel targeted anti-cancer drugs call for changes in designing first-in-human studies, such as definitions of biological doses, collection of fresh tumor tissue for surrogate marker analyses, and the management of infusion-related reactions with monoclonal antibodies. Consequently, the conduct of phase 1 clinical trials in oncology requires changes. Corresponding education with particular focus on phase 1 trials and on the complex drug development process needs to be an integrated part of the medical oncology curriculum for physicians and nursing staff. This is a crucial element for institutions to remain or become clinical research sites for phase 1 studies, and to participate in the drug development process of novel anti-cancer compounds in the future.

  18. Radiation Therapy Oncology Group Protocol 02-29: A Phase II Trial of Neoadjuvant Therapy With Concurrent Chemotherapy and Full-Dose Radiation Therapy Followed by Surgical Resection and Consolidative Therapy for Locally Advanced Non-small Cell Carcinoma of the Lung

    Energy Technology Data Exchange (ETDEWEB)

    Suntharalingam, Mohan, E-mail: msuntha@umm.edu [Marlene and Stewart Greenebaum Cancer Center, University of Maryland School of Medicine, Baltimore, Maryland (United States); Paulus, Rebecca [Radiation Therapy Oncology Group, Philadelphia, Pennsylvania (United States); Edelman, Martin J. [Marlene and Stewart Greenebaum Cancer Center, University of Maryland School of Medicine, Baltimore, Maryland (United States); Krasna, Mark [Cancer Center at St. Joseph Medical Center, Towson, Maryland (United States); Burrows, Whitney [Marlene and Stewart Greenebaum Cancer Center, University of Maryland School of Medicine, Baltimore, Maryland (United States); Gore, Elizabeth [Dept of Radiation Oncology, Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Wilson, Lynn D. [Dept of Radiation Oncology, Yale School of Medicine, New Haven, Connecticut (United States); Choy, Hak [Dept of Radiation Oncology, University of Texas Southwestern, Dallas, Texas (United States)

    2012-10-01

    Purpose: To evaluate mediastinal nodal clearance (MNC) rates after induction chemotherapy and concurrent, full-dose radiation therapy (RT) in a phase II trimodality trial (Radiation Therapy Oncology Group protocol 0229). Patients and Methods: Patients (n=57) with stage III non-small cell lung cancer (pathologically proven N2 or N3) were eligible. Induction chemotherapy consisted of weekly carboplatin (AUC = 2.0) and paclitaxel 50 mg/m{sup 2}. Concurrent RT was prescribed, with 50.4 Gy to the mediastinum and primary tumor and a boost of 10.8 Gy to all gross disease. The mediastinum was pathologically reassessed after completion of chemoradiation. The primary endpoint of the study was MNC, with secondary endpoints of 2-year overall survival and postoperative morbidity/mortality. Results: The grade 3/4 toxicities included hematologic 35%, gastrointestinal 14%, and pulmonary 23%. Forty-three patients (75%) were evaluable for the primary endpoint. Twenty-seven patients achieved the primary endpoint of MNC (63%). Thirty-seven patients underwent resection. There was a 14% incidence of grade 3 postoperative pulmonary complications and 1 30-day, postoperative grade 5 toxicity (3%). With a median follow-up of 24 months for all patients, the 2-year overall survival rate was 54%, and the 2-year progression-free survival rate was 33%. The 2-year overall survival rate was 75% for those who achieved nodal clearance, 52% for those with residual nodal disease, and 23% for those who were not evaluable for the primary endpoint (P=.0002). Conclusions: This multi-institutional trial confirms the ability of neoadjuvant concurrent chemoradiation with full-dose RT to sterilize known mediastinal nodal disease.

  19. Response evaluation criteria for solid tumours in dogs (v1.0): a Veterinary Cooperative Oncology Group (VCOG) consensus document.

    Science.gov (United States)

    Nguyen, S M; Thamm, D H; Vail, D M; London, C A

    2015-09-01

    In veterinary medical oncology, there is currently no standardized protocol for assessing response to therapy in solid tumours. The lack of such a formalized guideline makes it challenging to critically compare outcome measures across various treatment protocols. The Veterinary Cooperative Oncology Group (VCOG) membership consensus document presented here is based on the recommendations of a subcommittee of American College of Veterinary Internal Medicine (ACVIM) board-certified veterinary oncologists. This consensus paper has used the human response evaluation criteria in solid tumours (RECIST v1.1) as a framework to establish standard procedures for response assessment in canine solid tumours that is meant to be easy to use, repeatable and applicable across a variety of clinical trial structures in veterinary oncology. It is hoped that this new canine RECIST (cRECIST v1.0) will be adopted within the veterinary oncology community and thereby facilitate the comparison of current and future treatment protocols used for companion animals with cancer.

  20. Emotional intelligence: A unique group training in a hematology-oncology unit.

    Science.gov (United States)

    Tadmor, Tamar; Dolev, Niva; Attias, Dina; Lelong, Ayalla Reuven; Rofe, Amnon

    2016-01-01

    Emotional intelligence (EI) is increasingly viewed as one of the important skills required for a successful career and personal life. Consequently, efforts have been made to improve personal and group performance in EI, mostly in commercial organizations. However, these programs have not been widely applied in the health field. The aim of this study is to assess the impact of a unique special EI interventional process within the framework of an active hematology-oncology unit in a general hospital. This investigation employed a pre- and post-training design using the Bar-On Emotional Quotient Inventory (EQ-i) measure of EI, both before and after completion of training 10 months later. The training included personal and group EI assessments and 10 EI workshops, each 2 weeks apart and each lasting approximately 2 h. Results were compared to a control group of medical staff who did not undergo any EI training program during the same time period. Average total Bar-On EQ-i level at baseline for the group was 97.9, which increased significantly after the interventional process to a score of 105.6 (P = 0.001). There were also significant increases in all five main EQ-i scales, as well as for 12 of the 15 subscales. In contrast, the control group showed no significant differences in general EI level, in any of the five main scales or 15 EI subscale areas. This pilot study demonstrated the capability of a group intervention to improve EI of medical staff working in a hematology-oncological unit. The results are encouraging and suggest that the model program could be successfully applied in a large-scale interventional program.

  1. Dispositional optimism and therapeutic expectations in early-phase oncology trials.

    Science.gov (United States)

    Jansen, Lynn A; Mahadevan, Daruka; Appelbaum, Paul S; Klein, William M P; Weinstein, Neil D; Mori, Motomi; Daffé, Racky; Sulmasy, Daniel P

    2016-04-15

    Prior research has identified unrealistic optimism as a bias that might impair informed consent among patient-subjects in early-phase oncology trials. However, optimism is not a unitary construct; it also can be defined as a general disposition, or what is called dispositional optimism. The authors assessed whether dispositional optimism would be related to high expectations for personal therapeutic benefit reported by patient-subjects in these trials but not to the therapeutic misconception. The authors also assessed how dispositional optimism related to unrealistic optimism. Patient-subjects completed questionnaires designed to measure expectations for therapeutic benefit, dispositional optimism, unrealistic optimism, and the therapeutic misconception. Dispositional optimism was found to be significantly associated with higher expectations for personal therapeutic benefit (Spearman rank correlation coefficient [r], 0.333; Poptimism was found to be weakly associated with unrealistic optimism (Spearman r, 0.215; P = .005). On multivariate analysis, both dispositional optimism (P = .02) and unrealistic optimism (Poptimism (P = .0001), but not dispositional optimism, was found to be independently associated with the therapeutic misconception. High expectations for therapeutic benefit among patient-subjects in early-phase oncology trials should not be assumed to result from misunderstanding of specific information regarding the trials. The data from the current study indicate that these expectations are associated with either a dispositionally positive outlook on life or biased expectations concerning specific aspects of trial participation. Not all manifestations of optimism are the same, and different types of optimism likely have different consequences for informed consent in early-phase oncology research. © 2016 American Cancer Society.

  2. Drug induced interstitial lung disease in oncology phase I trials.

    Science.gov (United States)

    Yonemori, Kan; Hirakawa, Akihiro; Kawachi, Asuka; Kinoshita, Fumie; Okuma, Hitomi; Nishikawa, Tadaaki; Tamura, Kenji; Fujiwara, Yasuhiro; Takebe, Naoko

    2016-12-01

    Interstitial lung disease is a serious drug-related condition that can cause life threatening organ failure. The incidence and risk factors of drug-induced interstitial lung disease (DILD) are unknown in oncology phase I trials. This study analyzed clinical information from 8906 patients with malignancies who were enrolled in 470 phase I trials sponsored by the Cancer Therapy Evaluation Program, National Cancer Institute, from 1988 to 2014. Logistic and Cox statistical analyses were utilized to determine clinical differences between patients who developed DILD and patients who did not. In this study, the overall incidence rate of patients with pulmonary toxicity was 2.7%. The overall incidence rate for DILD was 0.77%, whereas for grade 3 or 4 DILD it was 0.31%. Median time to occurrence of DILD was 1.4 months. The Cox hazard analysis indicated smaller body surface area and a combination of thoracic radiation with investigational drug regimens were significant risk factors for time to occurrence of interstitial lung disease. Investigators should carefully monitor for DILD in oncology patients enrolled in phase I trials with identified risk factors. A 6-month observation period would be sufficient to detect the onset of most DILD in such patients.

  3. Online focus groups as a tool to collect data in hard-to-include populations : examples from paediatric oncology

    NARCIS (Netherlands)

    Tates, Kiek; Zwaanswijk, Marieke; Otten, Roel; van Dulmen, Sandra; Hoogerbrugge, Peter M.; Kamps, Willem A.; Bensing, Jozien M.

    2009-01-01

    Background: The purpose of this article is to describe and evaluate the methodology of online focus group discussions within the setting of paediatric oncology. Methods: Qualitative study consisting of separate moderated asynchronous online discussion groups with 7 paediatric cancer patients (aged 8

  4. Adolescents with Cancer in Italy: Improving Access to National Cooperative Pediatric Oncology Group (AIEOP) Centers.

    Science.gov (United States)

    Ferrari, Andrea; Rondelli, Roberto; Pession, Andrea; Mascarin, Maurizio; Buzzoni, Carlotta; Mosso, Maria Luisa; Maule, Milena; Barisone, Elena; Bertolotti, Marina; Clerici, Carlo Alfredo; Jankovic, Momcilo; Fagioli, Franca; Biondi, Andrea

    2016-06-01

    This analysis compared the numbers of patients treated at Italian pediatric oncology group (Associazione Italiana Ematologia Oncologia Pediatrica [AIEOP]) centers with the numbers of cases predicted according to the population-based registry. It considered 32,431 patients registered in the AIEOP database (1989-2012). The ratio of observed (O) to expected (E) cases was 0.79 for children (0-14 years old) and 0.15 for adolescents (15-19 years old). The proportion of adolescents increased significantly over the years, however, from 0.05 in the earliest period to 0.10, 0.18, and then 0.28 in the latest period of observation, suggesting a greater efficacy of local/national programs dedicated to adolescents.

  5. Gene expression profiles predictive of outcome and age in infant acute lymphoblastic leukemia: A Children's Oncology Group study

    NARCIS (Netherlands)

    H. Kang; C.S. Wilson (Carla); R. Harvey (R.); I.-M. Chen (I.-Ming); M.H. Murphy (Maurice); S.R. Atlas (Susan); E.J. Bedrick (Edward); M. Devidas (Meenakshi); A.J. Carroll; B.W. Robinson (Blaine); R.W. Stam (Ronald); M.G. Valsecchi (Maria Grazia); R. Pieters (Rob); N.A. Heerema (Nyla); J.M. Hilden (Joanne); C.A. Felix (Carolyn); G.H. Reaman (Gregory); B. Camitta (Bruce); N.J. Winick (Naomi); W.L. Carroll (William); S.D. Dreyer; S.P. Hunger (Stephen); S.F. Willman (Sami )

    2012-01-01

    textabstractGene expression profiling was performed on 97 cases of infant ALL from Children's Oncology Group Trial P9407. Statistical modeling of an outcome predictor revealed 3 genes highly predictive of event-free survival (EFS), beyond age and MLL status: FLT3, IRX2, and TACC2. Low FLT3 expressio

  6. Pelvic Normal Tissue Contouring Guidelines for Radiation Therapy: A Radiation Therapy Oncology Group Consensus Panel Atlas

    Energy Technology Data Exchange (ETDEWEB)

    Gay, Hiram A., E-mail: hgay@radonc.wustl.edu [Washington University School of Medicine, St Louis, MO (United States); Barthold, H. Joseph [Commonwealth Hematology and Oncology, Weymouth, MA (United States); Beth Israel Deaconess Medical Center, Boston, MA (Israel); O' Meara, Elizabeth [Radiation Therapy Oncology Group, Philadelphia, PA (United States); Bosch, Walter R. [Washington University School of Medicine, St Louis, MO (United States); El Naqa, Issam [Department of Radiation Oncology, McGill University Health Center, Montreal, Quebec (Canada); Al-Lozi, Rawan [Washington University School of Medicine, St Louis, MO (United States); Rosenthal, Seth A. [Radiation Oncology Centers, Radiological Associates of Sacramento, Sacramento, CA (United States); Lawton, Colleen [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, WI (United States); Lee, W. Robert [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Sandler, Howard [Cedars-Sinai Medical Center, Los Angeles, CA (United States); Zietman, Anthony [Department of Radiation Oncology, Massachusetts General Hospital and Harvard Medical School, Boston, MA (United States); Myerson, Robert [Washington University School of Medicine, St Louis, MO (United States); Dawson, Laura A. [Department of Radiation Oncology, Princess Margaret Hospital, University of Toronto, Toronto, Ontario (Canada); Willett, Christopher [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Kachnic, Lisa A. [Department of Radiation Oncology, Boston Medical Center, Boston University School of Medicine, Boston, MA (United States); Jhingran, Anuja [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, TX (United States); Portelance, Lorraine [University of Miami, Miami, FL (United States); Ryu, Janice [Radiation Oncology Centers, Radiological Associates of Sacramento, Sacramento, CA (United States); and others

    2012-07-01

    Purpose: To define a male and female pelvic normal tissue contouring atlas for Radiation Therapy Oncology Group (RTOG) trials. Methods and Materials: One male pelvis computed tomography (CT) data set and one female pelvis CT data set were shared via the Image-Guided Therapy QA Center. A total of 16 radiation oncologists participated. The following organs at risk were contoured in both CT sets: anus, anorectum, rectum (gastrointestinal and genitourinary definitions), bowel NOS (not otherwise specified), small bowel, large bowel, and proximal femurs. The following were contoured in the male set only: bladder, prostate, seminal vesicles, and penile bulb. The following were contoured in the female set only: uterus, cervix, and ovaries. A computer program used the binomial distribution to generate 95% group consensus contours. These contours and definitions were then reviewed by the group and modified. Results: The panel achieved consensus definitions for pelvic normal tissue contouring in RTOG trials with these standardized names: Rectum, AnoRectum, SmallBowel, Colon, BowelBag, Bladder, UteroCervix, Adnexa{sub R}, Adnexa{sub L}, Prostate, SeminalVesc, PenileBulb, Femur{sub R}, and Femur{sub L}. Two additional normal structures whose purpose is to serve as targets in anal and rectal cancer were defined: AnoRectumSig and Mesorectum. Detailed target volume contouring guidelines and images are discussed. Conclusions: Consensus guidelines for pelvic normal tissue contouring were reached and are available as a CT image atlas on the RTOG Web site. This will allow uniformity in defining normal tissues for clinical trials delivering pelvic radiation and will facilitate future normal tissue complication research.

  7. Modern Radiation Therapy for Primary Cutaneous Lymphomas: Field and Dose Guidelines From the International Lymphoma Radiation Oncology Group

    Energy Technology Data Exchange (ETDEWEB)

    Specht, Lena, E-mail: lena.specht@regionh.dk [Departments of Oncology and Hematology, Rigshospitalet, University of Copenhagen, Copenhagen (Denmark); Dabaja, Bouthaina [Division of Radiation Oncology, Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Illidge, Tim [Institute of Cancer Sciences, University of Manchester, Manchester Academic Health Sciences Centre, The Christie National Health Service Foundation Trust, Manchester (United Kingdom); Wilson, Lynn D. [Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, Connecticut (United States); Hoppe, Richard T. [Department of Radiation Oncology, Stanford University, Stanford, California (United States)

    2015-05-01

    Primary cutaneous lymphomas are a heterogeneous group of diseases. They often remain localized, and they generally have a more indolent course and a better prognosis than lymphomas in other locations. They are highly radiosensitive, and radiation therapy is an important part of the treatment, either as the sole treatment or as part of a multimodality approach. Radiation therapy of primary cutaneous lymphomas requires the use of special techniques that form the focus of these guidelines. The International Lymphoma Radiation Oncology Group has developed these guidelines after multinational meetings and analysis of available evidence. The guidelines represent an agreed consensus view of the International Lymphoma Radiation Oncology Group steering committee on the use of radiation therapy in primary cutaneous lymphomas in the modern era.

  8. The use, publication and future directions of immunocytochemistry in veterinary medicine: a consensus of the Oncology-Pathology Working Group.

    Science.gov (United States)

    Priest, H L; Hume, K R; Killick, D; Kozicki, A; Rizzo, V L; Seelig, D; Snyder, L A; Springer, N L; Wright, Z M; Robat, C

    2016-03-22

    One of the primary objectives of the Oncology Pathology Working Group (OPWG), a joint initiative of the Veterinary Cancer Society and the American College of Veterinary Pathologists, is for oncologists and pathologists to collaboratively generate consensus documents to standardize aspects of and provide guidelines for oncologic pathology. Consensus is established through review of relevant peer-reviewed literature relative to a subgroup's particular focus. In this document, the authors provide descriptions of the literature reviewed, the review process, and a summary of the information gathered on immunocytochemistry. The intent of this publication is to help educate practitioners and pathologists on the process of immunocytochemistry and to provide a guide for the use of this technique in veterinary medicine. This document represents the opinions of the working group and the authors and does not constitute a formal endorsement by the American College of Veterinary Pathologists or the Veterinary Cancer Society.

  9. Reliability and accuracy assessment of radiation therapy oncology group-endorsed guidelines for brachial plexus contouring

    Energy Technology Data Exchange (ETDEWEB)

    Velde, Joris van de [Ghent University, Department of Anatomy, Ghent (Belgium); Ghent University, Department of Radiotherapy, Ghent (Belgium); Vercauteren, Tom; Gersem, Werner de; Vandecasteele, Katrien; Vuye, Philippe; Vanpachtenbeke, Frank; Neve, Wilfried de [Ghent University, Department of Radiotherapy, Ghent (Belgium); Wouters, Johan; Herde, Katharina d' ; Kerckaert, Ingrid; Hoof, Tom van [Ghent University, Department of Anatomy, Ghent (Belgium)

    2014-07-15

    The goal of this work was to validate the Radiation Therapy Oncology Group (RTOG)-endorsed guidelines for brachial plexus (BP) contouring by determining the intra- and interobserver agreement. Accuracy of the delineation process was determined using anatomically validated imaging datasets as a gold standard. Five observers delineated the right BP on three cadaver computed tomography (CT) datasets. To assess intraobserver variation, every observer repeated each delineation three times with a time interval of 2 weeks. The BP contours were divided into four regions for detailed analysis. Inter- and intraobserver variation was verified using the Computerized Environment for Radiation Research (CERR) software. Accuracy was measured using anatomically validated fused CT-magnetic resonance imaging (MRI) datasets by measuring the BP inclusion of the delineations. The overall kappa (κ) values were rather low (mean interobserver overall κ: 0.29, mean intraobserver overall κ: 0.45), indicating poor inter- and intraobserver reliability. In general, the κ coefficient decreased gradually from the medial to lateral BP regions. The total agreement volume (TAV) was much smaller than the union volume (UV) for all delineations, resulting in a low Jaccard index (JI; interobserver agreement 0-0.124; intraobserver agreement 0.004-0.636). The overall accuracy was poor, with an average total BP inclusion of 38 %. Inclusions were insufficient for the most lateral regions (region 3: 21.5 %; region 4: 12.6 %). The inter- and intraobserver reliability of the RTOG-endorsed BP contouring guidelines was poor. BP inclusion worsened from the medial to lateral regions. Accuracy assessment of the contours showed an average BP inclusion of 38 %. For the first time, this was assessed using the original anatomically validated BP volume. The RTOG-endorsed BP guidelines have insufficient accuracy and reliability, especially for the lateral head-and-neck regions. (orig.) [German] Ziel der Studie war

  10. Maternal Dietary Patterns During Early Pregnancy and the Odds of Childhood Germ Cell Tumors: A Children's Oncology Group Study

    OpenAIRE

    Musselman, Jessica R.B.; Anne M Jurek; Johnson, Kimberly J.; Linabery, Amy M.; Robison, Leslie L.; Shu, Xiao-Ou; Ross, Julie A

    2010-01-01

    Maternal diet during pregnancy may be associated with cancer in offspring. Intake of individual foods, as well as dietary patterns, can be used when examining these relations. Here, the authors examined associations between maternal dietary intake patterns and pediatric germ cell tumors (GCTs) using principal components analysis and logistic regression. Mothers of 222 GCT cases aged less than 15 years who were diagnosed at a Children's Oncology Group institution between 1993 and 2001 and thos...

  11. A Decade in Banking Ewing Sarcoma: A Report from the Children's Oncology Group.

    Science.gov (United States)

    Borinstein, Scott C; Beeler, Natalie; Block, John J; Gorlick, Richard; Grohar, Patrick; Jedlicka, Paul; Krailo, Mark; Morris, Carol; Phillips, Sharon; Siegal, Gene P; Lawlor, Elizabeth R; Lessnick, Stephen L

    2013-01-01

    Outcomes for patients with metastatic and recurrent Ewing sarcoma remain poor and a better understanding of the biology of this malignancy is critical to the development of prognostic biomarkers and novel therapies. Therefore, the Children's Oncology Group (COG) has created tissue banking protocols designed to collect high quality, clinically annotated, tumor specimens that can be distributed to researchers to perform basic science and correlative investigation. Data from the COG Ewing sarcoma tissue banking protocols AEWS02B1 and its successor study AEWS07B1 were reviewed in this study. Six-hundred and thirty five patients were enrolled on AEWS02B1 and 396 patients have had tissue submitted to AEWS07B1. The average age of participation was 13.2 years. About 86% were less than 19 years old and only 6% were greater than 21 years of age at diagnosis. When compared to SEER data, approximately 18% of all cases and only 8% of all patients >20 years old diagnosed with Ewing sarcoma annually in the United States have had tumor banked. The majority of participants submitted formalin fixed, paraffin embedded, primary tumor and blood samples. In total, fresh frozen tissue was submitted for only 29% of cases. Only seven metastatic tumor samples have been collected. Although the COG has been successful in collecting tumor samples from patients newly diagnosed with Ewing sarcoma, fresh frozen tumor specimens from primary and metastatic disease are critically needed, especially from young adult patients, in order to conduct high quality basic science and translational research investigation with a goal of developing better treatments.

  12. A Decade in Banking Ewing Sarcoma: A Report from the Children’s Oncology Group

    Science.gov (United States)

    Borinstein, Scott C.; Beeler, Natalie; Block, John J.; Gorlick, Richard; Grohar, Patrick; Jedlicka, Paul; Krailo, Mark; Morris, Carol; Phillips, Sharon; Siegal, Gene P.; Lawlor, Elizabeth R.; Lessnick, Stephen L.

    2013-01-01

    Outcomes for patients with metastatic and recurrent Ewing sarcoma remain poor and a better understanding of the biology of this malignancy is critical to the development of prognostic biomarkers and novel therapies. Therefore, the Children’s Oncology Group (COG) has created tissue banking protocols designed to collect high quality, clinically annotated, tumor specimens that can be distributed to researchers to perform basic science and correlative investigation. Data from the COG Ewing sarcoma tissue banking protocols AEWS02B1 and its successor study AEWS07B1 were reviewed in this study. Six-hundred and thirty five patients were enrolled on AEWS02B1 and 396 patients have had tissue submitted to AEWS07B1. The average age of participation was 13.2 years. About 86% were less than 19 years old and only 6% were greater than 21 years of age at diagnosis. When compared to SEER data, approximately 18% of all cases and only 8% of all patients >20 years old diagnosed with Ewing sarcoma annually in the United States have had tumor banked. The majority of participants submitted formalin fixed, paraffin embedded, primary tumor and blood samples. In total, fresh frozen tissue was submitted for only 29% of cases. Only seven metastatic tumor samples have been collected. Although the COG has been successful in collecting tumor samples from patients newly diagnosed with Ewing sarcoma, fresh frozen tumor specimens from primary and metastatic disease are critically needed, especially from young adult patients, in order to conduct high quality basic science and translational research investigation with a goal of developing better treatments. PMID:23519678

  13. Late Effects Surveillance Recommendations among Survivors of Childhood Hematopoietic Cell Transplantation: A Children's Oncology Group Report.

    Science.gov (United States)

    Chow, Eric J; Anderson, Lynnette; Baker, K Scott; Bhatia, Smita; Guilcher, Gregory M T; Huang, Jennifer T; Pelletier, Wendy; Perkins, Joanna L; Rivard, Linda S; Schechter, Tal; Shah, Ami J; Wilson, Karla D; Wong, Kenneth; Grewal, Satkiran S; Armenian, Saro H; Meacham, Lillian R; Mulrooney, Daniel A; Castellino, Sharon M

    2016-05-01

    Hematopoietic cell transplantation (HCT) is an important curative treatment for children with high-risk hematologic malignancies, solid tumors, and, increasingly, nonmalignant diseases. Given improvements in care, there are a growing number of long-term survivors of pediatric HCT. Compared with childhood cancer survivors who did not undergo transplantation, HCT survivors have a substantially increased burden of serious chronic conditions and impairments involving virtually every organ system and overall quality of life. This likely reflects the joint contributions of pretransplantation treatment exposures and organ dysfunction, the transplantation conditioning regimen, and any post-transplantation graft-versus-host disease (GVHD). In response, the Children's Oncology Group (COG) has created long-term follow-up guidelines (www.survivorshipguidelines.org) for survivors of childhood, adolescent, and young adult cancer, including those who were treated with HCT. Guideline task forces, consisting of HCT specialists, other pediatric oncologists, radiation oncologists, organ-specific subspecialists, nurses, social workers, other health care professionals, and patient advocates systematically reviewed the literature with regards to late effects after childhood cancer and HCT since 2002, with the most recent review completed in 2013. For the most recent review cycle, over 800 articles from the medical literature relevant to childhood cancer and HCT survivorship were reviewed, including 586 original research articles. Provided herein is an organ system-based overview that emphasizes the most relevant COG recommendations (with accompanying evidence grade) for the long-term follow-up care of childhood HCT survivors (regardless of current age) based on a rigorous review of the available evidence. These recommendations cover both autologous and allogeneic HCT survivors, those who underwent transplantation for nonmalignant diseases, and those with a history of chronic GVHD.

  14. Phase III Randomized Study of 4 Weeks of High-Dose Interferon-α-2b in Stage T2bNO, T3a-bNO, T4a-bNO, and T1-4N1a-2a (microscopic) Melanoma: A Trial of the Eastern Cooperative Oncology Group-American College of Radiology Imaging Network Cancer Research Group (E1697).

    Science.gov (United States)

    Agarwala, Sanjiv S; Lee, Sandra J; Yip, Waiki; Rao, Uma N; Tarhini, Ahmad A; Cohen, Gary I; Reintgen, Douglas S; Evans, Terry L; Brell, Joanna M; Albertini, Mark R; Atkins, Michael B; Dakhil, Shaker R; Conry, Robert M; Sosman, Jeffrey A; Flaherty, Lawrence E; Sondak, Vernon K; Carson, William E; Smylie, Michael G; Pappo, Alberto S; Kefford, Richard F; Kirkwood, John M

    2017-03-10

    Purpose To test the efficacy of 4 weeks of intravenous (IV) induction with high-dose interferon (IFN) as part of the Eastern Cooperative Oncology Group regimen compared with observation (OBS) in patients with surgically resected intermediate-risk melanoma. Patients and Methods In this intergroup international trial, eligible patients had surgically resected cutaneous melanoma in the following categories: (1) T2bN0, (2) T3a-bN0, (3) T4a-bN0, and (4) T1-4N1a-2a (microscopic). Patients were randomly assigned to receive IFN α-2b at 20 MU/m(2)/d IV for 5 days (Monday to Friday) every week for 4 weeks (IFN) or OBS. Stratification factors were pathologic lymph node status, lymph node staging procedure, Breslow depth, ulceration of the primary lesion, and disease stage. The primary end point was relapse-free survival. Secondary end points included overall survival, toxicity, and quality of life. Results A total of 1,150 patients were randomly assigned. At a median follow-up of 7 years, the 5-year relapse-free survival rate was 0.70 (95% CI, 0.66 to 0.74) for OBS and 0.70, (95% CI, 0.66 to 0.74) for IFN ( P = .964). The 5-year overall survival rate was 0.83 (95% CI, 0.79 to 0.86) for OBS and 0.83 (95% CI, 0.80 to 0.86) for IFN ( P = .558). Treatment-related grade 3 and higher toxicity was 4.6% versus 57.9% for OBS and IFN, respectively ( P weeks of IV induction as part of the Eastern Cooperative Oncology Group high-dose IFN regimen is not better than OBS alone for patients with intermediate-risk melanoma as defined in this trial.

  15. Young patients', parents', and survivors' communication preferences in paediatric oncology: using online focus groups.

    NARCIS (Netherlands)

    Zwaanswijk, M.; Tates, K.; Dulmen, S. van; Hoogerbrugge, M.; Kamps, W.A.; Bensing, J.M.

    2007-01-01

    BACKGROUND: Guidelines in paediatric oncology encourage health care providers to share relevant information with young patients and parents to enable their active participation in decision making. It is not clear to what extent this mirrors patients' and parents' preferences. This study investigated

  16. Group Contribution Methods for Phase Equilibrium Calculations.

    Science.gov (United States)

    Gmehling, Jürgen; Constantinescu, Dana; Schmid, Bastian

    2015-01-01

    The development and design of chemical processes are carried out by solving the balance equations of a mathematical model for sections of or the whole chemical plant with the help of process simulators. For process simulation, besides kinetic data for the chemical reaction, various pure component and mixture properties are required. Because of the great importance of separation processes for a chemical plant in particular, a reliable knowledge of the phase equilibrium behavior is required. The phase equilibrium behavior can be calculated with the help of modern equations of state or g(E)-models using only binary parameters. But unfortunately, only a very small part of the experimental data for fitting the required binary model parameters is available, so very often these models cannot be applied directly. To solve this problem, powerful predictive thermodynamic models have been developed. Group contribution methods allow the prediction of the required phase equilibrium data using only a limited number of group interaction parameters. A prerequisite for fitting the required group interaction parameters is a comprehensive database. That is why for the development of powerful group contribution methods almost all published pure component properties, phase equilibrium data, excess properties, etc., were stored in computerized form in the Dortmund Data Bank. In this review, the present status, weaknesses, advantages and disadvantages, possible applications, and typical results of the different group contribution methods for the calculation of phase equilibria are presented.

  17. The cancer and leukemia group B oncology nursing committee (1983-2006): a history of passion, commitment, challenge, and accomplishment.

    Science.gov (United States)

    Smith, Ellen Lavoie; Skosey, Consuelo; Armer, Jane; Berg, Deborah; Cirrincione, Constance; Henggeler, Mary

    2006-06-01

    The Cancer and Leukemia Group B (CALGB) Oncology Nursing Committee (ONC) was initially established in 1983 as a working group with the specific aim of promoting protocol compliance through collaboration, communication, and education to enhance the scientific goals of the Group. Due to the efforts of its members, the committee gained full committee status. ONC members now serve as principal investigators and coinvestigators on research studies, continue to sponsor biannual educational sessions individually and in concert with other CALGB committees, and continue to develop tools to enlighten patients about their disease and the clinical trial process. The ONC, an administrative group of 12 members, provides leadership within CALGB. Although ONC members have always acted as liaisons to the disease and modality committees, three positions have recently been designated specifically for doctorally prepared nurse scientists. Since its inception, general nurse membership within the group has more than doubled to a total of more than 500 members.

  18. Hepato-biliary late effects in survivors of childhood and adolescent cancer: a report from the Children's Oncology Group.

    Science.gov (United States)

    Castellino, Sharon; Muir, Andrew; Shah, Ami; Shope, Sheila; McMullen, Kevin; Ruble, Kathy; Barber, Ashley; Davidoff, Andrew; Hudson, Melissa M

    2010-05-01

    Curative therapy for childhood and adolescent cancer translates to 1 in 640 young adults being a survivor of cancer. Although acute hepato-biliary toxicity occurs commonly during pediatric cancer therapy, the impact of antineoplastic therapy on long-term liver health in childhood/adolescent cancer survivors is unknown. This article reviews the medical literature on late liver dysfunction following treatment for childhood/adolescent cancer. We also outline the Children's Oncology Group (COG) guidelines for screening and follow-up of hepato-biliary sequelae. As the population of survivors grow and age, vigilance for risks to hepatic health needs to continue based on specific exposures during curative cancer therapy.

  19. Histologic effects of medroxyprogesterone acetate on endometrioid endometrial adenocarcinoma: a Gynecologic Oncology Group study.

    Science.gov (United States)

    Zaino, Richard J; Brady, William E; Todd, William; Leslie, Kimberly; Fischer, Edgar G; Horowitz, Neil S; Mannel, Robert S; Walker, Joan L; Ivanovic, Marina; Duska, Linda R

    2014-11-01

    Progestins have been used in the treatment of recurrent endometrial adenocarcinoma for almost 50 yr. Some endometrial carcinomas respond to hormonal therapy, but the mechanism of action remains incompletely known. We wished to determine the efficacy of progestins to induce a histologic response in endometrioid carcinomas and explore its effects on histologic and immunohistochemical measures of growth and cell death. The Gynecologic Oncology Group initiated a study of 75 women with endometrioid endometrial adenocarcinoma, 59 of whom received the progestin, medroxyprogesterone acetate for 21 to 24 d immediately before hysterectomy and had available slides. Initial biopsies and hysterectomies were hematoxylin and eosin-stained and immunostained for estrogen receptor (ER) and progesterone receptor (PR), progesterone receptor-β (PRB), Bcl-2, Ki-67, and cleaved caspase-3 (Casp3). A histologic response was defined subjectively, following which specific histologic measurements and semiquantitative scores of immunohistologic variables of initial biopsies were compared with posttreatment slides. Only 1 complete histologic response was seen, but 37 tumors (63%) had a partial histologic response. Specific histologic changes included the following: a decrease in the nuclear grade, the number of mitotic figures, nucleoli, and mean gland cellularity, and acquisition of more abundant eosinophilic cytoplasm, squamous metaplasia, and secretion. The tumors that displayed a subjectively defined histologic response following treatment differed initially from those that did not only with respect to initial nuclear grade and the mitotic index. Statistically significant differences in the specific histologic features in carcinomas of responders versus nonresponders following treatment were found only with respect to acquisition of pale eosinophilic cytoplasm and luminal secretion. More than 90% of tumors were initially ER positive and 76% were PR positive. The initial presence of ER or

  20. An introduction to molecular imaging in radiation oncology: a report by the AAPM Working Group on Molecular Imaging in Radiation Oncology (WGMIR).

    Science.gov (United States)

    Munley, Michael T; Kagadis, George C; McGee, Kiaran P; Kirov, Assen S; Jang, Sunyoung; Mutic, Sasa; Jeraj, Robert; Xing, Lei; Bourland, J Daniel

    2013-10-01

    Molecular imaging is the direct or indirect noninvasive monitoring and recording of the spatial and temporal distribution of in vivo molecular, genetic, and/or cellular processes for biochemical, biological, diagnostic, or therapeutic applications. Molecular images that indicate the presence of malignancy can be acquired using optical, ultrasonic, radiologic, radionuclide, and magnetic resonance techniques. For the radiation oncology physicist in particular, these methods and their roles in molecular imaging of oncologic processes are reviewed with respect to their physical bases and imaging characteristics, including signal intensity, spatial scale, and spatial resolution. Relevant molecular terminology is defined as an educational assist. Current and future clinical applications in oncologic diagnosis and treatment are discussed. National initiatives for the development of basic science and clinical molecular imaging techniques and expertise are reviewed, illustrating research opportunities in as well as the importance of this growing field.

  1. Special aspects of social support: Qualitative analysis of oncologic rehabilitation through a belly dancing peer support group.

    Science.gov (United States)

    Szalai, M; Szirmai, A; Füge, K; Makai, A; Erdélyi, G; Prémusz, V; Bódis, J

    2017-02-13

    Tumour-related peer support groups (PSGs) show long-term development in quality of life and coping, and decrease distress in cancer care. To clarify channels of social support in oncologic rehabilitation by combined exercise and psychosocial therapy, individual semi-structured interviews were conducted after 1 year additional belly dance rehabilitation in a closed PSG among 51 patients with malignant tumour diagnosis in Budapest, Hungary. Interview data were transcribed and analysed using qualitative content analysis (ATLAS.ti 6 Win). Results suggest that group experience provides emotional-, practical- and informational support. We could point out specific social effects of "role model" function and extend the coping model. The group dispose all the features of effective suggestion and may be effectively applied as additional therapy for patients with malignancies. The extended coping model and the introduction of "role model" function could be useful for PSGs' efficacy assessment. © 2017 John Wiley & Sons Ltd.

  2. [Solid phase techniques in blood group serology].

    Science.gov (United States)

    Uthemann, H; Sturmfels, L; Lenhard, V

    1993-06-01

    As alternatives to hemagglutination, solid-phase red blood cell adherence assays are of increasing importance. The adaptation of the new techniques to microplates offers several advantages over hemagglutination. Using microplates the assays may be processed semiautomatically, and the results can be read spectrophotometrically and interpreted by a personal computer. In this paper, different red blood cell adherence assays for AB0 grouping, Rh typing, Rh phenotyping, antibody screening and identification, as well as crossmatching will be described.

  3. Coping style and performance status in a group of oncological inpatients

    Directory of Open Access Journals (Sweden)

    Cecilia Chau Pérez-Aranibar

    2002-06-01

    Full Text Available The associations between coping styles, measured by COPE Test, dispositional version (Carver,Scheier and Weintraub, 1989, and Health Status inferred through a performance status, measured by Karnofsky's Index of Behavioral Performance are examined. The study focuses upon 28 oncological in patients. Positive moderate Pearson's correlations were found between these two variables in this correlational-descriptive study. These were interpreted in the following sense: the larger use of the style, the less health status among the scales suppression of competent activities, procrastination of coping, instrumental social support, focusing and releasing of emotions and behavioral disengagement. The active coping scale presented a negative correlationwith regard to Performance Status as a health measure.

  4. A Bayesian three-parameter logistic model for early- and late-onset DLTs in oncology Phase I studies.

    Science.gov (United States)

    Zheng, Wei; Zhao, Yang; Lu, Yuefeng; Miao, Harry; Liu, Hengchang

    2016-01-01

    We introduce a three-parameter logistic model to analyze the dose limiting toxicity (DLT) as a time-to-event endpoint in oncology Phase I trials. In the proposed model, patients are allowed to stay on trial without the constraint of a maximum follow-up time. Our model accommodates late-onset DLT as well as early-onset DLT, by both of which the dose recommendation is informed. A Bayesian approach is used to incorporate prior knowledge of the test treatment into dose recommendation. Simulation examples show that our proposed model has good operating characteristics in assessing the maximum tolerated dose (MTD).

  5. Modern Radiation Therapy for Extranodal Lymphomas: Field and Dose Guidelines From the International Lymphoma Radiation Oncology Group

    Energy Technology Data Exchange (ETDEWEB)

    Yahalom, Joachim, E-mail: yahalomj@mskcc.org [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Illidge, Tim [Institute of Cancer Sciences, University of Manchester, Manchester Academic Health Sciences Centre, The Christie National Health Service Foundation Trust, Manchester (United Kingdom); Specht, Lena [Department of Oncology and Hematology, Rigshospitalet, University of Copenhagen, Copenhagen (Denmark); Hoppe, Richard T. [Department of Radiation Oncology, Stanford University, Palo Alto, California (United States); Li, Ye-Xiong [Department of Radiation Oncology, Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Tsang, Richard [Department of Radiation Oncology, Princess Margaret Hospital, University of Toronto, Toronto, Ontario (Canada); Wirth, Andrew [Division of Radiation Oncology, Peter MacCallum Cancer Institute, St. Andrews Place, East Melbourne (Australia)

    2015-05-01

    Extranodal lymphomas (ENLs) comprise about a third of all non-Hodgkin lymphomas (NHL). Radiation therapy (RT) is frequently used as either primary therapy (particularly for indolent ENL), consolidation after systemic therapy, salvage treatment, or palliation. The wide range of presentations of ENL, involving any organ in the body and the spectrum of histological sub-types, poses a challenge both for routine clinical care and for the conduct of prospective and retrospective studies. This has led to uncertainty and lack of consistency in RT approaches between centers and clinicians. Thus far there is a lack of guidelines for the use of RT in the management of ENL. This report presents an effort by the International Lymphoma Radiation Oncology Group (ILROG) to harmonize and standardize the principles of treatment of ENL, and to address the technical challenges of simulation, volume definition and treatment planning for the most frequently involved organs. Specifically, detailed recommendations for RT volumes are provided. We have applied the same modern principles of involved site radiation therapy as previously developed and published as guidelines for Hodgkin lymphoma and nodal NHL. We have adopted RT volume definitions based on the International Commission on Radiation Units and Measurements (ICRU), as has been widely adopted by the field of radiation oncology for solid tumors. Organ-specific recommendations take into account histological subtype, anatomy, the treatment intent, and other treatment modalities that may be have been used before RT.

  6. Melonic phase transition in group field theory

    CERN Document Server

    Baratin, Aristide; Oriti, Daniele; Ryan, James P; Smerlak, Matteo

    2013-01-01

    Group field theories have recently been shown to admit a 1/N expansion dominated by so-called `melonic graphs', dual to triangulated spheres. In this note, we deepen the analysis of this melonic sector. We obtain a combinatorial formula for the melonic amplitudes in terms of a graph polynomial related to a higher dimensional generalization of the Kirchhoff tree-matrix theorem. Simple bounds on these amplitudes show the existence of a phase transition driven by melonic interaction processes. We restrict our study to the Boulatov-Ooguri models, which describe topological BF theories and are the basis for the construction of four dimensional models of quantum gravity.

  7. Impact of cytogenetics on the outcome of adult acute lymphoblastic leukemia: results of Southwest Oncology Group 9400 study.

    Science.gov (United States)

    Pullarkat, Vinod; Slovak, Marilyn L; Kopecky, Kenneth J; Forman, Stephen J; Appelbaum, Frederick R

    2008-03-01

    We examined the prognostic impact of cytogenetics on the outcome of 200 acute lymphoblastic leukemia (ALL) patients 15 to 65 years of age enrolled in Southwest Oncology Group (SWOG)-9400 study. Evaluable cytogenetics or fluorescence in situ hybridization studies were available in 140 (70%) patients. Four karyotype categories (normal [n = 31, 22%], t(9;22)/BCR/ABL1 [n = 36, 26%], other unfavorable [-7, +8, or 11q23 rearrangement, n = 19, 13%], and miscellaneous [n = 54, 39%]) and the biologically and clinically relevant ALL ploidy subgroups were prospectively defined. Overall survival (OS) decreased significantly with increasing age (P = .009) and varied with karyotype category (P cytogenetics as the most important prognostic factor in adult ALL. This trial was registered at www.ClinicalTrials.gov as #NCT00002665.

  8. Developing a decision-making model based on an interdisciplinary oncological care group for the management of colorectal cancer.

    Science.gov (United States)

    Genovesi, Domenico; Mazzilli, Lorenzo; Trignani, Marianna; DI Tommaso, Monica; Nuzzo, Antonio; Biondi, Edoardo; Tinari, Nicola; Martino, Maria Teresa; Innocenti, Paolo; DI Sebastiano, Pierluigi; Mazzola, Lorenzo; Lanci, Carmine; Neri, Matteo; Laterza, Francesco; Marino, Maria; Ferrini, Giovanni; Spadaccini, Antonio; Filippone, Antonella; DI Giandomenico, Enzo; Marulli, Antonio; Palombo, Giuseppe; Sparvieri, Antonio; Marchetti, Antonio; Pizzicannella, Giuseppe; Petrini, Flavia; DI Felice, Maria; Ottaviani, Floriana; Monteodorisio, Antonio; DI Nicola, Marta; Cefaro, Giampiero Ausili

    2014-05-01

    To report our experience on implementation and preliminary results of a decision-making model based on the recommendations of an Interdisciplinary Oncological Care Group developed for the management of colorectal cancer. The multidisciplinary team identified a reference guideline using appraisal of guidelines for research and evaluation (AGREE) tool based on a sequential assessment of the guideline quality. Thereafter, internal guidelines with diagnostic and therapeutic management for early, locally advanced and metastatic colonic and rectal cancer were drafted; organizational aspects, responsibility matrices, protocol actions for each area of specialty involved and indicators for performing audits were also defined. The National Institute for Health and Care Excellence (NICE) UK guideline was the reference for drafting the internal guideline document; from February to November 2013, 125 patients with colorectal cancer were discussed by and taken under the care of the Interdisciplinary Oncological Care Group. The first audit performed in December 2013 revealed optimal adherence to the internal guideline, mainly in terms of uniformity and accuracy of perioperative staging, coordination and timing of multi-modal therapies. To date, all patients under observation are within the diagnostic and therapeutic course, no patient came out from the multidisciplinary "path" and only in 14% of cases have the first recommendations proposed been changed. The selected indicators appear effective and reliable, while at the moment, it is not yet possible to assess the impact of the multidisciplinary team on clinical outcome. Although having a short observation period, our model seems capable of determining optimal uniformity of diagnostic and therapeutic management, to a high degree of patient satisfaction. A longer observation period is necessary in order to confirm these observations and for assessing the impact on clinical outcome.

  9. On Group Phase Quantization and Its Physical Characteristics

    Institute of Scientific and Technical Information of China (English)

    DU Bao-Qiang; ZHOU Wei; YU Jian-Guo; DONG Shao-Feng

    2011-01-01

    The physical characteristics of phase quantum are further revealed, based on the proposition of concepts of the greatest common factor frequency, the least common multiple period, quantized phase shift resolution and equivalent phase comparison frequency. Then the problem of phase comparison between different frequency signals is certified in detail. Using the basic principle of phase comparison between different frequencies and the variation law of group phase difference, a point of view on group phase quantization is presented. Group phase quantum is not only an indivisible individual of group phase, but also a basic unit composing group phase difference. It is equal to the equivalent phase comparison period of phase comparison between different frequencies in size. Experimental results show not only a high measurement resolution of 10-12/s in frequency measurement based on group phase quantum, but also a super-high locked phase precision of 10-13/s in active H atomic clock.%@@ The physical characteristics of phase quantum are further revealed,based on the proposition of concepts of the greatest common factor frequency,the least common multiple period,quantized phase shift resolution and equivalent phase comparison frequency.Then the problem of phase comparison between different frequency signals is certified in detail.Using the basic principle of phase comparison between different frequencies and the variation law of group phase difference,a point of view on group phase quantization is presented.Group phase quantum is not only an indivisible individual of group phase,but also a basic unit composing group phase difference.It is equal to the equivalent phase comparison period of phase comparison between different frequencies in size.Experimental results show not only a high measurement resolution of 10-12 /s in frequency measurement based on group phase quantum,but also a super-high locked phase precision of 10-13/s in active H atomic clock.

  10. Impact of cancer support groups on childhood cancer treatment and abandonment in a private pediatric oncology centre

    Directory of Open Access Journals (Sweden)

    Arathi Srinivasan

    2015-01-01

    Full Text Available Aims: To analyze the impact of two cancer support groups in the treatment and abandonment of childhood cancer. Materials and Methods: This is a retrospective review of children with cancer funded and non-funded who were treated at Kanchi Kamakoti CHILDS Trust Hospital from 2010 to 2013. A total of 100 patients were funded, 57 by Ray of Light Foundation and 43 by Pediatric Lymphoma Project and 70 non-funded. Results: The total current survival of 80%, including those who have completed treatment and those currently undergoing treatment, is comparable in both the groups. Abandonment of treatment after initiating therapy was not seen in the financially supported group whereas abandonment of treatment after initiation was seen in one child in the non-funded group. Conclusions: Besides intensive treatment with good supportive care, financial support also has an important impact on compliance and abandonment in all socioeconomic strata of society. Financial support from private cancer support groups also has its impact beyond the patient and family, in reducing the burden on government institutions by non-governmental funding in private sector. Improvement in the delivery of pediatric oncology care in developing countries could be done by financial support from the private sector.

  11. Control Group Design, Contamination and Drop-Out in Exercise Oncology Trials : A Systematic Review

    NARCIS (Netherlands)

    Bisschop, Charlotte N. Steins; Courneya, Kerry S.; Velthuis, Miranda J.; Monninkhof, Evelyn M.; Jones, Lee W.; Friedenreich, Christine; van der Wall, Elsken; Peeters, Petra H. M.; May, Anne M.

    2015-01-01

    Purpose Important considerations for exercise trials in cancer patients are contamination and differential drop-out among the control group members that might jeopardize the internal validity. This systematic review provides an overview of different control groups design characteristics of

  12. Recommendations for the Return of Research Results to Study Participants and Guardians: A Report From the Children's Oncology Group

    Science.gov (United States)

    Fernandez, Conrad V.; Ruccione, Kathleen; Wells, Robert J.; Long, Jay B.; Pelletier, Wendy; Hooke, Mary C.; Pentz, Rebecca D.; Noll, Robert B.; Baker, Justin N.; O'Leary, Maura; Reaman, Gregory; Adamson, Peter C.; Joffe, Steven

    2012-01-01

    Purpose The Children's Oncology Group (COG) strongly supports the widely recognized principle that research participants should be offered a summary of study results. The mechanism by which to do so in a cooperative research group setting has not been previously described. Methods On the basis of a review of the available empirical and theoretic literature and on iterative, multidisciplinary discussion, a COG Return of Results Task Force (RRTF) offered detailed recommendations for the return of results to research study participants. Results The RRTF established guidelines for the notification of research participants and/or their parents/guardians about the availability of research results, a mechanism for and timing of sharing results via registration on the COG public Web site, the scope of the research to be shared, the target audience, and a process for creating and vetting lay summaries of study results. The RRTF recognized the challenges in adequately conveying complex scientific results to audiences with varying levels of health literacy and recommended that particularly sensitive or complex results be returned using direct personal contact. The RRTF also recommended evaluation of the cost, effectiveness, and impact of sharing results. Conclusion These recommendations provide a framework for the offering and returning of results to participants. They can be used by individual investigators, multi-investigator research collaboratives, and large cooperative groups. PMID:23109703

  13. Salivary gland carcinoma : Independent prognostic factors for locoregional control, distant metastases, and overall survival: Results of the Dutch Head and Neck Oncology Cooperative Group

    NARCIS (Netherlands)

    Terhaard, CHJ; Lubsen, H; Van der Tweel, [No Value; Hilgers, FJM; Eijkenboom, WMH; Marres, HAM; Tjho-Heslinga, RE; de Jong, JMA; Roodenburg, JLN

    2004-01-01

    Background. We analyzed the records of patients with malignant salivary gland tumors, as diagnosed in centers of the Dutch Head and Neck Oncology Cooperative Group, in search of independent prognostic factors for locoregional control, distant metastases, and overall survival. Methods. In 565 patient

  14. Control Group Design, Contamination and Drop-Out in Exercise Oncology Trials : A Systematic Review

    NARCIS (Netherlands)

    Bisschop, Charlotte N. Steins; Courneya, Kerry S.; Velthuis, Miranda J.; Monninkhof, Evelyn M.; Jones, Lee W.; Friedenreich, Christine; van der Wall, Elsken; Peeters, Petra H. M.; May, Anne M.

    2015-01-01

    Purpose Important considerations for exercise trials in cancer patients are contamination and differential drop-out among the control group members that might jeopardize the internal validity. This systematic review provides an overview of different control groups design characteristics of exercise-

  15. Barriers to a Career Focus in Cancer Prevention: A Report and Initial Recommendations From the American Society of Clinical Oncology Cancer Prevention Workforce Pipeline Work Group

    Science.gov (United States)

    Meyskens, Frank L.; Bajorin, Dean F.; George, Thomas J.; Jeter, Joanne M.; Khan, Shakila; Tyne, Courtney A.; William, William N.

    2016-01-01

    Purpose To assist in determining barriers to an oncology career incorporating cancer prevention, the American Society of Clinical Oncology (ASCO) Cancer Prevention Workforce Pipeline Work Group sponsored surveys of training program directors and oncology fellows. Methods Separate surveys with parallel questions were administered to training program directors at their fall 2013 retreat and to oncology fellows as part of their February 2014 in-training examination survey. Forty-seven (67%) of 70 training directors and 1,306 (80%) of 1,634 oncology fellows taking the in-training examination survey answered questions. Results Training directors estimated that ≤ 10% of fellows starting an academic career or entering private practice would have a career focus in cancer prevention. Only 15% of fellows indicated they would likely be interested in cancer prevention as a career focus, although only 12% thought prevention was unimportant relative to treatment. Top fellow-listed barriers to an academic career were difficulty in obtaining funding and lower compensation. Additional barriers to an academic career with a prevention focus included unclear career model, lack of clinical mentors, lack of clinical training opportunities, and concerns about reimbursement. Conclusion Reluctance to incorporate cancer prevention into an oncology career seems to stem from lack of mentors and exposure during training, unclear career path, and uncertainty regarding reimbursement. Suggested approaches to begin to remedy this problem include: 1) more ASCO-led and other prevention educational resources for fellows, training directors, and practicing oncologists; 2) an increase in funded training and clinical research opportunities, including reintroduction of the R25T award; 3) an increase in the prevention content of accrediting examinations for clinical oncologists; and 4) interaction with policymakers to broaden the scope and depth of reimbursement for prevention counseling and

  16. Phase I/II adaptive design for drug combination oncology trials

    OpenAIRE

    Wages, Nolan A.; Conaway, Mark R.

    2014-01-01

    Existing statistical methodology on dose finding for combination chemotherapies has focused on toxicity considerations alone in finding a maximum tolerated dose combination to recommend for further testing of efficacy in a phase II setting. Recently, there has been increasing interest in integrating phase I and phase II trials in order to facilitate drug development. In this article, we propose a new adaptive phase I/II method for dual-agent combinations that takes into account both toxicity ...

  17. Radiation Therapy Oncology Group Consensus Panel Guidelines for the Delineation of the Clinical Target Volume in the Postoperative Treatment of Pancreatic Head Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Goodman, Karyn A., E-mail: goodmank@mskcc.org [Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Regine, William F. [University of Maryland School of Medicine, Baltimore, Maryland (United States); Dawson, Laura A. [Princess Margaret Hospital, University of Toronto, Toronto, Ontario (Canada); Ben-Josef, Edgar [University of Michigan Medical School, Ann Arbor, Michigan (United States); Haustermans, Karin [University Hospital Leuven, Leuven (Belgium); Bosch, Walter R. [Image-Guided Therapy QA Center, Washington University, St. Louis, Missouri (United States); Turian, Julius; Abrams, Ross A. [Rush University Medical College, Chicago, Illinois (United States)

    2012-07-01

    Purpose: To develop contouring guidelines to be used in the Radiation Therapy Oncology Group protocol 0848, a Phase III randomized trial evaluating the benefit of adjuvant chemoradiation in patients with resected head of pancreas cancer. Methods and Materials: A consensus committee of six radiation oncologists with expertise in gastrointestinal radiotherapy developed stepwise contouring guidelines and an atlas for the delineation of the clinical target volume (CTV) in the postoperative treatment of pancreas cancer, based on identifiable regions of interest and margin expansions. Areas at risk for subclinical disease to be included in the CTV were defined, including nodal regions, anastomoses, and the preoperative primary tumor location. Regions of interest that could be reproducibly contoured on postoperative imaging after a pancreaticoduodenectomy were identified. Standardized expansion margins to encompass areas at risk were developed after multiple iterations to determine the optimal margin expansions. Results: New contouring recommendations based on CT anatomy were established. Written guidelines for the delineation of the postoperative CTV and normal tissues, as well as a Web-based atlas, were developed. Conclusions: The postoperative abdomen has been a difficult area for effective radiotherapy. These new guidelines will help physicians create fields that better encompass areas at risk and minimize dose to normal tissues.

  18. Combination goserelin and tamoxifen therapy in premenopausal advanced breast cancer: a multicentre study by the ITMO group. Italian Trials in Medical Oncology.

    Science.gov (United States)

    Buzzoni, R.; Biganzoli, L.; Bajetta, E.; Celio, L.; Fornasiero, A.; Mariani, L.; Zilembo, N.; Di Bartolomeo, M.; Di Leo, A.; Arcangeli, G.

    1995-01-01

    It has been suggested that tamoxifen may improve the efficacy of medical castration with luteinising hormone-releasing hormone analogues, but very few data have so far been published concerning the clinical and endocrinological activity of this therapeutic modality. In this phase II multicentre trial conducted by the Italian Trials in Medical Oncology group (ITMO), 64 premenopausal patients with hormone receptor-positive or unknown breast cancer were treated with monthly s.c. injections of goserelin 3.6 mg, in association with a tamoxifen daily dose of 20 mg, as first-line therapy for their advanced disease. All of the patients were evaluable for efficacy and there was an overall response rate of 41% (95% confidence interval 28-52%), with 7 of the 26 responders achieving complete remission. The median time to response was 4 months (range 2-17), and the median response duration was 13 months (range 6-37 +). Better responses were observed in soft tissues (51%); the response in visceral and bone metastases was respectively 19% and 37%. Serum concentrations of gonadotrophins and oestradiol were significantly decreased by the treatment, oestrogen levels being constantly suppressed to within the range observed in post-menopausal women. No significant change was detected in serum testosterone levels. In our experience, although it was not associated with any increased clinical efficacy, the concurrent use of goserelin and tamoxifen proved to be a feasible approach in the management of premenopausal advanced breast cancer. PMID:7734310

  19. Treatment of children with early pre-B and pre-B acute lymphocytic leukemia with antimetabolite-based intensification regimens: a Pediatric Oncology Group Study.

    Science.gov (United States)

    Harris, M B; Shuster, J J; Pullen, J; Borowitz, M J; Carroll, A J; Behm, F G; Camitta, B; Land, V J

    2000-09-01

    Between May 1987 and January 1991, 1354 patients, 1-21 years old, with standard or poor prognosis B-lineage acute lymphocytic leukemia were treated on the Pediatric Oncology Group Study 8602. One thousand three hundred and twenty-three patients entered remission and 1051 patients were randomized on day 43 to an intensification regimen containing L-asparaginase and intermediate-dose methotrexate (regimen B) or cytarabine and intermediate dose methotrexate (regimen C). After completion of intensification at week 25, all patients received the same maintenance therapy until 3 years from diagnosis. Overall 5-year continuous complete remission (CCR) for regimen B was 72+/-2% (s.e.) and for regimen C, 73+/-2% (P = 0.72 by log-rank analysis). Significant differences between treatments for CCR, testicular, CNS relapses overall or with regard to phenotype (pre-B vs early pre-B), gender, or race were not detected. During intensification, regimen C had significantly more bacterial infections (P = 0.05) and days spent in the hospital (P intensification phase of therapy in children with B-lineage acute lymphocytic leukemia.

  20. Reconsidering Physical Activity Restrictions for Mononephric Survivors of Childhood Cancer: A Report From the Children's Oncology Group.

    Science.gov (United States)

    Okada, Maki; Hockenberry, Marilyn J; Koh, Chester J; Meeske, Kathleen A; Rangan, Kasey E; Rodgers, Cheryl; Rosenthal, Yael; Ruccione, Kathleen S; Freyer, David R

    2016-07-01

    Although traditional recommendations for mononephric childhood cancer survivors are to avoid contact sports in order to protect the remaining kidney, review of available evidence suggests that the majority of renal loss is caused by accidents not involving sports. An interdisciplinary team performed a review of the English literature published from 1999 to 2012 within the PubMed, Cochrane, Google Scholar, and National Guidelines Clearinghouse databases. The level of evidence and proposed recommendations were graded according to an established rubric and GRADE criteria. Our review found that kidney loss is most commonly caused by nonsports activities such as motor vehicle accidents and falls, implying that restrictions on sports-related activity in mononephric pediatric survivors are not well supported. This favors encouraging ordinary sports and related activities without restriction in mononephric childhood cancer survivors because the known benefits of exercise outweigh the exceedingly low risk of renal loss. Accordingly, activity recommendations for mononephric patients have been revised in the most current version of the Children's Oncology Group Long-term Follow-Up Guidelines for Survivors of Childhood, Adolescent and Young Adult Cancers. This has important implications for this and similar populations who may now undertake individual and organized sports without undue regard for their mononephric status.

  1. Testing different brain metastasis grading systems in stereotactic radiosurgery: Radiation Therapy Oncology Group's RPA, SIR, BSBM, GPA, and modified RPA.

    Science.gov (United States)

    Serizawa, Toru; Higuchi, Yoshinori; Nagano, Osamu; Hirai, Tatsuo; Ono, Junichi; Saeki, Naokatsu; Miyakawa, Akifumi

    2012-12-01

    The authors conducted validity testing of the 5 major reported indices for radiosurgically treated brain metastases- the original Radiation Therapy Oncology Group's Recursive Partitioning Analysis (RPA), the Score Index for Radiosurgery in Brain Metastases (SIR), the Basic Score for Brain Metastases (BSBM), the Graded Prognostic Assessment (GPA), and the subclassification of RPA Class II proposed by Yamamoto-in nearly 2500 cases treated with Gamma Knife surgery (GKS), focusing on the preservation of neurological function as well as the traditional endpoint of overall survival. The authors analyzed data from 2445 cases treated with GKS by the first author (T.S.), the primary surgeon. The patient group consisted of 1716 patients treated between January 1998 and March 2008 (the Chiba series) and 729 patients treated between April 2008 and December 2011 (the Tokyo series). The interval from the date of GKS until the date of the patient's death (overall survival) and impaired activities of daily living (qualitative survival) were calculated using the Kaplan-Meier method, while the absolute risk for two adjacent classes of each grading system and both hazard ratios and 95% confidence intervals were estimated using the Cox proportional hazards model. For overall survival, there were highly statistically significant differences between each two adjacent patient groups characterized by class or score (all p values GPA Scores 3.5-4.0 and 3.0. The SIR showed the best statistical results for predicting preservation of neurological function. Although no other grading systems yielded statistically significant differences in qualitative survival, the BSBM and the modified RPA appeared to be better than the original RPA and GPA. The modified RPA subclassification, proposed by Yamamoto, is well balanced in scoring simplicity with respect to case number distribution and statistical results for overall survival. However, a new or revised grading system is necessary for predicting

  2. Radiotherapy Quality Assurance Report From Children's Oncology Group AHOD0031

    Energy Technology Data Exchange (ETDEWEB)

    Dharmarajan, Kavita V. [Mount Sinai Medical Center, New York, New York (United States); Friedman, Debra L. [Vanderbilt University, Nashville, Tennessee (United States); FitzGerald, T.J. [Quality Assurance Review Center, Lincoln, Rhode Island (United States); McCarten, Kathleen M. [Rhode Island Hospital/Warren Alpert Medical School of Brown University, Providence, Rhode Island (United States); Constine, Louis S. [University of Rochester Medical Center, Rochester, New York (United States); Chen, Lu [Children' s Oncology Group, Arcadia, California (United States); Kessel, Sandy K.; Iandoli, Matt; Laurie, Fran [Quality Assurance Review Center, Lincoln, Rhode Island (United States); Schwartz, Cindy L. [MD Anderson Cancer Center, Houston, Texas (United States); Wolden, Suzanne L., E-mail: woldens@mskcc.org [Memorial Sloan-Kettering Cancer Center, New York, New York (United States)

    2015-04-01

    Purpose: A phase 3 trial assessing response-based therapy in intermediate-risk Hodgkin lymphoma mandated real-time central review of involved field radiation therapy (IFRT) and imaging records by a centralized review center to maximize protocol compliance. We report the impact of centralized radiation therapy review on protocol compliance. Methods and Materials: Review of simulation films, port films, and dosimetry records was required before and after treatment. Records were reviewed by study-affiliated or review center–affiliated radiation oncologists. A deviation of 6% to 10% from protocol-specified dose was scored as “minor”; a deviation of >10% was “major.” A volume deviation was scored as “minor” if margins were less than specified or “major” if fields transected disease-bearing areas. Interventional review and final compliance review scores were assigned to each radiation therapy case and compared. Results: Of 1712 patients enrolled, 1173 underwent IFRT at 256 institutions in 7 countries. An interventional review was performed in 88% of patients and a final review in 98%. Overall, minor and major deviations were found in 12% and 6% of patients, respectively. Among the cases for which ≥1 pre-IFRT modification was requested by the Quality Assurance Review Center and subsequently made by the treating institution, 100% were made compliant on final review. By contrast, among the cases for which ≥1 modification was requested but not made by the treating institution, 10% were deemed compliant on final review. Conclusions: In a large trial with complex treatment pathways and heterogeneous radiation therapy fields, central review was performed in a large percentage of cases before IFRT and identified frequent potential deviations in a timely manner. When suggested modifications were performed by the institutions, deviations were almost eliminated.

  3. First-in-Human Phase 1 Studies in Oncology: The New Challenge for Investigative Sites

    OpenAIRE

    Marc Salzberg

    2012-01-01

    Phase 1 first-in-human studies with anti-cancer products differ from other phase 1 studies in that they are evaluated in patients rather than healthy volunteers. The rationale design of targeted drugs triggers changes in the design of these studies. Patient populations are more precisely defined and pose a challenge to the efficient inclusion of study patients. Objectives shift from the definition of a maximum tolerated dose to the evaluation of a recommended phase 2 dose. Other challenges re...

  4. Long-term results in the treatment of acute nonlymphocytic leukemia: a Pediatric Oncology Group Study.

    Science.gov (United States)

    Krischer, J P; Steuber, C P; Vietti, T J; Culbert, S J; Ragab, A H; Morgan, S K; Berry, D H; Hvizdala, E; Thomas, P J; Land, V J

    1989-01-01

    Complete remission (CR), 5-year remission duration (RD), and overall 5-year survival rates are 74%, 28% and 25%, respectively, for previously untreated children with acute nonlymphocytic leukemia diagnosed between 1977 and 1981, following induction therapy with vincristine, doxorubicin and prednisone (VAP), consolidation therapy with 6-thioguanine, cytosine arabinoside (TA) and cyclophosphamide/vincristine/cytosine arabinoside/prednisone (COAP), and maintenance therapy of alternating TA and COAP with or without VAP pulses. Approximately 20% are free of their disease for more than 5 years. High white blood cell counts (WBC) at diagnosis and M3 and M6 morphology were associated with lower CR rates, while M5 morphology was associated with higher CR rates. Patients with M1 morphology had shorter remission duration as compared to those with M4 or M5 morphology. Low WBC and age between 2 and 10 years at diagnosis were associated with longer remission durations and survival. Patients with M4 morphology also survived longer. The observed CR rates are comparable to other studies initiated at the same time as this study but survival is less than those reported more recently. Low WBC at diagnosis and M4/M5 morphology may identify relatively favorable prognostic groups.

  5. Canine digital tumors: a veterinary cooperative oncology group retrospective study of 64 dogs.

    Science.gov (United States)

    Henry, Carolyn J; Brewer, William G; Whitley, Elizabeth M; Tyler, Jeff W; Ogilvie, Gregory K; Norris, Alan; Fox, Leslie E; Morrison, Wallace B; Hammer, Alan; Vail, David M; Berg, John

    2005-01-01

    We compared clinical characteristics and outcomes for dogs with various digital tumors. Medical records and histology specimens of affected dogs from 9 veterinary institutions were reviewed. Risk factors examined included age, weight, sex, tumor site (hindlimb or forelimb), local tumor (T) stage, metastases, tumor type, and treatment modality. The Kaplan-Meier product limit method was used to determine the effect of postulated risk factors on local disease-free interval (LDFI), metastasis-free interval (MFI), and survival time (ST). Outcomes were thought to differ significantly between groups when P dogs were included. Squamous cell carcinoma (SCC) accounted for 33 (51.6%) of the tumors. Three dogs presented with or developed multiple digital SCC. Other diagnoses included malignant melanoma (MM) (n = 10; 15.6%), osteosarcoma (OSA) (n = 4; 6.3%), hemangiopericytoma (n = 3; 4.7%), benign soft tissue tumors (n = 5; 7.8%), and malignant soft tissue tumors (n = 9; 14%). Fourteen dogs with malignancies had black hair coats, including 5 of the 10 dogs with MM. Surgery was the most common treatment and, regardless of the procedure, had a positive impact on survival. None of the patient variables assessed, including age, sex, tumor type, site, and stage, had a significant impact on ST. Both LDFI and MFI were negatively affected by higher T stage, but not by type of malignancy. Although metastasis at diagnosis correlated with a shorter LDFI, it did not have a significant impact on ST. On the basis of these findings, early surgical intervention is advised for the treatment of dogs with digital tumors, regardless of tumor type or the presence of metastatic disease.

  6. Recommendations for the use of long-term central venous catheter (CVC) in children with hemato-oncological disorders: management of CVC-related occlusion and CVC-related thrombosis. On behalf of the coagulation defects working group and the supportive therapy working group of the Italian Association of Pediatric Hematology and Oncology (AIEOP).

    Science.gov (United States)

    Giordano, Paola; Saracco, Paola; Grassi, Massimo; Luciani, Matteo; Banov, Laura; Carraro, Francesca; Crocoli, Alessandro; Cesaro, Simone; Zanazzo, Giulio Andrea; Molinari, Angelo Claudio

    2015-11-01

    Central venous catheters (CVC), used for the management of children with hemato-oncological disorders, are burdened by a significant incidence of mechanical, infective, or thrombotic complications. These complications favor an increasing risk in prolongation of hospitalization, extra costs of care, and sometimes severe life-threatening events. No guidelines for the management of CVC-related occlusion and CVC-related thrombosis are available for children. To this aim, members of the coagulation defects working group and the supportive therapy working group of the Italian Association of Pediatric Hematology and Oncology (AIEOP) reviewed the pediatric and adult literature to propose the first recommendations for the management of CVC-related occlusion and CVC-related thrombosis in children with hemato-oncological disorders.

  7. Radiation Therapy Planning for Early-Stage Hodgkin Lymphoma: Experience of the International Lymphoma Radiation Oncology Group

    Energy Technology Data Exchange (ETDEWEB)

    Maraldo, Maja V., E-mail: dra.maraldo@gmail.com [Departments of Clinical Oncology and Hematology, Rigshospitalet, University of Copenhagen (Denmark); Dabaja, Bouthaina S. [Department of Radiation Oncology, MD Anderson Cancer Center, Texas (United States); Filippi, Andrea R. [Department of Oncology, University of Torino School of Medicine, Torino (Italy); Illidge, Tim [Department of Oncology, Christie Hospital, Manchester (United Kingdom); Tsang, Richard [Department of Radiation Oncology, Princess Margaret Cancer Centre, Toronto, Ontario (Canada); Ricardi, Umberto [Department of Oncology, University of Torino School of Medicine, Torino (Italy); Petersen, Peter M.; Schut, Deborah A. [Departments of Clinical Oncology and Hematology, Rigshospitalet, University of Copenhagen (Denmark); Garcia, John [Department of Radiation Oncology, MD Anderson Cancer Center, Texas (United States); Headley, Jayne [Department of Oncology, Christie Hospital, Manchester (United Kingdom); Parent, Amy; Guibord, Benoit [Department of Radiation Oncology, Princess Margaret Cancer Centre, Toronto, Ontario (Canada); Ragona, Riccardo [Department of Oncology, University of Torino School of Medicine, Torino (Italy); Specht, Lena [Departments of Clinical Oncology and Hematology, Rigshospitalet, University of Copenhagen (Denmark)

    2015-05-01

    Purpose: Early-stage Hodgkin lymphoma (HL) is a rare disease, and the location of lymphoma varies considerably between patients. Here, we evaluate the variability of radiation therapy (RT) plans among 5 International Lymphoma Radiation Oncology Group (ILROG) centers with regard to beam arrangements, planning parameters, and estimated doses to the critical organs at risk (OARs). Methods: Ten patients with stage I-II classic HL with masses of different sizes and locations were selected. On the basis of the clinical information, 5 ILROG centers were asked to create RT plans to a prescribed dose of 30.6 Gy. A postchemotherapy computed tomography scan with precontoured clinical target volume (CTV) and OARs was provided for each patient. The treatment technique and planning methods were chosen according to each center's best practice in 2013. Results: Seven patients had mediastinal disease, 2 had axillary disease, and 1 had disease in the neck only. The median age at diagnosis was 34 years (range, 21-74 years), and 5 patients were male. Of the resulting 50 treatment plans, 15 were planned with volumetric modulated arc therapy (1-4 arcs), 16 with intensity modulated RT (3-9 fields), and 19 with 3-dimensional conformal RT (2-4 fields). The variations in CTV-to-planning target volume margins (5-15 mm), maximum tolerated dose (31.4-40 Gy), and plan conformity (conformity index 0-3.6) were significant. However, estimated doses to OARs were comparable between centers for each patient. Conclusions: RT planning for HL is challenging because of the heterogeneity in size and location of disease and, additionally, to the variation in choice of treatment techniques and field arrangements. Adopting ILROG guidelines and implementing universal dose objectives could further standardize treatment techniques and contribute to lowering the dose to the surrounding OARs.

  8. A summary of the osteosarcoma banking efforts: a report from the Children's Oncology Group and the QuadW Foundation.

    Science.gov (United States)

    Glover, Jason; Krailo, Mark; Tello, Tanya; Marina, Neyssa; Janeway, Katherine; Barkauskas, Don; Fan, Timothy M; Gorlick, Richard; Khanna, Chand

    2015-03-01

    Survival rates of patients with osteosarcoma have remained stagnant over the last thirty years. Better understanding of biology, new therapeutics, and improved biomarkers are needed. The Children's Oncology Group (COG) addressed this need by developing one of the largest osteosarcoma biorepositories ever, containing over 15,000 tumor and tissue samples from over 1,500 patients. The biology study P9851 and the banking study AOST06B1 has enrolled 1,787 patients (as of September, 2013). Clinical information was lacking on 510 patients on P9851, who were not enrolled on a concurrent therapeutic trial. The value of these specimens was diminished. The lack of statistical support available for biology projects slowed the analysis of several critical studies. The QuadW Foundation, CureSearch, and the COG formed the Childhood Sarcoma Biostatistics and Annotation Office (CSBAO) to provide the infrastructure and address these needs by linking clinically annotated patient data to archived tissue samples and to develop biostatistical support for childhood sarcoma research. Originally 5.3% of samples from the 510 patients on P9851 not enrolled on a therapeutic study had full clinical annotation. The efforts of the CSBAO have linked clinical annotation to 90.8% of those specimens and provided statistical analyses to several studies that had used COG samples. As a result, 24 biology studies in osteosarcoma have been completed and published in peer-reviewed journals. These samples and in-silico data are available to the research community for basic and translational science projects to improve the biological understanding and treatment of patients affected by osteosarcoma. © 2014 Wiley Periodicals, Inc.

  9. Implementation of Remote 3-Dimensional Image Guided Radiation Therapy Quality Assurance for Radiation Therapy Oncology Group Clinical Trials

    Energy Technology Data Exchange (ETDEWEB)

    Cui Yunfeng [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Galvin, James M. [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Radiation Therapy Oncology Group, American College of Radiology, Philadelphia, Pennsylvania (United States); Parker, William [Department of Medical Physics, McGill University Health Center, Montreal, QC (Canada); Breen, Stephen [Department of Radiation Physics, Princess Margaret Hospital, Toronto, ON (Canada); Yin Fangfang; Cai Jing [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Papiez, Lech S. [Department of Radiation Oncology, University of Texas Southwestern Medical Center, Dallas, Texas (United States); Li, X. Allen [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Bednarz, Greg [Department of Radiation Oncology, University of Pittsburgh Medical Center, Pittsburgh, Pennsylvania (United States); Chen Wenzhou [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Xiao Ying, E-mail: ying.xiao@jefferson.edu [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Radiation Therapy Oncology Group, American College of Radiology, Philadelphia, Pennsylvania (United States)

    2013-01-01

    Purpose: To report the process and initial experience of remote credentialing of three-dimensional (3D) image guided radiation therapy (IGRT) as part of the quality assurance (QA) of submitted data for Radiation Therapy Oncology Group (RTOG) clinical trials; and to identify major issues resulting from this process and analyze the review results on patient positioning shifts. Methods and Materials: Image guided radiation therapy datasets including in-room positioning CT scans and daily shifts applied were submitted through the Image Guided Therapy QA Center from institutions for the IGRT credentialing process, as required by various RTOG trials. A centralized virtual environment is established at the RTOG Core Laboratory, containing analysis tools and database infrastructure for remote review by the Physics Principal Investigators of each protocol. The appropriateness of IGRT technique and volumetric image registration accuracy were evaluated. Registration accuracy was verified by repeat registration with a third-party registration software system. With the accumulated review results, registration differences between those obtained by the Physics Principal Investigators and from the institutions were analyzed for different imaging sites, shift directions, and imaging modalities. Results: The remote review process was successfully carried out for 87 3D cases (out of 137 total cases, including 2-dimensional and 3D) during 2010. Frequent errors in submitted IGRT data and challenges in the review of image registration for some special cases were identified. Workarounds for these issues were developed. The average differences of registration results between reviewers and institutions ranged between 2 mm and 3 mm. Large discrepancies in the superior-inferior direction were found for megavoltage CT cases, owing to low spatial resolution in this direction for most megavoltage CT cases. Conclusion: This first experience indicated that remote review for 3D IGRT as part of QA

  10. Implementation of remote 3-dimensional image guided radiation therapy quality assurance for radiation therapy oncology group clinical trials.

    Science.gov (United States)

    Cui, Yunfeng; Galvin, James M; Parker, William; Breen, Stephen; Yin, Fang-Fang; Cai, Jing; Papiez, Lech S; Li, X Allen; Bednarz, Greg; Chen, Wenzhou; Xiao, Ying

    2013-01-01

    To report the process and initial experience of remote credentialing of three-dimensional (3D) image guided radiation therapy (IGRT) as part of the quality assurance (QA) of submitted data for Radiation Therapy Oncology Group (RTOG) clinical trials; and to identify major issues resulting from this process and analyze the review results on patient positioning shifts. Image guided radiation therapy datasets including in-room positioning CT scans and daily shifts applied were submitted through the Image Guided Therapy QA Center from institutions for the IGRT credentialing process, as required by various RTOG trials. A centralized virtual environment is established at the RTOG Core Laboratory, containing analysis tools and database infrastructure for remote review by the Physics Principal Investigators of each protocol. The appropriateness of IGRT technique and volumetric image registration accuracy were evaluated. Registration accuracy was verified by repeat registration with a third-party registration software system. With the accumulated review results, registration differences between those obtained by the Physics Principal Investigators and from the institutions were analyzed for different imaging sites, shift directions, and imaging modalities. The remote review process was successfully carried out for 87 3D cases (out of 137 total cases, including 2-dimensional and 3D) during 2010. Frequent errors in submitted IGRT data and challenges in the review of image registration for some special cases were identified. Workarounds for these issues were developed. The average differences of registration results between reviewers and institutions ranged between 2 mm and 3 mm. Large discrepancies in the superior-inferior direction were found for megavoltage CT cases, owing to low spatial resolution in this direction for most megavoltage CT cases. This first experience indicated that remote review for 3D IGRT as part of QA for RTOG clinical trials is feasible and effective

  11. Radiation therapy planning for early-stage Hodgkin lymphoma: experience of the International Lymphoma Radiation Oncology Group.

    Science.gov (United States)

    Maraldo, Maja V; Dabaja, Bouthaina S; Filippi, Andrea R; Illidge, Tim; Tsang, Richard; Ricardi, Umberto; Petersen, Peter M; Schut, Deborah A; Garcia, John; Headley, Jayne; Parent, Amy; Guibord, Benoit; Ragona, Riccardo; Specht, Lena

    2015-05-01

    Early-stage Hodgkin lymphoma (HL) is a rare disease, and the location of lymphoma varies considerably between patients. Here, we evaluate the variability of radiation therapy (RT) plans among 5 International Lymphoma Radiation Oncology Group (ILROG) centers with regard to beam arrangements, planning parameters, and estimated doses to the critical organs at risk (OARs). Ten patients with stage I-II classic HL with masses of different sizes and locations were selected. On the basis of the clinical information, 5 ILROG centers were asked to create RT plans to a prescribed dose of 30.6 Gy. A postchemotherapy computed tomography scan with precontoured clinical target volume (CTV) and OARs was provided for each patient. The treatment technique and planning methods were chosen according to each center's best practice in 2013. Seven patients had mediastinal disease, 2 had axillary disease, and 1 had disease in the neck only. The median age at diagnosis was 34 years (range, 21-74 years), and 5 patients were male. Of the resulting 50 treatment plans, 15 were planned with volumetric modulated arc therapy (1-4 arcs), 16 with intensity modulated RT (3-9 fields), and 19 with 3-dimensional conformal RT (2-4 fields). The variations in CTV-to-planning target volume margins (5-15 mm), maximum tolerated dose (31.4-40 Gy), and plan conformity (conformity index 0-3.6) were significant. However, estimated doses to OARs were comparable between centers for each patient. RT planning for HL is challenging because of the heterogeneity in size and location of disease and, additionally, to the variation in choice of treatment techniques and field arrangements. Adopting ILROG guidelines and implementing universal dose objectives could further standardize treatment techniques and contribute to lowering the dose to the surrounding OARs. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Male reproductive health after childhood, adolescent, and young adult cancers: a report from the Children's Oncology Group.

    Science.gov (United States)

    Kenney, Lisa B; Cohen, Laurie E; Shnorhavorian, Margarett; Metzger, Monika L; Lockart, Barbara; Hijiya, Nobuko; Duffey-Lind, Eileen; Constine, Louis; Green, Daniel; Meacham, Lillian

    2012-09-20

    The majority of children, adolescents, and young adults diagnosed with cancer will become long-term survivors. Although cancer therapy is associated with many adverse effects, one of the primary concerns of young male cancer survivors is reproductive health. Future fertility is often the focus of concern; however, it must be recognized that all aspects of male health, including pubertal development, testosterone production, and sexual function, can be impaired by cancer therapy. Although pretreatment strategies to preserve reproductive health have been beneficial to some male patients, many survivors remain at risk for long-term reproductive complications. Understanding risk factors and monitoring the reproductive health of young male survivors are important aspects of follow-up care. The Children's Oncology Group Long-Term Follow-Up Guidelines for Survivors of Childhood, Adolescent, and Young Adult Cancer (COG-LTFU Guidelines) were created by the COG to provide recommendations for follow-up care of survivors at risk for long-term complications. The male health task force of the COG-LTFU Guidelines, composed of pediatric oncologists, endocrinologists, nurse practitioners, a urologist, and a radiation oncologist, is responsible for updating the COG-LTFU Guidelines every 2 years based on literature review and expert consensus. This review summarizes current task force recommendations for the assessment and management of male reproductive complications after treatment for childhood, adolescent, and young adult cancers. Issues related to male health that are being investigated, but currently not included in the COG-LTFU Guidelines, are also discussed. Ongoing investigation will inform future COG-LTFU Guideline recommendations for follow-up care to improve health and quality of life for male survivors.

  13. Application of Bayesian hierarchical models for phase I/II clinical trials in oncology.

    Science.gov (United States)

    Yada, Shinjo; Hamada, Chikuma

    2017-03-01

    Treatment during cancer clinical trials sometimes involves the combination of multiple drugs. In addition, in recent years there has been a trend toward phase I/II trials in which a phase I and a phase II trial are combined into a single trial to accelerate drug development. Methods for the seamless combination of phases I and II parts are currently under investigation. In the phase II part, adaptive randomization on the basis of patient efficacy outcomes allocates more patients to the dose combinations considered to have higher efficacy. Patient toxicity outcomes are used for determining admissibility to each dose combination and are not used for selection of the dose combination itself. In cases where the objective is not to find the optimum dose combination solely for efficacy but regarding both toxicity and efficacy, the need exists to allocate patients to dose combinations with consideration of the balance of existing trade-offs between toxicity and efficacy. We propose a Bayesian hierarchical model and an adaptive randomization with consideration for the relationship with toxicity and efficacy. Using the toxicity and efficacy outcomes of patients, the Bayesian hierarchical model is used to estimate the toxicity probability and efficacy probability in each of the dose combinations. Here, we use Bayesian moving-reference adaptive randomization on the basis of desirability computed from the obtained estimator. Computer simulations suggest that the proposed method will likely recommend a higher percentage of target dose combinations than a previously proposed method.

  14. Stopping rules employing response rates, time to progression, and early progressive disease for phase II oncology trials

    Directory of Open Access Journals (Sweden)

    Goffin John R

    2011-12-01

    Full Text Available Abstract Background Response rate (RR, the most common early means of assessing oncology drugs, is not suitable as the sole endpoint for phase II trials of drugs which induce disease stability but not regression. Time to progression (TTP may be more sensitive to such agents, but induces recruitment delays in multistage studies. Early progressive disease (EPD is the earliest signal of time to progression, but is less intuitive to investigators, To study drugs with unknown anti-tumour effect, we designed the Combination Stopping Rule (CSR, which allows investigators to establish a hypothesis using RR and TTP, while the program also employs early progressive disease (EPD to assess for drug inactivity during the first stage of study accrual. Methods A computer program was created to generate stopping rules based on specified error rates, trial size, and RR and median TTP of interest and disinterest for a two-stage phase II trial. Rules were generated for stage II such that the null hypothesis (Hnul was rejected if either RR or TTP met desired thresholds, and accepted if both did not. Assuming an exponential distribution for progression, EPD thresholds were determined based on specified TTP values. Stopping rules were generated for stage I such that Hnul was accepted and the study stopped if both RR and EPD were unacceptable. Results Patient thresholds were generated for RR, median TTP, and EPD which achieved specified error rates and which allowed early stopping based on RR and EPD. For smaller proportional differences between interesting and disinteresting values of RR or TTP, larger trials are required to maintain alpha error, and early stopping is more common with a larger first stage. Conclusion Stopping rules are provided for phase II trials for drugs which have either a desirable RR or TTP. In addition, early stopping can be achieved using RR and EPD.

  15. Staff Time and Motion Assessment for Administration of Erythropoiesis-Stimulating Agents: A Two-Phase Pilot Study in Clinical Oncology Practices

    OpenAIRE

    Reitan, John F.; van Breda, Arletta; Corey-Lisle, Patricia K.; Shreay, Sanatan; Cong, Ze; Legg, Jason

    2013-01-01

    Background Erythropoiesis-stimulating agents (ESAs) are used for the management of anaemia in patients with non-myeloid malignancies where anaemia is due to the effect of concomitant myelosuppressive chemotherapy. Assessing the impact of different ESA dosing regimens on office staff time and projected labour costs is an important component of understanding the potential for optimization of oncology practice efficiencies. Objectives A two-phase study was conducted to evaluate staff time and la...

  16. Marginal prescription equivalent to the isocenter prescription in lung stereotactic body radiotherapy: preliminary study for Japan Clinical Oncology Group trial (JCOG1408)

    Science.gov (United States)

    Kawahara, Daisuke; Ozawa, Shuichi; Kimura, Tomoki; Saito, Akito; Nishio, Teiji; Nakashima, Takeo; Ohno, Yoshimi; Murakami, Yuji; Nagata, Yasushi

    2017-01-01

    A new randomized Phase III trial, the Japan Clinical Oncology Group (JCOG) 1408, which compares two dose fractionations (JCOG 0403 and JCOG 0702) for medically inoperable Stage IA NSCLC or small lung lesions clinically diagnosed as primary lung cancer, involves the introduction of a prescribed dose to the D95% of the planning target volume (PTV) using a superposition/convolution algorithm. Therefore, we must determine the prescribed dose in the D95% prescribing method to begin JCOG1408. JCOG 0702 uses density correction and the D95% prescribing method. However, JCOG 0403 uses no density correction and isocenter- prescribing method. The purpose of this study was to evaluate the prescribed dose to the D95% of the PTV equivalent to a dose of 48 Gy to the isocenter (JCOG 0403) using a superposition algorithm. The peripheral isodose line, which has the highest conformity index, and the D95% of the PTV were analyzed by considering the weighting factor, i.e. the inverse of the difference between the doses obtained using the superposition and Clarkson algorithms. The average dose at the isodose line of the highest conformity index and the D95% of the PTV were 41.5 ± 0.3 and 42.0 ± 0.3 Gy, respectively. The D95% of the PTV had a small correlation with the target volume (r2 = 0.0022) and with the distance between the scatterer and tumor volumes (r2 = 0.19). Thus, the prescribed dose of 48 Gy using the Clarkson algorithm (JCOG0403) was found to be equivalent to the prescribed dose of 42 Gy to the D95% of the PTV using the superposition algorithm. PMID:28115532

  17. Modern Radiation Therapy for Hodgkin Lymphoma: Field and Dose Guidelines From the International Lymphoma Radiation Oncology Group (ILROG)

    Energy Technology Data Exchange (ETDEWEB)

    Specht, Lena, E-mail: lena.specht@regionh.dk [Department of Oncology and Hematology, Rigshospitalet, University of Copenhagen (Denmark); Yahalom, Joachim [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Illidge, Tim [Institute of Cancer Sciences, University of Manchester, Manchester Academic Health Sciences Centre, Christie Hospital NHS Trust, Manchester (United Kingdom); Berthelsen, Anne Kiil [Department of Radiation Oncology and PET Centre, Rigshospitalet, University of Copenhagen (Denmark); Constine, Louis S. [Department of Radiation Oncology and Pediatrics, James P. Wilmot Cancer Center, University of Rochester Medical Center, Rochester, New York (United States); Eich, Hans Theodor [Department of Radiation Oncology, University of Münster (Germany); Girinsky, Theodore [Department of Radiation Oncology, Institut Gustave-Roussy, Villejuif (France); Hoppe, Richard T. [Department of Radiation Oncology, Stanford University, Stanford, California (United States); Mauch, Peter [Department of Radiation Oncology, Brigham and Women' s Hospital and Dana-Farber Cancer Institute, Harvard University, Boston, Massachusetts (United States); Mikhaeel, N. George [Department of Clinical Oncology and Radiotherapy, Guy' s and St Thomas' NHS Foundation Trust, London (United Kingdom); Ng, Andrea [Department of Radiation Oncology, Brigham and Women' s Hospital and Dana-Farber Cancer Institute, Harvard University, Boston, Massachusetts (United States)

    2014-07-15

    use of ISRT has not yet been validated in a formal study, it is more conservative than INRT, accounting for suboptimal information and appropriately designed for safe local disease control. The goal of modern smaller field radiation therapy is to reduce both treatment volume and treatment dose while maintaining efficacy and minimizing acute and late sequelae. This review is a consensus of the International Lymphoma Radiation Oncology Group (ILROG) Steering Committee regarding the modern approach to RT in the treatment of HL, outlining a new concept of ISRT in which reduced treatment volumes are planned for the effective control of involved sites of HL. Nodal and extranodal non-Hodgkin lymphomas (NHL) are covered separately by ILROG guidelines.

  18. Detection of Preoperative Wilms Tumor Rupture with CT: A Report from the Children’s Oncology Group

    Science.gov (United States)

    Naranjo, Arlene; Hoffer, Fredric; Mullen, Elizabeth; Geller, James; Gratias, Eric J.; Ehrlich, Peter F.; Perlman, Elizabeth J.; Rosen, Nancy; Grundy, Paul; Dome, Jeffrey S.

    2013-01-01

    Purpose: To retrospectively determine the diagnostic performance of computed tomography (CT) in identifying the presence or absence of preoperative Wilms tumor rupture. Materials and Methods: The cohort was derived from the AREN03B2 study of the Children’s Oncology Group. The study was approved by the institutional review board and was compliant with HIPAA. Written informed consent was obtained before enrollment. The diagnosis of Wilms tumor rupture was established by central review of notes from surgery and/or pathologic examination. Seventy Wilms tumor cases with rupture were matched to 70 Wilms tumor controls without rupture according to age and tumor weight (within 6 months and 50 g, respectively). CT scans were independently reviewed by two radiologists, and the following CT findings were assessed: poorly circumscribed mass, perinephric fat stranding, peritumoral fat planes obscured, retroperitoneal fluid (subcapsular vs extracapsular), ascites beyond the cul-de-sac, peritoneal implants, ipsilateral pleural effusion, and intratumoral hemorrhage. All fluids were classified as hemorrhagic or nonhemorrhagic by using a cutoff of 30 HU. The relationship between CT findings and rupture was assessed with logistic regression models. Results: The sensitivity and specificity for detecting Wilms tumor rupture were 54% (36 of 67 cases) and 88% (61 of 69 cases), respectively, for reviewer 1 and 70% (47 of 67 cases) and 88% (61 of 69 cases), respectively, for reviewer 2. Interobserver agreement was substantial (ĸ = 0.76). All imaging signs tested, except peritoneal implants, intratumoral hemorrhage, and subcapsular fluid, showed a significant association with rupture (P ≤ .02). The attenuation of ascitic fluid did not have a significant correlation with rupture (P = .9990). Ascites beyond the cul-de-sac was the single best indicator of rupture for both reviewers, followed by perinephric fat stranding and retroperitoneal fluid for reviewers 1 and 2, respectively (P cul

  19. Multiparametric Analysis of Oncology Drug Screening with Aqueous Two-Phase Tumor Spheroids.

    Science.gov (United States)

    Shahi Thakuri, Pradip; Ham, Stephanie L; Luker, Gary D; Tavana, Hossein

    2016-11-07

    Spheroids present a biologically relevant three-dimensional model of avascular tumors and a unique tool for discovery of anticancer drugs. Despite being used in research laboratories for several decades, spheroids are not routinely used in the mainstream drug discovery pipeline primarily due to the difficulty of mass-producing uniformly sized spheroids and intense labor involved in handling, drug treatment, and analyzing spheroids. We overcome this barrier using a polymeric aqueous two-phase microtechnology to robotically microprint spheroids of well-defined size in standard 384-microwell plates. We use different cancer cells and show that resulting spheroids grow over time and display characteristic features of solid tumors. We demonstrate the feasibility of robotic, high-throughput screening of 25 standard chemotherapeutics and molecular inhibitors against tumor spheroids of three different cancer cell lines. This screening uses over 7000 spheroids to elicit high quality dose-dependent drug responses from spheroids. To quantitatively compare performance of different drugs, we employ a multiparametric scoring system using half-maximum inhibitory concentration (IC50), maximum inhibition (Emax), and area under the dose-response curve (AUC) to take into account both potency and efficacy parameters. This approach allows us to identify several compounds that effectively inhibit growth of spheroids and compromise cellular viability, and distinguish them from moderately effective and ineffective drugs. Using protein expression analysis, we demonstrate that spheroids generated with the aqueous two-phase microtechnology reliably resolve molecular targets of drug compounds. Incorporating this low-cost and convenient-to-use tumor spheroid technology in preclinical drug discovery will make compound screening with realistic tumor models a routine laboratory technique prior to expensive and tedious animal tests to dramatically improve testing throughput and efficiency and

  20. Computational oncology.

    Science.gov (United States)

    Lefor, Alan T

    2011-08-01

    Oncology research has traditionally been conducted using techniques from the biological sciences. The new field of computational oncology has forged a new relationship between the physical sciences and oncology to further advance research. By applying physics and mathematics to oncologic problems, new insights will emerge into the pathogenesis and treatment of malignancies. One major area of investigation in computational oncology centers around the acquisition and analysis of data, using improved computing hardware and software. Large databases of cellular pathways are being analyzed to understand the interrelationship among complex biological processes. Computer-aided detection is being applied to the analysis of routine imaging data including mammography and chest imaging to improve the accuracy and detection rate for population screening. The second major area of investigation uses computers to construct sophisticated mathematical models of individual cancer cells as well as larger systems using partial differential equations. These models are further refined with clinically available information to more accurately reflect living systems. One of the major obstacles in the partnership between physical scientists and the oncology community is communications. Standard ways to convey information must be developed. Future progress in computational oncology will depend on close collaboration between clinicians and investigators to further the understanding of cancer using these new approaches.

  1. [Strategies for improving care of oncologic patients: SHARE Project results].

    Science.gov (United States)

    Reñones Crego, María de la Concepción; Fernández Pérez, Dolores; Vena Fernández, Carmen; Zamudio Sánchez, Antonio

    2016-01-01

    Cancer treatment is a major burden for the patient and its family that requires an individualized management by healthcare professionals. Nurses are in charge of coordinating care and are the closest healthcare professionals to patient and family; however, in Spain, there are not standard protocols yet for the management of oncology patients. The Spanish Oncology Nursing Society developed between 2012 and 2014 the SHARE project, with the aim of establishing strategies to improve quality of life and nursing care in oncology patients. It was developed in 3 phases. First, a literature search and review was performed to identify nursing strategies, interventions and tools to improve cancer patients' care. At the second stage, these interventions were agreed within a group of oncology nursing experts; and at the third phase, a different group of experts in oncology care categorized the interventions to identify the ones with highest priority and most feasible to be implemented. As a result, 3 strategic actions were identified to improve nursing care during cancer treatment: To provide a named nurse to carry out the follow up process by attending to the clinic or telephonic consultation, develop therapeutic education with adapted protocols for each tumor type and treatment and ensure specific training for nurses on the management of the cancer patients. Strategic actions proposed in this paper aim to improve cancer patients' healthcare and quality of life through the development of advanced nursing roles based on a higher level of autonomy, situating nurses as care coordinators to assure an holistic care in oncology patients.

  2. Geriatric Oncology

    National Research Council Canada - National Science Library

    Helen Hughes; Vikram Swaminathan; Alice Pellegrini; Riccardo Audisio

    2014-01-01

    .... In this article, we review the current field of geriatric oncology. We highlight that age is not a contradiction to cancer treatment but geriatric assessment is needed to identify which treatment a patient may tolerate and benefit from.

  3. Quality Indicators in Radiation Oncology

    Energy Technology Data Exchange (ETDEWEB)

    Albert, Jeffrey M. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Das, Prajnan, E-mail: prajdas@mdanderson.org [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2013-03-15

    Oncologic specialty societies and multidisciplinary collaborative groups have dedicated considerable effort to developing evidence-based quality indicators (QIs) to facilitate quality improvement, accreditation, benchmarking, reimbursement, maintenance of certification, and regulatory reporting. In particular, the field of radiation oncology has a long history of organized quality assessment efforts and continues to work toward developing consensus quality standards in the face of continually evolving technologies and standards of care. This report provides a comprehensive review of the current state of quality assessment in radiation oncology. Specifically, this report highlights implications of the healthcare quality movement for radiation oncology and reviews existing efforts to define and measure quality in the field, with focus on dimensions of quality specific to radiation oncology within the “big picture” of oncologic quality assessment efforts.

  4. Group theoretical construction of planar noncommutative phase spaces

    Energy Technology Data Exchange (ETDEWEB)

    Ngendakumana, Ancille, E-mail: nancille@yahoo.fr; Todjihoundé, Leonard, E-mail: leonardt@imsp.uac.org [Institut de Mathématiques et des Sciences Physiques (IMSP), Porto-Novo (Benin); Nzotungicimpaye, Joachim, E-mail: kimpaye@kie.ac.rw [Kigali Institute of Education (KIE), Kigali (Rwanda)

    2014-01-15

    Noncommutative phase spaces are generated and classified in the framework of centrally extended anisotropic planar kinematical Lie groups as well as in the framework of noncentrally abelian extended planar absolute time Lie groups. Through these constructions the coordinates of the phase spaces do not commute due to the presence of naturally introduced fields giving rise to minimal couplings. By symplectic realizations methods, physical interpretations of generators coming from the obtained structures are given.

  5. Genomics-based early-phase clinical trials in oncology: recommendations from the task force on Methodology for the Development of Innovative Cancer Therapies.

    Science.gov (United States)

    Liu, Stephen V; Miller, Vincent A; Lobbezoo, Marinus W; Giaccone, Giuseppe

    2014-11-01

    The Methodology for the Development of Innovative Cancer Therapies (MDICT) task force discussed incorporation of genomic profiling into early (Phase I and II) clinical trials in oncology. The task force reviewed the challenges of standardising genomics data in a manner conducive to conducting clinical trials. Current barriers to successful and efficient implementation were identified and discussed, as well as the methods of genomic analysis, the proper setting for study and strategies to facilitate timely completion of genomics-based studies. The importance of properly capturing and cataloguing outcomes was also discussed. Several recommendations regarding the use of genomics in these trials are provided.

  6. Interest groups, the Lesotho Highlands Water Project Phase 1 and ...

    African Journals Online (AJOL)

    attempts to influence public policy and their representation ... concept 'interest group', while in the third I investigate inter- ... groups will play certain roles within this arena and articulate ... Formally organised; have other social functions; part of a governmental ..... social problems that are likely to occur during Phase 1B and.

  7. A Group-Period Phase Comparison Method Based on Equivalent Phase Comparison Frequency

    Institute of Scientific and Technical Information of China (English)

    DU Bao-Qiang; ZHOU Wei; DONG Shao-Feng; ZHOU Hai-Niu

    2009-01-01

    Based on the principle of equivalent phase comparison frequency, we propose a group-period phase comparison method. This method can be used to reveal the inherent relations between periodic signals and the change laws of the phase difference. If these laws are applied in the processing of the mutual relations between frequency signals, phase comparison can be accomplished without frequency normalization. Experimental results show that the method can enhance the measurement resolution to 10-13/s in the time domain.

  8. Phenotype in combination with genotype improves outcome prediction in acute myeloid leukemia: a report from Children's Oncology Group protocol AAML0531.

    Science.gov (United States)

    Voigt, Andrew P; Eidenschink Brodersen, Lisa; Alonzo, Todd A; Gerbing, Robert B; Menssen, Andrew J; Wilson, Elisabeth R; Kahwash, Samir; Raimondi, Susana C; Hirsch, Betsy A; Gamis, Alan S; Meshinchi, Soheil; Wells, Denise A; Loken, Michael R

    2017-09-07

    Diagnostic biomarkers can be used to determine relapse risk in acute myeloid leukemia, and certain genetic aberrancies have prognostic relevance. A diagnostic immunophenotypic expression profile, which quantifies the amounts of distinct gene products, not just their presence or absence, was established to improve outcome prediction for patients with acute myeloid leukemia. The immunophenotypic expression profile, which defines each patient's leukemia as a location in 15-dimensional space, was generated for 769 patients enrolled in the Children's Oncology Group AAML0531 protocol. Unsupervised hierarchical clustering grouped patients with similar immunophenotypic expression profiles into eleven patient cohorts, demonstrating high associations among phenotype, genotype, morphology, and outcome. Of 95 patients with inv(16), 79% segregated in Cluster A. Of 109 patients with t(8;21), 92% segregated in Clusters A and B. Of 152 patients with 11q23 alterations, 78% segregated in Clusters D, E, F, G, or H. For both inv(16) and 11q23 abnormalities, differential phenotypic expression identified patient groups with different survival characteristics (P<0.05). Clinical outcome analysis revealed that Cluster B (predominantly t(8;21)) was associated with favorable outcome (P<0.001) and Clusters E, G, H, and K were associated with adverse outcomes (P<0.05). Multivariable regression analysis revealed that Clusters E, G, H, and K were independently associated with worse survival (P range <0.001 to 0.008). The Children's Oncology Group AAML0531 trial is registered at www.clinicaltrials.gov as NCT00372593. Copyright © 2017, Ferrata Storti Foundation.

  9. The role of prophylactic cranial irradiation in regionally advanced non-small cell lung cancer. A Southwest Oncology Group Study

    Energy Technology Data Exchange (ETDEWEB)

    Rusch, V.W.; Griffin, B.R.; Livingston, R.B. (Univ. of Washington, Seattle (USA))

    1989-10-01

    Lung cancer is the most common malignant disease in the United States. Only the few tumors detected very early are curable, but there has been some progress in the management of more advanced non-small cell lung cancer, particularly in regionally inoperable disease. Prevention of central nervous system relapse is an important issue in this group of patients because brain metastases ultimately develop in 20% to 25% of them. Seventy-three patients with regionally advanced non-small cell lung cancer were entered into a Phase II trial of neutron chest radiotherapy sandwiched between four cycles of chemotherapy including cisplatin, vinblastine, and mitomycin C. Prophylactic cranial irradiation was administered concurrently with chest radiotherapy (3000 cGy in 10 fractions in 15 patients; 3600 cGy in 18 fractions in the remaining 50 patients). Patients underwent computed tomographic scan of the brain before treatment and every 3 months after treatment. The initial overall response rate was 79%, but 65 of the 73 patients have subsequently died of recurrent disease. Median follow-up is 9 months for all 73 patients and 26 months for eight long-term survivors. No patient who completed the prophylactic cranial irradiation program had clinical or radiologic brain metastases. Toxic reactions to prophylactic cranial irradiation included reversible alopecia in all patients, progressive dementia in one patient, and possible optic neuritis in one patient. Both of these patients received 300 cGy per fraction of irradiation. The use of prophylactic cranial irradiation has been controversial, but its safety and efficacy in this trial supports its application in a group of patients at high risk for central nervous system relapse. Further evaluation of prophylactic cranial irradiation in clinical trials for regionally advanced non-small cell lung cancer is warranted.

  10. Background field functional renormalization group for absorbing state phase transitions.

    Science.gov (United States)

    Buchhold, Michael; Diehl, Sebastian

    2016-07-01

    We present a functional renormalization group approach for the active to inactive phase transition in directed percolation-type systems, in which the transition is approached from the active, finite density phase. By expanding the effective potential for the density field around its minimum, we obtain a background field action functional, which serves as a starting point for the functional renormalization group approach. Due to the presence of the background field, the corresponding nonperturbative flow equations yield remarkably good estimates for the critical exponents of the directed percolation universality class, even in low dimensions.

  11. Modern Radiation Therapy for Nodal Non-Hodgkin Lymphoma—Target Definition and Dose Guidelines From the International Lymphoma Radiation Oncology Group

    DEFF Research Database (Denmark)

    Illidge, Tim; Specht, Lena; Yahalom, Joachim

    2014-01-01

    Radiation therapy (RT) is the most effective single modality for local control of non-Hodgkin lymphoma (NHL) and is an important component of therapy for many patients. Many of the historic concepts of dose and volume have recently been challenged by the advent of modern imaging and RT planning...... tools. The International Lymphoma Radiation Oncology Group (ILROG) has developed these guidelines after multinational meetings and analysis of available evidence. The guidelines represent an agreed consensus view of the ILROG steering committee on the use of RT in NHL in the modern era. The roles...... of reduced volume and reduced doses are addressed, integrating modern imaging with 3-dimensional planning and advanced techniques of RT delivery. In the modern era, in which combined-modality treatment with systemic therapy is appropriate, the previously applied extended-field and involved-field RT...

  12. Insufficiency Fractures After Pelvic Radiation Therapy for Uterine Cervical Cancer: An Analysis of Subjects in a Prospective Multi-institutional Trial, and Cooperative Study of the Japan Radiation Oncology Group (JAROG) and Japanese Radiation Oncology Study Group (JROSG)

    Energy Technology Data Exchange (ETDEWEB)

    Tokumaru, Sunao, E-mail: tokumaru@cc.saga-u.ac.jp [Department of Heavy Particle Therapy and Radiation Oncology, Saga University, Saga (Japan); Toita, Takafumi [Department of Radiology, Graduate School of Medical Science, University of the Ryukyus, Okinawa (Japan); Oguchi, Masahiko [Radiation Oncology Department, Cancer Institute Hospital, Japanese Foundation for Cancer Research, Tokyo (Japan); Ohno, Tatsuya [Gunma University Heavy Ion Medical Center, Maebashi (Japan); Kato, Shingo [Department of Radiation Oncology, Saitama Medical University, International Medical Center, Saitama (Japan); Niibe, Yuzuru [Department of Radiology, School of Medicine, Kitasato University, Sagamihara (Japan); Kazumoto, Tomoko [Department of Radiology, Saitama Cancer Center, Saitama (Japan); Kodaira, Takeshi [Department of Radiation Oncology, Aichi Cancer Center, Nagoya (Japan); Kataoka, Masaaki [Department of Radiology, National Shikoku Cancer Center, Matsuyama (Japan); Shikama, Naoto [Department of Radiation Oncology, Saitama Medical University, International Medical Center, Saitama (Japan); Kenjo, Masahiro [Department of Radiation Oncology, Graduate School of Medical Science, Hiroshima University, Hiroshima (Japan); Yamauchi, Chikako [Department of Radiation Oncology, Shiga Medical Center for Adults, Moriyama (Japan); Suzuki, Osamu [Department of Radiation Oncology, Osaka Medical Center for Cancer, Osaka (Japan); Sakurai, Hideyuki [Proton Medical Research Center and Tsukuba University, Tuskuba (Japan); Teshima, Teruki [Department of Medical Physics and Engineering, Graduate School of Medicine, Osaka University, Suita (Japan); Kagami, Yoshikazu [Department of Radiology, Showa University School of Medicine, Tokyo (Japan); Nakano, Takashi [Department of Radiation Oncology, Gunma University, Graduate School of Medicine, Maebashi (Japan); Hiraoka, Masahiro [Department of Radiation Oncology and Image-applied Therapy, Kyoto University, Graduate School of Medicine, Kyoto (Japan); and others

    2012-10-01

    Purpose: To investigate pelvic insufficiency fractures (IF) after definitive pelvic radiation therapy for early-stage uterine cervical cancer, by analyzing subjects of a prospective, multi-institutional study. Materials and Methods: Between September 2004 and July 2007, 59 eligible patients were analyzed. The median age was 73 years (range, 37-84 years). The International Federation of Gynecologic Oncology and Obstetrics stages were Ib1 in 35, IIa in 12, and IIb in 12 patients. Patients were treated with the constant method, which consisted of whole-pelvic external-beam radiation therapy of 50 Gy/25 fractions and high-dose-rate intracavitary brachytherapy of 24 Gy/4 fractions without chemotherapy. After radiation therapy the patients were evaluated by both pelvic CT and pelvic MRI at 3, 6, 12, 18, and 24 months. Diagnosis of IF was made when the patients had both CT and MRI findings, neither recurrent tumor lesions nor traumatic histories. The CT findings of IF were defined as fracture lines or sclerotic linear changes in the bones, and MRI findings of IF were defined as signal intensity changes in the bones, both on T1- and T2-weighted images. Results: The median follow-up was 24 months. The 2-year pelvic IF cumulative occurrence rate was 36.9% (21 patients). Using Common Terminology Criteria for Adverse Events version 3.0, grade 1, 2, and 3 IF were seen in 12 (21%), 6 (10%), and 3 patients (5%), respectively. Sixteen patients had multiple fractures, so IF were identified at 44 sites. The pelvic IF were frequently seen at the sacroileal joints (32 sites, 72%). Nine patients complained of pain. All patients' pains were palliated by rest or non-narcotic analgesic drugs. Higher age (>70 years) and low body weight (<50 kg) were thought to be risk factors for pelvic IF (P=.007 and P=.013, Cox hazard test). Conclusions: Cervical cancer patients with higher age and low body weight may be at some risk for the development of pelvic IF after pelvic radiation therapy.

  13. Interobserver Variability in Target Definition for Hepatocellular Carcinoma With and Without Portal Vein Thrombus: Radiation Therapy Oncology Group Consensus Guidelines

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Theodore S., E-mail: tshong1@mgh.harvard.edu [Department of Radiation Oncology, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts (United States); Bosch, Walter R. [Department of Radiation Oncology, Washington University in St. Louis School of Medicine, St. Louis, Missouri (United States); Krishnan, Sunil [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Kim, Tae K. [Department of Medical Imaging, University Health Network, Mount Sinai Hospital and Women' s College Hospital, University of Toronto, Toronto, Ontario (Canada); Mamon, Harvey J. [Department of Radiation Oncology, Dana-Farber Cancer Institute/Brigham and Women' s Hospital and Harvard Medical School, Boston, Massachusetts (United States); Shyn, Paul [Department of Radiology, Brigham and Women' s Hospital and Harvard Medical School, Boston, Massachusetts (United States); Ben-Josef, Edgar [Department of Radiation Oncology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania (United States); Seong, Jinsil [Department of Radiation Oncology, Yonsei University Medical College, Seoul (Korea, Republic of); Haddock, Michael G. [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Cheng, Jason C. [Department of Oncology, National Taiwan University Hospital, Taipei, Taiwan (China); Feng, Mary U. [Department of Radiation Oncology, University of Michigan Health System, Ann Arbor, Michigan (United States); Stephans, Kevin L. [Department of Radiation Oncology, Cleveland Clinic, Cleveland, Ohio (United States); Roberge, David [Department of Radiation Oncology, Montreal General Hospital/McGill University Health Centre, Montreal, Quebec (Canada); Crane, Christopher [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); and others

    2014-07-15

    Purpose: Defining hepatocellular carcinoma (HCC) gross tumor volume (GTV) requires multimodal imaging, acquired in different perfusion phases. The purposes of this study were to evaluate the variability in contouring and to establish guidelines and educational recommendations for reproducible HCC contouring for treatment planning. Methods and Materials: Anonymous, multiphasic planning computed tomography scans obtained from 3 patients with HCC were identified and distributed to a panel of 11 gastrointestinal radiation oncologists. Panelists were asked the number of HCC cases they treated in the past year. Case 1 had no vascular involvement, case 2 had extensive portal vein involvement, and case 3 had minor branched portal vein involvement. The agreement between the contoured total GTVs (primary + vascular GTV) was assessed using the generalized kappa statistic. Agreement interpretation was evaluated using Landis and Koch's interpretation of strength of agreement. The S95 contour, defined using the simultaneous truth and performance level estimation (STAPLE) algorithm consensus at the 95% confidence level, was created for each case. Results: Of the 11 panelists, 3 had treated >25 cases in the past year, 2 had treated 10 to 25 cases, 2 had treated 5 to 10 cases, 2 had treated 1 to 5 cases, 1 had treated 0 cases, and 1 did not respond. Near perfect agreement was seen for case 1, and substantial agreement was seen for cases 2 and 3. For case 2, there was significant heterogeneity in the volume identified as tumor thrombus (range 0.58-40.45 cc). For case 3, 2 panelists did not include the branched portal vein thrombus, and 7 panelists contoured thrombus separately from the primary tumor, also showing significant heterogeneity in volume of tumor thrombus (range 4.52-34.27 cc). Conclusions: In a group of experts, excellent agreement was seen in contouring total GTV. Heterogeneity exists in the definition of portal vein thrombus that may impact treatment

  14. Evaluation of the prevalence of burnout and psychological morbidity among radiation oncologist members of the Kyoto Radiation Oncology Study Group (KROSG).

    Science.gov (United States)

    Mampuya, Wambaka Ange; Matsuo, Yukinori; Nakamura, Akira; Hiraoka, Masahiro

    2017-03-01

    This study aimed to evaluate the self-reported prevalence of burnout and psychological morbidity among radiation oncologists members of the Kyoto Radiation Oncology Study Group (KROSG) and to identify factors contributing to burnout. We mailed an anonymous survey to 125 radiation oncologists members of the KROSG. The survey included; the demographic data, the Maslach Burnout Inventory - Human Services Survey (MBI-HSS) and the 12-item General Health Questionnaire (GHQ-12). There were 87 responses out of 125 eligible respondents (69.6% response rate). In terms of burnout, three participants (3.4%) fulfilled the MBI-HSS criteria of having simultaneously high emotional exhaustion (EE), high depersonalization (DP) and low sense of personal accomplishment (PA). Eighteen (20.6%) reported a high score for either EE or DP meeting the alternative criteria for burnout with three of these simultaneously having high EE and high DP. The prevalence of psychological morbidity estimated using GHQ-12 was 32%. A high level of EE and low level of PA significantly correlated with high level of psychological morbidity with P burnout. This is the first study investigating the prevalence of burnout and psychological morbidity among radiation oncologists in Japan. Compared with other studies involving radiation oncologists, the prevalence of low personal accomplishment was particularly high in the present study. The prevalence of psychological morbidity was almost the double that of the Japanese general population and was significantly associated with low PA and high EE. © The Author 2016. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  15. Solving the Christoffel equation: Phase and group velocities

    Science.gov (United States)

    Jaeken, Jan W.; Cottenier, Stefaan

    2016-10-01

    We provide christoffel, a Python tool for calculating direction-dependent phase velocities, polarization vectors, group velocities, power flow angles and enhancement factors based on the stiffness tensor of a solid. It is built in a modular way to allow for efficient and flexible calculations, and the freedom to select and combine results as desired. All derivatives are calculated analytically, which circumvents possible numerical sampling problems. GNUPlot scripts are provided for convenient visualization.

  16. Phase analysis of sunspot group numbers on both solar hemispheres

    Institute of Scientific and Technical Information of China (English)

    Lin-Hua Deng; Zhong-Quan Qu; Xiao-Li Yan; Kai-Rang Wang

    2013-01-01

    Cross-correlation analysis and wavelet transform methods are proposed to investigate the phase relationship between the monthly sunspot group numbers in the solar northern and southern hemispheres.It is found that (1) the monthly sunspot group numbers in the northern hemisphere begin two months earlier than those in the southern one,which should lead to phase asynchrony between them but with a slight effect; (2) the Schwabe cycle length for the monthly sunspot group numbers in the two hemispheres obviously differs from each other,and the mean Schwabe cycle length of the monthly sunspot group numbers in the northern hemisphere is slightly larger than that in the southern one; (3) the monthly sunspot group numbers in the northern hemisphere precede those in the southern hemisphere during the years of about 1874-1927,after which,the southern hemisphere leads the northern hemisphere in the years 1928-1964,and then the northern hemisphere leads in time till the present.

  17. Perceived roles of oncology nursing.

    Science.gov (United States)

    Lemonde, Manon; Payman, Naghmeh

    2015-01-01

    The Canadian Association of Nurses in Oncology (CANO) Standards of Care (2001) provides a framework that delineates oncology nursing roles and responsibilities. The purpose of this study was to explore how oncology nurses perceive their roles and responsibilities compared to the CANO Standards of Care. Six focus groups were conducted and 21 registered nurses (RNs) from a community-based hospital participated in this study. Transcripts were analyzed using qualitative inductive content analysis. Three themes were identified: (1) Oncology nurses perceive a gap between their defined roles and the reality of daily practice, as cancer care becomes more complex and as they provide advanced oncology care to more patients while there is no parallel adaptation to the health care system to support them, such as safe staffing; (2) Oncology nursing, as a specialty, requires sustained professional development and leadership roles; and (3) Oncology nurses are committed to providing continuous care as a reference point in the health care team by fostering interdisciplinary collaboration andfacilitating patient's navigation through the system. Organizational support through commitment to appropriate staffing and matching scope ofpractice to patient needs may lead to maximize the health and well-being of nurses, quality of patient care and organizational performance.

  18. Body mass index and its association with clinical outcomes for advanced non-small-cell lung cancer patients enrolled on Eastern Cooperative Oncology Group clinical trials.

    Science.gov (United States)

    Dahlberg, Suzanne E; Schiller, Joan H; Bonomi, Philip B; Sandler, Alan B; Brahmer, Julie R; Ramalingam, Suresh S; Johnson, David H

    2013-09-01

    Obesity increases the risk of death from many adverse health outcomes and has also been linked with cancer outcomes. The impact of obesity on outcomes of advanced non-small-cell lung cancer patients is unclear. The authors evaluated the association of body mass index (BMI) and outcomes in 2585 eligible patients enrolled in three consecutive first-line trials conducted by the Eastern Cooperative Oncology Group. BMI was categorized as underweight (BMI obese (BMI ≥ 30 kg/m). In addition to analyzing overall and progression-free survival, reasons for treatment discontinuation were also assessed by BMI group. Of the patients enrolled, 4.6% were underweight, 44.1% were normal weight, 34.3% of patients were classified as overweight, and 16.9% were obese. Nonproportional hazards existed for obese patients relative to the other three groups of patients, with a change in overall survival hazard occurring at approximately 16 months. In multivariable Cox models, obese patients had superior outcomes earlier on study compared with normal/overweight patients 0.86 (HR=0.86, p=0.04; 95% CI: 0.75-0.99), but later experienced increased hazard (HR=1.54, p< 0.001; 95% CI: 1.22-1.94), indicating a time effect while undergoing treatment. Data from these three trials suggest differential outcomes associated with BMI, and additional studies of the mechanisms underlying this observation, as well as dietary and lifestyle interventions, are warranted to help optimize therapy.

  19. Local Control With Reduced-Dose Radiotherapy for Low-Risk Rhabdomyosarcoma: A Report From the Children's Oncology Group D9602 Study

    Energy Technology Data Exchange (ETDEWEB)

    Breneman, John, E-mail: john.breneman@uchealth.com [Department of Radiation Oncology, University of Cincinnati and Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Meza, Jane [Department of Biostatistics, University of Nebraska Medical Center College of Public Health, Omaha, NE (United States); Donaldson, Sarah S. [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, CA (United States); Raney, R. Beverly [Children' s Cancer Hospital and Division of Pediatrics, University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); Children' s Ambulatory Blood and Cancer Center, Dell Children' s Medical Center of Central Texas, Austin, TX (United States); Wolden, Suzanne [Department of Radiation Oncology, Memorial Sloan Kettering Cancer Center, New York, NY (United States); Michalski, Jeff [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Laurie, Fran [Quality Assurance Review Center, Lincoln, RI (United States); Rodeberg, David A. [Department of Surgery, East Carolina University, Greenville, NC (United States); Meyer, William [Section of Pediatric Hematology/Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Walterhouse, David [Division of Hematology/Oncology, Children' s Memorial Medical Center, Chicago, IL (United States); Hawkins, Douglas S. [Department of Pediatrics, Seattle Children' s Hospital, University of Washington, Seattle, WA (United States)

    2012-06-01

    Purpose: To analyze the effect of reduced-dose radiotherapy on local control in children with low-risk rhabdomyosarcoma (RMS) treated in the Children's Oncology Group D9602 study. Methods and Materials: Patients with low-risk RMS were nonrandomly assigned to receive radiotherapy doses dependent on the completeness of surgical resection of the primary tumor (clinical group) and the presence of involved regional lymph nodes. After resection, most patients with microscopic residual and uninvolved nodes received 36 Gy, those with involved nodes received 41.4 to 50.4 Gy, and those with orbital primary tumors received 45 Gy. All patients received vincristine and dactinomycin, with cyclophosphamide added for patient subsets with a higher risk of relapse in Intergroup Rhabdomyosarcoma Study Group III and IV studies. Results: Three hundred forty-two patients were eligible for analysis; 172 received radiotherapy as part of their treatment. The cumulative incidence of local/regional failure was 15% in patients with microscopic involved margins when cyclophosphamide was not part of the treatment regimen and 0% when cyclophosphamide was included. The cumulative incidence of local/regional failure was 14% in patients with orbital tumors. Protocol-specified omission of radiotherapy in girls with Group IIA vaginal tumors (n = 5) resulted in three failures for this group. Conclusions: In comparison with Intergroup Rhabdomyosarcoma Study Group III and IV results, reduced-dose radiotherapy does not compromise local control for patients with microscopic tumor after surgical resection or with orbital primary tumors when cyclophosphamide is added to the treatment program. Girls with unresected nonbladder genitourinary tumors require radiotherapy for postsurgical residual tumor for optimal local control to be achieved.

  20. Predictors of mother and child DNA yields in buccal cell samples collected in pediatric cancer epidemiologic studies: a report from the Children's Oncology group.

    Science.gov (United States)

    Poynter, Jenny N; Ross, Julie A; Hooten, Anthony J; Langer, Erica; Blommer, Crystal; Spector, Logan G

    2013-08-12

    Collection of high-quality DNA is essential for molecular epidemiology studies. Methods have been evaluated for optimal DNA collection in studies of adults; however, DNA collection in young children poses additional challenges. Here, we have evaluated predictors of DNA quantity in buccal cells collected for population-based studies of infant leukemia (N = 489 mothers and 392 children) and hepatoblastoma (HB; N = 446 mothers and 412 children) conducted through the Children's Oncology Group. DNA samples were collected by mail using mouthwash (for mothers and some children) and buccal brush (for children) collection kits and quantified using quantitative real-time PCR. Multivariable linear regression models were used to identify predictors of DNA yield. Median DNA yield was higher for mothers in both studies compared with their children (14 μg vs. mothers or children in this analysis. The association with seasonality suggests that conditions during transport may influence DNA yield. The low yields observed in most children in these studies highlight the importance of developing alternative methods for DNA collection in younger age groups.

  1. Preliminary Toxicity Analysis of 3-Dimensional Conformal Radiation Therapy Versus Intensity Modulated Radiation Therapy on the High-Dose Arm of the Radiation Therapy Oncology Group 0126 Prostate Cancer Trial

    Energy Technology Data Exchange (ETDEWEB)

    Michalski, Jeff M., E-mail: jmichalski@radonc.wustl.edu [Department of Radiation Oncology Washington University Medical Center, St. Louis, Missouri (United States); Yan, Yan [Radiation Therapy Oncology Group Statistical Center, Philadelphia, Pennsylvania (United States); Watkins-Bruner, Deborah [Emory University School of Nursing, Atlanta, Georgia (United States); Bosch, Walter R. [Department of Radiation Oncology Washington University Medical Center, St. Louis, Missouri (United States); Winter, Kathryn [Radiation Therapy Oncology Group Statistical Center, Philadelphia, Pennsylvania (United States); Galvin, James M. [Department of Radiation Oncology Thomas Jefferson University Hospital, Philadelphia, Pennsylvania (United States); Bahary, Jean-Paul [Department of Radiation Oncology Centre Hospitalier de l' Université de Montréal-Notre Dame, Montreal, QC (Canada); Morton, Gerard C. [Department of Radiation Oncology Toronto-Sunnybrook Regional Cancer Centre, Toronto, ON (Canada); Parliament, Matthew B. [Department of Oncology Cross Cancer Institute, Edmonton, AB (Canada); Sandler, Howard M. [Department of Radiation Oncology Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, California (United States)

    2013-12-01

    Purpose: To give a preliminary report of clinical and treatment factors associated with toxicity in men receiving high-dose radiation therapy (RT) on a phase 3 dose-escalation trial. Methods and Materials: The trial was initiated with 3-dimensional conformal RT (3D-CRT) and amended after 1 year to allow intensity modulated RT (IMRT). Patients treated with 3D-CRT received 55.8 Gy to a planning target volume that included the prostate and seminal vesicles, then 23.4 Gy to prostate only. The IMRT patients were treated to the prostate and proximal seminal vesicles to 79.2 Gy. Common Toxicity Criteria, version 2.0, and Radiation Therapy Oncology Group/European Organization for Research and Treatment of Cancer late morbidity scores were used for acute and late effects. Results: Of 763 patients randomized to the 79.2-Gy arm of Radiation Therapy Oncology Group 0126 protocol, 748 were eligible and evaluable: 491 and 257 were treated with 3D-CRT and IMRT, respectively. For both bladder and rectum, the volumes receiving 65, 70, and 75 Gy were significantly lower with IMRT (all P<.0001). For grade (G) 2+ acute gastrointestinal/genitourinary (GI/GU) toxicity, both univariate and multivariate analyses showed a statistically significant decrease in G2+ acute collective GI/GU toxicity for IMRT. There were no significant differences with 3D-CRT or IMRT for acute or late G2+ or 3+ GU toxicities. Univariate analysis showed a statistically significant decrease in late G2+ GI toxicity for IMRT (P=.039). On multivariate analysis, IMRT showed a 26% reduction in G2+ late GI toxicity (P=.099). Acute G2+ toxicity was associated with late G3+ toxicity (P=.005). With dose–volume histogram data in the multivariate analysis, RT modality was not significant, whereas white race (P=.001) and rectal V70 ≥15% were associated with G2+ rectal toxicity (P=.034). Conclusions: Intensity modulated RT is associated with a significant reduction in acute G2+ GI/GU toxicity. There is a trend for a

  2. XY-sliding phases - mirage of the Renormalization Group

    Science.gov (United States)

    Vayl, Steven; Kuklov, Anatoly; Oganesyan, Vadim

    The so called sliding XY phases in layered systems are predicted to occur if the one loop renormalization group (RG) flow renders the interlayer Josephson coupling irrelevant, while each layer still features broken U(1) symmetry. In other words, such a layered system remains essentially two-dimensional despite the presence of inter-layer Josephson coupling. We have analyzed numerically a layered system consisting of groups of asymmetric layers where the RG analysis predicts sliding phases to occur. Monte Carlo simulations of such a system have been conducted in the dual representation by Worm Algorithm in terms of the closed loops of J-currents for layer sizes varying from 4 ×4 to 640 ×640 and the number of layers - from 2 to 40. The resulting flow of the inter-layer XY-stiffness has been found to be inconsistent with the RG prediction and fully consistent with the behavior of the 3D standard XY model where the bare inter-layer Josephson coupling is much smaller than the intra-layer stiffness. This result emphasizes the importance of the compactness of the U(1) variable for 2D to 3D transformation. This work was supported by the NSF Grant PHY1314469.

  3. Modern Radiation Therapy for Nodal Non-Hodgkin Lymphoma—Target Definition and Dose Guidelines From the International Lymphoma Radiation Oncology Group

    Energy Technology Data Exchange (ETDEWEB)

    Illidge, Tim, E-mail: Tim.Illidge@ics.manchester.ac.uk [Institute of Cancer Sciences, University of Manchester, Manchester Academic Health Sciences Centre, The Christie National Health Service Foundation Trust, Manchester (United Kingdom); Specht, Lena [Department of Oncology and Hematology, Rigshospitalet, University of Copenhagen, Copenhagen (Denmark); Yahalom, Joachim [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Aleman, Berthe [Department of Radiotherapy, The Netherlands Cancer Institute, Amsterdam (Netherlands); Berthelsen, Anne Kiil [Department of Radiation Oncology and PET Centre, Rigshospitalet, University of Copenhagen, Copenhagen (Denmark); Constine, Louis [Departments of Radiation Oncology and Pediatrics, James P. Wilmot Cancer Center, University of Rochester Medical Center, Rochester, New York (United States); Dabaja, Bouthaina [Division of Radiation Oncology, Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Dharmarajan, Kavita [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Ng, Andrea [Department of Radiation Oncology, Brigham and Women' s Hospital and Dana-Farber Cancer Institute, Harvard University, Boston, Massachusetts (United States); Ricardi, Umberto [Radiation Oncology Unit, Department of Oncology, University of Torino, Torino (Italy); Wirth, Andrew [Division of Radiation Oncology, Peter MacCallum Cancer Institute, St. Andrews Place, East Melbourne (Australia)

    2014-05-01

    Radiation therapy (RT) is the most effective single modality for local control of non-Hodgkin lymphoma (NHL) and is an important component of therapy for many patients. Many of the historic concepts of dose and volume have recently been challenged by the advent of modern imaging and RT planning tools. The International Lymphoma Radiation Oncology Group (ILROG) has developed these guidelines after multinational meetings and analysis of available evidence. The guidelines represent an agreed consensus view of the ILROG steering committee on the use of RT in NHL in the modern era. The roles of reduced volume and reduced doses are addressed, integrating modern imaging with 3-dimensional planning and advanced techniques of RT delivery. In the modern era, in which combined-modality treatment with systemic therapy is appropriate, the previously applied extended-field and involved-field RT techniques that targeted nodal regions have now been replaced by limiting the RT to smaller volumes based solely on detectable nodal involvement at presentation. A new concept, involved-site RT, defines the clinical target volume. For indolent NHL, often treated with RT alone, larger fields should be considered. Newer treatment techniques, including intensity modulated RT, breath holding, image guided RT, and 4-dimensional imaging, should be implemented, and their use is expected to decrease significantly the risk for normal tissue damage while still achieving the primary goal of local tumor control.

  4. Introduction of online adaptive radiotherapy for bladder cancer through a multicentre clinical trial (Trans-Tasman Radiation Oncology Group 10.01: Lessons learned

    Directory of Open Access Journals (Sweden)

    Daniel Pham

    2013-01-01

    Full Text Available Online adaptive radiotherapy for bladder cancer is a novel radiotherapy technique that was found feasible in a pilot study at a single academic institution. In September 2010 this technique was opened as a multicenter study through the Trans-Tasman Radiation Oncology Group (TROG 10.01 bladder online adaptive radiotherapy treatment. Twelve centers across Australia and New-Zealand registered interest into the trial. A multidisciplinary team of radiation oncologists, radiation therapists and medical physicists represented the trial credentialing and technical support team. To provide timely activation and proper implementation of the adaptive technique the following key areas were addressed at each site: Staff education/training; Practical image guided radiotherapy assessment; provision of help desk and feedback. The trial credentialing process involved face-to-face training and technical problem solving via full day site visits. A dedicated "help-desk" team was developed to provide support for the clinical trial. 26% of the workload occurred at the credentialing period while the remaining 74% came post-center activation. The workload was made up of the following key areas; protocol clarification (36%, technical problems (46% while staff training was less than 10%. Clinical trial credentialing is important to minimizing trial deviations. It should not only focus on site activation quality assurance but also provide ongoing education and technical support.

  5. Randomized use of cyclosporin A (CsA) to modulate P-glycoprotein in children with AML in remission: Pediatric Oncology Group Study 9421

    Science.gov (United States)

    Becton, David; Dahl, Gary V.; Ravindranath, Yaddanapudi; Chang, Myron N.; Behm, Fred G.; Raimondi, Susana C.; Head, David R.; Stine, Kimo C.; Lacayo, Norman J.; Sikic, Branimir Ivan; Arceci, Robert J.; Weinstein, Howard

    2006-01-01

    Relapse is a major obstacle in the cure of acute myeloid leukemia (AML). The Pediatric Oncology Group AML Study 9421 tested 2 different strategies to improve event-free survival (EFS) and overall survival (OS). Patients were randomized to receive standard-dose DAT (daunorubicin, cytarabine, and thioguanine) or high-dose DAT during induction. To interfere with P-glycoprotein (P-gp)-dependent drug efflux, the second randomization tested the benefit of cyclosporine (CsA) added to consolidation chemotherapy. Of the 282 children randomly assigned to receive standard DAT induction, 248 (87.9%) achieved remission compared to 253 (91%) of the 278 receiving high-dose DAT (P = ns). Children with HLA-identical sibling donors who achieved a complete remission received an allogeneic bone marrow transplant as consolidation. For the 83 patients receiving a matched related donor bone marrow transplantation (BMT), the 3-year disease-free survival (DFS) is 67%. Of the 418 children who achieved remission and went on to consolidation with and without CsA, the DFS was 40.6% and 33.9%, respectively (P = .24). Overexpression of P-gp was infrequent (14%) in this pediatric population. In this study, intensifying induction with high-dose DAT and the addition of CsA to consolidation chemotherapy did not prolong the durations of remission or improve overall survival for children with AML. PMID:16254147

  6. Presurgical chemotherapy compared with immediate surgery and adjuvant chemotherapy for nonmetastatic osteosarcoma: Pediatric Oncology Group Study POG-8651.

    Science.gov (United States)

    Goorin, Allen M; Schwartzentruber, Douglas J; Devidas, Meenakshi; Gebhardt, Mark C; Ayala, Alberto G; Harris, Michael B; Helman, Lee J; Grier, Holcombe E; Link, Michael P

    2003-04-15

    Successful therapeutic interventions to prevent disease progression in patients with nonmetastatic osteosarcoma have included surgery with adjuvant chemotherapy. Presurgical chemotherapy has been advocated for these patients because of putative improvement in event-free survival (EFS). The advantages of presurgical chemotherapy include early administration of systemic chemotherapy, shrinkage of primary tumor, and pathologic identification of risk groups. The theoretic disadvantage is that it exposes a large tumor burden to marginally effective chemotherapy. The contribution of chemotherapy and surgery timing has not been tested rigorously. Between 1986 and 1993, we conducted a prospective trial in patients with nonmetastatic osteosarcoma who were assigned randomly to immediate surgery or presurgical chemotherapy. Except for the timing of surgery (week 0 or 10), patients received 44 weeks of identical combination chemotherapy that included high-dose methotrexate with leucovorin rescue, doxorubicin, cisplatin, bleomycin, cyclophosphamide, and dactinomycin. One hundred six patients were enrolled onto this study. Six were excluded from analysis. Of the remaining 100 patients, 45 were randomly assigned to immediate chemotherapy, and 55 were randomly assigned to immediate surgery. Sixty-seven patients remain disease-free. At 5 years, the projected EFS +/- SE is 65% +/- 6% (69% +/- 8% for immediate surgery and 61% +/- 8% for presurgical chemotherapy; P =.8). The treatment arms had similar incidence of limb salvage (55% for immediate surgery and 50% for presurgical chemotherapy). Chemotherapy was effective in both treatment groups. There was no advantage in EFS for patients given presurgical chemotherapy.

  7. Age, Tumor Characteristics, and Treatment Regimen as Event Predictors in Ewing: A Children’s Oncology Group Report

    Directory of Open Access Journals (Sweden)

    Neyssa Marina

    2015-01-01

    Full Text Available Purpose. To associate baseline patient characteristics and relapse across consecutive COG studies. Methods. We analyzed risk factors for LESFT patients in three randomized COG trials. We evaluated age at enrollment, primary site, gender, tumor size, and treatment (as randomized. We estimated event-free survival (EFS, Kaplan-Meier and compared risk across groups (log-rank test. Characteristics were assessed by proportional hazards regression with the characteristic of interest as the only component. Confidence intervals (CI for RR were derived. Factors related to outcome at level 0.05 were included in a multivariate regression model. Results. Between 12/1988 and 8/2005, 1444 patients were enrolled and data current to 2001, 2004, or 2008 were used. Patients were with a median age of 12 years (0–45, 55% male and 88% Caucasian. The 5-year EFS was 68.3% ± 1.3%. In univariate analysis age, treatment, and tumor location were identified for inclusion in the multivariate model, and all remained significant (p 18 years, pelvic tumor, size > 8 cms, and chemotherapy without ifosfamide/etoposide significantly predict worse outcome. AEWS0031 is NCT00006734, INT0091 and INT0054 designed before 1993 (unregistered.

  8. Validation of a multi-modal treatment protocol for Ewing sarcoma--a report from the polish pediatric oncology group.

    Science.gov (United States)

    Raciborska, Anna; Bilska, Katarzyna; Drabko, Katarzyna; Chaber, Radosław; Sobol, Grażyna; Pogorzała, Monika; Wyrobek, Elżbieta; Połczyńska, Katarzyna; Rogowska, Elżbieta; Rodriguez-Galindo, Carlos; Wożniak, Wojciech

    2014-12-01

    Ewing sarcoma (ES) is the second most common paediatric malignant bone tumor. Advances in multi-disciplinary care have resulted in significant improvement in cure rates over the last decades. However, the generalization of those results in countries traditionally excluded from large cooperative trials has yet to be demonstrated. We report the results of modern multi-disciplinary care for patients with ES in Poland. One hundred and thirty-two patients with ES were treated using modern multi-modal therapy during the period 2000-2009. Overall survival was estimated by Kaplan-Meier methods and compared using long-rank test and Cox models. Factors predictive of outcome in our setting were analyzed to identify distinct risk groups that could help identify areas for improvement. The median age at the time of diagnosis was 12.3 years. With a median follow-up of 5.0 years, the 5-year event-free survival (EFS) and OS estimates for localized disease were 54.88% and 68.29%, respectively. For patients with metastatic disease, 5-year EFS and OS estimates were 36% and 42%, respectively. There was no correlation between age and stage or site. Patients with localized, non-pelvic disease had better outcome than patients with axial tumors (71% vs. 44%, respectively, P = 0.00073). Treatment failure was associated with stage, pelvic primary, poor histological response, and type of local control. Successful treatment of ES requires optimal systemic and local therapy. We were able to replicate the results of modern multi-modal protocols. Validation of current treatment protocols in countries with more limited cancer treatment resources is required. © 2014 Wiley Periodicals, Inc.

  9. Impact of treatment in long-term survival patients with follicular lymphoma: A Spanish Lymphoma Oncology Group registry

    Science.gov (United States)

    Provencio, Mariano; Sabín, Pilar; Gomez-Codina, Jose; Calvo, Virginia; Llanos, Marta; Gumá, Josep; Quero, Cristina; Blasco, Ana; Cruz, Miguel Angel; Aguiar, David; García-Arroyo, Francisco; Lavernia, Javier; Martinez, Natividad; Morales, Manuel; Saez-Cusi, Alvaro; Rodriguez, Delvys; de la Cruz, Luis; Sanchez, Jose Javier; Rueda, Antonio

    2017-01-01

    Background Follicular lymphoma is the second most common non-Hodgkin lymphoma in the United States and Europe. However, most of the prospective randomized studies have very little follow-up compared to the long natural history of the disease. The primary aim of this study was to investigate the long-term survival of our series of patients with follicular lymphoma. Patients and methods A total of 1074 patients with newly diagnosed FL were enrolled. Patients diagnosed were prospectively enrolled from 1980 to 2013. Results Median follow-up was 54.9 months and median overall survival is over 20 years in our series. We analyzed the patients who are still alive beyond 10 years from diagnosis in order to fully assess the prognostic factors that condition this group. Out of 166 patients who are still alive after more than 10 years of follow-up, 118 of them (73%) are free of evident clinical disease. Variables significantly associated with survival at 10 years were stage < II (p <0.03), age < 60 years (p <0.0001), low FLIPI (p <0.002), normal β2 microglobulin (p <0.005), no B symptoms upon diagnosis (p <0.02), Performance Status 0–1 (p <0.03) and treatment with anthracyclines and rituximab (p <0.001), or rituximab (p <0.0001). Conclusions A longer follow-up and a large series demonstrated a substantial population of patients with follicular lymphoma free of disease for more than 10 years. PMID:28493986

  10. Collaborative Pediatric Bone Tumor Program to Improve Access to Specialized Care: An Initiative by the Lebanese Children's Oncology Group.

    Science.gov (United States)

    Saab, Raya; Merabi, Zeina; Abboud, Miguel R; Muwakkit, Samar; Noun, Peter; Gemayel, Gladys; Bechara, Elie; Khalifeh, Hassan; Farah, Roula; Kabbara, Nabil; El-Khoury, Tarek; Al-Yousef, Rasha; Haidar, Rachid; Saghieh, Said; Eid, Toufic; Akel, Samir; Khoury, Nabil; Bayram, Layal; Krasin, Matthew J; Jeha, Sima; El-Solh, Hassan

    2017-02-01

    Children with malignant bone tumors have average 5-year survival rates of 60% to 70% with current multimodality therapy. Local control modalities aimed at preserving function greatly influence the quality of life of long-term survivors. In developing countries, the limited availability of multidisciplinary care and limited expertise in specialized surgery and pediatric radiation therapy, as well as financial cost, all form barriers to achieving optimal outcomes in this population. We describe the establishment of a collaborative pediatric bone tumor program among a group of pediatric oncologists in Lebanon and Syria. This program provides access to specialized local control at a tertiary children's cancer center to pediatric patients with newly diagnosed bone tumors at participating sites. Central review of pathology, staging, and treatment planning is performed in a multidisciplinary tumor board setting. Patients receive chemotherapy at their respective centers on a unified treatment plan. Surgery and/or radiation therapy are performed centrally by specialized staff at the children's cancer center. Cost barriers were resolved through a program development initiative led by St Jude Children's Research Hospital. Once program feasibility was achieved, the Children's Cancer Center of Lebanon Foundation, via fundraising efforts, provided continuation of program-directed funding. Findings over a 3-year period showed the feasibility of this project, with timely local control and protocol adherence at eight collaborating centers. We report success in providing standard-of-care multidisciplinary therapy to this patient population with complex needs and financially challenging surgical procedures. This initiative can serve as a model, noting that facilitating access to specialized multidisciplinary care, resolution of financial barriers, and close administrative coordination all greatly contributed to the success of the program.

  11. Quality assurance standards drive improvements in the profile of radiation therapy departments participating in trials of the EORTC Radiation Oncology Group.

    Science.gov (United States)

    Grant, Warren; Hurkmans, Coen W; Poortmans, Philip M; Maingon, Philippe; Monti, Angelo F; van Os, Marjolein J H; Weber, Damien C

    2014-09-01

    The Facility Questionnaire (FQ) of the European Organisation for Research and Treatment of Cancer Radiation Oncology Group (EORTC-ROG) evaluates the human, technical and organizational resources at each EORTC member institution. The purpose of this study is to use the FQ database to assess the improvement of radiation therapy (RT) structures and resources within the EORTC compared to the previous surveys performed by our group. We report the content of the current FQ database, completed online by 156 EORTC candidate member institutions from 22 countries between February 2011 and February 2013. Results are compared to FQ-published data from 1992 and 2007. The average number of patients per year per EORTC institution is 2381 (range 350-12,000) an 18.2% increase compared to the 2007 figures. From 2007 to 2013 the average number of radiation oncologists, physicists and radiation technologists per EORTC institution has increased by 27% (from 8.5 to 10.8), 41% (from 5.2 to 7.4) and 38% (from 26.1 to 36.1) respectively. Consequently the number of patients per year per radiation oncologist has decreased from 258 to 243, for physicists from 426 to 354 and for radiation technologists from 107 to 86. One hundred and forty-six (94%) and 101 (65%) institutions can now deliver IMRT and SBRT, compared to 77 (79%) and 53 (54%) in 2007. The standards set by the EORTC-ROG are met by a continually improving number of institutions, helping to safeguard use of advanced technologies in EORTC-ROG clinical trials. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Metabolic Tumor Volume as a Prognostic Imaging-Based Biomarker for Head-and-Neck Cancer: Pilot Results From Radiation Therapy Oncology Group Protocol 0522

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, David L., E-mail: david.schwartz@utsw.edu [Department of Radiation Oncology, University of Texas Southwestern School of Medicine, Dallas, Texas (United States); Harris, Jonathan [Radiation Therapy Oncology Group Statistical Center, Philadelphia, Pennsylvania (United States); Yao, Min [Department of Radiation Oncology, Case Western Reserve University School of Medicine, Cleveland, Ohio (United States); Rosenthal, David I. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Opanowski, Adam; Levering, Anthony [American College of Radiology Imaging Network, Philadelphia, Pennsylvania (United States); Ang, K. Kian [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Trotti, Andy M. [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, Florida (United States); Garden, Adam S. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Jones, Christopher U. [Sutter Medical Group, Sacramento, California (United States); Harari, Paul [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin (United States); Foote, Robert [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Holland, John [Department of Radiation Medicine, Oregon Health & Science University, Portland, Oregon (United States); Zhang, Qiang [Radiation Therapy Oncology Group Statistical Center, Philadelphia, Pennsylvania (United States); Le, Quynh-Thu [Department of Radiation Oncology, Stanford University School of Medicine, Palo Alto, California (United States)

    2015-03-15

    Purpose: To evaluate candidate fluorodeoxyglucose positron emission tomography/computed tomography (FDG-PET/CT) imaging biomarkers for head-and-neck chemoradiotherapy outcomes in the cooperative group trial setting. Methods and Materials: Radiation Therapy Oncology Group (RTOG) protocol 0522 patients consenting to a secondary FDG-PET/CT substudy were serially imaged at baseline and 8 weeks after radiation. Maximum standardized uptake value (SUVmax), SUV peak (mean SUV within a 1-cm sphere centered on SUVmax), and metabolic tumor volume (MTV) using 40% of SUVmax as threshold were obtained from primary tumor and involved nodes. Results: Of 940 patients entered onto RTOG 0522, 74 were analyzable for this substudy. Neither high baseline SUVmax nor SUVpeak from primary or nodal disease were associated with poor treatment outcomes. However, primary tumor MTV above the cohort median was associated with worse local-regional control (hazard ratio 4.01, 95% confidence interval 1.28-12.52, P=.02) and progression-free survival (hazard ratio 2.34, 95% confidence interval 1.02-5.37, P=.05). Although MTV and T stage seemed to correlate (mean MTV 6.4, 13.2, and 26.8 for T2, T3, and T4 tumors, respectively), MTV remained a strong independent prognostic factor for progression-free survival in bivariate analysis that included T stage. Primary MTV remained prognostic in p16-associated oropharyngeal cancer cases, although sample size was limited. Conclusion: High baseline primary tumor MTV was associated with worse treatment outcomes in this limited patient subset of RTOG 0522. Additional confirmatory work will be required to validate primary tumor MTV as a prognostic imaging biomarker for patient stratification in future trials.

  13. Are Radiation Therapy Oncology Group Para-aortic Contouring Guidelines for Pancreatic Neoplasm Applicable to Other Malignancies—Assessment of Nodal Distribution in Gynecological Malignancies

    Energy Technology Data Exchange (ETDEWEB)

    Kabolizadeh, Peyman; Fulay, Suyash; Beriwal, Sushil, E-mail: beriwals@upmc.edu

    2013-09-01

    Purpose: Intensity modulated radiation therapy is used to reduce dose to adjacent critical structures while maintaining adequate target coverage, but it requires precise target localization. We report the 3-dimensional distribution of para-aortic (PA) lymph nodes (LN) in pelvic malignancies. We propose a guideline to accurately define the PA LN by anatomic landmarks and compare our data with published guidelines for pancreatic cancer. Methods and Materials: A retrospective analysis was performed on 46 patients with pelvic malignancies and positive PA LNs. Positive LNs were defined based on size and morphology or fluorodeoxyglucose avidity. All PA LNs were characterized into 3 groups based on location: left PA (between aorta and left psoas muscle), aortocaval (between aorta and inferior vena cava), and right paracaval (between inferior vena cava and right psoas muscle). Patients with retrocrural LNs were also analyzed. Results: One hundred thirty-three positive PA LNs were evaluated. The majority of the PA LNs were in the left PA (59%) and aortocaval (35) regions, and only 8% were in the right paracaval region. All patients with positive right paracaval LNs also had involved left PA LNs, with only 1 exception. The highest PA LN involvement was at the level of the renal vessels and was seen in 28% of patients. Of these patients with disease extending to renal vessels, 38% had retrocrural LN involvement. Conclusions: The nodal contouring for the PA region should not be defined by a fixed circumferential margin around the vessels. The left PA and aortocaval spaces should be covered adequately because these are common locations of PA LNs. For microscopic disease superiorly, contouring should extend up to renal vessels rather than a fixed bony landmark. For patients who have nodal involvement at renal vessels, one can consider including retrocrural LNs. Radiation Therapy Oncology Group Para-aortic Contouring Guidelines for Pancreatic Neoplasm are not applicable to

  14. Superfluid phase transition with activated velocity fluctuations: Renormalization group approach.

    Science.gov (United States)

    Dančo, Michal; Hnatič, Michal; Komarova, Marina V; Lučivjanský, Tomáš; Nalimov, Mikhail Yu

    2016-01-01

    A quantum field model that incorporates Bose-condensed systems near their phase transition into a superfluid phase and velocity fluctuations is proposed. The stochastic Navier-Stokes equation is used for a generation of the velocity fluctuations. As such this model generalizes model F of critical dynamics. The field-theoretic action is derived using the Martin-Siggia-Rose formalism and path integral approach. The regime of equilibrium fluctuations is analyzed within the perturbative renormalization group method. The double (ε,δ)-expansion scheme is employed, where ε is a deviation from space dimension 4 and δ describes scaling of velocity fluctuations. The renormalization procedure is performed to the leading order. The main corollary gained from the analysis of the thermal equilibrium regime suggests that one-loop calculations of the presented models are not sufficient to make a definite conclusion about the stability of fixed points. We also show that critical exponents are drastically changed as a result of the turbulent background and critical fluctuations are in fact destroyed by the developed turbulence fluctuations. The scaling exponent of effective viscosity is calculated and agrees with expected value 4/3.

  15. Interaktiver Kleingruppenunterricht für Medizinstudenten der Klinischen Semester in einer onkologischen Gemeinschaftspraxis [Interactive medical education for medical students in an oncology group practice

    Directory of Open Access Journals (Sweden)

    Weide, Rudolf

    2007-02-01

    Full Text Available [english] Background: The education of medical students to become qualified medical doctors should be improved in Germany. Reasons for this are medical teachers not properly trained in education, a lack of quality control and low esteem of medical education, too large groups, no intensive relationship between students and academic teachers and the triad for medical teachers at university hospitals to qualify in their discipline, to perform science and lecture medical students. At the same time experienced associate professors who left university are not integrated optimally in medical education programs. Pilotproject: Since 1998 we are performing weekend seminars for advanced medical students. 3 students are educated by 1 teacher. The topics of the training are differential diagnosis of anaemia, polyglobulinaemia, leukocytopenia, leukocytosis, thrombocytopenia, thrombocytosis, training in morphology, diagnosis and treatment of leukaemia and lymphoma and principles of communication skills. Patient cases are presented in a problem oriented learning manner using patient files, a video microscope and a computer based learning programme for interactive purposes.Results: So far 320 students have participated in our seminars. Systematic quality evaluation of the teaching reveals excellent marks for practical relevance, learning atmosphere, didactics and effectiveness. Impressions of the routine work in an oncology group practice widens the experience of the students.Conclusion: Academical training for medical students is feasable and successful in an oncology group practice. This teaching model enables external associate professors to give their education in the environment where they are working and may relieve the University personally and financially.[german] Hintergrund: Die Ausbildung von Medizinstudenten zu guten Ärzten ist in Deutschland verbesserungsbedürftig. Die Gründe für ein suboptimales Studium sind die häufig fehlende Vernetzung von

  16. Comparison of diagnostic performance of CT and MRI for abdominal staging of pediatric renal tumors: a report from the Children's Oncology Group

    Energy Technology Data Exchange (ETDEWEB)

    Servaes, Sabah [Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); Khanna, Geetika [Washington University School of Medicine, Pediatric Radiology, St. Louis Children' s Hospital, Mallinckrodt Institute for Radiology, 510 S. Kingshighway, Campus Box 8131-MIR, St. Louis, MO (United States); Naranjo, Arlene [University of Florida, Department of Biostatistics, Gainesville, FL (United States); Geller, James I. [Cincinnati Children' s Hospital Medical Center, Division of Oncology, Cincinnati, OH (United States); Ehrlich, Peter F. [University of Michigan, Department of Surgery, C.S. Mott Children' s Hospital, Ann Arbor, MI (United States); Gow, Kenneth W. [Seattle Children' s Hospital, Pediatric Surgery, Seattle, WA (United States); Perlman, Elizabeth J. [Ann and Robert H. Lurie Children' s Hospital of Chicago, Department of Pathology, Chicago, IL (United States); Dome, Jeffrey S. [Children' s National Medical Center, Center for Cancer and Blood Disorders, Washington, DC (United States); Gratias, Eric; Mullen, Elizabeth A. [Harvard University, Dana Farber Cancer Institute and Boston Children' s Hospital, Boston, MA (United States)

    2014-08-19

    CT and MRI are both used for abdominal staging of pediatric renal tumors. The diagnostic performance of the two modalities for local and regional staging of renal tumors has not been systematically evaluated. To compare the diagnostic performance of CT and MRI for local staging of pediatric renal tumors. The study population was derived from the AREN03B2 study of the Children's Oncology Group. Baseline abdominal imaging performed with both CT and MRI within 30 days of nephrectomy was available for retrospective review in 82 renal tumor cases. Each case was evaluated for capsular penetration, lymph node metastasis, tumor thrombus, preoperative tumor rupture, and synchronous contralateral lesions. The surgical and pathological findings at central review were the reference standard. The sensitivity of CT and MRI for detecting capsular penetration was 68.6% and 62.9%, respectively (P = 0.73), while specificity was 86.5% and 83.8% (P = 1.0). The sensitivity of CT and MRI for detecting lymph node metastasis was 76.5% and 52.9% (P = 0.22), and specificity was 90.4% and 92.3% (P = 1.0). Synchronous contralateral lesions were identified by CT in 4/9 cases and by MRI in 7/9 cases. CT and MRI have similar diagnostic performance for detection of lymph node metastasis and capsular penetration. MR detected more contralateral synchronous lesions; however these were present in a very small number of cases. Either modality can be used for initial loco-regional staging of pediatric renal tumors. (orig.)

  17. Do Intermediate Radiation Doses Contribute to Late Rectal Toxicity? An Analysis of Data From Radiation Therapy Oncology Group Protocol 94-06

    Energy Technology Data Exchange (ETDEWEB)

    Tucker, Susan L., E-mail: sltucker@mdanderson.org [Department of Bioinformatics and Computational Biology, University of Texas MD Anderson Cancer Center, Houston, TX (United States); Dong, Lei [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, TX (United States); Michalski, Jeff M. [Department of Radiation Oncology, Washington University, St. Louis, MO (United States); Bosch, Walter R. [Department of Radiation Oncology, Washington University, St. Louis, MO (United States); Image-Guided Therapy QA Center, Washington University, St. Louis, MO (United States); Winter, Kathryn [American College of Radiology, Philadelphia, PA (United States); Cox, James D. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, TX (United States); Purdy, James A. [Department of Radiation Oncology, University of California Davis Medical Center, Sacramento, CA (United States); Mohan, Radhe [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, TX (United States)

    2012-10-01

    Purpose: To investigate whether the volumes of rectum exposed to intermediate doses, from 30 to 50 Gy, contribute to the risk of Grade {>=}2 late rectal toxicity among patients with prostate cancer receiving radiotherapy. Methods and Materials: Data from 1009 patients treated on Radiation Therapy Oncology Group protocol 94-06 were analyzed using three approaches. First, the contribution of intermediate doses to a previously published fit of the Lyman-Kutcher-Burman (LKB) normal tissue complication probability (NTCP) model was determined. Next, the extent to which intermediate doses provide additional risk information, after taking the LKB model into account, was investigated. Third, the proportion of rectum receiving doses higher than a threshold, VDose, was computed for doses ranging from 5 to 85 Gy, and a multivariate Cox proportional hazards model was used to determine which of these parameters were significantly associated with time to Grade {>=}2 late rectal toxicity. Results: Doses <60 Gy had no detectable impact on the fit of the LKB model, as expected on the basis of the small estimate of the volume parameter (n = 0.077). Furthermore, there was no detectable difference in late rectal toxicity among cohorts with similar risk estimates from the LKB model but with different volumes of rectum exposed to intermediate doses. The multivariate Cox proportional hazards model selected V75 as the only value of VDose significantly associated with late rectal toxicity. Conclusions: There is no evidence from these data that intermediate doses influence the risk of Grade {>=}2 late rectal toxicity. Instead, the critical doses for this endpoint seem to be {>=}75 Gy. It is hypothesized that cases of Grade {>=}2 late rectal toxicity occurring among patients with V75 less than approximately 12% may be due to a 'background' level of risk, likely due mainly to biological factors.

  18. Childhood Hodgkin International Prognostic Score (CHIPS) Predicts event-free survival in Hodgkin Lymphoma: A Report from the Children's Oncology Group.

    Science.gov (United States)

    Schwartz, Cindy L; Chen, Lu; McCarten, Kathleen; Wolden, Suzanne; Constine, Louis S; Hutchison, Robert E; de Alarcon, Pedro A; Keller, Frank G; Kelly, Kara M; Trippet, Tanya A; Voss, Stephan D; Friedman, Debra L

    2017-04-01

    Early response to initial chemotherapy in Hodgkin lymphoma (HL) measured by computed tomography (CT) and/or positron emission tomography (PET) after two to three cycles of chemotherapy may inform therapeutic decisions. Risk stratification at diagnosis could, however, allow earlier and potentially more efficacious treatment modifications. We developed a predictive model for event-free survival (EFS) in pediatric/adolescent HL using clinical data known at diagnosis from 1103 intermediate-risk HL patients treated on Children's Oncology Group protocol AHOD0031 with doxorubicin, bleomycin, vincristine, etoposide, prednisone, cyclophosphamide (ABVE-PC) chemotherapy and radiation. Independent predictors of EFS were identified and used to develop and validate a prognostic score (Childhood Hodgkin International Prognostic Score [CHIPS]). A training cohort was randomly selected to include approximately half of the overall cohort, with the remainder forming the validation cohort. Stage 4 disease, large mediastinal mass, albumin (<3.5), and fever were independent predictors of EFS that were each assigned one point in the CHIPS.  Four-year EFS was 93.1% for patients with CHIPS = 0, 88.5% for patients with CHIPS = 1, 77.6% for patients with CHIPS = 2, and 69.2% for patients with CHIPS = 3. CHIPS was highly predictive of EFS, identifying a subset (with CHIPS 2 or 3) that comprises 27% of intermediate-risk patients who have a 4-year EFS of <80% and who may benefit from early therapeutic augmentation.  Furthermore, CHIPS identified higher risk patients who were not identified by early PET or CT response. CHIPS is a robust and inexpensive approach to predicting risk in patients with intermediate-risk HL that may improve ability to tailor therapy to risk factors known at diagnosis. © 2016 Wiley Periodicals, Inc.

  19. Healthcare Costs Reduced After Incorporating the Results of the American College of Surgeons Oncology Group Z0011 Trial into Clinical Practice.

    Science.gov (United States)

    Fillion, Michelle M; Glass, Katherine E; Hayek, Joe; Wehr, Allison; Phillips, Gary; Terando, Alicia; Agnese, Doreen M

    2016-11-30

    The purpose of our study was to quantitate the changes in axillary lymph node dissection (ALND), frozen section (FS), and the impact on costs after the publication of the American College of Surgeons Oncology Group (ACOSOG) Z0011 trial. We compared axillary nodal management and cost data in breast cancer patients who met Z0011 criteria and were treated with lumpectomy and sentinel lymph nodes (SLN) biopsy from 2007 to July 2013. Of 800 patients, 67 (13.5%) and 34 (12.5%) patients in the pre- and post-Z0011 era had 1-2 positive SLN. ALND decreased from 78% to 21% (p < 0.001) after publication of Z0011. The mean overall cost of SLN biopsy was $41,059 per patient, while SLN biopsy with completion ALND was $50,999 (p < 0.001). Intraoperative FS use decreased from 95% to 66% (p = 0.015). Omitting the FS decreased mean costs from $4,319 to $2,036. The application of Z0011 resulted in an overall mean cost savings of $571,653 from 2011 to July 2013. ACOSOG Z0011 significantly impacted axillary management resulting in a 20% reduction in the mean overall cost per patient by omitting ALND. In these patients, intraoperative FS analysis had poor sensitivity (56%) and doubled the cost of pathologic examination. Fewer ALND and intraoperative FS were performed after the publication of ACOSOG Z0011. Eliminating FS and ALND in patients who met Z0011 criteria, results in significant cost savings.

  20. Ki-67 Is an Independent Predictor of Metastasis and Cause-Specific Mortality for Prostate Cancer Patients Treated on Radiation Therapy Oncology Group (RTOG) 94-08

    Energy Technology Data Exchange (ETDEWEB)

    Verhoven, Bret [University of Wisconsin Carbone Cancer Center, Madison, Wisconsin (United States); Yan, Yan [RTOG Statistical Center, Philadelphia, Pennsylvania (United States); Ritter, Mark, E-mail: ritter@humonc.wisc.edu [University of Wisconsin Carbone Cancer Center, Madison, Wisconsin (United States); Khor, Li-Yan [Case Medical Center, Cleveland, Ohio (United States); Hammond, Elizabeth [LDS Hospital, Salt Lake City, Utah (United States); Jones, Christopher [Radiological Associates of Sacramento, Sacramento, California (United States); Amin, Mahul [Cedars-Sinai Medical Center, Los Angeles, California (United States); Bahary, Jean-Paul [Centre Hospitalier de l' Université de Montréal-Notre Dame, Montreal, Ontario (Canada); Zeitzer, Kenneth [Albert Einstein Medical Center, Philadelphia, Pennsylvania (United States); Pollack, Alan [University of Miami Miller School of Medicine, Miami, Florida (United States)

    2013-06-01

    Purpose: The association of Ki-67 staining index (Ki67-SI) with overall survival (OS), disease-specific mortality (DSM), distant metastasis (DM), and biochemical failure (BF) was examined in men with favorable- to intermediate-risk prostate cancer receiving radiation therapy (RT) alone or with short-term androgen deprivation (ADT) in Radiation Therapy Oncology Group (RTOG) 94-08. Methods and Materials: 468 patients (23.6%) on RTOG 94-08 had sufficient tissue for Ki67-SI analysis. The median follow-up time was 7.9 years. Ki67-SI was determined by immunohistochemistry and quantified manually and by image analysis. Correlative analysis versus clinical outcome was performed using the third quartile (≥Q3) cutpoint. A proportional hazards multivariable analysis (MVA) dichotomized covariates in accordance with trial stratification and randomization criteria. Results: In MVAs adjusted for all treatment covariates, high Ki67-SI (≥Q3) was correlated with increased DSM (hazard ratio [HR] 2.48, P=.03), DM (HR 3.5, P=.002), and BF (HR 3.55, P<.0001). MVA revealed similar Ki67-associated hazard ratios in each separate treatment arm for DSM, DM, and BF; these reached significance only for DM in the RT-alone arm and for BF in both arms. Ki67-SI was not a significant predictor of intraprostatic recurrence assessed by repeated biopsy 2 years after treatment. Patients with a high or low Ki67-SI seemed to experience a similar relative benefit from the addition of ADT to radiation. Conclusions: High Ki67-SI independently predicts for increased DSM, DM, and protocol BF in primarily intermediate-risk prostate cancer patients treated with RT with or without ADT on RTOG 94-08 but does not predict for local recurrence or for increased relative benefit from ADT. This and prior studies lend support for the use of Ki67-SI as a stratification factor in future trials.

  1. Outcome of stage IVA cervical cancer patients with disease limited to the pelvis in the era of chemoradiation: a Gynecologic Oncology Group study.

    Science.gov (United States)

    Rose, Peter G; Ali, Shamshad; Whitney, Charles W; Lanciano, Rachelle; Stehman, Frederick B

    2011-06-01

    To evaluate the outcome of stage IVA cervical cancer treated with radiation and concurrent cisplatin-based chemotherapy. We conducted a retrospective study of stage IVA cervical cancer patients from four trials (Gynecologic Oncology Group protocols 56, 85, 120, and 165) treated with radiotherapy with or without concurrent cisplatin-based chemotherapy. Patient records were reviewed for demographic and tumor features, treatment, and progression-free survival (PFS) and overall survival (OS). Stage IVA patients were compared to stage IIIB patients from these same studies. Among the 51 stage IVA patients studied, 92% were stage IVA on the basis of bladder involvement. The median PFS was 10.1 months (95% CI=6.3-14.5 months) and median OS was 21.2 months (95% CI=13.3-30.5 months). The 3 year survival was 32%. On univariate analysis, only advanced age was associated with OS (p=0.0115) but age had only marginal effect on PFS (p=0.083). Pathologic proven pelvic nodal metastasis was of marginal significance for both PFS and OS, p=0.059 and 0.064, respectively. Despite similar patient characteristics, the use of cisplatin-based chemotherapy had no impact on PFS or OS but was underpowered to address this question. When compared to stage IIIB patients, stage IVA patients had a poorer performance status (p=0.0231), larger tumor size (p=0.0302), and more frequent bilateral parametrial involvement (0.0063). Patients with stage IVA disease had poor median survival of only 21 months with only 32% 3 year survival. Stage IVA patients have larger tumor size, more bilateral parametrial involvement, and poorer survival when compared to stage IIIB patients. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Palliative medicine and medical oncology.

    Science.gov (United States)

    Maltoni, M; Amadori, D

    2001-04-01

    Traditionally, medical oncology and palliative care have been considered two distinct and separate disciplines, both as regards treatment objectives and delivery times. Palliative care in terminal stages, aimed exclusively at evaluating and improving quality of life, followed antitumor therapies, which concentrated solely on quantitative results (cure, prolongation of life, tumoral mass shrinkage). Over the years, more modern concepts have developed on the subject. Medical oncology, dealing with the skills and strategic co-ordination of oncologic interventions from primary prevention to terminal phases, should also include assessment and treatment of patients' subjective needs. Anticancer therapies should be evaluated in terms of both the quantitative and qualititative impact on patients' lives. Hence, the traditional view of palliative care has to be modified: it constitutes a philosophical and methodological approach to be adopted from the early phases of illness. It is not the evident cultural necessity of integrating medical oncology with palliative medicine that may be a matter of argument, but rather the organizational models needed to put this combined care into practice: should continuous care be guaranteed by a single figure, the medical oncologist, or rather by an interdisciplinary providers' team, including full-time doctors well-equipped for palliative care? In this paper the needs of cancer patients and the part that a complete oncologist should play to deal with such difficult and far-reaching problems are firstly described. Then, as mild provocation, data and critical considerations on the ever increasing needs of palliative care, the present shortcomings in quality of life and pain assessment and management by medical oncologists, and the uncertain efficacy of interventional programmes to change clinical practice are described. Finally, a model of therapeutic continuity is presented. which in our view is realistic and feasible: an Oncologic

  3. Comparing oncology clinical programs by use of innovative designs and expected net present value optimization: Which adaptive approach leads to the best result?

    Science.gov (United States)

    Parke, Tom; Marchenko, Olga; Anisimov, Vladimir; Ivanova, Anastasia; Jennison, Christopher; Perevozskaya, Inna; Song, Guochen

    2017-01-01

    Designing an oncology clinical program is more challenging than designing a single study. The standard approaches have been proven to be not very successful during the last decade; the failure rate of Phase 2 and Phase 3 trials in oncology remains high. Improving a development strategy by applying innovative statistical methods is one of the major objectives of a drug development process. The oncology sub-team on Adaptive Program under the Drug Information Association Adaptive Design Scientific Working Group (DIA ADSWG) evaluated hypothetical oncology programs with two competing treatments and published the work in the Therapeutic Innovation and Regulatory Science journal in January 2014. Five oncology development programs based on different Phase 2 designs, including adaptive designs and a standard two parallel arm Phase 3 design were simulated and compared in terms of the probability of clinical program success and expected net present value (eNPV). In this article, we consider eight Phase2/Phase3 development programs based on selected combinations of five Phase 2 study designs and three Phase 3 study designs. We again used the probability of program success and eNPV to compare simulated programs. For the development strategies, we considered that the eNPV showed robust improvement for each successive strategy, with the highest being for a three-arm response adaptive randomization design in Phase 2 and a group sequential design with 5 analyses in Phase 3.

  4. Group-Wide, Prospective Study of Ototoxicity Assessment in Children Receiving Cisplatin Chemotherapy (ACCL05C1): A Report From the Children's Oncology Group.

    Science.gov (United States)

    Knight, Kristin R; Chen, Lu; Freyer, David; Aplenc, Richard; Bancroft, Mary; Bliss, Bonnie; Dang, Ha; Gillmeister, Biljana; Hendershot, Eleanor; Kraemer, Dale F; Lindenfeld, Lanie; Meza, Jane; Neuwelt, Edward A; Pollock, Brad H; Sung, Lillian

    2017-02-01

    Purpose Optimal assessment methods and criteria for reporting hearing outcomes in children who receive treatment with cisplatin are uncertain. The objectives of our study were to compare different ototoxicity classification systems, to evaluate the feasibility of including otoacoustic emissions and extended high frequency audiometry, and to evaluate a central review mechanism for audiologic results for cisplatin-treated children in the cooperative group setting. Patients and Methods Eligible participants were 1 to 30 years, with planned cisplatin-containing treatment. Hearing evaluations were conducted at baseline, before each cisplatin cycle, and at the end of therapy. Audiologic results were assessed and graded by the testing audiologist and by two central review audiologists using the American Speech-Language-Hearing Association Ototoxicity Criteria (ASHA), Common Terminology Criteria for Adverse Events, version 3.0 (CTCAE), and Brock Ototoxicity Grades (Brock). One central reviewer also used the Society for Industrial and Organizational Psychology Ototoxicity Scale (SIOP). Results At the end of treatment, the prevalence of any degree of ototoxicity ranged from 40% to 56%, and severe ototoxicity ranged from 7% to 22%. Compared with CTCAE, SIOP detected significantly more ototoxicity ( P = .004), whereas Brock criteria detected significantly fewer patients with any or severe ototoxicity ( P ototoxicity earlier than did the other scales. Agreement between the central reviewers and the institutional audiologist was almost perfect for ASHA and Brock, whereas the poorest agreement occurred with CTCAE. Conclusion The SIOP scale may be superior to ASHA, Brock, and CTCAE scales for classifying ototoxicity in pediatric patients who were treated with cisplatin. Future studies should evaluate inter-rater reliability of the SIOP scale.

  5. Nanotechnology in radiation oncology.

    Science.gov (United States)

    Wang, Andrew Z; Tepper, Joel E

    2014-09-10

    Nanotechnology, the manipulation of matter on atomic and molecular scales, is a relatively new branch of science. It has already made a significant impact on clinical medicine, especially in oncology. Nanomaterial has several characteristics that are ideal for oncology applications, including preferential accumulation in tumors, low distribution in normal tissues, biodistribution, pharmacokinetics, and clearance, that differ from those of small molecules. Because these properties are also well suited for applications in radiation oncology, nanomaterials have been used in many different areas of radiation oncology for imaging and treatment planning, as well as for radiosensitization to improve the therapeutic ratio. In this article, we review the unique properties of nanomaterials that are favorable for oncology applications and examine the various applications of nanotechnology in radiation oncology. We also discuss the future directions of nanotechnology within the context of radiation oncology. © 2014 by American Society of Clinical Oncology.

  6. Personalized oncology

    DEFF Research Database (Denmark)

    Tuxen, Ida Viller; Jønson, Lars; Santoni-Rugiu, Eric;

    2014-01-01

    accelerated drug development. The overall advantage is to determine which mutation profiles correlate with sensitivity or lack of resistance to specific targeted therapies. The utility and current limitations of genomic screening to guide selection to Phase 1 clinical trial will be discussed....

  7. Time-to-event continual reassessment method incorporating treatment cycle information with application to an oncology phase I trial.

    Science.gov (United States)

    Huang, Bo; Kuan, Pei Fen

    2014-11-01

    Delayed dose limiting toxicities (i.e. beyond first cycle of treatment) is a challenge for phase I trials. The time-to-event continual reassessment method (TITE-CRM) is a Bayesian dose-finding design to address the issue of long observation time and early patient drop-out. It uses a weighted binomial likelihood with weights assigned to observations by the unknown time-to-toxicity distribution, and is open to accrual continually. To avoid dosing at overly toxic levels while retaining accuracy and efficiency for DLT evaluation that involves multiple cycles, we propose an adaptive weight function by incorporating cyclical data of the experimental treatment with parameters updated continually. This provides a reasonable estimate for the time-to-toxicity distribution by accounting for inter-cycle variability and maintains the statistical properties of consistency and coherence. A case study of a First-in-Human trial in cancer for an experimental biologic is presented using the proposed design. Design calibrations for the clinical and statistical parameters are conducted to ensure good operating characteristics. Simulation results show that the proposed TITE-CRM design with adaptive weight function yields significantly shorter trial duration, does not expose patients to additional risk, is competitive against the existing weighting methods, and possesses some desirable properties. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. EVALUATION OF CHIP (IPROPLATIN) IN RECURRENT PEDIATRIC MALIGNANT SOLID TUMORS - A PHASE-II STUDY (PEDIATRIC ONCOLOGY GROUP)

    NARCIS (Netherlands)

    NITSCHKE, R; PRATT, C; HARRIS, M; KRISCHER, J; VIETTI, TJ; GRIER, H; KAMPS, W; TOLEDANO, S

    1992-01-01

    CHIP (325 mg/M2), a second generation cisplatin derivative, was administered intravenously every 3 weeks to 85 pediatric patients with recurrent sarcomas (19), osteosarcomas (20), neuroblastoma (23), germ cell tumors (10), and other malignant tumors (7). Thirty-eight of them had been previously expo

  9. Phase space picture of quantum mechanics group theoretical approach

    CERN Document Server

    Kim, Y S

    1991-01-01

    This book covers the theory and applications of the Wigner phase space distribution function and its symmetry properties. The book explains why the phase space picture of quantum mechanics is needed, in addition to the conventional Schrödinger or Heisenberg picture. It is shown that the uncertainty relation can be represented more accurately in this picture. In addition, the phase space picture is shown to be the natural representation of quantum mechanics for modern optics and relativistic quantum mechanics of extended objects.

  10. The Danish Neuro-Oncology Registry

    DEFF Research Database (Denmark)

    Hansen, Steinbjørn

    2016-01-01

    AIM OF DATABASE: The Danish Neuro-Oncology Registry (DNOR) was established by the Danish Neuro-Oncology Group as a national clinical database. It was established for the purpose of supporting research and development in adult patients with primary brain tumors in Denmark. STUDY POPULATION: DNOR has...... advantage of reporting indicators is the related multidisciplinary discussions giving a better understanding of what actually is going on, thereby facilitating the work on adjusting the national guidelines in the Danish Neuro-Oncology Group. CONCLUSION: The establishment of DNOR has optimized the quality...

  11. Modernizing Clinical Trial Eligibility Criteria: Recommendations of the American Society of Clinical Oncology-Friends of Cancer Research Brain Metastases Working Group.

    Science.gov (United States)

    Lin, Nancy U; Prowell, Tatiana; Tan, Antoinette R; Kozak, Marina; Rosen, Oliver; Amiri-Kordestani, Laleh; White, Julia; Sul, Joohee; Perkins, Louise; Beal, Katherine; Gaynor, Richard; Kim, Edward S

    2017-10-02

    Purpose Broadening trial eligibility to improve accrual and access and to better reflect intended-to-treat populations has been recognized as a priority. Historically, patients with brain metastases have been understudied, because of restrictive eligibility across all phases of clinical trials. Methods In 2016, after a literature search and series of teleconferences, a multistakeholder workshop was convened. Our working group focused on developing consensus recommendations regarding the inclusion of patients with brain metastases in clinical trials, as part of a broader effort that encompassed minimum age, HIV status, and organ dysfunction. The working group attempted to balance the needs of protecting patient safety, facilitating access to investigational therapies, and ensuring trial integrity. On the basis of input at the workshop, guidelines were further refined and finalized. Results The working group identified three key populations: those with treated/stable brain metastases, defined as patients who have received prior therapy for their brain metastases and whose CNS disease is radiographically stable at study entry; those with active brain metastases, defined as new and/or progressive brain metastases at the time of study entry; and those with leptomeningeal disease. In most circumstances, the working group encourages the inclusion of patients with treated/stable brain metastases in clinical trials. A framework of key considerations for patients with active brain metastases was developed. For patients with leptomeningeal disease, inclusion of a separate cohort in both early-phase and later-phase trials is recommended, if CNS activity is anticipated and when relevant to the specific disease type. Conclusion Expanding eligibility to be more inclusive of patients with brain metastasis is justified in many cases and may speed the development of effective therapies in this area of high clinical need.

  12. Characteristics of phase-averaged equations for modulated wave groups

    NARCIS (Netherlands)

    Klopman, G.; Petit, H.A.H.; Battjes, J.A.

    2000-01-01

    The project concerns the influence of long waves on coastal morphology. The modelling of the combined motion of the long waves and short waves in the horizontal plane is done by phase-averaging over the short wave motion and using intra-wave modelling for the long waves, see e.g. Roelvink (1993). Th

  13. Extended Group Contribution Model for Polyfunctional Phase Equilibria

    DEFF Research Database (Denmark)

    Abildskov, Jens

    -liquid equilibria from data on binary mixtures, composed of structurally simple molecules with a single functional group. More complex is the situation with mixtures composed of structurally more complicated molecules or molecules with more than one functional group. The UNIFAC method is extended to handle...... polyfunctional group situations, based on additional information on molecular structure. The extension involves the addition of second-order correction terms to the existing equation. In this way the current first-order formulation is retained. The second-order concept is developed for mixture properties based....... In chapter 4 parameters are estimated for the first-order UNIFAC model, based on which parameters are estimated for one of the second-order models described in chapter 3. The parameter estimation is based on measured binary data on around 4000 systems, covering 11 C-, H- and O-containing functional groups...

  14. The Fossil Phase in the Life of a Galaxy Group

    CERN Document Server

    von Benda-Beckmann, Alexander M; Gottloeber, Stefan; Hoeft, Matthias; Khalatyan, Arman; Klypin, Anatoly; Mueller, Volker

    2007-01-01

    We investigate the origin and evolution of fossil groups in a concordance LCDM cosmological simulation. We consider haloes with masses between $(1-5)\\times10^{13} \\hMsun$ and study the physical mechanisms that lead to the formation of the large gap in magnitude between the brightest and the second most bright group member, which is typical for these fossil systems. Fossil groups are found to have high dark matter concentrations, which we can relate to their early formation time. The large magnitude-gaps arise after the groups have build up half of their final mass, due to merging of massive group members. We show that the existence of fossil systems is primarily driven by the relatively early infall of massive satellites, and that we do not find a strong environmental dependence for these systems. In addition, we find tentative evidence for fossil group satellites falling in on orbits with typically lower angular momentum, which might lead to a more efficient merger onto the host. We find a population of grou...

  15. Acute oncological emergencies.

    LENUS (Irish Health Repository)

    Gabriel, J

    2012-01-01

    The number of people receiving systemic anti-cancer treatment and presenting at emergency departments with treatment-related problems is rising. Nurses will be the first point of contact for most patients and need to be able to recognise oncological emergencies to initiate urgent assessment of patients and referral to the acute oncology team so that the most appropriate care can be delivered promptly. This article discusses the role of acute oncology services, and provides an overview of the most common acute oncological emergencies.

  16. Phases and Patterns of Group Development in Virtual Learning Teams

    Science.gov (United States)

    Yoon, Seung Won; Johnson, Scott D.

    2008-01-01

    With the advancement of Internet communication technologies, distributed work groups have great potential for remote collaboration and use of collective knowledge. Adopting the Complex Adaptive System (CAS) perspective (McGrath, Arrow, & Berdhal, "Personal Soc Psychol Rev" 4 (2000) 95), which views virtual learning teams as an adaptive and…

  17. Assessment of the Prognostic Value of Two Common Variants of BRCA1 and BRCA2 Genes in Ovarian Cancer Patients Treated with Cisplatin and Paclitaxel: A Gynecologic Oncology Group Study

    Directory of Open Access Journals (Sweden)

    Chunqiao eTian

    2013-08-01

    Full Text Available Purpose: BRCA1/BRCA2 germline mutations appear to enhance the platinum-sensitivity, but little is known about the prognostic relevance of polymorphisms in BRCA1/BRCA2 in epithelial ovarian cancer (EOC. This study evaluated whether common variants of BRCA1/BRCA2 are associated with progression-free survival (PFS and overall survival (OS in patients with advanced stage sporadic EOC.Experimental Design: The allelic frequency of BRCA1 (2612C>T, P871L-rs799917 and BRCA2 (114A>C, N372H-rs144848 were determined in normal blood DNA from women in Gynecologic Oncology Group (GOG protocol #172 phase III trial with optimally-resected stage III EOC treated with intraperitoneal or intravenous cisplatin and paclitaxel (C+P. Associations between polymorphisms and PFS or OS were assessed. Results: 232 women were included for analyses. African Americans (AA had different distributions for the two polymorphisms from Caucasians and others. For non-AA patients, the genotype for BRCA1 P871L was distributed as 38% for CC, 49% for CT and 13% for TT. Median PFS was estimated to be 31, 21 and 21 months, respectively. After adjusting for cell type, residual disease and chemotherapy regimen, CT/TT genotypes were associated with a 1.40-fold increased risk of disease progression (95% confidence interval [CI]=1.00-1.95, p=0.049. After removing 7 patients with known BRCA1 germline mutations, the hazard ratio (HR was 1.36 (95% CI=0.97-1.91, p=0.073. The association between BRCA1 P871L and OS was not significant (HR =1.25, 95% CI=0.88-1.76, p=0.212. Genotype distribution of BRCA2 N372H among non-AA patients was 50%, 44% and 6% for AA, AC and CC, respectively and there is no evidence that this BRCA2 polymorphism was related to PFS or OS. Conclusion: Polymorphisms in BRCA1 P871L or in BRCA2 N372H were not associated with either PFS or OS in women with optimally-resected, stage III EOC treated with cisplatin and paclitaxel.

  18. Exploring resilience in paediatric oncology nursing staff.

    Science.gov (United States)

    Zander, Melissa; Hutton, Alison; King, Lindy

    2013-01-01

    Resilience has been suggested as an important coping strategy for nurses working in demanding settings, such as paediatric oncology. This qualitative study explored paediatric oncology nurses' perceptions of their development of resilience and how this resilience underpinned their ability to deal with work-related stressors. Five paediatric oncology nurses were interviewed about their understanding of the concept of resilience, their preferred coping mechanisms, and their day-today work in paediatric oncology. Using thematic analysis, the interviews were subsequently grouped together into seventeen initial themes. These themes were then grouped into seven major aspects that described how the participants perceived resilience underpinned their work. These "seven aspects of forming resilience" contributed to an initial understanding of how paediatric oncology nurses develop resilience in the face of their personal and professional challenges. Several key strategies derived from the findings, such as improved rostering, support to a nurse's friend and family, and a clinical support nursing role, could be implemented at an organizational level to support resilience development within the paediatric oncology setting.

  19. Oncology Advanced Practitioners Bring Advanced Community Oncology Care.

    Science.gov (United States)

    Vogel, Wendy H

    2016-01-01

    Oncology care is becoming increasingly complex. The interprofessional team concept of care is necessary to meet projected oncology professional shortages, as well as to provide superior oncology care. The oncology advanced practitioner (AP) is a licensed health care professional who has completed advanced training in nursing or pharmacy or has completed training as a physician assistant. Oncology APs increase practice productivity and efficiency. Proven to be cost effective, APs may perform varied roles in an oncology practice. Integrating an AP into an oncology practice requires forethought given to the type of collaborative model desired, role expectations, scheduling, training, and mentoring.

  20. High-Resolution Group Quantization Phase Processing Method in Radio Frequency Measurement Range.

    Science.gov (United States)

    Du, Baoqing; Feng, Dazheng; Tang, Yaohua; Geng, Xin; Zhang, Duo; Cai, Chaofeng; Wan, Maoquan; Yang, Zhigang

    2016-07-08

    Aiming at the more complex frequency translation, the longer response time and the limited measurement precision in the traditional phase processing, a high-resolution phase processing method by group quantization higher than 100 fs level is proposed in radio frequency measurement range. First, the phase quantization is used as a step value to quantize every phase difference in a group by using the fixed phase relationships between different frequencies signals. The group quantization is formed by the results of the quantized phase difference. In the light of frequency drift mainly caused by phase noise of measurement device, a regular phase shift of the group quantization is produced, which results in the phase coincidence of two comparing signals which obtain high-resolution measurement. Second, in order to achieve the best coincidences pulse, a subtle delay is initiatively used to reduce the width of the coincidences fuzzy area according to the transmission characteristics of the coincidences in the specific medium. Third, a series of feature coincidences pulses of fuzzy area can be captured by logic gate to achieve the best phase coincidences information for the improvement of the measurement precision. The method provides a novel way to precise time and frequency measurement.

  1. Identifying oncological emergencies.

    Science.gov (United States)

    Guddati, Achuta K; Kumar, Nilay; Segon, Ankur; Joy, Parijat S; Marak, Creticus P; Kumar, Gagan

    2013-01-01

    Prompt identification and treatment of life-threatening oncological conditions is of utmost importance and should always be included in the differential diagnosis. Oncological emergencies can have a myriad of presentations ranging from mechanical obstruction due to tumor growth to metabolic conditions due to abnormal secretions from the tumor. Notably, hematologic and infectious conditions may complicate the presentation of oncological emergencies. Advanced testing and imaging is generally required to recognize these serious presentations of common malignancies. Early diagnosis and treatment of these conditions can significantly affect the patient's clinical outcome.

  2. Orthodontic treatment in oncological patients.

    Science.gov (United States)

    Mituś-Kenig, Maria; Łoboda, Magdalena; Marcinkowska-Mituś, Agata; Durka-Zajac, Magdalena; Pawłowska, Elzbieta

    2015-01-01

    The progress in oncological treatment has led to the current increase of childhood cancer survival rate to 80%. That is why orthodontists more and more frequently consult patients who had completed a successful anti-cancer therapy in childhood. Oncological treatments such as chemotherapy, radiotherapy or supportive immunosuppressive therapy cause numerous side effects in growing patients, connected i.a. with growth, the development of teeth or the viscerocranium. This is a special group of patients that needs an optimised plan of orthodontic treatment and often has to accept a compromise result. The purpose of the current work is to discuss the results of orthodontic treatment in patients after an anti-cancer therapy. Time of treatment was 12,5 months. In 6 patients (from 40 undergoing orthodontic therapy) we haven't reached a normocclusion, in 9 patients we should have stopped the therapy because of the recurrence. In 11 patients we found mucosa inflammation and in 1 patient the therapy stopped before the end because of very low oral hygiene level. Bearing in mind the limited number of original works on the above topic in Polish medical literature, the study has been carried out in order to make Polish orthodontists more acquainted with the topic and the standards of dealing with an oncological patient.

  3. Validation of Lysyl Oxidase As a Prognostic Marker for Metastasis and Survival in Head and Neck Squamous Cell Carcinoma: Radiation Therapy Oncology Group Trial 90-03

    Science.gov (United States)

    Le, Quynh-Thu; Harris, Jonathan; Magliocco, Anthony M.; Kong, Christina S.; Diaz, Roman; Shin, Brian; Cao, Hongbin; Trotti, Andy; Erler, Janine T.; Chung, Christine H.; Dicker, Adam; Pajak, Thomas F.; Giaccia, Amato J.; Ang, K. Kian

    2009-01-01

    Purpose To validate lysyl oxidase (LOX), a hypoxia-related protein, as a marker for metastasis in an independent head and neck cancer (HNC) patient group enrolled onto a prospective trial. Patients and Methods We performed traditional immunohistochemical (IHC) staining and automated quantitative analysis (AQUA) for LOX expression in 66 HNC patients from one institution. We also performed AQUA staining for LOX in 306 of 1,113 patients treated on a phase III trial comparing four radiation fractionation schedules in locally advanced HNC (RTOG 90-03). Pretreatment characteristics and outcome were similar between patients with and without LOX assessment. We correlated AQUA LOX expression with time to metastasis (TTM), time to progression (TTP), and overall survival (OS). Results LOX expression from both staining methods predicted for TTM in the first 66 patients. Multivariate analysis, controlling for significant parameters including nodal stage and performance status, revealed tumor LOX expression, as a continuous variable, was an independent predictor for TTM (hazard ratio [HR], 1.21; 95% CI, 1.10 to 1.33; P = .0001), TTP (HR, 1.06; 95% CI, 1.02 to 1.10; P = .0069), and OS (HR, 1.04; 95% CI, 1.00 to 1.07; P = .0311) in RTOG 90-03 patients. This translates into a 259% increase in metastatic risk for a patient at the 75th percentile of LOX compared with one at the 25th percentile. Conclusion AQUA LOX expression was strongly associated with increased metastasis, progression, and death in RTOG 90-03 patients. This study validates that LOX is a marker for metastasis and survival in HNC. PMID:19667273

  4. Imbalance of group velocities for amplitude and phase pulses propagating in a resonant atomic medium

    Science.gov (United States)

    Basalaev, M. Yu.; Taichenachev, A. V.; Yudin, V. I.

    2016-11-01

    The dynamics of light pulses with amplitude and phase modulations is investigated for a medium of resonant two-level atoms. It is shown that the pulse-like variations of the phase can be also described in terms of group velocity. It is found that in the nonlinear regime of atom-field interaction, the group velocities of amplitude and phase pulses can have a large imbalance. Namely, amplitude pulses travel at a velocity less than c , whereas the group velocity of phase pulses is greater than the velocity of light in free space or it is even negative. The predicted imbalance of the group velocities can be important in the case of chirped pulses propagating in a resonant medium.

  5. The deconfinement phase transition in Yang-Mills theory with general Lie group G

    CERN Document Server

    Holland, K; Wiese, U J

    2004-01-01

    We present numerical results for the deconfinement phase transition in Sp(2) and Sp(3) Yang-Mills theories in (2+1)-D and (3+1)-D. We then make a conjecture on the order of this phase transition in Yang-Mills theories with general Lie groups G = SU(N), SO(N), Sp(N) and with exceptional groups G = G(2), F(4), E(6), E(7), E(8).

  6. The reporting of adverse events in oncology phase III trials: a comparison of the current status versus the expectations of the EORTC members.

    Science.gov (United States)

    Maillet, D; Blay, J Y; You, B; Rachdi, A; Gan, H K; Péron, J

    2016-01-01

    Determination of drug safety and tolerability is usually based on the frequency of certain key adverse events (AEs) rather than the frequency of all-grade toxicities. We assessed the reporting of key AEs in oncology randomized, controlled trials (RCTs) and compared that with the expectations of the European Organization for Research and Treatment of Cancer (EORTC) membership. RCTs reports published between 2007 and 2011 were reviewed regarding the reporting of key AEs, namely: grade 3/4 AEs, grade 5 AEs, and AEs resulting in study withdrawal or in dose reduction. Study characteristics associated with better reporting of key AEs were investigated. Finally, a survey was conducted among the EORTC membership to determine their expectations on key AEs reporting. Although the frequency of grade 3/4 was reported in most reports (96%), only 17% of them described the reporting threshold above which grade 3/4 AEs were included for reporting, raising the possibility that important but less frequent grade 3/4 AEs might be underreported. Frequency and nature of grade 5 AEs were adequately reported in 161 (50%) of manuscripts; AEs leading to study withdrawal in 61 manuscripts (19%); and AEs leading to dose reduction in 43 manuscripts (13%). In contrast, most EORTC members expected a comprehensive reporting of grade 5 AEs (96% of EORTC member's responses), AEs leading to study withdrawal (86%) and AEs leading to dose reduction (70%). In multivariate analysis, frequencies of grade 5 AEs were less frequently reported in European trials (P = 0.004). Frequencies of AEs leading to withdrawals were more frequently reported in trials funded by industry (P = 0.005) and in trials including patients with breast or urological cancers (P = 0.006). These findings suggest that current practice of key AEs reporting remains highly variable and sometimes inadequate in oncology RCTs reports. Current standards for safety reporting in RCTs should be revised to emphasize the importance of key AEs

  7. Waste area Grouping 2 Phase I remedial investigation: Sediment and Cesium-137 transport modeling report

    Energy Technology Data Exchange (ETDEWEB)

    Clapp, R.B.; Bao, Y.S.; Moore, T.D.; Brenkert, A.L.; Purucker, S.T.; Reece, D.K.; Burgoa, B.B.

    1996-06-01

    This report is one of five reports issued in 1996 that provide follow-up information to the Phase I Remedial Investigation (RI) Report for Waste Area Grouping (WAG) 2 at Oak Ridge National Laboratory (ORNL). The five reports address areas of concern that may present immediate risk to public health at the Clinch River and ecological risk within WAG 2 at ORNL. A sixth report, on groundwater, in the series documenting WAG 2 RI Phase I results were part of project activities conducted in FY 1996. The five reports that complete activities conducted as part of Phase I of the Remedial Investigation (RI) for WAG 2 are as follows: (1) Waste Area Grouping 2, Phase I Task Data Report: Seep Data Assessment, (2) Waste Area Grouping 2, Phase I Task Data Report: Tributaries Data Assessment, (3) Waste Area Grouping 2, Phase I Task Data Report: Ecological Risk Assessment, (4) Waste Area Grouping 2, Phase I Task Data Report: Human Health Risk Assessment, (5) Waste Area Grouping 2, Phase I Task Data Report: Sediment and {sup 137}Cs Transport Modeling In December 1990, the Remedial Investigation Plan for Waste Area Grouping 2 at Oak Ridge National Laboratory was issued (ORNL 1990). The WAG 2 RI Plan was structured with a short-term component to be conducted while upgradient WAGs are investigated and remediated, and a long-term component that will complete the RI process for WAG 2 following remediation of upgradient WAGs. RI activities for the short-term component were initiated with the approval of the Environmental Protection Agency, Region IV (EPA), and the Tennessee Department of Environment and Conservation (TDEC). This report presents the results of an investigation of the risk associated with possible future releases of {sup 137}Cs due to an extreme flood. The results are based on field measurements made during storms and computer model simulations.

  8. Quantum field theory and phase transitions: universality and renormalization group; Theorie quantique des champs et transitions de phase: universalite et groupe de renormalisation

    Energy Technology Data Exchange (ETDEWEB)

    Zinn-Justin, J

    2003-08-01

    In the quantum field theory the problem of infinite values has been solved empirically through a method called renormalization, this method is satisfying only in the framework of renormalization group. It is in the domain of statistical physics and continuous phase transitions that these issues are the easiest to discuss. Within the framework of a course in theoretical physics the author introduces the notions of continuous limits and universality in stochastic systems operating with a high number of freedom degrees. It is shown that quasi-Gaussian and mean field approximation are unable to describe phase transitions in a satisfying manner. A new concept is required: it is the notion of renormalization group whose fixed points allow us to understand universality beyond mean field. The renormalization group implies the idea that long distance correlations near the transition temperature might be described by a statistical field theory that is a quantum field in imaginary time. Various forms of renormalization group equations are presented and solved in particular boundary limits, namely for fields with high numbers of components near the dimensions 4 and 2. The particular case of exact renormalization group is also introduced. (A.C.)

  9. Psycho-oncology: Searching for practical wisdom?

    Science.gov (United States)

    Butlin, Helen

    2015-10-01

    The debate is vigorous in psycho-oncology about whether spiritual, existential, and psychosocial are the most comprehensive terms for academic research discourses investigating meaning and purpose. A call-to-action email from the International Society of Psycho-Oncology included the term soul. The current essay highlights the historical and contemporary uses of "soul" to suggest that the re-emergent soul signifies a tacit quest for an "intangible" that seems missing in current constructs of clinical domains reflected in the vigor of the debates. It is suggested that the re-emergence of the pre-Medieval meaning(s) of the notion of soul affirms a growing need for integrative paradigms on "being human" to guide psycho-oncology practitioners and their research. As a paradigmatic example, a clinical support group entitled Soul Medicine is described as employing the term soul to open up the more marginal discourses about experiences of illness arising from philosophical reflection, arts, humanities, and spirituality within a clinical oncology context. A link between soul and wisdom is suggested for further exploration with the view that phronesis ("the virtue of practical wisdom"), an emerging concept in health professional education research, is of ultimate value to the people psycho-oncology seeks to serve. This group holds that garnering wisdom from the expertise of those living with cancer should be a central aim of our field.

  10. Late xerostomia after intensity-modulated conformational radiotherapy of upper aero-digestive tract cancers: study 2004-03 by the head and neck oncology and radiotherapy Group (Gortec); Xerostomie tardive apres radiotherapie conformationnelle avec modulation d'intensite des cancers des voies aero-digestives superieures: etude 2004-03 du Groupe oncologie et radiotherapie de la tete et du cou (Gortec)

    Energy Technology Data Exchange (ETDEWEB)

    Toledano, I.; Lapeyre, M. [Centre Jean-Perrin, 63 - Clermont-Ferrand (France); Graff, P. [Centre Alexis-Vautrin, 54 - Vandoeuvre-les-Nancy (France); Serre, C. [Centre Val d' Aurelle, 34 - Montpellier (France); Bensadoun, R.J. [CHU La Miletrie, 86 - Poitiers (France); Bensadoun, R.J.; Ortholan, C. [Centre Antoine-Lacassagne, 06 - Nice (France); Calais, G. [CHU Bretonneau, 37 - Tours (France); Alfonsi, M. [Institut Sainte-Catherine, 84 - Avignon (France); Giraud, P. [Institut Curie, 75 - Paris (France); Hopital europeen Georges-Pompidou, 75 - Paris (France); Racadot, S. [Centre Leon-Berrard, 69 - Lyon (France)

    2010-10-15

    The authors report a retrospective assessment of late xerostomia according to the RTOG (Radiation Therapy Oncology Group) classification of the European Organization for Research and Treatment of Cancer (EORTC) among patients treated by intensity-modulated conformational radiotherapy (IMRT) and suffering from upper aero-digestive tract carcinomas of different stages. Some of these patients have bee operated, and some have been treated by chemotherapy. It appears that the IMRT results in a reduction of late xerostomia, and even in an absence of salivary toxicity. Short communication

  11. American Society for Radiation Oncology

    Science.gov (United States)

    ... for other cancer types View videos on radiation oncology Please Select an Action Read a news release ... This online career board is the premier radiation oncology recruitment tool, offering employers and job seekers an ...

  12. Comparative oncology today.

    Science.gov (United States)

    Paoloni, Melissa C; Khanna, Chand

    2007-11-01

    The value of comparative oncology has been increasingly recognized in the field of cancer research, including the identification of cancer-associated genes; the study of environmental risk factors, tumor biology, and progression; and, perhaps most importantly, the evaluation of novel cancer therapeutics. The fruits of this effort are expected to be the creation of better and more specific drugs to benefit veterinary and human patients who have cancer. The state of the comparative oncology field is outlined in this article, with an emphasis on cancer in dogs.

  13. Female Representation in the Academic Oncology Physician Workforce: Radiation Oncology Losing Ground to Hematology Oncology.

    Science.gov (United States)

    Ahmed, Awad A; Hwang, Wei-Ting; Holliday, Emma B; Chapman, Christina H; Jagsi, Reshma; Thomas, Charles R; Deville, Curtiland

    2017-05-01

    Our purpose was to assess comparative female representation trends for trainees and full-time faculty in the academic radiation oncology and hematology oncology workforce of the United States over 3 decades. Simple linear regression models with year as the independent variable were used to determine changes in female percentage representation per year and associated 95% confidence intervals for trainees and full-time faculty in each specialty. Peak representation was 48.4% (801/1654) in 2013 for hematology oncology trainees, 39.0% (585/1499) in 2014 for hematology oncology full-time faculty, 34.8% (202/581) in 2007 for radiation oncology trainees, and 27.7% (439/1584) in 2015 for radiation oncology full-time faculty. Representation significantly increased for trainees and full-time faculty in both specialties at approximately 1% per year for hematology oncology trainees and full-time faculty and 0.3% per year for radiation oncology trainees and full-time faculty. Compared with radiation oncology, the rates were 3.84 and 2.94 times greater for hematology oncology trainees and full-time faculty, respectively. Despite increased female trainee and full-time faculty representation over time in the academic oncology physician workforce, radiation oncology is lagging behind hematology oncology, with trainees declining in recent years in radiation oncology; this suggests a de facto ceiling in female representation. Whether such issues as delayed or insufficient exposure, inadequate mentorship, or specialty competitiveness disparately affect female representation in radiation oncology compared to hematology oncology are underexplored and require continued investigation to ensure that the future oncologic physician workforce reflects the diversity of the population it serves. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Phase structure analysis of CP(N-1) model using Tensor renormalization group

    CERN Document Server

    Kawauchi, Hikaru

    2016-01-01

    The phase structure of the lattice CP($N-1$) model in two dimensions is analyzed by the tensor renormalization group (TRG) method. We focus on the case $N=2$ and compare the numerical result of the TRG method with that of the strong-coupling analysis in the presence of the $\\theta$ term and investigate the nature of the phase transition at $\\theta=\\pi$.

  15. Anti-CD13 Abs in children with extensive chronic GVHD and their relation to soluble CD13 after allogeneic blood and marrow transplantation from a Children's Oncology Groups Study, ASCT0031.

    Science.gov (United States)

    Cuvelier, G D E; Kariminia, A; Fujii, H; Aslanian, S; Wall, D; Goldman, F; Grupp, S A; Dunn, S E; Krailo, M; Shapiro, L H; Gilman, A; Schultz, K R

    2010-11-01

    Our group previously demonstrated a strong association between elevated plasma soluble CD13 enzyme activity and newly diagnosed extensive chronic GVHD (cGVHD) in children. As cytotoxic anti-CD13 Abs have been documented after blood and marrow transplant (BMT) in association with CMV infection and cGVHD, we hypothesized that soluble CD13 contributes to cGVHD pathogenesis by induction of CD13 reactive Abs and that anti-CD13 Abs could be additional biomarkers for newly diagnosed pediatric extensive cGVHD. Using prospectively collected plasma samples from pediatric allogeneic BMT (allo-BMT) subjects with cGVHD and controls without cGVHD enrolled in a large multi-institution Children's Oncology Group cGVHD therapeutic trial, we evaluated whether soluble CD13 correlates with induction of anti-CD13 Abs. We found that CD13 reactive Abs are present in a proportion of patients after allo-BMT, but did not seem to correlate with the presence of soluble CD13. Anti-CD13 Abs also did not meet our criteria as a diagnostic biomarker for cGVHD. These data do not confirm that induction of CD13 reactive Abs is a mechanism for cGVHD in children nor are part of the pathogenesis of cGVHD associated with elevated soluble CD13. The exact role of CD13 in cGVHD remains to be determined.

  16. PHOTOINDUCED HOLOGRAPHIC PHASE GRATINGS BURIED IN AZOBENZENE SIDE-CHAIN POLYMER FILMS WITH A CHIRAL GROUP

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    An optically active polymer (PM1) containing azobenzene moieties with a chiral group (s-2-methyl-butyl) was synthesized by homopolymerization of monomer, 4-[2-(methacryloyloxy)ethyloxy]-4'-(s-2-methyl-1-butyloxycarbonyl)azobenzene, using the free radical polymerization method. The polymer dissolved in tetrahydrofuran (THF) could be easily processed into high optical quality films. The optical anisotropy of the polymer films was investigated by polarizing optical microscopy (POM). The experimental results showed that irradiation with a circularly polarized beam could align the orientation of the molecules in the polymer films. Moreover, the holographic phase gratings of photo-induced polymer films were detected by atomic force microscopy (AFM) and POM. In comparison with polymer containing no chiral group, it was found from the preliminary measurement of the photo-induced holographic phase gratings that PM1 containing a chiral group could form holographic phase gratings buried in the films.

  17. Group Lifting Structures For Multirate Filter Banks, II: Linear Phase Filter Banks

    Energy Technology Data Exchange (ETDEWEB)

    Brislawn, Christopher M [Los Alamos National Laboratory

    2008-01-01

    The theory of group lifting structures is applied to linear phase lifting factorizations for the two nontrivial classes of two-channel linear phase perfect reconstruction filter banks, the whole-and half-sample symmetric classes. Group lifting structures defined for the reversible and irreversible classes of whole-and half-sample symmetric filter banks are shown to satisfy the hypotheses of the uniqueness theorem for group lifting structures. It follows that linear phase lifting factorizations of whole-and half-sample symmetric filter banks are therefore independent of the factorization methods used to compute them. These results cover the specification of user-defined whole-sample symmetric filter banks in Part 2 of the ISO JPEG 2000 standard.

  18. Tensor renormalization group: Local magnetizations, correlation functions, and phase diagrams of systems with quenched randomness

    Science.gov (United States)

    Güven, Can; Hinczewski, Michael; Berker, A. Nihat

    2011-03-01

    The tensor renormalization-group method, developed by Levin and Nave, brings systematic improvability to the position-space renormalization-group method and yields essentially exact results for phase diagrams and entire thermodynamic functions. The method, previously used on systems with no quenched randomness, is extended in this study to systems with quenched randomness. Local magnetizations and correlation functions as a function of spin separation are calculated as tensor products subject to renormalization-group transformation. Phase diagrams are extracted from the long-distance behavior of the correlation functions. The approach is illustrated with the quenched bond-diluted Ising model on the triangular lattice. An accurate phase diagram is obtained in temperature and bond-dilution probability for the entire temperature range down to the percolation threshold at zero temperature. This research was supported by the Alexander von Humboldt Foundation, the Scientific and Technological Research Council of Turkey (TÜBITAK), and the Academy of Sciences of Turkey.

  19. Tensor renormalization group: local magnetizations, correlation functions, and phase diagrams of systems with quenched randomness.

    Science.gov (United States)

    Güven, Can; Hinczewski, Michael; Berker, A Nihat

    2010-11-01

    The tensor renormalization-group method, developed by Levin and Nave, brings systematic improvability to the position-space renormalization-group method and yields essentially exact results for phase diagrams and entire thermodynamic functions. The method, previously used on systems with no quenched randomness, is extended in this study to systems with quenched randomness. Local magnetizations and correlation functions as a function of spin separation are calculated as tensor products subject to renormalization-group transformation. Phase diagrams are extracted from the long-distance behavior of the correlation functions. The approach is illustrated with the quenched bond-diluted Ising model on the triangular lattice. An accurate phase diagram is obtained in temperature and bond-dilution probability for the entire temperature range down to the percolation threshold at zero temperature.

  20. Tobacco control policies of oncology nursing organizations.

    Science.gov (United States)

    Sarna, Linda; Bialous, Stella Aguinaga

    2004-05-01

    Nurses, the largest group of health care professionals, and the policies of nursing organizations, have tremendous potential to promote health and tobacco control. Policies addressing tobacco use have been implemented by a variety of national and international nursing organizations. This article reviews existing tobacco control policies in oncology nursing organizations.

  1. PHASE STRUCTURE AND PROPERTIES OF EPOXY RESIN MODIFIED BY POLYSILOXANE BEARING PENDANT AMINO GROUPS

    Institute of Scientific and Technical Information of China (English)

    Bing Zhang; Xiang-luan Liu; Ying Huang

    2000-01-01

    Polysiloxane-modified epoxy resins were prepared through the reaction of epoxy resin with polydimethylsiloxanes bearing pendant N-(β-aminoethyl)-γ-aminopropyl groups. The morphology and properties of the cured epoxy resins modified by the polysiloxanes were investigated. It was found that the phase structure and properties of the cured epoxy resins depend mainly on the amino group content in the polydimethylsiloxane and the level of the modifier. The change of phase structure in the cured epoxy resin systems was responsible for the dramatic change in their mechanical and surface properties.

  2. Quality Assessment in Oncology

    Energy Technology Data Exchange (ETDEWEB)

    Albert, Jeffrey M. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Das, Prajnan, E-mail: prajdas@mdanderson.org [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2012-07-01

    The movement to improve healthcare quality has led to a need for carefully designed quality indicators that accurately reflect the quality of care. Many different measures have been proposed and continue to be developed by governmental agencies and accrediting bodies. However, given the inherent differences in the delivery of care among medical specialties, the same indicators will not be valid across all of them. Specifically, oncology is a field in which it can be difficult to develop quality indicators, because the effectiveness of an oncologic intervention is often not immediately apparent, and the multidisciplinary nature of the field necessarily involves many different specialties. Existing and emerging comparative effectiveness data are helping to guide evidence-based practice, and the increasing availability of these data provides the opportunity to identify key structure and process measures that predict for quality outcomes. The increasing emphasis on quality and efficiency will continue to compel the medical profession to identify appropriate quality measures to facilitate quality improvement efforts and to guide accreditation, credentialing, and reimbursement. Given the wide-reaching implications of quality metrics, it is essential that they be developed and implemented with scientific rigor. The aims of the present report were to review the current state of quality assessment in oncology, identify existing indicators with the best evidence to support their implementation, and propose a framework for identifying and refining measures most indicative of true quality in oncologic care.

  3. Nanomedicine in veterinary oncology.

    Science.gov (United States)

    Lin, Tzu-Yin; Rodriguez, Carlos O; Li, Yuanpei

    2015-08-01

    Nanomedicine is an interdisciplinary field that combines medicine, engineering, chemistry, biology and material sciences to improve disease management and can be especially valuable in oncology. Nanoparticle-based agents that possess functions such as tumor targeting, imaging and therapy are currently under intensive investigation. This review introduces the basic concept of nanomedicine and the classification of nanoparticles. Because of their favorable pharmacokinetics, tumor targeting properties, and resulting superior efficacy and toxicity profiles, nanoparticle-based agents can overcome several limitations associated with conventional diagnostic and therapeutic protocols in veterinary oncology. The two most important tumor targeting mechanisms (passive and active tumor targeting) and their dominating factors (i.e. shape, charge, size and nanoparticle surface display) are discussed. The review summarizes published clinical and preclinical studies that utilize different nanoformulations in veterinary oncology, as well as the application of nanoparticles for cancer diagnosis and imaging. The toxicology of various nanoformulations is also considered. Given the benefits of nanoformulations demonstrated in human medicine, nanoformulated drugs are likely to gain more traction in veterinary oncology.

  4. Active surveillance: Oncologic outcome

    NARCIS (Netherlands)

    L.D.F. Venderbos (Lionne); L.P. Bokhorst (Leonard); C.H. Bangma (Chris); M.J. Roobol-Bouts (Monique)

    2013-01-01

    textabstractPURPOSE OF REVIEW: To give insight into recent literature (during the past 12-18 months) reporting on oncologic outcomes of men on active surveillance. RECENT FINDINGS: From recent published trials comparing radical prostatectomy vs. watchful waiting, we learn that radical treatment only

  5. Molecular imaging in oncology

    Energy Technology Data Exchange (ETDEWEB)

    Schober, Otmar; Riemann, Burkhard (eds.) [Universitaetsklinikum Muenster (Germany). Klinik fuer Nuklearmedizin

    2013-02-01

    Considers in detail all aspects of molecular imaging in oncology, ranging from basic research to clinical applications in the era of evidence-based medicine. Examines technological issues and probe design. Discusses preclinical studies in detail, with particular attention to multimodality imaging. Presents current clinical use of PET/CT, SPECT/CT, and optical imagingWritten by acknowledged experts. The impact of molecular imaging on diagnostics, therapy, and follow-up in oncology is increasing significantly. The process of molecular imaging includes key biotarget identification, design of specific molecular imaging probes, and their preclinical evaluation, e.g., in vivo using small animal studies. A multitude of such innovative molecular imaging probes have already entered clinical diagnostics in oncology. There is no doubt that in future the emphasis will be on multimodality imaging in which morphological, functional, and molecular imaging techniques are combined in a single clinical investigation that will optimize diagnostic processes. This handbook addresses all aspects of molecular imaging in oncology, ranging from basic research to clinical applications in the era of evidence-based medicine. The first section is devoted to technology and probe design, and examines a variety of PET and SPECT tracers as well as multimodality probes. Preclinical studies are then discussed in detail, with particular attention to multimodality imaging. In the third section, diverse clinical applications are presented, and the book closes by looking at future challenges. This handbook will be of value to all who are interested in the revolution in diagnostic oncology that is being brought about by molecular imaging.

  6. Line group techniques in description of the structural phase transitions in some superconductors

    Science.gov (United States)

    Meszaros, CS.; Balint, A.; Bankuti, J.

    1995-01-01

    The main features of the theory of line groups, and their irreducible representations are briefly discussed, as well as the most important applications of them. A new approach in the general symmetry analysis of the modulated systems is presented. It is shown, that the line group formalism could be a very effective tool in the examination of the structural phase transitions in High Temperature SUperconductors. As an example, the material YBa2Cu3O(7-x) is discussed briefly.

  7. Measurement of the velocity of a quantum object: A role of phase and group velocities

    Science.gov (United States)

    Lapinski, Mikaila; Rostovtsev, Yuri V.

    2017-08-01

    We consider the motion of a quantum particle in a free space. Introducing an explicit measurement procedure for velocity, we demonstrate that the measured velocity is related to the group and phase velocities of the corresponding matter waves. We show that for long distances the measured velocity coincides with the matter wave group velocity. We discuss the possibilities to demonstrate these effects for the optical pulses in coherently driven media or for radiation propagating in waveguides.

  8. ALLOYING-DRIVEN PHASE STABILITY IN GROUP-VB TRANSITION METALS UNDER COMPRESSION

    Energy Technology Data Exchange (ETDEWEB)

    Landa, A; Soderlind, P

    2011-04-11

    The change in phase stability of Group-VB (V, Nb, and Ta) transition metals due to pressure and alloying is explored by means of first-principles electronic-structure calculations. It is shown that under compression stabilization or destabilization of the ground-state body-centered cubic (bcc) phase of the metal is mainly dictated by the band-structure energy that correlates well with the position of the Kohn anomaly in the transverse acoustic phonon mode. The predicted position of the Kohn anomaly in V, Nb, and Ta is found to be in a good agreement with data from the inelastic x-ray or neutron scattering measurements. In the case of alloying the change in phase stability is defined by the interplay between the band-structure and Madelung energies. We show that band-structure effects determine phase stability when a particular Group-VB metal is alloyed with its nearest neighbors within the same d-transition series: the neighbor with less and more d electrons destabilize and stabilize the bcc phase, respectively. When V is alloyed with neighbors of a higher (4d- or 5d-) transition series, both electrostatic Madelung and band-structure energies stabilize the body-centered-cubic phase. The opposite effect (destabilization) happens when Nb or Ta is alloyed with neighbors of the 3d-transition series.

  9. OPTICAL PHASE CONJUGATION RESPONSE OF PHOTOINDUCED POLYMER FILMS CONTAINING AZOBENZENE MOIETIES WITH CHIRAL GROUP

    Institute of Scientific and Technical Information of China (English)

    Ze-da Xu; Yong Zhang; Xing-he Fan; Xin-hua Wan; Qi-feng Zhou

    2002-01-01

    An optically active monomer containing azobenzene moieties with chiral group (s-2-methyl-butyl), 4-[2-(methacryloyloxy)ethyloxy]-4'-(s-2-methyl-1-butyloxycarbonyl) azobenzene (M1) was synthesized. Polymer (PM1) possessing optical phase conjugated response was obtained by homopolymerization of the optically active monomer (M1) using free radical polymerization. The polymer was very soluble in common solvents and good optical quality films could be easily fabricated by spin coating. The optical phase conjugated responses of the polymer PM1 were measured by degenerate four-wave mixing (DFWM). In comparison with polymer containing no chiral group, it was found from the preliminary measurement of photoisomeric change that optical phase conjugated response of the PM1 in the long-range order hexagonal symmetry microstructure could be easily controlled by choosing the appropriate polarization direction of the irradiating beams (514.5 nm) and the irradiating number, presumably due to the chiral group in the PM1 molecular structure. For the case of the polymer investigated here, a chiral group side chain was introduced to increase optical phase conjugated response intensity with different polarization directions of the irradiating beams, which aims originally at searching for a new photoactive material.

  10. Modernizing Clinical Trial Eligibility Criteria: Recommendations of the American Society of Clinical Oncology-Friends of Cancer Research Organ Dysfunction, Prior or Concurrent Malignancy, and Comorbidities Working Group.

    Science.gov (United States)

    Lichtman, Stuart M; Harvey, R Donald; Damiette Smit, Marie-Anne; Rahman, Atiqur; Thompson, Michael A; Roach, Nancy; Schenkel, Caroline; Bruinooge, Suanna S; Cortazar, Patricia; Walker, Dana; Fehrenbacher, Louis

    2017-10-02

    Purpose Patients with organ dysfunction, prior or concurrent malignancies, and comorbidities are often excluded from clinical trials. Excluding patients on the basis of these factors results in clinical trial participants who are healthier and younger than the overall population of patients with cancer. Methods ASCO and Friends of Cancer Research established a multidisciplinary working group that included experts in trial design and conduct to examine how eligibility criteria could be more inclusive. The group analyzed current eligibility criteria; conducted original data analysis; considered safety concerns, potential benefits, research, and potential hurdles of this approach through discussion; and reached consensus on recommendations regarding updated eligibility criteria that prioritize inclusiveness without compromising patient safety. Results If renal toxicity and clearance are not of direct treatment-related concern, then patients with lower creatinine clearance values of > 30 mL/min should be included in trials. Inclusion of patients with mild to moderate hepatic dysfunction may be possible when the totality of the available nonclinical and clinical data indicates that inclusion is safe. Ejection fraction values should be used with investigator assessment of a patient's risk for heart failure to determine eligibility. Patients with laboratory parameters out of normal range as a result of hematologic disease should be included in trials. Measures of patient functional status should be included in trials to better assess fit versus frail patients. Conclusion Expanding inclusion of these patients will increase the number and diversity of patients in clinical trials and result in a more appropriate population of patients.

  11. Presurgical window of carboplatin and surgery and multidrug chemotherapy for the treatment of newly diagnosed metastatic or unresectable osteosarcoma: Pediatric Oncology Group Trial.

    Science.gov (United States)

    Ferguson, W S; Harris, M B; Goorin, A M; Gebhardt, M C; Link, M P; Shochat, S J; Siegal, G P; Devidas, M; Grier, H E

    2001-01-01

    Relapse remains a significant problem in patients with metastatic osteosarcoma. The response to carboplatin of patients with newly diagnosed metastatic or unresectable osteosarcoma was assessed in an upfront phase II window, which was followed-up by surgery and intensive multiagent chemotherapy. Thirty-seven patients, ages 3 to 23 years with histologically confirmed diagnoses of osteosarcoma, were treated between January 1992 and November 1994 with carboplatin 1,000 mg/m2 per dose administered as a 48-hour continuous infusion. Two courses were administered in 3-week intervals, depending on marrow recovery. After radiographic reevaluation, patients underwent surgical removal of tumor (if feasible) and then 40 weeks of chemotherapy with high-dose methotrexate, ifosfamide, doxorubicin, and cisplatin. One of the 37 evaluable patients demonstrated a partial response to carboplatin; there were no complete responses. Patients were additionally analyzed by the response of pulmonary metastases to therapy and the extent of tumor necrosis of the primary lesion. By these criteria, 8 of 37 (22%) of patients showed a response at one or more sites, whereas 20 of 37 (54%) had unequivocal disease progression. Severe myelosuppression was the major toxicity. The projected 3-year event-free and overall survival rates were 23.9% and 31.9%, respectively. Only 1 of 17 patients with unresectable disease or distant bone metastases remains alive, in contrast to 6 of 17 patients with the lung as their only metastatic site and two of three patients with resected regional bone metastases. Continuous-infusion carboplatin demonstrated limited activity as an upfront agent in patients with metastatic osteosarcoma at diagnosis, even at doses that result in severe and prolonged myelosuppression. Patients with isolated pulmonary metastases or resectable bone metastases have a longer median survival time and greater chance of long-term survival than do patients with unresectable bone disease, for whom

  12. A Research Agenda for Radiation Oncology: Results of the Radiation Oncology Institute's Comprehensive Research Needs Assessment

    Energy Technology Data Exchange (ETDEWEB)

    Jagsi, Reshma, E-mail: rjagsi@med.umich.edu [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Bekelman, Justin E. [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, PA (United States); Brawley, Otis W. [Department of Hematology and Oncology, Emory University, and American Cancer Society, Atlanta, Georgia (United States); Deasy, Joseph O. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Le, Quynh-Thu [Department of Radiation Oncology, Stanford University, Stanford, CA (United States); Michalski, Jeff M. [Department of Radiation Oncology, Washington University, St. Louis, MO (United States); Movsas, Benjamin [Department of Radiation Oncology, Henry Ford Health System, Detroit, MI (United States); Thomas, Charles R. [Department of Radiation Oncology, Oregon Health and Sciences University, Portland, OR (United States); Lawton, Colleen A. [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, WI (United States); Lawrence, Theodore S. [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Hahn, Stephen M. [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, PA (United States)

    2012-10-01

    Purpose: To promote the rational use of scarce research funding, scholars have developed methods for the systematic identification and prioritization of health research needs. The Radiation Oncology Institute commissioned an independent, comprehensive assessment of research needs for the advancement of radiation oncology care. Methods and Materials: The research needs assessment used a mixed-method, qualitative and quantitative social scientific approach, including structured interviews with diverse stakeholders, focus groups, surveys of American Society for Radiation Oncology (ASTRO) members, and a prioritization exercise using a modified Delphi technique. Results: Six co-equal priorities were identified: (1) Identify and develop communication strategies to help patients and others better understand radiation therapy; (2) Establish a set of quality indicators for major radiation oncology procedures and evaluate their use in radiation oncology delivery; (3) Identify best practices for the management of radiation toxicity and issues in cancer survivorship; (4) Conduct comparative effectiveness studies related to radiation therapy that consider clinical benefit, toxicity (including quality of life), and other outcomes; (5) Assess the value of radiation therapy; and (6) Develop a radiation oncology registry. Conclusions: To our knowledge, this prioritization exercise is the only comprehensive and methodologically rigorous assessment of research needs in the field of radiation oncology. Broad dissemination of these findings is critical to maximally leverage the impact of this work, particularly because grant funding decisions are often made by committees on which highly specialized disciplines such as radiation oncology are not well represented.

  13. Assessment of 4-nitrogenated benzyloxymethyl groups for 2'-hydroxyl protection in solid-phase RNA synthesis.

    Science.gov (United States)

    Cieślak, Jacek; Kauffman, Jon S; Kolodziejski, Michelle J; Lloyd, John R; Beaucage, Serge L

    2007-02-15

    The search for a 2'-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2'-O-(4-nitrogenated benzyloxy)methyl groups through solid-phase RNA synthesis using phosphoramidites 2a-d, 12a, and 14a. These phosphoramidites exhibited rapid and efficient coupling properties. Particularly noteworthy is the cleavage of the 2'-O-[4-(N-methylamino)benzyloxy]methyl groups in 0.1 M AcOH, which led to U19dT within 15 min at 90 degrees C. [reaction: see text

  14. Quality of Life (QOL) Analysis of a Randomized Radiation Dose Escalation Non-Small Cell Lung Cancer (NSCLC) Study: Radiation Therapy Oncology Group (RTOG) Trial 0617

    Science.gov (United States)

    Movsas, Benjamin; Hu, Chen; Sloan, Jeffrey; Bradley, Jeffrey; Komaki, Ritsuko; Masters, Gregory; Kavadi, Vivek; Narayan, Samir; Michalski, Jeff; Johnson, Douglas W.; Koprowski, Christopher; Curran, Walter J.; Garces, Yolanda I.; Gaur, Rakesh; Wynn, Raymond B.; Schallenkamp, John; Gelblum, Daphna Y.; MacRae, Robert M; Paulus, Rebecca; Choy, Hak

    2015-01-01

    Importance A recent randomized radiation dose escalation trial in unresectable stage III NSCLC showed a lower survival in the high-dose arm (74Gy vs. 60Gy) with concurrent chemotherapy. Quality of life (QOL), an important secondary endpoint, is presented here. Objective The primary QOL hypothesis predicted a clinically meaningful decline (CMD) in QOL via the Functional Assessment of Cancer Therapy-Lung Cancer Subscale (FACT-LCS) in the high-dose RT-arm at 3 months. Design RTOG 0617 was a randomized phase III study (conducted from Nov 2007 to Nov 2011) in stage III NSCLC using a 2×2 factorial design and stratified by histology, PET staging, performance status and radiation technique (3D-conformal RT [3DCRT] vs. intensity-modulated radiation [IMRT]). Setting 185 institutions in the USA and Canada. Participants Of 424 eligible stage III NSCLC patients randomized, 360 (85%) consented to QOL, of whom 313 (88%) completed baseline QOL assessments. Intervention for Clinical Trials 74Gy vs. 60Gy with concurrent and consolidation carboplatin/paclitaxel +/− cetuximab. Main Outcomes and Measures QOL was collected prospectively via FACT-Trial Outcome Index (FACT-TOI), equaling Physical-Well-Being (PWB) + Functional-Well-Being (FWB) + Lung Cancer Subscale (LCS). Data are presented at baseline & 3 and 12 months via minimal clinically meaningful changes of >=2 points for PWB, FWB or LCS or >=5 points for TOI. Results Patient demographics and baseline QOL scores were comparable between the 74Gy and 60Gy arms. Two-hundred-nineteen (72%) of living patients who completed QOL at baseline did so at 3 months and 137 (57%) of living patients did so at 12 months. Significantly more patients on 74Gy arm had clinically meaningful decline in FACT-LCS at 3 months than on the 60Gy arm (45% vs. 30%, p=0.02). At 12 months, fewer patients who received IMRT (vs 3DCRT) had clinically meaningful decline in FACT-LCS (21% vs 46%, p=0.003). Baseline FACT-TOI was associated with overall survival in

  15. Measuring Group Synchrony: A Cluster-Phase Method for Analyzing Multivariate Movement Time-Series

    Directory of Open Access Journals (Sweden)

    Michael eRichardson

    2012-10-01

    Full Text Available A new method for assessing group synchrony is introduced as being potentially useful for objectively determining degree of group cohesiveness or entitativity. The cluster-phase method of Frank and Richardson (2010 was used to analyze movement data from the rocking chair movements of six-member groups who rocked their chairs while seated in a circle facing the center. In some trials group members had no information about others’ movements (their eyes were shut or they had their eyes open and gazed at a marker in the center of the group. As predicted, the group level synchrony measure was able to distinguish between situations where synchrony would have been possible and situations where it would be impossible. Moreover, other aspects of the analysis illustrated how the cluster phase measures can be used to determine the type of patterning of group synchrony, and, when integrated with multi-level modeling, can be used to examine individual-level differences in synchrony and dyadic level synchrony as well.

  16. Diagnosis and management of acquired aplastic anemia in childhood. Guidelines from the Marrow Failure Study Group of the Pediatric Haemato-Oncology Italian Association (AIEOP).

    Science.gov (United States)

    Barone, Angelica; Lucarelli, Annunziata; Onofrillo, Daniela; Verzegnassi, Federico; Bonanomi, Sonia; Cesaro, Simone; Fioredda, Francesca; Iori, Anna Paola; Ladogana, Saverio; Locasciulli, Anna; Longoni, Daniela; Lanciotti, Marina; Macaluso, Alessandra; Mandaglio, Rosalba; Marra, Nicoletta; Martire, Baldo; Maruzzi, Matteo; Menna, Giuseppe; Notarangelo, Lucia Dora; Palazzi, Giovanni; Pillon, Marta; Ramenghi, Ugo; Russo, Giovanna; Svahn, Johanna; Timeus, Fabio; Tucci, Fabio; Cugno, Chiara; Zecca, Marco; Farruggia, Piero; Dufour, Carlo; Saracco, Paola

    2015-06-01

    Acquired aplastic anemia (AA) is a rare heterogeneous disease characterized by pancytopenia and hypoplastic bone marrow. The incidence is 2-3/million inhabitants/year, in Europe, but higher in East Asia. Survival in severe aplastic anemia (SAA) has markedly improved in the past 2 decades because of advances in hematopoietic stem cell transplantation, immunosuppressive and biologic drugs, and supportive care. In SAA hematopoietic stem cell transplant (HSCT) from a matched sibling donor (MSD) is the treatment of choice. If a MSD is not available, the options include immunosuppressive therapy (IST) or unrelated donor HSCT. The objective of this guideline is to provide healthcare professionals with clear guidance on the diagnosis and management of pediatric patients with AA. A preliminary, evidence-based document issued by a group of pediatric hematologists was discussed, modified and approved during a series of "Consensus Conferences" according to procedures previously validated by the AIEOP Board. The guidelines highlight the importance of referring pediatric patients with AA to pediatric centers with long experience in diagnosis, differential diagnosis, management, supportive care and follow-up of AA.

  17. Vesicular monoamine transporter protein expression correlates with clinical features, tumor biology, and MIBG avidity in neuroblastoma: a report from the Children's Oncology Group

    Energy Technology Data Exchange (ETDEWEB)

    Temple, William; Mendelsohn, Lori; Nekritz, Erin; Gustafson, W.C.; Matthay, Katherine K. [UCSF School of Medicine, Department of Pediatrics, San Francisco, CA (United States); UCSF Benioff Children' s Hospital, San Francisco, CA (United States); Kim, Grace E. [UCSF School of Medicine, Department of Pathology, San Francisco, CA (United States); Lin, Lawrence; Giacomini, Kathy [UCSF School of Pharmacy, Department of Bioengineering and Therapeutic Sciences, San Francisco, CA (United States); Naranjo, Arlene; Van Ryn, Collin [University of Florida, Children' s Oncology Group Statistics and Data Center, Gainesville, FL (United States); Yanik, Gregory A. [University of Michigan, CS Mott Children' s Hospital, Ann Arbor, MI (United States); Kreissman, Susan G. [Duke University Medical Center, Durham, NC (United States); Hogarty, Michael [University of Pennsylvania, Children' s Hospital of Philadelphia and Perelman School of Medicine, Philadelphia, PA (United States); DuBois, Steven G. [UCSF School of Medicine, Department of Pediatrics, San Francisco, CA (United States); UCSF Benioff Children' s Hospital, San Francisco, CA (United States); UCSF School of Medicine, San Francisco, CA (United States)

    2016-03-15

    Vesicular monoamine transporters 1 and 2 (VMAT1 and VMAT2) are thought to mediate MIBG uptake in adult neuroendocrine tumors. In neuroblastoma, the norepinephrine transporter (NET) has been investigated as the principal MIBG uptake protein, though some tumors without NET expression concentrate MIBG. We investigated VMAT expression in neuroblastoma and correlated expression with MIBG uptake and clinical features. We evaluated VMAT1 and VMAT2 expression by immunohistochemistry (IHC) in neuroblastoma tumors from 76 patients with high-risk metastatic disease treated in a uniform cooperative group trial (COG A3973). All patients had baseline MIBG diagnostic scans centrally reviewed. IHC results were scored as the product of intensity grading (0 - 3+) and percent of tumor cells expressing the protein of interest. The association between VMAT1 and VMAT2 scores and clinical and biological features was tested using Wilcoxon rank-sum tests. Patient characteristics were typical of high-risk neuroblastoma, though the cohort was intentionally enriched in patients with MIBG-nonavid tumors (n = 20). VMAT1 and VMAT2 were expressed in 62 % and 75 % of neuroblastoma tumors, respectively. VMAT1 and VMAT2 scores were both significantly lower in MYCN amplified tumors and in tumors with high mitotic karyorrhectic index. MIBG-avid tumors had significantly higher VMAT2 scores than MIBG-nonavid tumors (median 216 vs. 45; p = 0.04). VMAT1 expression did not correlate with MIBG avidity. VMAT1 and VMAT2 are expressed in the majority of neuroblastomas. Expression correlates with other biological features. The expression level of VMAT2 but not that of VMAT1 correlates with avidity for MIBG. (orig.)

  18. Prevalence of BRCA1 mutations among 403 women with triple-negative breast cancer: implications for genetic screening selection criteria: a Hellenic Cooperative Oncology Group Study.

    Science.gov (United States)

    Fostira, Florentia; Tsitlaidou, Marianthi; Papadimitriou, Christos; Pertesi, Maroulio; Timotheadou, Eleni; Stavropoulou, Alexandra V; Glentis, Stavros; Bournakis, Evangelos; Bobos, Mattheos; Pectasides, Dimitrios; Papakostas, Pavlos; Pentheroudakis, George; Gogas, Helen; Skarlos, Pantelis; Samantas, Epaminontas; Bafaloukos, Dimitrios; Kosmidis, Paris A; Koutras, Angelos; Yannoukakos, Drakoulis; Konstantopoulou, Irene; Fountzilas, George

    2012-07-01

    In spite the close association of the triple-negative breast cancer immunophenotype with hereditary breast cancers and the BRCA1 pathway, there is a lack of population studies that determine the frequency of BRCA1 mutations among triple-negative breast cancer patients. To address this, we have screened a large sample of 403 women diagnosed with triple-negative invasive breast cancer, independently of their age or family history, for germline BRCA1 mutations. Median age at diagnosis was 50 years (range 20-83). The overall prevalence of triple-negative cases among the initial patient group with invasive breast cancer was 8%. BRCA1 was screened by direct DNA sequencing in all patients, including all exons where a mutation was previously found in the Greek population (exons 5, 11, 12, 16, 20, 21, 22, 23, 24-77% of the BRCA1 coding region), including diagnostic PCRs to detect the three Greek founder large genomic rearrangements. Sixty-five deleterious BRCA1 mutations were identified among the 403 triple-negative breast cancer patients (16%). Median age of onset for mutation carriers was 39 years. Among a total of 106 women with early-onset triple-negative breast cancer (<40 years), 38 (36%) had a BRCA1 mutation, while 27% of women with triple-negative breast cancer diagnosed before 50 years (56/208) had a BRCA1 mutation. A mutation was found in 48% (50/105) of the triple-negative breast cancer patients with family history of breast or ovarian cancer. It is noteworthy, however, that of the 65 carriers, 15 (23%) had no reported family history of related cancers. All but one of the carriers had grade III tumors (98%). These results indicate that women with early-onset triple-negative breast cancer, and ideally all triple-negative breast cancer patients, are candidates for BRCA1 genetic testing even in the absence of a family history of breast or ovarian cancer.

  19. What, why, and when we image: considerations for diagnostic imaging and clinical research in the Children's Oncology Group

    Energy Technology Data Exchange (ETDEWEB)

    Reaman, Gregory H. [The George Washington University, School of Medicine and Health Sciences, Division of Hematology Oncology, Children' s National Medical Center, Washington, DC (United States)

    2009-02-15

    Success in improving treatment outcomes in childhood cancer has been achieved almost exclusively through multicenter and multidisciplinary clinical and applied research over several decades. While biologically rational as well as empirical approaches have led to combination chemotherapy and multimodality approaches to therapy, which have given rise to evidence-based practice standards, similar scientific rigor has not always been as evidently applied to modalities utilized to assess initial disease burden and, more important, response to investigational approaches to therapy. As the empirical approach to therapeutic advances has likely maximized its benefit, future progress will require translation of biologic discovery most notably from the areas of genomics and proteomics. Hence, attempts to improve efficacy of therapy will require a parallel effort to minimize collateral damage of future therapeutic approaches, and such a parallel approach will mandate the continued dependence on advances in diagnostic imaging for improvements in staging methodologies to best define risk groups for risk-adjusted therapy. In addition, anatomic and functional assessment of response and surveillance for disease recurrence will require improved understanding of the biology as well as natural history of individual diseases, which one hopes will better inform investigators in designing trials. Clinical and research expertise is urgently needed in the selection of specific imaging studies and frequencies that best assess a response as well as to define disease-free intervals. Despite limited resources to develop sufficient infrastructure, emphasis on enabling early assessment of new technology to minimize risks associated with treatment advances and with those critical diagnostic and staging procedures must continue to be a focus of pediatric cancer clinical research. (orig.)

  20. Do all patients in the phase I oncology trials need to be hospitalized? Domestic but outstanding issues for globalization of drug development in Japan.

    Science.gov (United States)

    Shimomura, Akihiko; Kondo, Shunsuke; Kobayashi, Noriko; Iwasa, Satoru; Kitano, Shigehisa; Tamura, Kenji; Fujiwara, Yutaka; Yamamoto, Noboru

    2017-08-01

    Most trials investigating new drugs around the world, including phase I trials, are conducted in outpatient clinics. However, in Japan, regulatory authority requirements and traditional domestic guidelines often require hospitalization of phase I study participants. Patients participating in single-agent phase I clinical trials at National Cancer Center Hospital between December 1996 and August 2014 were monitored. Toxicity requiring hospitalization is defined as toxicity that needs intensive treatment. Study designs were classified into three types: first-in-human (FIH) study, dose-escalation study (conventional dose-escalation study to determine maximum tolerated dose (MTD) in Japanese patients), and dose-finding study (to assess safety and pharmacokinetic profiles up to the MTD previously determined in the West). A total of 945 patients who participated in a variety of single-agent phase I clinical trials between December 1996 and August 2014 were included in this study. Patients participated in one of three study types: dose-escalation (n = 582, 62%), first-in-human (n = 129, 14%), or dose-finding (n = 234, 25%). A total of 76 study drugs were evaluated as part of this pool of phase I studies. Subdivided by mechanism of action, 20 (26%) were cytotoxic, 50 (66%) were molecularly targeted, and 6 (8%) were immune checkpoint inhibitor. Thirty-six patients (3.8%) had severe toxicities requiring hospitalization during the first cycle. The overall number of toxicities requiring hospitalization and/or grade 4 toxicities during any cycle was 5.0%. The frequency of severe toxicity that needs to be hospitalized was unexpectedly low. The data did not demonstrate the need for hospitalization in the phase I trials, suggesting that phase I trials in Japan could be conducted in outpatient settings.

  1. Integrative oncology: an overview.

    Science.gov (United States)

    Deng, Gary; Cassileth, Barrie

    2014-01-01

    Integrative oncology, the diagnosis-specific field of integrative medicine, addresses symptom control with nonpharmacologic therapies. Known commonly as "complementary therapies" these are evidence-based adjuncts to mainstream care that effectively control physical and emotional symptoms, enhance physical and emotional strength, and provide patients with skills enabling them to help themselves throughout and following mainstream cancer treatment. Integrative or complementary therapies are rational and noninvasive. They have been subjected to study to determine their value, to document the problems they ameliorate, and to define the circumstances under which such therapies are beneficial. Conversely, "alternative" therapies typically are promoted literally as such; as actual antitumor treatments. They lack biologic plausibility and scientific evidence of safety and efficacy. Many are outright fraudulent. Conflating these two very different categories by use of the convenient acronym "CAM," for "complementary and alternative therapies," confuses the issue and does a substantial disservice to patients and medical professionals. Complementary and integrative modalities have demonstrated safety value and benefits. If the same were true for "alternatives," they would not be "alternatives." Rather, they would become part of mainstream cancer care. This manuscript explores the medical and sociocultural context of interest in integrative oncology as well as in "alternative" therapies, reviews commonly-asked patient questions, summarizes research results in both categories, and offers recommendations to help guide patients and family members through what is often a difficult maze. Combining complementary therapies with mainstream oncology care to address patients' physical, psychologic and spiritual needs constitutes the practice of integrative oncology. By recommending nonpharmacologic modalities that reduce symptom burden and improve quality of life, physicians also enable

  2. Neurologic complications in oncology

    Directory of Open Access Journals (Sweden)

    Andrea Pace

    2010-06-01

    Full Text Available Neurologic side effects related to cancer therapy are a common problem in oncology practice. These complications can negatively affect the management of the patient, because they can inhibit treatment and diminish quality of life. Therefore specific skills are required to recognise symptoms and clinical manifestations. This review focuses on the most common neurologic complications to improve physician’s familiarity in determining the aetiology of these symptoms.

  3. Significance of PIK3CA Mutations in Patients with Early Breast Cancer Treated with Adjuvant Chemotherapy: A Hellenic Cooperative Oncology Group (HeCOG Study.

    Directory of Open Access Journals (Sweden)

    George Papaxoinis

    Full Text Available The PI3K-AKT pathway is frequently activated in breast cancer. PIK3CA mutations are most frequently found in the helical (exon 9 and kinase (exon 20 domains of this protein. The aim of the present study was to examine the role of different types of PIK3CA mutations in combination with molecular biomarkers related to PI3K-AKT signaling in patients with early breast cancer.Tumor tissue samples from 1008 early breast cancer patients treated with adjuvant chemotherapy in two similar randomized trials of HeCOG were examined. Tumors were subtyped with immunohistochemistry (IHC and FISH for ER, PgR, Ki67, HER2 and androgen receptor (AR. PIK3CA mutations were analyzed by Sanger sequencing (exon 20 and qPCR (exon 9 (Sanger/qPCR mutations. In 610 cases, next generation sequencing (NGS PIK3CA mutation data were also available. PIK3CA mutations and PTEN protein expression (IHC were analyzed in luminal tumors (ER and/or PgR positive, molecular apocrine carcinomas (MAC; ER/PgR negative / AR positive and hormone receptor (ER/PgR/AR negative tumors.PIK3CA mutations were detected in 235/1008 tumors (23% with Sanger/qPCR and in 149/610 tumors (24% with NGS. Concordance between the two methods was good with a Kappa coefficient of 0.76 (95% CI 0.69-0.82. Lobular histology, low tumor grade and luminal A tumors were associated with helical domain mutations (PIK3CAhel, while luminal B with kinase domain mutations (PIK3CAkin. The overall incidence of PIK3CA mutations was higher in luminal as compared to MAC and hormone receptor negative tumors (p = 0.004. Disease-free and overall survival did not significantly differ with respect to PIK3CA mutation presence and type. However, a statistically significant interaction between PIK3CA mutation status and PTEN low protein expression with regard to prognosis was identified.The present study did not show any prognostic significance of specific PIK3CA mutations in a large group of predominantly lymph-node positive breast cancer

  4. Nasopharyngeal carcinoma in a low incidence European area. A prospective observational analysis from the Head and Neck Study Group of the Italian Society of Radiation Oncology (AIRO)

    Energy Technology Data Exchange (ETDEWEB)

    Tonoli, S.; Bruschieri, L. [Brescia University, Istituto del Radio, Brescia (Italy); Alterio, D. [European Institute of Oncology, Milan (Italy); Caspiani, O. [Isola Tiberina Hospital, Rome (Italy); Bacigalupo, A. [IRCCS A.O.U. San Martino IST Genoa, Genoa (Italy); Bunkheila, F. [S. Orsola Hospital, Bologna (Italy); Cianciulli, M. [S. Camillo Hospital, Rome (Italy); Merlotti, A. [Busto Arsizio Hospital, Busto Arsizio (Italy); Podhradska, A. [Milan University - Monza S. Gerardo Hospital, Milan (Italy); Rampino, M. [Turin University, Turin (Italy); Cante, D. [Treviglio Hospital, Treviglio (Italy); Gatta, R. [Brescia University, Istituto del Radio, Brescia (Italy); Prato Hospital, Prato (Italy); Magrini, S.M.

    2016-12-15

    To evaluate the outcomes with respect to long-term survival and toxicity in patients with nasopharyngeal carcinoma (NPC) treated in a European country with low incidence. A prospective observational study carried out by the AIRO Head and Neck group in 12 Italian institutions included 136 consecutive patients treated with radiotherapy (RT) ± chemotherapy (CHT) for NPC (without distant metastasis) between January 1, 2008 and December 31, 2010. The disease-specific survival (DSS), overall survival (OS), and disease-free survival (DFS) at 5 years were 92 (±2), 91 (±3), and 69 % (±5 %), respectively. Distant failure was the most frequent modality of relapse. The local, regional, and locoregional control at 5 years were 89 (±3), 93 (±3), and 84 % (±4 %), respectively. The incidence of acute and late toxicity and the correlations with different clinical/technical variables were analyzed. Neoadjuvant CHT prolongs radiotherapy overall treatment time (OTT) and decreases treatment adherence during concomitant chemoradiotherapy. An adequate minimum dose coverage to PTV(T) is a predictive variable well related to outcome. Our data do not substantially differ in terms of survival and toxicity outcomes from those reported in larger series of patients treated in countries with higher incidences of NPC. The T stage (TNM 2002 UICC classification) is predictive of DSS and OS. The GTV volume (T ± N) and an adequate minimum PTV(T) coverage dose (D95 %) were also identified as potential predictive variables. Sophisticated technologies of dose delivery (IMRT) with image-guided radiotherapy could help to obtain better minimum PTV(T) coverage dose with increased DFS; distant metastasis after treatment still remains an unresolved issue. (orig.) [German] Bewertung von langfristigem Ueberleben und Toxizitaet bei Patienten mit Nasopharynxkarzinom (NPC), die in einem europaeischen Land mit geringer Inzidenz behandelt wurden. Die prospektive Beobachtungsanalyse, durchgefuehrt von der

  5. Many-body localization phase transition: A simplified strong-randomness approximate renormalization group

    Science.gov (United States)

    Zhang, Liangsheng; Zhao, Bo; Devakul, Trithep; Huse, David A.

    2016-06-01

    We present a simplified strong-randomness renormalization group (RG) that captures some aspects of the many-body localization (MBL) phase transition in generic disordered one-dimensional systems. This RG can be formulated analytically and is mathematically equivalent to a domain coarsening model that has been previously solved. The critical fixed-point distribution and critical exponents (that satisfy the Chayes inequality) are thus obtained analytically or to numerical precision. This reproduces some, but not all, of the qualitative features of the MBL phase transition that are indicated by previous numerical work and approximate RG studies: our RG might serve as a "zeroth-order" approximation for future RG studies. One interesting feature that we highlight is that the rare Griffiths regions are fractal. For thermal Griffiths regions within the MBL phase, this feature might be qualitatively correctly captured by our RG. If this is correct beyond our approximations, then these Griffiths effects are stronger than has been previously assumed.

  6. Influence of head group methylation on the phase behavior of lipid monolayers

    DEFF Research Database (Denmark)

    Brezesinski, G.; Bringezu, F.; Weidemann, G.

    1998-01-01

    per three tails exceeds that per head, an influence of the head group methylation on the monolayer structure is observed. The tilt angles at lower lateral pressures and the transition pressure to a hexagonal packing of upright oriented chains increase with increasing methylation degree. The transition...... from the NN tilted rectangular to this hexagonal phase is connected with a pressure region where the in-plane components Q(xy) of the two peaks coincide while the out-of-plane components Q(z) differ. This indicates an undistorted hexagonal in-plane lattice even for tilted chains. The area-pressure...... and X-ray measurements below 10 mN/m, can be explained by the formation of holes in the monolayer. Possibly the tilting of the triple-chain molecules leads to an orientational ordering of the head group dipoles and therefore to an electrostatic repulsion between condensed phase domains. (C) 1998...

  7. Time from prior chemotherapy enhances prognostic risk grouping in the second-line setting of advanced urothelial carcinoma: a retrospective analysis of pooled, prospective phase 2 trials.

    Science.gov (United States)

    Sonpavde, Guru; Pond, Gregory R; Fougeray, Ronan; Choueiri, Toni K; Qu, Angela Q; Vaughn, David J; Niegisch, Guenter; Albers, Peter; James, Nicholas D; Wong, Yu-Ning; Ko, Yoo-Joung; Sridhar, Srikala S; Galsky, Matthew D; Petrylak, Daniel P; Vaishampayan, Ulka N; Khan, Awais; Vogelzang, Nicholas J; Beer, Tomasz M; Stadler, Walter M; O'Donnell, Peter H; Sternberg, Cora N; Rosenberg, Jonathan E; Bellmunt, Joaquim

    2013-04-01

    Outcomes for patients in the second-line setting of advanced urothelial carcinoma (UC) are dismal. The recognized prognostic factors in this context are Eastern Cooperative Oncology Group (ECOG) performance status (PS) >0, hemoglobin level (Hb) value of time from prior chemotherapy (TFPC) independent of known prognostic factors. Data from patients from seven prospective trials with available baseline TFPC, Hb, PS, and LM values were used for retrospective analysis (n=570). External validation was conducted in a second-line phase 3 trial comparing best supportive care (BSC) versus vinflunine plus BSC (n=352). Cox proportional hazards regression was used to evaluate the association of factors, with overall survival (OS) and progression-free survival (PFS) being the respective primary and secondary outcome measures. ECOG-PS >0, LM, Hb 0, Hb <10 g/dl, and LM in the setting of second-line therapy for advanced UC. These data may facilitate drug development and interpretation of trials. Copyright © 2012 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  8. Internal character dictates phase transition dynamics between isolation and cohesive grouping

    CERN Document Server

    Manrique, Pedro D; Johnson, Neil F

    2015-01-01

    We show that accounting for internal character among interacting, heterogeneous entities generates rich phase transition behavior between isolation and cohesive dynamical grouping. Our analytical and numerical calculations reveal different critical points arising for different character-dependent grouping mechanisms. These critical points move in opposite directions as the population's diversity decreases. Our analytical theory helps explain why a particular class of universality is so common in the real world, despite fundamental differences in the underlying entities. Furthermore, it correctly predicts the non-monotonic temporal variation in connectivity observed recently in one such system.

  9. Line group techniques in description of the structural phase transitions in some superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Meszaros, C.; Bankuti, J. [Roland Eoetvoes Univ., Budapest (Hungary); Balint, A. [Univ. of Agricultural Sciences, Goedoello (Hungary)

    1994-12-31

    The main features of the theory of line groups, and their irreducible representations are briefly discussed, as well as the most important applications of them. A new approach in the general symmetry analysis of the modulated systems is presented. It is shown, that the line group formalism could be a very effective tool in the examination of the structural phase transitions in High Temperature Superconductors. As an example, the material YBa{sub 2}Cu{sub 3}O{sub 7-x} is discussed briefly.

  10. Overall survival and local recurrence of 406 completely resected stage IIIa-N2 non-small cell lung cancer patients: questionnaire survey of the Japan Clinical Oncology Group to plan for clinical trials.

    Science.gov (United States)

    Ichinose, Y; Kato, H; Koike, T; Tsuchiya, R; Fujisawa, T; Shimizu, N; Watanabe, Y; Mitsudomi, T; Yoshimura, M

    2001-10-01

    the group of completely resected stage IIIA-N2 non-small cell lung cancer patients (NSCLC) is considered to be heterogeneous in various aspects including survival and the recurrent pattern. In the present study, we attempted to clarify the factors which separate these patients into high and low risk groups based on the survival and local recurrence. a questionnaire survey on the survival and local recurrence of non-small cell lung cancer patients with pathological stage IIIA-N2 disease who underwent a complete resection from January 1992 to December 1993 was performed by the Japan Clinical Oncology Group as of July 1999. The information on the survival of 406 patients and that of local recurrence in 332 of them was available. the 5-year survival of the 406 patients was 31.0%. In a univariate analysis, the age, clinical and pathological T status, number of N2 stations, pathological N1 disease, operative modality and postoperative radiotherapy were all found to be important prognostic factors. Clinical N2 disease marginally influenced the survival (P=0.07). In a multivariate analysis of these variables including clinical N2 disease, the survival was significantly worse in the case of multiple N2 stations (hazard ratio=1.741), the presence of pathological N1 disease (1.403), pathological T2 or 3 disease (1.399) and an age older than 65 (1.327). The rate of freedom from any local recurrence at the bronchial stump, or in the hilar, mediastinal or supraclavicular lymph nodes at 5 years was 64%. In a univariate analysis of the freedom from local recurrence, the clinical N status, pathological T status, pathological N1 disease and number of N2 stations were all found to be important prognostic factors. A multivariate analysis revealed the freedom from local recurrence to be adversely influenced by multiple N2 stations (hazard ratio=2.05), and the presence of either clinical N1 or 2 (1.733) disease. The 5-year survival and the rate of freedom from local recurrence at 5

  11. Results of a Quality Assurance Review of External Beam Radiation Therapy in the International Society of Paediatric Oncology (Europe) Neuroblastoma Group's High-risk Neuroblastoma Trial: A SIOPEN Study

    Energy Technology Data Exchange (ETDEWEB)

    Gaze, Mark N., E-mail: mark.gaze@uclh.nhs.uk [Department of Oncology, University College London Hospitals NHS Foundation Trust, London (United Kingdom); Boterberg, Tom [Department of Radiation Oncology, Ghent University Hospital, Ghent (Belgium); Dieckmann, Karin; Hoermann, Marcus [General Hospital Vienna, Medical University Vienna (Austria); Gains, Jennifer E.; Sullivan, Kevin P. [Department of Oncology, University College London Hospitals NHS Foundation Trust, London (United Kingdom); Ladenstein, Ruth [Children' s Cancer Research Institute, St. Anna Children' s Hospital, Vienna (Austria)

    2013-01-01

    Purpose: Radiation therapy is important for local control in neuroblastoma. This study reviewed the compliance of plans with the radiation therapy guidelines of the International Society of Paediatric Oncology (Europe) Neuroblastoma Group (SIOPEN) High-Risk Trial protocol. Methods and Materials: The SIOPEN trial central electronic database has sections to record diagnostic imaging and radiation therapy planning data. Individual centers may upload data remotely, but not all centers involved in the trial chose to use this system. A quality scoring system was devised based on how well the radiation therapy plan matched the protocol guidelines, to what extent deviations were justified, and whether adverse effects may result. Central review of radiation therapy planning was undertaken retrospectively in 100 patients for whom complete diagnostic and treatment sets were available. Data were reviewed and compared against protocol guidelines by an international team of radiation oncologists and radiologists. For each patient in the sample, the central review team assigned a quality assurance score. Results: It was found that in 48% of patients there was full compliance with protocol requirements. In 29%, there were deviations for justifiable reasons with no likely long-term adverse effects resulting. In 5%, deviations had occurred for justifiable reasons, but that might result in adverse effects. In 1%, there was a deviation with no discernible justification, which would not lead to long-term adverse events. In 17%, unjustified deviations were noted, with a risk of an adverse outcome resulting. Conclusions: Owing to concern over the proportion of patients in whom unjustified deviations were observed, a protocol amendment has been issued. This offers the opportunity for central review of radiation therapy plans before the start of treatment and the treating clinician a chance to modify plans.

  12. A Paired, Double-Blind, Randomized Comparison of a Moisturizing Durable Barrier Cream to 10% Glycerine Cream in the Prophylactic Management of Postmastectomy Irradiation Skin Care: Trans Tasman Radiation Oncology Group (TROG) 04.01

    Energy Technology Data Exchange (ETDEWEB)

    Graham, Peter H., E-mail: peter.graham@sesiahs.health.nsw.gov.au [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Plant, Natalie; Graham, Jennifer L.; Browne, Lois [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Borg, Martin [Department of Radiation Oncology, Royal Adelaide Hospital (Australia); Capp, Anne [Department of Radiation Oncology, Mater Hospital, Newcastle, New South Wales (Australia); Delaney, Geoff P. [Cancer Care Centre, Liverpool Hospital, Liverpool, New South Wales (Australia); Harvey, Jennifer [Mater Hospital, South Brisbane, Queensland (Australia); Kenny, Lisbeth [Royal Brisbane Hospital, Herston, Queensland (Australia); Francis, Michael [Andrew Love Cancer Centre, Geelong (Australia); Zissiadis, Yvonne [Department of Radiation Oncology, Royal Perth Hospital, Perth (Australia)

    2013-05-01

    Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies.

  13. The helical phase of chiral nematic liquid crystals as the Bianchi VII(0) group manifold

    CERN Document Server

    Gibbons, G W

    2011-01-01

    We show that the optical structure of the helical phase of a chiral nematic is naturally associated with the Bianchi VII(0) group manifold. The Joets-Ribotta metric governing propagation of the extraordinary rays is invariant under the simply transitive action of the universal cover of the three dimensional Euclidean group of two dimensions. Thus extraordinary light rays are geodesics of a left-invariant metric on this Bianchi type VII(0) group. We are able to solve by separation of variables both the wave equation and the Hamilton-Jacobi equation for this metric. The former reduces to Mathieu's equation and the later to the quadrantal pendulum equation. We further discuss Maxwell's equations for uniaxial optical materials where the configuration is invariant under a group action. The material is not assumed to be impedance matched, thus going beyond the usual scope of transformation optics. We show that for a chiral nematic in its helical phase Maxwell's equations reduce to a generalised Mathieu equation. Ou...

  14. Influence of the leaving group on the dynamics of a gas-phase SN2 reaction

    Science.gov (United States)

    Stei, Martin; Carrascosa, Eduardo; Kainz, Martin A.; Kelkar, Aditya H.; Meyer, Jennifer; Szabó, István; Czakó, Gábor; Wester, Roland

    2016-02-01

    In addition to the nucleophile and solvent, the leaving group has a significant influence on SN2 nucleophilic substitution reactions. Its role is frequently discussed with respect to reactivity, but its influence on the reaction dynamics remains unclear. Here, we uncover the influence of the leaving group on the gas-phase dynamics of SN2 reactions in a combined approach of crossed-beam imaging and dynamics simulations. We have studied the reaction F- + CH3Cl and compared it to F- + CH3I. For the two leaving groups, Cl and I, we find very similar structures and energetics, but the dynamics show qualitatively different features. Simple scaling of the leaving group mass does not explain these differences. Instead, the relevant impact parameters for the reaction mechanisms are found to be crucial and the differences are attributed to the relative orientation of the approaching reactants. This effect occurs on short timescales and may also prevail in solution-phase conditions.

  15. Standardizing Naming Conventions in Radiation Oncology

    Energy Technology Data Exchange (ETDEWEB)

    Santanam, Lakshmi [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Hurkmans, Coen [Department of Radiation Oncology, Catharina Hospital, Eindhoven (Netherlands); Mutic, Sasa [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Vliet-Vroegindeweij, Corine van [Department of Radiation Oncology, Thomas Jefferson University Hospital, Philadelphia, PA (United States); Brame, Scott; Straube, William [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Galvin, James [Department of Radiation Oncology, Thomas Jefferson University Hospital, Philadelphia, PA (United States); Tripuraneni, Prabhakar [Department of Radiation Oncology, Scripps Clinic, LaJolla, CA (United States); Michalski, Jeff [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Bosch, Walter, E-mail: wbosch@radonc.wustl.edu [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Advanced Technology Consortium, Image-guided Therapy QA Center, St. Louis, MO (United States)

    2012-07-15

    Purpose: The aim of this study was to report on the development of a standardized target and organ-at-risk naming convention for use in radiation therapy and to present the nomenclature for structure naming for interinstitutional data sharing, clinical trial repositories, integrated multi-institutional collaborative databases, and quality control centers. This taxonomy should also enable improved plan benchmarking between clinical institutions and vendors and facilitation of automated treatment plan quality control. Materials and Methods: The Advanced Technology Consortium, Washington University in St. Louis, Radiation Therapy Oncology Group, Dutch Radiation Oncology Society, and the Clinical Trials RT QA Harmonization Group collaborated in creating this new naming convention. The International Commission on Radiation Units and Measurements guidelines have been used to create standardized nomenclature for target volumes (clinical target volume, internal target volume, planning target volume, etc.), organs at risk, and planning organ-at-risk volumes in radiation therapy. The nomenclature also includes rules for specifying laterality and margins for various structures. The naming rules distinguish tumor and nodal planning target volumes, with correspondence to their respective tumor/nodal clinical target volumes. It also provides rules for basic structure naming, as well as an option for more detailed names. Names of nonstandard structures used mainly for plan optimization or evaluation (rings, islands of dose avoidance, islands where additional dose is needed [dose painting]) are identified separately. Results: In addition to its use in 16 ongoing Radiation Therapy Oncology Group advanced technology clinical trial protocols and several new European Organization for Research and Treatment of Cancer protocols, a pilot version of this naming convention has been evaluated using patient data sets with varying treatment sites. All structures in these data sets were

  16. Grade Inflation in Medical Student Radiation Oncology Clerkships: Missed Opportunities for Feedback?

    Energy Technology Data Exchange (ETDEWEB)

    Grover, Surbhi, E-mail: surbhi.grover@uphs.upenn.edu [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, Pennsylvania (United States); Swisher-McClure, Samuel [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, Pennsylvania (United States); Sosnowicz, Stasha [University of Pennsylvania, Philadelphia, Pennsylvania (United States); Li, Jiaqi; Mitra, Nandita [Department of Biostatistics and Epidemiology, University of Pennsylvania, Philadelphia, Pennsylvania (United States); Berman, Abigail T.; Baffic, Cordelia; Vapiwala, Neha; Freedman, Gary M. [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, Pennsylvania (United States)

    2015-07-15

    Purpose: To test the hypothesis that medical student radiation oncology elective rotation grades are inflated and cannot be used to distinguish residency applicants. Methods and Materials: The records of 196 applicants to a single radiation oncology residency program in 2011 and 2012 were retrospectively reviewed. The grades for each rotation in radiation oncology were collected and converted to a standardized 4-point grading scale (honors, high pass, pass, fail). Pass/fail grades were scored as not applicable. The primary study endpoint was to compare the distribution of applicants' grades in radiation oncology with their grades in medicine, surgery, pediatrics, and obstetrics/gynecology core clerkships. Results: The mean United States Medical Licensing Examination Step 1 score of the applicants was 237 (range, 188-269), 43% had additional Masters or PhD degrees, and 74% had at least 1 publication. Twenty-nine applicants were graded for radiation oncology rotations on a pass/fail basis and were excluded from the final analysis. Of the remaining applicants (n=167), 80% received the highest possible grade for their radiation oncology rotations. Grades in radiation oncology were significantly higher than each of the other 4 clerkships studied (P<.001). Of all applicants, 195 of 196 matched into a radiation oncology residency. Higher grades in radiation oncology were associated with significantly higher grades in the pediatrics core clerkship (P=.002). However, other medical school performance metrics were not significantly associated with higher grades in radiation oncology. Conclusions: Although our study group consists of a selected group of radiation oncology applicants, their grades in radiation oncology clerkships were highly skewed toward the highest grades when compared with grades in other core clerkships. Student grading in radiation oncology clerkships should be re-evaluated to incorporate more objective and detailed performance metrics to allow for

  17. Renormalization group evolution of neutrino parameters in presence of seesaw threshold effects and Majorana phases

    Directory of Open Access Journals (Sweden)

    Shivani Gupta

    2015-04-01

    Full Text Available We examine the renormalization group evolution (RGE for different mixing scenarios in the presence of seesaw threshold effects from high energy scale (GUT to the low electroweak (EW scale in the Standard Model (SM and Minimal Supersymmetric Standard Model (MSSM. We consider four mixing scenarios namely Tri–Bimaximal Mixing, Bimaximal Mixing, Hexagonal Mixing and Golden Ratio Mixing which come from different flavor symmetries at the GUT scale. We find that the Majorana phases play an important role in the RGE running of these mixing patterns along with the seesaw threshold corrections. We present a comparative study of the RGE of all these mixing scenarios both with and without Majorana CP phases when seesaw threshold corrections are taken into consideration. We find that in the absence of these Majorana phases both the RGE running and seesaw effects may lead to θ13<5° at low energies both in the SM and MSSM. However, if the Majorana phases are incorporated into the mixing matrix the running can be enhanced both in the SM and MSSM. Even by incorporating non-zero Majorana CP phases in the SM, we do not get θ13 in its present 3σ range. The current values of the two mass squared differences and mixing angles including θ13 can be produced in the MSSM case with tan⁡β=10 and non-zero Majorana CP phases at low energy. We also calculate the order of effective Majorana mass and Jarlskog Invariant for each scenario under consideration.

  18. Medicinal cannabis in oncology.

    Science.gov (United States)

    Engels, Frederike K; de Jong, Floris A; Mathijssen, Ron H J; Erkens, Joëlle A; Herings, Ron M; Verweij, Jaap

    2007-12-01

    In The Netherlands, since September 2003, a legal medicinal cannabis product, constituting the whole range of cannabinoids, is available for clinical research, drug development strategies, and on prescription for patients. To date, this policy, initiated by the Dutch Government, has not yet led to the desired outcome; the amount of initiated clinical research is less than expected and only a minority of patients resorts to the legal product. This review aims to discuss the background for the introduction of legal medicinal cannabis in The Netherlands, the past years of Dutch clinical experience in oncology practice, possible reasons underlying the current outcome, and future perspectives.

  19. Numerical renormalization group for impurity quantum phase transitions: structure of critical fixed points

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyun-Jung [Theoretische Physik III, Elektronische Korrelationen und Magnetismus, Institut fuer Physik, Universitaet Augsburg, D-86135 Augsburg (Germany); Bulla, Ralf [Theoretische Physik III, Elektronische Korrelationen und Magnetismus, Institut fuer Physik, Universitaet Augsburg, D-86135 Augsburg (Germany); Vojta, Matthias [Institut fuer Theorie der Kondensierten Materie, Universitaet Karlsruhe, D-76128 Karlsruhe (Germany)

    2005-11-02

    The numerical renormalization group method is used to investigate zero-temperature phase transitions in quantum impurity systems, in particular in the particle-hole symmetric soft-gap Anderson model. The model displays two stable phases whose fixed points can be built up of non-interacting single-particle states. In contrast, the quantum phase transitions turn out to be described by interacting fixed points, and their excitations cannot be described in terms of free particles. We show that the structure of the many-body spectrum of these critical fixed points can be understood using renormalized perturbation theory close to certain values of the bath exponents which play the role of critical dimensions. Contact is made with perturbative renormalization group calculations for the soft-gap Anderson and Kondo models. A complete description of the quantum critical many-particle spectra is achieved using suitable marginal operators; technically this can be understood as epsilon-expansion for full many-body spectra.

  20. Numerical renormalization group for impurity quantum phase transitions: structure of critical fixed points

    Science.gov (United States)

    Lee, Hyun-Jung; Bulla, Ralf; Vojta, Matthias

    2005-11-01

    The numerical renormalization group method is used to investigate zero-temperature phase transitions in quantum impurity systems, in particular in the particle-hole symmetric soft-gap Anderson model. The model displays two stable phases whose fixed points can be built up of non-interacting single-particle states. In contrast, the quantum phase transitions turn out to be described by interacting fixed points, and their excitations cannot be described in terms of free particles. We show that the structure of the many-body spectrum of these critical fixed points can be understood using renormalized perturbation theory close to certain values of the bath exponents which play the role of critical dimensions. Contact is made with perturbative renormalization group calculations for the soft-gap Anderson and Kondo models. A complete description of the quantum critical many-particle spectra is achieved using suitable marginal operators; technically this can be understood as epsilon-expansion for full many-body spectra.

  1. Oncology in Cambodia.

    Science.gov (United States)

    Eav, S; Schraub, S; Dufour, P; Taisant, D; Ra, C; Bunda, P

    2012-01-01

    Cambodia, a country of 14 million inhabitants, was devastated during the Khmer Rouge period and thereafter. The resources of treatment are rare: only one radiotherapy department, renovated in 2003, with an old cobalt machine; few surgeons trained to operate on cancer patients; no hematology; no facilities to use intensive chemotherapy; no nuclear medicine department and no palliative care unit. Cervical cancer incidence is one of the highest in the world, while in men liver cancer ranks first (20% of all male cancers). Cancers are seen at stage 3 or 4 for 70% of patients. There is no prevention program - only a vaccination program against hepatitis B for newborns - and no screening program for cervical cancer or breast cancer. In 2010, oncology, recognized as a full specialty, was created to train the future oncologists on site at the University of Phnom Penh. A new National Cancer Center will be built in 2013 with modern facilities for radiotherapy, medical oncology, hematology and nuclear medicine. Cooperation with foreign countries, especially France, and international organizations has been established and is ongoing. Progress is occurring slowly due to the shortage of money for Cambodian institutions and the lay public.

  2. Molecular radio-oncology

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Michael; Krause, Mechthild; Cordes, Nils (eds.) [Technische Univ. Dresden (Germany). Faculty of Medicine and University Hospital

    2016-07-01

    This book concisely reviews our current understanding of hypoxia, molecular targeting, DNA repair, cancer stem cells, and tumor pathophysiology, while also discussing novel strategies for putting these findings into practice in daily clinical routine. Radiotherapy is an important part of modern multimodal cancer treatment, and the past several years have witnessed not only substantial improvements in radiation techniques and the use of new beam qualities, but also major strides in our understanding of molecular tumor biology and tumor radiation response. Against this backdrop, the book highlights recent efforts to identify reasonable and clinically applicable biomarkers using broad-spectrum tissue microarrays and high-throughput systems biology approaches like genomics and epigenomics. In particular, it describes in detail how such molecular information is now being exploited for diagnostic imaging and imaging throughout treatment using the example of positron emission tomography. By discussing all these issues in the context of modern radiation oncology, the book provides a broad, up-to-date overview of the molecular aspects of radiation oncology that will hopefully foster its further optimization.

  3. The Influence of Group Versus Individual Prenatal Care on Phase of Labor at Hospital Admission.

    Science.gov (United States)

    Tilden, Ellen L; Emeis, Cathy L; Caughey, Aaron B; Weinstein, Sarah R; Futernick, Sarah B; Lee, Christopher S

    2016-07-01

    Group prenatal care, an alternate model of prenatal care delivery, has been associated with various improved perinatal outcomes in comparison to standard, individual prenatal care. One important maternity care process measure that has not been explored among women who receive group prenatal care versus standard prenatal care is the phase of labor (latent vs active) at hospital admission. A retrospective case-control study was conducted comparing 150 women who selected group prenatal care with certified nurse-midwives (CNMs) versus 225 women who chose standard prenatal care with CNMs. Analyses performed included descriptive statistics to compare groups and multivariate regression to evaluate the contribution of key covariates potentially influencing outcomes. Propensity scores were calculated and included in regression models. Women within this sample who received group prenatal care were more likely to be in active labor (≥ 4 cm of cervical dilatation) at hospital admission (odds ratio [OR], 1.73; 95% confidence interval [CI], 1.03-2.99; P = .049) and were admitted to the hospital with significantly greater cervical dilatation (mean [standard deviation, SD] 5.7 [2.5] cm vs. 5.1 [2.3] cm, P = .005) compared with women who received standard prenatal care, controlling for potential confounding variables and propensity for group versus individual care selection. Group prenatal care may be an effective and safe intervention for decreasing latent labor hospital admission among low-risk women. Neither group prenatal care nor active labor hospital admission was associated with increased morbidity. © 2016 by the American College of Nurse-Midwives.

  4. Life Cycle Leadership Theory vs. Theory on the Phases of Small Group Discussion: Comparisons, Contrasts, and Examples.

    Science.gov (United States)

    Preston, Charles Thomas, Jr.

    The work of Paul Hersey and Kenneth Blanchard on life-cycle leadership was compared and contrasted to three studies on group phase theories. The studies on group phases were conducted by Robert Bales and Fred Strodtbeck in 1951, Thomas Scheidel and Laura Crowell in 1964, and B. Aubrey Fisher in 1970. The two theoretical approaches were found to…

  5. NRG Oncology Radiation Therapy Oncology Group 0822: A Phase 2 Study of Preoperative Chemoradiation Therapy Using Intensity Modulated Radiation Therapy in Combination With Capecitabine and Oxaliplatin for Patients With Locally Advanced Rectal Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Theodore S., E-mail: tshong1@mgh.harvard.edu [Massachusetts General Hospital, Boston, Massachusetts (United States); Moughan, Jennifer [NRG Oncology Statistics and Data Management Center, Philadelphia, Pennsylvania (United States); Garofalo, Michael C. [University of Maryland School of Medicine, Baltimore, Maryland (United States); Bendell, Johanna [Sarah Cannon Research Institute, Nashville, Tennessee (United States); Berger, Adam C. [Thomas Jefferson University Hospital, Philadelphia, Pennsylvania (United States); Oldenburg, Nicklas B.E. [North Main Radiation Oncology, Providence, Rhode Island (United States); Anne, Pramila Rani [Thomas Jefferson University Hospital, Philadelphia, Pennsylvania (United States); Perera, Francisco [London Regional Cancer Program/Western Ontario, London, Ontario (Canada); Lee, R. Jeffrey [Intermountain Medical Center, Salt Lake City, Utah (United States); Jabbour, Salma K. [Rutgers Cancer Institute of New Jersey, New Brunswick, New Jersey (United States); Nowlan, Adam [Piedmont Hospital, Atlanta, Georgia (United States); DeNittis, Albert [Main Line Community Clinical Oncology Program, Wynnewood, Pennsylvania (United States); Crane, Christopher [University of Texas-MD Anderson Cancer Center, Houston, Texas (United States)

    2015-09-01

    Purpose: To evaluate the rate of gastrointestinal (GI) toxicity of neoadjuvant chemoradiation with capecitabine, oxaliplatin, and intensity modulated radiation therapy (IMRT) in cT3-4 rectal cancer. Methods and Materials: Patients with localized, nonmetastatic T3 or T4 rectal cancer <12 cm from the anal verge were enrolled in a prospective, multi-institutional, single-arm study of preoperative chemoradiation. Patients received 45 Gy with IMRT in 25 fractions, followed by a 3-dimensional conformal boost of 5.4 Gy in 3 fractions with concurrent capecitabine/oxaliplatin (CAPOX). Surgery was performed 4 to 8 weeks after the completion of therapy. Patients were recommended to receive FOLFOX chemotherapy after surgery. The primary endpoint of the study was acute grade 2 to 5 GI toxicity. Seventy-one patients provided 80% probability to detect at least a 12% reduction in the specified GI toxicity with the treatment of CAPOX and IMRT, at a significance level of .10 (1-sided). Results: Seventy-nine patients were accrued, of whom 68 were evaluable. Sixty-one patients (89.7%) had cT3 disease, and 37 (54.4%) had cN (+) disease. Postoperative chemotherapy was given to 42 of 68 patients. Fifty-eight patients had target contours drawn per protocol, 5 patients with acceptable variation, and 5 patients with unacceptable variations. Thirty-five patients (51.5%) experienced grade ≥2 GI toxicity, 12 patients (17.6%) experienced grade 3 or 4 diarrhea, and pCR was achieved in 10 patients (14.7%). With a median follow-up time of 3.98 years, the 4-year rate of locoregional failure was 7.4% (95% confidence interval [CI]: 1.0%-13.7%). The 4-year rates of OS and DFS were 82.9% (95% CI: 70.1%-90.6%) and 60.6% (95% CI: 47.5%-71.4%), respectively. Conclusion: The use of IMRT in neoadjuvant chemoradiation for rectal cancer did not reduce the rate of GI toxicity.

  6. Operable Unit 3-13, Group 3, Other Surface Soils (Phase I) Remedial Action Report

    Energy Technology Data Exchange (ETDEWEB)

    L. Davison

    2007-07-31

    This Remedial Action Report summarizes activities undertaken to remediate the Operable Unit 3-13, Group 3, Other Surface Soils, Phase I sites at the Idaho Nuclear Technology and Engineering Center at the Idaho National Laboratory Site. The 10 sites addressed in this report were defined in the Operable Unit 3-13 Record of Decision and subsequent implementing documents. This report concludes that remediation requirements and cleanup goals established for these 10 sites have been accomplished and are hereafter considered No Action or No Further Action sites.

  7. Dimensionless groups for three-phase gravity drainage flow in porous media

    Energy Technology Data Exchange (ETDEWEB)

    Grattoni, C.A.; Jing, X.D. [T.H. Huxley School, Imperial College, Prince Consort Road, SW7 2AZ London (United Kingdom); Dawe, R.A. [Chemical Engineering Department, University of West Indies, St. Augustine (Trinidad and Tobago)

    2001-01-01

    The downward displacement of oil by gas (either through gas cap expansion or by gas injection) at the crest of the reservoir is an attractive method of oil recovery. The drainage of oil under gravity forces is a potentially efficient method as it can reduce the remaining oil saturation to below that obtained after waterflooding. This paper describes a series of experiments of gas invasion under gravity-dominated conditions with special attention to the effects of wettability and water saturation on three-phase flow. The experiments were performed in bead-pack models by spontaneous gas invasion at both low and high water saturations with a spreading oil. Different oil recovery rates were observed depending on the wettability of the beads and initial water saturation. At irreducible water saturation, the process appeared to be less efficient for the oil-wet conditions, while similar oil recoveries are observed for both oil-wet and water-wet media at residual oil saturation. Different recovery rates occur with different fluid morphology, which depend on the matrix wettability and the balance between gravity, viscous and capillary forces. The results have been analysed using dimensionless groups. The Bond (N{sub B}) and capillary numbers (N{sub C}) were modified to include the 3-phase effects of gas, oil and water. However, for these cases the Bond and capillary numbers alone were insufficient to fully describe the dynamics of oil recovery by gravity drainage. Therefore, a new dimensionless group combining the effects of gravity and viscous forces to capillary forces was defined as: N=N{sub B}+A({mu}{sub d}/{mu}{sub g})N{sub C}, where A is a scaling factor (in all our experiments A=-17225) and ({mu}{sub d}/{mu}{sub g}) is the viscosity ratio between the displaced and displacing phase. A linear relationship was found between this new group and the total recovery for all the scenarios tested. The slope was approximately 40 for three cases, i.e., water-wet case at

  8. Surveillance of HCC Patients after Liver RFA: Role of MRI with Hepatospecific Contrast versus Three-Phase CT Scan—Experience of High Volume Oncologic Institute

    Directory of Open Access Journals (Sweden)

    Vincenza Granata

    2013-01-01

    Full Text Available Purpose. To compare the diagnostic accuracy of hepatospecific contrast-enhanced MRI versus triple-phase CT scan after radiofrequency ablation (RFA in hepatocellular carcinoma (HCC patients. Methods. Thirty-four consecutive HCC patients (42 hepatic nodules were treated with percutaneous RFA and underwent MR and CT scans. All patients were enrolled in a research protocol that included CT with iodized contrast medium injection and MR with hepatospecific contrast medium injection. All patients were restaged within four weeks and at 3 months from ablation. The images were reviewed by four different radiologists to evaluate tumor necrosis, residual or recurrence disease, and evidence of new foci. Results. Thirty-two nodules were necrotic after treatment; 10 showed residual disease. Six new HCCs were identified. At first month followup CT has identified 34 necrotic lesions and 8 residual diseases; no new foci were recognized. At MRI instead, 32 complete necrotic lesions were identified, 10 lesions showed residual disease, and 2 new HCCs were found. At three months, CT demonstrated 33 completely necrotic lesions, 9 residual diseases, and 2 new HCCs. MR showed 31 complete necrotic lesions, 11 cases of residual disease, and 6 new HCCs. Conclusions. Hepatospecific contrast-enhanced MRI is more effective than multiphase CT in assessment of HCC treated with RFA.

  9. A discrete single server queue with Markovian arrivals and phase type group services

    Directory of Open Access Journals (Sweden)

    Attahiru Sule Alfa

    1995-01-01

    Full Text Available We consider a single-server discrete queueing system in which arrivals occur according to a Markovian arrival process. Service is provided in groups of size no more than M customers. The service times are assumed to follow a discrete phase type distribution, whose representation may depend on the group size. Under a probabilistic service rule, which depends on the number of customers waiting in the queue, this system is studied as a Markov process. This type of queueing system is encountered in the operations of an automatic storage retrieval system. The steady-state probability vector is shown to be of (modified matrix-geometric type. Efficient algorithmic procedures for the computation of the rate matrix, steady-state probability vector, and some important system performance measures are developed. The steady-state waiting time distribution is derived explicitly. Some numerical examples are presented.

  10. A phase synchronization clustering algorithm for identifying interesting groups of genes from cell cycle expression data

    Directory of Open Access Journals (Sweden)

    Tcha Hong

    2008-01-01

    Full Text Available Abstract Background The previous studies of genome-wide expression patterns show that a certain percentage of genes are cell cycle regulated. The expression data has been analyzed in a number of different ways to identify cell cycle dependent genes. In this study, we pose the hypothesis that cell cycle dependent genes are considered as oscillating systems with a rhythm, i.e. systems producing response signals with period and frequency. Therefore, we are motivated to apply the theory of multivariate phase synchronization for clustering cell cycle specific genome-wide expression data. Results We propose the strategy to find groups of genes according to the specific biological process by analyzing cell cycle specific gene expression data. To evaluate the propose method, we use the modified Kuramoto model, which is a phase governing equation that provides the long-term dynamics of globally coupled oscillators. With this equation, we simulate two groups of expression signals, and the simulated signals from each group shares their own common rhythm. Then, the simulated expression data are mixed with randomly generated expression data to be used as input data set to the algorithm. Using these simulated expression data, it is shown that the algorithm is able to identify expression signals that are involved in the same oscillating process. We also evaluate the method with yeast cell cycle expression data. It is shown that the output clusters by the proposed algorithm include genes, which are closely associated with each other by sharing significant Gene Ontology terms of biological process and/or having relatively many known biological interactions. Therefore, the evaluation analysis indicates that the method is able to identify expression signals according to the specific biological process. Our evaluation analysis also indicates that some portion of output by the proposed algorithm is not obtainable by the traditional clustering algorithm with

  11. Vorinostat and bortezomib as third-line therapy in patients with advanced non-small cell lung cancer: a Wisconsin Oncology Network Phase II study

    Science.gov (United States)

    Campbell, Toby C.; Zhang, Chong; Kim, KyungMann; Kolesar, Jill M.; Oettel, Kurt R.; Blank, Jules H.; Robinson, Emily G.; Ahuja, Harish G.; Kirschling, Ron J.; Johnson, Peter H.; Huie, Michael S.; Wims, Mary E.; Larson, Martha M.; Hernan, Hilary R.; Traynor, Anne M.

    2014-01-01

    Summary Introduction The primary objective of this phase II trial was to evaluate the efficacy and tolerability of vorinostat and bortezomib as third-line therapy in advanced non-small cell lung cancer (NSCLC) patients. Methods Eligibility criteria included recurrent/metastatic NSCLC, having received 2 prior systemic regimens, and performance status 0–2. Patients took vorinostat 400 mg PO daily days 1–14 and bortezomib 1.3 mg/m2 IV day 1, 4, 8 and 11 in a 21-day cycle. Primary endpoint was 3-month progression free survival (3m-PFS), with a goal of at least 40 % of patients being free of progression at that time point. This study followed a two-stage minimax design. Results Eighteen patients were enrolled in the first stage. All patients had two prior lines of treatment. Patients received a median of two treatment cycles (range: 1–6) on study. There were no anti-tumor responses; stable disease was observed in 5 patients (27.8 %). Median PFS was 1.5 months, 3m-PFS rate 11.1 %, and median overall survival 4.7 months. The most common grade 3/4 toxicities were thrombocytopenia and fatigue. Two patients who had baseline taxane-related grade 1 peripheral neuropathy developed grade 3 neuropathy. The study was closed at its first interim analysis for lack of efficacy. Conclusions Bortezomib and vorinostat displayed minimal anti-tumor activity as third-line therapy in NSCLC. We do not recommend this regimen for further investigation in unselected patients. PMID:23728919

  12. Continuous 5-fluorouracil infusion plus long acting octreotide in advanced well-differentiated neuroendocrine carcinomas. A phase II trial of the Piemonte Oncology Network

    Directory of Open Access Journals (Sweden)

    Ciuffreda Libero

    2009-11-01

    Full Text Available Abstract Background Well-differentiated neuroendocrine carcinomas are highly vascularized and may be sensitive to drugs administered on a metronomic schedule that has shown antiangiogenic properties. A phase II study was designed to test the activity of protracted 5-fluorouracil (5FU infusion plus long-acting release (LAR octreotide in patients with neuroendocrine carcinoma. Methods Twenty-nine patients with metastatic or locally advanced well-differentiated neuroendocrine carcinoma were treated with protracted 5FU intravenous infusion (200 mg/m2 daily plus LAR octreotide (20 mg monthly. Patients were followed for toxicity, objective response, symptomatic and biochemical response, time to progression and survival. Results Assessment by Response Evaluation Criteria in Solid Tumors (RECIST criteria showed partial response in 7 (24.1%, stable disease in 20 (69.0%, and disease progression in 2 patients. Response did not significantly differ when patients were stratified by primary tumor site and proliferative activity. A biochemical (chromogranin A response was observed in 12/25 assessable patients (48.0%; symptom relief was obtained in 9/15 symptomatic patients (60.0%. There was non significant decrease in circulating vascular epithelial growth factor (VEGF over time. Median time to progression was 22.6 months (range, 2.7-68.5; median overall survival was not reached yet. Toxicity was mild and manageable. Conclusion Continuous/metronomic 5FU infusion plus LAR octreotide is well tolerated and shows activity in patients with well-differentiated neuroendocrine carcinoma. The potential synergism between metronomic chemotherapy and antiangiogenic drugs provides a rationale for exploring this association in the future. Trial registration NCT00953394

  13. Epigenetic Therapy Using Belinostat for Patients With Unresectable Hepatocellular Carcinoma: A Multicenter Phase I/II Study With Biomarker and Pharmacokinetic Analysis of Tumors From Patients in the Mayo Phase II Consortium and the Cancer Therapeutics Research Group

    Science.gov (United States)

    Yeo, Winnie; Chung, Hyun C.; Chan, Stephen L.; Wang, Ling Z.; Lim, Robert; Picus, Joel; Boyer, Michael; Mo, Frankie K.F.; Koh, Jane; Rha, Sun Y.; Hui, Edwin P.; Jeung, Hei C.; Roh, Jae K.; Yu, Simon C.H.; To, Ka F.; Tao, Qian; Ma, Brigette B.; Chan, Anthony W.H.; Tong, Joanna H.M.; Erlichman, Charles; Chan, Anthony T.C.; Goh, Boon C.

    2012-01-01

    Purpose Epigenetic aberrations have been reported in hepatocellular carcinoma (HCC). In this study of patients with unresectable HCC and chronic liver disease, epigenetic therapy with the histone deacetylase inhibitor belinostat was assessed. The objectives were to determine dose-limiting toxicity and maximum-tolerated dose (MTD), to assess pharmacokinetics in phase I, and to assess activity of and explore potential biomarkers for response in phase II. Patients and Methods Major eligibility criteria included histologically confirmed unresectable HCC, European Cooperative Oncology Group performance score ≤ 2, and adequate organ function. Phase I consisted of 18 patients; belinostat was given intravenously once per day on days 1 to 5 every 3 weeks; dose levels were 600 mg/m2 per day (level 1), 900 mg/m2 per day (level 2), 1,200 mg/m2 per day (level 3), and 1,400 mg/m2 per day (level 4). Phase II consisted of 42 patients. The primary end point was progression-free survival (PFS), and the main secondary end points were response according to Response Evaluation Criteria in Solid Tumors (RECIST) and overall survival (OS). Exploratory analysis was conducted on pretreatment tumor tissues to determine whether HR23B expression is a potential biomarker for response. Results Belinostat pharmacokinetics were linear from 600 to 1,400 mg/m2 without significant accumulation. The MTD was not reached at the maximum dose administered. Dose level 4 was used in phase II. The median number of cycles was two (range, one to 12). The partial response (PR) and stable disease (SD) rates were 2.4% and 45.2%, respectively. The median PFS and OS were 2.64 and 6.60 months, respectively. Exploratory analysis revealed that disease stabilization rate (complete response plus PR plus SD) in tumors having high and low HR23B histoscores were 58% and 14%, respectively (P = .036). Conclusion Epigenetic therapy with belinostat demonstrates tumor stabilization and is generally well-tolerated. HR23B

  14. SYNTHESIS AND PHASE BEHAVIOR OF POLYURETHANES END-CAPPED WITH FLUORINATED PHOSPHATIDYLCHOLINE HEAD GROUPS

    Institute of Scientific and Technical Information of China (English)

    Dong-sheng Tan; Xiao-qing Zhang; Jian-chuan Wang; Jie-hua Li; Hong Tan; Qiang Fu

    2011-01-01

    A series of fluorinated phosphatidylcholine polyurethane macromolecular additives were synthesized by solution polymerization using methylenebis(phylene isocyanates) (MDI) and 1,4-butanediol (BDO) as hard segments,a new phoshporycholine,2-(2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9-hexadecafluoro-10-(2-hydroxyethoxy)decyloxy) ethyl phosphorycholine (HDFOPC) as end-capper,and four polydiols,poly(tetramethylene glycol)s (PTMG),polydimethylsiloxane (PDMS),poly(1,6-hexyl-1,5-pentylcarbonate) (PHPC) and poly(propylene glycol) (PPG) as soft segments,respectively.The chemical structures of the synthesized polyurethanes were characterized by 1H-NMR and FTIR.DSC and DMA were employed to study the phase behavior of these novel polyurethanes due to their great influences on the surface properties,and hence their interactions with bio-systems.The results showed that phase separation of the fluorinated phosphatidylcholine end-capped polyurethanes was increased in comparison with that of normal polyurethanes.The effect of fluorinated phosphatidylcholine end-capped groups on the phase behavior was further demonstrated by analyzing the degree of hydrogen-bonding between hard and soft segments.

  15. Effect of Vision Angle on the Phase Transition in a Flocking Behavior of Animal Groups

    CERN Document Server

    Nguyen, P The; Ngo, V Thanh

    2014-01-01

    The nature of the phase transition in a system of self-propelling particles has been extensively studied during the last few decades. A theoretical model was proposed by T. Vicsek, et. al. [Phys. Rev. Lett. 75, 1226 (1995)] with a simple rule for updating the direction of motion of each particle. Based on the Vicsek's model (VM) [1], in this work, we consider a group of animals as particles moving freely on a two-dimensional space. Due to the fact that the viewable area of animals depends on the species, we consider the motion of each individual within an angle $\\varphi=\\Phi/2$ ($\\Phi$ is called angle of view) of a circle centered at its position, of radius $R$. We obtained a phase diagram in the space ($\\varphi$, $\\eta_c$) with $\\eta_c$ being the critical noise. We show that, the phase transition exists only in the case of a wide view's angle $\\varphi \\geq 0.5\\pi$. The flocking of animals is perhaps a behavior of the species of prey only, but not the one of the predator. Our simulation results are in good ag...

  16. Renormalization-group theory for cooling first-order phase transitions in Potts models.

    Science.gov (United States)

    Liang, Ning; Zhong, Fan

    2017-03-01

    We develop a dynamic field-theoretic renormalization-group (RG) theory for cooling first-order phase transitions in the Potts model. It is suggested that the well-known imaginary fixed points of the q-state Potts model for q>10/3 in the RG theory are the origin of the dynamic scaling found recently from numerical simulations, apart from logarithmic corrections. This indicates that the real and imaginary fixed points of the Potts model are both physical and control the scalings of the continuous and discontinuous phase transitions, respectively, of the model. Our one-loop results for the scaling exponents are already not far away from the numerical results. Further, the scaling exponents depend on q only slightly, consistent with the numerical results. Therefore, the theory is believed to provide a natural explanation of the dynamic scaling including the scaling exponents and their scaling laws for various observables in the cooling first-order phase transition of the Potts model.

  17. Renormalization-group theory for cooling first-order phase transitions in Potts models

    Science.gov (United States)

    Liang, Ning; Zhong, Fan

    2017-03-01

    We develop a dynamic field-theoretic renormalization-group (RG) theory for cooling first-order phase transitions in the Potts model. It is suggested that the well-known imaginary fixed points of the q -state Potts model for q >10 /3 in the RG theory are the origin of the dynamic scaling found recently from numerical simulations, apart from logarithmic corrections. This indicates that the real and imaginary fixed points of the Potts model are both physical and control the scalings of the continuous and discontinuous phase transitions, respectively, of the model. Our one-loop results for the scaling exponents are already not far away from the numerical results. Further, the scaling exponents depend on q only slightly, consistent with the numerical results. Therefore, the theory is believed to provide a natural explanation of the dynamic scaling including the scaling exponents and their scaling laws for various observables in the cooling first-order phase transition of the Potts model.

  18. Decline in Tested and Self-Reported Cognitive Functioning After Prophylactic Cranial Irradiation for Lung Cancer: Pooled Secondary Analysis of Radiation Therapy Oncology Group Randomized Trials 0212 and 0214

    Energy Technology Data Exchange (ETDEWEB)

    Gondi, Vinai, E-mail: vgondi@chicagocancer.org [Central Dupage Hospital Cancer Center, Warrenville, Illinois (United States); University of Wisconsin Comprehensive Cancer Center, Madison, Wisconsin (United States); Paulus, Rebecca [Radiation Therapy Oncology Group Statistical Center, Philadelphia, Pennsylvania (United States); Bruner, Deborah W. [Nell Hodgson Woodfull School of Nursing, Emory University, Atlanta, Georgia (United States); Meyers, Christina A. [University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Gore, Elizabeth M. [Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Wolfson, Aaron [University of Miami School of Medicine, Miami, Florida (United States); Werner-Wasik, Maria [Thomas Jefferson University Hospital, Philadelphia, Pennsylvania (United States); Sun, Alexander Y. [Princess Margaret Hospital, Toronto, ON (Canada); Choy, Hak [University of Texas Southwestern Moncreif Cancer Center, Fort Worth, Texas (United States); Movsas, Benjamin [Henry Ford Health System, Detroit, Michigan (United States)

    2013-07-15

    Purpose: To assess the impact of prophylactic cranial irradiation (PCI) on self-reported cognitive functioning (SRCF), a functional scale on the European Organization for Research and Treatment of Cancer Core Quality of Life Questionnaire (EORTC QLQ-C30). Methods and Materials: Radiation Therapy Oncology Group (RTOG) protocol 0214 randomized patients with locally advanced non-small cell lung cancer to PCI or observation; RTOG 0212 randomized patients with limited-disease small cell lung cancer to high- or standard-dose PCI. In both trials, Hopkins Verbal Learning Test (HVLT)-Recall and -Delayed Recall and SRCF were assessed at baseline (after locoregional therapy but before PCI or observation) and at 6 and 12 months. Patients developing brain relapse before follow-up evaluation were excluded. Decline was defined using the reliable change index method and correlated with receipt of PCI versus observation using logistic regression modeling. Fisher's exact test correlated decline in SRCF with HVLT decline. Results: Of the eligible patients pooled from RTOG 0212 and RTOG 0214, 410 (93%) receiving PCI and 173 (96%) undergoing observation completed baseline HVLT or EORTC QLQ-C30 testing and were included in this analysis. Prophylactic cranial irradiation was associated with a higher risk of decline in SRCF at 6 months (odds ratio 3.60, 95% confidence interval 2.34-6.37, P<.0001) and 12 months (odds ratio 3.44, 95% confidence interval 1.84-6.44, P<.0001). Decline on HVLT-Recall at 6 and 12 months was also associated with PCI (P=.002 and P=.002, respectively) but was not closely correlated with decline in SRCF at the same time points (P=.05 and P=.86, respectively). Conclusions: In lung cancer patients who do not develop brain relapse, PCI is associated with decline in HVLT-tested and self-reported cognitive functioning. Decline in HVLT and decline in SRCF are not closely correlated, suggesting that they may represent distinct elements of the cognitive spectrum.

  19. Low Interrater Reliability in Grading of Rectal Bleeding Using National Cancer Institute Common Toxicity Criteria and Radiation Therapy Oncology Group Toxicity Scales: A Survey of Radiation Oncologists

    Energy Technology Data Exchange (ETDEWEB)

    Huynh-Le, Minh-Phuong [Department of Radiation Oncology and Molecular Radiation Sciences, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Zhang, Zhe [Department of Oncology Biostatistics, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Tran, Phuoc T.; DeWeese, Theodore L. [Department of Radiation Oncology and Molecular Radiation Sciences, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Song, Daniel Y., E-mail: dsong2@jhmi.edu [Department of Radiation Oncology and Molecular Radiation Sciences, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States)

    2014-12-01

    Purpose: To measure concordance among genitourinary radiation oncologists in using the National Cancer Institute Common Toxicity Criteria (NCI CTC) and Radiation Therapy Oncology Group (RTOG) grading scales to grade rectal bleeding. Methods and Materials: From June 2013 to January 2014, a Web-based survey was sent to 250 American and Canadian academic radiation oncologists who treat prostate cancer. Participants were provided 4 case vignettes in which patients received radiation therapy and developed rectal bleeding and were asked for management plans and to rate the bleeding according to NCI CTC v.4 and RTOG late toxicity grading (scales provided). In 2 cases, participants were also asked whether they would send the patient for colonoscopy. A multilevel, random intercept modeling approach was used to assess sources of variation (case, respondent) in toxicity grading to calculate the intraclass correlation coefficient (ICC). Agreement on a dichotomous grading scale (low grades 1-2 vs high grades 3-4) was also assessed, using the κ statistic for multiple respondents. Results: Seventy-two radiation oncologists (28%) completed the survey. Forty-seven (65%) reported having either written or been principal investigator on a study using these scales. Agreement between respondents was moderate (ICC 0.52, 95% confidence interval [CI] 0.47-0.58) when using NCI CTC and fair using the RTOG scale (ICC 0.28, 95% CI 0.20-0.40). Respondents who chose an invasive management were more likely to select a higher toxicity grade (P<.0001). Using the dichotomous scale, we observed moderate agreement (κ = 0.42, 95% CI 0.40-0.44) with the NCI CTC scale, but only slight agreement with the RTOG scale (κ = 0.19, 95% CI 0.17-0.21). Conclusion: Low interrater reliability was observed among radiation oncologists grading rectal bleeding using 2 common scales. Clearer definitions of late rectal bleeding toxicity should be constructed to reduce this variability and avoid ambiguity in both

  20. Higher Biologically Effective Dose of Radiotherapy Is Associated With Improved Outcomes for Locally Advanced Non-Small Cell Lung Carcinoma Treated With Chemoradiation: An Analysis of the Radiation Therapy Oncology Group

    Energy Technology Data Exchange (ETDEWEB)

    Machtay, Mitchell, E-mail: Mitchell.machtay@uhhospitals.org [University Hospitals/Case Western Reserve University, Cleveland, OH (United States); Bae, Kyounghwa [Radiation Therapy Oncology Group (RTOG) Department of Statistics, Philadelphia, PA (United States); Movsas, Benjamin [Henry Ford Hospital, Detroit, MI (United States); Paulus, Rebecca [Radiation Therapy Oncology Group (RTOG) Department of Statistics, Philadelphia, PA (United States); Gore, Elizabeth M. [Medical College of Wisconsin, Milwaukee, WI (United States); Komaki, Ritsuko [M.D. Anderson Cancer Center, Houston, TX (United States); Albain, Kathy [Loyola University Chicago Stritch School of Medicine, Maywood, IL (United States); Sause, William T. [LDS Hospital, Salt Lake City, UT (United States); Curran, Walter J. [Emory University, Atlanta, GA (United States)

    2012-01-01

    Purpose: Patients treated with chemoradiotherapy for locally advanced non-small-cell lung carcinoma (LA-NSCLC) were analyzed for local-regional failure (LRF) and overall survival (OS) with respect to radiotherapy dose intensity. Methods and Materials: This study combined data from seven Radiation Therapy Oncology Group (RTOG) trials in which chemoradiotherapy was used for LA-NSCLC: RTOG 88-08 (chemoradiation arm only), 90-15, 91-06, 92-04, 93-09 (nonoperative arm only), 94-10, and 98-01. The radiotherapeutic biologically effective dose (BED) received by each individual patient was calculated, as was the overall treatment time-adjusted BED (tBED) using standard formulae. Heterogeneity testing was done with chi-squared statistics, and weighted pooled hazard ratio estimates were used. Cox and Fine and Gray's proportional hazard models were used for OS and LRF, respectively, to test the associations between BED and tBED adjusted for other covariates. Results: A total of 1,356 patients were analyzed for BED (1,348 for tBED). The 2-year and 5-year OS rates were 38% and 15%, respectively. The 2-year and 5-year LRF rates were 46% and 52%, respectively. The BED (and tBED) were highly significantly associated with both OS and LRF, with or without adjustment for other covariates on multivariate analysis (p < 0.0001). A 1-Gy BED increase in radiotherapy dose intensity was statistically significantly associated with approximately 4% relative improvement in survival; this is another way of expressing the finding that the pool-adjusted hazard ratio for survival as a function of BED was 0.96. Similarly, a 1-Gy tBED increase in radiotherapy dose intensity was statistically significantly associated with approximately 3% relative improvement in local-regional control; this is another way of expressing the finding that the pool-adjusted hazard ratio as a function of tBED was 0.97. Conclusions: Higher radiotherapy dose intensity is associated with improved local-regional control

  1. Phase II/III trial of etoposide and high-dose ifosfamide in newly diagnosed metastatic osteosarcoma: a pediatric oncology group trial.

    Science.gov (United States)

    Goorin, Allen M; Harris, Michael B; Bernstein, Mark; Ferguson, William; Devidas, Meenakshi; Siegal, Gene P; Gebhardt, Mark C; Schwartz, Cindy L; Link, Michael; Grier, Holcombe E

    2002-01-15

    The objectives of this trial were to estimate the response rate, progression-free survival, and overall survival of patients who received therapy with etoposide and high-dose ifosfamide, and to define the toxicity of this combination when provided with standard chemotherapy in patients with newly diagnosed metastatic osteosarcoma. Eligible patients received infusions of 100 mg/m(2) per day of etoposide and 3.5 g/m(2) per day of ifosfamide for 5 days. Therapy with granulocyte colony-stimulating factor was begun on day 6. This was repeated 3 weeks after therapy was begun. Response was determined at week 6 by both standard World Health Organization response criteria and by pathologic determination of tumor necrosis of the primary tumor. Forty-three patients were registered; 39 were assessable for response and 41 for toxicity and survival. Twenty-eight (68%) of 41 had metastatic sites only in the lung; 12 (29%) had metastatic sites in other bones with or without lung involvement. Four patients (10%) experienced complete response, and 19 patients (49%) experienced partial response, for an overall response rate of 59% +/- 8%. The projected 2-year progression-free survival (PFS) for the 28 patients with metastases to lungs was 39% +/- 11%. The projected 2-year PFS for the 12 patients with metastases to other bones (with or without pulmonary metastases) was 58% +/- 17%. Two patients died as a result of therapy toxicity. Eighty-three percent of patients had grade 4 neutropenia, and 29% had grade 4 thrombocytopenia. Ten patients (24%) had sepsis. Fanconi's syndrome was observed in five patients. The combination of etoposide and high-dose ifosfamide is effective induction chemotherapy for patients with metastatic osteosarcoma, despite significant associated myelosuppression sometimes complicated by infection and renal toxicity.

  2. Motexafin-Gadolinium and Involved Field Radiation Therapy for Intrinsic Pontine Glioma of Childhood: A Children's Oncology Group Phase 2 Study

    Energy Technology Data Exchange (ETDEWEB)

    Bradley, Kristin A., E-mail: bradley@humonc.wisc.edu [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin (United States); Zhou Tianni [Department of Preventive Medicine, University of Southern California, Los Angeles, California (United States); McNall-Knapp, Rene Y. [Department of Pediatrics, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma (United States); Jakacki, Regina I. [Division of Pediatric Hematology/Oncology, Children' s Hospital of Pittsburgh, Pittsburgh, Pennsylvania (United States); Levy, Adam S. [Division of Pediatric Hematology/Oncology, Children' s Hospital at Montefiore, Albert Einstein College of Medicine, Bronx, New York (United States); Vezina, Gilbert [Department of Radiology, Children' s National Medical Center, George Washington University School of Medicine, Washington, DC (United States); Pollack, Ian F. [Department of Neurosurgery, Children' s Hospital of Pittsburgh, University of Pittsburgh Medical Center, Pittsburgh, Pennsylvania (United States)

    2013-01-01

    Purpose: To evaluate the effects on 1-year event-free survival (EFS) and overall survival (OS) of combining motexafin and gadolinium (MGd), a potent radiosensitizer, with daily fractionated radiation therapy in children with newly diagnosed intrinsic pontine gliomas. Methods and Materials: Patients with newly diagnosed intrinsic pontine glioma were treated with MGd daily for 5 consecutive days each week, for a total of 30 doses. Patients received a 5- to 10-min intravenous bolus of MGd, 4.4 mg/kg/day, given 2 to 5 h prior to standard dose irradiation. Radiation therapy was administered at a daily dose of 1.8 Gy for 30 treatments over 6 weeks. The total dose was 54 Gy. Results: Sixty eligible children received MGd daily, concurrent with 6 weeks of radiation therapy. The estimated 1-year EFS was 18% {+-} 5%, and the estimated 1-year OS was 53% {+-} 6.5%. The most common grade 3 to 4 toxicities were lymphopenia, transient elevation of liver transaminases, and hypertension. Conclusions: Compared to historical controls, the addition of MGd to a standard 6-week course of radiation did not improve the survival of pediatric patients with newly diagnosed intrinsic pontine gliomas.

  3. A Phase II Study of Intensity Modulated Radiation Therapy to the Pelvis for Postoperative Patients With Endometrial Carcinoma: Radiation Therapy Oncology Group Trial 0418

    Energy Technology Data Exchange (ETDEWEB)

    Jhingran, Anuja, E-mail: ajhingra@mdanderson.org [University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Winter, Kathryn [RTOG Statistical Center, Philadelphia, Pennsylvania (United States); Portelance, Lorraine [University of Miami, Miami, Florida (United States); Miller, Brigitte [Carolinas Medical Center North East, Concord, North Carolina (United States); Salehpour, Mohammad [University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Gaur, Rakesh [St. Luke' s Hospital, Kansas City, Missouri (United States); Souhami, Luis [McGill University Health Centre, Montreal, Quebec (Canada); Small, William [Robert H. Lurie Comprehensive Cancer Center of Northwestern University, Chicago, Illionis (United States); Berk, Lawrence [H. Lee Moffitt Cancer Center, Tampa, Florida (United States); Gaffney, David [Huntsman Cancer Hospital, Salt Lake City, Utah (United States)

    2012-09-01

    Purpose: To determine the feasibility of pelvic intensity modulated radiation therapy (IMRT) for patients with endometrial cancer in a multi-institutional setting and to determine whether this treatment is associated with fewer short-term bowel adverse events than standard radiation therapy. Methods: Patients with adenocarcinoma of the endometrium treated with pelvic radiation therapy alone were eligible. Guidelines for target definition and delineation, dose prescription, and dose-volume constraints for the targets and critical normal structures were detailed in the study protocol and a web-based atlas. Results: Fifty-eight patients were accrued by 25 institutions; 43 were eligible for analysis. Forty-two patients (98%) had an acceptable IMRT plan; 1 had an unacceptable variation from the prescribed dose to the nodal planning target volume. The proportions of cases in which doses to critical normal structures exceeded protocol criteria were as follows: bladder, 67%; rectum, 76%; bowel, 17%; and femoral heads, 33%. Twelve patients (28%) developed grade {>=}2 short-term bowel adverse events. Conclusions: Pelvic IMRT for endometrial cancer is feasible across multiple institutions with use of a detailed protocol and centralized quality assurance (QA). For future trials, contouring of vaginal and nodal tissue will need continued monitoring with good QA and better definitions will be needed for organs at risk.

  4. A phase II evaluation of mifepristone in the treatment of recurrent or persistent epithelial ovarian, fallopian or primary peritoneal cancer: a gynecologic oncology group study.

    Science.gov (United States)

    Rocereto, Thomas F; Brady, William E; Shahin, Mark S; Hoffman, James S; Small, Laurie; Rotmensch, Jacob; Mannel, Robert S

    2010-03-01

    To evaluate the effectiveness and toxicity of mifepristone in patients with ovarian, peritoneal and fallopian tube cancers. Patients with confirmed epithelial ovarian, peritoneal and fallopian tube cancers which were persistent or recurred in less then 1 year after primary chemotherapy were entered into this study. Patients were given mifepristone 200 mg by mouth daily for a 28 day cycle. The medication was stopped for unacceptable toxicity or tumor progression. Twenty-four patients were entered into the study. Twenty-two patients were evaluable for response. Only one patient had a partial response for a response rate of only 4.5% (90% confidence interval: 0.2%, 19.8%). Mifepristone has not proven to be an effective agent in the treatment of patients with recurrent or persistent ovarian, peritoneal and fallopian tube cancers.

  5. Mathematical oncology 2013

    CERN Document Server

    Gandolfi, Alberto

    2014-01-01

    With chapters on free boundaries, constitutive equations, stochastic dynamics, nonlinear diffusion–consumption, structured populations, and applications of optimal control theory, this volume presents the most significant recent results in the field of mathematical oncology. It highlights the work of world-class research teams, and explores how different researchers approach the same problem in various ways. Tumors are complex entities that present numerous challenges to the mathematical modeler. First and foremost, they grow. Thus their spatial mean field description involves a free boundary problem. Second, their interiors should be modeled as nontrivial porous media using constitutive equations. Third, at the end of anti-cancer therapy, a small number of malignant cells remain, making the post-treatment dynamics inherently stochastic. Fourth, the growth parameters of macroscopic tumors are non-constant, as are the parameters of anti-tumor therapies. Changes in these parameters may induce phenomena that a...

  6. [Dermato-oncological rehabilitation].

    Science.gov (United States)

    Buhles, N; Sander, C

    2005-07-01

    National insurance companies in Germany support health cures for patients with malignant tumors (malignant melanoma, squamous cell carcinoma, Merkel cell tumor, malignant cutaneous lymphoma). The clinical requirements are an invasively growing tumor, problems of self-assurance, and dis-integration of the patient regarding his social and/or professional environment. The decision for a health cure is made by the treating dermatologist in the hospital. In this context, the following sociomedical criteria should be applied: impairment, disability, and handicap. Usually, rehabilitation starts after the patient is discharged from the hospital. The inpatient rehabilitation program should be performed at an institution capable of providing dermatological and psychological treatment. The dermatologist acts as a manager for the members of the rehabilitation team (psychologists, physiotherapists, social workers, and ergo-therapists). In conclusion, dermato-oncologic rehabilitation plays an important role in re-integrating the patient into his professional life to avoid retirement.

  7. Development of a group contribution method to predict aqueous phase hydroxyl radical (HO*) reaction rate constants.

    Science.gov (United States)

    Minakata, Daisuke; Li, Ke; Westerhoff, Paul; Crittenden, John

    2009-08-15

    The hydroxyl radical (HO*) is a strong oxidant that reacts with electron-rich sites of organic compounds and initiates complex chain mechanisms. In order to help understand the reaction mechanisms, a rule-based model was previously developed to predict the reaction pathways. For a kinetic model, there is a need to develop a rate constant estimator that predicts the rate constants for a variety of organic compounds. In this study, a group contribution method (GCM) is developed to predict the aqueous phase HO* rate constants for the following reaction mechanisms: (1) H-atom abstraction, (2) HO* addition to alkenes, (3) HO* addition to aromatic compounds, and (4) HO* interaction with sulfur (S)-, nitrogen (N)-, or phosphorus (P)-atom-containing compounds. The GCM hypothesizes that an observed experimental rate constant for a given organic compound is the combined rate of all elementary reactions involving HO*, which can be estimated using the Arrhenius activation energy, E(a), and temperature. Each E(a) for those elementary reactions can be comprised of two parts: (1) a base part that includes a reactive bond in each reaction mechanism and (2) contributions from its neighboring functional groups. The GCM includes 66 group rate constants and 80 group contribution factors, which characterize each HO* reaction mechanism with steric effects of the chemical structure groups and impacts of the neighboring functional groups, respectively. Literature-reported experimental HO* rate constants for 310 and 124 compounds were used for calibration and prediction, respectively. The genetic algorithms were used to determine the group rate constants and group contribution factors. The group contribution factors for H-atom abstraction and HO* addition to the aromatic compounds were found to linearly correlate with the Taft constants, sigma*, and electrophilic substituent parameters, sigma+, respectively. The best calibrations for 83% (257 rate constants) and predictions for 62% (77

  8. Gas Phase Chromatography of some Group 4, 5, and 6 Halides

    Energy Technology Data Exchange (ETDEWEB)

    Sylwester, Eric Robert [Univ. of California, Berkeley, CA (United States)

    1998-10-01

    Gas phase chromatography using The Heavy Element Volatility Instrument (HEVI) and the On Line Gas Apparatus (OLGA III) was used to determine volatilities of ZrBr4, HfBr4, RfBr4, NbBr5, TaOBr3, HaCl5, WBr6, FrBr, and BiBr3. Short-lived isotopes of Zr, Hf, Rf, Nb, Ta, Ha, W, and Bi were produced via compound nucleus reactions at the 88-Inch Cyclotron at Lawrence Berkeley National Laboratory and transported to the experimental apparatus using a He gas transport system. The isotopes were halogenated, separated from the other reaction products, and their volatilities determined by isothermal gas phase chromatography. Adsorption Enthalpy (ΔHa) values for these compounds were calculated using a Monte Carlo simulation program modeling the gas phase chromatography column. All bromides showed lower volatility than molecules of similar molecular structures formed as chlorides, but followed similar trends by central element. Tantalum was observed to form the oxybromide, analogous to the formation of the oxychloride under the same conditions. For the group 4 elements, the following order in volatility and ΔHa was observed: RfBr4 > ZrBr4 > HfBr4. The ΔHa values determined for the group 4, 5, and 6 halides are in general agreement with other experimental data and theoretical predictions. Preliminary experiments were performed on Me-bromides. A new measurement of the half-life of 261Rf was performed. 261Rf was produced via the 248Cm(18O, 5n) reaction and observed with a half-life of 74-6+7 seconds, in excellent agreement with the previous measurement of 78-6+11 seconds. We recommend a new half-life of 75±7 seconds for 261Rf based on these two measurements. Preliminary studies in transforming HEVI from an isothermal (constant

  9. Phase-specific brain change of spatial working memory processing in genetic and ultra-high risk groups of schizophrenia.

    Science.gov (United States)

    Choi, Jung-Seok; Park, Ji-Young; Jung, Myung Hun; Jang, Joon Hwan; Kang, Do-Hyung; Jung, Wi Hoon; Han, Ji Yeon; Choi, Chi-Hoon; Hong, Kyung Sue; Kwon, Jun Soo

    2012-11-01

    Spatial working memory (WM) processing has 3 distinct phases: encoding, maintenance, and retrieval and its dysfunction is a core feature in schizophrenia. We examined phase-specific brain activations associated with spatial WM in first-degree relatives of schizophrenia (genetic high risk, GHR), ultra-high risk (UHR) subjects, patients with schizophrenia, and healthy controls. We used an event-related functional magnetic resonance imaging in 17 GHR subjects, 21 UHR subjects, 15 clinically stable patients with schizophrenia and 16 healthy controls, while subjects were performing a spatial delayed-response task. During the encoding phase, the GHR group showed increased activation in the fronto-parietal regions, whereas the UHR and schizophrenia groups showed significantly less activation in these regions than did the healthy control group. Especially, frontal activation was strongest in GHR subjects, followed by healthy controls, and occurred to a lesser degree in the UHR group, with the least activation occurring in the schizophrenia group. During the maintenance phase, the thalamus showed a differential activation, similar to frontal activation pattern during the encoding phase. During the retrieval phase, no prominent differential activations were found. Increased activations were observed in the superior temporal gyrus during the encoding and maintenance phases in the GHR, UHR, and schizophrenia groups relative to healthy controls. Our findings suggest that functional deficits associated with spatial WM processing emerge in the UHR before the onset of schizophrenia and compensatory neural processes exist in the GHR with genetic liability to schizophrenia.

  10. Phase transitions in Group III-V and II-VI semiconductors at high pressure

    Science.gov (United States)

    Yu, S. C.; Liu, C. Y.; Spain, I. L.; Skelton, E. F.

    1979-01-01

    The structures and transition pressures of Group III-V and II-VI semiconductors and of a pseudobinary system (Ga/x/In/1-x/Sb) have been investigated. Results indicate that GaP, InSb, GaSb, GaAs and possible AlP assume Metallic structures at high pressures; a tetragonal, beta-Sn-like structure is adopted by only InSb and GaSb. The rocksalt phase is preferred in InP, InAs, AlSb, ZnO and ZnS. The model of Van Vechten (1973) gives transition pressures which are in good agreement with measured values, but must be refined to account for the occurrence of the ionic rocksalt structure in some compounds. In addition, discrepancies between the theoretical scaling values for volume changes at the semiconductor-to-metal transitions are observed.

  11. Ordered phase of the O(N) model within the nonperturbative renormalization group.

    Science.gov (United States)

    Peláez, Marcela; Wschebor, Nicolás

    2016-10-01

    We analyze nonperturbative renormalization group flow equations for the ordered phase of Z_{2} and O(N) invariant scalar models. This is done within the well-known derivative expansion scheme. For its leading order [local potential approximation (LPA)], we show that not every regulator yields a smooth flow with a convex free energy and discuss for which regulators the flow becomes singular. Then we generalize the known exact solutions of smooth flows in the "internal" region of the potential and exploit these solutions to implement an improved numerical algorithm, which is much more stable than previous ones for N>1. After that, we study the flow equations at second order of the derivative expansion and analyze how and when the LPA results change. We also discuss the evolution of the field renormalization factors.

  12. [Oncologic gynecology and the Internet].

    Science.gov (United States)

    Gizler, Robert; Bielanów, Tomasz; Kulikiewicz, Krzysztof

    2002-11-01

    The strategy of World Wide Web searching for medical sites was presented in this article. The "deep web" and "surface web" resources were searched. The 10 best sites connected with the gynecological oncology, according to authors' opinion, were presented.

  13. American Society of Clinical Oncology

    Science.gov (United States)

    ... of Interest Mobile App Privacy Policy Privacy Policy Social Media Policy Sponsor Policy Terms of Use American Society of Clinical Oncology ASCO Annual Meeting Register and Reserve Your Hotel June 2-6, 2017 | Chicago, Illinois Hotel Reservation & ...

  14. Personalizing medicine in geriatric oncology

    National Research Council Canada - National Science Library

    Walko, Christine M; McLeod, Howard L

    2014-01-01

    Minimizing toxicity while maximizing efficacy is a common goal in the treatment of any condition but its importance is underscored in the discipline of oncology because of the serious nature of many...

  15. Waste area Grouping 2 Phase I task data report: Human health risk assessment

    Energy Technology Data Exchange (ETDEWEB)

    Purucker, S.T.; Douthat, D.M.

    1996-06-01

    This report is one of five reports issued in 1996 that provide follow- up information to the Phase 1 Remedial Investigation (RI) Report for Waste Area Grouping (WAG) 2 at Oak Ridge National Laboratory (ORNL). The five reports address areas of concern that could cause potential human health risk and ecological risk within WAG2 at ORNL. The purpose of this report is to present a summary of the human health risk assessment results based on the data collected for the WAG 2 Phase 1 RI. Estimates of risk are provided based on measured concentrations in the surface water, floodplain soil, and sediment of White Oak Creek, Melton Branch, and their tributaries. The human health risk assessment methodology used in this risk assessment is based on Risk Assessment Guidance for Superfund (RAGS). First, the data for the different media are elevated to determine usability for risk assessment. Second, through the process of selecting chemicals of potential concern (COPCs), contaminants to be considered in the risk assessment are identified for each assessment of exposure potential is performed, and exposure pathways are identified. Subsequently, exposure is estimated quantitatively, and the toxicity of each of the COPCs is determined. The results of these analyses are combined and summarized in a risk characterization.

  16. International Outreach: What Is the Responsibility of ASTRO and the Major International Radiation Oncology Societies?

    Energy Technology Data Exchange (ETDEWEB)

    Mayr, Nina A., E-mail: ninamayr@uw.edu [Department of Radiation Oncology, University of Washington School of Medicine, Seattle, Washington (United States); Hu, Kenneth S. [Department of Radiation Oncology, Beth Israel Medical Center, New York, New York (United States); Liao, Zhongxing [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Viswanathan, Akila N. [Department of Radiation Oncology, Dana-Farber/Brigham and Women' s Cancer Center, Harvard Medical School, Boston, Massachusetts (United States); Wall, Terry J. [St. Luke' s Cancer Institute, Kansas City, Missouri (United States); Amendola, Beatriz E. [Innovative Cancer Institute, Miami, Florida (United States); Calaguas, Miriam J. [Department of Radiation Oncology, St. Luke' s Medical Center, Quezon City (Philippines); Palta, Jatinder R. [Department of Radiation Oncology, Virginia Commonwealth University, Richmond, Virginia (United States); Yue, Ning J. [Department of Radiation Oncology, Rutgers Cancer Institute of New Jersey, New Brunswick, New Jersey (United States); Rengan, Ramesh [Department of Radiation Oncology, University of Washington School of Medicine, Seattle, Washington (United States); Williams, Timothy R. [Lynn Cancer Institute, Boca Raton Regional Hospital, Boca Raton, Florida (United States)

    2014-07-01

    In this era of globalization and rapid advances in radiation oncology worldwide, the American Society for Radiation Oncology (ASTRO) is committed to help decrease profound regional disparities through the work of the International Education Subcommittee (IES). The IES has expanded its base, reach, and activities to foster educational advances through a variety of educational methods with broad scope, in addition to committing to the advancement of radiation oncology care for cancer patients around the world, through close collaboration with our sister radiation oncology societies and other educational, governmental, and organizational groups.

  17. Topological influence and excitations: decomposition formulas for calculating homotopy groups of symmetry broken phases

    CERN Document Server

    Higashikawa, Sho

    2016-01-01

    A symmetry broken phase of a system with internal degrees of freedom often features a complex order parameter, which generates a rich variety of topological excitations and topological influence between them, yet the very complexity of the order parameter makes it difficult to treat topological excitations and topological influence in a unified manner. To overcome this problem, we develop a general method to calculate homotopy groups and derive decomposition formulas which express homotopy groups of a quotient space $G/H$ in terms of those of the symmetry $G$ of the system and those of the remaining symmetry $H$ of the state. We apply these formulas to analyze a general monopole and a general three-dimensional skyrmion, and show that their textures are obtained through substitution of the corresponding $\\mathfrak{su}(2)$-subalgebra for the $\\mathfrak{su}(2)$-spin. We also show that a discrete symmetry of $H$ is necessary for the presence of topological influence and find the topological influence on a skyrmio...

  18. Encoding Curved Tetrahedra in Face Holonomies: Phase Space of Shapes from Group-Valued Moment Maps

    Science.gov (United States)

    Haggard, Hal M.; Han, Muxin; Riello, Aldo

    2016-08-01

    We present a generalization of Minkowski's classic theorem on the reconstruction of tetrahedra from algebraic data to homogeneously curved spaces. Euclidean notions such as the normal vector to a face are replaced by Levi-Civita holonomies around each of the tetrahedron's faces. This allows the reconstruction of both spherical and hyperbolic tetrahedra within a unified framework. A new type of hyperbolic simplex is introduced in order for all the sectors encoded in the algebraic data to be covered. Generalizing the phase space of shapes associated to flat tetrahedra leads to group valued moment maps and quasi-Poisson spaces. These discrete geometries provide a natural arena for considering the quantization of gravity including a cosmological constant. A concrete realization of this is provided by the relation with the spin-network states of loop quantum gravity. This work therefore provides a bottom-up justification for the emergence of deformed gauge symmetries and quantum groups in 3+1 dimensional covariant loop quantum gravity in the presence of a cosmological constant.

  19. [Unproven methods in oncology].

    Science.gov (United States)

    Jallut, O; Guex, P; Barrelet, L

    1984-09-08

    As in some other chronic diseases (rheumatism, multiple sclerosis, etc.), unproven methods of diagnosis and treatment have long been current in cancer. Since 1960 the American Cancer Society has published an abundant literature on these "unproven methods", which serves as a basis for a historical review: some substances (Krebiozen, Laetrile) have enjoyed tremendous if shortlived success. The present trend is back to nature and "mild medicine". The proponents of this so-called natural medicine are often disciples of a pseudoscientific religion using irrational arguments. Direct attacks on these erroneous theories and their public refutation fail to convince the adepts, who trust in these methods and are not amenable to a scientific approach. Study of their psychological motivations reveals that in fact they seek something more reassuring than plain medical explanation which is aware of its limits. They feel reassured by theories which often bear some resemblance to the old popular medicine. To protect patients against these dangerous methods and all the disillusionment they entail, the Swiss Society of Oncology and the Swiss Cancer League have decided to gather information and draw up a descriptive list of the commonest unproven methods in Switzerland (our File No. 2, "Total anti-cancer cure", is given as an example). The files are published in French, German and English and are available to physicians, nursing teams, and also patients who wish to have more objective information on these methods.

  20. [Economic limits in oncology].

    Science.gov (United States)

    Hellriegel, K P

    2000-12-01

    Economic aspects require consideration even in oncology. However, they have to be seen in context with open questions concerning especially the evaluation of therapeutic effectiveness, of methodology, and particularly of ethics. Medical procedures and achievements should primarily be measured against objective results, against effectiveness and benefits. Consequently, the suitability of diagnostic and therapeutic strategies has to be evaluated. Overall objective of medical achievements should be their optimalization, not their maximization. For a physician being aware of his responsibility, the optimal care for his patients always has highest priority. Medical guidelines for diagnosis, treatment and follow-up are the basis for effective and economic patient care. They have to undergo economic evaluation and permanent updating. For systematic collection, documentation and evaluation, the clinical register is the appropriate instrument. For the assessment of medical care, a continuous monitoring of its processes has to be established. The documentation of medical care processes should lead to sustainable cost reductions together with an optimalization of the quality of care.

  1. Micronutrients in Oncological Intervention

    Directory of Open Access Journals (Sweden)

    Uwe Gröber

    2016-03-01

    Full Text Available Nutritional supplements are widely used among patients with cancer who perceive them to be anticancer and antitoxicity agents. Depending on the type of malignancy and the gender 30%–90% of the cancer patients supplement their diets with antioxidant and immuno-stabilizing micronutrients, such as selenium, vitamin C, and vitamin D, often without the knowledge of the treating physician. From the oncological viewpoint, there are justifiable concerns that dietary supplements decrease the effectiveness of chemotherapy and radiotherapy. Recent studies, however, have provided increasing evidence that treatment is tolerated better—with an increase in patient compliance and a lower rate of treatment discontinuations—when micronutrients, such as selenium, are added as appropriate to the patient’s medication. Nutritional supplementation tailored to an individual’s background diet, genetics, tumor histology, and treatments may yield benefits in subsets of patients. Clinicians should have an open dialogue with patients about nutritional supplements. Supplement advice needs to be individualized and come from a credible source, and it is best communicated by the physician.

  2. Renormalization Group and Phase Transitions in Spin, Gauge, and QCD Like Theories

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yuzhi [Univ. of Iowa, Iowa City, IA (United States)

    2013-08-01

    In this thesis, we study several different renormalization group (RG) methods, including the conventional Wilson renormalization group, Monte Carlo renormalization group (MCRG), exact renormalization group (ERG, or sometimes called functional RG), and tensor renormalization group (TRG).

  3. Waste Area Grouping 2 Remedial Investigation Phase 1 Seep Task data report: Contaminant source area assessment

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, D.S.

    1996-03-01

    This report presents the findings of the Waste Area Grouping (WAG) 2, Phase 1 Remedial Investigation (RI) Seep Task efforts during 1993 and 1994 at Oak Ridge National Laboratory (ORNL). The results presented here follow results form the first year of sampling, 1992, which are contained in the Phase 1 RI report for WAG 2 (DOE 1995a). The WAG 2 Seep Task efforts focused on contaminants in seeps, tributaries, and main streams within the White Oak Creek (WOC) watershed. This report is designed primarily as a reference for contaminants and a resource for guiding remedial decisions. Additional in-depth assessments of the Seep Task data may provide clearer understandings of contaminant transport from the different source areas in the WOC watershed. WAG 2 consists of WOC and its tributaries downstream of the ORNL main plant area, White Oak Lake, the White Oak Creek Embayment of the Clinch River, and the associated flood plains and subsurface environment. The WOC watershed encompasses ORNL and associated WAGs. WAG 2 acts as an integrator for contaminant releases from the contaminated sites at ORNL and as the conduit transporting contaminants to the Clinch River. The main objectives of the Seep Task were to identify and characterize seeps, tributaries and source areas that are responsible for the contaminant releases to the main streams in WAG 2 and to quantify their input to the total contaminant release from the watershed at White Oak Dam (WOD). Efforts focused on {sup 90}Sr, {sup 3}H, and {sup 137}Cs because these contaminants pose the greatest potential human health risk from water ingestion at WOD. Bimonthly sampling was conducted throughout the WOC watershed beginning in March 1993 and ending in August 1994. Samples were also collected for metals, anions, alkalinity, organics, and other radionuclides.

  4. Renormalization-Group Theory Study of Superfluidity and Phase Separation of Helium Mixtures Immersed in Jungle-Gym Aerogel

    Science.gov (United States)

    Lopatnikova, Anna; Berker, A. Nihat

    1997-03-01

    Superfluidity and phase separation in ^3He-^4He mixtures immersed in jungle-gym (non-random) aerogel are studied by renormalization-group theory.(Phys. Rev. B, in press (1996)) Phase diagrams are calculated for a variety of aerogel concentrations. Superfluidity at very low ^4He concentrations and a depressed tricritical temperature are found at the onset of superfluidity. A superfluid-superfluid phase separation, terminating at an isolated critical point, is found entirely within the superfluid phase. These phenomena, and trends with respect to aerogel concentration, are explained by the connectivity and tenuousness of jungle-gym aerogel.

  5. The National Cancer Institute's Physical Sciences - Oncology Network

    Science.gov (United States)

    Espey, Michael Graham

    In 2009, the NCI launched the Physical Sciences - Oncology Centers (PS-OC) initiative with 12 Centers (U54) funded through 2014. The current phase of the Program includes U54 funded Centers with the added feature of soliciting new Physical Science - Oncology Projects (PS-OP) U01 grant applications through 2017; see NCI PAR-15-021. The PS-OPs, individually and along with other PS-OPs and the Physical Sciences-Oncology Centers (PS-OCs), comprise the Physical Sciences-Oncology Network (PS-ON). The foundation of the Physical Sciences-Oncology initiative is a high-risk, high-reward program that promotes a `physical sciences perspective' of cancer and fosters the convergence of physical science and cancer research by forming transdisciplinary teams of physical scientists (e.g., physicists, mathematicians, chemists, engineers, computer scientists) and cancer researchers (e.g., cancer biologists, oncologists, pathologists) who work closely together to advance our understanding of cancer. The collaborative PS-ON structure catalyzes transformative science through increased exchange of people, ideas, and approaches. PS-ON resources are leveraged to fund Trans-Network pilot projects to enable synergy and cross-testing of experimental and/or theoretical concepts. This session will include a brief PS-ON overview followed by a strategic discussion with the APS community to exchange perspectives on the progression of trans-disciplinary physical sciences in cancer research.

  6. Hangzhou Jinjiang Group Shanxi Fusheng Aluminum Phase I 800,000 t/a Aluminum Oxide Project Started Operation

    Institute of Scientific and Technical Information of China (English)

    2014-01-01

    <正>On October 19,the Shanxi Province Pinglu County Phase I 800,000t/a Aluminum Oxide Project of Shanxi Fusheng Aluminum Co.,Ltd,a subordinate of Hangzhou Jinjiang Group,started operation.This is the fourth Aluminum oxide project constructed and operated by Jinjiang Group.

  7. Relationship between the types of binary alloy phase diagrams of VIII and IB group elements and the Mendeleev numbers

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The relationship between the types of binary alloy phase diagrams of Vlll and IB group elements and the Men deleev numbers was discussed for the first time using the Vlll and IB group elements as solvent metals (A) and the other elements as solute metals (B), basesd on their alloy phase diagram types. The Mendeleev numbers of the solvent metals and the solute metals were expressed as Ma and MB, respectively. A two-dimension map of MdMB was drawn. It is indicated that there is an oblique line in the map, which divides the binary alloy phase diagram types of solvent metals into two symmetry parts, the phase diagram types of the other elements with solvent metals located at the above or down of the line respectively, while on the line, AM= 0. The phase diagrams between the solvent metals basically are simple systems, mainly belong to the types of continues solid solution and the peritectic (about 40% for each type). The solvent metals can be divided into three groups: Co, Ir, Rh, Ni, Pt, and Pd as the first group; Ag, Au, and Cu as the second group;and Fe, Os, and Ru as the third group. The characteristics of the phase diagrams formed between the elements in each group were discussed. About 80% phase diagrams belong to complex systems and less than 20% belong to the simple systems. The regular variation of the chemical scale, the metallic radii of the atoms, the number of valence electrons, and the first ionization energy with the Mendeleev numbers and the crystal structure were introduced as well.

  8. Emergence of a Low Spin Phase in Group Field Theory Condensates

    CERN Document Server

    Gielen, Steffen

    2016-01-01

    Recent years have seen great progress towards deriving quantum cosmology models from the effective dynamics of condensate states in group field theory (GFT), where 'cosmology is the hydrodynamics of quantum gravity'; the classical Friedmann dynamics for homogeneous, isotropic universes, as well as loop quantum cosmology (LQC) corrections to general relativity have been shown to emerge from fundamental quantum gravity. We take one further step towards strengthening the link with LQC and show, in a rather wide class of GFT models for gravity coupled to a free massless scalar field and for generic initial conditions, that GFT condensates dynamically reach a low spin phase of many quanta of geometry, in which all but an exponentially small number of quanta are characterised by a single spin $j_0$ (i.e. by a constant volume per quantum). In one particular simple and natural case, this spin is the lowest one, $j_0=1/2$. The type of quantum state usually assumed in the derivation of LQC is hence derived from the qua...

  9. Frequencies of Blood Group Systems MNS, Diego, and Duffy and Clinical Phases of Carrion's Disease in Amazonas, Peru.

    Science.gov (United States)

    Acosta, Oscar; Solano, Luis; Escobar, Jorge; Fernandez, Miguel; Solano, Carlos; Fujita, Ricardo

    2014-01-01

    Carrion's disease (CD), is a human bartonellosis, that is, endemic in the Andes of Peru, Ecuador, and Colombia. Bartonella bacilliformis, a native hemotrophic bacteria, is the causative agent of CD, and the interaction with the host could have produced changes in the gene frequencies of erythrocyte antigens. The goal here is to investigate the relationship between allele frequencies of blood group systems MNS, Diego, and Duffy and the clinical phases of CD, within a genetic context. In this associative and analytical study, 76 individuals from Bagua Grande, the province of Utcubamba, and the department of Amazonas in Peru, were enrolled. Forty of them resided in Tomocho-Collicate-Vista Hermosa area (high prevalence of cases in chronic phase, verrucous, or eruptive phase, without previous acute phase). Thirty-six individuals were from the area of Miraflores (high prevalence of cases in acute phase only) and were evaluated for blood group systems MNS, Diego, and Duffy. This study constitutes one of the first attempts at evaluating the genetic factors and clinical phases of CD. No significant statistical differences (P > 0.05) between allele frequencies of blood groups MNS, Diego, and Duffy and the prevalence of chronic and acute phases were detected in the two areas of Amazonas, Peru.

  10. Unique Phase Behaviors in the Gemini Surfactant/EAN Binary System: The Role of the Hydroxyl Group.

    Science.gov (United States)

    Li, Qintang; Wang, Xudong; Yue, Xiu; Chen, Xiao

    2015-12-22

    The hydroxyl group in the spacer of a cationic Gemini surfactant (12-3OH-12) caused dramatic changes of the phase behaviors in a protic ionic liquid (EAN). Here, the effects of the hydroxyl group on micellization and lyotropic liquid crystal formation were investigated through the surface tension, small-angle X-ray scattering, polarized optical microscopy, and rheological measurements. With the hydroxyl group in the spacer, the critical micellization concentration of 12-3OH-12 was found to be lower than that of the homologue without hydroxyl (12-3-12) and the 12-3OH-12 molecules packed more densely at the air/EAN interface. It was then interesting to observe a coexistence of two separated phases at wide concentration and temperature ranges in this 12-3OH-12/EAN system. Such a micellar phase separation was rarely observed in the ionic surfactant binary system. With the increase of surfactant concentration, the reverse hexagonal and bicontinuous cubic phases appeared in sequence, whereas only a reverse hexagonal phase was found in 12-3-12/EAN system. But, the hexagonal phases formed with 12-3OH-12 exhibited lower viscoelasticity and thermostability than those observed in 12-3-12/EAN system. Such unique changes in phase behaviors of 12-3OH-12 were ascribed to their enhanced solvophilic interactions of 12-3OH-12 and relatively weak solvophobic interactions in EAN.

  11. The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

    Science.gov (United States)

    Wilk, Andrzej; Chmielewski, Marcin K; Grajkowski, Andrzej; Phillips, Lawrence R; Beaucage, Serge L

    2002-09-06

    Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

  12. Phenotypic and molecular detection of Salmonella sp. on growing, rearing and production phases in a commercial group of laying hens

    Directory of Open Access Journals (Sweden)

    Dunya M.C. Moraes

    2016-06-01

    Full Text Available Abstract: This present study was developed with the objective of detect Salmonella sp. by conventional bacteriology and qPCR techniques in samples of flooring material from transport crates (meconium; raising environment (swab of cages and drinking fountains; cloacal swab; food and insects from growing, rearing and production phases in a commercial group of laying hens. A total of 864 samples were collected, among whom 248 originated from growing, 392 from rearing and 224 from production phase. Among the 864 samples, 2,8% where positives in bacteriologic technique and 15.3% in qPCR. Contamination was higher in growing and rearing phases and declined in production phase. Twenty four isolations of Salmonella where typified as Salmonella Agona (41.7%, Salmonella Livingstone (33.3%, Salmonella Cerro (16.7%, Salmonella Senftenberg (4.2% and Salmonella Schwarzengrund (4.2%. During growing phase Salmonella Livingstone was identified. These findings suggest vertical contamination in the group. During rearing and production phases, isolated materials belong to serovars Agona, Cerro, Senftenberg and Schwarzengrund, pointing to horizontal contamination. It is possible to conclude that both vertical and horizontal contaminations are important during the cycle of commercial egg production and contamination in rearing phase is higher than in growing and production phases.

  13. Daily Bathing with Chlorhexidine and Its Effects on Nosocomial Infection Rates in Pediatric Oncology Patients.

    Science.gov (United States)

    Raulji, Chittalsinh M; Clay, Kristin; Velasco, Cruz; Yu, Lolie C

    2015-01-01

    Infections remain a serious complication in pediatric oncology patients. To determine if daily bathing with Chlorhexidine gluconate can decrease the rate of nosocomial infection in pediatric oncology patients, we reviewed rates of infections in pediatric oncology patients over a 14-month span. Intervention group received daily bath with Chlorhexidine, while the control group did not receive daily bath. The results showed that daily bath with antiseptic chlorhexidine as daily prophylactic antiseptic topical wash leads to decreased infection density amongst the pediatric oncology patients, especially in patients older than 12 years of age. Furthermore, daily chlorhexidine bathing significantly reduced the rate of hospital acquired infection in patients older than 12 years of age. The findings of this study suggest that daily bathing with chlorhexidine may be an effective measure of reducing nosocomial infection in pediatric oncology patients.

  14. Guidelines on Vaccinations in Paediatric Haematology and Oncology Patients

    Directory of Open Access Journals (Sweden)

    Simone Cesaro

    2014-01-01

    Full Text Available Objective. Vaccinations are the most important tool to prevent infectious diseases. Chemotherapy-induced immune depression may impact the efficacy of vaccinations in children. Patients and Methods. A panel of experts of the supportive care working group of the Italian Association Paediatric Haematology Oncology (AIEOP addressed this issue by guidelines on vaccinations in paediatric cancer patients. The literature published between 1980 and 2013 was reviewed. Results and Conclusion. During intensive chemotherapy, vaccination turned out to be effective for hepatitis A and B, whilst vaccinations with toxoid, protein subunits, or bacterial antigens should be postponed to the less intensive phases, to achieve an adequate immune response. Apart from varicella, the administration of live-attenuated-virus vaccines is not recommended during this phase. Family members should remain on recommended vaccination schedules, including toxoid, inactivated vaccine (also poliomyelitis, and live-attenuated vaccines (varicella, measles, mumps, and rubella. By the time of completion of chemotherapy, insufficient serum antibody levels for vaccine-preventable diseases have been reported, while immunological memory appears to be preserved. Once immunological recovery is completed, usually after 6 months, response to booster or vaccination is generally good and allows patients to be protected and also to contribute to herd immunity.

  15. Guidelines on Vaccinations in Paediatric Haematology and Oncology Patients

    Science.gov (United States)

    Cesaro, Simone; Giacchino, Mareva; Fioredda, Francesca; Barone, Angelica; Battisti, Laura; Bezzio, Stefania; Frenos, Stefano; De Santis, Raffaella; Livadiotti, Susanna; Marinello, Serena; Zanazzo, Andrea Giulio; Caselli, Désirée

    2014-01-01

    Objective. Vaccinations are the most important tool to prevent infectious diseases. Chemotherapy-induced immune depression may impact the efficacy of vaccinations in children. Patients and Methods. A panel of experts of the supportive care working group of the Italian Association Paediatric Haematology Oncology (AIEOP) addressed this issue by guidelines on vaccinations in paediatric cancer patients. The literature published between 1980 and 2013 was reviewed. Results and Conclusion. During intensive chemotherapy, vaccination turned out to be effective for hepatitis A and B, whilst vaccinations with toxoid, protein subunits, or bacterial antigens should be postponed to the less intensive phases, to achieve an adequate immune response. Apart from varicella, the administration of live-attenuated-virus vaccines is not recommended during this phase. Family members should remain on recommended vaccination schedules, including toxoid, inactivated vaccine (also poliomyelitis), and live-attenuated vaccines (varicella, measles, mumps, and rubella). By the time of completion of chemotherapy, insufficient serum antibody levels for vaccine-preventable diseases have been reported, while immunological memory appears to be preserved. Once immunological recovery is completed, usually after 6 months, response to booster or vaccination is generally good and allows patients to be protected and also to contribute to herd immunity. PMID:24868544

  16. Guidelines on vaccinations in paediatric haematology and oncology patients.

    Science.gov (United States)

    Cesaro, Simone; Giacchino, Mareva; Fioredda, Francesca; Barone, Angelica; Battisti, Laura; Bezzio, Stefania; Frenos, Stefano; De Santis, Raffaella; Livadiotti, Susanna; Marinello, Serena; Zanazzo, Andrea Giulio; Caselli, Désirée

    2014-01-01

    Vaccinations are the most important tool to prevent infectious diseases. Chemotherapy-induced immune depression may impact the efficacy of vaccinations in children. A panel of experts of the supportive care working group of the Italian Association Paediatric Haematology Oncology (AIEOP) addressed this issue by guidelines on vaccinations in paediatric cancer patients. The literature published between 1980 and 2013 was reviewed. During intensive chemotherapy, vaccination turned out to be effective for hepatitis A and B, whilst vaccinations with toxoid, protein subunits, or bacterial antigens should be postponed to the less intensive phases, to achieve an adequate immune response. Apart from varicella, the administration of live-attenuated-virus vaccines is not recommended during this phase. Family members should remain on recommended vaccination schedules, including toxoid, inactivated vaccine (also poliomyelitis), and live-attenuated vaccines (varicella, measles, mumps, and rubella). By the time of completion of chemotherapy, insufficient serum antibody levels for vaccine-preventable diseases have been reported, while immunological memory appears to be preserved. Once immunological recovery is completed, usually after 6 months, response to booster or vaccination is generally good and allows patients to be protected and also to contribute to herd immunity.

  17. Oocyte cryopreservation in oncological patients.

    Science.gov (United States)

    Porcu, Eleonora; Fabbri, Raffaella; Damiano, Giuseppe; Fratto, Rosita; Giunchi, Susanna; Venturoli, Stefano

    2004-04-05

    The use of chemotherapy and radiotherapy in oncological patients may reduce their reproductive potential. Sperm cryopreservation has been already used in men affected by neoplastic disease. Oocyte cryopreservation might be an important solution for these patients at risk of losing ovarian function. A program of oocyte cryopreservation for oncological patients is also present in our center. From June 1996 to January 2000, 18 patients awaiting chemotherapy and radiotherapy for neoplastic disease were included in our oocyte cryopreservation program. Our experience documents that oocyte storage may be a concrete and pragmatic alternative for oncological patients. The duration of oocyte storage does not seem to interfere with oocyte survival as pregnancies occurred even after several years of gamete cryopreservation in liquid nitrogen.

  18. Multidisciplinary care in pediatric oncology

    Directory of Open Access Journals (Sweden)

    Cantrell MA

    2011-05-01

    Full Text Available Mary Ann Cantrell1, Kathy Ruble21College of Nursing, Villanova University, Villanova, PA, USA; 2Department of Pediatric Oncology, Johns Hopkins University, School of Medicine, Baltimore, MD, USAAbstract: This paper describes the significant advances in the treatment of childhood cancer and supportive care that have occurred over the last several decades and details how these advances have led to improved survival and quality of life (QOL for children with cancer through a multidisciplinary approach to care. Advances in the basic sciences, general medicine, cooperative research protocols, and policy guidelines have influenced and guided the multidisciplinary approach in pediatric oncology care across the spectrum from diagnosis through long-term survival. Two case studies are provided to highlight the nature and scope of multidisciplinary care in pediatric oncology care.Keywords: childhood cancer, chemotherapy, leukemia

  19. Personality types of oncology nurses.

    Science.gov (United States)

    Bean, C A; Holcombe, J K

    1993-12-01

    Personality type influences the choice of occupation. The breadth of specialty areas within oncology nursing allows for divergent activities and relationships and, thus, the accommodation of different personality characteristics. This exploratory study examined personality types for a convenience sample of oncology nurses predominantly employed in hospitals. According to the personality typology defined by Carl Jung, a person demonstrates a preference among four dimensions, i.e., extraversion/introversion, sensory/intuition, thinking/feeling, and judging/perceiving. The type with the strongest self-selection for these oncology nurses was ISFJ, where feeling is introverted and perception is practical, so that helping others is both a responsibility and a pleasure. The discussion relates the personality types to Jung's theory and their impact in clinical practice. Strengths and weaknesses of each personality type are described.

  20. Geriatric oncology in the Netherlands: a survey of medical oncology specialists and oncology nursing specialists.

    Science.gov (United States)

    Jonker, J M; Smorenburg, C H; Schiphorst, A H; van Rixtel, B; Portielje, J E A; Hamaker, M E

    2014-11-01

    To identify ways to improve cancer care for older patients, we set out to examine how older patients in the Netherlands are currently being evaluated prior to oncological treatment and to explore the potential obstacles in the incorporation of a geriatric evaluation, using a web-based survey sent to Dutch medical oncology specialists and oncology nursing specialists. The response rate was 34% (183 out of 544). Two-thirds of respondents reported that a geriatric evaluation was being used, although primarily on an ad hoc basis only. Most respondents expressed a desire for a routine evaluation or more intensive collaboration with the geriatrician and 86% of respondents who were not using a geriatric evaluation expressed their interest to do so. The most important obstacles were a lack of time or personnel and insufficient availability of a geriatrician to perform the assessment. Thus, over 30% of oncology professionals in the Netherlands express an interest in geriatric oncology. Important obstacles to a routine implementation of a geriatric evaluation are a lack of time, or insufficient availability of geriatricians; this could be overcome with policies that acknowledge that quality cancer care for older patients requires the investment of time and personnel.

  1. 77 FR 57095 - Pediatric Oncology Subcommittee of the Oncologic Drugs Advisory Committee; Notice of Meeting

    Science.gov (United States)

    2012-09-17

    ... HUMAN SERVICES Food and Drug Administration Pediatric Oncology Subcommittee of the Oncologic Drugs... (FDA). The meeting will be open to the public. Name of Committee: Pediatric Oncology Subcommittee of... plans for four products that are in development for an adult oncology indication. The subcommittee...

  2. 75 FR 66773 - Pediatric Oncology Subcommittee of the Oncologic Drugs Advisory Committee; Notice of Meeting

    Science.gov (United States)

    2010-10-29

    ... HUMAN SERVICES Food and Drug Administration Pediatric Oncology Subcommittee of the Oncologic Drugs... (FDA). The meeting will be open to the public. Name of Committee: Pediatric Oncology Subcommittee of... were either recently approved by FDA or, are in late stage development for an adult oncology...

  3. 78 FR 63222 - Pediatric Oncology Subcommittee of the Oncologic Drugs Advisory Committee; Notice of Meeting

    Science.gov (United States)

    2013-10-23

    ... HUMAN SERVICES Food and Drug Administration Pediatric Oncology Subcommittee of the Oncologic Drugs... ] (FDA). The meeting will be open to the public. Name of Committee: Pediatric Oncology Subcommittee of... relevance and potential use of such measures in the pediatric development plans of oncology products....

  4. 78 FR 63224 - Pediatric Oncology Subcommittee of the Oncologic Drugs Advisory Committee; Notice of Meeting

    Science.gov (United States)

    2013-10-23

    ... HUMAN SERVICES Food and Drug Administration Pediatric Oncology Subcommittee of the Oncologic Drugs... (FDA). The meeting will be open to the public. Name of Committee: Pediatric Oncology Subcommittee of... late stage development for various adult oncology indications. The subcommittee will consider...

  5. 76 FR 61713 - Pediatric Oncology Subcommittee of the Oncologic Drugs Advisory Committee; Notice of Meeting

    Science.gov (United States)

    2011-10-05

    ... HUMAN SERVICES Food and Drug Administration Pediatric Oncology Subcommittee of the Oncologic Drugs... (FDA). The meeting will be open to the public. Name of Committee: Pediatric Oncology Subcommittee of..., are in late stage development for an adult oncology indication, or in late stage development...

  6. Mechanism of phase splitting in two coupled groups of suprachiasmatic-nucleus neurons

    Science.gov (United States)

    Gu, Changgui; Wang, Jianxiong; Wang, Jiaxiang; Liu, Zonghua

    2011-04-01

    The phase-splitting behavior of coupled suprachiasmatic-nucleus neurons has been observed in many mammals, and its mechanism is still not completely understood. Based on our previous work [C. Gu, J. Wang, and Z. Liu, Phys. Rev. E JTBIAP1539-375510.1103/PhysRevE.80.03090480, 030904(R) (2009)] on the free-running periods of neurons in the suprachiasmatic nucleus, we present here a modified Goodwin oscillator model to explain the mechanism of phase splitting. In contrast to the previous phase model, the modified Goodwin oscillator model contains the information on both the phase and amplitude and, thus, can show more features than the purely phase model, including all three behaviors of synchronization, phase splitting, and amplitude death and the distributed periodicity in the regions of synchronization and phase splitting, etc. An analytic phase model is extracted from the modified Goodwin oscillator model to explain the dependence of periodicity on the parameters. Moreover, both the modified Goodwin oscillator model and the analytic phase model show that the ensemble frequency can be enhanced or reduced by the time delay.

  7. PET/MR in oncology

    DEFF Research Database (Denmark)

    Balyasnikova, Svetlana; Löfgren, Johan; de Nijs, Robin

    2012-01-01

    of the challenges inherent in this new technology, but focus on potential applications for simultaneous PET/MR in the field of oncology. Methods and tracers for use with the PET technology will be familiar to most readers of this journal; thus this paper aims to provide a short and basic introduction to a number...... be applied together with PET increasing the amount of information about the tissues of interest. The potential clinical benefit of applying PET/MR in staging, radiotherapy planning and treatment evaluation in oncology, as well as the research perspectives for the use of PET/MR in the development of new...

  8. Global Health in Radiation Oncology

    DEFF Research Database (Denmark)

    Rodin, Danielle; Yap, Mei Ling; Grover, Surbhi

    2017-01-01

    The massive global shortfall in radiotherapy equipment and human resources in developing countries is an enormous challenge for international efforts in cancer control. This lack of access to treatment has been long-standing, but there is now a growing consensus about the urgent need to prioritize...... programs. However, formalized training and career promotion tracks in global health within radiation oncology have been slow to emerge, thereby limiting the sustained involvement of students and faculty, and restricting opportunities for leadership in this space. We examine here potential structures...... and funding models might be used to further develop and expand radiation oncology services globally....

  9. PET/MR in oncology

    DEFF Research Database (Denmark)

    Balyasnikova, Svetlana; Löfgren, Johan; de Nijs, Robin

    2012-01-01

    of the challenges inherent in this new technology, but focus on potential applications for simultaneous PET/MR in the field of oncology. Methods and tracers for use with the PET technology will be familiar to most readers of this journal; thus this paper aims to provide a short and basic introduction to a number...... be applied together with PET increasing the amount of information about the tissues of interest. The potential clinical benefit of applying PET/MR in staging, radiotherapy planning and treatment evaluation in oncology, as well as the research perspectives for the use of PET/MR in the development of new...

  10. Establishment of the Asia Oncology Nursing Society (AONS

    Directory of Open Access Journals (Sweden)

    Kazuko Onishi

    2014-01-01

    Full Text Available Over the past several years, whenever an informal group of Asian oncology nurses gathered, they talked about their mutual desire to create an organization closer to their homes that would be similar to the European Oncology Nursing Society (EONS. They saw this as a means for more of their colleagues to learn about the latest in cancer nursing and to have a time and place to network among themselves. This message continued to gain strength whenever these nurses met at other international meetings such as the International Conference on Cancer Nursing (ICCN, the Multinational Association of Supportive Care in Cancer (MASCC and the Oncology Nursing Society in US. A definite and planned step toward forming an Asian organization as the first meeting was taken on June 24 2011 when several Asian nurses were attending a MASCC meeting in Greece. The second meeting was held in Prague, Czech Republic, in conjunction with the 17 th ICCN meeting on September 10 2012, where the participants of the meeting included 21 oncology nurses from Asian countries. Finally, the first official meeting of the board directors from nine countries was held on November 21 2013 in Bangkok, Thailand. Now, and in the future, sharing and collaborating in the practice, education and research for oncology nursing in Asia is needed.

  11. Establishment of the Asia Oncology Nursing Society (AONS

    Directory of Open Access Journals (Sweden)

    Kazuko Onishi

    2014-06-01

    Full Text Available Over the past several years, whenever an informal group of Asian oncology nurses gathered, they talked about their mutual desire to create an organization closer to their homes that would be similar to the European Oncology Nursing Society (EONS. They saw this as a means for more of their colleagues to learn about the latest in cancer nursing and to have a time and place to network among themselves. This message continued to gain strength whenever these nurses met at other international meetings such as the International Conference on Cancer Nursing (ICCN, the Multinational Association of Supportive Care in Cancer (MASCC and the Oncology Nursing Society in US. A definite and planned step toward forming an Asian organization as the first meeting was taken on June 24 2011 when several Asian nurses were attending a MASCC meeting in Greece. The second meeting was held in Prague, Czech Republic, in conjunction with the 17 th ICCN meeting on September 10 2012, where the participants of the meeting included 21 oncology nurses from Asian countries. Finally, the first official meeting of the board directors from nine countries was held on November 21 2013 in Bangkok, Thailand. Now, and in the future, sharing and collaborating in the practice, education and research for oncology nursing in Asia is needed.

  12. Structural phase diagrams for the surface of a solid - A total-energy, renormalization-group approach

    Science.gov (United States)

    Ihm, J.; Lee, D. H.; Joannopoulos, J. D.; Xiong, J. J.

    1983-11-01

    Total-energy calculations based on microscopic electronic structure are combined with position-space renormalization-group calculations to predict the structural phase transitions of the Si(100) surface as a function of temperature. It is found that two distinct families of reconstructed geometries can exist on the surface, with independent phase transitions occurring within each. Two critical temperatures representing order-disorder transitions are calculated.

  13. Nomenclature of magnetic, incommensurate, composition-changed morphotropic, polytype, transient-structural and quasicrystalline phases undergoing phase transitions. II. Report of an IUCr Working Group on Phase Transition Nomenclature.

    Science.gov (United States)

    Tolédano, J C; Berry, R S; Brown, P J; Glazer, A M; Metselaar, R; Pandey, D; Perez-Mato, J M; Roth, R S; Abrahams, S C

    2001-09-01

    A general nomenclature applicable to the phases that form in any sequence of transitions in the solid state has been recommended by an IUCr Working Group [Acta Cryst. (1998). A54, 1028-1033]. The six-field notation of the first Report, hereafter I, was applied to the case of structural phase transitions, i.e. to transformations resulting from temperature and/or pressure changes between two crystalline (strictly periodic) phases involving modifications to the atomic arrangement. Extensive examples that illustrate the recommendations were provided. This second Report considers, within the framework of a similar six-field notation, the more complex nomenclature of transitions involving magnetic phases, incommensurate phases and transitions that occur as a function of composition change. Extension of the nomenclature to the case of phases with less clearly established relevance to standard schemes of transition in equilibrium systems, namely polytype phases, radiation-induced and other transient phases, quasicrystalline phases and their transitions is recommended more tentatively. A uniform notation for the translational periodicity, propagation vector or wavevector for magnetic and/or incommensurate substances is specified. The notation adopted for incommensurate phases, relying partly on the existence of an average structure, is also consistent with that for commensurate phases in a sequence. The sixth field of the nomenclature is used to emphasize the special features of polytypes and transient phases. As in I, illustrative examples are provided for each category of phase sequence.

  14. [Artificial intelligence applied to radiation oncology].

    Science.gov (United States)

    Bibault, J-E; Burgun, A; Giraud, P

    2017-05-01

    Performing randomised comparative clinical trials in radiation oncology remains a challenge when new treatment modalities become available. One of the most recent examples is the lack of phase III trials demonstrating the superiority of intensity-modulated radiation therapy in most of its current indications. A new paradigm is developing that consists in the mining of large databases to answer clinical or translational issues. Beyond national databases (such as SEER or NCDB), that often lack the necessary level of details on the population studied or the treatments performed, electronic health records can be used to create detailed phenotypic profiles of any patients. In parallel, the Record-and-Verify Systems used in radiation oncology precisely document the planned and performed treatments. Artificial Intelligence and machine learning algorithms can be used to incrementally analyse these data in order to generate hypothesis to better personalize treatments. This review discusses how these methods have already been used in previous studies. Copyright © 2017 Société française de radiothérapie oncologique (SFRO). Published by Elsevier SAS. All rights reserved.

  15. Attitudes toward infection prophylaxis in pediatric oncology: a qualitative approach.

    Directory of Open Access Journals (Sweden)

    Caroline Diorio

    Full Text Available BACKGROUND: The risks and benefits of infection prophylaxis are uncertain in children with cancer and thus, preferences should be considered in decision making. The purpose of this report was to describe the attitudes of parents, children and healthcare professionals to infection prophylaxis in pediatric oncology. METHODS: THE STUDY WAS COMPLETED IN THREE PHASES: 1 An initial qualitative pilot to identify the main attributes influencing the decision to use infection prophylaxis, which were then incorporated into a discrete choice experiment; 2 A think aloud during the discrete choice experiment in which preferences for infection prophylaxis were elicited quantitatively; and 3 In-depth follow up interviews. Interviews were recorded verbatim and analyzed using an iterative, thematic analysis. Final themes were selected using a consensus approach. RESULTS: A total of 35 parents, 22 children and 28 healthcare professionals participated. All three groups suggested that the most important factor influencing their decision making was the effect of prophylaxis on reducing the chance of death. Themes of importance to the three groups included antimicrobial resistance, side effects of medications, the financial impact of outpatient prophylaxis and the route and schedule of administration. CONCLUSION: Effect of prophylaxis on risk of death was a key factor in decision making. Other identified factors were antimicrobial resistance, side effects of medication, financial impact and administration details. Better understanding of factors driving decision making for infection prophylaxis will help facilitate future implementation of prophylactic regiments.

  16. Apps for Radiation Oncology. A Comprehensive Review

    Directory of Open Access Journals (Sweden)

    J.J. Calero

    2017-02-01

    Full Text Available Introduction: Software applications executed on a smart-phone or mobile device (“Apps” are increasingly used by oncologists in their daily work. A comprehensive critical review was conducted on Apps specifically designed for Radiation Oncology, which aims to provide scientific support for these tools and to guide users in choosing the most suited to their needs. Material and methods: A systematic search was conducted in mobile platforms, iOS and Android, returning 157 Apps. Excluding those whose purpose did not match the scope of the study, 31 Apps were methodically analyzed by the following items: Objective Features, List of Functionalities, Consistency in Outcomes and Usability. Results: Apps are presented in groups of features, as Dose Calculators (7 Apps, Clinical Calculators (4, Tools for Staging (7, Multipurpose (7 and Others (6. Each App is presented with the list of attributes and a brief comment. A short summary is provided at the end of each group. Discussion and Recommendations: There are numerous Apps with useful tools at the disposal of radiation oncologists. The most advisable Apps do not match the more expensive. Three all-in-one apps seem advisable above all: RadOnc Reference (in English, Easy Oncology (in German and iOncoR (in Spanish. Others recommendations are suggested for specific tasks: dose calculators, treatment-decision and staging.

  17. Training oncology practitioners in communication skills.

    Science.gov (United States)

    Baile, Walter F

    2011-10-01

    Many practitioners in oncology receive no or little training in how to effectively communicate with patients and families who are dealing with cancer. Moreover medical teachers are not always aware of the pedagogy of teaching communication skills in a way that results in performance improvement in this area. In this paper a method of small group teaching that was used to instruct medical oncology fellows in the essentials of communication using a retreat format that lasted three days is described. The paper covers the theoretical basis for the teaching format as well as the specific components of the workshops. It describes the process of facilitation using a "learner-centered" approach using standardized patients who take on the role of cancer patients along the trajectory of the illness. It discuss the use of small group process to facilitate skills acquisition and other strategies that facilitate learning such as reflective exercises, open role play and parallel process. It concludes with a consideration of the various ways that such workshops can be evaluated.

  18. Apps for Radiation Oncology. A Comprehensive Review.

    Science.gov (United States)

    Calero, J J; Oton, L F; Oton, C A

    2017-02-01

    Software applications executed on a smart-phone or mobile device ("Apps") are increasingly used by oncologists in their daily work. A comprehensive critical review was conducted on Apps specifically designed for Radiation Oncology, which aims to provide scientific support for these tools and to guide users in choosing the most suited to their needs. A systematic search was conducted in mobile platforms, iOS and Android, returning 157 Apps. Excluding those whose purpose did not match the scope of the study, 31 Apps were methodically analyzed by the following items: Objective Features, List of Functionalities, Consistency in Outcomes and Usability. Apps are presented in groups of features, as Dose Calculators (7 Apps), Clinical Calculators (4), Tools for Staging (7), Multipurpose (7) and Others (6). Each App is presented with the list of attributes and a brief comment. A short summary is provided at the end of each group. There are numerous Apps with useful tools at the disposal of radiation oncologists. The most advisable Apps do not match the more expensive. Three all-in-one apps seem advisable above all: RadOnc Reference (in English), Easy Oncology (in German) and iOncoR (in Spanish). Others recommendations are suggested for specific tasks: dose calculators, treatment-decision and staging. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Vienna International Summer School on Experimental and Clinical Oncology for Medical Students : An Austrian Cancer Education Project

    NARCIS (Netherlands)

    Fromm-Haidenberger, Sabine; Pohl, Gudrun; Widder, Joachim; Kren, Gerhard; Fitzal, Florian; Bartsch, Rupert; de Vries, Jakob; Zielinski, Christoph; Poetter, Richard

    The "International Summer School on Experimental and Clinical Oncology for Medical Students" is organised at the Medical University of Vienna to teach a multidisciplinary approach to oncology to medical students in the final phase of their studies. The program includes biology, diagnosis, clinical

  20. Oncological emergencies for the internist

    Directory of Open Access Journals (Sweden)

    Umesh Das

    2015-01-01

    Full Text Available An oncologic emergency is defined as any acute, potentially life-threatening event, either directly or indirectly related to a patient′s cancer (ca or its treatment. It requires rapid intervention to avoid death or severe permanent damage. Most oncologic emergencies can be classified as metabolic, hematologic, structural, or side effects from chemotherapy agents. Tumor lysis syndrome is a metabolic emergency that presents as severe electrolyte abnormalities. The condition is treated with aggressive hydration, allopurinol or urate oxidase to lower uric acid levels. Hypercalcemia of malignancy is treated with aggressive rehydration, furosemide, and intravenous (IV bisphosphonates. Syndrome of inappropriate antidiuretic hormone should be suspected if a patient with ca presents with normovolemic hyponatremia. This metabolic condition usually is treated with fluid restriction and furosemide. Febrile neutropenia is a hematologic emergency that usually requires inpatient therapy with broad-spectrum antibiotics, although outpatient therapy may be appropriate for low-risk patients. Hyperviscosity syndrome usually is associated with Waldenstrφm′s macroglobulinemia, which is treated with plasmapheresis and chemotherapy. Structural oncologic emergencies are caused by direct compression of surrounding structures or by metastatic disease. Superior vena cava syndrome is the most common structural oncological emergency. Treatment options include chemotherapy, radiation, and IV stenting. Epidural spinal cord compression can be treated with dexamethasone, radiation, or surgery. Malignant pericardial effusion, which often is undiagnosed in ca patients, can be treated with pericardiocentesis or a pericardial window procedure.

  1. Exploring targeted therapies in oncology

    NARCIS (Netherlands)

    Mom, Constantijne Helene

    2007-01-01

    Targeted therapy in oncology is treatment directed at specific biological pathways and processes that play a critical role in carcinogenesis. Increased knowledge regarding the molecular changes underlying tumor progression and metastatis has resulted in the development of agents that are designed to

  2. [What's new in geriatric oncology?].

    Science.gov (United States)

    Terret, Catherine; Albrand, Gilles; Jeanton, Martine; Courpron, Philippe; Droz, Jean-Pierre

    2006-01-01

    Remarkably, although 60% of new cancer cases and over 70% of cancer deaths occur in patients aged 65 years and older in Europe, standard treatment strategies have been mostly validated in younger adults. This demographic trend has led to the emergence of a new medical discipline, geriatric oncology and the development worldwide of geriatric oncology programs for the individualized management of elderly cancer patients. Elderly cancer patients represent an increasing share of the population and strategies for treating cancer must evolve to face this ineluctable reality. Treatment should take into account the highly heterogeneous physiological age of the elderly, their individual life expectancy, functional reserves, social support and preferences. French geriatric oncology programs have been mostly based on the interdependence of geriatricians, oncologists and auxiliary nursing people. This approach represent the best way to offer patients optimal management; oncologists and geriatricians collaborate to assess both global health status by means of Comprehensive Geriatric Assessment (CGA) and tumor stage by means of Comprehensive Tumor Assessment (CTA) and to initiate individualized care plans, involving comprehensive management and follow-up of all identified problems. This paper focuses on progress observed in the field of geriatric oncology both in France and worldwide.

  3. [History of Oncology in Slovakia].

    Science.gov (United States)

    Ondruš, D; Kaušitz, J

    2016-01-01

    The history of oncology in Slovakia is closely linked to the history of St. Elizabeth Hospital, which was set up in the mid-18th century by nuns of the St. Elizabeth Order in Bratislava. In the first half of the 20th century, a unit was set up in the hospital dedicated to diagnosis and treatment of cancer. Shortly after World War II, the unit was turned into the Institute for Cancer Research and Treatment. In 1950, St. Elizabeth Hospital was nationalized, and the Cancer Research Institute of the Slovak Academy of Science and the Institute of Clinical Oncology were located there as centers for oncological diagnosis and treatment. After the restitution of church property in the early 1990s, the hospital was returned to the Order of St. Elizabeth, which set up the St. Elisabeth Cancer Institute in the hospital premises in January of 1996. This year marks the 20th anniversary of this institute in its new premises and the 85th anniversary of the Institute of Radiumtherapy founded in Bratislava, and thus the establishment of institutional healthcare for cancer patients in Slovakia is the reason for balancing. We present a view of the consecutive changes in the organization, space and staff of the Institute and evaluate the impact of celebrities on medicine who developed oncology as a clinical, scientific and educational discipline in Bratislava and in other cities and regions of Slovakia.

  4. The effect of short term neo-adjuvant androgen deprivation on erectile function in patients treated with external beam radiotherapy for localised prostate cancer: an analysis of the 4- versus 8-month randomised trial (Irish Clinical Oncology Research Group 97-01).

    LENUS (Irish Health Repository)

    Daly, Patricia E

    2012-07-01

    Erectile dysfunction is a common consequence of external beam radiotherapy (EBRT) for prostate cancer. The addition of neo-adjuvant androgen deprivation (NAD) has an indeterminate additive effect. We examined the long-term effect on erectile function (EF) of two durations (4 months: arm 1 and 8 months: arm 2) of NAD prior to radiation (RT) for patients with localised prostate cancer from the Irish Clinical Oncology Research Group (ICORG 97-01) 4- versus 8-month trial. In this study we aimed to (1) analyse the overall effect on EF of NAD in an EBRT population, (2) compare the probability of retained EF over time in an EBRT population treated with either 4 or 8 months of NAD and (3) identify any variables such as risk group and age which may have an additive detrimental effect. This analysis provides unique long term follow up data.

  5. Formation of Pickering emulsions stabilized via interaction between nanoparticles dispersed in aqueous phase and polymer end groups dissolved in oil phase.

    Science.gov (United States)

    Okada, Masahiro; Maeda, Hayata; Fujii, Syuji; Nakamura, Yoshinobu; Furuzono, Tsutomu

    2012-06-26

    The influence of end groups of a polymer dissolved in an oil phase on the formation of a Pickering-type hydroxyapatite (HAp) nanoparticle-stabilized emulsion and on the morphology of HAp nanoparticle-coated microspheres prepared by evaporating solvent from the emulsion was investigated. Polystyrene (PS) molecules with varying end groups and molecular weights were used as model polymers. Although HAp nanoparticles alone could not function as a particulate emulsifier for stabilizing dichloromethane (oil) droplets, oil droplets could be stabilized with the aid of carboxyl end groups of the polymers dissolved in the oil phase. Lower-molecular-weight PS molecules containing carboxyl end groups formed small droplets and deflated microspheres, due to the higher concentration of carboxyl groups on the droplet/microsphere surface and hence stronger adsorption of the nanoparticles at the water/oil interface. In addition, Pickering-type suspension polymerization of styrene droplets stabilized by PS molecules containing carboxyl end groups successfully led to the formation of spherical HAp-coated microspheres.

  6. Lessons Learned: Dose Selection of Small Molecule-Targeted Oncology Drugs.

    Science.gov (United States)

    Bullock, Julie M; Rahman, Atiqur; Liu, Qi

    2016-06-01

    Evaluation of dose plays a critical role in a successful oncology development program. Typically for oncology agents, the first-in-man phase I dose-escalation trials are conducted to determine a maximum tolerated dose (MTD). This MTD is taken forward into subsequent trials to establish the safety and efficacy of the drug product. Although this approach was appropriate historically for cytotoxics, the application of MTD as the recommend phase II dose has been problematic for the newer small molecule-targeted oncology agents. Promising alternative approaches using dose and exposure exploration, including lessons learned from recent targeted oncology agent development and approvals, are summarized and discussed. Clin Cancer Res; 22(11); 2630-8. ©2016 AACR SEE ALL ARTICLES IN THIS CCR FOCUS SECTION, "NEW APPROACHES FOR OPTIMIZING DOSING OF ANTICANCER AGENTS".

  7. Perceptions, attitudes, and experiences of hematology/oncology fellows toward incorporating geriatrics in their training.

    Science.gov (United States)

    Maggiore, Ronald J; Gorawara-Bhat, Rita; Levine, Stacie K; Dale, William

    2014-01-01

    The aging of the U.S. population continues to highlight emerging issues in providing care generally for older adults and specifically for older adults with cancer. The majority of patients with cancer in the U.S. are currently 65 years of age or older; therefore, training and research in geriatrics and geriatric oncology are viewed to be integral in meeting the needs of this vulnerable population. Yet, the ways to develop and integrate best geriatrics training within the context of hematology/oncology fellowship remain unclear. Toward this end, the current study seeks to evaluate the prior and current geriatric experiences and perspectives of hematology/oncology fellows. To gain insight into these experiences, focus groups of hematology/oncology fellows were conducted. Emergent themes included: 1) perceived lack of formal geriatric oncology didactics among fellows; 2) a considerable amount of variability exists in pre-fellowship geriatric experiences; 3) shared desire to participate in a geriatric oncology-based clinic; 4) differences across training levels in confidence in managing older adults with cancer; and 5) identification of specific criteria on how best to approach older adults with cancer in a particular clinical scenario. The present findings will help guide future studies in evaluating geriatrics among hematology/oncology fellows across institutions. They will also have implications in the development of geriatrics curricula and competencies specific to hematology/oncology training. © 2013.

  8. Toward a consensus on radiobiology teaching to radiation oncology residents.

    Science.gov (United States)

    Dynlacht, Joseph R; Dewhirst, Mark W; Hall, Eric J; Rosenstein, Barry S; Zeman, Elaine M

    2002-05-01

    There are approximately 82 radiation oncology residency programs in the United States, which provide training opportunities for about 400 residents. All accredited radiation oncology residency programs must have at least one basic scientist on the faculty, and it is these individuals who often assume, wholly or in part, the responsibility of teaching radiation and cancer biology to radiation oncology residents in preparation for the American College of Radiology (ACR) In-Training Examination in Radiation Oncology and the American Board of Radiology (ABR) written examinations. In response to a perceived lack of uniformity in radiation and cancer biology curricula currently being taught to residents and a perceived lack of guidance for instructors in formulating course content for this population, a special session was presented at the Forty-eighth Annual Radiation Research Society meeting on April 23, 2001. The session, entitled "Toward a Consensus on Radiobiology Teaching to Radiation Oncology Residents", was focused on issues related to teaching radiobiology to radiation oncology residents and targeted for individuals who actively teach radiation and cancer biology as well as coordinators of residency training programs. The speakers addressed current challenges and future problems facing instructors and programs. Among these were lack of feedback on resident performance on ABR and ACR written examinations and on course content, uncertainty about what topics residents must know to pass the ABR examination, and, in the near future, a reduction (due to retirement) of instructors qualified to teach radiobiology. This article provides a synopsis of the information that was presented during that session, offers a glimpse into how the ABR and ACR examinations are prepared and details of the content of past and future examinations, and summarizes the activities of the Joint Working Group on Radiobiology Teaching which was formed to educate instructors, to establish a

  9. The coupling of thermochemistry and phase diagrams for group III-V semiconductor systems. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, T.J.

    1998-07-21

    The project was directed at linking the thermochemical properties of III-V compound semiconductors systems with the reported phase diagrams. The solid-liquid phase equilibrium problem was formulated and three approaches to calculating the reduced standard state chemical potential were identified and values were calculated. In addition, thermochemical values for critical properties were measured using solid state electrochemical techniques. These values, along with the standard state chemical potentials and other available thermochemical and phase diagram data, were combined with a critical assessment of selected III-V systems. This work was culminated with a comprehensive assessment of all the III-V binary systems. A novel aspect of the experimental part of this project was the demonstration of the use of a liquid encapsulate to measure component activities by a solid state emf technique in liquid III-V systems that exhibit high vapor pressures at the measurement temperature.

  10. Advances in radiation oncology in new millennium in Korea

    Energy Technology Data Exchange (ETDEWEB)

    Huh, Seung Jae [College of Medicine, Sungkyunkwan Univ., Seoul (Korea, Republic of); Park, Charn Il [College of Medicine, Seoul National Univ., Seoul (Korea, Republic of)

    2000-06-01

    The objective of recent radiation therapy is to improve the quality of treatment and the after treatment quality of life. In Korea, sharing the same objective, significant advancement was made due to the gradual increase of patient number and rapid increase of treatment facilities. The advancement includes generalization of three-dimensional conformal radiotherapy (3D-CRT), application of linac-based stereotactic radiosurgery (SRS), and furthermore, the introduction of intensity modulated radiation therapy (IMRT). Authors in this paper prospectively review the followings: the advancement of radiation oncology in Korea, the recent status of four-dimensional radiation therapy. IMRT, the concept of the treatment with biological conformity, the trend of combined chemoradiotherapy, the importance of internet and radiation oncology information management system as influenced by the revolution of information technology, and finally the global trend of telemedicine in radiation oncology. Additionally, we suggest the methods to improve radiotherapy treatment, which include improvement of quality assurance (QA) measures by developing Koreanized QA protocol and system, regional study about clinical protocol development for phase three clinical trial, suggestion of unified treatment protocol and guideline by academic or research societies, domestic generation of treatment equipment's or system, establishment of nationwide data base of radiation-oncology-related information, and finally pattems-of-care study about major cancers.

  11. The 2-(N-formyl-N-methyl)aminoethyl group as a potential phosphate/thiophosphate protecting group in solid-phase oligodeoxyribonucleotide synthesis.

    Science.gov (United States)

    Grajkowski, A; Wilk, A; Chmielewski, M K; Phillips, L R; Beaucage, S L

    2001-05-03

    [reaction in text] The 2-(N-formyl-N-methyl)aminoethyl deoxyribonucleoside phosphoramidite 1 has been synthesized and used in the solid-phase synthesis of an octadecathymidylic acid as a cost-efficient monomer for potential application in the preparation of therapeutic oligonucleotides. The 2-(N-formyl-N-methyl)aminoethyl group can be cleaved from oligonucleotides according to a unique thermolytic cyclodeesterification process at pH 7.0. In addition to being cost-effective, the use of 1 simplifies oligonucleotide postsynthesis processing by eliminating the utilization of concentrated ammonium hydroxide in oligonucleotide deprotection.

  12. Etoposide in malignant pleural mesothelioma : Two phase II trials of the EORTC Lung Cancer Cooperative Group

    NARCIS (Netherlands)

    Sahmoud, T; Postmus, PE; van Pottelsberghe, C; Mattson, K; Tammilehto, L; Splinter, TAW; Planting, AST; Sutedja, T; van Pawel, J; van Zandwijk, N; Baas, P; Roozendaal, KJ; Schrijver, M; Kirkpatrick, A; Van Glabbeke, M; Ardizzoni, A; Giaccone, G

    1997-01-01

    Intravenous and oral etoposide (VP 16-213) were tested in two sequential phase II trials in chemotherapy-naive patients with malignant pleural mesothelioma. In the first trial, etoposide was given intravenously (i.v.) at a dose of 150 mg/m(2) on days 1, 3 and 5 every 3 weeks. The second trial invest

  13. Etude et simulation des groupes convertisseurs-machines synchrones a six phases

    Science.gov (United States)

    Doyon, Jean-Francois

    Since many years, multiphase (n > 3) machines represent a growing research interest in the electrical machines domain. This type of machine can be used for many systems like automotive electrical traction, electric ship propulsion, wind farms or high-power industrial applications. Above all multiphase machines, the six phases wounded rotor synchronous machine brings a huge interest. Subsequently, using that kind of machine in any application requires a good understanding of the machine model and its respective converters. Hence, simulation represents a great way to study the behaviour and design of such applications that uses six phases wounded rotor synchronous machines. The present research concerns the study and simulation of six phase synchronous machinesconverters systems. From this project resulted the implementation of the six phases wound rotor salient pole synchronous machine in the Demos library of Matlab SimPowerSytems. In terms of study, a six phase machine electric drive is designed as well as a six phase machine implementation in a type 4 wind farm. The modeling of the six phase synchronous machine is fully detailed for the electrical part and the mechanical part. Then, the voltage source inverter electric drive with hysteresis control is conceived. Simulations of torque control, speed control and degraded mode of the machine are executed. The results illustrate the electric drive efficiency. This is followed by the type 4 wind turbine application of the machine. The wind farm is connected to a 120 kV grid, where a voltage drop fault appears at the 120 kV bar for a duration of six 60 Hz cycles. The results show a good operation of the regulators during the fault. This application is also subjected to a degraded mode, where results illustrate once again a good system regulation. Also, for the electric drive and the wind farm applications, a comparative study is made for the use of an asymmetrical versus symmetrical winding configuration of the machine

  14. Genetics in neuro-oncology.

    Science.gov (United States)

    Martuza, R L

    1983-01-01

    This review provides a framework for the neurosurgeon in understanding the increasingly important role of genetics in the study of nervous system tumors. The three tumors discussed (retinoblastoma, meningioma, and neurofibroma) are neither the most common nor the most clinically devastating tumors faced by neurosurgeons. Rather, the studies on these tumors are presented because of the important lessons each provides. Studies of retinoblastoma demonstrate the ability of a gene which is recessive at the cellular level to require a second mutation for tumorigenesis and therein to appear as a dominantly inherited disorder at the level of the organism. This "multi-hit" theory could easily be applied to other nervous system tumors which have both sporadic solitary tumors and familial multiple tumors. In this group we should include acoustic neuromas, meningiomas, gliomas, neurofibromas, paragangliomas (glomus and carotid body tumors), and the pituitary tumors (and others) associated with the multiple endocrine neoplasia syndromes. The limits of this review do not allow a separate discussion of the neurosurgical aspect of these lesions; for this, the reader is referred elsewhere (18, 19). Meningiomas are discussed because it appears that two separate lines of inquiry may eventually be related at a cellular level. These directions of study are the demonstration that a common karyotypic abnormality (monosomy 22) is associated with a female preponderance of meningiomas and the demonstration of sex hormone binding in meningiomas. Future studies should be aimed at showing an in vitro biologic response of these tumors to exogenously added hormones or to their blocking agents. Moreover, one would hope that this response would correlate with a specific chromosomal abnormality. It is possible that some portion of the DNA which has been deleted or altered in these tumors plays an essential role in the regulation of the sex steroid regulatory system. If this segment of the genome

  15. Effect of phase transition on quantum transport in group-IV two-dimensional U-shape device

    Energy Technology Data Exchange (ETDEWEB)

    Sadi, Mohammad Abdullah; Gupta, Gaurav, E-mail: a0089293@nus.edu.sg; Liang, Gengchiau [Department of Electrical and Computer Engineering, National University of Singapore, Singapore 117576 (Singapore)

    2014-10-21

    The effect of phase-transition from the quantum-spin-hall to the band-insulator phase on the transport through a three-terminal U-shape spin-separator has been computationally investigated via non-equilibrium green function formalism. Two-dimensional group-IV elements have been comprehensively appraised as the device material. The device separates the unpolarized current injected at the source-terminal into nearly 100% spin-polarized currents of the opposite polarities at the two drain terminals. The phase-transition activated by the electric-field orthogonal to the device is shown to extensively influence the current magnitude and its spin-polarization, and the effect is stronger for materials with smaller intrinsic spin-orbit coupling. Moreover, the device length and the area under field are shown to critically affect the device characteristics on phase change. It is shown that the same device can be operated as a spin-filter by inducing phase-transition selectively in the channel. The results are important for designing spin-devices from Group-IV monolayers.

  16. Therapists in Oncology Settings

    Science.gov (United States)

    Hendrick, Susan S.

    2013-01-01

    This article describes the author's experiences of working with cancer patients/survivors both individually and in support groups for many years, across several settings. It also documents current best-practice guidelines for the psychosocial treatment of cancer patients/survivors and their families. The author's view of the important qualities…

  17. Evaluation of a Two-Phase Experimental Study of a Small Group ("MultiLit") Reading Intervention for Older Low-Progress Readers

    Science.gov (United States)

    Buckingham, Jennifer; Beaman-Wheldall, Robyn; Wheldall, Kevin

    2014-01-01

    The study reported here examined the efficacy of a small group (Tier 2 in a three-tier Response to Intervention model) literacy intervention for older low-progress readers (in Years 3-6). This article focuses on the second phase of a two-phase, crossover randomized control trial involving 26 students. In Phase 1, the experimental group (E1)…

  18. Novel chiral stationary phases based on peptoid combining a quinine/quinidine moiety through a C9-position carbamate group.

    Science.gov (United States)

    Wu, Haibo; Wang, Dongqiang; Song, Guangjun; Ke, Yanxiong; Liang, Xinmiao

    2014-04-01

    By connecting a quinine or quinidine moiety to the peptoid chain through the C9-position carbamate group, we synthesized two new chiral selectors. After immobilizing them onto 3-mercaptopropyl-modified silica gel, two novel chiral stationary phases were prepared. With neutral, acid, and basic chiral compounds as analytes, we evaluated these two stationary phases and compared their chromatographic performance with chiral columns based on quinine tert-butyl carbamate and the previous peptoid. From the resolution of neutral and basic analytes under normal-phase mode, it was found that the new stationary phases exhibited much better enantioselectivity than the quinine tert-butyl carbamate column; the peptoid moiety played an important role in enantiorecognition, which controlled the elution orders of enantiomers; the assisting role of the cinchona alkaloid moieties was observed in some separations. Under acid polar organic phase mode, it was proved that cinchona alkaloid moieties introduced excellent enantiorecognitions for chiral acid compounds; in some separations, the peptoid moiety affected enantioseparations as well. Overall, chiral moieties with specific enantioselectivity were demonstrated to improve the performance of peptoid chiral stationary phase efficiently.

  19. [Shared web-based data center for multi-institutional clinical trials: evaluation of UMIN-INDICE (university hospital medical information network-internet data and information center for medical research)in clinical trials of JIVROSG (Japan interventional radiology in oncology study group)].

    Science.gov (United States)

    Sone, Miyuki; Arai, Yasuaki; Kiuchi, Takahiro; Ishikawa, Hirono; Aoki, Noriaki; Inaba, Yoshitaka; Yoshioka, Tetsuya; Aramaki, Takeshi; Kobayashi, Takeshi; Matsuoka, Toshiyuki; Anai, Hiroshi; Tanigawa, Noboru; Osuga, Keigo; Takeuchi, Yoshito; Okusaka, Takushi; Kanazawa, Susumu; Matsui, Osamu; Endo, Keigo

    2012-04-01

    A patient registration system is mandatory for establishing the scientific credibility of the multi-center clinical trials. The Japan Interventional Radiology in Oncology Study Group (JIVROSG) was organized in 2002 to establish evidence supporting the procedures used in interventional radiology. The Internet Data and Information Center for Medical Research (INDICE), provided by the University Hospital Medical Information Network(UMIN), has been utilized for patient registration in the clinical trials of JIVROSG. In this study, the safety and efficacy of UMIN-INDICE were evaluated. From 2002 to 2010, 18 clinical trials, including one international trial, were conducted. A total of 736 patients were enrolled from 51 institutions. No significant trouble was encountered during this period. A questionnaire survey demonstrated that 90% of participating researchers could use this system without difficulties. UMIN-INDICE may contribute to promoting clinical trials as an infrastructure of multicenter studies.

  20. Raman Spectroscopy for Clinical Oncology

    Directory of Open Access Journals (Sweden)

    Michael B. Fenn

    2011-01-01

    Full Text Available Cancer is one of the leading causes of death throughout the world. Advancements in early and improved diagnosis could help prevent a significant number of these deaths. Raman spectroscopy is a vibrational spectroscopic technique which has received considerable attention recently with regards to applications in clinical oncology. Raman spectroscopy has the potential not only to improve diagnosis of cancer but also to advance the treatment of cancer. A number of studies have investigated Raman spectroscopy for its potential to improve diagnosis and treatment of a wide variety of cancers. In this paper the most recent advances in dispersive Raman spectroscopy, which have demonstrated promising leads to real world application for clinical oncology are reviewed. The application of Raman spectroscopy to breast, brain, skin, cervical, gastrointestinal, oral, and lung cancers is reviewed as well as a special focus on the data analysis techniques, which have been employed in the studies.

  1. Report on the International Colloquium on Cardio-Oncology (Rome, 12–14 March 2014)

    Science.gov (United States)

    Ewer, Michael; Gianni, Luca; Pane, Fabrizio; Sandri, Maria Teresa; Steiner, Rudolf K; Wojnowski, Leszek; Yeh, Edward T; Carver, Joseph R; Lipshultz, Steven E; Minotti, Giorgio; Armstrong, Gregory T; Cardinale, Daniela; Colan, Steven D; Darby, Sarah C; Force, Thomas L; Kremer, Leontien CM; Lenihan, Daniel J; Sallan, Stephen E; Sawyer, Douglas B; Suter, Thomas M; Swain, Sandra M; van Leeuwen, Flora E

    2014-01-01

    Cardio-oncology is a relatively new discipline that focuses on the cardiovascular sequelae of anti-tumour drugs. As any other young adolescent discipline, cardio-oncology struggles to define its scientific boundaries and to identify best standards of care for cancer patients or survivors at risk of cardiovascular events. The International Colloquium on Cardio-Oncology was held in Rome, Italy, 12–14 March 2014, with the aim of illuminating controversial issues and unmet needs in modern cardio-oncology. This colloquium embraced contributions from different kind of disciplines (oncology and cardiology but also paediatrics, geriatrics, genetics, and translational research); in fact, cardio-oncology goes way beyond the merging of cardiology with oncology. Moreover, the colloquium programme did not review cardiovascular toxicity from one drug or the other, rather it looked at patients as we see them in their fight against cancer and eventually returning to everyday life. This represents the melting pot in which anti-cancer therapies, genetic backgrounds, and risk factors conspire in producing cardiovascular sequelae, and this calls for screening programmes and well-designed platforms of collaboration between one key professional figure and another. The International Colloquium on Cardio-Oncology was promoted by the Menarini International Foundation and co-chaired by Giorgio Minotti (Rome), Joseph R Carver (Philadelphia, Pennsylvania, United States), and Steven E Lipshultz (Detroit, Michigan, United States). The programme was split into five sessions of broad investigational and clinical relevance (what is cardiotoxicity?, cardiotoxicity in children, adolescents, and young adults, cardiotoxicity in adults, cardiotoxicity in special populations, and the future of cardio-oncology). Here, the colloquium chairs and all the session chairs briefly summarised what was said at the colloquium. Topics and controversies were reported on behalf of all members of the working group

  2. Generalities of the oncological pain

    Directory of Open Access Journals (Sweden)

    Sarah María Regueira Betancourt

    2015-09-01

    Full Text Available Cancer pain can be caused by a malignant tumor, by the therapy used to treat it, or by both causes. It begins with an acute onset that goes towards healing or chronicity. Together with the manifestations of a chronic pain, acute episodes may appear. A bibliographic study was carried out on the oncological pain, using the resources available in the Infomed network, specifically Ebsco, The Cochrane Librery, PubMed, Hinari and SciELO, by means of which the following databases were accessed: MEDLINE, AcademicSearch Premier and MedicLatina. The presence of pain in an oncological process is variable and it depends on the type and extension of the disease, as well as on each person's own individual tolerance. The terminal intense oncological pain is a circumstance both foreseeable and necessarily avoidable. Its relief is a priority in the cancer program of the World Health Organization. To know the classification of pain, its causes, the assessment scales and the way in which it may be described provides a comprehensive treatment for cancer pain. It also helps to optimize the comprehensive care to the patients suffering from this condition and improve their quality of life.

  3. The role of European Federation of Clinical Chemistry and Laboratory Medicine Working Group for Preanalytical Phase in standardization and harmonization of the preanalytical phase in Europe

    DEFF Research Database (Denmark)

    Cornes, Michael P; Church, Stephen; van Dongen-Lases, Edmée;

    2016-01-01

    and Laboratory Medicine Working Group for Preanalytical Phase (EFLM WG-PRE) was established to lead in standardization and harmonization of preanalytical policies and practices at a European level. One of the key activities of the WG-PRE is the organization of the biennial EFLM-BD conference on the preanalytical......Patient safety is a leading challenge in healthcare and from the laboratory perspective it is now well established that preanalytical errors are the major contributor to the overall rate of diagnostic and therapeutic errors. To address this, the European Federation of Clinical Chemistry...... summarises the work that has and will be done in these areas. The goal of this initiative is to ensure the EFLM WG-PRE produces work that meets the needs of the European laboratory medicine community. Progress made in the identified areas will be updated at the next preanalytical phase conference and show...

  4. Clinical Trials and the Role of the Oncology Clinical Trials Nurse.

    Science.gov (United States)

    Ness, Elizabeth A; Royce, Cheryl

    2017-03-01

    Clinical trials are paramount to improving human health. New trial designs and informed consent issues are emerging as a result of genomic profiling and the development of molecularly targeted agents. Many groups and individuals are responsible for ensuring the protection of research participants and the quality of the data produced. The specialty role of the clinical trials nurse (CTN) is critical to clinical trials. Oncology CTNs have competencies that can help guide their practice; however, not all oncology clinical trials are supervised by a nurse. Using the process of engagement, one organization has restructured oncology CTNs under a nurse-supervised model.

  5. Diazonium modification of porous graphitic carbon with catechol and amide groups for hydrophilic interaction and attenuated reversed phase liquid chromatography.

    Science.gov (United States)

    Iverson, Chad D; Zhang, Ya; Lucy, Charles A

    2015-11-27

    Porous graphitic carbon (PGC) is an increasingly popular and attractive phase for HPLC on account of its chemical and thermal stability, and its unique separation mechanism. However, native PGC is strongly hydrophobic and in some instances excessively retentive. As part of our effort to build a library of hydrophilic covalently modified PGC phases, we functionalized PGC with catechol and amide groups by means of aryl diazonium chemistry to produce two new phases. Successful grafting was confirmed by X-ray photoelectron spectroscopy (XPS). Under HILIC conditions, the Catechol-PGC showed up to 5-fold increased retention relative to unmodified PGC and selectivity that differed from four other HILIC phases. Under reversed phase conditions, the Amide-PGC reduced the retentivity of PGC by almost 90%. The chromatographic performance of Catechol-PGC and Amide-PGC is demonstrated by separations of nucleobases, nucleosides, phenols, alkaline pharmaceuticals, and performance enhancing stimulants. These compounds had retention factors (k) ranging from 0.5 to 13.

  6. Detecting local heterogeneity and ionization ability in the head group region of different lipidic phases using modified fluorescent probes

    Science.gov (United States)

    Abou-Zied, Osama K.; Zahid, N. Idayu; Khyasudeen, M. Faisal; Giera, David S.; Thimm, Julian C.; Hashim, Rauzah

    2015-01-01

    Local heterogeneity in lipid self-assembly is important for executing the cellular membrane functions. In this work, we chemically modified 2-(2′-hydroxyphenyl)benzoxazole (HBO) and attached a C8 alkyl chain in two different locations to probe the microscopic environment of four lipidic phases of dodecyl β-maltoside. The fluorescence change in HBO and the new probes (HBO-1 and HBO-2) shows that in all phases (micellar, hexagonal, cubic and lamellar) three HBO tautomeric species (solvated syn-enol, anionic, and closed syn-keto) are stable. The formation of multi tautomers reflects the heterogeneity of the lipidic phases. The results indicate that HBO and HBO-1 reside in a similar location within the head group region, whereas HBO-2 is slightly pushed away from the sugar-dominated area. The stability of the solvated syn-enol tautomer is due to the formation of a hydrogen bond between the OH group of the HBO moiety and an adjacent oxygen atom of a sugar unit. The detected HBO anions was proposed to be a consequence of this solvation effect where a hydrogen ion abstraction by the sugar units is enhanced. Our results point to a degree of local heterogeneity and ionization ability in the head group region as a consequence of the sugar amphoterism. PMID:25731606

  7. Detecting local heterogeneity and ionization ability in the head group region of different lipidic phases using modified fluorescent probes.

    Science.gov (United States)

    Abou-Zied, Osama K; Zahid, N Idayu; Khyasudeen, M Faisal; Giera, David S; Thimm, Julian C; Hashim, Rauzah

    2015-03-03

    Local heterogeneity in lipid self-assembly is important for executing the cellular membrane functions. In this work, we chemically modified 2-(2'-hydroxyphenyl)benzoxazole (HBO) and attached a C8 alkyl chain in two different locations to probe the microscopic environment of four lipidic phases of dodecyl β-maltoside. The fluorescence change in HBO and the new probes (HBO-1 and HBO-2) shows that in all phases (micellar, hexagonal, cubic and lamellar) three HBO tautomeric species (solvated syn-enol, anionic, and closed syn-keto) are stable. The formation of multi tautomers reflects the heterogeneity of the lipidic phases. The results indicate that HBO and HBO-1 reside in a similar location within the head group region, whereas HBO-2 is slightly pushed away from the sugar-dominated area. The stability of the solvated syn-enol tautomer is due to the formation of a hydrogen bond between the OH group of the HBO moiety and an adjacent oxygen atom of a sugar unit. The detected HBO anions was proposed to be a consequence of this solvation effect where a hydrogen ion abstraction by the sugar units is enhanced. Our results point to a degree of local heterogeneity and ionization ability in the head group region as a consequence of the sugar amphoterism.

  8. Intervention patterns of pivot nurses in oncology.

    Science.gov (United States)

    Skrutkowski, Myriam; Saucier, Andréanne; Ritchie, Judith A; Tran, Ngoc; Smith, Kevin

    2011-01-01

    The Pivot Nurse in Oncology (PNO) is a health care professional dedicated to providing patients with cancer and their families with continuing and consistent supportive care throughout the care trajectory. The purpose of this paper is to describe the variation and frequency of nursing interventions delivered by 12 PNOs at our health centre. An administrative analysis over a three-year period revealed a total of 43,906 interventions that were grouped into 10 categories. This analysis provided a description of the intervention frequency and these interventions were further collapsed into the four role functions of the PNO. Coordination/continuity of care and the assessment of needs and symptoms were identified as the dominant practice domains of the PNO in the professional cancer navigator role.

  9. Renormalization group improved computation of correlation functions in theories with nontrivial phase diagram

    DEFF Research Database (Denmark)

    Codello, Alessandro; Tonero, Alberto

    2016-01-01

    the momentum modes that contribute to it according to their renormalization group (RG) relevance, i.e. we weight each mode according to the value of the running couplings at that scale. In this way, we are able to encode in a loop computation the information regarding the RG trajectory along which we...

  10. Organisational design for an integrated oncological department

    Directory of Open Access Journals (Sweden)

    Ch.L. Meiss-de Haas

    2001-09-01

    Full Text Available Objective: The outcomes of a Strength, Weakness, Opportunities and Threat (SWOT analysis of three Integrated Oncological Departments were compared with their present situation three years later to define factors that can influence a successful implementation and development of an Integrated Oncological Department in- and outside (i.e. home care the hospital. Research design: Comparative Qualitative Case Study. Methods: Auditing based on care-as-usual norms by an external, experienced auditing committee. Research setting: Integrated Oncological Departments of three hospitals. Results: Successful multidisciplinary care in an integrated, oncological department needs broad support inside the hospital and a well-defined organisational plan.

  11. Randomized Trial Comparing Conventional-Dose With High-Dose Conformal Radiation Therapy in Early-Stage Adenocarcinoma of the Prostate: Long-Term Results From Proton Radiation Oncology Group/American College of Radiology 95-09

    Science.gov (United States)

    Zietman, Anthony L.; Bae, Kyounghwa; Slater, Jerry D.; Shipley, William U.; Efstathiou, Jason A.; Coen, John J.; Bush, David A.; Lunt, Margie; Spiegel, Daphna Y.; Skowronski, Rafi; Jabola, B. Rodney; Rossi, Carl J.

    2010-01-01

    Purpose To test the hypothesis that increasing radiation dose delivered to men with early-stage prostate cancer improves clinical outcomes. Patients and Methods Men with T1b-T2b prostate cancer and prostate-specific antigen ≤ 15 ng/mL were randomly assigned to a total dose of either 70.2 Gray equivalents (GyE; conventional) or 79.2 GyE (high). No patient received androgen suppression therapy with radiation. Local failure (LF), biochemical failure (BF), and overall survival (OS) were outcomes. Results A total of 393 men were randomly assigned, and median follow-up was 8.9 years. Men receiving high-dose radiation therapy were significantly less likely to have LF, with a hazard ratio of 0.57. The 10-year American Society for Therapeutic Radiology and Oncology BF rates were 32.4% for conventional-dose and 16.7% for high-dose radiation therapy (P < .0001). This difference held when only those with low-risk disease (n = 227; 58% of total) were examined: 28.2% for conventional and 7.1% for high dose (P < .0001). There was a strong trend in the same direction for the intermediate-risk patients (n = 144; 37% of total; 42.1% v 30.4%, P = .06). Eleven percent of patients subsequently required androgen deprivation for recurrence after conventional dose compared with 6% after high dose (P = .047). There remains no difference in OS rates between the treatment arms (78.4% v 83.4%; P = .41). Two percent of patients in both arms experienced late grade ≥ 3 genitourinary toxicity, and 1% of patients in the high-dose arm experienced late grade ≥ 3 GI toxicity. Conclusion This randomized controlled trial shows superior long-term cancer control for men with localized prostate cancer receiving high-dose versus conventional-dose radiation. This was achieved without an increase in grade ≥ 3 late urinary or rectal morbidity. PMID:20124169

  12. 78 FR 25304 - Siemens Medical Solutions, USA, Inc., Oncology Care Systems (Radiation Oncology), Including On...

    Science.gov (United States)

    2013-04-30

    ... Employment and Training Administration Siemens Medical Solutions, USA, Inc., Oncology Care Systems (Radiation Oncology), Including On-Site Leased Workers From Source Right Solutions, Concord, California, Now Located... 5, 2012, applicable to workers of Siemens Medical Solutions, USA, Inc., Oncology Care...

  13. 76 FR 58520 - Pediatric Oncology Subcommittee of the Oncologic Drugs Advisory Committee; Notice of Meeting

    Science.gov (United States)

    2011-09-21

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration Pediatric Oncology Subcommittee of the Oncologic Drugs... (FDA). The meeting will be open to the public. Name of Committee: Pediatric Oncology Subcommittee...

  14. The Renormalization Group, Entropy, Thermodynamic Phase Transitions and Order in Quantum Field Theory

    CERN Document Server

    Pérez-Mercader, J

    1993-01-01

    We define an entropy for a quantum field theory by combining quantum fluctuations, scaling and the maximum entropy concept. This entropy has different behavior in asymptotically free and non--asymptotically free theories. We find that the transition between the two regimes (from the asymptotically free to the non--asymptotically free) takes place via a continuous phase transition. For asymptotically free theories there exist regimes where the ``temperatures" are negative. In asymptotically free theories there exist maser--like states mostly in the infrared; furthermore, as one goes into the ultraviolet and more matter states contribute to quantum processes, the quantum field system can shed entropy and cause the formation of thermodynamically stable {\\it entropy--ordered} states. It is shown how the known heavier quarks can be thus described.

  15. Use of Psychosocial Services Increases after a Social Worker-Mediated Intervention in Gynecology Oncology Patients

    Science.gov (United States)

    Abbott, Yuko; Shah, Nina R.; Ward, Kristy K.; McHale, Michael T.; Alvarez, Edwin A.; Saenz, Cheryl C.; Plaxe, Steven C.

    2013-01-01

    The purpose of this study was to determine whether the introduction of psychosocial services to gynecologic oncology outpatients by a social worker increases service use. During the initial six weeks (phase I), patients were referred for psychosocial services by clinic staff. During the second six weeks (phase II), a nurse introduced available…

  16. Breaking phase focused wave group loads on offshore wind turbine monopiles

    DEFF Research Database (Denmark)

    Ghadirian, Amin; Bredmose, Henrik; Dixen, M.

    2016-01-01

    OceanWave3D-OpenFOAM solver, against measurements of focused wave group impacts on a monopile. The focused 2D and 3D wave groups are reproduced and the free surface elevation and the in-line forces are compared to the experimental results. In addition, the pressure distribution on the monopile...... is examined at the time of maximum force and discussed in terms of shape and magnitude. Relative pressure time series are also compared between the simulations and experiments and detailed pressure fields for a 2D and 3D impact are discussed in terms of impact type. In general a good match for free surface...... elevation, in-line force and wave-induced pressures is found....

  17. Modeling the production of intergalactic light in the pre-collapse phase of galaxy groups

    OpenAIRE

    Solanes, Jose M.; Darriba, Laura; Collaboration, for the IDILICO

    2012-01-01

    This paper reports one recent result from a set of pre-virialized galaxy group simulations that are being used in an investigation of measurement techniques for the quantity of intragroup light (IGL). We present evidence that the binding energy of the stellar material stripped from the galaxies is essentially uncorrelated with the local mass density. This suggests that IGL detection methods based on the distribution of luminosity perform poorly in detecting the unbound stars.

  18. hsphase: an R package for pedigree reconstruction, detection of recombination events, phasing and imputation of half-sib family groups

    Science.gov (United States)

    2014-01-01

    Background Identification of recombination events and which chromosomal segments contributed to an individual is useful for a number of applications in genomic analyses including haplotyping, imputation, signatures of selection, and improved estimates of relationship and probability of identity by descent. Genotypic data on half-sib family groups are widely available in livestock genomics. This structure makes it possible to identify recombination events accurately even with only a few individuals and it lends itself well to a range of applications such as parentage assignment and pedigree verification. Results Here we present hsphase, an R package that exploits the genetic structure found in half-sib livestock data to identify and count recombination events, impute and phase un-genotyped sires and phase its offspring. The package also allows reconstruction of family groups (pedigree inference), identification of pedigree errors and parentage assignment. Additional functions in the package allow identification of genomic mapping errors, imputation of paternal high density genotypes from low density genotypes, evaluation of phasing results either from hsphase or from other phasing programs. Various diagnostic plotting functions permit rapid visual inspection of results and evaluation of datasets. Conclusion The hsphase package provides a suite of functions for analysis and visualization of genomic structures in half-sib family groups implemented in the widely used R programming environment. Low level functions were implemented in C++ and parallelized to improve performance. hsphase was primarily designed for use with high density SNP array data but it is fast enough to run directly on sequence data once they become more widely available. The package is available (GPL 3) from the Comprehensive R Archive Network (CRAN) or from http://www-personal.une.edu.au/~cgondro2/hsphase.htm. PMID:24906803

  19. Development of the Pediatric Neuro-Oncology Rating of Treatment Intensity (PNORTI).

    Science.gov (United States)

    Hocking, Matthew C; Hobbie, Wendy; Fisher, Michael J

    2017-09-08

    Measures of treatment intensity for childhood cancer are needed in research in order to control for variability in treatments. Existing measures of treatment intensity for childhood cancers do not reflect the complexities of treatment protocols for central nervous system (CNS) tumors. This paper describes the development of the Pediatric Neuro-Oncology Rating of Treatment Intensity (PNORTI). PNORTI development occurred in three phases. Phase 1: five experts in pediatric neuro-oncology created a 5-point scale of treatment intensity and 42 pediatric neuro-oncology providers completed a three-part online questionnaire to evaluate the classification system and apply the rating system to 16 sample patients. Validity was determined by respondents classifying therapy modalities into intensity levels. Inter-rater reliability was calculated from ratings of the 16 sample patients. Phase 2: three experts revised the PNORTI based on survey results and 18 pediatric neuro-oncology providers evaluated the classification system. Phase 3: ten experts in pediatric neuro-oncology refined and finalized the PNORTI and rated 10 sample patients using the PNORTI. Agreement between median ratings of the survey respondents and criterion raters for chemotherapy intensity (r's = .82 and 1.0) and overall treatment intensity level (r's = .91 and .94) were high in Phases 1 and 2. Inter-rater reliability also was very high when using the PNORTI to classify the 16 sample patients in Phase 1 (median agreement of r = .93 and rICC = .99) and the 10 sample patients in Phase 3 (median agreement of r = .92 and rICC = .98). The PNORTI is a valid and reliable method for classifying the intensity of different treatment modalities used in pediatric neuro-oncology.

  20. [Limitations and pitfalls of clinical studies in oncology].

    Science.gov (United States)

    Cerny, Thomas

    2008-01-01

    Nowadays results of clinical studies in oncology are often first found and commented in the news media because of their high relevance to the pharmaceutical market. The limits and pitfalls of clinical studies are manifold and not always appreciated even by specialists as well as journalists and politicians. The planning of a study is a most crucial phase, and most deficits are due to inappropriate design and conduct of a study. Adequate and skilful interpretation of a study is often hampered by many known but mostly overlooked variable pitfalls. Today there is an overrepresentation of pharmaceutically sponsored studies and a painful lack of well-designed academic studies with really meaningful endpoints for patient care. This paper touches several important aspects of today's shortcomings of clinical studies in oncology and highlights the importance of strengthening the academic clinical research. Evidence-based medicine needs to be more clinically relevant, and therefore we need well-designed, and critically interpreted studies in the future.

  1. Partial laryngectomy in glottic cancer: complications and oncological results.

    Science.gov (United States)

    Graciano, Agnaldo José; Sonagli, Marina; da Silva, Ana Gabriela Clemente; Fischer, Carlos Augusto; Chone, Carlos Takahiro

    2016-01-01

    Most patients with laryngeal carcinoma present tumors in the glottis that can be treated by different treatment modalities. Some authors consider open partial laryngectomy as obsolete, while others still deem this as a viable and cost-efficient option. To compare the oncological and functional results of a series of patients undergoing partial laryngectomy vs. external radiotherapy for the treatment of glottic cancer. Historical cohort study with a series of glottic carcinoma patients undergoing partial laryngectomy or external radiotherapy during a period of ten years. Sixty-two patients with glottic carcinoma were included. Group A comprised those submitted to partial laryngectomy (n=30), and Group B, those who underwent radiotherapy (n=32). They were homogeneous in the comparison of mean age, 56.4 vs. 60.4 years (p=0.12) and distribution in pathological stage (p=0.91). With regard to oncological outcome, there were no differences in distant metastasis rates, or second primary tumor between groups (p=1.0), as well as in disease-free time, laryngeal rescue-free time, and overall five-year survival. Severe complication rates were also similar between groups. Open partial laryngectomy had complication rates and oncological results similar to those of radiotherapy for patients with glottic carcinomas and should still be considered among the main available therapeutic options. Copyright © 2015 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  2. Study protocol: Addressing evidence and context to facilitate transfer and uptake of consultation recording use in oncology: A knowledge translation implementation study

    Directory of Open Access Journals (Sweden)

    Ruether J Dean

    2011-03-01

    Full Text Available Abstract Background The time period from diagnosis to the end of treatment is challenging for newly diagnosed cancer patients. Patients have a substantial need for information, decision aids, and psychosocial support. Recordings of initial oncology consultations improve information recall, reduce anxiety, enhance patient satisfaction with communication, and increase patients' perceptions that the essential aspects of their disease and treatment have been addressed during the consultation. Despite the research evidence supporting the provision of consultation recordings, uptake of this intervention into oncology practice has been slow. The primary aim of this project is to conduct an implementation study to explicate the contextual factors, including use of evidence, that facilitate and impede the transfer and uptake of consultation-recording use in a sample of patients newly diagnosed with breast or prostate cancer. Methods Sixteen oncologists from cancer centres in three Canadian cities will participate in this three-phase study. The preimplementation phase will be used to identify and address those factors that are fundamental to facilitating the smooth adoption and delivery of the intervention during the implementation phase. During the implementation phase, breast and prostate cancer patients will receive a recording of their initial oncology consultation to take home. Patient interviews will be conducted in the days following the consultation to gather feedback on the benefits of the intervention. Patients will complete the Digital Recording Use Semi-Structured Interview (DRUSSI and be invited to participate in focus groups in which their experiences with the consultation recording will be explored. Oncologists will receive a summary letter detailing the benefits voiced by their patients. The postimplementation phase includes a conceptual framework development meeting and a seven-point dissemination strategy. Discussion Consultation

  3. Breaking phase focused wave group loads on offshore wind turbine monopiles

    Science.gov (United States)

    Ghadirian, A.; Bredmose, H.; Dixen, M.

    2016-09-01

    The current method for calculating extreme wave loads on offshore wind turbine structures is based on engineering models for non-breaking regular waves. The present article has the aim of validating previously developed models at DTU, namely the OceanWave3D potential flow wave model and a coupled OceanWave3D-OpenFOAM solver, against measurements of focused wave group impacts on a monopile. The focused 2D and 3D wave groups are reproduced and the free surface elevation and the in-line forces are compared to the experimental results. In addition, the pressure distribution on the monopile is examined at the time of maximum force and discussed in terms of shape and magnitude. Relative pressure time series are also compared between the simulations and experiments and detailed pressure fields for a 2D and 3D impact are discussed in terms of impact type. In general a good match for free surface elevation, in-line force and wave-induced pressures is found.

  4. Introduction to veterinary clinical oncology

    Energy Technology Data Exchange (ETDEWEB)

    Weller, R.E.

    1991-10-01

    Veterinary clinical oncology involves a multidisciplinary approach to the recognition and management of spontaneously occurring neoplasms of domestic animals. This requires some knowledge of the causes, incidence, and natural course of malignant disease as it occurs in domestic species. The purpose of this course is to acquaint you with the more common neoplastic problems you will encounter in practice, so that you can offer your clients an informed opinion regarding prognosis and possible therapeutic modalities. A major thrust will be directed toward discussing and encouraging treatment/management of malignant disease. Multimodality therapy will be stressed. 10 refs., 3 tabs.

  5. Introduction to veterinary clinical oncology

    Energy Technology Data Exchange (ETDEWEB)

    Weller, R.E.

    1991-10-01

    Veterinary clinical oncology involves a multidisciplinary approach to the recognition and management of spontaneously occurring neoplasms of domestic animals. This requires some knowledge of the causes, incidence, and natural course of malignant disease as it occurs in domestic species. The purpose of this course is to acquaint you with the more common neoplastic problems you will encounter in practice, so that you can offer your clients an informed opinion regarding prognosis and possible therapeutic modalities. A major thrust will be directed toward discussing and encouraging treatment/management of malignant disease. Multimodality therapy will be stressed. 10 refs., 3 tabs.

  6. New Technologies in Radiation Oncology

    Science.gov (United States)

    Schlegel, Wolfgang; Bortfeld, Thomas; Grosu, Anca-Ligia

    This book provides an overview of recent advances in radiation oncology, many of which have originated from physics and engineering sciences. After an introductory section on basic aspects of 3D medical imaging, the role of 3D imaging in the context of radiotherapy is explored in a series of chapters on the various modern imaging techniques. A further major section addresses 3D treatment planning for conformal radiotherapy, with consideration of both external radiotherapy and brachytherapy. Subsequently the modern techniques of 3D conformal radiotherapy are described, including stereotactic radiotherapy, intensity-modulated radiation therapy, image-guided and adaptive radiotherapy, and radiotherapy with charged particles.

  7. Effects of group-velocity mismatch and cubicquintic nonlinearity on cross-phase modulation instability in optical fibers

    Institute of Scientific and Technical Information of China (English)

    Xianqiong Zhong; Anping Xiang

    2007-01-01

    @@ The synthetic effects of group-velocity mismatch and cubic-quintic nonlinearity on cross-phase modulation induced modulation instability in loss single-mode optical fibers have been numerically investigated. The results show that the quintic nonlinearity plays a role similar to the case of neglecting the group-velocity mismatch in modifying the modulation instability, namely, the positive and negative quintic nonlinearities can still enhance and weaken the modulation instability, respectively. The group-velocity mismatch can considerably change the gain spectrum of modulation instability in terms of its shape, peak value, and position. In the normal dispersion regime, with the increase of the group-velocity mismatch parameter,the gain spectrum widens and then narrows, shifts to higher frequencies, and the peak value gets higher before approaching a saturable value. In the abnormal dispersion regime, two separated spectra may occur when the group-velocity mismatch is taken into account. With the increase of the group-velocity mismatch parameter, the peak value of the gain spectrum gets higher and shorter before tending to a saturable value for the first and second spectral regimes, respectively.

  8. Phase behavior of semifluorinated catanionic mixtures: head group dependence and spontaneous formation of vesicles.

    Science.gov (United States)

    Blanco, Elena; Olsson, Ulf; Ruso, Juan M; Schulz, Pablo C; Prieto, Gerardo; Sarmiento, Félix

    2009-03-15

    Hexadecyltrimethylammonium bromide (C(16)TAB)-sodium perfluorooctanoate (C(8)FONa) and hexadecylpyridynium bromide (C(16)PyB)-C(8)FONa catanionic semifluorinated mixtures have been studied by conductivity, dynamic light scattering (DLS), cryo-transmission electron microscopy (cryo-TEM) and polarizing microscopy. The regular solution theory, applicable for a limited fluorinated molar ratio, does not predict long-range electrostatic interactions. The results are consistent with the fact that in the hydrogenated-rich region the interaction is attractive in both catanionic mixtures. The systems containing pyridinium headgroups were of the stronger interaction. A transition from micelles was found in both mixtures as a function of fluorinated molar ratio. Special attention was devoted to the effect of the head group in the system properties. The information related with the mean vesicle radius measured by DLS was compared with the vesicle size distribution as well as the elastic properties of the bilayer measured with cryo-TEM.

  9. Analgesic stairway in the treatment of oncological pain

    Directory of Open Access Journals (Sweden)

    Sarah María Regueira Betancourt

    2015-10-01

    Full Text Available Pain represents the main symptom in an important group of patients who are in active treatment for cancer and in sick people in a very advanced stage. The objective of this article is to review the basic pharmacology of the nonsteroidal antiinflammatory drugs, weak opioids, bigger opioids, as well as the different special pharmacological and non- pharmacological techniques that constitute the analgesic stairway in the management of patients who are suffering from oncological pain.

  10. Pediatric hematology and oncology in Iran.

    Science.gov (United States)

    Alebouyeh, Mardawig

    2005-01-01

    Pediatric hematology and oncology (PHO) is a rapidly expandingfield. It has been our goal to meet the needs and increasing demands for comprehensive medical care of children suffering from chronic blood diseases and malignancies. In the past decade we have been able expand and optimize the PHO services throughout Iran, in general and in respect to their prevalence and clinical importance, by trained pediatric hematologist-oncologists, pediatric surgeons and improved para clinical facilities. Major beta-thalassemics receive blood transfusion and chelation therapy according to the current standards mostly at regional blood banks centers. To curb major beta-thalassemia a premarital screening program has been enacted and abortion has been legitimized if major thalassemia is diagnosed by CVS. Hemophiliacs are supervised and treated as indicated by Iranian Hemophilia Comprehensive Care Centers (IHCCC). Screening for transfusion related complications and transmitted viral diseases (HBV, HCV and HIV) in both cohorts are carried out in regular intervals and necessary management will be then carried out as indicated at respective specialized units. Childhood malignancies are treated according to protocols adopted from accredited institutions in the USA and Europe, with almost comparable results. BMT is available for selected patients with beta-thalassemia or malignancies. By going to public we have been able to rise general awareness about chronic blood diseases and childhood malignancies and have initiated establishment of parents groups and formation of NGOs to support these children and their families. Foundation of Iranian Society of Pediatric Hamatology and Oncology (ISPHO) in the year 2000 has been another step forward to consolidate and coordinate the available manpower and facilities. By evaluation of the country's main problems and shortcomings and conduction of collaborative studies and operation planning one will succeed to get the expected feedback and

  11. [Breaking bad news in oncology: the Belgian experience].

    Science.gov (United States)

    Delevallez, F; Lienard, A; Gibon, A-S; Razavi, D

    2014-10-01

    Breaking bad news is a complex and frequent clinical task for physicians working in oncology. It can have a negative impact on patients and their relatives who are often present during breaking bad news consultations. Many factors influence how the delivery of bad news will be experienced especially the communication skills used by physicians. A three-phase process (post-delivery phase, delivery phase, pre-delivery phase) has been developed to help physician to handle this task more effectively. Communication skills and specific breaking bad news training programs are both necessary and effective. A recent study conducted in Belgium has shown their impact on the time allocated to each of the three phases of this process, on the communication skills used, on the inclusion of the relative in the consultation and on physicians' physiological arousal. These results underscore the importance of promoting intensive communication skills and breaking bad news training programs for health care professionals.

  12. A group-based approach to stabilisation and symptom management in a phased treatment model for refugees and asylum seekers

    Directory of Open Access Journals (Sweden)

    Mary E. A. Robertson

    2013-12-01

    Full Text Available Background: Traumatised asylum seekers and refugees may present with significant and complex mental health problems as a result of prolonged, extreme, and multiple traumatic events. This is further complicated by ongoing complex social circumstances. Concepts: In our work at the Traumatic Stress Clinic (TSC, the understanding afforded by the concept of complex posttraumatic stress disorder (PTSD together with the related notion of a phased treatment model, provides a useful framework for organising our work with this population. Clinical Applications: An explication of complex PTSD as it applies to our client group is presented, followed by a description of our phased treatment model and an outline of the core principles, which guide our clinical approach. Our symptom management and stabilisation groups have been developed and refined over time and draw on techniques from a variety of cognitive behavioural therapies. These are described in some detail with illustrative clinical case vignettes. Conclusion: This paper concludes with some reflections on the challenges inherent to working with this complex client group.

  13. Report from the OECI Oncology Days 2014

    NARCIS (Netherlands)

    Harten, van W.H.; Stanta, G.; Bussolati, G.; Riegman, P.; Hoefler, G.; Becker, K.F.; Folprecht, G.; Truini, M.; Haybaeck, J.; Buiga, R.; Dono, M.; Bagg, A.; Lopez Guerrero, J.A.; Zupo, S.; Lemare, F.; Lorenzo, de F.; Goedbloed, N.; Razavi, D.; Lovey, J.; Cadariu, P.A.; Rollandi, G.A.; Paparo, F.; Pierotti, M.; Ciuleanu, T.; de Paoli, P.; Weiner, G.; Saghatchian, M.; Lombardo, Claudio

    2014-01-01

    The 2014 OECI Oncology Days was held at the ‘Prof. Dr. Ion Chiricuta’ Oncology Institute in Cluj, Romania, from 12 to 13 June. The focus of this year’s gathering was on developments in personalised medicine and other treatment advances which have made the cost of cancer care too high for many region

  14. Nursing 436A: Pediatric Oncology for Nurses.

    Science.gov (United States)

    Jackman, Cynthia L.

    A description is provided of "Pediatric Oncology for Nurses," the first in a series of three courses offered to fourth-year nursing students in pediatric oncology. The first section provides a course overview, discusses time assignments, and describes the target student population. Next, a glossary of terms, and lists of course goals, long-range…

  15. Perceptions of Oncology as a Medical Specialty.

    Science.gov (United States)

    Cassileth, Barrie R.; And Others

    1980-01-01

    The characteristics and prestige associated with oncology and assessed shifts in medical students' perceptions as a result of participation in an oncology course are explored. Respondents were asked to rate the prestige of eight specialities and asked to select characteristics "that best describe each type of specialist." (MLW)

  16. Art Therapy with an Oncology Care Team

    Science.gov (United States)

    Nainis, Nancy A.

    2005-01-01

    Oncology nurses are particularly vulnerable to "burnout" syndrome due to the intensity of their work and the ongoing losses they experience while providing oncology care to their patients. High levels of stress in the workplace left untended lead to high job turnover, poor productivity, and diminished quality of care for patients.…

  17. Clinical Oncology Assistantship Program for Medical Students.

    Science.gov (United States)

    Neilan, Barbara A.; And Others

    1985-01-01

    The Clinical Oncology Assistantship Program at the University of Arkansas for Medical Sciences is described, along with student reactions to the program. The summer elective program involves cancer lectures (one week) and clinical exposure (nine weeks) in medical, surgical, and pediatric oncology services, as well as self-directed learning…

  18. Organisational design for an integrated oncological department

    NARCIS (Netherlands)

    Meiss-de Haas, Ch.L.; Falkmann, H.; Douma, J.; Van Gassel, J.G.; Peters, W.G.; Van Mierlo, R.; Van Turnhout, J.M.; Verhagen, C.A.H.H.V.M.; Schrijvers, A.J.P.

    2001-01-01

    Objective: The outcomes of a Strength, Weakness, Opportunities and Threat (SWOT) analysis of three Integrated Oncological Departments were compared with their present situation three years later to define factors that can influence a successful implementation and development of an Integrated Oncolog

  19. Group and phase velocities from deterministic and ambient sources measured during the AlpArray-EASI experiment

    Science.gov (United States)

    Kolínský, Petr; Zigone, Dimitri; Fuchs, Florian; Bianchi, Irene; Qorbani, Ehsan; Apoloner, Maria-Theresia; Bokelmann, Götz; AlpArray-EASI Working Group

    2016-04-01

    The Eastern Alpine Seismic Investigation (EASI) was a complementary experiment to the AlpArray project. EASI was composed of 55 broadband seismic stations deployed in a winding swath of 540 km length along longitude 13.350 E from the Czech-German border to the Adriatic Sea. Average north-south inter-station distance was 10 km, the distance of each station to either side of the central line was 6 km. Such a dense linear network allows for surface wave dispersion measurements by both deterministic and ambient noise sources along the same paths. During the experiment (July 2014 - August 2015), three earthquakes ML = 2.6, 2.9 and 4.2 occurred in Austria and Northern Italy only several kilometers off the swath. We measure Rayleigh and Love wave group velocities between the source and a single station for the recorded earthquakes, as well as phase velocities between selected pairs of stations using the standard two-station method. We also calculate cross-correlations of ambient noise between selected pairs of stations and we determine the corresponding group velocity dispersion curves. We propose a comparison of phase velocities between two stations measured from earthquakes with group velocities obtained from cross-correlations for the same station pairs. We also compare group velocities measured at single station using earthquakes, which occurred along the swath, with group velocities measured from cross-correlations. That way we analyze velocities of both deterministic and ambient noise reconstructed surface waves propagating along the same path. We invert the resulting dispersion curves for 1D shear wave velocity profiles with depth and we compile a quasi-2D velocity model along the EASI swath.

  20. Big data in oncologic imaging.

    Science.gov (United States)

    Regge, Daniele; Mazzetti, Simone; Giannini, Valentina; Bracco, Christian; Stasi, Michele

    2017-06-01

    Cancer is a complex disease and unfortunately understanding how the components of the cancer system work does not help understand the behavior of the system as a whole. In the words of the Greek philosopher Aristotle "the whole is greater than the sum of parts." To date, thanks to improved information technology infrastructures, it is possible to store data from each single cancer patient, including clinical data, medical images, laboratory tests, and pathological and genomic information. Indeed, medical archive storage constitutes approximately one-third of total global storage demand and a large part of the data are in the form of medical images. The opportunity is now to draw insight on the whole to the benefit of each individual patient. In the oncologic patient, big data analysis is at the beginning but several useful applications can be envisaged including development of imaging biomarkers to predict disease outcome, assessing the risk of X-ray dose exposure or of renal damage following the administration of contrast agents, and tracking and optimizing patient workflow. The aim of this review is to present current evidence of how big data derived from medical images may impact on the diagnostic pathway of the oncologic patient.

  1. [Therapeutic Aggressiveness and Liquid Oncology].

    Science.gov (United States)

    Barón Duarte, F J; Rodríguez Calvo, M S; Amor Pan, J R

    2017-01-01

    Aggressiveness criteria proposed in the scientific literature a decade ago provide a quality judgment and are a reference in the care of patients with advanced cancer, but their use is not generalized in the evaluation of Oncology Services. In this paper we analyze the therapeutic aggressiveness, according to standard criteria, in 1.001 patients with advanced cancer who died in our Institution between 2010 and 2013. The results seem to show that aggressiveness at the end of life is present more frequently than experts recommend. About 25% of patients fulfill at least one criterion of aggressiveness. This result could be explained by a liquid Oncology which does not prioritize the patient as a moral subject in the clinical appointment. Medical care is oriented to necessities and must be articulated in a model focused on dignity and communication. Its implementation through Advanced Care Planning, consideration of patient's values and preferences, and Limitation of therapeutic effort are ways to reduce aggressiveness and improve clinical practice at the end of life. We need to encourage synergic and proactive attitudes, adding the best of cancer research with the best clinical care for the benefit of human being, moral subject and main goal of Medicine.

  2. Decision making in surgical oncology.

    Science.gov (United States)

    Lamb, B; Green, J S A; Vincent, C; Sevdalis, N

    2011-09-01

    Decisions in surgical oncology are increasingly being made by multi-disciplinary teams (MDTs). Although MDTs have been widely accepted as the preferred model for cancer service delivery, the process of decision making has not been well described and there is little evidence pointing to the ideal structure of an MDT. Performance in surgery has been shown to depend on non-technical skills, such as decision making, as well as patient factors and the technical skills of the healthcare team. Application of this systems approach to MDT working allows the identification of factors that affect the quality of decision making for cancer patients. In this article we review the literature on decision making in surgical oncology and by drawing from the systems approach to surgical performance we provide a framework for understanding the process of decision making in MDTs. Technical factors that affect decision making include the information about patients, robust ICT and video-conferencing equipment, a minimum dataset with expert review of radiological and pathological information, implementation and recording of the MDTs decision. Non-technical factors with an impact on decision making include attendance of team members at meetings, leadership, teamwork, open discussion, consensus on decisions and communication with patients and primary care. Optimising these factors will strengthen the decision making process and raise the quality of care for cancer patients.

  3. Optical imaging probes in oncology.

    Science.gov (United States)

    Martelli, Cristina; Lo Dico, Alessia; Diceglie, Cecilia; Lucignani, Giovanni; Ottobrini, Luisa

    2016-07-26

    Cancer is a complex disease, characterized by alteration of different physiological molecular processes and cellular features. Keeping this in mind, the possibility of early identification and detection of specific tumor biomarkers by non-invasive approaches could improve early diagnosis and patient management.Different molecular imaging procedures provide powerful tools for detection and non-invasive characterization of oncological lesions. Clinical studies are mainly based on the use of computed tomography, nuclear-based imaging techniques and magnetic resonance imaging. Preclinical imaging in small animal models entails the use of dedicated instruments, and beyond the already cited imaging techniques, it includes also optical imaging studies. Optical imaging strategies are based on the use of luminescent or fluorescent reporter genes or injectable fluorescent or luminescent probes that provide the possibility to study tumor features even by means of fluorescence and luminescence imaging. Currently, most of these probes are used only in animal models, but the possibility of applying some of them also in the clinics is under evaluation.The importance of tumor imaging, the ease of use of optical imaging instruments, the commercial availability of a wide range of probes as well as the continuous description of newly developed probes, demonstrate the significance of these applications. The aim of this review is providing a complete description of the possible optical imaging procedures available for the non-invasive assessment of tumor features in oncological murine models. In particular, the characteristics of both commercially available and newly developed probes will be outlined and discussed.

  4. Electro-optic prism-pair setup for efficient high bandwidth isochronous CEP phase shift or group delay generation

    Science.gov (United States)

    Gobert, Olivier; Mennerat, Gabriel; Cornaggia, Christian; Lupinski, Dominique; Perdrix, Michel; Guillaumet, Delphine; Lepetit, Fabien; Oksenhendler, Thomas; Comte, Michel

    2016-05-01

    We report the experimental demonstration of an electro-optic prism pair pure carrier-envelope phase (CEP) shifter at low voltage (shift of 1 rad for a voltage of 90 V, applied to a crystal of 5 mm aperture). Validating our mathematical model, the experiments prove that this set-up which uses two rubidium titanyl phosphate (RTP) crystals, can be used either as an efficient high bandwidth CEP shifter without modifying the group delay of an ultrashort pulse (isochronous CEP shifter) or alternatively as a group delay generator with quasi-constant CEP (Pure Group Delay generator). These two configurations which correspond to specific geometries are characterized by spectral interferometry with a 800 nm mode-locked Ti:sapphire laser. The results are in very good agreement with the model. In the pure group delay mode, a group delay of 2.3 fs is obtained at 1000 V/cm without significant CEP shift. In the isochronous mode, a shift of 5.5 rad at 1000 V/cm is generated without significant delay. The applied voltage is also lowered by a factor of nearly three in this configuration, compared to the case of an RTP rectangular slab of the same total length.

  5. Solution-phase-peptide synthesis via the group-assisted purification (GAP) chemistry without using chromatography and recrystallization.

    Science.gov (United States)

    Wu, Jianbin; An, Guanghui; Lin, Siqi; Xie, Jianbo; Zhou, Wei; Sun, Hao; Pan, Yi; Li, Guigen

    2014-02-01

    The solution phase synthesis of N-protected amino acids and peptides has been achieved through the Group-Assisted Purification (GAP) chemistry by avoiding disadvantages of other methods in regard to the difficult scale-up, expenses of solid and soluble polymers, etc. The GAP synthesis can reduce the use of solvents, silica gels, energy and manpower. In addition, the GAP auxiliary can be conveniently recovered for re-use and is environmentally friendly and benign, and substantially reduces waste production in academic labs and industry.

  6. AWESoMe: A code for the calculation of phase and group velocities of acoustic waves in homogeneous solids

    Science.gov (United States)

    Muñoz-Santiburcio, Daniel; Hernández-Laguna, Alfonso; Soto, Juan I.

    2015-07-01

    We present AWESoMe, an implementation of a method for the evaluation of acoustic wave velocities in homogeneous solid media. The code computes the phase and group velocities for all the possible propagation directions, as well as some related parameters such as the polarization vectors, the power flow angle and the enhancement factor. The code is conveniently interfaced with GNUPLOT, thus offering immediate visualization of the results. AWESoMe is open-source software, available under the GNU General Public License v3.

  7. AllergoOncology - the impact of allergy in oncology: EAACI position paper.

    Science.gov (United States)

    Jensen-Jarolim, E; Bax, H J; Bianchini, R; Capron, M; Corrigan, C; Castells, M; Dombrowicz, D; Daniels-Wells, T R; Fazekas, J; Fiebiger, E; Gatault, S; Gould, H J; Janda, J; Josephs, D H; Karagiannis, P; Levi-Schaffer, F; Meshcheryakova, A; Mechtcheriakova, D; Mekori, Y; Mungenast, F; Nigro, E A; Penichet, M L; Redegeld, F; Saul, L; Singer, J; Spicer, J F; Siccardi, A G; Spillner, E; Turner, M C; Untersmayr, E; Vangelista, L; Karagiannis, S N

    2016-12-29

    Th2 immunity and allergic immune surveillance play critical roles in host responses to pathogens, parasites and allergens. Numerous studies have reported significant links between Th2 responses and cancer, including insights into the functions of IgE antibodies and associated effector cells in both antitumour immune surveillance and therapy. The interdisciplinary field of AllergoOncology was given Task Force status by the European Academy of Allergy and Clinical Immunology in 2014. Affiliated expert groups focus on the interface between allergic responses and cancer, applied to immune surveillance, immunomodulation and the functions of IgE-mediated immune responses against cancer, to derive novel insights into more effective treatments. Coincident with rapid expansion in clinical application of cancer immunotherapies, here we review the current state-of-the-art and future translational opportunities, as well as challenges in this relatively new field. Recent developments include improved understanding of Th2 antibodies, intratumoral innate allergy effector cells and mediators, IgE-mediated tumour antigen cross-presentation by dendritic cells, as well as immunotherapeutic strategies such as vaccines and recombinant antibodies, and finally, the management of allergy in daily clinical oncology. Shedding light on the crosstalk between allergic response and cancer is paving the way for new avenues of treatment.

  8. American Society of Clinical Oncology/Oncology Nursing Society chemotherapy administration safety standards.

    Science.gov (United States)

    Jacobson, Joseph O; Polovich, Martha; McNiff, Kristen K; LeFebvre, Kristine B; Cummings, Charmaine; Galioto, Michele; Bonelli, Katherine R; McCorkle, Michele R

    2009-11-01

    Standardization of care can reduce the risk of errors, increase efficiency, and provide a framework for best practice. In 2008, the American Society of Clinical Oncology (ASCO) and the Oncology Nursing Society (ONS) invited a broad range of stakeholders to create a set of standards for the administration of chemotherapy to adult patients in the outpatient setting. At the close of a full-day structured workshop, 64 draft standards were proposed. After a formal process of electronic voting and conference calls, 29 draft standards were eliminated, resulting in a final list of 35 draft measures. The proposed set of standards was posted for 6 weeks of open public comment. Three hundred twenty-two comments were reviewed by the Steering Group and used as the basis for final editing to a final set of standards. The final list includes 31 standards encompassing seven domains, which include the following: review of clinical information and selection of a treatment regimen; treatment planning and informed consent; ordering of treatment; drug preparation; assessment of treatment compliance; administration and monitoring; assessment of response and toxicity monitoring. Adherence to ASCO and ONS standards for safe chemotherapy administration should be a goal of all providers of adult cancer care.

  9. Burnout in United States Academic Chairs of Radiation Oncology Programs

    Energy Technology Data Exchange (ETDEWEB)

    Kusano, Aaron S. [Department of Radiation Oncology, University of Washington School of Medicine, Seattle, Washington (United States); Thomas, Charles R., E-mail: thomasch@ohsu.edu [Department of Radiation Medicine, Knight Cancer Institute/Oregon Health and Science University, Portland, Oregon (United States); Bonner, James A. [Department of Radiation Oncology, University of Alabama at Birmingham, Birmingham, Alabama (United States); DeWeese, Theodore L. [Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins Medical Institutions, Baltimore, Maryland (United States); Formenti, Silvia C. [Department of Radiation Oncology, New York University, New York, New York (United States); Hahn, Stephen M. [Department of Radiation Oncology, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania (United States); Lawrence, Theodore S. [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States); Mittal, Bharat B. [Department of Radiation Oncology, Northwestern University, Chicago, Ilinois (United States)

    2014-02-01

    Purpose: The aims of this study were to determine the self-reported prevalence of burnout in chairs of academic radiation oncology departments, to identify factors contributing to burnout, and to compare the prevalence of burnout with that seen in other academic chair groups. Methods and Materials: An anonymous online survey was administered to the membership of the Society of Chairs of Academic Radiation Oncology Programs (SCAROP). Burnout was measured with the Maslach Burnout Inventory-Human Services Survey (MBI-HSS). Results: Questionnaires were returned from 66 of 87 chairs (76% response rate). Seventy-nine percent of respondents reported satisfaction with their current positions. Common major stressors were budget deficits and human resource issues. One-quarter of chairs reported that it was at least moderately likely that they would step down in the next 1 to 2 years; these individuals demonstrated significantly higher emotional exhaustion. Twenty-five percent of respondents met the MBI-HSS criteria for low burnout, 75% for moderate burnout, and none for high burnout. Group MBI-HSS subscale scores demonstrated a pattern of moderate emotional exhaustion, low depersonalization, and moderate personal accomplishment, comparing favorably with other specialties. Conclusions: This is the first study of burnout in radiation oncology chairs with a high response rate and using a validated psychometric tool. Radiation oncology chairs share similar major stressors to other chair groups, but they demonstrate relatively high job satisfaction and lower burnout. Emotional exhaustion may contribute to the anticipated turnover in coming years. Further efforts addressing individual and institutional factors associated with burnout may improve the relationship with work of chairs and other department members.

  10. Encoding Curved Tetrahedra in Face Holonomies: a Phase Space of Shapes from Group-Valued Moment Maps

    CERN Document Server

    Haggard, Hal M; Riello, Aldo

    2015-01-01

    We present a generalization of Minkowski's classic theorem on the reconstruction of tetrahedra from algebraic data to homogeneously curved spaces. Euclidean notions such as the normal vector to a face are replaced by Levi-Civita holonomies around each of the tetrahedron's faces. This allows the reconstruction of both spherical and hyperbolic tetrahedra within a unified framework. A new type of hyperbolic simplex is introduced in order for all the sectors encoded in the algebraic data to be covered. Generalizing the phase space of shapes associated to flat tetrahedra leads to group valued moment maps and quasi-Poisson spaces. These discrete geometries provide a natural arena for considering the quantization of gravity including a cosmological constant. A concrete realization of this is provided by the relation with the spin-network states of loop quantum gravity. This work therefore provides a bottom-up justification for the emergence of deformed gauge symmetries and quantum groups in 3+1 dimensional covariant...

  11. Enhanced Retention of Chelating Reagents in Octadecylsilyl Silica Phase by Interaction with Residual Silanol Groups in Solid Phase Extraction of Divalent Metal Ions.

    Science.gov (United States)

    Ohmuro, Satoshi; Fujii, Kan; Yasui, Takashi; Takada, Kazutake; Yuchi, Akio; Kokusen, Hisao

    2016-01-01

    Solid-phase extraction (SPE) of divalent metal ions with a lipophilic and potentially divalent hexadentate chelating reagent (H2L), with which octadecylsilyl silica (ODS), was impregnated with was studied to gain more insight into and develop the potential of this methodology. This is the first time to demonstrate that this reagent as well as other common nitrogen-containing reagents were retained both by adsorption due to hydrogen bonding between nitrogen atoms of the reagent and residual silanol groups in the ODS phase and by simple distribution into the hydrophobic space. An appreciably large amount of this reagent could be retained by the adsorption mechanism even with a relatively thin loading solution. The divalent metal ions of Mn(2+), Co(2+) and Zn(2+) were extracted as 1:1 neutral complexes ([ML]), while Ni(2+) and Cu(2+) as ion-pairs of 1:1 cationic complex ([MHL](+)) with anion in SPE with H2L. The extractability and selectivity were substantially the same as that in liquid-liquid extraction.

  12. Evaluación del riesgo nutricional e instauración de soporte nutricional en pacientes oncológicos, según el protocolo del grupo español de Nutrición y Cáncer Nutritional risk evalution and establishment of nutritional support in oncology patients according to the protocol of the Spanish Nutrition and Cancer Group

    Directory of Open Access Journals (Sweden)

    M. M. Marín Caro

    2008-10-01

    porcentaje de pérdida de peso es del 6,64% ± 0,87 (min 0, máx 33%. El 32% de la población presenta cifras de albúmina entre 3 y 3,5 g/dl, existiendo una correlación negativa entre ésta y las dificultades con la alimentación p = 0,001. El IMC no mostró ser un parámetro significativo para detectar malnutrición (sólo un 10% se encontraba por debajo de 19,9 kg/m², pero tiene una tendencia lineal significativa con las dificultades en la alimentación, de forma tal que a medida que disminuye el IMC aumentan las dificultades p = 0,001. Más de la mitad de la población, requirió recomendaciones dietéticas específicas para el control de los síntomas que dificultaban la ingesta y una tercera parte de la población necesitó la indicación de suplementos nutricionales. Tras la intervención nutricional más de la mitad (60% mantuvo su peso y una sexta parte lo aumentó. Conclusión: La aplicación de este protocolo es útil, sencillo y podría facilitar la detección de malnutrición en los pacientes oncológicos. Seleccionando a los pacientes que realmente se podrían beneficiar de una intervención nutricional específica, pero debería aplicarse al inicio coincidiendo si fuera posible con el diagnóstico de la enfermedad. El soporte nutricional resulta eficaz en la mayoría de los pacientes.Introduction: Cancer and its oncological treatment cause symptoms which increase the patients risk to suffer from malnutrition. This affects the patients health status negatively by increasing the number of complications, reducing the tolerance to the oncology treatment and a decrease of the patients quality of life. Motivated by this, a group of health professionals from several spanish regions met with the backing of the Sociedad Española de Nutrición Básica y Aplicada (SENBA to address strategies to improve the quality of nutritional intervention in cancer patients. Methods: This multidisciplinary group developed a protocol describing nutritional assessment and

  13. Educating medical students about radiation oncology: initial results of the oncology education initiative.

    Science.gov (United States)

    Hirsch, Ariel E; Singh, Deeptej; Ozonoff, Al; Slanetz, Priscilla J

    2007-10-01

    Multidisciplinary cancer care requires the integration of teaching across established educational boundaries. Because exposure to oncology and radiation oncology is limited in the undergraduate medical curriculum, the authors introduced an oncology education initiative at their institution. They report on the addition of structured multidisciplinary oncology education to the required radiology core clerkship. An institutional-based cohort study of fourth-year medical students rotating through a required clerkship in radiology at Boston University School of Medicine was conducted, beginning with the class of 2007. An educational questionnaire measuring the perceived quality of oncology education before and after exposure to a structured didactic program was administered. Of the 149 fourth-year students, 121 (81%) have completed the didactics of the initiative. Although 68 of 121 (56%) students reported having limited exposure to cancer care in the clinical years, 107 of 121 (88%) were motivated to learn more about the subject, and 100 of 121 (83%) reported a better understanding of the multidisciplinary nature of cancer care after this oncology education initiative. One hundred ten of 121 (91%) felt that the radiology clerkship was an opportune time to receive oncology and radiation oncology teaching. As a result of the initiative, 32% of the students pursued advanced training in radiation oncology. Of students who before the initiative were not planning on taking oncology electives, 70 of 99 (71%) agreed or strongly agreed that the lecture motivated them to learn more about the subject, and 43 of 99 (43%) agreed or strongly agreed that the lecture motivated them to take oncology electives. Systematic exposure to multidisciplinary oncology education as part of a radiology core clerkship provides an excellent opportunity for the integrated teaching of oncologic principles and patient management. This type of experience addresses an important yet underrepresented

  14. Overview of pediatric oncology and hematology in Myanmar

    Directory of Open Access Journals (Sweden)

    Jay Halbert

    2014-01-01

    Full Text Available Myanmar is a country in southeast Asia in political, economic and healthcare transition. There are currently only two pediatric oncology centers serving a population of almost 19 million children. An estimated 85-92% of children with cancer are undiagnosed or not receiving treatment. Abandonment of treatment is as high as 60%. Although a number of chemotherapy agents are available, difficulties remain concerning treatment costs, quality control and the availability of supportive care. Radiotherapy services are also limited and not usually included in pediatric protocols. Healthcare professional training, improved diagnostics, strategies to tackle abandonment of treatment and the development of a parents′ support group are major priorities. Local and international partnerships including a recent partnership with world child cancer are essential in the interim to support the development of pediatric oncology and hematology in Myanmar. A unique opportunity exists to support the development of preventive, diagnostic, curative and palliative care for children′s cancer in Myanmar from the outset.

  15. Nutrition support in surgical oncology.

    Science.gov (United States)

    Huhmann, Maureen B; August, David A

    2009-01-01

    This review article, the second in a series of articles to examine the American Society for Parenteral and Enteral Nutrition (A.S.P.E.N.) Guidelines for the Use of Parenteral and Enteral Nutrition in Adult and Pediatric Patients, evaluates the evidence related to the use of nutrition support in surgical oncology patients. Cancer patients develop complex nutrition issues. Nutrition support may be indicated in malnourished cancer patients undergoing surgery, depending on individual patient characteristics. As with the first article in this series, this article provides background concerning nutrition issues in cancer patients, as well as discusses the role of nutrition support in the care of surgical cancer patients. The goal of this review is to enrich the discussion contained in the clinical guidelines as they relate to recommendations made for surgical patients, cite the primary literature more completely, and suggest updates to the guideline statements in light of subsequently published studies.

  16. BCVPP chemotherapy for advanced Hodgkin's disease: evidence for greater duration of complete remission, greater survival, and less toxicity than with a MOPP regimen. Results of the Eastern Cooperative Oncology Group study.

    Science.gov (United States)

    Bakemeier, R F; Anderson, J R; Costello, W; Rosner, G; Horton, J; Glick, J H; Hines, J D; Berard, C W; DeVita, V T

    1984-10-01

    Two chemotherapy regimens for treatment of patients with advanced Hodgkin's disease, BCVPP (carmustine, cyclophosphamide, vinblastine, procarbazine, and prednisone) and MOPP (mechlorethamine hydrochloride, vincristine, procarbazine, and prednisone), were compared in a randomized prospective study. Two hundred ninety-three patients were evaluable in the induction phase of this study. The complete remission rate with BCVPP was 76% (112/147) and with MOPP, 73% (106/146) (p = 0.51). The duration of complete remissions for previously untreated patients given BCVPP was significantly longer than that for previously untreated patients given MOPP (p = 0.02). Although hematologic toxicities were similar, BCVPP caused less gastrointestinal (p = 0.0001) and neurologic toxicity (p = 0.01) than MOPP. Previously untreated patients achieving complete remission with BCVPP survived significantly longer than those receiving MOPP (p = 0.03). As primary induction chemotherapy for advanced Hodgkin's disease, BCVPP is an effective alternative to MOPP, having equal or greater therapeutic benefit with less toxicity.

  17. The impact of genomics on oncology nursing.

    Science.gov (United States)

    Beamer, Laura Curr; Linder, Lauri; Wu, Bohua; Eggert, Julia

    2013-12-01

    Since 2003, genetics and genomics information has led to exciting new diagnostics, prognostics, and treatment options in oncology practice. Profiling of cancers offers providers insight into treatment and prognostic factors. Germline testing provides an individual with information for surveillance or therapy that may help them prevent cancer in their lifetime and options for family members as yet untouched by malignancy. This offers a challenge for oncology nurses and other oncology health care providers to become comfortable with incorporating education about genetics/genomics into their clinical practice and patient education.

  18. PET-Based Thoracic Radiation Oncology.

    Science.gov (United States)

    Simone, Charles B; Houshmand, Sina; Kalbasi, Anusha; Salavati, Ali; Alavi, Abass

    2016-07-01

    Fluorodeoxyglucose-PET is increasingly being integrated into multiple aspects of oncology. PET/computed tomography (PET/CT) has become especially important in radiation oncology. With the increasing use of advanced techniques like intensity-modulated radiation therapy and proton therapy, PET/CT scans have played critical roles in the target delineation of tumors for radiation oncologists delivering conformal treatment techniques. Use of PET/CT is well established in lung cancer and several other thoracic malignancies. This article details the current uses of PET/CT in thoracic radiation oncology with a focus on lung cancer and describes expected future roles of PET/CT for thoracic tumors.

  19. Overestimation of the effect size in group sequential trials.

    Science.gov (United States)

    Zhang, Jenny J; Blumenthal, Gideon M; He, Kun; Tang, Shenghui; Cortazar, Patricia; Sridhara, Rajeshwari

    2012-09-15

    Group sequential designs (GSD), which provide for interim monitoring of efficacy data and allow potential early trial termination while preserving the type I error rate, have become commonplace in oncology clinical trials. Although ethically appealing, GSDs tend to overestimate the true treatment effect size at early interim analyses. Overestimation of the treatment effect may exaggerate the benefit of a drug and provide imprecise information for physicians and their patients about a drug's true effect. The cause and effect of such a phenomenon are generally not well understood by many in clinical trial practice. In this article, we provide a graphical explanation for why the phenomenon of overestimation in GSDs occurs. The potential overestimation of the magnitude of the treatment effect is of particular concern in oncology, in which the more subjective endpoint of progression-free survival has increasingly been adopted as the primary endpoint in pivotal phase III trials. ©2012 AACR.

  20. Mature Results of a Prospective Randomized Trial Comparing 5-Flourouracil with Leucovorin to 5-Flourouracil with Levamisole as Adjuvant Therapy of Stage II and III Colorectal Cancer- The Israel Cooperative Oncology Group (ICOG Study

    Directory of Open Access Journals (Sweden)

    Arie Figer, Aviram Nissan, Adi Shani, Riva Borovick, Mariana Stiener, Mario Baras, Herbert R. Freund, Aaron Sulkes, Alexander Stojadinovic, Tamar Peretz

    2011-01-01

    Full Text Available Objective: Survival benefit with adjuvant therapy was shown in patients with Stage III colorectal cancer (CRC. This study evaluates long-term (10-year outcome in patients with CRC randomly assigned to adjuvant 5-Fluorouracil/Leucovorin (5FU+LV or 5-FU/Levamisole (5FU+LEV.Methods: Between 1990 and 1995, 398 patients with curatively resected Stage II-III CRC were randomly assigned to adjuvant 5FU+LV or 5FU+LEV for 12 months.Results: No difference was evident in 10-year relapse-free or overall survival between study groups. Grade III toxicity was similar between groups; however, neurotoxicity was significantly greater with 5FU+LEV (p=0.02 and gastrointestinal toxicity with 5FU+LV (p=0.03. Female patients treated with 5FU+LEV had improved overall survival.Conclusions: Adjuvant treatment of CRC is still based on leucovorin modulated fluorouracil. The long-term follow-up results of this trial indicate that the adjuvant treatment of Stage II-III CRC with 5FU+LV or 5FU+LEV is equally effective. The finding of improved survival in female subjects treated with 5FU+LEV warrants further study to determine if Levamisole is a better modulator of 5-FU than Leucovorin in this patient subset.

  1. Mature Results of a Prospective Randomized Trial Comparing 5-Flourouracil with Leucovorin to 5-Flourouracil with Levamisole as Adjuvant Therapy of Stage II and III Colorectal Cancer- The Israel Cooperative Oncology Group (ICOG) Study

    Science.gov (United States)

    Figer, Arie; Nissan, Aviram; Shani, Adi; Borovick, Riva; Stiener, Mariana; Baras, Mario; Freund, Herbert R.; Sulkes, Aaron; Stojadinovic, Alexander; Peretz, Tamar

    2011-01-01

    Objective: Survival benefit with adjuvant therapy was shown in patients with Stage III colorectal cancer (CRC). This study evaluates long-term (10-year) outcome in patients with CRC randomly assigned to adjuvant 5-Fluorouracil/Leucovorin (5FU+LV) or 5-FU/Levamisole (5FU+LEV). Methods: Between 1990 and 1995, 398 patients with curatively resected Stage II-III CRC were randomly assigned to adjuvant 5FU+LV or 5FU+LEV for 12 months. Results: No difference was evident in 10-year relapse-free or overall survival between study groups. Grade III toxicity was similar between groups; however, neurotoxicity was significantly greater with 5FU+LEV (p=0.02) and gastrointestinal toxicity with 5FU+LV (p=0.03). Female patients treated with 5FU+LEV had improved overall survival. Conclusions: Adjuvant treatment of CRC is still based on leucovorin modulated fluorouracil. The long-term follow-up results of this trial indicate that the adjuvant treatment of Stage II-III CRC with 5FU+LV or 5FU+LEV is equally effective. The finding of improved survival in female subjects treated with 5FU+LEV warrants further study to determine if Levamisole is a better modulator of 5-FU than Leucovorin in this patient subset. PMID:21475636

  2. Oncology clinicians' accounts of discussing complementary and alternative medicine with their patients.

    Science.gov (United States)

    Broom, Alex; Adams, Jon

    2009-05-01

    The profile of complementary and alternative medicine (CAM) has risen dramatically over recent years, with cancer patients representing some of the highest users of any patient group. This article reports the results from a series of in-depth interviews with oncology consultants and oncology nurses in two hospitals in Australia. Analysis identifies a range of self-reported approaches with which oncology clinicians discuss CAM, highlighting the potential implications for patient care and inter-professional dynamics. The interview data suggest that, whilst there are a range of consultant approaches to CAM, ;risk' is consistently deployed rhetorically as a key regulatory strategy to frame CAM issues and potentially direct patient behaviour. Moreover, ;irrationality', ;seeking control', and ;desperation' were viewed by consultants as the main drivers of CAM use, presenting potential difficulties for effective doctor-patient dialogue about CAM. In contrast, oncology nurses appear to perceive their role as that of CAM and patient advocate - an approach disapproved of by the consultants on their respective teams, presenting implications for oncology teamwork. CAM education emerged as a contentious and crucial issue for oncology clinicians. Yet, while viewed as a key barrier to clinician-patient communication about CAM, various forms of individual and organizational resistance to CAM education were evident. A number of core issues for clinical practice and broader work in the sociology of CAM are discussed in light of these findings.

  3. Cancer patient-centered home care: a new model for health care in oncology

    Directory of Open Access Journals (Sweden)

    Tralongo P

    2011-09-01

    Full Text Available Paolo Tralongo1, Francesco Ferraù2, Nicolò Borsellino3, Francesco Verderame4, Michele Caruso5, Dario Giuffrida6, Alfredo Butera7, Vittorio Gebbia81Medical Oncology Unit, Azienda Sanitaria Provinciale, Siracusa; 2Medical Oncology Unit, Ospedale San Vincenzo, Taormina; 3Medical Oncology Unit, Ospedale Buccheri La Ferla, Palermo; 4Medical Oncology Unit, Ospedale Giovanni Paolo II, Sciacca; 5Medical Oncology Unit, Istituto Humanitas, Catania; 6Medical Oncology Unit, Istituto Oncologico del Mediterraneo, Catania; 7Medical Oncology Unit, Ospedale San Giovanni di Dio, Agrigento; 8Medical Oncology Unit, Dipartimento Oncologico, La Maddalena, Università degli Studi, Palermo, ItalyAbstract: Patient-centered home care is a new model of assistance, which may be integrated with more traditional hospital-centered care especially in selected groups of informed and trained patients. Patient-centered care is based on patients' needs rather than on prognosis, and takes into account the emotional and psychosocial aspects of the disease. This model may be applied to elderly patients, who present comorbid diseases, but it also fits with the needs of younger fit patients. A specialized multidisciplinary team coordinated by experienced medical oncologists and including pharmacists, psychologists, nurses, and social assistance providers should carry out home care. Other professional figures may be required depending on patients' needs. Every effort should be made to achieve optimal coordination between the health professionals and the reference hospital and to employ shared evidence-based guidelines, which in turn guarantee safety and efficacy. Comprehensive care has to be easily accessible and requires a high level of education and knowledge of the disease for both the patients and their caregivers. Patient-centered home care represents an important tool to improve quality of life and help cancer patients while also being cost effective.Keywords: cancer, home care

  4. Challenges and opportunities to advance pediatric neuro-oncology care in the developing world.

    Science.gov (United States)

    Chan, Michael H; Boop, Frederick; Qaddoumi, Ibrahim

    2015-08-01

    As the morbidity and mortality associated with communicable diseases continue to decrease in the developing world, the medical burden of childhood cancer continues to expand. Although international aid and relief groups such as the World Health Organization recognize the importance of childhood cancer, their main emphasis is on the more easily treated malignancies, such as leukemias and lymphomas, and not pediatric brain tumors, which are the second most common malignancy in children and the leading cause of cancer-related deaths in the pediatric population. Addressing the needs of these children is a growing concern of several professional neuro-oncology-related societies. Thus, the goal of this review is to describe the current state of pediatric neuro-oncology care in the developing world, address the current and future needs of the field, and help guide professional societies' efforts to contribute in a more holistic and multidisciplinary manner. We reviewed the literature to compare the availability of neuro-oncology care in various regions of the developing world with that in higher income nations, to describe examples of successful initiatives, and to present opportunities to improve care. The current challenges, previous successes, and future opportunities to improve neuro-oncology care are presented. The multidisciplinary nature of neuro-oncology depends on large teams of highly specialized individuals, including neuro-oncologists, neurosurgeons, neurologists, radiologists, radiation oncologists, pathologists, palliative care specialists, oncology nurses, physical therapists, occupational therapists, speech therapists, pediatric intensivists, and social workers, among others. Pediatric neuro-oncology is one of the most complex types of medical care to deliver, as it relies on numerous specialists, subspecialists, support staff, and physical resources and infrastructure. However, with increasing collaboration and advancing technologies, developed nations

  5. Geometry of mixed states and degeneracy structure of geometric phases for multi-level quantum systems. A unitary group approach

    CERN Document Server

    Ercolessi, E; Morandi, G; Mukunda, N

    2001-01-01

    We analyze the geometric aspects of unitary evolution of general states for a multilevel quantum system by exploiting the structure of coadjoint orbits in the unitary group Lie algebra. Using the same method in the case of SU(3) we study the effect of degeneracies on geometric phases for three-level systems. This is shown to lead to a highly nontrivial generalization of the result for two-level systems in which degeneracy results in a "monopole" structure in parameter space. The rich structures that arise are related to the geometry of adjoint orbits in SU(3). The limiting case of a two-level degeneracy in a three-level system is shown to lead to the known monopole structure.

  6. Frequency and phase synchronization in large groups: Low dimensional description of synchronized clapping, firefly flashing, and cricket chirping

    Science.gov (United States)

    Ott, Edward; Antonsen, Thomas M.

    2017-05-01

    A common observation is that large groups of oscillatory biological units often have the ability to synchronize. A paradigmatic model of such behavior is provided by the Kuramoto model, which achieves synchronization through coupling of the phase dynamics of individual oscillators, while each oscillator maintains a different constant inherent natural frequency. Here we consider the biologically likely possibility that the oscillatory units may be capable of enhancing their synchronization ability by adaptive frequency dynamics. We propose a simple augmentation of the Kuramoto model which does this. We also show that, by the use of a previously developed technique [Ott and Antonsen, Chaos 18, 037113 (2008)], it is possible to reduce the resulting dynamics to a lower dimensional system for the macroscopic evolution of the oscillator ensemble. By employing this reduction, we investigate the dynamics of our system, finding a characteristic hysteretic behavior and enhancement of the quality of the achieved synchronization.

  7. AWESOME 1.1: A code for the calculation of phase and group velocities of acoustic waves in homogeneous solids

    Science.gov (United States)

    Muñoz-Santiburcio, Daniel; Hernández-Laguna, Alfonso

    2017-08-01

    We present an improved version of the code AWESOME, capable of computing phase and group velocities, power flow angles and enhancement factors of acoustic waves in homogeneous solids. In this version, some algorithms are improved and the code provides a better estimation of the enhancement factor compared to the previous version. In addition, we include a quadruple-precision version of the code, which even though using the same numerical approach as the double-precision version, is able to calculate the exact values of the enhancement factor. The standard, double-precision version of the code has been interfaced and merged with the development version of CRYSTAL and will be available as part of its next stable release. Finally, we have improved the scripts for visualizing the results, which now are compatible with GNUPLOT 5.X.X, including new scripts for the visualization of the normal and ray surfaces.

  8. An interprofessionally developed geriatric oncology curriculum for hematology–oncology fellows

    Science.gov (United States)

    Eid, Ahmed; Hughes, Caren; Karuturi, Meghan; Reyes, Connie; Yorio, Jeffrey; Holmes, Holly

    2016-01-01

    Objective Because the cancer population is aging, interprofessional education incorporating geriatric principles is essential to providing adequate training for oncology fellows. We report the targeted needs assessment, content, and evaluation tools for our geriatric oncology curriculum at MD Anderson Cancer Center. Methods A team comprising a geriatrician, a medical oncologist, an oncology PharmD, an oncology advanced nurse practitioner, and two oncology chief fellows developed the geriatric oncology curriculum. First, a general needs assessment was conducted by reviewing the literature and medical societies’ publications and by consulting experts. A targeted needs assessment was then conducted by reviewing the fellows’ evaluations of the geriatric oncology rotation and by interviewing fellows and recently graduated oncology faculty. Results Geriatric assessment, pharmacology, and psychosocial knowledge skills were the three identified areas of educational need. Curriculum objectives and an evaluation checklist were developed to evaluate learners in the three identified areas. The checklist content was validated by consulting experts in the field. Online materials, including a curriculum, a geriatric pharmacology job aid, and pharmacology cases, were also developed and delivered as part of the curriculum. Conclusion An interprofessional team approach was a successful method for identifying areas of learners’ educational needs, which in turn helped us develop an integrated geriatric oncology curriculum. The curriculum is currently being piloted and evaluated. PMID:25487037

  9. ELECTRICAL RESISTANCE IMAGING OF TWO-PHASE FLOW WITH A MESH GROUPING TECHNIQUE BASED ON PARTICLE SWARM OPTIMIZATION

    Directory of Open Access Journals (Sweden)

    BO AN LEE

    2014-02-01

    Full Text Available An electrical resistance tomography (ERT technique combining the particle swarm optimization (PSO algorithm with the Gauss-Newton method is applied to the visualization of two-phase flows. In the ERT, the electrical conductivity distribution, namely the conductivity values of pixels (numerical meshes comprising the domain in the context of a numerical image reconstruction algorithm, is estimated with the known injected currents through the electrodes attached on the domain boundary and the measured potentials on those electrodes. In spite of many favorable characteristics of ERT such as no radiation, low cost, and high temporal resolution compared to other tomography techniques, one of the major drawbacks of ERT is low spatial resolution due to the inherent ill-posedness of conventional image reconstruction algorithms. In fact, the number of known data is much less than that of the unknowns (meshes. Recalling that binary mixtures like two-phase flows consist of only two substances with distinct electrical conductivities, this work adopts the PSO algorithm for mesh grouping to reduce the number of unknowns. In order to verify the enhanced performance of the proposed method, several numerical tests are performed. The comparison between the proposed algorithm and conventional Gauss-Newton method shows significant improvements in the quality of reconstructed images.

  10. Dynamic fabric phase sorptive extraction for a group of pharmaceuticals and personal care products from environmental waters.

    Science.gov (United States)

    Lakade, Sameer S; Borrull, Francesc; Furton, Kenneth G; Kabir, Abuzar; Marcé, Rosa Maria; Fontanals, Núria

    2016-07-22

    This paper describes for the first time the use of a new extraction technique, based on fabric phase sorptive extraction (FPSE). This new mode proposes the extraction of the analytes in dynamic mode in order to reduce the extraction time. Dynamic fabric phase sorptive extraction (DFPSE) followed by liquid chromatography-tandem mass spectrometry was evaluated for the extraction of a group of pharmaceuticals and personal care products (PPCPs) from environmental water samples. Different parameters affecting the extraction were optimized and best conditions were achieved when 50mL of sample at pH 3 was passed through 3 disks and analytes retained were eluted with 10mL of ethyl acetate. The recoveries were higher than 60% for most of compounds with the exception of the most polar ones (between 8% and 38%). The analytical method was validated with environmental samples such as river water and effluent and influent wastewater, and good performance was obtained. The analysis of samples revealed the presence of some PPCPs at low ngL(-1) concentrations. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. HPV status, cancer stem cell marker expression, hypoxia gene signatures and tumour volume identify good prognosis subgroups in patients with HNSCC after primary radiochemotherapy: A multicentre retrospective study of the German Cancer Consortium Radiation Oncology Group (DKTK-ROG)

    DEFF Research Database (Denmark)

    Linge, Annett; Lohaus, Fabian; Löck, Steffen

    2016-01-01

    carcinoma (HNSCC), who received primary radiochemotherapy (RCTx). MATERIALS AND METHODS: For 158 patients with locally advanced HNSCC of the oral cavity, oropharynx or hypopharynx who were treated at six DKTK partner sites, the impact of tumour volume, HPV DNA, p16 overexpression, p53 expression, CSC marker...... expression and hypoxia-associated gene signatures on outcome of primary RCTx was retrospectively analyzed. The primary endpoint of this study was loco-regional control (LRC). RESULTS: Univariate Cox regression revealed a significant impact of tumour volume, p16 overexpression, and SLC3A2 and CD44 protein......-negative group). Logistic modelling showed that inclusion of CD44 protein expression and p16 overexpression significantly improved the performance to predict LRC at 2years compared to the model with tumour volume alone. CONCLUSIONS: Tumour volume, HPV status, CSC marker expression and hypoxia gene...

  12. Complementary and alternative medicine in oncology nursing.

    Science.gov (United States)

    Somani, Salima; Ali, Fauziya; Saeed Ali, Tazeen; Sulaiman Lalani, Nasreen

    Use of complementary and alternative medicine (CAM) has increased globally, particularly among oncology patients. This study investigated the knowledge, experience and attitudes of oncology nurses towards CAM. A quantitative study was conducted in tertiary care hospitals in Karachi, Pakistan, where 132 oncology nurses were surveyed. The survey revealed that more than 50% of nurses had never heard about many of the CAM therapies used in Pakistan. Approximately 65% of the nurses had knowledge about prayer and less than 30% had experience of CAM education or training. In addition, the majority of nurses had seen patients using CAM and felt that their health status could be enhanced with the use of CAM. This study showed that oncology nurses had a positive experience of and attitude towards CAM, although they needed to enhance their knowledge of it to maximise patient satisfaction and quality of care.

  13. Organisational design for an integrated oncological department

    NARCIS (Netherlands)

    Meiss-de Haas, Ch.L.; Falkmann, H.; Douma, J.; Van Gassel, J.G.; Peters, W.G.; Van Mierlo, R.; Van Turnhout, J.M.; Verhagen, C.A.H.H.V.M.; Schrijvers, A.J.P.

    2001-01-01

    Objective: The outcomes of a Strength, Weakness, Opportunities and Threat (SWOT) analysis of three Integrated Oncological Departments were compared with their present situation three years later to define factors that can influence a successful implementation and development of an Integrated

  14. Do Pediatric Hematology/Oncology (PHO) Fellows Receive Communication Training?

    Science.gov (United States)

    File, Wilson; Bylund, Carma L.; Kesselheim, Jennifer; Leonard, David; Leavey, Patrick

    2017-01-01

    Purpose The Accreditation Council for Graduate Medical Education (ACGME) has established communication as a core competency for physicians in training. However, data suggest that most pediatric residents perceive inadequate training in the delivery of bad news and the majority of former trainees in pediatric oncology received no formal training in the delivery of bad news during fellowship. The study examines communication training in ACGME accredited US pediatric hematology-oncology (PHO) fellowship programs. Methods An online survey was distributed to 315 PHO fellows in training via the American Society of Pediatric Hematology/Oncology (ASPHO) fellow email registry. Each fellow received an initial request to participate and 2 reminders, while participation was encouraged through a random incentive drawing. Results One hundred and ten fellows (35%) responded. Eighty percent of respondents perceived communication training to be important to fellow education, however only 32% reported receiving communication training (other than direct observation). The most common reported teaching method of fellowship communication training was formal lecture (42%). Twenty-three percent of respondents reported neither communication training nor frequent feedback on their communication skills from faculty observation. This same group was the least satisfied with their programs’ approach to teaching communication (P communication training in PHO fellowships despite ACGME requirements and fellows’ interest in this training. Didactic learning remains the most frequently described training method, yet educational theory identifies the limitation of didactic lectures alone. Communication training employing novel teaching methods and emphasizing communication challenges identified by fellows should be developed and evaluated. PMID:24039096

  15. BURNOUT SYNDROME IN ONCOLOGY WORKERS: AN INTEGRATIVE REVIEW

    Directory of Open Access Journals (Sweden)

    Anne kettley Lacerda de Lima Gonzaga

    2016-11-01

    Full Text Available The study aimed to identify, in the literature, the main factors causing burnout in health professionals, mainly nurses working in oncology units. This is an integrative review, which used the methodological steps of Ganong. We searched an electronic search for articles indexed in the databases Web of Science, PubMed Central and Virtual Health Library, published between 2010 and 2015. We used, in different combinations, controlled descriptors: burnout, nursing and oncology. The final sample consisted of 18 articles. The highest number of publications, four articles (22.2% in each year, occurred in 2010 and 2013, mainly in the United States (n=5, 27.8% and Australia (n = 3, 16.6%. Dealing with the worsening of the patient's disease and death were considered the main burnout causing factors. The implementation of professional appreciation programs and psychosocial support groups for nursing staff have the potential to assist in the development of mechanisms to handle difficult situations that permeate the daily life of oncology nursing.

  16. The radiation oncology workforce: A focus on medical dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, Gregg F., E-mail: grobinson@medicaldosimetry.org [American Association of Medical Dosimetrists, Herndon, VA (United States); Mobile, Katherine [American Association of Medical Dosimetrists, Herndon, VA (United States); Yu, Yan [Thomas Jefferson University, Philadelphia, PA (United States)

    2014-07-01

    The 2012 Radiation Oncology Workforce survey was conducted to assess the current state of the entire workforce, predict its future needs and concerns, and evaluate quality improvement and safety within the field. This article describes the dosimetrist segment results. The American Society for Radiation Oncology (ASTRO) Workforce Subcommittee, in conjunction with other specialty societies, conducted an online survey targeting all segments of the radiation oncology treatment team. The data from the dosimetrist respondents are presented in this article. Of the 2573 dosimetrists who were surveyed, 890 responded, which resulted in a 35% segment response rate. Most respondents were women (67%), whereas only a third were men (33%). More than half of the medical dosimetrists were older than 45 years (69.2%), whereas the 45 to 54 years age group represented the highest percentage of respondents (37%). Most medical dosimetrists stated that their workload was appropriate (52%), with respondents working a reported average of 41.7 ± 4 hours per week. Overall, 86% of medical dosimetrists indicated that they were satisfied with their career, and 69% were satisfied in their current position. Overall, 61% of respondents felt that there was an oversupply of medical dosimetrists in the field, 14% reported that supply and demand was balanced, and the remaining 25% felt that there was an undersupply. The medical dosimetrists' greatest concerns included documentation/paperwork (78%), uninsured patients (80%), and insufficient reimbursement rates (87%). This survey provided an insight into the dosimetrist perspective of the radiation oncology workforce. Though an overwhelming majority has conveyed satisfaction concerning their career, the study allowed a spotlight to be placed on the profession's current concerns, such as insufficient reimbursement rates and possible oversupply of dosimetrists within the field.

  17. Effect of pressure on bilayer phase behavior of N-methylated di-O-hexadecylphosphatidylethanolamines: relevance of head-group modification on the bilayer interdigitation.

    Science.gov (United States)

    Goto, Masaki; Aoki, Yuya; Tamai, Nobutake; Matsuki, Hitoshi

    2017-03-30

    The phase transitions of N-methylated di-O-hexadecylphosphatidylethanolamines (DHPE, DH-N-methyl-PE (DHMePE) and DH-N,N-dimethyl-PE (DHMe2PE)) were observed by differential scanning calorimetry (DSC) and fluorometry under atmospheric pressure and by light-transmittance measurements under high pressure. The DSC thermograms showed that the N-methylated DHPE bilayers underwent the phase transition from the gel phase to the liquid crystalline (Lα) phase under atmospheric pressure. The gel phase was identified by fluorometry as the lamellar gel (Lβ) phase, and not interdigitated gel (LβI) phase. The gel/Lα transition temperature increased with pressure while decreased stepwise with increasing polar head-group size. This stepwise depression of the transition temperature may be caused by the inverse-proportional hydrogen-bonding capabilities of the head-group to the head-group size. The thermodynamic quantities of the gel/Lα transition were comparable for the N-methylated DHPE bilayers. The pressure-induced LβI phase was not found in these bilayers although the bilayer of di-O-hexadecylphosphatidylcholine (DHPC), which is a kind of N-methylated DHPEs, forms the LβI phase only by hydration under atmospheric pressure. Taking into account that the bilayers of diacyl-homologs of N-methylated DHPEs, N-methylated dipalmitoyl-PEs except for dipalmitoylphosphatidylcholine (DPPC), do not form the LβI phase in the whole pressure range investigated but the DPPC bilayer forms the LβI phase under high pressure, we can say that the interdigitation requires weaker interaction between large-sized head groups like the bulky choline group. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Platinum-Group Minerals and Other Accessory Phases in Chromite Deposits of the Alapaevsk Ophiolite, Central Urals, Russia

    Directory of Open Access Journals (Sweden)

    Federica Zaccarini

    2016-10-01

    Full Text Available An electron microprobe study has been carried out on platinum-group minerals, accessory phases, and chromite in several chromite deposits of the Alapaevsk ophiolite (Central Urals, Russia namely the Bakanov Kluch, Kurmanovskoe, Lesnoe, 3-d Podyony Rudnik, Bol’shaya Kruglyshka, and Krest deposits. These deposits occur in partially to totally serpentinized peridotites. The microprobe data shows that the chromite composition varies from Cr-rich to Al-rich. Tiny platinum-group minerals (PGM, 1–10 µm in size, have been found in the chromitites. The most abundant PGM is laurite, accompanied by minor cuproiridsite and alloys in the system Os–Ir–Ru. A small grain (about 20 μm was found in the interstitial serpentine of the Bakanov Kluch chromitite, and its calculated stoichiometry corresponds to (Ni,Fe5P. Olivine, occurring in the silicate matrix or included in fresh chromite, has a mantle-compatible composition in terms of major and minor elements. Several inclusions of amphibole, Na-rich phlogopite, and clinopyroxene have been identified. The bimodal Cr–Al composition of chromite probably corresponds to a vertical distribution in the ophiolite sequence, implying formation of Cr-rich chromitites in the deep mantle, and Al-rich chromitites close to the Moho-transition zone, in a supra-subduction setting. The presence of abundant hydrous silicate inclusions, such as amphibole and phlogopite, suggests that the Alapaevsk chromitites crystallized as a result of the interaction between a melt enriched in fluids and peridotites. Laurite and cuproiridsite are considered to be magmatic in origin, i.e., entrapped as solid phases during the crystallization of chromite at high temperatures. The sulfur fugacity was relatively high to allow the precipitation of Ir-bearing sulfides, but below the Os–OsS2 buffer. The alloys in the system Os–Ir–Ru are classified as secondary PGM, i.e., formed at low temperature during the serpentinization process. The

  19. [Interests of applied anthropology to oncology].

    Science.gov (United States)

    Soum-Pouyalet, Fanny; Hubert, Annie; Dilhuydy, Jean-Marie

    2008-01-01

    From now on the introduction of social and human sciences studies in the field of oncology has not always been conclusive. This article aims to analyze the bounds that border the meeting and the understanding between physicians, patients and anthropologists. It also treats the problems due to the introduction of applied anthropology in the field of oncology and points up the interests and practical contributions that this disciplinary bring and could bring.

  20. The Globalization of Cooperative Groups.

    Science.gov (United States)

    Valdivieso, Manuel; Corn, Benjamin W; Dancey, Janet E; Wickerham, D Lawrence; Horvath, L Elise; Perez, Edith A; Urton, Alison; Cronin, Walter M; Field, Erica; Lackey, Evonne; Blanke, Charles D

    2015-10-01

    The National Cancer Institute (NCI)-supported adult cooperative oncology research groups (now officially Network groups) have a longstanding history of participating in international collaborations throughout the world. Most frequently, the US-based cooperative groups work reciprocally with the Canadian national adult cancer clinical trial group, NCIC CTG (previously the National Cancer Institute of Canada Clinical Trials Group). Thus, Canada is the largest contributor to cooperative groups based in the United States, and vice versa. Although international collaborations have many benefits, they are most frequently utilized to enhance patient accrual to large phase III trials originating in the United States or Canada. Within the cooperative group setting, adequate attention has not been given to the study of cancers that are unique to countries outside the United States and Canada, such as those frequently associated with infections in Latin America, Asia, and Africa. Global collaborations are limited by a number of barriers, some of which are unique to the countries involved, while others are related to financial support and to US policies that restrict drug distribution outside the United States. This article serves to detail the cooperative group experience in international research and describe how international collaboration in cancer clinical trials is a promising and important area that requires greater consideration in the future. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Outcomes of haematopoietic stem cell transplantation for inherited metabolic disorders: a report from the Australian and New Zealand Children's Haematology Oncology Group and the Australasian Bone Marrow Transplant Recipient Registry.

    Science.gov (United States)

    Mitchell, R; Nivison-Smith, I; Anazodo, A; Tiedemann, K; Shaw, P J; Teague, L; Fraser, C J; Carter, T L; Tapp, H; Alvaro, F; O'Brien, T A

    2013-09-01

    We report a retrospective analysis of 53 haematopoietic stem cell transplants for inherited metabolic disorders performed at ANZCHOG transplant centres between 1992 and 2008. Indications for transplant included Hurler syndrome, ALD, and MLD. The majority of transplants utilized unrelated donor stem cells (66%) with 65% of those being unrelated cord blood. Conditioning therapy was largely myeloablative, with Bu plus another cytotoxic agent used in 89% of recipients. Primary graft failure was rare, occurring in three patients, all of whom remain long-term survivors following the second transplant. The CI of grade II-IV and grade III-IV acute GVHD at day +100 was 39% and 14%, respectively. Chronic GVHD occurred in 17% of recipients. TRM was 12% at day +100 and 19% at one yr post-transplant. OS at five yr was 78% for the cohort, 73% for patients with ALD and 83% for patients with Hurler syndrome. There was no statistically significant difference in overall survival between unrelated marrow and unrelated cord blood donor groups. The development of interstitial pneumonitis was an independent variable shown to significantly impact on TRM and OS. In summary, we report a large cohort of patients with inherited metabolic disorders with excellent survival post-allogeneic transplant.

  2. European Society for Medical Oncology (ESMO) Program for the integration of oncology and Palliative Care: a 5-year review of the Designated Centers' incentive program.

    Science.gov (United States)

    Cherny, N; Catane, R; Schrijvers, D; Kloke, M; Strasser, F

    2010-02-01

    In 1999, the National Representatives of European Society for Medical Oncology (ESMO) created a Palliative Care Working Group to improve the delivery of supportive and palliative care (S + PC) by oncologists, oncology departments and cancer centers. They have addressed this task through initiatives in policy, education, research and incentives. As an incentive program for oncology departments and centers, ESMO developed a program of Designated Centers (DCs) for programs meeting predetermined targets of service development and delivery of a high level of S + PC. The history, accreditation criteria and implementation of the DC incentive program is described. Since 2004, 75 centers have applied for designation and 48 have been accredited including 34 comprehensive cancer centers (CCCs) in general hospitals and seven freestanding CCCs. Perceived benefits accrued from the accreditation included the following: improved status and role identification of the center, positive impact on daily work, positive impact on business activity and positive impact on funding for projects. The accreditation of DCs has been a central to the ESMO initiative to improve the palliative care provided by oncologists and oncology centers. It is likely that many other oncology departments and cancer centers already meet the criteria and ESMO strongly encourages them to apply for accreditation.

  3. Selenol protecting groups in organic chemistry: special emphasis on selenocysteine Se-protection in solid phase peptide synthesis.

    Science.gov (United States)

    Flemer, Stevenson

    2011-04-18

    The appearance of selenium in organic synthesis is relatively rare, and thus examples in the literature pertaining to the masking of its considerable reactivity are similarly uncommon. Greene's Protecting Groups in Organic Synthesis, the standard reference for the state of the art in this arena, offers no entries for selenium protective methodology, in stark comparison to its mention of the great variety of protecting groups germane to its chalcogen cousin sulfur. This scarcity of Se-protection methods makes it no less interesting and pertinent toward the construction of selenium-containing organic systems which do indeed require the iterative blocking and de-blocking of selenol functionalities. A selenium-containing system which is especially relevant is selenocysteine, as its use in Solid Phase Peptide Synthesis requires extensive protection of its selenol side chain. This review will attempt to summarize the current state of understanding with regard to selenium protection protocol in organic synthesis. Moreover, it will provide a special emphasis on selenocysteine side chain protection, comprising both the breadth of functionality used for this purpose as well as methods of deprotection.

  4. Selenol Protecting Groups in Organic Chemistry: Special Emphasis on Selenocysteine Se-Protection in Solid Phase Peptide Synthesis

    Directory of Open Access Journals (Sweden)

    Stevenson Flemer Jr.

    2011-04-01

    Full Text Available The appearance of selenium in organic synthesis is relatively rare, and thus examples in the literature pertaining to the masking of its considerable reactivity are similarly uncommon. Greene's Protecting Groups in Organic Synthesis, the standard reference for the state of the art in this arena, offers no entries for selenium protective methodology, in stark comparison to its mention of the great variety of protecting groups germane to its chalcogen cousin sulfur. This scarcity of Se-protection methods makes it no less interesting and pertinent toward the construction of selenium-containing organic systems which do indeed require the iterative blocking and de-blocking of selenol functionalities. A selenium-containing system which is especially relevant is selenocysteine, as its use in Solid Phase Peptide Synthesis requires extensive protection of its selenol side chain. This review will attempt to summarize the current state of understanding with regard to selenium protection protocol in organic synthesis. Moreover, it will provide a special emphasis on selenocysteine side chain protection, comprising both the breadth of functionality used for this purpose as well as methods of deprotection.

  5. Thermolytic 4-methylthio-1-butyl group for phosphate/thiophosphate protection in solid-phase synthesis of DNA oligonucleotides.

    Science.gov (United States)

    Cieślak, Jacek; Grajkowski, Andrzej; Livengood, Victor; Beaucage, Serge L

    2004-04-02

    The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.

  6. GNRH-agonist or antagonist in the treatment of prostate cancer: a comparision based on oncological results.

    Science.gov (United States)

    Salciccia, Stefano; Gentilucci, Alessandro; Cattarino, Susanna; Sciarra, Alessandro

    2016-11-18

    On the basis of the trials available, are we ready to consider GnRH antagonists better than agonists? Is there a population of patients who may benefit from antagonists more than agonists?We specifically focused our analysis on the significance of oncological results obtained in phase III trials directly comparing Degarelix with GnRH agonists. Oncological results were evaluated only in 1 trial (CS21) with some subanalysis and they were not the primary endpoints of the study. The follow-up duration was 364 days, and therefore, the number of events (all causes deaths and prostate cancer (PC), Prostate Specific Antigen (PSA), Hazard ratio (HR)-related deaths) was very low in both groups and this aspect strongly reduces the significance of overall survival evaluation. In our opinion, the CS21A open-label extension does not consent to obtain useful clinical data and the design of the study loses the possibility to have a longer randomized comparison between degarelix and agonist. Moreover, the fact that the crossover from leuprolide to degarelix was pre-defined at 12 months and not at agonist failure does not allow to gather data also on the effect of sequential treatment.The answer to the question whether we are ready to consider antagonists better than agonists, based on oncological results, is probably no. We have data in terms of testosterone suppression and PSA control rather than overall survival or clinical progression free survival. A PSA progression-free survival is a secondary endpoint that in our opinion is not sufficient. Large prospective comparative trials with long-term follow-up are needed to clarify this critical clinical question.

  7. Assessing the Prognostic Significance of Histologic Response in Osteosarcoma: A Comparison of Outcomes on CCG-782 and INT0133—A Report From the Children’s Oncology Group Bone Tumor Committee

    Science.gov (United States)

    Bishop, Michael W.; Chang, Yu-Chen; Krailo, Mark D.; Meyers, Paul A.; Provisor, Arthur J.; Schwartz, Cindy L.; Marina, Neyssa M.; Teot, Lisa A.; Gebhardt, Mark C.; Gorlick, Richard; Janeway, Katherine A.; Chou, Alexander J.

    2016-01-01

    Background The prognostic value of histologic response for osteosarcoma may have changed with induction chemotherapy schedules over time. We hypothesized that the increased intensity of induction therapy provided on INT0133 compared to the Children’s Cancer Group study CCG-782 would diminish the impact of histologic response on the risk of events after definitive surgery. Methods Retrospective analysis was performed for patients aged osteosarcoma enrolled on CCG-782 and INT0133. Clinical factors were evaluated for association with response and outcome. Good response was defined as <5% viable tumor at resection. Associations of response, study, and post-definitive surgery event-free survival (EFS-DS)were determined using Cox proportional hazard models. EFS-DS was estimated by Kaplan–Meier methodology. Results Data were available for 814 patients (206 CCG-782, 608 INT0133). For good responders, 10-year EFS-DS (±SE) was 75.4% ± 7.7% for CCG-782 and 70.8% ± 3.1% for INT0133. For poor responders, 10-year EFS-DS was 39.9% ± 4.9% for CCG-782 and 58.4% ± 3.1% for INT0133. Histologic response predicted outcome across studies (P < 0.0001). Significant interaction between study and histologic response was observed for EFS-DS (P = 0.011). Using proportional hazards regression, INT0133 poor responders had less risk of events compared to CCG-782 poor responders (relative hazard ratio (RHR) = 0.6:1), but good responders on INT0133 had a greater risk of events compared to CCG-782 good responders (RHR = 1.53:1). Conclusion We observed an inverse relationship between the predictive value of tumor necrosis and intensity of induction therapy, raising questions about the true prognostic value of histologic response. This highlights the need for novel markers to develop strategies for treatment in future trials. PMID:27128693

  8. Assessing the Prognostic Significance of Histologic Response in Osteosarcoma: A Comparison of Outcomes on CCG-782 and INT0133-A Report From the Children's Oncology Group Bone Tumor Committee.

    Science.gov (United States)

    Bishop, Michael W; Chang, Yu-Chen; Krailo, Mark D; Meyers, Paul A; Provisor, Arthur J; Schwartz, Cindy L; Marina, Neyssa M; Teot, Lisa A; Gebhardt, Mark C; Gorlick, Richard; Janeway, Katherine A; Chou, Alexander J

    2016-10-01

    The prognostic value of histologic response for osteosarcoma may have changed with induction chemotherapy schedules over time. We hypothesized that the increased intensity of induction therapy provided on INT0133 compared to the Children's Cancer Group study CCG-782 would diminish the impact of histologic response on the risk of events after definitive surgery. Retrospective analysis was performed for patients aged osteosarcoma enrolled on CCG-782 and INT0133. Clinical factors were evaluated for association with response and outcome. Good response was defined as <5% viable tumor at resection. Associations of response, study, and postdefinitive surgery event-free survival (EFS-DS) were determined using Cox proportional hazard models. EFS-DS was estimated by Kaplan-Meier methodology. Data were available for 814 patients (206 CCG-782, 608 INT0133). For good responders, 10-year EFS-DS (±SE) was 75.4% ± 7.7% for CCG-782 and 70.8% ± 3.1% for INT0133. For poor responders, 10-year EFS-DS was 39.9% ± 4.9% for CCG-782 and 58.4% ± 3.1% for INT0133. Histologic response predicted outcome across studies (P < 0.0001). Significant interaction between study and histologic response was observed for EFS-DS (P = 0.011). Using proportional hazards regression, INT0133 poor responders had less risk of events compared to CCG-782 poor responders (relative hazard ratio (RHR) = 0.6:1), but good responders on INT0133 had a greater risk of events compared to CCG-782 good responders (RHR = 1.53:1). We observed an inverse relationship between the predictive value of tumor necrosis and intensity of induction therapy, raising questions about the true prognostic value of histologic response. This highlights the need for novel markers to develop strategies for treatment in future trials. © 2016 Wiley Periodicals, Inc.

  9. Palliative care and pediatric surgical oncology.

    Science.gov (United States)

    Inserra, Alessandro; Narciso, Alessandra; Paolantonio, Guglielmo; Messina, Raffaella; Crocoli, Alessandro

    2016-10-01

    Survival rate for childhood cancer has increased in recent years, reaching as high as 70% in developed countries compared with 54% for all cancers diagnosed in the 1980s. In the remaining 30%, progression or metastatic disease leads to death and in this framework palliative care has an outstanding role though not well settled in all its facets. In this landscape, surgery has a supportive actor role integrated with other welfare aspects from which are not severable. The definition of surgical palliation has moved from the ancient definition of noncurative surgery to a group of practices performed not to cure but to alleviate an organ dysfunction offering the best quality of life possible in all the aspects of life (pain, dysfunctions, caregivers, psychosocial, etc.). To emphasize this aspect a more modern definition has been introduced: palliative therapy in whose context is comprised not only the care assistance but also the plans of care since the onset of illness, teaching the matter to surgeons in training and share paths. Literature is very poor regarding surgical aspects specifically dedicated and all researches (PubMed, Google Scholar, and Cochrane) with various meshing terms result in a more oncologic and psychosocial effort. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Multidisciplinary approach to the geriatric oncology patient.

    Science.gov (United States)

    Terret, Catherine; Zulian, Gilbert B; Naiem, Arash; Albrand, Gilles

    2007-05-10

    Given the dramatic demographic shift observed in developed countries, the medical community, especially oncologists, geriatricians, and primary care providers, are confronted with the expanding challenge of the management of elderly people with cancer. Ageing is associated with the accumulation of multiple and various medical and social problems. With a prevalence comparable to that of other chronic conditions in this age group, such as diabetes or dementia, cancer holds a prominent place among diseases of the elderly. The care of elderly cancer patients is fundamentally interdisciplinary. Communication and collaboration between geriatricians/primary care providers and oncologists represent key features of effective care in geriatric oncology. The combination of the disease-oriented approach of oncologists and the patient-oriented approach of geriatricians is the most powerful way to better serve this specific population. The medical approach of elderly cancer patients should ideally be under the lead of geriatricians or primary care providers sensitive to geriatric issues. Oncologists should manage the biologic consequences of the interplay between cancer and ageing. Close collaboration between clinicians will help promote active dedicated clinical research and the development of guidelines on the management of elderly people with cancer.

  11. A Comparison of Computer-Assisted Instruction and Tutorials in Hematology and Oncology.

    Science.gov (United States)

    Garrett, T. J.; And Others

    1987-01-01

    A study comparing the effectiveness of computer-assisted instruction (CAI) and small group instruction found no significant difference in medical student achievement in oncology but higher achievement through small-group instruction in hematology. Students did not view CAI as more effective, but saw it as a supplement to traditional methods. (MSE)

  12. Evaluation of a two-phase experimental study of a small group (“MultiLit” reading intervention for older low-progress readers

    Directory of Open Access Journals (Sweden)

    Jennifer Buckingham

    2014-12-01

    Full Text Available The study reported here examined the efficacy of a small group (Tier 2 in a three-tier Response to Intervention model literacy intervention for older low-progress readers (in Years 3–6. This article focuses on the second phase of a two-phase, crossover randomized control trial involving 26 students. In Phase 1, the experimental group (E1 received the 1 h literacy intervention daily for three school terms. The control group received regular classroom instruction. In Phase 2, the original control group received the intervention (E2. At the end of Phase 1, there was a statistically significant difference between groups and a large treatment effect on one of five measures—the Martin and Pratt Non-word Reading Test of phonological recoding. At the end of Phase 2, the large effect on phonological recoding was confirmed for the second experimental group, and there were also statistically significant differences with moderate or large effect sizes on four other measures—single word reading, fluency, passage reading accuracy, and comprehension.

  13. Prognostic significance of ESR1 gene amplification, mRNA/protein expression and functional profiles in high-risk early breast cancer: a translational study of the Hellenic Cooperative Oncology Group (HeCOG.

    Directory of Open Access Journals (Sweden)

    George Pentheroudakis

    amplification do not constitute per se prognostic markers, instead they can be classified to distinct prognostic groups according to their protein-mediated functional status.

  14. Optimizing oncology therapeutics through quantitative translational and clinical pharmacology: challenges and opportunities.

    Science.gov (United States)

    Venkatakrishnan, K; Friberg, L E; Ouellet, D; Mettetal, J T; Stein, A; Trocóniz, I F; Bruno, R; Mehrotra, N; Gobburu, J; Mould, D R

    2015-01-01

    Despite advances in biomedical research that have deepened our understanding of cancer hallmarks, resulting in the discovery and development of targeted therapies, the success rates of oncology drug development remain low. Opportunities remain for objective dose selection informed by exposure-response understanding to optimize the benefit-risk balance of novel therapies for cancer patients. This review article discusses the principles and applications of modeling and simulation approaches across the lifecycle of development of oncology therapeutics. Illustrative examples are used to convey the value gained from integration of quantitative clinical pharmacology strategies from the preclinical-translational phase through confirmatory clinical evaluation of efficacy and safety.

  15. Interventional radiology in pediatric oncology

    Energy Technology Data Exchange (ETDEWEB)

    Hoffer, Fredric A. [Division of Diagnostic Imaging, Department of Radiological Sciences, St. Jude Children' s Research Hospital, 332 N. Lauderdale St., Memphis, TN 38105 (United States)]. E-mail: fred.hoffer@stjude.org

    2005-01-01

    There are many radiological interventions necessary for pediatric oncology patients, some of which may be covered in other articles in this publication. I will discuss a number of interventions including percutaneous biopsy for solid tumor and hematological malignancy diagnosis or recurrence, for the diagnosis of graft versus host disease after stem cell or bone marrow transplantation, and for the diagnosis of complications of immunosuppression such as invasive pulmonary aspergillosis. In the past, tumor localization techniques have been necessary to biopsy or resect small lesions. However improved guidance techniques have allowed for more precise biopsy and the use of thermal ablation instead of excision for local tumor control. A percutaneously placed radio frequency, microwave, laser or cryogen probe can ablate the primary and metastatic tumors of the liver, lung, bone, kidney and other structures in children. This is an alternative treatment for the local control of tumors that may not be amenable to surgery, chemotherapy or radiotherapy. I will also describe how chemoembolization can be used to treat primary or metastatic tumors of the liver that have failed other therapies. This treatment delivers chemotherapy in the hepatic artery infused with emboli to increase the dwell time and concentration of the agents.

  16. Phase I remedial investigation report of Waste Area Grouping 2 at Oak Ridge National Laboratory, Oak Ridge, Tennessee

    Energy Technology Data Exchange (ETDEWEB)

    Miller, D.E. [ed.

    1995-07-01

    This report presents the activities and findings of the first phase of a three-phase remedial investigation (RI) of Waste Area Grouping (WAG) 2 at Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee, and updates the scope and strategy for WAG-2-related efforts. WAG 2 contains White Oak Creek (WOC) and its tributaries downstream of the ORNL main plant area, White Oak Lake, White Oak Creek Embayment on the Clinch River, and the associated floodplain and subsurface environment. Water, sediment, soil, and biota in WAG 2 are contaminated and continue to receive contaminants from upgradient WAGs. This report includes field activities completed through October 1992. The remediation of WAG 2 is scheduled to follow the cessation of contaminant input from hydrologically upgradient WAGs. While upgradient areas are being remediated, the strategy for WAG 2 is to conduct a long-term monitoring and investigation program that takes full advantage of WAG 2`s role as an integrator of contaminant fluxes from other ORNL WAGs and focuses on four key goals: (1) Implement, in concert with other programs, long-term, multimedia environmental monitoring and tracking of contaminants leaving other WAGs, entering WAG 2, and being transported off-site. (2) Provide a conceptual framework to integrate and develop information at the watershed-level for pathways and processes that are key to contaminant movement, and so support remedial efforts at ORNL. (3) Provide periodic updates of estimates of potential risk (both human health and ecological) associated with contaminants accumulating in and moving through WAG 2 to off-site areas. (4) Support the ORNL Environmental Restoration Program efforts to prioritize, remediate, and verify remedial effectiveness for contaminated sites at ORNL, through long-term monitoring and continually updated risk assessments.

  17. Phase I remedial investigation report of Waste Area Grouping 2 at Oak Ridge National Laboratory, Oak Ridge, Tennessee

    Energy Technology Data Exchange (ETDEWEB)

    Miller, D.E. [ed.

    1995-07-01

    This report presents the activities and findings of the first phase of a three-phase remedial investigation (RI) of Waste Area Grouping (WAG) 2 at Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee, and updates the scope and strategy for WAG-2-related efforts. WAG 2 contains White Oak Creek (WOC) and its tributaries downstream of the ORNL main plant area, White Oak Lake, White Oak Creek Embayment on the Clinch River, and the associated floodplain and subsurface environment. Water, sediment, soil, and biota in WAG 2 are contaminated and continue to receive contaminants from upgradient WAGs. This report includes field activities completed through October 1992. The remediation of WAG 2 is scheduled to follow the cessation of contaminant input from hydrologically upgradient WAGs. While upgradient areas are being remediated, the strategy for WAG 2 is to conduct a long-term monitoring and investigation program that takes full advantage of WAG 2`s role as an integrator of contaminant fluxes from other ORNL WAGs and focuses on four key goals: (1) Implement, in concert with other programs, long-term, multimedia environmental monitoring and tracking of contaminants leaving other WAGs, entering WAG 2, and being transported off-site. (2) Provide a conceptual framework to integrate and develop information at the watershed-level for pathways and processes that are key to contaminant movement, and so support remedial efforts at ORNL. (3) Provide periodic updates of estimates of potential risk (both human health and ecological) associated with contaminants accumulating in and moving through WAG 2 to off-site areas. (4) Support the ORNL Environmental Restoration Program efforts to prioritize, remediate, and verify remedial effectiveness for contaminated sites at ORNL, through long-term monitoring and continually updated risk assessments.

  18. Highly cited German research contributions to the fields of radiation oncology, biology, and physics. Focus on collaboration and diversity

    Energy Technology Data Exchange (ETDEWEB)

    Nieder, C. [Nordland Hospital, Bodoe (Norway). Dept. of Oncology and Palliative Medicine; Tromsoe Univ. (Norway). Inst. of Clinical Medicine

    2012-10-15

    Background and purpose: Tight budgets and increasing competition for research funding pose challenges for highly specialized medical disciplines such as radiation oncology. Therefore, a systematic review was performed of successfully completed research that had a high impact on clinical practice. These data might be helpful when preparing new projects. Methods: Different measures of impact, visibility, and quality of published research are available, each with its own pros and cons. For this study, the article citation rate was chosen (minimum 15 citations per year on average). Highly cited German contributions to the fields of radiation oncology, biology, and physics (published between 1990 and 2010) were identified from the Scopus database. Results: Between 1990 and 2010, 106 articles published in 44 scientific journals met the citation requirement. The median average of yearly citations was 21 (maximum 167, minimum 15). All articles with {>=} 40 citations per year were published between 2003 and 2009, consistent with the assumption that the citation rate gradually increases for up to 2 years after publication. Most citations per year were recorded for meta-analyses and randomized phase III trials, which typically were performed by collaborative groups. Conclusion: A large variety of clinical radiotherapy, biology, and physics topics achieved high numbers of citations. However, areas such as quality of life and side effects, palliative radiotherapy, and radiotherapy for nonmalignant disorders were underrepresented. Efforts to increase their visibility might be warranted. (orig.)

  19. American Society of Clinical Oncology Policy Statement on Clinical Pathways in Oncology.

    Science.gov (United States)

    Zon, Robin T; Frame, James N; Neuss, Michael N; Page, Ray D; Wollins, Dana S; Stranne, Steven; Bosserman, Linda D

    2016-03-01

    The use of clinical pathways in oncology care is increasingly important to patients and oncology providers as a tool for enhancing both quality and value. However, with increasing adoption of pathways into oncology practice, concerns have been raised by ASCO members and other stakeholders. These include the process being used for pathway development, the administrative burdens on oncology practices of reporting on pathway adherence, and understanding the true impact of pathway use on patient health outcomes. To address these concerns, ASCO's Board of Directors established a Task Force on Clinical Pathways, charged with articulating a set of recommendations to improve the development of oncology pathways and processes, allowing the demonstration of pathway concordance in a manner that promotes evidence-based, high-value care respecting input from patients, payers, and providers. These recommendations have been approved and adopted by ASCO's Board of Directors on August 12, 2015, and are presented herein.

  20. Companion diagnostics and molecular imaging-enhanced approaches for oncology clinical trials.

    Science.gov (United States)

    Van Heertum, Ronald L; Scarimbolo, Robert; Ford, Robert; Berdougo, Eli; O'Neal, Michael

    2015-01-01

    In the era of personalized medicine, diagnostic approaches are helping pharmaceutical and biotechnology sponsors streamline the clinical trial process. Molecular assays and diagnostic imaging are routinely being used to stratify patients for treatment, monitor disease, and provide reliable early clinical phase assessments. The importance of diagnostic approaches in drug development is highlighted by the rapidly expanding global cancer diagnostics market and the emergent attention of regulatory agencies worldwide, who are beginning to offer more structured platforms and guidance for this area. In this paper, we highlight the key benefits of using companion diagnostics and diagnostic imaging with a focus on oncology clinical trials. Nuclear imaging using widely available radiopharmaceuticals in conjunction with molecular imaging of oncology targets has opened the door to more accurate disease assessment and the modernization of standard criteria for the evaluation, staging, and treatment responses of cancer patients. Furthermore, the introduction and validation of quantitative molecular imaging continues to drive and optimize the field of oncology diagnostics. Given their pivotal role in disease assessment and treatment, the validation and commercialization of diagnostic tools will continue to advance oncology clinical trials, support new oncology drugs, and promote better patient outcomes.

  1. Sport and oxidative stress in oncological patients.

    Science.gov (United States)

    Knop, K; Schwan, R; Bongartz, M; Bloch, W; Brixius, K; Baumann, F

    2011-12-01

    Oxidative stress is thought to be an important factor in the onset, progression and recurrence of cancer. In order to investigate how it is influenced by physical activity, we measured oxidative stress and antioxidative capacity (aoC) in 12 women with breast cancer and 6 men with prostate cancer, before and after long hiking trips. Before the hike, the men had a ROS-concentration of 1.8±0.6 mM H2O2 and an aoC of 0.7±0.6 mM Trolox-equivalent (Tro), while the women had a ROS-concentration of 3.1±0.7 mM H2O2 and an aoC of 1.2±0.2 mM Tro. After the hike, women showed no significant change in ROS and a significant increase in aoC (1.3±0.2 mM Tro), while the ROS concentration in men increased significantly (2.1±0.3 mM H2O2) and their aoC decreased (0.25±0.1 mM Tro). After a regenerative phase, the ROS concentration of the men decreased to 1.7±0.4 mM H2O2 and their aoC recovered significantly (1.2±0.4 mM Tro), while the women presented no significant change in the concentration of H2O2 but showed an ulterior increase in antioxidant capacity (2.05±0.43 mM Tro). From this data we conclude that physical training programs as for example long distance hiking trips can improve the aoC in the blood of oncological patients. © Georg Thieme Verlag KG Stuttgart · New York.

  2. Gas-phase formaldehyde adsorption isotherm studies on activated carbon: correlations of adsorption capacity to surface functional group density.

    Science.gov (United States)

    Carter, Ellison M; Katz, Lynn E; Speitel, Gerald E; Ramirez, David

    2011-08-01

    Formaldehyde (HCHO) adsorption isotherms were developed for the first time on three activated carbons representing one activated carbon fiber (ACF) cloth, one all-purpose granular activated carbon (GAC), and one GAC commercially promoted for gas-phase HCHO removal. The three activated carbons were evaluated for HCHO removal in the low-ppm(v) range and for water vapor adsorption from relative pressures of 0.1-0.9 at 26 °C where, according to the IUPAC isotherm classification system, the adsorption isotherms observed exhibited Type V behavior. A Type V adsorption isotherm model recently proposed by Qi and LeVan (Q-L) was selected to model the observed adsorption behavior because it reduces to a finite, nonzero limit at low partial pressures and it describes the entire range of adsorption considered in this study. The Q-L model was applied to a polar organic adsorbate to fit HCHO adsorption isotherms for the three activated carbons. The physical and chemical characteristics of the activated carbon surfaces were characterized using nitrogen adsorption isotherms, X-ray photoelectron spectroscopy (XPS), and Boehm titrations. At low concentrations, HCHO adsorption capacity was most strongly related to the density of basic surface functional groups (SFGs), while water vapor adsorption was most strongly influenced by the density of acidic SFGs.

  3. Low-energy effective interactions beyond the constrained random-phase approximation by the functional renormalization group

    Science.gov (United States)

    Kinza, Michael; Honerkamp, Carsten

    2015-07-01

    In the derivation of low-energy effective models for solids targeting the bands near the Fermi level, the constrained random-phase approximation (cRPA) has become an appreciated tool to compute the effective interactions. The Wick-ordered constrained functional renormalization group (cfRG) generalizes the cRPA approach by including all interaction channels in an unbiased way. Here we present applications of the cfRG to two simple multiband systems and compare the resulting effective interactions to the cRPA. First, we consider a multiband model for monolayer graphene, where we integrate out the σ bands to get an effective theory for π bands. It turns out that terms beyond cRPA are strongly suppressed by the different x y -plane reflection symmetry of the bands. In our model the cfRG corrections to cRPA become visible when one disturbs this symmetry difference slightly, however, without qualitative changes. This study shows that the embedding or layering of two-dimensional electronic systems can alter the effective interaction parameters beyond what is expected from screening considerations. The second example is a one-dimensional model for a diatomic system reminiscent of a CuO chain, where we consider an effective theory for Cu 3 d -like orbitals. Here the fRG data shows relevant and qualitative corrections compared to the cRPA results. We argue that the new interaction terms affect the magnetic properties of the low-energy model.

  4. Music therapy: a valuable adjunct in the oncology setting.

    Science.gov (United States)

    Mahon, Emily M; Mahon, Suzanne M

    2011-08-01

    Music therapy is the supervised and therapeutic use of music by a credentialed therapist to promote positive clinical outcomes. It can be a valuable form of complementary medicine in the oncology setting to decrease patient stress and anxiety, relieve pain and nausea, provide distraction, alleviate depression, and promote the expression of feelings. The music therapist assesses the patient and consults other members of the multidisciplinary team to create a therapeutic treatment plan. Music therapists design music sessions based on patients' needs and their intended therapeutic goals. Patients can participate actively or passively in individual or group sessions. Only a credentialed music therapist can provide safe and beneficial music therapy interventions.

  5. Precision oncology: origins, optimism, and potential.

    Science.gov (United States)

    Prasad, Vinay; Fojo, Tito; Brada, Michael

    2016-02-01

    Imatinib, the first and arguably the best targeted therapy, became the springboard for developing drugs aimed at molecular targets deemed crucial to tumours. As this development unfolded, a revolution in the speed and cost of genetic sequencing occurred. The result--an armamentarium of drugs and an array of molecular targets--set the stage for precision oncology, a hypothesis that cancer treatment could be markedly improved if therapies were guided by a tumour's genomic alterations. Drawing lessons from the biological basis of cancer and recent empirical investigations, we take a more measured view of precision oncology's promise. Ultimately, the promise is not our concern, but the threshold at which we declare success. We review reports of precision oncology alongside those of precision diagnostics and novel radiotherapy approaches. Although confirmatory evidence is scarce, these interventions have been widely endorsed. We conclude that the current path will probably not be successful or, at a minimum, will have to undergo substantive adjustments before it can be successful. For the sake of patients with cancer, we hope one form of precision oncology will deliver on its promise. However, until confirmatory studies are completed, precision oncology remains unproven, and as such, a hypothesis in need of rigorous testing.

  6. Comparison of methods for prioritizing risk in radiation oncology; Comparacao entre metodos de priorizacao de riscos em radioterapia

    Energy Technology Data Exchange (ETDEWEB)

    Biazotto, Bruna; Tokarski, Marcio, E-mail: bruna@ceb.unicamp.br [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Centro de Engenharia Biomedica

    2016-07-01

    Proactive risk management tools, such as Failure Mode and Effect Analysis (FEMA), were imported from engineering and have been widely used in Radiation Oncology. An important step in this process is the risk prioritization and there are many methods to do that. This paper compares the risk prioritization of computerized planning phase in interstitial implants with high dose rate brachytherapy performed with Health Care Failure Mode and Effect Analysis (HFMEA) and FMEA with guidelines given by the Task Group 100 (TG 100) of the American Association of Physicists in Medicine. Out of the 33 possible failure modes of this process, 21 require more attention when evaluated by HFMEA and 22, when evaluated by FMEA TG 100. Despite the high coincidence between the methods, the execution of HFMEA was simpler. (author)

  7. Stepwise positional-orientational order and the multicritical-multistructural global phase diagram of the s=3/2 Ising model from renormalization-group theory.

    Science.gov (United States)

    Yunus, Çağın; Renklioğlu, Başak; Keskin, Mustafa; Berker, A Nihat

    2016-06-01

    The spin-3/2 Ising model, with nearest-neighbor interactions only, is the prototypical system with two different ordering species, with concentrations regulated by a chemical potential. Its global phase diagram, obtained in d=3 by renormalization-group theory in the Migdal-Kadanoff approximation or equivalently as an exact solution of a d=3 hierarchical lattice, with flows subtended by 40 different fixed points, presents a very rich structure containing eight different ordered and disordered phases, with more than 14 different types of phase diagrams in temperature and chemical potential. It exhibits phases with orientational and/or positional order. It also exhibits quintuple phase transition reentrances. Universality of critical exponents is conserved across different renormalization-group flow basins via redundant fixed points. One of the phase diagrams contains a plastic crystal sequence, with positional and orientational ordering encountered consecutively as temperature is lowered. The global phase diagram also contains double critical points, first-order and critical lines between two ordered phases, critical end points, usual and unusual (inverted) bicritical points, tricritical points, multiple tetracritical points, and zero-temperature criticality and bicriticality. The four-state Potts permutation-symmetric subspace is contained in this model.

  8. [Economic and logistical problems of radiation oncology].

    Science.gov (United States)

    Solodkiĭ, V A; Pan'shin, G A; Sotnikov, V M; Ivashin, A V

    2014-01-01

    An analysis of economic and logistical problems of radiation oncology is presented based on domestic and foreign literature. Despite the high efficacy of radiotherapy this branch of oncology is not financed enough in most countries. As a consequence, it is ubiquitously marked radiotherapy capacity deficit that does not allow to fully realize its therapeutic potential. Medical electron accelerators and related equipment have become increasingly complex and expensive and radiotherapy techniques more consuming. Even in developed countries growing waiting times for radiotherapy, not using the most modern and efficient radiotherapy technologies (image guiding, etc.) has become a daily reality. Based on these data, we assessed the prospects and possibilities of upgrading the technical base of radiation oncology in Russia including the development of hadron therapy.

  9. Robot-assisted surgery in gynecological oncology

    DEFF Research Database (Denmark)

    Kristensen, Steffen E; Mosgaard, Berit J; Rosendahl, Mikkel

    2017-01-01

    INTRODUCTION: Robot-assisted surgery has become more widespread in gynecological oncology. The purpose of this systematic review is to present current knowledge on robot-assisted surgery, and to clarify and discuss controversies that have arisen alongside the development and deployment. MATERIAL...... AND METHODS: A database search in PubMed and EMBASE was performed up until 4 March 2016. The search strategy was developed in collaboration with an information specialist, and by application of the PRISMA guidelines. Human participants and English language were the only restrictive filters applied. Selection...... was performed by screening of titles and abstracts, and by full text scrutiny. From 2001 to 2016, a total of 76 references were included. RESULTS: Robot-assisted surgery in gynecological oncology has increased, and current knowledge supports that the oncological safety is similar, compared with previous...

  10. The Servier oncology pipeline in 2017.

    Science.gov (United States)

    Therasse, Patrick; Perron, Beatrice; Novack, Sarah A; Abastado, Jean-Pierre

    2017-07-01

    Cancer is a complex, multifactorial disease that for years has been the focus of intensive research efforts to explore both the molecular and biological mechanisms involved and the development of novel agents to target these pathways. Servier is an independent French pharmaceutical company with a focus on oncology. Currently, Servier's commercial portfolio includes agents used to treat non-Hodgkin's lymphoma and metastatic colorectal cancer; Servier's oncology pipeline involves agents for the treatment of both solid and hematological tumors. The main areas of future research focus on the development of therapeutics targeting apoptosis or the active immune components involved in tumour development/maintenance. Servier intends to continue its focus on cutting-edge oncology innovation by collaborating with both industry and academia, and maintaining its strong patient-centered approach.

  11. The appearence of the resolved singular hypersurface {x_0}{x_1}-{{x_2}^n} =0 in the classical phase space of the Lie group SU(n)

    CERN Document Server

    Paul, S K; Paul, Samir K.; Sen, Siddhartha

    2002-01-01

    A classical phase space with a suitable symplectic structure is constructed together with functions which have Poisson brackets algebraically identical to the Lie algebra structure of the Lie group SU(n). In this phase space we show that the orbit of the generators corresponding to the simple roots of the Lie algebra give rise to fibres that are complex lines containing spheres. There are n-1 spheres on a fibre and they intersect in exactly the same way as the Cartan matrix of the Lie algebra. This classical phase space bundle,being compact,has a description as a variety.Our construction shows that the variety containing the intersecting spheres is exactly the one obtained by resolving the singularities of the variety {x_0}{x_1}-{{x_2}^n}=0 in {C^3}. A direct connection between this singular variety and the classical phase space corresponding to the Lie group SU(n) is thus established.

  12. Contemporary Trends in Radiation Oncology Resident Research.

    Science.gov (United States)

    Verma, Vivek; Burt, Lindsay; Gimotty, Phyllis A; Ojerholm, Eric

    2016-11-15

    To test the hypothesis that recent resident research productivity might be different than a decade ago, and to provide contemporary information about resident scholarly activity. We compiled a list of radiation oncology residents from the 2 most recent graduating classes (June 2014 and 2015) using the Association of Residents in Radiation Oncology annual directories. We queried the PubMed database for each resident's first-authored publications from postgraduate years (PGY) 2 through 5, plus a 3-month period after residency completion. We abstracted corresponding historical data for 2002 to 2007 from the benchmark publication by Morgan and colleagues (Int J Radiat Oncol Biol Phys 2009;74:1567-1572). We tested the null hypothesis that these 2 samples had the same distribution for number of publications using the Wilcoxon rank-sum test. We explored the association of demographic factors and publication number using multivariable zero-inflated Poisson regression. There were 334 residents publishing 659 eligible first-author publications during residency (range 0-17; interquartile range 0-3; mean 2.0; median 1). The contemporary and historical distributions were significantly different (Presearch (75%). In the historical cohort, half of all articles were published in 3 journals; in contrast, the top half of contemporary publications were spread over 10 journals-most commonly International Journal of Radiation Oncology • Biology • Physics (17%), Practical Radiation Oncology (7%), and Radiation Oncology (4%). Male gender, non-PhD status, and larger residency size were associated with higher number of publications in the multivariable analysis. We observed an increase in first-author publications during training compared with historical data from the mid-2000s. These contemporary figures may be useful to medical students considering radiation oncology, current residents, training programs, and prospective employers. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Current management of surgical oncologic emergencies.

    Directory of Open Access Journals (Sweden)

    Marianne R F Bosscher

    Full Text Available For some oncologic emergencies, surgical interventions are necessary for dissolution or temporary relieve. In the absence of guidelines, the most optimal method for decision making would be in a multidisciplinary cancer conference (MCC. In an acute setting, the opportunity for multidisciplinary discussion is often not available. In this study, the management and short term outcome of patients after surgical oncologic emergency consultation was analyzed.A prospective registration and follow up of adult patients with surgical oncologic emergencies between 01-11-2013 and 30-04-2014. The follow up period was 30 days.In total, 207 patients with surgical oncologic emergencies were included. Postoperative wound infections, malignant obstruction, and clinical deterioration due to progressive disease were the most frequent conditions for surgical oncologic emergency consultation. During the follow up period, 40% of patients underwent surgery. The median number of involved medical specialties was two. Only 30% of all patients were discussed in a MCC within 30 days after emergency consultation, and only 41% of the patients who underwent surgery were discussed in a MCC. For 79% of these patients, the surgical procedure was performed before the MCC. Mortality within 30 days was 13%.In most cases, surgery occurred without discussing the patient in a MCC, regardless of the fact that multiple medical specialties were involved in the treatment process. There is a need for prognostic aids and acute oncology pathways with structural multidisciplinary management. These will provide in faster institution of the most appropriate personalized cancer care, and prevent unnecessary investigations or invasive therapy.

  14. Integrated biophotonics in endoscopic oncology

    Science.gov (United States)

    Muguruma, Naoki; DaCosta, Ralph S.; Wilson, Brian C.; Marcon, Norman E.

    2009-02-01

    endoscopic diagnosis is likely to be impacted by a combination of biomarkers and technology, and 'endoscopic molecular imaging' should be defined as "visualization of molecular characteristics with endoscopy". These innovations will allow us not only to locate a tumor or dysplastic lesion but also to visualize its molecular characteristics (e.g., DNA mutations and polymorphisms, gene and/or protein expression), and the activity of specific molecules and biological processes that affect tumor behavior and/or its response to therapy. In the near future, these methods should be promising technologies that will play a central role in gastrointestinal oncology.

  15. Trend in coral-algal phase shift in the Mandapam group of islands, Gulf of Mannar Marine Biosphere Reserve, India

    Science.gov (United States)

    Machendiranathan, M.; Senthilnathan, L.; Ranith, R.; Saravanakumar, A.; Thangaradjou, T.; Choudhry, S. B.; Sasamal, S. K.

    2016-12-01

    The present study revealed proliferation of macro-algae modifying coral reef ecosystems in a different manner due to diseases and sedimentations in the Mandapam group of islands in the Gulf of Mannar. Benthic surveys were conducted with major attack of seven coral reefs diseases with high sedimentation rate, nine species of fleshy macro-algae ( Turbinaria ornata, Turbinaria conaides, Caulerpa scalpelliformis, Caulerpa racemosa, Kappaphycus alvarezii, Padina gymnosphora, Sargassu