WorldWideScience

Sample records for omp1 gene detected

  1. Application of virtual phase-shifting speckle-interferometry for detection of polymorphism in the Chlamydia trachomatis omp1 gene

    Science.gov (United States)

    Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.

    2018-04-01

    Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.

  2. Statistics on gene-based laser speckles with a small number of scatterers: implications for the detection of polymorphism in the Chlamydia trachomatis omp1 gene

    Science.gov (United States)

    Ulyanov, Sergey S.; Ulianova, Onega V.; Zaytsev, Sergey S.; Saltykov, Yury V.; Feodorova, Valentina A.

    2018-04-01

    The transformation mechanism for a nucleotide sequence of the Chlamydia trachomatis gene into a speckle pattern has been considered. The first and second-order statistics of gene-based speckles have been analyzed. It has been demonstrated that gene-based speckles do not obey Gaussian statistics and belong to the class of speckles with a small number of scatterers. It has been shown that gene polymorphism can be easily detected through analysis of the statistical characteristics of gene-based speckles.

  3. [Advances and strategies in gene doping detection].

    Science.gov (United States)

    He, Jiangang; Liu, Zhen; Liu, Jing; Dou, Peng; Chen, Hong-Yuan

    2008-07-01

    This review surveys the recent status of gene doping detection and the strategies for anti-gene doping. The main gene doping candidates for athletes are summarized, and the advances in the detection of the proteins expressed by these genes such as erythropoietin (EPO) and human growth hormone (hGH) are reviewed. The potential detection strategies for further gene doping analysis are also discussed.

  4. Developing strategies for detection of gene doping.

    Science.gov (United States)

    Baoutina, Anna; Alexander, Ian E; Rasko, John E J; Emslie, Kerry R

    2008-01-01

    It is feared that the use of gene transfer technology to enhance athletic performance, the practice that has received the term 'gene doping', may soon become a real threat to the world of sport. As recognised by the anti-doping community, gene doping, like doping in any form, undermines principles of fair play in sport and most importantly, involves major health risks to athletes who partake in gene doping. One attraction of gene doping for such athletes and their entourage lies in the apparent difficulty of detecting its use. Since the realisation of the threat of gene doping to sport in 2001, the anti-doping community and scientists from different disciplines concerned with potential misuse of gene therapy technologies for performance enhancement have focused extensive efforts on developing robust methods for gene doping detection which could be used by the World Anti-Doping Agency to monitor athletes and would meet the requirements of a legally defensible test. Here we review the approaches and technologies which are being evaluated for the detection of gene doping, as well as for monitoring the efficacy of legitimate gene therapy, in relation to the detection target, the type of sample required for analysis and detection methods. We examine the accumulated knowledge on responses of the body, at both cellular and systemic levels, to gene transfer and evaluate strategies for gene doping detection based on current knowledge of gene technology, immunology, transcriptomics, proteomics, biochemistry and physiology. (c) 2008 John Wiley & Sons, Ltd.

  5. Detection of EPO gene doping in blood.

    Science.gov (United States)

    Neuberger, Elmo W I; Jurkiewicz, Magdalena; Moser, Dirk A; Simon, Perikles

    2012-11-01

    Gene doping--or the abuse of gene therapy--will continue to threaten the sports world. History has shown that progress in medical research is likely to be abused in order to enhance human performance. In this review, we critically discuss the progress and the risks associated with the field of erythropoietin (EPO) gene therapy and its applicability to EPO gene doping. We present typical vector systems that are employed in ex vivo and in vivo gene therapy trials. Due to associated risks, gene doping is not a feasible alternative to conventional EPO or blood doping at this time. Nevertheless, it is well described that about half of the elite athlete population is in principle willing to risk its health to gain a competitive advantage. This includes the use of technologies that lack safety approval. Sophisticated detection approaches are a prerequisite for prevention of unapproved and uncontrolled use of gene therapy technology. In this review, we present current detection approaches for EPO gene doping, with a focus on blood-based direct and indirect approaches. Gene doping is detectable in principle, and recent DNA-based detection strategies enable long-term detection of transgenic DNA (tDNA) following in vivo gene transfer. Copyright © 2012 John Wiley & Sons, Ltd.

  6. [Current status and prospects of gene doping detection].

    Science.gov (United States)

    Wang, Wenjun; Zhang, Sichun; Xu, Jingjuan; Xia, Xinghua; Tian, Yaping; Zhang, Xinrong; Chen, Hong-Yuan

    2008-07-01

    The fast development of biotechnology promotes the development of doping. From recombinant protein to gene doping, there is a great challenge to their detection. The improvement of gene therapy and potential to enhance athletic performance open the door for gene doping. After a brief introduction of the concept of gene doping, the current status and prospects of gene doping detection are reviewed.

  7. Research progress in machine learning methods for gene-gene interaction detection.

    Science.gov (United States)

    Peng, Zhe-Ye; Tang, Zi-Jun; Xie, Min-Zhu

    2018-03-20

    Complex diseases are results of gene-gene and gene-environment interactions. However, the detection of high-dimensional gene-gene interactions is computationally challenging. In the last two decades, machine-learning approaches have been developed to detect gene-gene interactions with some successes. In this review, we summarize the progress in research on machine learning methods, as applied to gene-gene interaction detection. It systematically examines the principles and limitations of the current machine learning methods used in genome wide association studies (GWAS) to detect gene-gene interactions, such as neural networks (NN), random forest (RF), support vector machines (SVM) and multifactor dimensionality reduction (MDR), and provides some insights on the future research directions in the field.

  8. [Gene doping: gene transfer and possible molecular detection].

    Science.gov (United States)

    Argüelles, Carlos Francisco; Hernández-Zamora, Edgar

    2007-01-01

    The use of illegal substances in sports to enhance athletic performance during competition has caused international sports organizations such as the COI and WADA to take anti doping measures. A new doping method know as gene doping is defined as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". However, gene doping in sports is not easily identified and can cause serious consequences. Molecular biology techniques are needed in order to distinguish the difference between a "normal" and an "altered" genome. Further, we need to develop new analytic methods and biological molecular techniques in anti-doping laboratories, and design programs that avoid the non therapeutic use of genes.

  9. Gene doping detection: evaluation of approach for direct detection of gene transfer using erythropoietin as a model system.

    Science.gov (United States)

    Baoutina, A; Coldham, T; Bains, G S; Emslie, K R

    2010-08-01

    As clinical gene therapy has progressed toward realizing its potential, concern over misuse of the technology to enhance performance in athletes is growing. Although 'gene doping' is banned by the World Anti-Doping Agency, its detection remains a major challenge. In this study, we developed a methodology for direct detection of the transferred genetic material and evaluated its feasibility for gene doping detection in blood samples from athletes. Using erythropoietin (EPO) as a model gene and a simple in vitro system, we developed real-time PCR assays that target sequences within the transgene complementary DNA corresponding to exon/exon junctions. As these junctions are absent in the endogenous gene due to their interruption by introns, the approach allows detection of trace amounts of a transgene in a large background of the endogenous gene. Two developed assays and one commercial gene expression assay for EPO were validated. On the basis of ability of these assays to selectively amplify transgenic DNA and analysis of literature on testing of gene transfer in preclinical and clinical gene therapy, it is concluded that the developed approach would potentially be suitable to detect gene doping through gene transfer by analysis of small volumes of blood using regular out-of-competition testing.

  10. A review for detecting gene-gene interactions using machine learning methods in genetic epidemiology.

    Science.gov (United States)

    Koo, Ching Lee; Liew, Mei Jing; Mohamad, Mohd Saberi; Salleh, Abdul Hakim Mohamed

    2013-01-01

    Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs), support vector machine (SVM), and random forests (RFs) in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.

  11. Efficient strategy for detecting gene × gene joint action and its application in schizophrenia

    NARCIS (Netherlands)

    Won, Sungho; Kwon, Min-Seok; Mattheisen, Manuel; Park, Suyeon; Park, Changsoon; Kihara, Daisuke; Cichon, Sven; Ophoff, Roel; Nöthen, Markus M.; Rietschel, Marcella; Baur, Max; Uitterlinden, Andre G.; Hofmann, A.; Lange, Christoph; Kahn, René S.; Linszen, Don H.; van Os, Jim; Wiersma, Durk; Bruggeman, Richard; Cahn, Wiepke; de Haan, Lieuwe; Krabbendam, Lydia; Myin-Germeys, Inez

    2014-01-01

    We propose a new approach to detect gene × gene joint action in genome-wide association studies (GWASs) for case-control designs. This approach offers an exhaustive search for all two-way joint action (including, as a special case, single gene action) that is computationally feasible at the

  12. Detection of virulence-associated genes in Brucella melitensis ...

    African Journals Online (AJOL)

    The current study involved detection of three virulence genes (bvfA, virB, ure) by PCR in 52 isolates of Brucella melitensis biovar 3, recovered from different animal species (28 sheep, 10 goats, 9 cattle and 5 buffaloes). Of the 52 B. melitensis strains; 48 (92.3%) isolates carried bvfA genes, 51 (98.1%) isolates had virB genes ...

  13. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  14. A powerful score-based test statistic for detecting gene-gene co-association.

    Science.gov (United States)

    Xu, Jing; Yuan, Zhongshang; Ji, Jiadong; Zhang, Xiaoshuai; Li, Hongkai; Wu, Xuesen; Xue, Fuzhong; Liu, Yanxun

    2016-01-29

    The genetic variants identified by Genome-wide association study (GWAS) can only account for a small proportion of the total heritability for complex disease. The existence of gene-gene joint effects which contains the main effects and their co-association is one of the possible explanations for the "missing heritability" problems. Gene-gene co-association refers to the extent to which the joint effects of two genes differ from the main effects, not only due to the traditional interaction under nearly independent condition but the correlation between genes. Generally, genes tend to work collaboratively within specific pathway or network contributing to the disease and the specific disease-associated locus will often be highly correlated (e.g. single nucleotide polymorphisms (SNPs) in linkage disequilibrium). Therefore, we proposed a novel score-based statistic (SBS) as a gene-based method for detecting gene-gene co-association. Various simulations illustrate that, under different sample sizes, marginal effects of causal SNPs and co-association levels, the proposed SBS has the better performance than other existed methods including single SNP-based and principle component analysis (PCA)-based logistic regression model, the statistics based on canonical correlations (CCU), kernel canonical correlation analysis (KCCU), partial least squares path modeling (PLSPM) and delta-square (δ (2)) statistic. The real data analysis of rheumatoid arthritis (RA) further confirmed its advantages in practice. SBS is a powerful and efficient gene-based method for detecting gene-gene co-association.

  15. Detection of Gene Interactions Based on Syntactic Relations

    Directory of Open Access Journals (Sweden)

    Mi-Young Kim

    2008-01-01

    Full Text Available Interactions between proteins and genes are considered essential in the description of biomolecular phenomena, and networks of interactions are applied in a system's biology approach. Recently, many studies have sought to extract information from biomolecular text using natural language processing technology. Previous studies have asserted that linguistic information is useful for improving the detection of gene interactions. In particular, syntactic relations among linguistic information are good for detecting gene interactions. However, previous systems give a reasonably good precision but poor recall. To improve recall without sacrificing precision, this paper proposes a three-phase method for detecting gene interactions based on syntactic relations. In the first phase, we retrieve syntactic encapsulation categories for each candidate agent and target. In the second phase, we construct a verb list that indicates the nature of the interaction between pairs of genes. In the last phase, we determine direction rules to detect which of two genes is the agent or target. Even without biomolecular knowledge, our method performs reasonably well using a small training dataset. While the first phase contributes to improve recall, the second and third phases contribute to improve precision. In the experimental results using ICML 05 Workshop on Learning Language in Logic (LLL05 data, our proposed method gave an F-measure of 67.2% for the test data, significantly outperforming previous methods. We also describe the contribution of each phase to the performance.

  16. Detecting Horizontal Gene Transfer between Closely Related Taxa.

    Directory of Open Access Journals (Sweden)

    Orit Adato

    2015-10-01

    Full Text Available Horizontal gene transfer (HGT, the transfer of genetic material between organisms, is crucial for genetic innovation and the evolution of genome architecture. Existing HGT detection algorithms rely on a strong phylogenetic signal distinguishing the transferred sequence from ancestral (vertically derived genes in its recipient genome. Detecting HGT between closely related species or strains is challenging, as the phylogenetic signal is usually weak and the nucleotide composition is normally nearly identical. Nevertheless, there is a great importance in detecting HGT between congeneric species or strains, especially in clinical microbiology, where understanding the emergence of new virulent and drug-resistant strains is crucial, and often time-sensitive. We developed a novel, self-contained technique named Near HGT, based on the synteny index, to measure the divergence of a gene from its native genomic environment and used it to identify candidate HGT events between closely related strains. The method confirms candidate transferred genes based on the constant relative mutability (CRM. Using CRM, the algorithm assigns a confidence score based on "unusual" sequence divergence. A gene exhibiting exceptional deviations according to both synteny and mutability criteria, is considered a validated HGT product. We first employed the technique to a set of three E. coli strains and detected several highly probable horizontally acquired genes. We then compared the method to existing HGT detection tools using a larger strain data set. When combined with additional approaches our new algorithm provides richer picture and brings us closer to the goal of detecting all newly acquired genes in a particular strain.

  17. Development of a universal RNA beacon for exogenous gene detection.

    Science.gov (United States)

    Guo, Yuanjian; Lu, Zhongju; Cohen, Ira Stephen; Scarlata, Suzanne

    2015-05-01

    Stem cell therapy requires a nontoxic and high-throughput method to achieve a pure cell population to prevent teratomas that can occur if even one cell in the implant has not been transformed. A promising method to detect and separate cells expressing a particular gene is RNA beacon technology. However, developing a successful, specific beacon to a particular transfected gene can take months to develop and in some cases is impossible. Here, we report on an off-the-shelf universal beacon that decreases the time and cost of applying beacon technology to select any living cell population transfected with an exogenous gene. ©AlphaMed Press.

  18. A Review for Detecting Gene-Gene Interactions Using Machine Learning Methods in Genetic Epidemiology

    Directory of Open Access Journals (Sweden)

    Ching Lee Koo

    2013-01-01

    Full Text Available Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs, support vector machine (SVM, and random forests (RFs in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.

  19. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Science.gov (United States)

    2010-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...

  20. A functional gene array for detection of bacterial virulence elements

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C

    2007-11-01

    We report our development of the first of a series of microarrays designed to detect pathogens with known mechanisms of virulence and antibiotic resistance. By targeting virulence gene families as well as genes unique to specific biothreat agents, these arrays will provide important data about the pathogenic potential and drug resistance profiles of unknown organisms in environmental samples. To validate our approach, we developed a first generation array targeting genes from Escherichia coli strains K12 and CFT073, Enterococcus faecalis and Staphylococcus aureus. We determined optimal probe design parameters for microorganism detection and discrimination, measured the required target concentration, and assessed tolerance for mismatches between probe and target sequences. Mismatch tolerance is a priority for this application, due to DNA sequence variability among members of gene families. Arrays were created using the NimbleGen Maskless Array Synthesizer at Lawrence Livermore National Laboratory. Purified genomic DNA from combinations of one or more of the four target organisms, pure cultures of four related organisms, and environmental aerosol samples with spiked-in genomic DNA were hybridized to the arrays. Based on the success of this prototype, we plan to design further arrays in this series, with the goal of detecting all known virulence and antibiotic resistance gene families in a greatly expanded set of organisms.

  1. Combination of PCR targeting the VD2 of omp1 and reverse line blot analysis for typing of urogenital Chlamydia trachomatis serovars in cervical scrape specimens.

    NARCIS (Netherlands)

    Molano, M; Meijer, C.J.L.M.; Morre, S.A.; Pol, R; Brule, van den AJ

    2004-01-01

    50% contained both serovars D and E. The nested VD2 PCR-RLB developed is a simple, fast, and specific method for the identification of individual urogenital C. trachomatis serovars previously detected by using plasmid PCR. Moreover, it is an appropriate method for studying multiple C. trachomatis

  2. Efficient strategy for detecting gene × gene joint action and its application in schizophrenia.

    Science.gov (United States)

    Won, Sungho; Kwon, Min-Seok; Mattheisen, Manuel; Park, Suyeon; Park, Changsoon; Kihara, Daisuke; Cichon, Sven; Ophoff, Roel; Nöthen, Markus M; Rietschel, Marcella; Baur, Max; Uitterlinden, Andre G; Hofmann, A; Lange, Christoph

    2014-01-01

    We propose a new approach to detect gene × gene joint action in genome-wide association studies (GWASs) for case-control designs. This approach offers an exhaustive search for all two-way joint action (including, as a special case, single gene action) that is computationally feasible at the genome-wide level and has reasonable statistical power under most genetic models. We found that the presence of any gene × gene joint action may imply differences in three types of genetic components: the minor allele frequencies and the amounts of Hardy-Weinberg disequilibrium may differ between cases and controls, and between the two genetic loci the degree of linkage disequilibrium may differ between cases and controls. Using Fisher's method, it is possible to combine the different sources of genetic information in an overall test for detecting gene × gene joint action. The proposed statistical analysis is efficient and its simplicity makes it applicable to GWASs. In the current study, we applied the proposed approach to a GWAS on schizophrenia and found several potential gene × gene interactions. Our application illustrates the practical advantage of the proposed method. © 2013 WILEY PERIODICALS, INC.

  3. Molecular detection of carbapenemase-producing genes in referral ...

    African Journals Online (AJOL)

    Molecular confirmation of carbapenemase-producing Enterobacteriaceae (CPE) was introduced in South Africa (SA) at the end of 2011. We report on the detection of these resistance genes based on referral isolates. Enterobacteriaceae with non-susceptibility to any of the carbapenems according to defined criteria for ...

  4. PCR-based detection of gene transfer vectors: application to gene doping surveillance.

    Science.gov (United States)

    Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

    2013-12-01

    Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

  5. Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

    Directory of Open Access Journals (Sweden)

    Henrich Birgit

    2008-04-01

    Full Text Available Abstract Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1 -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies.

  6. Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

    Science.gov (United States)

    Schaeffer, Anke; Henrich, Birgit

    2008-01-01

    Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1) -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H) -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies. PMID:18447917

  7. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2015-07-01

    Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

  8. Detection of Horizontal Gene Transfers from Phylogenetic Comparisons

    Science.gov (United States)

    Pylro, Victor Satler; Vespoli, Luciano de Souza; Duarte, Gabriela Frois; Yotoko, Karla Suemy Clemente

    2012-01-01

    Bacterial phylogenies have become one of the most important challenges for microbial ecology. This field started in the mid-1970s with the aim of using the sequence of the small subunit ribosomal RNA (16S) tool to infer bacterial phylogenies. Phylogenetic hypotheses based on other sequences usually give conflicting topologies that reveal different evolutionary histories, which in some cases may be the result of horizontal gene transfer events. Currently, one of the major goals of molecular biology is to understand the role that horizontal gene transfer plays in species adaptation and evolution. In this work, we compared the phylogenetic tree based on 16S with the tree based on dszC, a gene involved in the cleavage of carbon-sulfur bonds. Bacteria of several genera perform this survival task when living in environments lacking free mineral sulfur. The biochemical pathway of the desulphurization process was extensively studied due to its economic importance, since this step is expensive and indispensable in fuel production. Our results clearly show that horizontal gene transfer events could be detected using common phylogenetic methods with gene sequences obtained from public sequence databases. PMID:22675653

  9. Detection of biosurfactants in Bacillus species: genes and products identification.

    Science.gov (United States)

    Płaza, G; Chojniak, J; Rudnicka, K; Paraszkiewicz, K; Bernat, P

    2015-10-01

    To screen environmental Bacillus strains for detection of genes encoding the enzymes involved in biosurfactant synthesis and to evaluate their products e.g. surfactin, iturin and fengycin. The taxonomic identification of isolated from the environment Bacillus strains was performed by Microgene ID Bacillus panel and GEN III Biolog system. The polymerase chain reaction (PCR) strategy for screening of genes in Bacillus strains was set up. Liquid chromatography-mass spectrometry (LC-MS/MS) method was used for the identification of lipopeptides (LPs). All studied strains exhibited the presence of srfAA gene and produced surfactin mostly as four homologues (C13 to C16). Moreover, in 2 strains (KP7, T'-1) simultaneous co-production of 3 biosurfactants: surfactin, iturin and fengycin was observed. Additionally, it was found out that isolate identified as Bacillus subtilis ssp. subtilis (KP7), beside LPs co-production, synthesizes surfactin with the efficiency much higher than other studied strains (40·2 mg l(-1) ) and with the yield ranging from 0·8 to 8·3 mg l(-1) . We showed that the combined methodology based on PCR and LC-MS/MS technique is an optimal tool for the detection of genes encoding enzymes involved in biosurfactant synthesis as well as their products, e.g. surfactin, iturin and fengycin. This approach improves the screening and the identification of environmental Bacillus co-producing biosurfactants-stimulating and facilitating the development of this area of science. The findings of this work will help to improve screening of biosurfactant producers. Discovery of novel biosurfactants and biosurfactants co-production ability has shed light on their new application fields and for the understanding of their interactions and properties. © 2015 The Society for Applied Microbiology.

  10. Association testing to detect gene-gene interactions on sex chromosomes in trio data

    Directory of Open Access Journals (Sweden)

    Yeonok eLee

    2013-11-01

    Full Text Available Autism Spectrum Disorder (ASD occurs more often among males than females in a 4:1 ratio. Among theories used to explain the causes of ASD, the X chromosome and the Y chromosome theories attribute ASD to X-linked mutation and the male-limited gene expressions on the Y chromosome, respectively. Despite the rationale of the theory, studies have failed to attribute the sex-biased ratio to the significant linkage or association on the regions of interest on X chromosome. We further study the gender biased ratio by examining the possible interaction effects between two genes in the sex chromosomes. We propose a logistic regression model with mixed effects to detect gene-gene interactions on sex chromosomes. We investigated the power and type I error rates of the approach for a range of minor allele frequencies and varying linkage disequilibrium between markers and QTLs. We also evaluated the robustness of the model to population stratification. We applied the model to a trio-family data set with an ASD affected male child to study gene-gene interactions on sex chromosomes.

  11. Gene-wide analysis detects two new susceptibility genes for Alzheimer's disease.

    Science.gov (United States)

    Escott-Price, Valentina; Bellenguez, Céline; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Jones, Lesley; Holmans, Peter; Gerrish, Amy; Vedernikov, Alexey; Richards, Alexander; DeStefano, Anita L; Lambert, Jean-Charles; Ibrahim-Verbaas, Carla A; Naj, Adam C; Sims, Rebecca; Jun, Gyungah; Bis, Joshua C; Beecham, Gary W; Grenier-Boley, Benjamin; Russo, Giancarlo; Thornton-Wells, Tricia A; Denning, Nicola; Smith, Albert V; Chouraki, Vincent; Thomas, Charlene; Ikram, M Arfan; Zelenika, Diana; Vardarajan, Badri N; Kamatani, Yoichiro; Lin, Chiao-Feng; Schmidt, Helena; Kunkle, Brian; Dunstan, Melanie L; Vronskaya, Maria; Johnson, Andrew D; Ruiz, Agustin; Bihoreau, Marie-Thérèse; Reitz, Christiane; Pasquier, Florence; Hollingworth, Paul; Hanon, Olivier; Fitzpatrick, Annette L; Buxbaum, Joseph D; Campion, Dominique; Crane, Paul K; Baldwin, Clinton; Becker, Tim; Gudnason, Vilmundur; Cruchaga, Carlos; Craig, David; Amin, Najaf; Berr, Claudine; Lopez, Oscar L; De Jager, Philip L; Deramecourt, Vincent; Johnston, Janet A; Evans, Denis; Lovestone, Simon; Letenneur, Luc; Hernández, Isabel; Rubinsztein, David C; Eiriksdottir, Gudny; Sleegers, Kristel; Goate, Alison M; Fiévet, Nathalie; Huentelman, Matthew J; Gill, Michael; Brown, Kristelle; Kamboh, M Ilyas; Keller, Lina; Barberger-Gateau, Pascale; McGuinness, Bernadette; Larson, Eric B; Myers, Amanda J; Dufouil, Carole; Todd, Stephen; Wallon, David; Love, Seth; Rogaeva, Ekaterina; Gallacher, John; George-Hyslop, Peter St; Clarimon, Jordi; Lleo, Alberto; Bayer, Anthony; Tsuang, Debby W; Yu, Lei; Tsolaki, Magda; Bossù, Paola; Spalletta, Gianfranco; Proitsi, Petra; Collinge, John; Sorbi, Sandro; Garcia, Florentino Sanchez; Fox, Nick C; Hardy, John; Naranjo, Maria Candida Deniz; Bosco, Paolo; Clarke, Robert; Brayne, Carol; Galimberti, Daniela; Scarpini, Elio; Bonuccelli, Ubaldo; Mancuso, Michelangelo; Siciliano, Gabriele; Moebus, Susanne; Mecocci, Patrizia; Zompo, Maria Del; Maier, Wolfgang; Hampel, Harald; Pilotto, Alberto; Frank-García, Ana; Panza, Francesco; Solfrizzi, Vincenzo; Caffarra, Paolo; Nacmias, Benedetta; Perry, William; Mayhaus, Manuel; Lannfelt, Lars; Hakonarson, Hakon; Pichler, Sabrina; Carrasquillo, Minerva M; Ingelsson, Martin; Beekly, Duane; Alvarez, Victoria; Zou, Fanggeng; Valladares, Otto; Younkin, Steven G; Coto, Eliecer; Hamilton-Nelson, Kara L; Gu, Wei; Razquin, Cristina; Pastor, Pau; Mateo, Ignacio; Owen, Michael J; Faber, Kelley M; Jonsson, Palmi V; Combarros, Onofre; O'Donovan, Michael C; Cantwell, Laura B; Soininen, Hilkka; Blacker, Deborah; Mead, Simon; Mosley, Thomas H; Bennett, David A; Harris, Tamara B; Fratiglioni, Laura; Holmes, Clive; de Bruijn, Renee F A G; Passmore, Peter; Montine, Thomas J; Bettens, Karolien; Rotter, Jerome I; Brice, Alexis; Morgan, Kevin; Foroud, Tatiana M; Kukull, Walter A; Hannequin, Didier; Powell, John F; Nalls, Michael A; Ritchie, Karen; Lunetta, Kathryn L; Kauwe, John S K; Boerwinkle, Eric; Riemenschneider, Matthias; Boada, Mercè; Hiltunen, Mikko; Martin, Eden R; Schmidt, Reinhold; Rujescu, Dan; Dartigues, Jean-François; Mayeux, Richard; Tzourio, Christophe; Hofman, Albert; Nöthen, Markus M; Graff, Caroline; Psaty, Bruce M; Haines, Jonathan L; Lathrop, Mark; Pericak-Vance, Margaret A; Launer, Lenore J; Van Broeckhoven, Christine; Farrer, Lindsay A; van Duijn, Cornelia M; Ramirez, Alfredo; Seshadri, Sudha; Schellenberg, Gerard D; Amouyel, Philippe; Williams, Julie

    2014-01-01

    Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over 7 m genotypes from 25,580 Alzheimer's cases and 48,466 controls. In addition to earlier reported genes, we detected genome-wide significant loci on chromosomes 8 (TP53INP1, p = 1.4×10-6) and 14 (IGHV1-67 p = 7.9×10-8) which indexed novel susceptibility loci. The additional genes identified in this study, have an array of functions previously implicated in Alzheimer's disease, including aspects of energy metabolism, protein degradation and the immune system and add further weight to these pathways as potential therapeutic targets in Alzheimer's disease.

  12. Gene-wide analysis detects two new susceptibility genes for Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Valentina Escott-Price

    Full Text Available Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over 7 m genotypes from 25,580 Alzheimer's cases and 48,466 controls.In addition to earlier reported genes, we detected genome-wide significant loci on chromosomes 8 (TP53INP1, p = 1.4×10-6 and 14 (IGHV1-67 p = 7.9×10-8 which indexed novel susceptibility loci.The additional genes identified in this study, have an array of functions previously implicated in Alzheimer's disease, including aspects of energy metabolism, protein degradation and the immune system and add further weight to these pathways as potential therapeutic targets in Alzheimer's disease.

  13. Detecting negative selection on recurrent mutations using gene genealogy

    Science.gov (United States)

    2013-01-01

    Background Whether or not a mutant allele in a population is under selection is an important issue in population genetics, and various neutrality tests have been invented so far to detect selection. However, detection of negative selection has been notoriously difficult, partly because negatively selected alleles are usually rare in the population and have little impact on either population dynamics or the shape of the gene genealogy. Recently, through studies of genetic disorders and genome-wide analyses, many structural variations were shown to occur recurrently in the population. Such “recurrent mutations” might be revealed as deleterious by exploiting the signal of negative selection in the gene genealogy enhanced by their recurrence. Results Motivated by the above idea, we devised two new test statistics. One is the total number of mutants at a recurrently mutating locus among sampled sequences, which is tested conditionally on the number of forward mutations mapped on the sequence genealogy. The other is the size of the most common class of identical-by-descent mutants in the sample, again tested conditionally on the number of forward mutations mapped on the sequence genealogy. To examine the performance of these two tests, we simulated recurrently mutated loci each flanked by sites with neutral single nucleotide polymorphisms (SNPs), with no recombination. Using neutral recurrent mutations as null models, we attempted to detect deleterious recurrent mutations. Our analyses demonstrated high powers of our new tests under constant population size, as well as their moderate power to detect selection in expanding populations. We also devised a new maximum parsimony algorithm that, given the states of the sampled sequences at a recurrently mutating locus and an incompletely resolved genealogy, enumerates mutation histories with a minimum number of mutations while partially resolving genealogical relationships when necessary. Conclusions With their

  14. Random regression models for detection of gene by environment interaction

    Directory of Open Access Journals (Sweden)

    Meuwissen Theo HE

    2007-02-01

    Full Text Available Abstract Two random regression models, where the effect of a putative QTL was regressed on an environmental gradient, are described. The first model estimates the correlation between intercept and slope of the random regression, while the other model restricts this correlation to 1 or -1, which is expected under a bi-allelic QTL model. The random regression models were compared to a model assuming no gene by environment interactions. The comparison was done with regards to the models ability to detect QTL, to position them accurately and to detect possible QTL by environment interactions. A simulation study based on a granddaughter design was conducted, and QTL were assumed, either by assigning an effect independent of the environment or as a linear function of a simulated environmental gradient. It was concluded that the random regression models were suitable for detection of QTL effects, in the presence and absence of interactions with environmental gradients. Fixing the correlation between intercept and slope of the random regression had a positive effect on power when the QTL effects re-ranked between environments.

  15. From gene engineering to gene modulation and manipulation: can we prevent or detect gene doping in sports?

    Science.gov (United States)

    Fischetto, Giuseppe; Bermon, Stéphane

    2013-10-01

    -carboxamide 1-β-D-ribofuranoside (AICAR), GW1516], might concomitantly improve endurance exercise capacity in ischaemic conditions but also in normal conditions. Undoubtedly, some athletes will attempt to take advantage of these new molecules to increase strength or endurance. Antidoping laboratories are improving detection methods. These are based both on direct identification of new substances or their metabolites and on indirect evaluation of changes in gene, protein or metabolite patterns (genomics, proteomics or metabolomics).

  16. Molecular detection of TasA gene in endophytic Bacillus species ...

    African Journals Online (AJOL)

    Molecular detection of TasA gene in endophytic Bacillus species and characterization of the gene in Bacillus amyloliquefaciens. ... African Journal of Biotechnology ... in Bacillus amyloliquefaciens PEBA20 and 7 strains of Bacillus subtilis, ...

  17. Functional validation of candidate genes detected by genomic feature models

    DEFF Research Database (Denmark)

    Rohde, Palle Duun; Østergaard, Solveig; Kristensen, Torsten Nygaard

    2018-01-01

    Understanding the genetic underpinnings of complex traits requires knowledge of the genetic variants that contribute to phenotypic variability. Reliable statistical approaches are needed to obtain such knowledge. In genome-wide association studies, variants are tested for association with trait...... then functionally assessed whether the identified candidate genes affected locomotor activity by reducing gene expression using RNA interference. In five of the seven candidate genes tested, reduced gene expression altered the phenotype. The ranking of genes within the predictive GO term was highly correlated...

  18. Development of Ecogenomic Sensors for Remote Detection of Marine Microbes, Their Genes and Gene Products

    Science.gov (United States)

    Scholin, C.; Preston, C.; Harris, A.; Birch, J.; Marin, R.; Jensen, S.; Roman, B.; Everlove, C.; Makarewicz, A.; Riot, V.; Hadley, D.; Benett, W.; Dzenitis, J.

    2008-12-01

    An internet search using the phrase "ecogenomic sensor" will return numerous references that speak broadly to the idea of detecting molecular markers indicative of specific organisms, genes or other biomarkers within an environmental context. However, a strict and unified definition of "ecogenomic sensor" is lacking and the phrase may be used for laboratory-based tools and techniques as well as semi or fully autonomous systems that can be deployed outside of laboratory. We are exploring development of an ecogenomic sensor from the perspective of a field-portable device applied towards oceanographic research and water quality monitoring. The device is known as the Environmental Sample Processor, or ESP. The ESP employs wet chemistry molecular analytical techniques to autonomously assess the presence and abundance of specific organisms, their genes and/or metabolites in near real-time. Current detection chemistries rely on low- density DNA probe and protein arrays. This presentation will emphasize results from 2007-8 field trials when the ESP was moored in Monterey Bay, CA, as well as current engineering activities for improving analytical capacity of the instrument. Changes in microbial community structure at the rRNA level were observed remotely in accordance with changing chemical and physical oceanographic conditions. Current developments include incorporation of a reusable solid phase extraction column for purifying nucleic acids and a 4-channel real-time PCR module. Users can configure this system to support a variety of PCR master mixes, primer/probe combinations and control templates. An update on progress towards fielding a PCR- enabled ESP will be given along with an outline of plans for its use in coastal and oligotrophic oceanic regimes.

  19. Functional validation of candidate genes detected by genomic feature models

    DEFF Research Database (Denmark)

    Rohde, Palle Duun; Østergaard, Solveig; Kristensen, Torsten Nygaard

    2018-01-01

    to investigate locomotor activity, and applied genomic feature prediction models to identify gene ontology (GO) cate- gories predictive of this phenotype. Next, we applied the covariance association test to partition the genomic variance of the predictive GO terms to the genes within these terms. We...... then functionally assessed whether the identified candidate genes affected locomotor activity by reducing gene expression using RNA interference. In five of the seven candidate genes tested, reduced gene expression altered the phenotype. The ranking of genes within the predictive GO term was highly correlated......Understanding the genetic underpinnings of complex traits requires knowledge of the genetic variants that contribute to phenotypic variability. Reliable statistical approaches are needed to obtain such knowledge. In genome-wide association studies, variants are tested for association with trait...

  20. Detection of drought tolerant genes within seedling apple rootstocks in Syria

    Science.gov (United States)

    This investigation was conducted to detect the drought tolerant genes (four genes) within seedling apple rootstocks derived from five apple genotypes, including Syrian apple cultivars. The results showed that the gene MdPepPro (a cyclophilin) was found in all studied genotypes and their progenies e...

  1. Detection of Lsr2 gene of Mycobacterium leprae in nasal mucus

    Directory of Open Access Journals (Sweden)

    Luiz Antonio Custodio

    2012-06-01

    Full Text Available In the present study, nasal mucus from patients with leprosy were analyzed by PCR using specific primers for Lsr2 gene of Mycobacterium leprae. The presence of Lsr2 gene in the nasal mucus was detected in 25.80% of patients with paucibacillari leprosy, and 23.07% of contacts. Despite the absence of clinical features in the contact individuals, it was possible to detect the presence of Lsr2 gene in the nasal mucus of these individuals. Therefore, PCR detection of M. leprae targeting Lsr2 gene using nasal mucus samples could contribute to early diagnosis of leprosy.

  2. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  3. Genome-Wide Detection and Analysis of Multifunctional Genes

    Science.gov (United States)

    Pritykin, Yuri; Ghersi, Dario; Singh, Mona

    2015-01-01

    Many genes can play a role in multiple biological processes or molecular functions. Identifying multifunctional genes at the genome-wide level and studying their properties can shed light upon the complexity of molecular events that underpin cellular functioning, thereby leading to a better understanding of the functional landscape of the cell. However, to date, genome-wide analysis of multifunctional genes (and the proteins they encode) has been limited. Here we introduce a computational approach that uses known functional annotations to extract genes playing a role in at least two distinct biological processes. We leverage functional genomics data sets for three organisms—H. sapiens, D. melanogaster, and S. cerevisiae—and show that, as compared to other annotated genes, genes involved in multiple biological processes possess distinct physicochemical properties, are more broadly expressed, tend to be more central in protein interaction networks, tend to be more evolutionarily conserved, and are more likely to be essential. We also find that multifunctional genes are significantly more likely to be involved in human disorders. These same features also hold when multifunctionality is defined with respect to molecular functions instead of biological processes. Our analysis uncovers key features about multifunctional genes, and is a step towards a better genome-wide understanding of gene multifunctionality. PMID:26436655

  4. A hybrid network-based method for the detection of disease-related genes

    Science.gov (United States)

    Cui, Ying; Cai, Meng; Dai, Yang; Stanley, H. Eugene

    2018-02-01

    Detecting disease-related genes is crucial in disease diagnosis and drug design. The accepted view is that neighbors of a disease-causing gene in a molecular network tend to cause the same or similar diseases, and network-based methods have been recently developed to identify novel hereditary disease-genes in available biomedical networks. Despite the steady increase in the discovery of disease-associated genes, there is still a large fraction of disease genes that remains under the tip of the iceberg. In this paper we exploit the topological properties of the protein-protein interaction (PPI) network to detect disease-related genes. We compute, analyze, and compare the topological properties of disease genes with non-disease genes in PPI networks. We also design an improved random forest classifier based on these network topological features, and a cross-validation test confirms that our method performs better than previous similar studies.

  5. Robust multi-tissue gene panel for cancer detection

    Directory of Open Access Journals (Sweden)

    Talantov Dmitri

    2010-06-01

    Full Text Available Abstract Background We have identified a set of genes whose relative mRNA expression levels in various solid tumors can be used to robustly distinguish cancer from matching normal tissue. Our current feature set consists of 113 gene probes for 104 unique genes, originally identified as differentially expressed in solid primary tumors in microarray data on Affymetrix HG-U133A platform in five tissue types: breast, colon, lung, prostate and ovary. For each dataset, we first identified a set of genes significantly differentially expressed in tumor vs. normal tissue at p-value = 0.05 using an experimentally derived error model. Our common cancer gene panel is the intersection of these sets of significantly dysregulated genes and can distinguish tumors from normal tissue on all these five tissue types. Methods Frozen tumor specimens were obtained from two commercial vendors Clinomics (Pittsfield, MA and Asterand (Detroit, MI. Biotinylated targets were prepared using published methods (Affymetrix, CA and hybridized to Affymetrix U133A GeneChips (Affymetrix, CA. Expression values for each gene were calculated using Affymetrix GeneChip analysis software MAS 5.0. We then used a software package called Genes@Work for differential expression discovery, and SVM light linear kernel for building classification models. Results We validate the predictability of this gene list on several publicly available data sets generated on the same platform. Of note, when analysing the lung cancer data set of Spira et al, using an SVM linear kernel classifier, our gene panel had 94.7% leave-one-out accuracy compared to 87.8% using the gene panel in the original paper. In addition, we performed high-throughput validation on the Dana Farber Cancer Institute GCOD database and several GEO datasets. Conclusions Our result showed the potential for this panel as a robust classification tool for multiple tumor types on the Affymetrix platform, as well as other whole genome arrays

  6. Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.

    Science.gov (United States)

    Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar

    2018-06-05

    The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.

  7. Detecting microRNA activity from gene expression data

    LENUS (Irish Health Repository)

    Madden, Stephen F

    2010-05-18

    Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  8. Detecting microRNA activity from gene expression data.

    LENUS (Irish Health Repository)

    Madden, Stephen F

    2010-01-01

    BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  9. Advances in detection systems of gene and chromosome abnormalities

    International Nuclear Information System (INIS)

    Yatagai, Takeo

    2002-01-01

    This review is described from the aspect of radiation biology. For analysis at gene level, oxidative lesion of DNA like 7,8-dihydro-8-oxoguanine formation and its repair by DNA polymerase η etc in bacteria, yeast and mammalian cells are suggested to be a useful index of radiation mutation. Transgenic mice with E. coli and/or phage gene as a reporter can be a tool for gene analysis for specific organ mutation: data obtained by irradiation of X-ray, γ-ray and accelerated carbon beam to the mouse gpt delta are presented. For analysis from gene to chromosome levels, loss of heterozygosity of a specific gene is a key for analysis of chromosome aberration at the molecular level. Studies in yeast and mammalian cells are presented. The author also described data of gene mutation in TK6 cells irradiated by 2 Gy of X-ray and 10 cGy of carbon beam (135 MeV/u) generated by ring-cycrotron. Human-hamster hybrid cell is an alternative tool. Concerning significance at the individual level, the author quoted studies of irradiation of parent mice resulting in increased incidence of somatic cell mutation and of cancer in offspring. Future systems for gene mutation will be a use of transgenic mice or of markers like a specific cancer. (K.H.)

  10. Can subtle changes in gene expression be consistently detected with different microarray platforms?

    Directory of Open Access Journals (Sweden)

    Kuiper Rowan

    2008-03-01

    Full Text Available Abstract Background The comparability of gene expression data generated with different microarray platforms is still a matter of concern. Here we address the performance and the overlap in the detection of differentially expressed genes for five different microarray platforms in a challenging biological context where differences in gene expression are few and subtle. Results Gene expression profiles in the hippocampus of five wild-type and five transgenic δC-doublecortin-like kinase mice were evaluated with five microarray platforms: Applied Biosystems, Affymetrix, Agilent, Illumina, LGTC home-spotted arrays. Using a fixed false discovery rate of 10% we detected surprising differences between the number of differentially expressed genes per platform. Four genes were selected by ABI, 130 by Affymetrix, 3,051 by Agilent, 54 by Illumina, and 13 by LGTC. Two genes were found significantly differentially expressed by all platforms and the four genes identified by the ABI platform were found by at least three other platforms. Quantitative RT-PCR analysis confirmed 20 out of 28 of the genes detected by two or more platforms and 8 out of 15 of the genes detected by Agilent only. We observed improved correlations between platforms when ranking the genes based on the significance level than with a fixed statistical cut-off. We demonstrate significant overlap in the affected gene sets identified by the different platforms, although biological processes were represented by only partially overlapping sets of genes. Aberrances in GABA-ergic signalling in the transgenic mice were consistently found by all platforms. Conclusion The different microarray platforms give partially complementary views on biological processes affected. Our data indicate that when analyzing samples with only subtle differences in gene expression the use of two different platforms might be more attractive than increasing the number of replicates. Commercial two-color platforms seem to

  11. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Pathogen, E. coli O157:H7, virulence genes, antibiotic-resistance, beef meat. Correspondence: ... box to the laboratory for further processing. Isolation and identification of ... Technologies (IDT) Inc, U.S.A. The sequences and annealing ...

  12. RUBIC identifies driver genes by detecting recurrent DNA copy number breaks

    NARCIS (Netherlands)

    van Dyk, H.O.; Hoogstraat, M; ten Hoeve, J; Reinders, M.J.T.; Wessels, L.F.A.

    2016-01-01

    The frequent recurrence of copy number aberrations across tumour samples is a reliable hallmark of certain cancer driver genes. However, state-of-the-art algorithms for detecting recurrent aberrations fail to detect several known drivers. In this study, we propose RUBIC, an approach that detects

  13. Alteration in follistatin gene expression detected in prenatally androgenized rats.

    Science.gov (United States)

    Salehi Jahromi, Marziyeh; Ramezani Tehrani, Fahimeh; Hill, Jennifer W; Noroozzadeh, Mahsa; Zarkesh, Maryam; Ghasemi, Asghar; Zadeh-Vakili, Azita

    2017-06-01

    Impaired ovarian follicle development, the hallmark of polycystic ovarian syndrome (PCOS), is believed to be due to the changes in expression of related genes such as follistatin (FST). Expression of FST gene and methylation level of its promoter in theca cells from adult female rats, prenatally exposed to androgen excess, during different phases of the estrus cycle was determined and compared with controls. Eight pregnant Wistar rats (experimental group) were treated by subcutaneous injection of 5 mg free testosterone on day 20 of pregnancy, while controls (n = 8) received 500 ml solvent. Based on observed vaginal smear, adult female offspring of mothers were divided into three groups. Levels of serum steroidogenic sexual hormones and gonadotropins, expression and promoter methylation of the FST gene were measured using ELISA, cyber-green real-time PCR and bisulfite sequence PCR (BSP), respectively. Compared to controls, the relative expression of FST gene in the treated group decreased overall by 0.85 fold; despite significant changes in different phases, but no significant differences in methylation of FST promoter. Our results reveal that manifestation of PCOS-like phenotype following prenatal exposure to excess androgen is associated with irregularity in expression of the FST gene during the estrus cycle.

  14. Detection of horizontal transfer of individual genes by anomalous oligomer frequencies

    Directory of Open Access Journals (Sweden)

    Elhai Jeff

    2012-06-01

    Full Text Available Abstract Background Understanding the history of life requires that we understand the transfer of genetic material across phylogenetic boundaries. Detecting genes that were acquired by means other than vertical descent is a basic step in that process. Detection by discordant phylogenies is computationally expensive and not always definitive. Many have used easily computed compositional features as an alternative procedure. However, different compositional methods produce different predictions, and the effectiveness of any method is not well established. Results The ability of octamer frequency comparisons to detect genes artificially seeded in cyanobacterial genomes was markedly increased by using as a training set those genes that are highly conserved over all bacteria. Using a subset of octamer frequencies in such tests also increased effectiveness, but this depended on the specific target genome and the source of the contaminating genes. The presence of high frequency octamers and the GC content of the contaminating genes were important considerations. A method comprising best practices from these tests was devised, the Core Gene Similarity (CGS method, and it performed better than simple octamer frequency analysis, codon bias, or GC contrasts in detecting seeded genes or naturally occurring transposons. From a comparison of predictions with phylogenetic trees, it appears that the effectiveness of the method is confined to horizontal transfer events that have occurred recently in evolutionary time. Conclusions The CGS method may be an improvement over existing surrogate methods to detect genes of foreign origin.

  15. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles

    2016-08-01

    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  16. Detection of biomarkers for Hepatocellular Carcinoma using a hybrid univariate gene selection methods

    Directory of Open Access Journals (Sweden)

    Abdel Samee Nagwan M

    2012-08-01

    Full Text Available Abstract Background Discovering new biomarkers has a great role in improving early diagnosis of Hepatocellular carcinoma (HCC. The experimental determination of biomarkers needs a lot of time and money. This motivates this work to use in-silico prediction of biomarkers to reduce the number of experiments required for detecting new ones. This is achieved by extracting the most representative genes in microarrays of HCC. Results In this work, we provide a method for extracting the differential expressed genes, up regulated ones, that can be considered candidate biomarkers in high throughput microarrays of HCC. We examine the power of several gene selection methods (such as Pearson’s correlation coefficient, Cosine coefficient, Euclidean distance, Mutual information and Entropy with different estimators in selecting informative genes. A biological interpretation of the highly ranked genes is done using KEGG (Kyoto Encyclopedia of Genes and Genomes pathways, ENTREZ and DAVID (Database for Annotation, Visualization, and Integrated Discovery databases. The top ten genes selected using Pearson’s correlation coefficient and Cosine coefficient contained six genes that have been implicated in cancer (often multiple cancers genesis in previous studies. A fewer number of genes were obtained by the other methods (4 genes using Mutual information, 3genes using Euclidean distance and only one gene using Entropy. A better result was obtained by the utilization of a hybrid approach based on intersecting the highly ranked genes in the output of all investigated methods. This hybrid combination yielded seven genes (2 genes for HCC and 5 genes in different types of cancer in the top ten genes of the list of intersected genes. Conclusions To strengthen the effectiveness of the univariate selection methods, we propose a hybrid approach by intersecting several of these methods in a cascaded manner. This approach surpasses all of univariate selection methods when

  17. A kernel regression approach to gene-gene interaction detection for case-control studies.

    Science.gov (United States)

    Larson, Nicholas B; Schaid, Daniel J

    2013-11-01

    Gene-gene interactions are increasingly being addressed as a potentially important contributor to the variability of complex traits. Consequently, attentions have moved beyond single locus analysis of association to more complex genetic models. Although several single-marker approaches toward interaction analysis have been developed, such methods suffer from very high testing dimensionality and do not take advantage of existing information, notably the definition of genes as functional units. Here, we propose a comprehensive family of gene-level score tests for identifying genetic elements of disease risk, in particular pairwise gene-gene interactions. Using kernel machine methods, we devise score-based variance component tests under a generalized linear mixed model framework. We conducted simulations based upon coalescent genetic models to evaluate the performance of our approach under a variety of disease models. These simulations indicate that our methods are generally higher powered than alternative gene-level approaches and at worst competitive with exhaustive SNP-level (where SNP is single-nucleotide polymorphism) analyses. Furthermore, we observe that simulated epistatic effects resulted in significant marginal testing results for the involved genes regardless of whether or not true main effects were present. We detail the benefits of our methods and discuss potential genome-wide analysis strategies for gene-gene interaction analysis in a case-control study design. © 2013 WILEY PERIODICALS, INC.

  18. Shiga Toxin (Stx) Gene Detection and Verotoxigenic Potentials of ...

    African Journals Online (AJOL)

    Non-0157 Escherichia coli, isolated from Nono (fermented fresh cow milk) sampled from four major Nigerian cities, namely, Abuja, Benin City, Lagos and Onitsha were investigated for the presence shiga toxins (stx1 and stx2) genes using PCR technique and for their verotoxigenic potentials using tissue culture assay on ...

  19. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  20. Gene-wide analysis detects two new susceptibility genes for Alzheimer's Disease

    OpenAIRE

    Escott-Price, Valentina; Bellenguez, Céline; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Jones, Lesley; Holmans, Peter Alan; Gerrish, Amy; Vedernikov, Alexey; Richards, Alexander; DeStefano, Anita L.; Lambert, Jean-Charles; Ibrahim-Verbaas, Carla A.; Naj, Adam C.; Sims, Rebecca

    2014-01-01

    PUBLISHED BACKGROUND: Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over...

  1. PCR-based detection of resistance genes in anaerobic bacteria isolated from intra-abdominal infections.

    Science.gov (United States)

    Tran, Chau Minh; Tanaka, Kaori; Watanabe, Kunitomo

    2013-04-01

    Little information is available on the distribution of antimicrobial resistance genes in anaerobes in Japan. To understand the background of antimicrobial resistance in anaerobes involved in intra-abdominal infections, we investigated the distribution of eight antimicrobial resistance genes (cepA, cfiA, cfxA, ermF, ermB, mefA, tetQ, and nim) and a mutation in the gyrA gene in a total of 152 organisms (Bacteroides spp., Prevotella spp., Fusobacterium spp., Porphyromonas spp., Bilophila wadsworthia, Desulfovibrio desulfuricans, Veillonella spp., gram-positive cocci, and non-spore-forming gram-positive bacilli) isolated between 2003 and 2004 in Japan. The cepA gene was distributed primarily in Bacteroides fragilis. Gene cfxA was detected in about 9 % of the Bacteroides isolates and 75 % of the Prevotella spp. isolates and did not appear to contribute to cephamycin resistance. Two strains of B. fragilis contained the metallo-β-lactamase gene cfiA, but they did not produce the protein product. Gene tetQ was detected in about 81, 44, and 63 % of B. fragilis isolates, other Bacteroides spp., and Prevotella spp. isolates, respectively. The ermF gene was detected in 25, 13, 56, 64, and 16 % of Bacteroides spp., Prevotella spp., Fusobacterium spp., B. wadsworthia, and anaerobic cocci, respectively. Gene mefA was found in only 10 % of the B. fragilis strains and 3 % of the non-B. fragilis strains. Genes nim and ermB were not detected in any isolate. Substitution at position 82 (Ser to Phe) in gyrA was detected in B. fragilis isolates that were less susceptible or resistant to moxifloxacin. This study is the first report on the distribution of resistance genes in anaerobes isolated from intra-abdominal infections in Japan. We expect that the results might help in understanding the resistance mechanisms of specific anaerobes.

  2. Statistical Assessment of Gene Fusion Detection Algorithms using RNASequencing Data

    NARCIS (Netherlands)

    Varadan, V.; Janevski, A.; Kamalakaran, S.; Banerjee, N.; Harris, L.; Dimitrova, D.

    2012-01-01

    The detection and quantification of fusion transcripts has both biological and clinical implications. RNA sequencing technology provides a means for unbiased and high resolution characterization of fusion transcript information in tissue samples. We evaluated two fusiondetection algorithms,

  3. Fast and sensitive detection of indels induced by precise gene targeting

    DEFF Research Database (Denmark)

    Yang, Zhang; Steentoft, Catharina; Hauge, Camilla

    2015-01-01

    The nuclease-based gene editing tools are rapidly transforming capabilities for altering the genome of cells and organisms with great precision and in high throughput studies. A major limitation in application of precise gene editing lies in lack of sensitive and fast methods to detect...... and characterize the induced DNA changes. Precise gene editing induces double-stranded DNA breaks that are repaired by error-prone non-homologous end joining leading to introduction of insertions and deletions (indels) at the target site. These indels are often small and difficult and laborious to detect...

  4. Shiga Toxin (Stx) Gene Detection and Verotoxigenic Potentials of ...

    African Journals Online (AJOL)

    DR-AMADI

    Nigerian Journal of Basic and Applied Science (June, 2016), 24(1): 98-105 .... dangerous pathogenic shiga- toxin producing E. coli from the food product. Consequent .... Table 3: Vero Toxin Analysis of non – 0157 E. coli Isolates From Nono Sold in Nigeria. City .... receptors in their plasma membranes and will detect all ...

  5. Resistance pattern and detection of metallo‑beta‑lactamase genes ...

    African Journals Online (AJOL)

    Materials and Methods: Two hundred nonduplicate, consecutive isolates of P. aeruginosa from clinical samples submitted to the Medical Microbiology Laboratory of National Hospital, Abuja were screened for carbapenem resistance using imipenem and meropenem. Phenotypic detection of MBL‑producing strains was ...

  6. Detection of Bacillus thuringiensis genes in transgenic maize by the ...

    African Journals Online (AJOL)

    We optimized the PCR method to detect genetically engineered Bacillus thuringiensis (Bt) maize in open quarantine fields in Kenya. Many factors affect the extraction of the DNA from plants, such as the amount of tissue available, the condition of the plant material, the numbers of steps involved in the extraction procedure, ...

  7. Detection of Genes for Superantigen Toxins in Methicillin-Resistant Staphylococcus aureus Clinical Isolates in Karachi

    International Nuclear Information System (INIS)

    Taj, Y.; Fatima, I.; Ali, S. W.; Kazmi, S. U.

    2014-01-01

    Objective: To detect genes for enterotoxins, exfoliative and toxic shock syndrome toxins in Staphylococcus aureus (S. aureus) strains isolated from clinical specimens. Study Design: Cross-sectional observational study. Place and Duration of Study: Department of Molecular Genetics, Dr. Ziauddin Hospital, Karachi, from January to December 2010. Methodology: Two hundred and ninety eight S. aureus clinical isolates were obtained from various clinical samples received at Dr. Ziauddin Hospital, Karachi. Out of these, 115 were detected as methicillin resistant (MRSA) by cefoxitin disk diffusion test showing a prevalence rate of 38.6%. Detection of individual toxin genes was performed by Polymerase Chain Reaction (PCR) by using only one primer pair for each tube. Uniplex primers were preferred as multiplex primers are longer in base pairs and have the potential for cross reaction due to non-specific binding and increase in optimization time. Results: The possession of a single gene or more than a single gene in MRSA isolates was found in 61.73% of clinical samples; the highest number was found in pus swab, followed by sputum, blood, urethral swab, and urine. The prevalence of toxin genes was higher in MRSA as compared to methicillin sensitive (MSSA) isolates (19.12%). Conclusion: PCR detects strains possessing toxin genes independent of their expression. The possession of genes for super-antigens seems to be a frequent and habitual trait of S. aureus more so in MRSA. (author)

  8. Detection of GSTM1, GSTT1 and the Ile105Val GSTP1 gene variants

    DEFF Research Database (Denmark)

    Buchard, Anders; Sanchez, Juan J.; Dalhoff, Kim

    2008-01-01

    We have developed a PCR multiplex method that in a fast, inexpensive and reliable manner can detect if a person has two, one or no GSTM1 and GSTT1 genes and which at the same time can detect the allelic status of the GSTP1 Ile105Val genetic variant. A total of 200 Danes, 100 Somalis and 100...

  9. Direct and long-term detection of gene doping in conventional blood samples.

    Science.gov (United States)

    Beiter, T; Zimmermann, M; Fragasso, A; Hudemann, J; Niess, A M; Bitzer, M; Lauer, U M; Simon, P

    2011-03-01

    The misuse of somatic gene therapy for the purpose of enhancing athletic performance is perceived as a coming threat to the world of sports and categorized as 'gene doping'. This article describes a direct detection approach for gene doping that gives a clear yes-or-no answer based on the presence or absence of transgenic DNA in peripheral blood samples. By exploiting a priming strategy to specifically amplify intronless DNA sequences, we developed PCR protocols allowing the detection of very small amounts of transgenic DNA in genomic DNA samples to screen for six prime candidate genes. Our detection strategy was verified in a mouse model, giving positive signals from minute amounts (20 μl) of blood samples for up to 56 days following intramuscular adeno-associated virus-mediated gene transfer, one of the most likely candidate vector systems to be misused for gene doping. To make our detection strategy amenable for routine testing, we implemented a robust sample preparation and processing protocol that allows cost-efficient analysis of small human blood volumes (200 μl) with high specificity and reproducibility. The practicability and reliability of our detection strategy was validated by a screening approach including 327 blood samples taken from professional and recreational athletes under field conditions.

  10. Detection of growth hormone doping by gene expression profiling of peripheral blood.

    Science.gov (United States)

    Mitchell, Christopher J; Nelson, Anne E; Cowley, Mark J; Kaplan, Warren; Stone, Glenn; Sutton, Selina K; Lau, Amie; Lee, Carol M Y; Ho, Ken K Y

    2009-12-01

    GH abuse is a significant problem in many sports, and there is currently no robust test that allows detection of doping beyond a short window after administration. Our objective was to evaluate gene expression profiling in peripheral blood leukocytes in-vivo as a test for GH doping in humans. Seven men and thirteen women were administered GH, 2 mg/d sc for 8 wk. Blood was collected at baseline and at 8 wk. RNA was extracted from the white cell fraction. Microarray analysis was undertaken using Agilent 44K G4112F arrays using a two-color design. Quantitative RT-PCR using TaqMan gene expression assays was performed for validation of selected differentially expressed genes. GH induced an approximately 2-fold increase in circulating IGF-I that was maintained throughout the 8 wk of the study. GH induced significant changes in gene expression with 353 in women and 41 in men detected with a false discovery rate of less than 5%. None of the differentially expressed genes were common between men and women. The maximal changes were a doubling for up-regulated or halving for down-regulated genes, similar in magnitude to the variation between individuals. Quantitative RT-PCR for seven target genes showed good concordance between microarray and quantitative PCR data in women but not in men. Gene expression analysis of peripheral blood leukocytes is unlikely to be a viable approach for the detection of GH doping.

  11. Real-time PCR detection of aldoxime dehydratase genes in nitrile-degrading microorganisms.

    Science.gov (United States)

    Dooley-Cullinane, Tríona Marie; O'Reilly, Catherine; Coffey, Lee

    2017-02-01

    Aldoxime dehydratase catalyses the conversion of aldoximes to their corresponding nitriles. Utilization of the aldoxime-nitrile metabolising enzyme pathway can facilitate the move towards a greener chemistry. In this work, a real-time PCR assay was developed for the detection of aldoxime dehydratase genes in aldoxime/nitrile metabolising microorganisms which have been purified from environmental sources. A conventional PCR assay was also designed allowing gene confirmation via sequencing. Aldoxime dehydratase genes were identified in 30 microorganisms across 11 genera including some not previously shown to harbour the gene. The assay displayed a limit of detection of 1 pg/μL DNA or 7 CFU/reaction. This real-time PCR assay should prove valuable in the high-throughput screening of micro-organisms for novel aldoxime dehydratase genes towards pharmaceutical and industrial applications.

  12. Detection of polymorphism in booroola gene and growth ...

    African Journals Online (AJOL)

    [12] and Davis et al [17], forced PCR–RFLP DNA test was used to detect the mutations of FecB and GDF9 in Lori breed sheep. The primer sequences used for the FecB AvaII site and. GDF9 HhaI site are presented in Table 1. Polymerase chain reactions were performed in a. 25 μL reaction mixture containing approximately.

  13. Canine olfactory receptor gene polymorphism and its relation to odor detection performance by sniffer dogs.

    Science.gov (United States)

    Lesniak, Anna; Walczak, Marta; Jezierski, Tadeusz; Sacharczuk, Mariusz; Gawkowski, Maciej; Jaszczak, Kazimierz

    2008-01-01

    The outstanding sensitivity of the canine olfactory system has been acknowledged by using sniffer dogs in military and civilian service for detection of a variety of odors. It is hypothesized that the canine olfactory ability is determined by polymorphisms in olfactory receptor (OR) genes. We investigated 5 OR genes for polymorphic sites which might affect the olfactory ability of service dogs in different fields of specific substance detection. All investigated OR DNA sequences proved to have allelic variants, the majority of which lead to protein sequence alteration. Homozygous individuals at 2 gene loci significantly differed in their detection skills from other genotypes. This suggests a role of specific alleles in odor detection and a linkage between single-nucleotide polymorphism and odor recognition efficiency.

  14. Application of nanomaterials in the bioanalytical detection of disease-related genes.

    Science.gov (United States)

    Zhu, Xiaoqian; Li, Jiao; He, Hanping; Huang, Min; Zhang, Xiuhua; Wang, Shengfu

    2015-12-15

    In the diagnosis of genetic diseases and disorders, nanomaterials-based gene detection systems have significant advantages over conventional diagnostic systems in terms of simplicity, sensitivity, specificity, and portability. In this review, we describe the application of nanomaterials for disease-related genes detection in different methods excluding PCR-related method, such as colorimetry, fluorescence-based methods, electrochemistry, microarray methods, surface-enhanced Raman spectroscopy (SERS), quartz crystal microbalance (QCM) methods, and dynamic light scattering (DLS). The most commonly used nanomaterials are gold, silver, carbon and semiconducting nanoparticles. Various nanomaterials-based gene detection methods are introduced, their respective advantages are discussed, and selected examples are provided to illustrate the properties of these nanomaterials and their emerging applications for the detection of specific nucleic acid sequences. Copyright © 2015. Published by Elsevier B.V.

  15. Detecting genes contributing to longevity using twin data

    Directory of Open Access Journals (Sweden)

    Begun Alexander

    2009-12-01

    Full Text Available Abstract Searching for genes contributing to longevity is a typical task in association analysis. A number of methods can be used for finding this association -- from the simplest method based on the technique of contingency tables to more complex algorithms involving demographic data, which allow us to estimate the genotype-specific hazard functions. The independence of individuals is the common assumption in all these methods. At the same time, data on related individuals such as twins are often used in genetic studies. This paper proposes an extension of the relative risk model to encompass twin data. We estimate the power and also discuss what happens if we treat the twin data using the univariate model.

  16. Using the candidate gene approach for detecting genes underlying seed oil concentration and yield in soybean.

    Science.gov (United States)

    Eskandari, Mehrzad; Cober, Elroy R; Rajcan, Istvan

    2013-07-01

    Increasing the oil concentration in soybean seeds has been given more attention in recent years because of demand for both edible oil and biodiesel production. Oil concentration in soybean is a complex quantitative trait regulated by many genes as well as environmental conditions. To identify genes governing seed oil concentration in soybean, 16 putative candidate genes of three important gene families (GPAT: acyl-CoA:sn-glycerol-3-phosphate acyltransferase, DGAT: acyl-CoA:diacylglycerol acyltransferase, and PDAT: phospholipid:diacylglycerol acyltransferase) involved in triacylglycerol (TAG) biosynthesis pathways were selected and their sequences retrieved from the soybean database ( http://www.phytozome.net/soybean ). Three sequence mutations were discovered in either coding or noncoding regions of three DGAT soybean isoforms when comparing the parents of a 203 recombinant inbreed line (RIL) population; OAC Wallace and OAC Glencoe. The RIL population was used to study the effects of these mutations on seed oil concentration and other important agronomic and seed composition traits, including seed yield and protein concentration across three field locations in Ontario, Canada, in 2009 and 2010. An insertion/deletion (indel) mutation in the GmDGAT2B gene in OAC Wallace was significantly associated with reduced seed oil concentration across three environments and reduced seed yield at Woodstock in 2010. A mutation in the 3' untranslated (3'UTR) region of GmDGAT2C was associated with seed yield at Woodstock in 2009. A mutation in the intronic region of GmDGAR1B was associated with seed yield and protein concentration at Ottawa in 2010. The genes identified in this study had minor effects on either seed yield or oil concentration, which was in agreement with the quantitative nature of the traits. However, the novel gene-specific markers designed in the present study can be used in soybean breeding for marker-assisted selection aimed at increasing seed yield and oil

  17. An endogenous reference gene of common and durum wheat for detection of genetically modified wheat.

    Science.gov (United States)

    Imai, Shinjiro; Tanaka, Keiko; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Matsuoka, Yasuyuki; Arami, Shin-Ichiro; Sato, Megumi; Haraguchi, Hiroyuki; Kurimoto, Youichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2012-01-01

    To develop a method for detecting GM wheat that may be marketed in the near future, we evaluated the proline-rich protein (PRP) gene as an endogenous reference gene of common wheat (Triticum aestivum L.) and durum wheat (Triticum durum L.). Real-time PCR analysis showed that only DNA of wheat was amplified and no amplification product was observed for phylogenetically related cereals, indicating that the PRP detection system is specific to wheat. The intensities of the amplification products and Ct values among all wheat samples used in this study were very similar, with no nonspecific or additional amplification, indicating that the PRP detection system has high sequence stability. The limit of detection was estimated at 5 haploid genome copies. The PRP region was demonstrated to be present as a single or double copy in the common wheat haploid genome. Furthermore, the PRP detection system showed a highly linear relationship between Ct values and the amount of plasmid DNA, indicating that an appropriate calibration curve could be constructed for quantitative detection of GM wheat. All these results indicate that the PRP gene is a suitable endogenous reference gene for PCR-based detection of GM wheat.

  18. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

  19. Detection of mutations in genes by specific LNA primers

    DEFF Research Database (Denmark)

    2001-01-01

    acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...

  20. High-throughput Microarray Detection of Vomeronasal Receptor Gene Expression in Rodents

    Directory of Open Access Journals (Sweden)

    Xiaohong Zhang

    2010-11-01

    Full Text Available We performed comprehensive data mining to explore the vomeronasal receptor (V1R & V2R repertoires in mouse and rat using the mm5 and rn3 genome, respectively. This bioinformatic analysis was followed by investigation of gene expression using a custom designed high-density oligonucleotide array containing all of these receptors and other selected genes of interest. This array enabled us to detect the specific expression of V1R and V2Rs which were previously identified solely based on computational prediction from gene sequence data, thereby establishing that these genes are indeed part of the vomeronasal system, especially the V2Rs. 168 V1Rs and 98 V2Rs were detected to be highly enriched in mouse vomeronasal organ (VNO, and 108 V1Rs and 87 V2Rs in rat VNO. We monitored the expression profile of mouse VR genes in other non-VNO tissues with the result that some VR genes were re-designated as VR-like genes based on their non-olfactory expression pattern. Temporal expression profiles for mouse VR genes were characterized and their patterns were classified, revealing the developmental dynamics of these so-called pheromone receptors. We found numerous patterns of temporal expression which indicate possible behavior-related functions. The uneven composition of VR genes in certain patterns suggests a functional differentiation between the two types of VR genes. We found the coherence between VR genes and transcription factors in terms of their temporal expression patterns. In situ hybridization experiments were performed to evaluate the cell number change over time for selected receptor genes.

  1. Causality analysis detects the regulatory role of maternal effect genes in the early Drosophila embryo

    Directory of Open Access Journals (Sweden)

    Zara Ghodsi

    2017-03-01

    Full Text Available In developmental studies, inferring regulatory interactions of segmentation genetic network play a vital role in unveiling the mechanism of pattern formation. As such, there exists an opportune demand for theoretical developments and new mathematical models which can result in a more accurate illustration of this genetic network. Accordingly, this paper seeks to extract the meaningful regulatory role of the maternal effect genes using a variety of causality detection techniques and to explore whether these methods can suggest a new analytical view to the gene regulatory networks. We evaluate the use of three different powerful and widely-used models representing time and frequency domain Granger causality and convergent cross mapping technique with the results being thoroughly evaluated for statistical significance. Our findings show that the regulatory role of maternal effect genes is detectable in different time classes and thereby the method is applicable to infer the possible regulatory interactions present among the other genes of this network.

  2. A polymerase chain reaction-based methodology to detect gene doping.

    Science.gov (United States)

    Carter, Adam; Flueck, Martin

    2012-04-01

    The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

  3. Methodological issues in detecting gene-gene interactions in breast cancer susceptibility: a population-based study in Ontario

    Directory of Open Access Journals (Sweden)

    Onay Venus

    2007-08-01

    Full Text Available Abstract Background There is growing evidence that gene-gene interactions are ubiquitous in determining the susceptibility to common human diseases. The investigation of such gene-gene interactions presents new statistical challenges for studies with relatively small sample sizes as the number of potential interactions in the genome can be large. Breast cancer provides a useful paradigm to study genetically complex diseases because commonly occurring single nucleotide polymorphisms (SNPs may additively or synergistically disturb the system-wide communication of the cellular processes leading to cancer development. Methods In this study, we systematically studied SNP-SNP interactions among 19 SNPs from 18 key genes involved in major cancer pathways in a sample of 398 breast cancer cases and 372 controls from Ontario. We discuss the methodological issues associated with the detection of SNP-SNP interactions in this dataset by applying and comparing three commonly used methods: the logistic regression model, classification and regression trees (CART, and the multifactor dimensionality reduction (MDR method. Results Our analyses show evidence for several simple (two-way and complex (multi-way SNP-SNP interactions associated with breast cancer. For example, all three methods identified XPD-[Lys751Gln]*IL10-[G(-1082A] as the most significant two-way interaction. CART and MDR identified the same critical SNPs participating in complex interactions. Our results suggest that the use of multiple statistical approaches (or an integrated approach rather than a single methodology could be the best strategy to elucidate complex gene interactions that have generally very different patterns. Conclusion The strategy used here has the potential to identify complex biological relationships among breast cancer genes and processes. This will lead to the discovery of novel biological information, which will improve breast cancer risk management.

  4. Shared Gene Expression Alterations in Nasal and Bronchial Epithelium for Lung Cancer Detection.

    Science.gov (United States)

    2017-07-01

    We previously derived and validated a bronchial epithelial gene expression biomarker to detect lung cancer in current and former smokers. Given that bronchial and nasal epithelial gene expression are similarly altered by cigarette smoke exposure, we sought to determine if cancer-associated gene expression might also be detectable in the more readily accessible nasal epithelium. Nasal epithelial brushings were prospectively collected from current and former smokers undergoing diagnostic evaluation for pulmonary lesions suspicious for lung cancer in the AEGIS-1 (n = 375) and AEGIS-2 (n = 130) clinical trials and gene expression profiled using microarrays. All statistical tests were two-sided. We identified 535 genes that were differentially expressed in the nasal epithelium of AEGIS-1 patients diagnosed with lung cancer vs those with benign disease after one year of follow-up ( P  cancer-associated gene expression alterations between the two airway sites ( P  lung cancer classifier derived in the AEGIS-1 cohort that combined clinical factors (age, smoking status, time since quit, mass size) and nasal gene expression (30 genes) had statistically significantly higher area under the curve (0.81; 95% confidence interval [CI] = 0.74 to 0.89, P  = .01) and sensitivity (0.91; 95% CI = 0.81 to 0.97, P  = .03) than a clinical-factor only model in independent samples from the AEGIS-2 cohort. These results support that the airway epithelial field of lung cancer-associated injury in ever smokers extends to the nose and demonstrates the potential of using nasal gene expression as a noninvasive biomarker for lung cancer detection. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Detection of virulence genes and the phylogenetic groups of Escherichia coli isolated from dogs in Brazil

    Directory of Open Access Journals (Sweden)

    Fernanda Morcatti Coura

    2018-02-01

    Full Text Available ABSTRACT: This study identified the virulence genes, pathovars, and phylogenetic groups of Escherichia coli strains obtained from the feces of dogs with and without diarrhea. Virulence genes and phylogenetic group identification were studied using polymerase chain reaction. Thirty-seven E. coli isolates were positive for at least one virulence factor gene. Twenty-one (57.8% of the positive isolates were isolated from diarrheal feces and sixteen (43.2% were from the feces of non-diarrheic dogs. Enteropathogenic E. coli (EPEC were the most frequently (62.2% detected pathovar in dog feces and were mainly from phylogroup B1 and E. Necrotoxigenic E. coli were detected in 16.2% of the virulence-positive isolates and these contained the cytotoxic necrotizing factor 1 (cnf1 gene and were classified into phylogroups B2 and D. All E. coli strains were negative for the presence of enterotoxigenic E. coli (ETEC enterotoxin genes, but four strains were positive for ETEC-related fimbriae 987P and F18. Two isolates were Shiga toxin-producing E. coli strains and contained the toxin genesStx2 or Stx2e, both from phylogroup B1. Our data showed that EPEC was the most frequent pathovar and B1 and E were the most common phylogroups detected in E. coli isolated from the feces of diarrheic and non-diarrheic dogs.

  6. Impairments of mecA gene detection in bovine Staphylococcus spp.

    Directory of Open Access Journals (Sweden)

    Dayanne Araújo de Melo

    2014-09-01

    Full Text Available Staphylococcus aureus antimicrobial resistance, especially to beta-lactams, favors treatment failures and its persistence in herd environment. This work aimed to develop a more specific primer for mecA gene detection based on the comparison of the conserved regions from distinct host origins and also investigated the presence of homologue mecA LGA251 in bovine strains. A total of 43 Staphylococcus spp. were included in this study, comprising 38 bovine S. aureus, two human and three equine coagulase-negative staphylococci (CNS. Phenotypical methicillin-resistance detection was performed through oxacillin agar-screening and cefoxitin disk-diffusion test. None isolate tested positive for mecA LGA251 gene. For mecA gene PCR, new primers were designed based on the sequences of human S. aureus (HE681097 and bovine S. sciuri (AY820253 mecA. The new primers based on the S. aureus mecA sequence amplified fragments of human and equine CNS and the ones based on S. sciuri mecA sequence only yielded fragments for S. aureus bovine strains. Multiples alignments of mecA gene sequences from bovine, human and equine revealed punctual but significant differences in bovine strains that can lead to the mecA gene detection impairment. The observed divergences of mecA gene sequences are not a matter of animal or human origin, it is a specificity of bovine samples.

  7. In situ detection of the Clostridium botulinum type C1 toxin gene in wetland sediments with a nested PCR assay

    Science.gov (United States)

    Williamson, Judy L.; Rocke, Tonie E.; Aiken, Judd M.

    1999-01-01

    A nested PCR was developed for detection of the Clostridium botulinum type C1 toxin gene in sediments collected from wetlands where avian botulism outbreaks had or had not occurred. The C1 toxin gene was detected in 16 of 18 sites, demonstrating both the ubiquitous distribution of C. botulinum type C in wetland sediments and the sensitivity of the detection assay.

  8. TESTING HIGH-DIMENSIONAL COVARIANCE MATRICES, WITH APPLICATION TO DETECTING SCHIZOPHRENIA RISK GENES.

    Science.gov (United States)

    Zhu, Lingxue; Lei, Jing; Devlin, Bernie; Roeder, Kathryn

    2017-09-01

    Scientists routinely compare gene expression levels in cases versus controls in part to determine genes associated with a disease. Similarly, detecting case-control differences in co-expression among genes can be critical to understanding complex human diseases; however statistical methods have been limited by the high dimensional nature of this problem. In this paper, we construct a sparse-Leading-Eigenvalue-Driven (sLED) test for comparing two high-dimensional covariance matrices. By focusing on the spectrum of the differential matrix, sLED provides a novel perspective that accommodates what we assume to be common, namely sparse and weak signals in gene expression data, and it is closely related with Sparse Principal Component Analysis. We prove that sLED achieves full power asymptotically under mild assumptions, and simulation studies verify that it outperforms other existing procedures under many biologically plausible scenarios. Applying sLED to the largest gene-expression dataset obtained from post-mortem brain tissue from Schizophrenia patients and controls, we provide a novel list of genes implicated in Schizophrenia and reveal intriguing patterns in gene co-expression change for Schizophrenia subjects. We also illustrate that sLED can be generalized to compare other gene-gene "relationship" matrices that are of practical interest, such as the weighted adjacency matrices.

  9. Selection of Suitable Endogenous Reference Genes for Relative Copy Number Detection in Sugarcane

    Directory of Open Access Journals (Sweden)

    Bantong Xue

    2014-05-01

    Full Text Available Transgene copy number has a great impact on the expression level and stability of exogenous gene in transgenic plants. Proper selection of endogenous reference genes is necessary for detection of genetic components in genetically modification (GM crops by quantitative real-time PCR (qPCR or by qualitative PCR approach, especially in sugarcane with polyploid and aneuploid genomic structure. qPCR technique has been widely accepted as an accurate, time-saving method on determination of copy numbers in transgenic plants and on detection of genetically modified plants to meet the regulatory and legislative requirement. In this study, to find a suitable endogenous reference gene and its real-time PCR assay for sugarcane (Saccharum spp. hybrids DNA content quantification, we evaluated a set of potential “single copy” genes including P4H, APRT, ENOL, CYC, TST and PRR, through qualitative PCR and absolute quantitative PCR. Based on copy number comparisons among different sugarcane genotypes, including five S. officinarum, one S. spontaneum and two S. spp. hybrids, these endogenous genes fell into three groups: ENOL-3—high copy number group, TST-1 and PRR-1—medium copy number group, P4H-1, APRT-2 and CYC-2—low copy number group. Among these tested genes, P4H, APRT and CYC were the most stable, while ENOL and TST were the least stable across different sugarcane genotypes. Therefore, three primer pairs of P4H-3, APRT-2 and CYC-2 were then selected as the suitable reference gene primer pairs for sugarcane. The test of multi-target reference genes revealed that the APRT gene was a specific amplicon, suggesting this gene is the most suitable to be used as an endogenous reference target for sugarcane DNA content quantification. These results should be helpful for establishing accurate and reliable qualitative and quantitative PCR analysis of GM sugarcane.

  10. Detection of antibiotic resistance genes in samples from acute and chronic endodontic infections and after treatment.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2013-09-01

    The purpose of this study was twofold: survey samples from acute and chronic endodontic infections for the presence of genes encoding resistance to beta-lactams, tetracycline and erythromycin, and evaluate the ability of treatment to eliminate these genes from root canals. DNA extracts from samples of abscess aspirates (n=25) and root canals of teeth with asymptomatic apical periodontitis (n=24) were used as template for direct detection of the genes blaTEM, cfxA, tetM, tetQ, tetW, and ermC using real-time polymerase chain reaction (PCR). Bacterial presence was determined using PCR with universal bacterial primers. Root canals of the asymptomatic cases were also sampled and evaluated after chemomechanical procedures using NiTi instruments with 2.5% NaOCl irrigation. All abscess and initial root canal samples were positive for bacteria. At least one of the target resistance genes was found in 36% of the abscess samples and 67% of the asymptomatic cases. The most prevalent genes in abscesses were blaTEM (24%) and ermC (24%), while tetM (42%) and tetW (29%) prevailed in asymptomatic cases. The blaTEM gene was significantly associated with acute cases (p=0.02). Conversely, tetM was significantly more prevalent in asymptomatic cases (p=0.008). Treatment eliminated resistance genes from most cases. Acute and chronic endodontic infections harboured resistance genes for 3 classes of widely used antibiotics. In most cases, treatment was effective in eliminating these genes, but there were a few cases in which they persisted. The implications of persistence are unknown. Direct detection of resistance genes in abscesses may be a potential method for rapid diagnosis and establishment of proactive antimicrobial therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Staphylococcus aureus Isolates from Bovine Mastitis in Eight Countries: Genotypes, Detection of Genes Encoding Different Toxins and Other Virulence Genes

    Directory of Open Access Journals (Sweden)

    Valentina Monistero

    2018-06-01

    Full Text Available Staphylococcus aureus is recognized worldwide as one of the major agents of dairy cow intra-mammary infections. This microorganism can express a wide spectrum of pathogenic factors used to attach, colonize, invade and infect the host. The present study evaluated 120 isolates from eight different countries that were genotyped by RS-PCR and investigated for 26 different virulence factors to increase the knowledge on the circulating genetic lineages among the cow population with mastitis. New genotypes were observed for South African strains while for all the other countries new variants of existing genotypes were detected. For each country, a specific genotypic pattern was found. Among the virulence factors, fmtB, cna, clfA and leucocidins genes were the most frequent. The sea and sei genes were present in seven out of eight countries; seh showed high frequency in South American countries (Brazil, Colombia, Argentina, while sel was harboured especially in one Mediterranean country (Tunisia. The etb, seb and see genes were not detected in any of the isolates, while only two isolates were MRSA (Germany and Italy confirming the low diffusion of methicillin resistance microorganism among bovine mastitis isolates. This work demonstrated the wide variety of S. aureus genotypes found in dairy cattle worldwide. This condition suggests that considering the region of interest might help to formulate strategies for reducing the infection spreading.

  12. Human synthetic lethal inference as potential anti-cancer target gene detection

    Directory of Open Access Journals (Sweden)

    Solé Ricard V

    2009-12-01

    Full Text Available Abstract Background Two genes are called synthetic lethal (SL if mutation of either alone is not lethal, but mutation of both leads to death or a significant decrease in organism's fitness. The detection of SL gene pairs constitutes a promising alternative for anti-cancer therapy. As cancer cells exhibit a large number of mutations, the identification of these mutated genes' SL partners may provide specific anti-cancer drug candidates, with minor perturbations to the healthy cells. Since existent SL data is mainly restricted to yeast screenings, the road towards human SL candidates is limited to inference methods. Results In the present work, we use phylogenetic analysis and database manipulation (BioGRID for interactions, Ensembl and NCBI for homology, Gene Ontology for GO attributes in order to reconstruct the phylogenetically-inferred SL gene network for human. In addition, available data on cancer mutated genes (COSMIC and Cancer Gene Census databases as well as on existent approved drugs (DrugBank database supports our selection of cancer-therapy candidates. Conclusions Our work provides a complementary alternative to the current methods for drug discovering and gene target identification in anti-cancer research. Novel SL screening analysis and the use of highly curated databases would contribute to improve the results of this methodology.

  13. Detection of toxin genes and RAPD analysis of bacillus cereus isolates from different soil types

    Directory of Open Access Journals (Sweden)

    Savic Dejana

    2015-01-01

    Full Text Available The aim of this study was to detect genes for enterotoxins (hbla, entFM and bceT and for emetic toxin (cer, to determine antibiotic resistance, and to estimate intraspecies diversity in B. cereus isolates by RAPD analysis. B. cereus was identified in 12 out of 117 indigenous Bacillus spp. using the classical microbiological methods and PCR. All isolates were resistant to penicillin and ampicillin, two to tetracyclin and four to trimethoprim-sulphamethoxazole. Also, all isolates produced inducible penicillinases and β-lactamase. Toxin genes were detected with PCR. EntFM and cer genes were present in all isolates, hbla in all, but two, and bceT in none. RAPD analysis was performed with four different primers, two of them designed for this study. The intraspecies diversity revealed 10 different patterns at the 90% similarity level. Two separate clusters were formed regardless of a soil type or utilization. The detection of genes encoding toxins in all B. cereus isolates indicated these bacteria as potentially pathogenic and seriously for human health. Regardless of a soil type or utilization, the RAPD analysis showed high intraspecies heterogeneity in B. cereus isolates. To the best of our knowledge, this is the first study to analyse the presence of entero- and emetic toxin genes and genetic heterogeneity in B. cereus isolates from different soil types and different soil utilization in Serbia. [Projekat Ministarstva nauke Republike Srbije, br. TR37006

  14. Rapid detection of single nucleotide mutation in p53 gene based on ...

    Indian Academy of Sciences (India)

    mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

  15. 40 CFR 798.5300 - Detection of gene mutations in somatic cells in culture.

    Science.gov (United States)

    2010-07-01

    ... cells in culture. 798.5300 Section 798.5300 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5300 Detection of gene mutations in somatic cells in culture. (a) Purpose. Mammalian cell culture... selected by resistance to ouabain. (2) Description. Cells in suspension or monolayer culture are exposed to...

  16. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design

    NARCIS (Netherlands)

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-01-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from

  17. Molecular detection of TasA gene in endophytic Bacillus species ...

    African Journals Online (AJOL)

    hope&shola

    2012-03-20

    Mar 20, 2012 ... formation in Bacillus species was detected in the endophytic bacteria by polymerase chain reaction. (PCR) amplification. In ten endophytic ... confer a competitive advantage to the spore from the onset of sporulation and later, ... possessing TasA gene (Chen et al., 2007; Gioia et al.,. 2007; Kunst et al., 1997; ...

  18. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Directory of Open Access Journals (Sweden)

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  19. Detection of anabolic androgenic steroid abuse in doping control using mammalian reporter gene bioassays.

    Science.gov (United States)

    Houtman, Corine J; Sterk, Saskia S; van de Heijning, Monique P M; Brouwer, Abraham; Stephany, Rainer W; van der Burg, Bart; Sonneveld, Edwin

    2009-04-01

    Anabolic androgenic steroids (AAS) are a class of steroid hormones related to the male hormone testosterone. They are frequently detected as drugs in sport doping control. Being similar to or derived from natural male hormones, AAS share the activation of the androgen receptor (AR) as common mechanism of action. The mammalian androgen responsive reporter gene assay (AR CALUX bioassay), measuring compounds interacting with the AR can be used for the analysis of AAS without the necessity of knowing their chemical structure beforehand, whereas current chemical-analytical approaches may have difficulty in detecting compounds with unknown structures, such as designer steroids. This study demonstrated that AAS prohibited in sports and potential designer AAS can be detected with this AR reporter gene assay, but that also additional steroid activities of AAS could be found using additional mammalian bioassays for other types of steroid hormones. Mixtures of AAS were found to behave additively in the AR reporter gene assay showing that it is possible to use this method for complex mixtures as are found in doping control samples, including mixtures that are a result of multi drug use. To test if mammalian reporter gene assays could be used for the detection of AAS in urine samples, background steroidal activities were measured. AAS-spiked urine samples, mimicking doping positive samples, showed significantly higher androgenic activities than unspiked samples. GC-MS analysis of endogenous androgens and AR reporter gene assay analysis of urine samples showed how a combined chemical-analytical and bioassay approach can be used to identify samples containing AAS. The results indicate that the AR reporter gene assay, in addition to chemical-analytical methods, can be a valuable tool for the analysis of AAS for doping control purposes.

  20. Simultaneous detection of transgenic DNA by surface plasmon resonance imaging with potential application to gene doping detection.

    Science.gov (United States)

    Scarano, Simona; Ermini, Maria Laura; Spiriti, Maria Michela; Mascini, Marco; Bogani, Patrizia; Minunni, Maria

    2011-08-15

    Surface plasmon resonance imaging (SPRi) was used as the transduction principle for the development of optical-based sensing for transgenes detection in human cell lines. The objective was to develop a multianalyte, label-free, and real-time approach for DNA sequences that are identified as markers of transgenosis events. The strategy exploits SPRi sensing to detect the transgenic event by targeting selected marker sequences, which are present on shuttle vector backbone used to carry out the transfection of human embryonic kidney (HEK) cell lines. Here, we identified DNA sequences belonging to the Cytomegalovirus promoter and the Enhanced Green Fluorescent Protein gene. System development is discussed in terms of probe efficiency and influence of secondary structures on biorecognition reaction on sensor; moreover, optimization of PCR samples pretreatment was carried out to allow hybridization on biosensor, together with an approach to increase SPRi signals by in situ mass enhancement. Real-time PCR was also employed as reference technique for marker sequences detection on human HEK cells. We can foresee that the developed system may have potential applications in the field of antidoping research focused on the so-called gene doping.

  1. Advance in plasma SEPT9 gene methylation assay for colorectal cancer early detection.

    Science.gov (United States)

    Wang, Yu; Chen, Pei-Min; Liu, Rong-Bin

    2018-01-15

    This review article summarizes the research advances of the plasma-based SEPT9 gene methylation assay for the clinical detection of colorectal cancer and its limitations. Colorectal cancer is a common malignancy with a poor prognosis and a high mortality, for which early detection and diagnosis are particularly crucial for the high-risk groups. Increasing evidence supported that SEPT9 gene methylation is associated with the pathogenesis of colorectal cancer and that detecting the level of methylation of SEPT9 in the peripheral blood can be used for screening of colorectal cancer in susceptible populations. In recent years, the data obtained in clinical studies demonstrated that the SEPT9 gene methylation assay has a good diagnostic performance with regard to both sensitivity and specificity with the advantage of better acceptability, convenience and compliance with serological testing compared with fecal occult blood tests and carcinoembryonic antigen for colorectal cancer (CRC). Furthermore, the combination of multiple methods or markers has become a growing trend for CRC detection and screening. Nevertheless, the clinical availability of the methylated SEPT9 assay is still limited because of the large degree of sample heterogeneity caused by demographic characteristics, pathological features, comorbidities and/or technique selection. Another factor is the cost-effectiveness of colorectal cancer screening strategies that hinders its large-scale application. In addition, improvements in its accuracy in detecting adenomas and premalignant polyps are required.

  2. Erythropoietin abuse and erythropoietin gene doping: detection strategies in the genomic era.

    Science.gov (United States)

    Diamanti-Kandarakis, Evanthia; Konstantinopoulos, Panagiotis A; Papailiou, Joanna; Kandarakis, Stylianos A; Andreopoulos, Anastasios; Sykiotis, Gerasimos P

    2005-01-01

    The administration of recombinant human erythropoietin (rhEPO) increases the maximum oxygen consumption capacity, and is therefore abused as a doping method in endurance sports. The detection of erythropoietin (EPO) abuse is based on direct pharmacological and indirect haematological approaches, both of which have several limitations. In addition, current detection methods cannot cope with the emerging doping strategies of EPO mimicry, analogues and gene doping, and thus novel detection strategies are urgently needed. Direct detection methods for EPO misuse can be either pharmacological approaches that identify exogenous substances based on their physicochemical properties, or molecular methods that recognise EPO transgenes or gene transfer vectors. Since direct detection with molecular methods requires invasive procedures, it is not appropriate for routine screening of large numbers of athletes. In contrast, novel indirect methods based on haematological and/or molecular profiling could be better suited as screening tools, and athletes who are suspect of doping would then be submitted to direct pharmacological and molecular tests. This article reviews the current state of the EPO doping field, discusses available detection methods and their shortcomings, outlines emerging pharmaceutical and genetic technologies in EPO misuse, and proposes potential directions for the development of novel detection strategies.

  3. A PLSPM-Based Test Statistic for Detecting Gene-Gene Co-Association in Genome-Wide Association Study with Case-Control Design

    Science.gov (United States)

    Zhang, Xiaoshuai; Yang, Xiaowei; Yuan, Zhongshang; Liu, Yanxun; Li, Fangyu; Peng, Bin; Zhu, Dianwen; Zhao, Jinghua; Xue, Fuzhong

    2013-01-01

    For genome-wide association data analysis, two genes in any pathway, two SNPs in the two linked gene regions respectively or in the two linked exons respectively within one gene are often correlated with each other. We therefore proposed the concept of gene-gene co-association, which refers to the effects not only due to the traditional interaction under nearly independent condition but the correlation between two genes. Furthermore, we constructed a novel statistic for detecting gene-gene co-association based on Partial Least Squares Path Modeling (PLSPM). Through simulation, the relationship between traditional interaction and co-association was highlighted under three different types of co-association. Both simulation and real data analysis demonstrated that the proposed PLSPM-based statistic has better performance than single SNP-based logistic model, PCA-based logistic model, and other gene-based methods. PMID:23620809

  4. Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs

    Directory of Open Access Journals (Sweden)

    Hutchison Clyde A

    2006-01-01

    Full Text Available Abstract Background Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs. We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. Results "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not are attractive targets when seeking errors of gene predicion. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency. We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Conclusion Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes.

  5. Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs.

    Science.gov (United States)

    Powell, Bradford C; Hutchison, Clyde A

    2006-01-19

    Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs) of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs). We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not) are attractive targets when seeking errors of gene prediction. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency). We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes.

  6. Detection of methicillin resistant Staphylococcus aureus (MRSA) from recreational beach using the mecA gene

    Science.gov (United States)

    Zulkifli, Aisya; Ahmad, Asmat

    2015-09-01

    Water samples were collected in triplicates from three different locations choosen from the recreational beach of Teluk Kemang, Port Dickson as sampling station including main area of recreation activity for the public. Bacteria were isolated from the water and cultured. Out of 286 presumptive Staphylococcus aureus enumerated by using culture method, only 4 (1.4 %) confirmed as Meticillin Resistant S. aureus (MRSA) based on PCR detection of mecA gene. Interestingly, all of MRSA detections were found at the main area of recreational activity. Our results suggested that public beaches may be reservoir for transmission of MRSA to beach visitors and PCR using the mecA gene is the fastest way to detect this pathogenic bacteria.

  7. Detection of Genes that Determine Maize Grain Quality Characteristics and Resistance to Stress Factors

    Directory of Open Access Journals (Sweden)

    Markovskyi, O.V.

    2014-01-01

    Full Text Available 200 experimental maize samples (Maize Company were examined for the presence of genes that determine the quality characteristics of grain (wx and fl-2 genes, herbicide (bar (pat, epsps genes and insect (cry-genes resistance. The total DNA was extracted from maize living plant tissue. Primers to detect wx, fl-2, bar (pat, mepsps, CP4 epsps, cry1A(b, cry1F, cry1A.105, mcry3A, cry2Ab2, cry3Bb1, cry34Ab1, cry35Ab1 genes were designed and selected. Multiplex and Touchdown PCR were worked out. PCR amplification of certain sequences was carried out. No transgenes (bar (pat, mepsps, CP4 epsps, cry1A(b, cry1F, cry1A.105, mcry3A, cry2Ab2, cry3Bb1, cry34Ab1, cry35Ab1 were found among 200 analyzed experimental maize samples. At the same time, fl-2 gene was found in 41 samples, wx gene was found in 192 analyzed samples.

  8. Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

    International Nuclear Information System (INIS)

    Irshad, S.; Nawaz, T.

    2008-01-01

    Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

  9. Detection of Shiga toxins genes by Multiplex PCR in clinical samples

    Directory of Open Access Journals (Sweden)

    2013-09-01

    Full Text Available Background: Different methods have been used for detection of shiga toxins; such as,  cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR.  For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results:  Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences.  The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.

  10. PCR detection of oxytetracycline resistance genes from diverse habitats in total community DNA and in streptomycete isolates.

    NARCIS (Netherlands)

    Nikolakopoulou, T.L.; Egan, S.; Overbeek, van L.S.; Guillaume, G.; Heuer, H.; Wellington, E.M.H.; Elsas, van J.D.; Collard, J.M.; Smalla, K.; Karagouni, A.D.

    2005-01-01

    A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (TcR) streptomycete isolates from

  11. Detection of single-copy functional genes in prokaryotic cells by two-pass TSA-FISH with polynucleotide probes.

    Science.gov (United States)

    Kawakami, Shuji; Hasegawa, Takuya; Imachi, Hiroyuki; Yamaguchi, Takashi; Harada, Hideki; Ohashi, Akiyoshi; Kubota, Kengo

    2012-02-01

    In situ detection of functional genes with single-cell resolution is currently of interest to microbiologists. Here, we developed a two-pass tyramide signal amplification (TSA)-fluorescence in situ hybridization (FISH) protocol with PCR-derived polynucleotide probes for the detection of single-copy genes in prokaryotic cells. The mcrA gene and the apsA gene in methanogens and sulfate-reducing bacteria, respectively, were targeted. The protocol showed bright fluorescence with a good signal-to-noise ratio and achieved a high efficiency of detection (>98%). The discrimination threshold was approximately 82-89% sequence identity. Microorganisms possessing the mcrA or apsA gene in anaerobic sludge samples were successfully detected by two-pass TSA-FISH with polynucleotide probes. The developed protocol is useful for identifying single microbial cells based on functional gene sequences. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Detection of the intercellular adhesion gene cluster (ica in clinical Staphylococcus aureus isolates

    Directory of Open Access Journals (Sweden)

    Namvar, Amirmorteza Ebrahimzadeh

    2013-04-01

    Full Text Available [english] is a major hospital and community pathogen having the aptitude to cause a wide variety of infections in men. The ability of microorganisms to produce biofilm facilitates them to withstand the host immune response and is recognized as one factor contributing to chronic or persistent infections. It was demonstrated that the -encoded genes lead to the biosynthesis of polysaccharide intercellular adhesion (PIA molecules, and may be involved in the accumulation phase of biofilm formation. Different studies have shown the decisive role of the gene as virulence factors in staphylococcal infections. This study was carried out to demonstrate the relationship between gene and production of slime layer in strains. Sixty strains were isolated from patients. The isolates were identified morphologically and biochemically following standard laboratory methods. After identification, the staphylococcal isolates were maintained in trypticase soy broth (TSB, to which 15% glycerol was added, and stored at –20°C. Slime formation and biofilm assay was monitored. A PCR assay was developed to identify the presence of (intercellular adhesion gene gene in all isolates. Thirty-nine slime producing colonies with CRA plates (65% formed black colors, the remaining 21 isolates were pink (35%. In the quantitative biofilm assay 35 (58% produced biofilm while 25 (42% isolates did not exhibit this property. All isolates were positive for detection of gene by PCR method. The interaction of and in the investigated isolates may be important in slime layer formation and biofilm phenomena.We propose PCR detection of the gene locus as a rapid and effective method to be used for discrimination between potentially virulent and nonvirulent isolates, with implications for therapeutic and preventive measures pertainin to the management of colonized indwelling catheters.

  13. Development of a rapid method for direct detection of tet(M) genes in soil from Danish farmland

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Sengeløv, Gitte; Jensen, Lars Bogø

    2004-01-01

    . The tet(M) gene was directly detected in 10-80% of the samples from the various farmland soils and could be detected in all samples tested after selective enrichment. To validate the obtained results, the method was applied to garden soil samples where lower prevalence of resistance was found. Result......A method for direct detection of antibiotic resistance genes in soil samples has been developed. The tetracycline resistance gene, tet(M), was used as a model. The method was validated on Danish farmland soil that had repeatedly been treated with pig manure slurry containing resistant bacteria......: A detection limit of 10(2)-10(3) copies of the tet(M) gene per gram of soil (in a Bacillus cereus group bacterium) was achieved. tet(M) gene was detected in soil samples with the highest prevalence on farmland treated with pig manure slurry....

  14. Detection of virulence-associated genes in pathogenic and commensal avian Escherichia coli isolates.

    Science.gov (United States)

    Paixão, A C; Ferreira, A C; Fontes, M; Themudo, P; Albuquerque, T; Soares, M C; Fevereiro, M; Martins, L; Corrêa de Sá, M I

    2016-07-01

    Poultry colibacillosis due to Avian Pathogenic Escherichia coli (APEC) is responsible for several extra-intestinal pathological conditions, leading to serious economic damage in poultry production. The most commonly associated pathologies are airsacculitis, colisepticemia, and cellulitis in broiler chickens, and salpingitis and peritonitis in broiler breeders. In this work a total of 66 strains isolated from dead broiler breeders affected with colibacillosis and 61 strains from healthy broilers were studied. Strains from broiler breeders were typified with serogroups O2, O18, and O78, which are mainly associated with disease. The serogroup O78 was the most prevalent (58%). All the strains were checked for the presence of 11 virulence genes: 1) arginine succinyltransferase A (astA); ii) E.coli hemeutilization protein A (chuA); iii) colicin V A/B (cvaA/B); iv) fimbriae mannose-binding type 1 (fimC); v) ferric yersiniabactin uptake A (fyuA); vi) iron-repressible high-molecular-weight proteins 2 (irp2); vii) increased serum survival (iss); viii) iron-uptake systems of E.coli D (iucD); ix) pielonefritis associated to pili C (papC); x) temperature sensitive haemaglutinin (tsh), and xi) vacuolating autotransporter toxin (vat), by Multiplex-PCR. The results showed that all genes are present in both commensal and pathogenic E. coli strains. The iron uptake-related genes and the serum survival gene were more prevalent among APEC. The adhesin genes, except tsh, and the toxin genes, except astA, were also more prevalent among APEC isolates. Except for astA and tsh, APEC strains harbored the majority of the virulence-associated genes studied and fimC was the most prevalent gene, detected in 96.97 and 88.52% of APEC and AFEC strains, respectively. Possession of more than one iron transport system seems to play an important role on APEC survival. © 2016 Poultry Science Association Inc.

  15. Bayesian logistic regression in detection of gene-steroid interaction for cancer at PDLIM5 locus.

    Science.gov (United States)

    Wang, Ke-Sheng; Owusu, Daniel; Pan, Yue; Xie, Changchun

    2016-06-01

    The PDZ and LIM domain 5 (PDLIM5) gene may play a role in cancer, bipolar disorder, major depression, alcohol dependence and schizophrenia; however, little is known about the interaction effect of steroid and PDLIM5 gene on cancer. This study examined 47 single-nucleotide polymorphisms (SNPs) within the PDLIM5 gene in the Marshfield sample with 716 cancer patients (any diagnosed cancer, excluding minor skin cancer) and 2848 noncancer controls. Multiple logistic regression model in PLINK software was used to examine the association of each SNP with cancer. Bayesian logistic regression in PROC GENMOD in SAS statistical software, ver. 9.4 was used to detect gene- steroid interactions influencing cancer. Single marker analysis using PLINK identified 12 SNPs associated with cancer (Plogistic regression in PROC GENMOD showed that both rs6532496 and rs951613 revealed strong gene-steroid interaction effects (OR=2.18, 95% CI=1.31-3.63 with P = 2.9 × 10⁻³ for rs6532496 and OR=2.07, 95% CI=1.24-3.45 with P = 5.43 × 10⁻³ for rs951613, respectively). Results from Bayesian logistic regression showed stronger interaction effects (OR=2.26, 95% CI=1.2-3.38 for rs6532496 and OR=2.14, 95% CI=1.14-3.2 for rs951613, respectively). All the 12 SNPs associated with cancer revealed significant gene-steroid interaction effects (P logistic regression and OR=2.59, 95% CI=1.4-3.97 from Bayesian logistic regression; respectively). This study provides evidence of common genetic variants within the PDLIM5 gene and interactions between PLDIM5 gene polymorphisms and steroid use influencing cancer.

  16. A new efficient statistical test for detecting variability in the gene expression data.

    Science.gov (United States)

    Mathur, Sunil; Dolo, Samuel

    2008-08-01

    DNA microarray technology allows researchers to monitor the expressions of thousands of genes under different conditions. The detection of differential gene expression under two different conditions is very important in microarray studies. Microarray experiments are multi-step procedures and each step is a potential source of variance. This makes the measurement of variability difficult because approach based on gene-by-gene estimation of variance will have few degrees of freedom. It is highly possible that the assumption of equal variance for all the expression levels may not hold. Also, the assumption of normality of gene expressions may not hold. Thus it is essential to have a statistical procedure which is not based on the normality assumption and also it can detect genes with differential variance efficiently. The detection of differential gene expression variance will allow us to identify experimental variables that affect different biological processes and accuracy of DNA microarray measurements.In this article, a new nonparametric test for scale is developed based on the arctangent of the ratio of two expression levels. Most of the tests available in literature require the assumption of normal distribution, which makes them inapplicable in many situations, and it is also hard to verify the suitability of the normal distribution assumption for the given data set. The proposed test does not require the assumption of the distribution for the underlying population and hence makes it more practical and widely applicable. The asymptotic relative efficiency is calculated under different distributions, which show that the proposed test is very powerful when the assumption of normality breaks down. Monte Carlo simulation studies are performed to compare the power of the proposed test with some of the existing procedures. It is found that the proposed test is more powerful than commonly used tests under almost all the distributions considered in the study. A

  17. Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.

    Science.gov (United States)

    Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto

    2018-08-01

    Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  19. Detection of stx1 and stx2 Genes in Pennsylvanian White-Tailed Deer

    Directory of Open Access Journals (Sweden)

    Steven A. Mauro

    2011-06-01

    Full Text Available Shiga toxin-producing E. coli carrying the stx1 and/or stx2 genes can cause multi-symptomatic illness in humans. A variety of terrestrial and aquatic environmental reservoirs of stx have been described. Culture based detection of microbes in deer species have found a low percentage of samples that have tested positive for Stx-producing microbes, suggesting that while deer may contain these microbes, their overall abundance in deer is low. In this study, quantitative PCR (qPCR was utilized to test for the presence of stx genes in white-tailed deer fecal matter in western Pennsylvania. In this culture independent screening, nearly half of the samples tested positive for the stx2 gene, with a bias towards samples that were concentrated with stx2. This study, while limited in scope, suggests that deer may be a greater reservoir for stx than was previously thought.

  20. Affinity-based biosensors as promising tools for gene doping detection.

    Science.gov (United States)

    Minunni, Maria; Scarano, Simona; Mascini, Marco

    2008-05-01

    Innovative bioanalytical approaches can be foreseen as interesting means for solving relevant emerging problems in anti-doping control. Sport authorities fear that the newer form of doping, so-called gene doping, based on a misuse of gene therapy, will be undetectable and thus much less preventable. The World Anti-Doping Agency has already asked scientists to assist in finding ways to prevent and detect this newest kind of doping. In this Opinion article we discuss the main aspects of gene doping, from the putative target analytes to suitable sampling strategies. Moreover, we discuss the potential application of affinity sensing in this field, which so far has been successfully applied to a variety of analytical problems, from clinical diagnostics to food and environmental analysis.

  1. Bioaerosol emissions and detection of airborne antibiotic resistance genes from a wastewater treatment plant

    Science.gov (United States)

    Li, Jing; Zhou, Liantong; Zhang, Xiangyu; Xu, Caijia; Dong, Liming; Yao, Maosheng

    2016-01-01

    Air samples from twelve sampling sites (including seven intra-plant sites, one upwind site and four downwind sites) from a wastewater treatment plant (WWTP) in Beijing were collected using a Reuter Centrifugal Sampler High Flow (RCS); and their microbial fractions were studied using culturing and high throughput gene sequence. In addition, the viable (fluorescent) bioaerosol concentrations for 7 intra-plant sites were also monitored for 30 min each using an ultraviolet aerodynamic particle sizer (UV-APS). Both air and water samples collected from the plant were investigated for possible bacterial antibiotic resistance genes and integrons using polymerase chain reaction (PCR) coupled with gel electrophoresis. The results showed that the air near sludge thickening basin was detected to have the highest level of culturable bacterial aerosols (up to 1697 CFU/m3) and fungal aerosols (up to 930 CFU/m3). For most sampling sites, fluorescent peaks were observed at around 3-4 μm, except the office building with a peak at 1.5 μm, with a number concentration level up to 1233-6533 Particles/m3. About 300 unique bacterial species, including human opportunistic pathogens, such as Comamonas Testosteroni and Moraxella Osloensis, were detected from the air samples collected over the biological reaction basin. In addition, we have detected the sul2 gene resistant to cotrimoxazole (also known as septra, bactrim and TMP-SMX) and class 1 integrase gene from the air samples collected from the screen room and the biological reaction basin. Overall, the screen room, sludge thickening basin and biological reaction basin imposed significant microbial exposure risks, including those from airborne antibiotic resistance genes.

  2. The Spike-and-Slab Lasso Generalized Linear Models for Prediction and Associated Genes Detection.

    Science.gov (United States)

    Tang, Zaixiang; Shen, Yueping; Zhang, Xinyan; Yi, Nengjun

    2017-01-01

    Large-scale "omics" data have been increasingly used as an important resource for prognostic prediction of diseases and detection of associated genes. However, there are considerable challenges in analyzing high-dimensional molecular data, including the large number of potential molecular predictors, limited number of samples, and small effect of each predictor. We propose new Bayesian hierarchical generalized linear models, called spike-and-slab lasso GLMs, for prognostic prediction and detection of associated genes using large-scale molecular data. The proposed model employs a spike-and-slab mixture double-exponential prior for coefficients that can induce weak shrinkage on large coefficients, and strong shrinkage on irrelevant coefficients. We have developed a fast and stable algorithm to fit large-scale hierarchal GLMs by incorporating expectation-maximization (EM) steps into the fast cyclic coordinate descent algorithm. The proposed approach integrates nice features of two popular methods, i.e., penalized lasso and Bayesian spike-and-slab variable selection. The performance of the proposed method is assessed via extensive simulation studies. The results show that the proposed approach can provide not only more accurate estimates of the parameters, but also better prediction. We demonstrate the proposed procedure on two cancer data sets: a well-known breast cancer data set consisting of 295 tumors, and expression data of 4919 genes; and the ovarian cancer data set from TCGA with 362 tumors, and expression data of 5336 genes. Our analyses show that the proposed procedure can generate powerful models for predicting outcomes and detecting associated genes. The methods have been implemented in a freely available R package BhGLM (http://www.ssg.uab.edu/bhglm/). Copyright © 2017 by the Genetics Society of America.

  3. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design.

    Science.gov (United States)

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-11-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from 29.9% to 37.8%. Copyright © 2014. Published by Elsevier B.V.

  4. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-01-01

    From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  5. Polymerase chain reaction detection of retinoblastoma gene deletions in paraffin-embedded mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1991-01-01

    A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  6. A Microchip for Integrated Single-Cell Gene Expression Profiling and Genotoxicity Detection

    Directory of Open Access Journals (Sweden)

    Hui Dong

    2016-09-01

    Full Text Available Microfluidics-based single-cell study is an emerging approach in personalized treatment or precision medicine studies. Single-cell gene expression holds a potential to provide treatment selections with maximized efficacy to help cancer patients based on a genetic understanding of their disease. This work presents a multi-layer microchip for single-cell multiplexed gene expression profiling and genotoxicity detection. Treated by three drug reagents (i.e., methyl methanesulfonate, docetaxel and colchicine with varied concentrations and time lengths, individual human cancer cells (MDA-MB-231 are lysed on-chip, and the released mRNA templates are captured and reversely transcribed into single strand DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, cyclin-dependent kinase inhibitor 1A (CDKN1A, and aurora kinase A (AURKA genes from single cells are amplified and real-time quantified through multiplex polymerase chain reaction. The microchip is capable of integrating all steps of single-cell multiplexed gene expression profiling, and providing precision detection of drug induced genotoxic stress. Throughput has been set to be 18, and can be further increased following the same approach. Numerical simulation of on-chip single cell trapping and heat transfer has been employed to evaluate the chip design and operation.

  7. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

    Science.gov (United States)

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

    2003-01-01

    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  8. Alternative splicing and differential gene expression in colon cancer detected by a whole genome exon array

    Directory of Open Access Journals (Sweden)

    Sugnet Charles

    2006-12-01

    Full Text Available Abstract Background Alternative splicing is a mechanism for increasing protein diversity by excluding or including exons during post-transcriptional processing. Alternatively spliced proteins are particularly relevant in oncology since they may contribute to the etiology of cancer, provide selective drug targets, or serve as a marker set for cancer diagnosis. While conventional identification of splice variants generally targets individual genes, we present here a new exon-centric array (GeneChip Human Exon 1.0 ST that allows genome-wide identification of differential splice variation, and concurrently provides a flexible and inclusive analysis of gene expression. Results We analyzed 20 paired tumor-normal colon cancer samples using a microarray designed to detect over one million putative exons that can be virtually assembled into potential gene-level transcripts according to various levels of prior supporting evidence. Analysis of high confidence (empirically supported transcripts identified 160 differentially expressed genes, with 42 genes occupying a network impacting cell proliferation and another twenty nine genes with unknown functions. A more speculative analysis, including transcripts based solely on computational prediction, produced another 160 differentially expressed genes, three-fourths of which have no previous annotation. We also present a comparison of gene signal estimations from the Exon 1.0 ST and the U133 Plus 2.0 arrays. Novel splicing events were predicted by experimental algorithms that compare the relative contribution of each exon to the cognate transcript intensity in each tissue. The resulting candidate splice variants were validated with RT-PCR. We found nine genes that were differentially spliced between colon tumors and normal colon tissues, several of which have not been previously implicated in cancer. Top scoring candidates from our analysis were also found to substantially overlap with EST-based bioinformatic

  9. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    Science.gov (United States)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  10. Non-invasive detection of urothelial cancer through the analysis of driver gene mutations and aneuploidy

    Science.gov (United States)

    Li, Lu; Douville, Christopher; Wang, Yuxuan; Cohen, Joshua David; Taheri, Diana; Silliman, Natalie; Schaefer, Joy; Ptak, Janine; Dobbyn, Lisa; Papoli, Maria; Kinde, Isaac; Afsari, Bahman; Tregnago, Aline C; Bezerra, Stephania M; VandenBussche, Christopher; Fujita, Kazutoshi; Ertoy, Dilek; Cunha, Isabela W; Yu, Lijia; Bivalacqua, Trinity J; Grollman, Arthur P; Diaz, Luis A; Karchin, Rachel; Danilova, Ludmila; Huang, Chao-Yuan; Shun, Chia-Tung; Turesky, Robert J; Yun, Byeong Hwa; Rosenquist, Thomas A; Pu, Yeong-Shiau; Hruban, Ralph H; Tomasetti, Cristian; Papadopoulos, Nickolas; Kinzler, Ken W

    2018-01-01

    Current non-invasive approaches for detection of urothelial cancers are suboptimal. We developed a test to detect urothelial neoplasms using DNA recovered from cells shed into urine. UroSEEK incorporates massive parallel sequencing assays for mutations in 11 genes and copy number changes on 39 chromosome arms. In 570 patients at risk for bladder cancer (BC), UroSEEK was positive in 83% of those who developed BC. Combined with cytology, UroSEEK detected 95% of patients who developed BC. Of 56 patients with upper tract urothelial cancer, 75% tested positive by UroSEEK, including 79% of those with non-invasive tumors. UroSEEK detected genetic abnormalities in 68% of urines obtained from BC patients under surveillance who demonstrated clinical evidence of recurrence. The advantages of UroSEEK over cytology were evident in low-grade BCs; UroSEEK detected 67% of cases whereas cytology detected none. These results establish the foundation for a new non-invasive approach for detection of urothelial cancer. PMID:29557778

  11. Development of a dot blot assay using gene probes for the detection of enteroviruses in water

    International Nuclear Information System (INIS)

    Margolin, A.B.

    1986-01-01

    Enteric viruses are viruses which replicate in the intestinal tract of man and animals. One mode of transmission for enteric viruses is the fecal-oral route. Drinking water which has been contaminated with sewage or sewage effluent has been implicated as a means for the spread of enteric viruses. Current methods for the detection of enteric viruses in water requires the use of animal cell culture. This technique has several drawbacks. More rapid techniques, such as fluorescent antibody or radioimmunoassay do not have the needed sensitivity to detect the low levels of virus found in contaminated water. An alternative technique for the detection of viruses in water was sought. Recent advances in recombinant DNA technology now makes it possible to detect viruses without the use of cell culture or antibodies. Gene probes that hybridize to the RNA of poliovirus and hepatitis A virus were tested for their ability to detect different enteric viruses. The probes were labeled with 32 P dCTP and 32 P dATP to a specific activity greater then 1.0 x 10 9 cpm/ug DNA. One infectious unit of poliovirus and hepatitis A virus was detected using labeled cDNA probes. Upon comparison, the dot blot assay was as sensitive as tissue culture for the detection of poliovirus in beef extract, secondary effluent, and tap water. Environmental samples, such as secondary effluent, reclaimed wastewater and unchlorinated drinking water were also assayed for poliovirus and hepatitis A virus with the use of gene probes. The results presented here offer an alternative method for screening water samples for the presence of enteric viruses

  12. Shrinkage covariance matrix approach based on robust trimmed mean in gene sets detection

    Science.gov (United States)

    Karjanto, Suryaefiza; Ramli, Norazan Mohamed; Ghani, Nor Azura Md; Aripin, Rasimah; Yusop, Noorezatty Mohd

    2015-02-01

    Microarray involves of placing an orderly arrangement of thousands of gene sequences in a grid on a suitable surface. The technology has made a novelty discovery since its development and obtained an increasing attention among researchers. The widespread of microarray technology is largely due to its ability to perform simultaneous analysis of thousands of genes in a massively parallel manner in one experiment. Hence, it provides valuable knowledge on gene interaction and function. The microarray data set typically consists of tens of thousands of genes (variables) from just dozens of samples due to various constraints. Therefore, the sample covariance matrix in Hotelling's T2 statistic is not positive definite and become singular, thus it cannot be inverted. In this research, the Hotelling's T2 statistic is combined with a shrinkage approach as an alternative estimation to estimate the covariance matrix to detect significant gene sets. The use of shrinkage covariance matrix overcomes the singularity problem by converting an unbiased to an improved biased estimator of covariance matrix. Robust trimmed mean is integrated into the shrinkage matrix to reduce the influence of outliers and consequently increases its efficiency. The performance of the proposed method is measured using several simulation designs. The results are expected to outperform existing techniques in many tested conditions.

  13. ICGE: an R package for detecting relevant clusters and atypical units in gene expression

    Directory of Open Access Journals (Sweden)

    Irigoien Itziar

    2012-02-01

    Full Text Available Abstract Background Gene expression technologies have opened up new ways to diagnose and treat cancer and other diseases. Clustering algorithms are a useful approach with which to analyze genome expression data. They attempt to partition the genes into groups exhibiting similar patterns of variation in expression level. An important problem associated with gene classification is to discern whether the clustering process can find a relevant partition as well as the identification of new genes classes. There are two key aspects to classification: the estimation of the number of clusters, and the decision as to whether a new unit (gene, tumor sample... belongs to one of these previously identified clusters or to a new group. Results ICGE is a user-friendly R package which provides many functions related to this problem: identify the number of clusters using mixed variables, usually found by applied biomedical researchers; detect whether the data have a cluster structure; identify whether a new unit belongs to one of the pre-identified clusters or to a novel group, and classify new units into the corresponding cluster. The functions in the ICGE package are accompanied by help files and easy examples to facilitate its use. Conclusions We demonstrate the utility of ICGE by analyzing simulated and real data sets. The results show that ICGE could be very useful to a broad research community.

  14. Detection of Promyelocytic Leukemia/Retinoic Acid Receptor α (PML/RARα Fusion Gene with Functionalized Graphene Oxide

    Directory of Open Access Journals (Sweden)

    Hongwei Wang

    2013-06-01

    Full Text Available An attempt was made to use functionalized graphene oxide (GO to detect the Promyelocytic leukemia/Retinoic acid receptor α fusion gene (PML/RARα fusion gene, a marker gene of acute promyelocytic leukemia. The functionalized GO was prepared by chemical exfoliation method, followed by a polyethylene glycol grafting. It is found that the functionalized GO can selectively adsorb the fluorescein isothiocyanate (FITC-labeled single-stranded DNA probe and quench its fluorescence. The probe can be displaced by the PML/RARα fusion gene to restore the fluorescence, which can be detected by laser confocal microscopy and flow cytometry. These can be used to detect the presence of the PML/RARα fusion gene. This detection method is verified to be fast, simple and reliable.

  15. A combination test for detection of gene-environment interaction in cohort studies.

    Science.gov (United States)

    Coombes, Brandon; Basu, Saonli; McGue, Matt

    2017-07-01

    Identifying gene-environment (G-E) interactions can contribute to a better understanding of disease etiology, which may help researchers develop disease prevention strategies and interventions. One big criticism of studying G-E interaction is the lack of power due to sample size. Studies often restrict the interaction search to the top few hundred hits from a genome-wide association study or focus on potential candidate genes. In this paper, we test interactions between a candidate gene and an environmental factor to improve power by analyzing multiple variants within a gene. We extend recently developed score statistic based genetic association testing approaches to the G-E interaction testing problem. We also propose tests for interaction using gene-based summary measures that pool variants together. Although it has recently been shown that these summary measures can be biased and may lead to inflated type I error, we show that under several realistic scenarios, we can still provide valid tests of interaction. These tests use significantly less degrees of freedom and thus can have much higher power to detect interaction. Additionally, we demonstrate that the iSeq-aSum-min test, which combines a gene-based summary measure test, iSeq-aSum-G, and an interaction-based summary measure test, iSeq-aSum-I, provides a powerful alternative to test G-E interaction. We demonstrate the performance of these approaches using simulation studies and illustrate their performance to study interaction between the SNPs in several candidate genes and family climate environment on alcohol consumption using the Minnesota Center for Twin and Family Research dataset. © 2017 WILEY PERIODICALS, INC.

  16. Detecting coordinated regulation of multi-protein complexes using logic analysis of gene expression

    Directory of Open Access Journals (Sweden)

    Yeates Todd O

    2009-12-01

    Full Text Available Abstract Background Many of the functional units in cells are multi-protein complexes such as RNA polymerase, the ribosome, and the proteasome. For such units to work together, one might expect a high level of regulation to enable co-appearance or repression of sets of complexes at the required time. However, this type of coordinated regulation between whole complexes is difficult to detect by existing methods for analyzing mRNA co-expression. We propose a new methodology that is able to detect such higher order relationships. Results We detect coordinated regulation of multiple protein complexes using logic analysis of gene expression data. Specifically, we identify gene triplets composed of genes whose expression profiles are found to be related by various types of logic functions. In order to focus on complexes, we associate the members of a gene triplet with the distinct protein complexes to which they belong. In this way, we identify complexes related by specific kinds of regulatory relationships. For example, we may find that the transcription of complex C is increased only if the transcription of both complex A AND complex B is repressed. We identify hundreds of examples of coordinated regulation among complexes under various stress conditions. Many of these examples involve the ribosome. Some of our examples have been previously identified in the literature, while others are novel. One notable example is the relationship between the transcription of the ribosome, RNA polymerase and mannosyltransferase II, which is involved in N-linked glycan processing in the Golgi. Conclusions The analysis proposed here focuses on relationships among triplets of genes that are not evident when genes are examined in a pairwise fashion as in typical clustering methods. By grouping gene triplets, we are able to decipher coordinated regulation among sets of three complexes. Moreover, using all triplets that involve coordinated regulation with the ribosome

  17. Analysis of human reticulocyte genes reveals altered erythropoiesis: potential use to detect recombinant human erythropoietin doping.

    Science.gov (United States)

    Varlet-Marie, Emmanuelle; Audran, Michel; Lejeune, Mireille; Bonafoux, Béatrice; Sicart, Marie-Therese; Marti, Jacques; Piquemal, David; Commes, Thérèse

    2004-08-01

    Enhancement of oxygen delivery to tissues is associated with improved sporting performance. One way of enhancing oxygen delivery is to take recombinant human erythropoietin (rHuEpo), which is an unethical and potentially dangerous practice. However, detection of the use of rHuEpo remains difficult in situations such as: i) several days after the end of treatment ii) when a treatment with low doses is conducted iii) if the rHuEpo effect is increased by other substances. In an attempt to detect rHuEpo abuse, we selected erythroid gene markers from a SAGE library and analyzed the effects of rHuEpo administration on expression of the HBB, FTL and OAZ genes. Ten athletes were assigned to the rHuEpo or placebo group. The rHuEpo group received subcutaneous injections of rHuEpo (50 UI/kg three times a week, 4 weeks; 20 UI/kg three times a week, 2 weeks). HBB, FTL and OAZ gene profiles were monitored by real time-polymerase chain reaction (PCR) quantification during and for 3 weeks after drug administration. The global analysis of these targeted genes detected in whole blood samples showed a characteristic profile of subjects misusing rHuEpo with a increase above the threshold levels. The individual analysis of OAZ mRNA seemed indicative of rHuEpo treatment. The performance-enhancing effect of rHuEpo treatment is greater than the duration of hematologic changes associated with rHuEpo misuse. Although direct electrophoretic methods to detect rHuEpo have been developed, recombinant isoforms of rHuEpo are not detectable some days after the last subcutaneous injection. To overcome these limitations indirect OFF models have been developed. Our data suggest that, in the near future, it will be possible to consolidate results achievable with the OFF models by analyzing selected erythroid gene markers as a supplement to indirect methods.

  18. A resampling-based meta-analysis for detection of differential gene expression in breast cancer

    International Nuclear Information System (INIS)

    Gur-Dedeoglu, Bala; Konu, Ozlen; Kir, Serkan; Ozturk, Ahmet Rasit; Bozkurt, Betul; Ergul, Gulusan; Yulug, Isik G

    2008-01-01

    proposed meta-analysis approach has the ability to detect a set of differentially expressed genes with the least amount of within-group variability, thus providing highly stable gene lists for class prediction. Increased statistical power and stringent filtering criteria used in the present study also make identification of novel candidate genes possible and may provide further insight to improve our understanding of breast cancer development

  19. A resampling-based meta-analysis for detection of differential gene expression in breast cancer

    Directory of Open Access Journals (Sweden)

    Ergul Gulusan

    2008-12-01

    -time qRT-PCR supported the meta-analysis results. Conclusion The proposed meta-analysis approach has the ability to detect a set of differentially expressed genes with the least amount of within-group variability, thus providing highly stable gene lists for class prediction. Increased statistical power and stringent filtering criteria used in the present study also make identification of novel candidate genes possible and may provide further insight to improve our understanding of breast cancer development.

  20. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)

    1995-11-06

    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  1. Detection of Amp C genes encoding for beta-lactamases in Escherichia coli and Klebsiella pneumoniae

    Directory of Open Access Journals (Sweden)

    M Shanthi

    2012-01-01

    Full Text Available Purpose : Amp C beta-lactamase are Ambler class C enzymes that confer resistance to extended spectrum cephalosporins and are not inhibited by beta-lactamase inhibitors. Their detection is crucial, since the phenotypic tests are not standardised leading to ambiguity in interpretation of results. This study was done to detect the types of Amp C prevalent in Escherichia coli and Klebsiella pneumoniae by multiplex polymerase chain reaction (PCR. Materials and Methods : Seventy-seven consecutive cefoxitin resistant clinical isolates of E. coli (n = 25 and K. pneumoniae (n = 52 were included in the study. Antibiotic susceptibility testing to various classes of antibiotics was performed by disc diffusion using Clinical Laboratory Standards Institute (CLSI guidelines. Minimum inhibitory concentration (MIC to cefoxitin, imipenem and meropenem were determined by broth microdilution method. Isolates were screened for production of Extended Spectrum Beta-Lactamase (ESBL. Multiplex PCR was performed for the detection of Amp C genes after phenotypic testing (Hodge test and inhibitor based test. Results : Cefoxitin Hodge test was positive in 40 isolates which included 20 E. coli and 20 K. pneumoniae. There was zone enhancement with boronic acid in 55 isolates, of which 36 were K. pneumoniae and 19 were E. coli. Multiplex PCR detected Amp C in 11/25 E. coli and 12/52 K. pneumoniae isolates. The Amp C genes detected were CIT (Amp C origin - Citrobacter freundii, DHA (Dhahran Hospital, Saudi Arabia, ACC (Ambler class C, EBC (Amp C origin - Enterobacter cloacae groups. ESBL was co-produced in 54 isolates. Conclusions : Amp C was detected in 29.87% of the study isolates. Majority of them co-produced ESBL. The most common Amp C was the CIT family. Screen tests for cefoxitin resistance may be falsely positive due to production of carbapenamases.

  2. The application of reporter gene assays for the detection of endocrine disruptors in sport supplements

    Energy Technology Data Exchange (ETDEWEB)

    Plotan, Monika; Elliott, Christopher T. [Institute of Agri-Food and Land Use, School of Biological Sciences, Queen' s University Belfast, Belfast BT95AG, Northern Ireland (United Kingdom); Scippo, Marie Louise [Department of Food Sciences, University of Liege, 4000 Liege (Belgium); Muller, Marc [Molecular Biology and Genetic Engineering GIGA-R, University of Liege, 4000 Liege (Belgium); Antignac, Jean-Philippe [LABERCA, ENVN, USC INRA 2013, BP 50707, 44 307, Nantes (France); Malone, Edward [The State Laboratory, Young' s Cross, Celbridge, Co. Kildare (Ireland); Bovee, Toine F.H. [RIKILT Institute of Food Safety, P.O. Box 230, AE Wageningen 6700 (Netherlands); Mitchell, Samuel [Agri-Food and Biosciences Institute, Belfast BT9 5PX (United Kingdom); Connolly, Lisa, E-mail: l.connolly@qub.ac.uk [Institute of Agri-Food and Land Use, School of Biological Sciences, Queen' s University Belfast, Belfast BT95AG, Northern Ireland (United Kingdom)

    2011-08-26

    The increasing availability and use of sports supplements is of concern as highlighted by a number of studies reporting endocrine disruptor contamination in such products. The health food supplement market, including sport supplements, is growing across the Developed World. Therefore, the need to ensure the quality and safety of sport supplements for the consumer is essential. The development and validation of two reporter gene assays coupled with solid phase sample preparation enabling the detection of estrogenic and androgenic constituents in sport supplements is reported. Both assays were shown to be of high sensitivity with the estrogen and androgen reporter gene assays having an EC{sub 50} of 0.01 ng mL{sup -1} and 0.16 ng mL{sup -1} respectively. The developed assays were applied in a survey of 63 sport supplements samples obtained across the Island of Ireland with an additional seven reference samples previously investigated using LC-MS/MS. Androgen and estrogen bio-activity was found in 71% of the investigated samples. Bio-activity profiling was further broken down into agonists, partial agonists and antagonists. Supplements (13) with the strongest estrogenic bio-activity were chosen for further investigation. LC-MS/MS analysis of these samples determined the presence of phytoestrogens in seven of them. Supplements (38) with androgen bio-activity were also selected for further investigation. Androgen agonist bio-activity was detected in 12 supplements, antagonistic bio-activity was detected in 16 and partial antagonistic bio-activity was detected in 10. A further group of supplements (7) did not present androgenic bio-activity when tested alone but enhanced the androgenic agonist bio-activity of dihydrotestosterone when combined. The developed assays offer advantages in detection of known, unknown and low-level mixtures of endocrine disruptors over existing analytical screening techniques. For the detection and identification of constituent hormonally

  3. Geographically weighted regression as a generalized Wombling to detect barriers to gene flow.

    Science.gov (United States)

    Diniz-Filho, José Alexandre Felizola; Soares, Thannya Nascimento; de Campos Telles, Mariana Pires

    2016-08-01

    Barriers to gene flow play an important role in structuring populations, especially in human-modified landscapes, and several methods have been proposed to detect such barriers. However, most applications of these methods require a relative large number of individuals or populations distributed in space, connected by vertices from Delaunay or Gabriel networks. Here we show, using both simulated and empirical data, a new application of geographically weighted regression (GWR) to detect such barriers, modeling the genetic variation as a "local" linear function of geographic coordinates (latitude and longitude). In the GWR, standard regression statistics, such as R(2) and slopes, are estimated for each sampling unit and thus are mapped. Peaks in these local statistics are then expected close to the barriers if genetic discontinuities exist, capturing a higher rate of population differentiation among neighboring populations. Isolation-by-Distance simulations on a longitudinally warped lattice revealed that higher local slopes from GWR coincide with the barrier detected with Monmonier algorithm. Even with a relatively small effect of the barrier, the power of local GWR in detecting the east-west barriers was higher than 95 %. We also analyzed empirical data of genetic differentiation among tree populations of Dipteryx alata and Eugenia dysenterica Brazilian Cerrado. GWR was applied to the principal coordinate of the pairwise FST matrix based on microsatellite loci. In both simulated and empirical data, the GWR results were consistent with discontinuities detected by Monmonier algorithm, as well as with previous explanations for the spatial patterns of genetic differentiation for the two species. Our analyses reveal how this new application of GWR can viewed as a generalized Wombling in a continuous space and be a useful approach to detect barriers and discontinuities to gene flow.

  4. The application of reporter gene assays for the detection of endocrine disruptors in sport supplements

    International Nuclear Information System (INIS)

    Plotan, Monika; Elliott, Christopher T.; Scippo, Marie Louise; Muller, Marc; Antignac, Jean-Philippe; Malone, Edward; Bovee, Toine F.H.; Mitchell, Samuel; Connolly, Lisa

    2011-01-01

    The increasing availability and use of sports supplements is of concern as highlighted by a number of studies reporting endocrine disruptor contamination in such products. The health food supplement market, including sport supplements, is growing across the Developed World. Therefore, the need to ensure the quality and safety of sport supplements for the consumer is essential. The development and validation of two reporter gene assays coupled with solid phase sample preparation enabling the detection of estrogenic and androgenic constituents in sport supplements is reported. Both assays were shown to be of high sensitivity with the estrogen and androgen reporter gene assays having an EC 50 of 0.01 ng mL -1 and 0.16 ng mL -1 respectively. The developed assays were applied in a survey of 63 sport supplements samples obtained across the Island of Ireland with an additional seven reference samples previously investigated using LC-MS/MS. Androgen and estrogen bio-activity was found in 71% of the investigated samples. Bio-activity profiling was further broken down into agonists, partial agonists and antagonists. Supplements (13) with the strongest estrogenic bio-activity were chosen for further investigation. LC-MS/MS analysis of these samples determined the presence of phytoestrogens in seven of them. Supplements (38) with androgen bio-activity were also selected for further investigation. Androgen agonist bio-activity was detected in 12 supplements, antagonistic bio-activity was detected in 16 and partial antagonistic bio-activity was detected in 10. A further group of supplements (7) did not present androgenic bio-activity when tested alone but enhanced the androgenic agonist bio-activity of dihydrotestosterone when combined. The developed assays offer advantages in detection of known, unknown and low-level mixtures of endocrine disruptors over existing analytical screening techniques. For the detection and identification of constituent hormonally active compounds the

  5. Insect-gene-activity detection system for chemical and biological warfare agents and toxic industrial chemicals

    Science.gov (United States)

    Mackie, Ryan S.; Schilling, Amanda S.; Lopez, Arturo M.; Rayms-Keller, Alfredo

    2002-02-01

    Detection of multiple chemical and biological weapons (CBW) agents and/or complex mixtures of toxic industrial chemicals (TIC) is imperative for both the commercial and military sectors. In a military scenario, a multi-CBW attack would create confusion, thereby delaying decontamination and therapeutic efforts. In the commercial sector, polluted sites invariably contain a mixture of TIC. Novel detection systems capable of detecting CBW and TIC are sorely needed. While it may be impossible to build a detector capable of discriminating all the possible combinations of CBW, a detection system capable of statistically predicting the most likely composition of a given mixture is within the reach of current emerging technologies. Aquatic insect-gene activity may prove to be a sensitive, discriminating, and elegant paradigm for the detection of CBW and TIC. We propose to systematically establish the expression patterns of selected protein markers in insects exposed to specific mixtures of chemical and biological warfare agents to generate a library of biosignatures of exposure. The predicting capabilities of an operational library of biosignatures of exposures will allow the detection of emerging novel or genetically engineered agents, as well as complex mixtures of chemical and biological weapons agents. CBW and TIC are discussed in the context of war, terrorism, and pollution.

  6. Detection of exogenous gene doping of IGF-I by a real-time quantitative PCR assay.

    Science.gov (United States)

    Zhang, Jin-Ju; Xu, Jing-Feng; Shen, Yong-Wei; Ma, Shi-Jiao; Zhang, Ting-Ting; Meng, Qing-Lin; Lan, Wen-Jun; Zhang, Chun; Liu, Xiao-Mei

    2017-07-01

    Gene doping can be easily concealed since its product is similar to endogenous protein, making its effective detection very challenging. In this study, we selected insulin-like growth factor I (IGF-I) exogenous gene for gene doping detection. First, the synthetic IGF-I gene was subcloned to recombinant adeno-associated virus (rAAV) plasmid to produce recombinant rAAV2/IGF-I-GFP vectors. Second, in an animal model, rAAV2/IGF-I-GFP vectors were injected into the thigh muscle tissue of mice, and then muscle and blood specimens were sampled at different time points for total DNA isolation. Finally, real-time quantitative PCR was employed to detect the exogenous gene doping of IGF-I. In view of the characteristics of endogenous IGF-I gene sequences, a TaqMan probe was designed at the junction of exons 2 and 3 of IGF-I gene to distinguish it from the exogenous IGF-I gene. In addition, an internal reference control plasmid and its probe were used in PCR to rule out false-positive results through comparison of their threshold cycle (Ct) values. Thus, an accurate exogenous IGF-I gene detection approach was developed in this study. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

  7. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  8. Rapid Molecular detection of citrus brown spot disease using ACT gene in Alternaria alternata

    Directory of Open Access Journals (Sweden)

    Hamid Moghimi

    2017-06-01

    Full Text Available Introduction:Using rapid detection methods is important for detection of plant pathogens and also prevention through spreading pests in agriculture. Citrus brown spot disease caused by pathogenic isolates of Alternaria alternata is a common disease in Iran. Materials and methods: In this study, for the first time a PCR based molecular method was used for rapid diagnosis of brown spot disease. Nine isolates of A. Alternata were isolated in PDA medium from different citrus gardens. The plant pathogenic activity was examined in tangerine leaves for isolates. Results showed that these isolates are the agents of brown spot disease. PCR amplification of specific ACT-toxin gene was performed for DNA extracted from A. alternata isolates, with 11 different fungal isolates as negative controls and 5 DNA samples extracted from soil. Results: Results showed that A. alternata, the causal agent of brown spot disease, can be carefully distinguished from other pathogenic agents by performing PCR amplification with specific primers for ACT toxin gene. Also, the results from Nested-PCR method confirmed the primary reaction and the specificity of A. alternata for brown spot disease. PCR results to control samples of the other standard fungal isolates, showed no amplification band. In addition, PCR with the DNA extracted from contaminated soils confirmed the presence of ACT toxin gene. Discussion and conclusion: Molecular procedure presented here can be used in rapid identification and prevention of brown spot infection in citrus gardens all over the country.

  9. Digenic mutations involving both the BSND and GJB2 genes detected in Bartter syndrome type IV.

    Science.gov (United States)

    Wang, Hong-Han; Feng, Yong; Li, Hai-Bo; Wu, Hong; Mei, Ling-Yun; Wang, Xing-Wei; Jiang, Lu; He, Chu-Feng

    2017-01-01

    Bartter syndrome type IV, characterized by salt-losing nephropathies and sensorineural deafness, is caused by mutations of BSND or simultaneous mutations of both CLCNKA and CLCNKB. GJB2 is the primary causative gene for non-syndromic sensorineural deafness and associated with several syndromic sensorineural deafness. Owing to the rarity of Bartter syndrome, only a few mutations have been reported in the abovementioned causative genes. To investigate the underlying mutations in a Chinese patient with Bartter syndrome type IV, genetic analysis of BSND, CLCNKA, CLCNKB and GJB2 were performed by polymerase chain reaction and direct sequencing. Finally, double homozygous mutations c.22C > T (p.Arg8Trp) and c.127G > A (Val43Ile) were detected in exon 1 of BSND. Intriguingly, compound heterozygous mutations c.235delC (p.Leu79CysfsX3) and c.109G > A (p.Val37Ile) were also revealed in exon 2 of GJB2 in the same patient. No pathogenic mutations were found in CLCNKA and CLCNKB. Our results indicated that the homozygous mutation c.22C > T was the key genetic reason for the proband, and a digenic effect of BSND and GJB2 might contributed to sensorineural deafness. To our knowledge, it was the first report showing that the GJB2 gene mutations were detected in Bartter syndrome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. PanCoreGen - Profiling, detecting, annotating protein-coding genes in microbial genomes.

    Science.gov (United States)

    Paul, Sandip; Bhardwaj, Archana; Bag, Sumit K; Sokurenko, Evgeni V; Chattopadhyay, Sujay

    2015-12-01

    A large amount of genomic data, especially from multiple isolates of a single species, has opened new vistas for microbial genomics analysis. Analyzing the pan-genome (i.e. the sum of genetic repertoire) of microbial species is crucial in understanding the dynamics of molecular evolution, where virulence evolution is of major interest. Here we present PanCoreGen - a standalone application for pan- and core-genomic profiling of microbial protein-coding genes. PanCoreGen overcomes key limitations of the existing pan-genomic analysis tools, and develops an integrated annotation-structure for a species-specific pan-genomic profile. It provides important new features for annotating draft genomes/contigs and detecting unidentified genes in annotated genomes. It also generates user-defined group-specific datasets within the pan-genome. Interestingly, analyzing an example-set of Salmonella genomes, we detect potential footprints of adaptive convergence of horizontally transferred genes in two human-restricted pathogenic serovars - Typhi and Paratyphi A. Overall, PanCoreGen represents a state-of-the-art tool for microbial phylogenomics and pathogenomics study. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. PanCoreGen – profiling, detecting, annotating protein-coding genes in microbial genomes

    Science.gov (United States)

    Bhardwaj, Archana; Bag, Sumit K; Sokurenko, Evgeni V.

    2015-01-01

    A large amount of genomic data, especially from multiple isolates of a single species, has opened new vistas for microbial genomics analysis. Analyzing pan-genome (i.e. the sum of genetic repertoire) of microbial species is crucial in understanding the dynamics of molecular evolution, where virulence evolution is of major interest. Here we present PanCoreGen – a standalone application for pan- and core-genomic profiling of microbial protein-coding genes. PanCoreGen overcomes key limitations of the existing pan-genomic analysis tools, and develops an integrated annotation-structure for species-specific pan-genomic profile. It provides important new features for annotating draft genomes/contigs and detecting unidentified genes in annotated genomes. It also generates user-defined group-specific datasets within the pan-genome. Interestingly, analyzing an example-set of Salmonella genomes, we detect potential footprints of adaptive convergence of horizontally transferred genes in two human-restricted pathogenic serovars – Typhi and Paratyphi A. Overall, PanCoreGen represents a state-of-the-art tool for microbial phylogenomics and pathogenomics study. PMID:26456591

  12. Partial antiviral activities detection of chicken Mx jointing with neuraminidase gene (NA against Newcastle disease virus.

    Directory of Open Access Journals (Sweden)

    Yani Zhang

    Full Text Available As an attempt to increase the resistance to Newcastle Disease Virus (NDV and so further reduction of its risk on the poultry industry. This work aimed to build the eukaryotic gene co-expression plasmid of neuraminidase (NA gene and myxo-virus resistance (Mx and detect the gene expression in transfected mouse fibroblasts (NIH-3T3 cells, it is most important to investigate the influence of the recombinant plasmid on the chicken embryonic fibroblasts (CEF cells. cDNA fragment of NA and mutant Mx gene were derived from pcDNA3.0-NA and pcDNA3.0-Mx plasmid via PCR, respectively, then NA and Mx cDNA fragment were inserted into the multiple cloning sites of pVITRO2 to generate the eukaryotic co-expression plasmid pVITRO2-Mx-NA. The recombinant plasmid was confirmed by restriction endonuclease treatment and sequencing, and it was transfected into the mouse fibroblasts (NIH-3T3 cells. The expression of genes in pVITRO2-Mx-NA were measured by RT-PCR and indirect immunofluorescence assay (IFA. The recombinant plasmid was transfected into CEF cells then RT-PCR and the micro-cell inhibition tests were used to test the antiviral activity for NDV. Our results showed that co-expression vector pVITRO2-Mx-NA was constructed successfully; the expression of Mx and NA could be detected in both NIH-3T3 and CEF cells. The recombinant proteins of Mx and NA protect CEF cells from NDV infection until after 72 h of incubation but the individually mutagenic Mx protein or NA protein protects CEF cells from NDV infection till 48 h post-infection, and co-transfection group decreased significantly NDV infection compared with single-gene transfection group (P<0. 05, indicating that Mx-NA jointing contributed to delaying the infection of NDV in single-cell level and the co-transfection of the jointed genes was more powerful than single one due to their synergistic effects.

  13. Efficacy of Exome-Targeted Capture Sequencing to Detect Mutations in Known Cerebellar Ataxia Genes.

    Science.gov (United States)

    Coutelier, Marie; Hammer, Monia B; Stevanin, Giovanni; Monin, Marie-Lorraine; Davoine, Claire-Sophie; Mochel, Fanny; Labauge, Pierre; Ewenczyk, Claire; Ding, Jinhui; Gibbs, J Raphael; Hannequin, Didier; Melki, Judith; Toutain, Annick; Laugel, Vincent; Forlani, Sylvie; Charles, Perrine; Broussolle, Emmanuel; Thobois, Stéphane; Afenjar, Alexandra; Anheim, Mathieu; Calvas, Patrick; Castelnovo, Giovanni; de Broucker, Thomas; Vidailhet, Marie; Moulignier, Antoine; Ghnassia, Robert T; Tallaksen, Chantal; Mignot, Cyril; Goizet, Cyril; Le Ber, Isabelle; Ollagnon-Roman, Elisabeth; Pouget, Jean; Brice, Alexis; Singleton, Andrew; Durr, Alexandra

    2018-05-01

    Molecular diagnosis is difficult to achieve in disease groups with a highly heterogeneous genetic background, such as cerebellar ataxia (CA). In many patients, candidate gene sequencing or focused resequencing arrays do not allow investigators to reach a genetic conclusion. To assess the efficacy of exome-targeted capture sequencing to detect mutations in genes broadly linked to CA in a large cohort of undiagnosed patients and to investigate their prevalence. Three hundred nineteen index patients with CA and without a history of dominant transmission were included in the this cohort study by the Spastic Paraplegia and Ataxia Network. Centralized storage was in the DNA and cell bank of the Brain and Spine Institute, Salpetriere Hospital, Paris, France. Patients were classified into 6 clinical groups, with the largest being those with spastic ataxia (ie, CA with pyramidal signs [n = 100]). Sequencing was performed from January 1, 2014, through December 31, 2016. Detected variants were classified as very probably or definitely causative, possibly causative, or of unknown significance based on genetic evidence and genotype-phenotype considerations. Identification of variants in genes broadly linked to CA, classified in pathogenicity groups. The 319 included patients had equal sex distribution (160 female [50.2%] and 159 male patients [49.8%]; mean [SD] age at onset, 27.9 [18.6] years). The age at onset was younger than 25 years for 131 of 298 patients (44.0%) with complete clinical information. Consanguinity was present in 101 of 298 (33.9%). Very probable or definite diagnoses were achieved for 72 patients (22.6%), with an additional 19 (6.0%) harboring possibly pathogenic variants. The most frequently mutated genes were SPG7 (n = 14), SACS (n = 8), SETX (n = 7), SYNE1 (n = 6), and CACNA1A (n = 6). The highest diagnostic rate was obtained for patients with an autosomal recessive CA with oculomotor apraxia-like phenotype (6 of 17 [35.3%]) or

  14. [Detection of putative polysaccharide biosynthesis genes in Azospirillum brasilense strains from serogroups I and II].

    Science.gov (United States)

    Petrova, L P; Prilipov, A G; Katsy, E I

    2017-01-01

    It is known that in Azospirillum brasilense strains Sp245 and SR75 included in serogroup I, the repeat units of their O-polysaccharides consist of five residues of D-rhamnose, and in strain SR15, of four; and the heteropolymeric O-polysaccharide of A. brasilense type strain Sp7 from serogroup II contains not less than five types of repeat units. In the present work, a complex of nondegenerate primers to the genes of A. brasilense Sp245 plasmids AZOBR_p6, AZOBR_p3, and AZOBR_p2, which encode putative enzymes for the biosynthesis of core oligosaccharide and O-polysaccharide of lipopolysaccharide, capsular polysaccharides, and exopolysaccharides, was proposed. By using the designed primers, products of the expected sizes were synthesized in polymerase chain reactions on genomic DNA of A. brasilense Sp245, SR75, SR15, and Sp7 in 36, 29, 23, and 12 cases, respectively. As a result of sequencing of a number of amplicons, a high (86–99%) level of identity of the corresponding putative polysaccharide biosynthesis genes in three A. brasilense strains from serogroup I was detected. In a blotting-hybridization reaction with the biotin-labeled DNA of the A. brasilense gene AZOBR_p60122 coding for putative permease of the ABC transporter of polysaccharides, localization of the homologous gene in ~120-MDa plasmids of the bacteria A. brasilense SR15 and SR75 was revealed.

  15. Detecting Role Errors in the Gene Hierarchy of the NCI Thesaurus

    Directory of Open Access Journals (Sweden)

    Yehoshua Perl

    2008-01-01

    Full Text Available Gene terminologies are playing an increasingly important role in the ever-growing field of genomic research. While errors in large, complex terminologies are inevitable, gene terminologies are even more susceptible to them due to the rapid growth of genomic knowledge and the nature of its discovery. It is therefore very important to establish quality- assurance protocols for such genomic-knowledge repositories. Different kinds of terminologies oftentimes require auditing methodologies adapted to their particular structures. In light of this, an auditing methodology tailored to the characteristics of the NCI Thesaurus’s (NCIT’s Gene hierarchy is presented. The Gene hierarchy is of particular interest to the NCIT’s designers due to the primary role of genomics in current cancer research. This multiphase methodology focuses on detecting role-errors, such as missing roles or roles with incorrect or incomplete target structures, occurring within that hierarchy. The methodology is based on two kinds of abstraction networks, called taxonomies, that highlight the role distribution among concepts within the IS-A (subsumption hierarchy. These abstract views tend to highlight portions of the hierarchy having a higher concentration of errors. The errors found during an application of the methodology

  16. Diversity of virulence genes in Brucella melitensis and Brucella abortus detected from patients with rheumatoid arthritis.

    Science.gov (United States)

    Rahdar, Hossein Ali; Golmohammadi, Reza; Mirnejad, Reza; Ataee, Ramezan Ali; Alishiri, Gholam Hossein; Kazemian, Hossein

    2018-03-22

    The presence of Brucella melitensis and Brucella abortus genomes were investigated in the synovial fluid (SF) samples from 90 patients with rheumatoid arthritis (RA). DNA extraction and PCR assay were performed for simultaneous identification and discrimination of B. melitensis and B. abortus from the SF using three specific primers. After gel electrophoresis, the PCR products were confirmed by DNA sequencing. The cbg, omp31, manA, virB, and znuA virulence genes typing were performed by multiplex-PCR. Of the 90 samples, 14 were positive for B. melitensis (n = 9; 10%) and B. abortus (n = 5; 5.5%). The virulotyping of positive samples revealed the presence of all five virulence genes in B. melitensis. The virB, cbg, and om31 were detected in all five samples of B. abortus. In addition, zhuA and manA were detected in three (60%) and four (80%) samples, respectively, of the B. abortus-positive samples. Moreover, a total of 94.2% and 89.2% of the 14 positive samples were also found positive for manA and znuA, respectively. Our findings revealed that the Brucella spp. genomes can be detected in the SF of RA patients by the PCR-based method. We thus suggest that physicians should consider the Brucella spp. as indicators of potential RA for the timely diagnosis and treatment of RA. Copyright © 2018. Published by Elsevier Ltd.

  17. Detection and phylogenetic analysis of a new adenoviral polymerase gene in reptiles in Korea.

    Science.gov (United States)

    Bak, Eun-Jung; Jho, Yeonsook; Woo, Gye-Hyeong

    2018-06-01

    Over a period of 7 years (2004-2011), samples from 34 diseased reptiles provided by local governments, zoos, and pet shops were tested for viral infection. Animals were diagnosed based on clinical signs, including loss of appetite, diarrhea, rhinorrhea, and unexpected sudden death. Most of the exotic animals had gastrointestinal problems, such as mucosal redness and ulcers, while the native animals had no clinical symptoms. Viral sequences were found in seven animals. Retroviral genes were amplified from samples from five Burmese pythons (Python molurus bivittatus), an adenovirus was detected in a panther chameleon (Furcifer pardalis), and an adenovirus and a paramyxovirus were detected in a tropical girdled lizard (Cordylus tropidosternum). Phylogenetic analysis of retroviruses and paramyxoviruses showed the highest sequence identity to both a Python molurus endogenous retrovirus and a Python curtus endogenous retrovirus and to a lizard isolate, respectively. Partial sequencing of an adenoviral DNA polymerase gene from the lizard isolate suggested that the corresponding virus was a novel isolate different from the reference strain (accession no. AY576677.1). The virus was not isolated but was detected, using molecular genetic techniques, in a lizard raised in a pet shop. This animal was also coinfected with a paramyxovirus.

  18. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  19. Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene

    Directory of Open Access Journals (Sweden)

    Lewin Astrid

    2008-12-01

    Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.

  20. Multi-gene detection and identification of mosquito-borne RNA viruses using an oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Nathan D Grubaugh

    Full Text Available BACKGROUND: Arthropod-borne viruses are important emerging pathogens world-wide. Viruses transmitted by mosquitoes, such as dengue, yellow fever, and Japanese encephalitis viruses, infect hundreds of millions of people and animals each year. Global surveillance of these viruses in mosquito vectors using molecular based assays is critical for prevention and control of the associated diseases. Here, we report an oligonucleotide DNA microarray design, termed ArboChip5.1, for multi-gene detection and identification of mosquito-borne RNA viruses from the genera Flavivirus (family Flaviviridae, Alphavirus (Togaviridae, Orthobunyavirus (Bunyaviridae, and Phlebovirus (Bunyaviridae. METHODOLOGY/PRINCIPAL FINDINGS: The assay utilizes targeted PCR amplification of three genes from each virus genus for electrochemical detection on a portable, field-tested microarray platform. Fifty-two viruses propagated in cell-culture were used to evaluate the specificity of the PCR primer sets and the ArboChip5.1 microarray capture probes. The microarray detected all of the tested viruses and differentiated between many closely related viruses such as members of the dengue, Japanese encephalitis, and Semliki Forest virus clades. Laboratory infected mosquitoes were used to simulate field samples and to determine the limits of detection. Additionally, we identified dengue virus type 3, Japanese encephalitis virus, Tembusu virus, Culex flavivirus, and a Quang Binh-like virus from mosquitoes collected in Thailand in 2011 and 2012. CONCLUSIONS/SIGNIFICANCE: We demonstrated that the described assay can be utilized in a comprehensive field surveillance program by the broad-range amplification and specific identification of arboviruses from infected mosquitoes. Furthermore, the microarray platform can be deployed in the field and viral RNA extraction to data analysis can occur in as little as 12 h. The information derived from the ArboChip5.1 microarray can help to establish

  1. Heat-transfer-based detection of SNPs in the PAH gene of PKU patients

    Directory of Open Access Journals (Sweden)

    Vanden Bon N

    2014-03-01

    Full Text Available Natalie Vanden Bon,1 Bart van Grinsven,2 Mohammed Sharif Murib,2 Weng Siang Yeap,2 Ken Haenen,2,3 Ward De Ceuninck,2,3 Patrick Wagner,2,3 Marcel Ameloot,1 Veronique Vermeeren,1 Luc Michiels11Biomedical Research Institute, Hasselt University, Diepenbeek, Belgium; 2Institute for Materials Research, Hasselt University, Diepenbeek, Belgium; 3IMOMEC, Diepenbeek, BelgiumAbstract: Conventional neonatal diagnosis of phenylketonuria is based on the presence of abnormal levels of phenylalanine in the blood. However, for carrier detection and prenatal diagnosis, direct detection of disease-correlated mutations is needed. To speed up and simplify mutation screening in genes, new technologies are developed. In this study, a heat-transfer method is evaluated as a mutation-detection technology in entire exons of the phenylalanine hydroxylase (PAH gene. This method is based on the change in heat-transfer resistance (Rth upon thermal denaturation of dsDNA (double-stranded DNA on nanocrystalline diamond. First, ssDNA (single-stranded DNA fragments that span the size range of the PAH exons were successfully immobilized on nanocrystalline diamond. Next, it was studied whether an Rth change could be observed during the thermal denaturation of these DNA fragments after hybridization to their complementary counterpart. A clear Rth shift during the denaturation of exon 5, exon 9, and exon 12 dsDNA was observed, corresponding to lengths of up to 123 bp. Finally, Rth was shown to detect prevalent single-nucleotide polymorphisms, c.473G>A (R158Q, c.932T>C (p.L311P, and c.1222C>T (R408W, correlated with phenylketonuria, displaying an effect related to the different melting temperatures of homoduplexes and heteroduplexes.Keywords: mutation detection, heat-transfer resistance, melting temperature, nanocrystalline diamond, persistence length

  2. Sensitive detection of enteropathogenic E. coli using a bfpA gene-based electrochemical sensor

    International Nuclear Information System (INIS)

    Zhang, Wei; Luo, Caihui; Zhong, Liang; Zhao, Dan; Ding, Shijia; Nie, Shichang; Cheng, Wei

    2013-01-01

    We have developed a sensitive assay for enteropathogenic E. coli (EPEC) by integrating DNA extraction, specific polymerase chain reaction (PCR) and DNA detection using an electrode modified with the bundle-forming pilus (bfpA) structural gene. The PCR amplified products are captured on the electrode and hybridized with biotinylated detection probes to form a sandwich hybrid containing two biotinylated detection probes. The sandwich hybridization structure significantly combined the numerous streptavidin alkaline phosphatase on the electrode by biotin-streptavidin connectors. Electrochemical readout is based on dual signal amplification by both the sandwich hybridization structure and the enzyme. The electrode can satisfactorily discriminate complementary and mismatched oligonucleotides. Under optimal conditions, synthetic target DNA can be detected in the 1 pM to 10 nM concentration range, with a detection limit of 0.3 pM. EPEC can be quantified in the 10 to 10 7 CFU mL −1 levels within 3.5 h. The method also is believed to present a powerful platform for the screening of pathogenic microorganisms in clinical diagnostics, food safety and environmental monitoring. (author)

  3. Real-time PCR detection of Fe-type nitrile hydratase genes from environmental isolates suggests horizontal gene transfer between multiple genera.

    Science.gov (United States)

    Coffey, Lee; Owens, Erica; Tambling, Karen; O'Neill, David; O'Connor, Laura; O'Reilly, Catherine

    2010-11-01

    Nitriles are widespread in the environment as a result of biological and industrial activity. Nitrile hydratases catalyse the hydration of nitriles to the corresponding amide and are often associated with amidases, which catalyze the conversion of amides to the corresponding acids. Nitrile hydratases have potential as biocatalysts in bioremediation and biotransformation applications, and several successful examples demonstrate the advantages. In this work a real-time PCR assay was designed for the detection of Fe-type nitrile hydratase genes from environmental isolates purified from nitrile-enriched soils and seaweeds. Specific PCR primers were also designed for amplification and sequencing of the genes. Identical or highly homologous nitrile hydratase genes were detected from isolates of numerous genera from geographically diverse sites, as were numerous novel genes. The genes were also detected from isolates of genera not previously reported to harbour nitrile hydratases. The results provide further evidence that many bacteria have acquired the genes via horizontal gene transfer. The real-time PCR assay should prove useful in searching for nitrile hydratases that could have novel substrate specificities and therefore potential in industrial applications.

  4. Sex determination in femurs of modern Egyptians: A comparative study between metric measurements and SRY gene detection

    Directory of Open Access Journals (Sweden)

    Iman F. Gaballah

    2014-12-01

    Conclusion: The SRY gene detection method for sex determination is quick and simple, requiring only one PCR reaction. It corroborates the results obtained from anatomical measurements and further confirms the sex of the femur bone in question.

  5. Detection of Cyanobacteria in Eutrophic Water Using a Portable Electrocoagulator and NanoGene Assay.

    Science.gov (United States)

    Lee, Eun-Hee; Chua, Beelee; Son, Ahjeong

    2018-02-06

    We have demonstrated the detection of cyanobacteria in eutrophic water samples using a portable electrocoagulator and NanoGene assay. The electrocoagulator is designed to preconcentrate cyanobacteria from water samples prior to analysis via NanoGene assay. Using Microcystis aeruginosa laboratory culture and environmental samples (cell densities ranging from 1.7 × 10 5 to 4.1 × 10 6 and 6.5 × 10 3 to 6.6 × 10 7 cells·mL -1 , respectively), the electrocoagulator was evaluated and compared with a conventional centrifuge. Varying the operation duration from 0 to 300 s with different cell densities was first investigated. Preconcentration efficiencies (obtained via absorbance measurement) and dry cell weight of preconcentrated cyanobacteria were then obtained and compared. For laboratory samples at cell densities from 3.2 × 10 5 to 4.1 × 10 6 cells·mL -1 , the preconcentration efficiencies of electrocoagulator appeared to be stable at ∼60%. At lower cell densities (1.7 and 2.2 × 10 5 cells·mL -1 ), the preconcentration efficiencies decreased to 33.9 ± 0.2 and 40.4 ± 5.4%, respectively. For environmental samples at cell densities of 2.7 × 10 5 and 6.6 × 10 7 cells·mL -1 , the electrocoagulator maintained its preconcentration efficiency at ∼60%. On the other hand, the centrifuge's preconcentration efficiencies decreased to nondetectable and below 40%, respectively. This shows that the electrocoagulator outperformed the centrifuge when using eutrophic water samples. Finally, the compatibility of the electrocoagulator with the NanoGene assay was verified via the successful detection of the microcystin synthetase D (mcyD) gene in environmental samples. The viability of the electrocoagulator as an in situ compatible alternative to the centrifuge is also discussed.

  6. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-01-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  7. GeneBreak: detection of recurrent DNA copy number aberration-associated chromosomal breakpoints within genes [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Evert van den Broek

    2017-07-01

    Full Text Available Development of cancer is driven by somatic alterations, including numerical and structural chromosomal aberrations. Currently, several computational methods are available and are widely applied to detect numerical copy number aberrations (CNAs of chromosomal segments in tumor genomes. However, there is lack of computational methods that systematically detect structural chromosomal aberrations by virtue of the genomic location of CNA-associated chromosomal breaks and identify genes that appear non-randomly affected by chromosomal breakpoints across (large series of tumor samples. ‘GeneBreak’ is developed to systematically identify genes recurrently affected by the genomic location of chromosomal CNA-associated breaks by a genome-wide approach, which can be applied to DNA copy number data obtained by array-Comparative Genomic Hybridization (CGH or by (low-pass whole genome sequencing (WGS. First, ‘GeneBreak’ collects the genomic locations of chromosomal CNA-associated breaks that were previously pinpointed by the segmentation algorithm that was applied to obtain CNA profiles. Next, a tailored annotation approach for breakpoint-to-gene mapping is implemented. Finally, dedicated cohort-based statistics is incorporated with correction for covariates that influence the probability to be a breakpoint gene. In addition, multiple testing correction is integrated to reveal recurrent breakpoint events. This easy-to-use algorithm, ‘GeneBreak’, is implemented in R (www.cran.r-project.org and is available from Bioconductor (www.bioconductor.org/packages/release/bioc/html/GeneBreak.html.

  8. Normal uniform mixture differential gene expression detection for cDNA microarrays

    Directory of Open Access Journals (Sweden)

    Raftery Adrian E

    2005-07-01

    Full Text Available Abstract Background One of the primary tasks in analysing gene expression data is finding genes that are differentially expressed in different samples. Multiple testing issues due to the thousands of tests run make some of the more popular methods for doing this problematic. Results We propose a simple method, Normal Uniform Differential Gene Expression (NUDGE detection for finding differentially expressed genes in cDNA microarrays. The method uses a simple univariate normal-uniform mixture model, in combination with new normalization methods for spread as well as mean that extend the lowess normalization of Dudoit, Yang, Callow and Speed (2002 1. It takes account of multiple testing, and gives probabilities of differential expression as part of its output. It can be applied to either single-slide or replicated experiments, and it is very fast. Three datasets are analyzed using NUDGE, and the results are compared to those given by other popular methods: unadjusted and Bonferroni-adjusted t tests, Significance Analysis of Microarrays (SAM, and Empirical Bayes for microarrays (EBarrays with both Gamma-Gamma and Lognormal-Normal models. Conclusion The method gives a high probability of differential expression to genes known/suspected a priori to be differentially expressed and a low probability to the others. In terms of known false positives and false negatives, the method outperforms all multiple-replicate methods except for the Gamma-Gamma EBarrays method to which it offers comparable results with the added advantages of greater simplicity, speed, fewer assumptions and applicability to the single replicate case. An R package called nudge to implement the methods in this paper will be made available soon at http://www.bioconductor.org.

  9. Plasmid fingerprinting and virulence gene detection among indigenous strains of salmonella enterica serovar enteritidis

    International Nuclear Information System (INIS)

    Sajid, S.U.; Schwarz, S.

    2009-01-01

    Salmonella enterica serovar Enteritidis is an important frequently reported zoonotic pathogen and a common cause of human gastroenteritis worldwide. The highly conserved Serospecific plasmids (SSPs) and Salmonella plasmid virulence (Spv) genes have been shown to mediate extra-intestinal colonization and systemic infection. The objective of current study was to document the presence of SSPs and SpvB/SpvC genes prevailing in the indigenous population of serovar Enteritidis. A total of 48 epidemiologically unrelated strains of Salmonella enteritidis were included in the study. Preparation of plasmids DNA suitable for endonuclease digestion and separation of respective fragments by agarose gel electrophoresis followed previously described protocols. The plasmids of Escherichia coli V517, 1-kbp ladder, and lambda DNA HindIII fragments served as DNA size standards. Transfer of DNA fragments from agarose gels to nitrocellulose membranes was achieved by capillary blot procedure. An ECL labeled 3.6 kbp HindIII fragment of plasmid PRQ 51 was used as probe for SpvB/SpvC gene detection. Plasmid DNA fingerprinting revealed the presence of two different profiles of approximately 55 kbp and 90 kbp and were identified as virulence plasmids by DNA hybridization. The SpvB/SpvC genes were located on HindIII fragments of 3.6 kbp in each of the two types of virulence plasmids. The study confirms the presence of SSPs and SpvB/SpvC genes in indigenous strains of S. enteritidis isolated from Northern Punjab area of Pakistan and substantiate the previous data on such findings from other parts of the world. (author)

  10. Detection of new paternal dystrophin gene mutations in isolated cases of dystrophinopathy in females

    Energy Technology Data Exchange (ETDEWEB)

    Pegoraro, E.; Wessel, H.B.; Schwartz, L.; Hoffman, E.P. (Univ. of Pittsburgh, PA (United States)); Schimke, R.N. (Kansas Univ. Medical Center, Kansas City (United States)); Arahata, Kiichi; Hayashi, Yukiko (National Institute of Neurosciences, Tokyo (Japan)); Stern, H. (Children' s National Medical Center, Washington, DC (United States)); Marks, H. (A.I. duPont Institute, Wilmington (United States)); Glasberg, M.R. (Henry Ford Hospital, Detroit, MI (United States)) (and others)

    1994-06-01

    Duchenne muscular dystrophy is one of the most common lethal monogenic disorders and is caused by dystrophin deficiency. The disease is transmitted as an X-linked recessive trait; however, recent biochemical and clinical studies have shown that many girls and women with a primary myopathy have an underlying dystrophinopathy, despite a negative family history for Duchenne dystrophy. These isolated female dystrophinopathy patients carried ambiguous diagnoses with presumed autosomal recessive inheritance (limb-girdle muscular dystrophy) prior to biochemical detection of dystrophin abnormalities in their muscle biopsy. It has been assumed that these female dystrophinopathy patients are heterozygous carries who show preferential inactivation of the X chromosome harboring the normal dystrophin gene, although this has been shown for only a few X:autosome translocations and for two cases of discordant monozygotic twin female carriers. Here the authors study X-inactivation patterns of 13 female dystrophinopathy patients - 10 isolated cases and 3 cases with a positive family history for Duchenne dystrophy in males. They show that all cases have skewed X-inactivation patterns in peripheral blood DNA. Of the nine isolated cases informative in the assay, eight showed inheritance of the dystrophin gene mutation from the paternal germ line. Only a single case showed maternal inheritance. The 10-fold higher incidence of paternal transmission of dystrophin gene mutations in these cases is at 30-fold variance with Bayesian predictions and gene mutation rates. Thus, the results suggest some mechanistic interaction between new dystrophin gene mutations, paternal inheritance, and skewed X inactivation. The results provide both empirical risk data and a molecular diagnostic test method, which permit genetic counseling and prenatal diagnosis of this new category of patients. 58 refs., 7 figs., 2 tabs.

  11. Heteroduplex analysis of the dystrophin gene: Application to point mutation and carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Papp, A.C.; Snyder, P.J.; Sedra, M.S.; Western, L.M.; Bartolo, C.; Mendell, J.R. [Ohio State Univ., Columbus, OH (United States); Moxley, R.T. [Univ. of Rochester Medical Center, NY (United States)

    1994-03-01

    Approximately one-third of Duchenne muscular dystrophy patients have undefined mutations in the dystrophin gene. For carrier and prenatal studies in families without detectable mutations, the indirect restriction fragment length polymorphism linkage approach is used. Using a multiplex amplification and heteroduplex analysis of dystrophin exons, the authors identified nonsense mutations in two DMD patients. Although the nonsense mutations are predicted to severely truncate the dystrophin protein, both patients presented with mild clinical courses of the disease. As a result of identifying the mutation in the affected boys, direct carrier studies by heteroduplex analysis were extended to other relatives. The authors conclude that the technique is not only ideal for mutation detection but is also useful for diagnostic testing. 29 refs., 4 figs.

  12. A method to detect transfected chloramphenicol acetyltransferase gene expression in intact animals

    International Nuclear Information System (INIS)

    Narayanan, R.; Jastreboff, M.M.; Chiu, Chang Fang; Ito, Etsuro; Bertino, J.R.

    1988-01-01

    A rapid procedure is described for assaying chloramphenicol acetyltransferase enzyme activity in intact animals following transfection of the RSV CAT plasmid into mouse bone marrow cells by electroporation. The reconstituted mice were injected with [ 14 C]chloramphenicol and ethyl acetate extracts of 24-h urine samples were analyzed by TLC autoradiography for the excretion of 14 C-labeled metabolites. CAT expression in vivo can be detected by the presence of acetylated 14 C-labeled metabolites in the urine within 1 week after bone marrow transplantation and, under the conditions described, these metabolites can be detected for at least 3 months. CAT expression in intact mice as monitored by the urine assay correlates with the CAT expression in the hematopoietic tissues assayed in vitro. This method offers a quick mode of screening for introduced CAT gene expression in vivo without sacrificing the mice

  13. Palindromic Molecule Beacon-Based Cascade Amplification for Colorimetric Detection of Cancer Genes.

    Science.gov (United States)

    Shen, Zhi-Fa; Li, Feng; Jiang, Yi-Fan; Chen, Chang; Xu, Huo; Li, Cong-Cong; Yang, Zhe; Wu, Zai-Sheng

    2018-03-06

    A highly sensitive and selective colorimetric assay based on a multifunctional molecular beacon with palindromic tail (PMB) was proposed for the detection of target p53 gene. The PMB probe can serve as recognition element, primer, and polymerization template and contains a nicking site and a C-rich region complementary to a DNAzyme. In the presence of target DNA, the hairpin of PMB is opened, and the released palindromic tails intermolecularly hybridize with each other, triggering the autonomous polymerization/nicking/displacement cycles. Although only one type of probe is involved, the system can execute triple and continuous polymerization strand displacement amplifications, generating large amounts of G-quadruplex fragments. These G-rich fragments can bind to hemin and form the DNAzymes that possess the catalytic activity similar to horseradish peroxidase, catalyzing the oxidation of ABTS by H 2 O 2 and producing the colorimetric signal. Utilizing the newly proposed sensing system, target DNA can be detected down to 10 pM with a linear response range from 10 pM to 200 nM, and mutant target DNAs are able to be distinguished even by the naked eye. The desirable detection sensitivity, high specificity, and operation convenience without any separation step and chemical modification demonstrate that the palindromic molecular beacon holds the potential for detecting and monitoring a variety of nucleic acid-related biomarkers.

  14. Background Adjusted Alignment-Free Dissimilarity Measures Improve the Detection of Horizontal Gene Transfer

    Directory of Open Access Journals (Sweden)

    Kujin Tang

    2018-04-01

    Full Text Available Horizontal gene transfer (HGT plays an important role in the evolution of microbial organisms including bacteria. Alignment-free methods based on single genome compositional information have been used to detect HGT. Currently, Manhattan and Euclidean distances based on tetranucleotide frequencies are the most commonly used alignment-free dissimilarity measures to detect HGT. By testing on simulated bacterial sequences and real data sets with known horizontal transferred genomic regions, we found that more advanced alignment-free dissimilarity measures such as CVTree and d2* that take into account the background Markov sequences can solve HGT detection problems with significantly improved performance. We also studied the influence of different factors such as evolutionary distance between host and donor sequences, size of sliding window, and host genome composition on the performances of alignment-free methods to detect HGT. Our study showed that alignment-free methods can predict HGT accurately when host and donor genomes are in different order levels. Among all methods, CVTree with word length of 3, d2* with word length 3, Markov order 1 and d2* with word length 4, Markov order 1 outperform others in terms of their highest F1-score and their robustness under the influence of different factors.

  15. Use of next-generation sequencing to detect LDLR gene copy number variation in familial hypercholesterolemia.

    Science.gov (United States)

    Iacocca, Michael A; Wang, Jian; Dron, Jacqueline S; Robinson, John F; McIntyre, Adam D; Cao, Henian; Hegele, Robert A

    2017-11-01

    Familial hypercholesterolemia (FH) is a heritable condition of severely elevated LDL cholesterol, caused predominantly by autosomal codominant mutations in the LDL receptor gene ( LDLR ). In providing a molecular diagnosis for FH, the current procedure often includes targeted next-generation sequencing (NGS) panels for the detection of small-scale DNA variants, followed by multiplex ligation-dependent probe amplification (MLPA) in LDLR for the detection of whole-exon copy number variants (CNVs). The latter is essential because ∼10% of FH cases are attributed to CNVs in LDLR ; accounting for them decreases false negative findings. Here, we determined the potential of replacing MLPA with bioinformatic analysis applied to NGS data, which uses depth-of-coverage analysis as its principal method to identify whole-exon CNV events. In analysis of 388 FH patient samples, there was 100% concordance in LDLR CNV detection between these two methods: 38 reported CNVs identified by MLPA were also successfully detected by our NGS method, while 350 samples negative for CNVs by MLPA were also negative by NGS. This result suggests that MLPA can be removed from the routine diagnostic screening for FH, significantly reducing associated costs, resources, and analysis time, while promoting more widespread assessment of this important class of mutations across diagnostic laboratories. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

  16. Detection of chicken contamination in beef meatball using duplex-PCR Cyt b gene

    Science.gov (United States)

    Sari, E. P.; Kartikasari, L. R.; Cahyadi, M.

    2017-04-01

    Beef is one of expensive animal protein sources compared to other meats, on the other hand, chicken is cheap animal protein source. Mixing of chicken into beef meatball is possibly performed to decrease production cost. The aim of this study was to detect chicken contamination in beef meatball using Cytochrome b (Cyt b) gene by duplex-PCR. Sample was designed and prepared as follows, 100% of chicken meatball, 100% of beef meatball and serial level of chicken contaminations in beef meatball (1, 5, 10 and 25%, respectively). Isolation of DNA genome from meatball was according to the guideline of gSYNCTM DNA Extraction Kit for animal tissue. The PCR reaction was carried out using KAPA2G Fast Multiplex Mix. This study found that the DNA genome was succesfully extracted. Moreover, chicken contamination in beef meatball was indicated by the presence of 227 bp DNA band on 2% of agarose gels. Current study revealed that duplex-PCR using Cyt b gene as a genetic marker was able to detect chicken contamination in beef meatball until 1% of chicken meat in the sample. It can be effectively used to identify contamination and also authenticate species origin in animal products to protect consumer from undesirable contents in the food.

  17. Detection of the HTLV-I gene on cytologic smear slides.

    Science.gov (United States)

    Kashima, Kenji; Nagahama, Junji; Sato, Keiji; Tanamachi, Hiroyuki; Gamachi, Ayako; Daa, Tsutomu; Nakayama, Iwao; Yokoyama, Shigeo

    2002-01-01

    To apply the polymerase chain reaction (PCR) for detection of the HTLV-I gene from cytologic smear slides. Samples were from seven cases of serum anti-ATL antibody (ATLA)-positive T-cell lymphoma and three from ATLA-negative T-cell lymphoma. Six of the seven ATLA-positive cases were confirmed to be ATLL by Southern blotting. From the seventh case a fresh sample for blotting could not obtained. DNA was extracted from the cytologic smear slides of all 10 cases; they had been stained with Papanicolaou or May-Giemsa stain, digested with proteinase K and precipitated with phenol and ethanol. The target sequence in the pX region of the HTLV-I gene was amplified by PCR. All seven ATLA-positive cases, including one that had not yet been confirmed by Southern blotting, showed a single band, as predicted, while the three ATLA-negative cases showed no band. If cytologic smear slides are available but a fresh sample is not, the PCR method should provide evidence that the virus is present since in our study sufficient DNA templates were successfully extracted from the stained cytologic smear slides for detection of the virus.

  18. Detection of meca gene from methicillin resistant staphylococcus aureus isolates of north sumatera

    Science.gov (United States)

    Septiani Nasution, Gabriella; Suryanto, Dwi; Lia Kusumawati, R.

    2018-03-01

    Methicillin Resistant Staphylococcus aureus (MRSA) is a major pathogen associated with hospital-acquired infections (nosocomial infections). MRSA is a type of S. aureus resistant to the sub-group of beta-lactam antibiotics such as penicillin, cephalosporin, monobactam, and carbapenem. MRSA is resistant because of genetic changes caused by exposure to irrational antibiotic therapy. This study aimed to detect mecA gene in North Sumatra isolates of MRSA and to determine the pattern of antibiotic resistance in S.aureus isolates classified as MRSA by Vitek 2 Compact in the Central Public Hospital Haji Adam Malik, Medan. Samples were 40 isolates of S. aureus classified as MRSA obtained from clinical microbiology specimens. DNA isolation of the isolates was conducted by a method of freeze-thaw cycling. Amplification of mecA gene was done by PCR technique using specific primer for the gene. PCR products were visualized using mini-gel electrophoresis. The results showed that all MRSA isolates showed to have 533 bp band of mecA. Antibiotics test of Vitek 2 Compact showed that despite all isolates were resistant to beta-lactam antibiotics groups; the isolates showed multidrug resistant to other common antibiotics, such as aminoglycosides, macrolides, and fluoroquinolones. However, they were still sensitive to vancomycin (82.5% isolates), linezolid (97.5% isolates), and tigecycline (100% isolates).

  19. Spectroscopic detection of fluorescent protein marker gene activity in genetically modified plants

    Science.gov (United States)

    Liew, O. W.; Chong, Jenny P. C.; Asundi, Anand K.

    2005-04-01

    This work focuses on developing a portable fibre optic fluorescence analyser for rapid identification of genetically modified plants tagged with a fluorescent marker gene. Independent transgenic tobacco plant lines expressing the enhanced green fluorescence protein (EGFP) gene were regenerated following Agrobacterium-mediated gene transfer. Molecular characterisation of these plant lines was carried out at the DNA level by PCR screening to confirm their transgenic status. Conventional transgene expression analysis was then carried out at the RNA level by RT-PCR and at the protein level by Western blotting using anti-GFP rabbit antiserum. The amount of plant-expressed EGFP on a Western blot was quantified against known amounts of purified EGFP by scanning densitometry. The expression level of EGFP in transformed plants was found to range from 0.1 - 0.6% of total extractable protein. A comparison between conventional western analysis of transformants and direct spectroscopic quantification using the fibre optic fluorescence analyser was made. The results showed that spectroscopic measurements of fluorescence emission from strong EGFP expressors correlated positively with Western blot data. However, the fluorescence analyser was also able to identify weakly expressing plant transformants below the detection limit of colorimetric Western blotting.

  20. Detection of toxic shock toxin (tst gene in Staphylococcus aureus isolated from bovine milk samples

    Directory of Open Access Journals (Sweden)

    S. Baniardalan

    2017-09-01

    Full Text Available Staphylococcus aureus is a major causative pathogen of clinical and subclinical mastitis in dairy cattle all over the world. This agent produces a variety of extracellular toxins and virulence factors in-cluding toxic shock syndrome toxin-1 (TSST-1 which is the major cause of toxic shock syndrome (TSS. In the present study, 76 S. aureus isolates have been obtained from milk samples collected from 7 dairy herds in Hamedan province of Iran. The isolates were identified based on the biochemical and molecular methods using PCR amplification of the femA gene. The staphylococcal isolates were also examined for the presence of TSST-1 (tst encoding gene. This gene was detected in only one S. aureus isolate (1.3%. The results revealed that S. aureus strains causing bovine mastitis may potentially produce staphylococcal toxic shock syndrome toxin-1, indicating that it is very important to follow the presence of TSST-1 producing S. aureus isolates in foodstuffs to protect consumers against the risk of toxic shock syndrome

  1. Characterization of Antimicrobial Resistance Patterns and Detection of Virulence Genes in Campylobacter Isolates in Italy

    Science.gov (United States)

    Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

    2014-01-01

    Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations. PMID:24556669

  2. Detection and characterization of interleukin-6 gene variants in Canis familiaris: association studies with periodontal disease.

    Science.gov (United States)

    Morinha, Francisco; Albuquerque, Carlos; Requicha, João; Dias, Isabel; Leitão, José; Gut, Ivo; Guedes-Pinto, Henrique; Viegas, Carlos; Bastos, Estela

    2011-10-10

    Periodontal disease (PD) is the most common inflammatory disease of the oral cavity of domestic carnivores. In Human Medicine molecular genetics research showed that several genes play a role in the predisposition and progression of this complex disease, primarily through the regulation of inflammatory mediators, but the exactly mechanisms are poorly understood. This study aims to contribute to the characterization of the genetic basis of PD in the dog, a classically accepted model in Periodontology. We searched for genetic variations in the interleukin-6 (IL6) gene, in order to verify its association with PD in a case-control study including 25 dogs in the PD case group and 45 dogs in the control group. We indentified and characterized three new genetic variations in IL6 gene. No statistically significant differences were detected between the control and PD cases groups. Our results do not support an evidence for a major role contribution of these variants in the susceptibility to PD in the analyzed population. Nevertheless, the sequence variant I/5_g.105G>A leads to an amino acid change (arginine to glutamine) and was predicted to be possibly damaging to the IL6 protein. A larger cohort and functional studies would be of extreme importance in a near future to understand the possible role of IL6 variants in this disease. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Usual normalization strategies for gene expression studies impair the detection and analysis of circadian patterns.

    Science.gov (United States)

    Figueredo, Diego de Siqueira; Barbosa, Mayara Rodrigues; Coimbra, Daniel Gomes; Dos Santos, José Luiz Araújo; Costa, Ellyda Fernanda Lopes; Koike, Bruna Del Vechio; Alexandre Moreira, Magna Suzana; de Andrade, Tiago Gomes

    2018-03-01

    Recent studies have shown that transcriptomes from different tissues present circadian oscillations. Therefore, the endogenous variation of total RNA should be considered as a potential bias in circadian studies of gene expression. However, normalization strategies generally include the equalization of total RNA concentration between samples prior to cDNA synthesis. Moreover, endogenous housekeeping genes (HKGs) frequently used for data normalization may exhibit circadian variation and distort experimental results if not detected or considered. In this study, we controlled experimental conditions from the amount of initial brain tissue samples through extraction steps, cDNA synthesis, and quantitative real time PCR (qPCR) to demonstrate a circadian oscillation of total RNA concentration. We also identified that the normalization of the RNA's yield affected the rhythmic profiles of different genes, including Per1-2 and Bmal1. Five widely used HKGs (Actb, Eif2a, Gapdh, Hprt1, and B2m) also presented rhythmic variations not detected by geNorm algorithm. In addition, the analysis of exogenous microRNAs (Cel-miR-54 and Cel-miR-39) spiked during RNA extraction suggests that the yield was affected by total RNA concentration, which may impact circadian studies of small RNAs. The results indicate that the approach of tissue normalization without total RNA equalization prior to cDNA synthesis can avoid bias from endogenous broad variations in transcript levels. Also, the circadian analysis of 2 -Cycle threshold (Ct) data, without HKGs, may be an alternative for chronobiological studies under controlled experimental conditions.

  4. Antimicrobial Susceptibility of Bordetella bronchiseptica Isolates from Swine and Companion Animals and Detection of Resistance Genes.

    Directory of Open Access Journals (Sweden)

    Sandra Prüller

    Full Text Available Bordetella bronchiseptica causes infections of the respiratory tract in swine and other mammals and is a precursor for secondary infections with Pasteurella multocida. Treatment of B. bronchiseptica infections is conducted primarily with antimicrobial agents. Therefore it is essential to get an overview of the susceptibility status of these bacteria. The aim of this study was to comparatively analyse broth microdilution susceptibility testing according to CLSI recommendations with an incubation time of 16 to 20 hours and a longer incubation time of 24 hours, as recently proposed to obtain more homogenous MICs. Susceptibility testing against a panel of 22 antimicrobial agents and two fixed combinations was performed with 107 porcine isolates from different farms and regions in Germany and 43 isolates obtained from companion animals in Germany and other European countries. Isolates with increased MICs were investigated by PCR assays for the presence of resistance genes. For ampicillin, all 107 porcine isolates were classified as resistant, whereas only a single isolate was resistant to florfenicol. All isolates obtained from companion animals showed elevated MICs for β-lactam antibiotics and demonstrated an overall low susceptibility to cephalosporines. Extension of the incubation time resulted in 1-2 dilution steps higher MIC50 values of porcine isolates for seven antimicrobial agents tested, while isolates from companion animals exhibited twofold higher MIC50/90 values only for tetracycline and cefotaxime. For three antimicrobial agents, lower MIC50 and MIC90 values were detected for both, porcine and companion animal isolates. Among the 150 isolates tested, the resistance genes blaBOR-1 (n = 147, blaOXA-2, (n = 4, strA and strB (n = 17, sul1 (n = 10, sul2 (n = 73, dfrA7 (n = 3 and tet(A (n = 8 were detected and a plasmid localisation was identified for several of the resistance genes.

  5. Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda

    2014-12-01

    Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

  6. Simultaneous amplification of two bacterial genes: more reliable method of Helicobacter pylori detection in microbial rich dental plaque samples.

    Science.gov (United States)

    Chaudhry, Saima; Idrees, Muhammad; Izhar, Mateen; Butt, Arshad Kamal; Khan, Ayyaz Ali

    2011-01-01

    Polymerase Chain reaction (PCR) assay is considered superior to other methods for detection of Helicobacter pylori (H. pylori) in oral cavity; however, it also has limitations when sample under study is microbial rich dental plaque. The type of gene targeted and number of primers used for bacterial detection in dental plaque samples can have a significant effect on the results obtained as there are a number of closely related bacterial species residing in plaque biofilm. Also due to high recombination rate of H. pylori some of the genes might be down regulated or absent. The present study was conducted to determine the frequency of H. pylori colonization of dental plaque by simultaneously amplifying two genes of the bacterium. One hundred dental plaque specimens were collected from dyspeptic patients before their upper gastrointestinal endoscopy and presence of H. pylori was determined through PCR assay using primers targeting two different genes of the bacterium. Eighty-nine of the 100 samples were included in final analysis. With simultaneous amplification of two bacterial genes 51.6% of the dental plaque samples were positive for H. pylori while this prevalence increased to 73% when only one gene amplification was used for bacterial identification. Detection of H. pylori in dental plaque samples is more reliable when two genes of the bacterium are simultaneously amplified as compared to one gene amplification only.

  7. Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

    Science.gov (United States)

    Rozi; Rahayu, K.; Daruti, D. N.

    2018-04-01

    The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

  8. Hearing-loss-associated gene detection in neonatal intensive care unit.

    Science.gov (United States)

    Yang, S M; Liu, Ying; Liu, C; Yin, A H; Wu, Y F; Zheng, X E; Yang, H M; Yang, J

    2018-02-01

    To investigate the frequency and mutation spectrum of hearing loss-associated gene mutation in Neonatal Intensive Care Unit (NICU). Neonates (n=2305) admitted to NICU were enrolled in this study. Nine prominent hearing loss-associated genes, GJB2 (35 del G, 176 del 16,235 del C, 299 del AT), GJB3 (538 C > T), SLC26A4 (IVS7-2A > G, 2168 A > G) and mtDNA 12S rRNA(1555 A > G, 1494 C > T), were detected. There were 73 cases hearing-loss-associated gene mutation among 2305 cases, the mutation frequency was 3.1%, with 40 cases GJB2 (235del C) mutation (54.8%), 6 cases GJB2 (299 del AT) mutation (8.2%), 21 cases SLC26A4 (IVS 7-2 A > G) mutation (28.7%), 4 cases SLC26A4 (2168 A > G) mutation (5.5%), 2 cases of GJB2 (235del C) combined SLC26A4 (IVS 7-2 A > G, 2168 A > G) mutation (2.8%). Among 73 gene mutation cases, preterm neonates presented in 18 cases, accounting for 24.7% (18/73); hyperbilirubinemia in 13 cases, accounting for 17.8% (13/73); Torch Syndrome in 15 cases, with 12 cases CMV, 2 cases rubella, 1 case toxoplasm, respectively, totally accounting for 20.54% (15/73); neonatal pneumonia in 12 cases, accounting for 16.4% (12/73); birth asphyxia in 5 cases, accounting for 6.9% (5/73); sepsis in 5 cases, accounting for 6.9% (5/73); others in 5 cases, accounting for 6.8% (5/73) . The frequency of hearing loss-associated gene mutation was higher in NICU.There were hearing loss-associated gene mutations in the NICU, suggesting this mutation may complicate with perinatal high-risk factors.

  9. Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

    Science.gov (United States)

    Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2017-11-01

    Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  10. Fully automated pipeline for detection of sex linked genes using RNA-Seq data.

    Science.gov (United States)

    Michalovova, Monika; Kubat, Zdenek; Hobza, Roman; Vyskot, Boris; Kejnovsky, Eduard

    2015-03-11

    Sex chromosomes present a genomic region which to some extent, differs between the genders of a single species. Reliable high-throughput methods for detection of sex chromosomes specific markers are needed, especially in species where genome information is limited. Next generation sequencing (NGS) opens the door for identification of unique sequences or searching for nucleotide polymorphisms between datasets. A combination of classical genetic segregation analysis along with RNA-Seq data can present an ideal tool to map and identify sex chromosome-specific expressed markers. To address this challenge, we established genetic cross of dioecious plant Rumex acetosa and generated RNA-Seq data from both parental generation and male and female offspring. We present a pipeline for detection of sex linked genes based on nucleotide polymorphism analysis. In our approach, tracking of nucleotide polymorphisms is carried out using a cross of preferably distant populations. For this reason, only 4 datasets are needed - reads from high-throughput sequencing platforms for parent generation (mother and father) and F1 generation (male and female progeny). Our pipeline uses custom scripts together with external assembly, mapping and variant calling software. Given the resource-intensive nature of the computation, servers with high capacity are a requirement. Therefore, in order to keep this pipeline easily accessible and reproducible, we implemented it in Galaxy - an open, web-based platform for data-intensive biomedical research. Our tools are present in the Galaxy Tool Shed, from which they can be installed to any local Galaxy instance. As an output of the pipeline, user gets a FASTA file with candidate transcriptionally active sex-linked genes, sorted by their relevance. At the same time, a BAM file with identified genes and alignment of reads is also provided. Thus, polymorphisms following segregation pattern can be easily visualized, which significantly enhances primer design

  11. Detection of copy number variants reveals association of cilia genes with neural tube defects.

    Directory of Open Access Journals (Sweden)

    Xiaoli Chen

    Full Text Available BACKGROUND: Neural tube defects (NTDs are one of the most common birth defects caused by a combination of genetic and environmental factors. Currently, little is known about the genetic basis of NTDs although up to 70% of human NTDs were reported to be attributed to genetic factors. Here we performed genome-wide copy number variants (CNVs detection in a cohort of Chinese NTD patients in order to exam the potential role of CNVs in the pathogenesis of NTDs. METHODS: The genomic DNA from eighty-five NTD cases and seventy-five matched normal controls were subjected for whole genome CNVs analysis. Non-DGV (the Database of Genomic Variants CNVs from each group were further analyzed for their associations with NTDs. Gene content in non-DGV CNVs as well as participating pathways were examined. RESULTS: Fifty-five and twenty-six non-DGV CNVs were detected in cases and controls respectively. Among them, forty and nineteen CNVs involve genes (genic CNV. Significantly more non-DGV CNVs and non-DGV genic CNVs were detected in NTD patients than in control (41.2% vs. 25.3%, p<0.05 and 37.6% vs. 20%, p<0.05. Non-DGV genic CNVs are associated with a 2.65-fold increased risk for NTDs (95% CI: 1.24-5.87. Interestingly, there are 41 cilia genes involved in non-DGV CNVs from NTD patients which is significantly enriched in cases compared with that in controls (24.7% vs. 9.3%, p<0.05, corresponding with a 3.19-fold increased risk for NTDs (95% CI: 1.27-8.01. Pathway analyses further suggested that two ciliogenesis pathways, tight junction and protein kinase A signaling, are top canonical pathways implicated in NTD-specific CNVs, and these two novel pathways interact with known NTD pathways. CONCLUSIONS: Evidence from the genome-wide CNV study suggests that genic CNVs, particularly ciliogenic CNVs are associated with NTDs and two ciliogenesis pathways, tight junction and protein kinase A signaling, are potential pathways involved in NTD pathogenesis.

  12. Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

    Directory of Open Access Journals (Sweden)

    Gaya Prasad

    2013-06-01

    Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

  13. Novel mutations detected in avirulence genes overcoming tomato Cf resistance genes in isolates of a Japanese population of Cladosporium fulvum

    NARCIS (Netherlands)

    Iida, Y.; Hof, van 't P.M.J.; Beenen, H.G.; Mesarich, C.H.; Kubota, M.; Stergiopoulos, I.; Mehrabi, A.; Notsu, A.; Fujiwara, K.; Bahkali, A.; Abd-Elsalam, K.; Collemare, J.; Wit, de P.J.G.M.

    2015-01-01

    Leaf mold of tomato is caused by the biotrophic fungus Cladosporium fulvum which complies with the gene-for-gene system. The disease was first reported in Japan in the 1920s and has since been frequently observed. Initially only race 0 isolates were reported, but since the consecutive introduction

  14. Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR).

    Science.gov (United States)

    Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A

    2005-12-01

    Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

  15. Fundamental study of detection of muscle hypertrophy-oriented gene doping by myostatin knock down using RNA interference.

    Science.gov (United States)

    Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori

    2012-01-01

    To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray.

  16. [Using exon combined target region capture sequencing chip to detect the disease-causing genes of retinitis pigmentosa].

    Science.gov (United States)

    Rong, Weining; Chen, Xuejuan; Li, Huiping; Liu, Yani; Sheng, Xunlun

    2014-06-01

    To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip. Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations. Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree. Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.

  17. Carbon nanoparticles as detection labels in antibody microarrays. Detection of genes encoding virulence factors in Shiga toxin-producing Escherichia coli.

    NARCIS (Netherlands)

    Noguera, P.S.; Posthuma-Trumpie, G.A.; Tuil, Van M.; Wal, van der F.J.; Boer, De A.; Moers, A.P.H.A.; Amerongen, Van A.

    2011-01-01

    The present study demonstrates that carbon nanoparticles (CNPs) can be used as labels in microarrays. CNPs were used in nucleic acid microarray immunoassays (NAMIAs) for the detection of different Shiga toxin-producing Escherichia coli (STEC) virulence factors: four genes specific for STEC (vt1,

  18. Coupled Transcriptome and Proteome Analysis of Human Lymphotropic Tumor Viruses: Insights on the Detection and Discovery of Viral Genes

    Energy Technology Data Exchange (ETDEWEB)

    Dresang, Lindsay R.; Teuton, Jeremy R.; Feng, Huichen; Jacobs, Jon M.; Camp, David G.; Purvine, Samuel O.; Gritsenko, Marina A.; Li, Zhihua; Smith, Richard D.; Sugden, Bill; Moore, Patrick S.; Chang, Yuan

    2011-12-20

    Kaposi's sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV) are related human tumor viruses that cause primary effusion lymphomas (PEL) and Burkitt's lymphomas (BL), respectively. Viral genes expressed in naturally-infected cancer cells contribute to disease pathogenesis; knowing which viral genes are expressed is critical in understanding how these viruses cause cancer. To evaluate the expression of viral genes, we used high-resolution separation and mass spectrometry coupled with custom tiling arrays to align the viral proteomes and transcriptomes of three PEL and two BL cell lines under latent and lytic culture conditions. Results The majority of viral genes were efficiently detected at the transcript and/or protein level on manipulating the viral life cycle. Overall the correlation of expressed viral proteins and transcripts was highly complementary in both validating and providing orthogonal data with latent/lytic viral gene expression. Our approach also identified novel viral genes in both KSHV and EBV, and extends viral genome annotation. Several previously uncharacterized genes were validated at both transcript and protein levels. Conclusions This systems biology approach coupling proteome and transcriptome measurements provides a comprehensive view of viral gene expression that could not have been attained using each methodology independently. Detection of viral proteins in combination with viral transcripts is a potentially powerful method for establishing virus-disease relationships.

  19. Oxidative stress/reactive metabolite gene expression signature in rat liver detects idiosyncratic hepatotoxicants

    Energy Technology Data Exchange (ETDEWEB)

    Leone, Angelique; Nie, Alex; Brandon Parker, J.; Sawant, Sharmilee; Piechta, Leigh-Anne; Kelley, Michael F., E-mail: mkelley2@its.jnj.com; Mark Kao, L.; Jim Proctor, S.; Verheyen, Geert; Johnson, Mark D.; Lord, Peter G.; McMillian, Michael K.

    2014-03-15

    Previously we reported a gene expression signature in rat liver for detecting a specific type of oxidative stress (OS) related to reactive metabolites (RM). High doses of the drugs disulfiram, ethinyl estradiol and nimesulide were used with another dozen paradigm OS/RM compounds, and three other drugs flutamide, phenacetin and sulindac were identified by this signature. In a second study, antiepileptic drugs were compared for covalent binding and their effects on OS/RM; felbamate, carbamazepine, and phenobarbital produced robust OS/RM gene expression. In the present study, liver RNA samples from drug-treated rats from more recent experiments were examined for statistical fit to the OS/RM signature. Of all 97 drugs examined, in addition to the nine drugs noted above, 19 more were identified as OS/RM-producing compounds—chlorpromazine, clozapine, cyproterone acetate, dantrolene, dipyridamole, glibenclamide, isoniazid, ketoconazole, methapyrilene, naltrexone, nifedipine, sulfamethoxazole, tamoxifen, coumarin, ritonavir, amitriptyline, valproic acid, enalapril, and chloramphenicol. Importantly, all of the OS/RM drugs listed above have been linked to idiosyncratic hepatotoxicity, excepting chloramphenicol, which does not have a package label for hepatotoxicity, but does have a black box warning for idiosyncratic bone marrow suppression. Most of these drugs are not acutely toxic in the rat. The OS/RM signature should be useful to avoid idiosyncratic hepatotoxicity of drug candidates. - Highlights: • 28 of 97 drugs gave a positive OS/RM gene expression signature in rat liver. • The specificity of the signature for human idiosyncratic hepatotoxicants was 98%. • The sensitivity of the signature for human idiosyncratic hepatotoxicants was 75%. • The signature can help eliminate hepatotoxicants from drug development.

  20. Detection of the Light Organ Symbiont, Vibrio fischeri, in Hawaiian Seawater by Using lux Gene Probes.

    Science.gov (United States)

    Lee, K H; Ruby, E G

    1992-03-01

    Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both luminous and non-visibly luminous V. fischeri colonies by DNA-DNA hybridization. The probes were specific, hybridizing at least 50 to 100 times more strongly to immobilized DNAs from V. fischeri strains than to those of pure cultures of other related species. Thus, even non-visibly luminous V. fischeri colonies could be identified among colonies obtained from natural seawater samples by their probe-positive reaction. Bacteria in seawater samples, obtained either within or distant from squid habitats, were collected on membrane filters and incubated until colonies appeared. The filters were then observed for visibly luminous V. fischeri colonies and hybridized with the lux gene probes to determine the number of total V. fischeri colonies (both luminous and non-visibly luminous). We detected no significant differences in the abundance of luminous V. fischeri CFU in any of the water samples observed (gene probes were species specific and gave a reliable estimate of the number of culturable V. fischeri colonies in natural water samples.

  1. Finding the joker among the maize endogenous reference genes for genetically modified organism (GMO) detection.

    Science.gov (United States)

    Paternò, Annalisa; Marchesi, Ugo; Gatto, Francesco; Verginelli, Daniela; Quarchioni, Cinzia; Fusco, Cristiana; Zepparoni, Alessia; Amaddeo, Demetrio; Ciabatti, Ilaria

    2009-12-09

    The comparison of five real-time polymerase chain reaction (PCR) methods targeted at maize ( Zea mays ) endogenous sequences is reported. PCR targets were the alcohol dehydrogenase (adh) gene for three methods and high-mobility group (hmg) gene for the other two. The five real-time PCR methods have been checked under repeatability conditions at several dilution levels on both pooled DNA template from several genetically modified (GM) maize certified reference materials (CRMs) and single CRM DNA extracts. Slopes and R(2) coefficients of all of the curves obtained from the adopted regression model were compared within the same method and among all of the five methods, and the limit of detection and limit of quantitation were analyzed for each PCR system. Furthermore, method equivalency was evaluated on the basis of the ability to estimate the target haploid genome copy number at each concentration level. Results indicated that, among the five methods tested, one of the hmg-targeted PCR systems can be considered equivalent to the others but shows the best regression parameters and a higher repeteability along the dilution range. Thereby, it is proposed as a valid module to be coupled to different event-specific real-time PCR for maize genetically modified organism (GMO) quantitation. The resulting practicability improvement on the analytical control of GMOs is discussed.

  2. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  3. Simple Detection of Large InDeLS by DHPLC: The ACE Gene as a Model

    Directory of Open Access Journals (Sweden)

    Renata Guedes Koyama

    2008-01-01

    Full Text Available Insertion-deletion polymorphism (InDeL is the second most frequent type of genetic variation in the human genome. For the detection of large InDeLs, researchers usually resort to either PCR gel analysis or RFLP, but these are time consuming and dependent on human interpretation. Therefore, a more efficient method for genotyping this kind of genetic variation is needed. In this report, we describe a method that can detect large InDeLs by DHPLC (denaturating high-performance liquid chromatography using the angiotensin-converting enzyme (ACE gene I/D polymorphism as a model. The InDeL targeted in this study is characterized by a 288 bp Alu element insertion (I. We used DHPLC at nondenaturating conditions to analyze the PCR product with a flow through the chromatographic column under two different gradients based on the differences between D and I sequences. The analysis described is quick and easy, making this technique a suitable and efficient means for DHPLC users to screen InDeLs in genetic epidemiological studies.

  4. Serotonin transporter gene-linked polymorphism affects detection of facial expressions.

    Directory of Open Access Journals (Sweden)

    Ai Koizumi

    Full Text Available Previous studies have demonstrated that the serotonin transporter gene-linked polymorphic region (5-HTTLPR affects the recognition of facial expressions and attention to them. However, the relationship between 5-HTTLPR and the perceptual detection of others' facial expressions, the process which takes place prior to emotional labeling (i.e., recognition, is not clear. To examine whether the perceptual detection of emotional facial expressions is influenced by the allelic variation (short/long of 5-HTTLPR, happy and sad facial expressions were presented at weak and mid intensities (25% and 50%. Ninety-eight participants, genotyped for 5-HTTLPR, judged whether emotion in images of faces was present. Participants with short alleles showed higher sensitivity (d' to happy than to sad expressions, while participants with long allele(s showed no such positivity advantage. This effect of 5-HTTLPR was found at different facial expression intensities among males and females. The results suggest that at the perceptual stage, a short allele enhances the processing of positive facial expressions rather than that of negative facial expressions.

  5. The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

    International Nuclear Information System (INIS)

    Xi Dong; Luo Xiaoping; Lu Qianghua; Yao Kailun; Liu Zuli; Ning Qin

    2008-01-01

    Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method

  6. Gene Expression Profiling of Peripheral Blood From Kidney Transplant Recipients for the Early Detection of Digestive System Cancer.

    Science.gov (United States)

    Kusaka, M; Okamoto, M; Takenaka, M; Sasaki, H; Fukami, N; Kataoka, K; Ito, T; Kenmochi, T; Hoshinaga, K; Shiroki, R

    2017-06-01

    Kidney transplant recipients are at increased risk of developing cancer in comparison with the general population. To effectively manage post-transplantation malignancies, it is essential to proactively monitor patients. A long-term intensive screening program was associated with a reduced incidence of cancer after transplantation. This study evaluated the usefulness of the gene expression profiling of peripheral blood samples obtained from kidney transplant patients and adopted a screening test for detecting cancer of the digestive system (gastric, colon, pancreas, and biliary tract). Nineteen patients were included in this study and a total of 53 gene expression screening tests were performed. The gene expression profiles of blood-delivered total RNA and whole genome human gene expression profiles were obtained. We investigated the expression levels of 2665 genes associated with digestive cancers and counted the number of genes in which expression was altered. A hierarchical clustering analysis was also performed. The final prediction of the cancer possibility was determined according to an algorithm. The number of genes in which expression was altered was significantly increased in the kidney transplant recipients in comparison with the general population (1091 ± 63 vs 823 ± 94; P = .0024). The number of genes with altered expression decreased after the induction of mechanistic target of rapamycin (mTOR) inhibitor (1484 ± 227 vs 883 ± 154; P = .0439). No cases of possible digestive cancer were detected in this study period. The gene expression profiling of peripheral blood samples may be a useful and noninvasive diagnostic tool that allows for the early detection of cancer of the digestive system. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  8. A powerful nonparametric method for detecting differentially co-expressed genes: distance correlation screening and edge-count test.

    Science.gov (United States)

    Zhang, Qingyang

    2018-05-16

    Differential co-expression analysis, as a complement of differential expression analysis, offers significant insights into the changes in molecular mechanism of different phenotypes. A prevailing approach to detecting differentially co-expressed genes is to compare Pearson's correlation coefficients in two phenotypes. However, due to the limitations of Pearson's correlation measure, this approach lacks the power to detect nonlinear changes in gene co-expression which is common in gene regulatory networks. In this work, a new nonparametric procedure is proposed to search differentially co-expressed gene pairs in different phenotypes from large-scale data. Our computational pipeline consisted of two main steps, a screening step and a testing step. The screening step is to reduce the search space by filtering out all the independent gene pairs using distance correlation measure. In the testing step, we compare the gene co-expression patterns in different phenotypes by a recently developed edge-count test. Both steps are distribution-free and targeting nonlinear relations. We illustrate the promise of the new approach by analyzing the Cancer Genome Atlas data and the METABRIC data for breast cancer subtypes. Compared with some existing methods, the new method is more powerful in detecting nonlinear type of differential co-expressions. The distance correlation screening can greatly improve computational efficiency, facilitating its application to large data sets.

  9. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  10. Sequence diversity within the HA-1 gene as detected by melting temperature assay without oligonucleotide probes

    Directory of Open Access Journals (Sweden)

    Mattiuz Pier

    2005-10-01

    Full Text Available Abstract Background The minor histocompatibility antigens (mHags are self-peptides derived from common cellular proteins and presented by MHC class I and II molecules. Disparities in mHags are a potential risk for the development of graft-versus-host disease (GvHD in the recipients of bone marrow from HLA-identical donors. Two alleles have been identified in the mHag HA-1. The correlation between mismatches of the mHag HA-1 and GvHD has been suggested and methods to facilitate large-scale testing were afterwards developed. Methods We used sequence specific primer (SSP PCR and direct sequencing to detect HA-1 gene polymorphisms in a sample of 131 unrelated Italian subjects. We then set up a novel melting temperature (Tm assay that may help identification of HA-1 alleles without oligonucleotide probes. Results We report the frequencies of HA-1 alleles in the Italian population and the presence of an intronic 5 base-pair deletion associated with the immunogeneic allele HA-1H. We also detected novel variable sites with respect to the consensus sequence of HA-1 locus. Even though recombination/gene conversion events are documented, there is considerable linkage disequilibrium in the data. The gametic associations between HA-1R/H alleles and the intronic 5-bp ins/del polymorphism prompted us to try the Tm analysis with SYBR® Green I. We show that the addition of dimethylsulfoxide (DMSO during the assay yields distinct patterns when amplicons from HA-1H homozygotes, HA-1R homozygotes, and heterozygotes are analysed. Conclusion The possibility to use SYBR® Green I to detect Tm differences between allelic variants is attractive but requires great caution. We succeeded in allele discrimination of the HA-1 locus using a relatively short (101 bp amplicon, only in the presence of DMSO. We believe that, at least in certain assets, Tm assays may benefit by the addition of DMSO or other agents affecting DNA strand conformation and stability.

  11. Novel Mutations Detected in Avirulence Genes Overcoming Tomato Cf Resistance Genes in Isolates of a Japanese Population of Cladosporium fulvum.

    Directory of Open Access Journals (Sweden)

    Yuichiro Iida

    Full Text Available Leaf mold of tomato is caused by the biotrophic fungus Cladosporium fulvum which complies with the gene-for-gene system. The disease was first reported in Japan in the 1920s and has since been frequently observed. Initially only race 0 isolates were reported, but since the consecutive introduction of resistance genes Cf-2, Cf-4, Cf-5 and Cf-9 new races have evolved. Here we first determined the virulence spectrum of 133 C. fulvum isolates collected from 22 prefectures in Japan, and subsequently sequenced the avirulence (Avr genes Avr2, Avr4, Avr4E, Avr5 and Avr9 to determine the molecular basis of overcoming Cf genes. Twelve races of C. fulvum with a different virulence spectrum were identified, of which races 9, 2.9, 4.9, 4.5.9 and 4.9.11 occur only in Japan. The Avr genes in many of these races contain unique mutations not observed in races identified elsewhere in the world including (i frameshift mutations and (ii transposon insertions in Avr2, (iii point mutations in Avr4 and Avr4E, and (iv deletions of Avr4E, Avr5 and Avr9. New races have developed by selection pressure imposed by consecutive introductions of Cf-2, Cf-4, Cf-5 and Cf-9 genes in commercially grown tomato cultivars. Our study shows that molecular variations to adapt to different Cf genes in an isolated C. fulvum population in Japan are novel but overall follow similar patterns as those observed in populations from other parts of the world. Implications for breeding of more durable C. fulvum resistant varieties are discussed.

  12. Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

    Science.gov (United States)

    Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

    2013-01-01

    Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

  13. Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

    Directory of Open Access Journals (Sweden)

    Huali Huang

    Full Text Available Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L. DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

  14. Evaluation of Four Endogenous Reference Genes and Their Real-Time PCR Assays for Common Wheat Quantification in GMOs Detection

    Science.gov (United States)

    Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

    2013-01-01

    Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat. PMID:24098735

  15. Subclassification and Detection of New Markers for the Discrimination of Primary Liver Tumors by Gene Expression Analysis Using Oligonucleotide Arrays.

    Science.gov (United States)

    Hass, Holger G; Vogel, Ulrich; Scheurlen, Michael; Jobst, Jürgen

    2017-12-26

    The failure to correctly differentiate between intrahepatic cholangiocarcinoma [CC] and hepatocellular carcinoma [HCC] is a significant clinical problem, particularly in terms of the different treatment goals for both cancers. In this study a specific gene expression profile to discriminate these two subgroups of liver cancer was established and potential diagnostic markers for clinical use were analyzed. To evaluate the gene expression profiles of HCC and intrahepatic CC, Oligonucleotide arrays ( Affymetrix U133A) were used. Overexpressed genes were checked for their potential use as new markers for discrimination and their expression values were validated by reverse transcription polymerase chain reaction and immunohistochemistry analyses. 695 genes/expressed sequence tags (ESTs) in HCC (245 up-/450 down-regulated) and 552 genes/ESTs in CC (221 up-/331 down-regulated) were significantly dysregulated (p〈0.05, fold change >2, ≥70%). Using a supervised learning method, and one-way analysis of variance a specific 270-gene expression profile that enabled rapid, reproducible differentiation between both tumors and non-malignant liver tissues was established. A panel of 12 genes (e.g. HSP90β, ERG1, GPC3, TKT, ACLY, and NME1 for HCC; SPT2, T4S3, CNX43, TTD1, HBD01 for CC) were detected and partly described for the first time as potential discrimination markers. A specific gene expression profile for discrimination of primary liver cancer was identified and potential marker genes with feasible clinical impact were described.

  16. GBOOST: a GPU-based tool for detecting gene-gene interactions in genome-wide case control studies.

    Science.gov (United States)

    Yung, Ling Sing; Yang, Can; Wan, Xiang; Yu, Weichuan

    2011-05-01

    Collecting millions of genetic variations is feasible with the advanced genotyping technology. With a huge amount of genetic variations data in hand, developing efficient algorithms to carry out the gene-gene interaction analysis in a timely manner has become one of the key problems in genome-wide association studies (GWAS). Boolean operation-based screening and testing (BOOST), a recent work in GWAS, completes gene-gene interaction analysis in 2.5 days on a desktop computer. Compared with central processing units (CPUs), graphic processing units (GPUs) are highly parallel hardware and provide massive computing resources. We are, therefore, motivated to use GPUs to further speed up the analysis of gene-gene interactions. We implement the BOOST method based on a GPU framework and name it GBOOST. GBOOST achieves a 40-fold speedup compared with BOOST. It completes the analysis of Wellcome Trust Case Control Consortium Type 2 Diabetes (WTCCC T2D) genome data within 1.34 h on a desktop computer equipped with Nvidia GeForce GTX 285 display card. GBOOST code is available at http://bioinformatics.ust.hk/BOOST.html#GBOOST.

  17. Detection of Toxoplasma gondii in Diabetic Patients Using the Nested PCR Assay via RE and B1 Genes.

    Science.gov (United States)

    Mousavi, Mohammad; Saravani, Ramin; Jafari Modrek, Mohammad; Shahrakipour, Mahnaz; Sekandarpour, Sina

    2016-02-01

    Toxoplasma gondii is an obligate intracellular protozoan parasite that exists worldwide. Various techniques have been developed for T. gondii detection. The aim of this study was the detection of T. gondii in diabetic patients with RE and B1 genes and the comparison of these two genes for diagnosis using the nested-PCR assay method. DNA samples from 205 diabetic patients who had been referred to the diabetes center of Ali Asghar hospital in Zahedan, Iran, were collected and analyzed using the nested-PCR assay method. Toxoplasma antibody data gathered using the enzyme-linked immunosorbent assay (ELISA) method from a previous study was used to group patients. The data were analyzed using SPSS 18. The chi-square test was used for comparison. Of the diabetic patients selected, the following results were obtained: 53 (IgG+, IgM+); 20 (IgG-, IgM+); 72 (IgG+, IgM-); and 60 (IgG-, IgM-). The nested-PCR detected the following: in the acute group, 21/53 (39.63%), 30/53 (56.60%) (IgM+, IgG+); in the chronic group, 40/72 (55.56%), 51/72 (70.83%), (IgG+, IgM-); in the false positive group, 18/20 (90%), 17/20 (85%) (IgM+, IgG-); and sero-negative samples of 38/60 (63.33%) and 60/ 41 (77.35%) for RE and B1 genes, respectively. The prevalence of toxoplasmosis showed positive in patients with diabetes in the B1 gene 139 (67.8%) and RE gene 117 (57.1%). Our study demonstrated that the B1 gene, more so than the RE gene, showed positive samples and can be used to detect toxoplasmosis, although the B1 gene, in comparison to the RE gene, did not show any superiority of molecular diagnosing capability. Results also showed that toxoplasma molecular detection methods can be used instead of routine serological detection methods in a clinical laboratory testing.

  18. Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

    Directory of Open Access Journals (Sweden)

    Hashishe Mervat M

    2010-06-01

    Full Text Available Abstract Background Breast cancer is one of the most common diseases affecting women. Inherited susceptibility genes, BRCA1 and BRCA2, are considered in breast, ovarian and other common cancers etiology. BRCA1 and BRCA2 genes have been identified that confer a high degree of breast cancer risk. Objective Our study was performed to identify germline mutations in some exons of BRCA1 and BRCA2 genes for the early detection of presymptomatic breast cancer in females. Methods This study was applied on Egyptian healthy females who first degree relatives to those, with or without a family history, infected with breast cancer. Sixty breast cancer patients, derived from 60 families, were selected for molecular genetic testing of BRCA1 and BRCA2 genes. The study also included 120 healthy first degree female relatives of the patients, either sisters and/or daughters, for early detection of presymptomatic breast cancer mutation carriers. Genomic DNA was extracted from peripheral blood lymphocytes of all the studied subjects. Universal primers were used to amplify four regions of the BRCA1 gene (exons 2,8,13 and 22 and one region (exon 9 of BRCA2 gene using specific PCR. The polymerase chain reaction was carried out. Single strand conformation polymorphism assay and heteroduplex analysis were used to screen for mutations in the studied exons. In addition, DNA sequencing of the normal and mutated exons were performed. Results Mutations in both BRCA1 and BRCA2 genes were detected in 86.7% of the families. Current study indicates that 60% of these families were attributable to BRCA1 mutations, while 26.7% of them were attributable to BRCA2 mutations. Results showed that four mutations were detected in the BRCA1 gene, while one mutation was detected in the BRCA2 gene. Asymptomatic relatives, 80(67% out of total 120, were mutation carriers. Conclusions BRCA1 and BRCA2 genes mutations are responsible for a significant proportion of breast cancer. BRCA mutations

  19. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    OpenAIRE

    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

    2004-01-01

    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  20. Comparison of different phenotypic methods of detection of methicillin resistance in staphylococcus aureus with the molecular detection of mec-a gene

    International Nuclear Information System (INIS)

    Zeeshan, M.; Jabeen, K.; Irfan, S.; Parween, Z.; Zafar, A.

    2007-01-01

    To evaluate accuracy, cost-effectiveness and ease to perform different phenotypic methods i.e. Cefoxitin 30 micro g disc, Oxacillin 1micro g disc and Oxacillin agar screening plate (6 micro g/ml) for early and accurate identification of MRSA by comparing with the detection of mec-A gene in our clinical isolates. Out of 200 clinical samples, conventional Polymerase Chain Reaction (PCR) was done on 62 pure biochemically identified S. aureus isolates for mec-A gene detection. Phenotypic methods for detecting methicillin sensitivity (Cefoxitin 30 microg disc, Oxacillin 1 micro g disc and Oxacillin agar screening plate) were also used according to the recommended incubation time, duration and temperature on the same isolates. Out of 62 isolates of S. aureus, mec-A gene were detected (MRSA) in 32, whereas 30 were mec-A gene negative (MSSA). Cefoxitin disc and agar screening plate correctly identify all MRSA isolates with the sensitivity and specificity of 100%. Single isolate was false, positively detected as sensitive with Oxacillin 1g disc, due to which, the sensitivity and negative predictive value of this method were reduced to 96.9% and 96.8% respectively, while positive predictive value and specificity remained 100%. Comparing different phenotypic methods for MRSA screening in routine microbiology laboratory, Cefoxitin disc and Oxacillin agar screening has better sensitivity and specificity comparative to Oxacillin disc. However, Cefoxitin disc can be preferred especially for small laboratories because it is easy to perform, do not require special technique and media preparation is consequently more cost-effective. (author)

  1. Automated Detection of Cancer Associated Genes Using a Combined Fuzzy-Rough-Set-Based F-Information and Water Swirl Algorithm of Human Gene Expression Data.

    Directory of Open Access Journals (Sweden)

    Pugalendhi Ganesh Kumar

    Full Text Available This study describes a novel approach to reducing the challenges of highly nonlinear multiclass gene expression values for cancer diagnosis. To build a fruitful system for cancer diagnosis, in this study, we introduced two levels of gene selection such as filtering and embedding for selection of potential genes and the most relevant genes associated with cancer, respectively. The filter procedure was implemented by developing a fuzzy rough set (FR-based method for redefining the criterion function of f-information (FI to identify the potential genes without discretizing the continuous gene expression values. The embedded procedure is implemented by means of a water swirl algorithm (WSA, which attempts to optimize the rule set and membership function required to classify samples using a fuzzy-rule-based multiclassification system (FRBMS. Two novel update equations are proposed in WSA, which have better exploration and exploitation abilities while designing a self-learning FRBMS. The efficiency of our new approach was evaluated on 13 multicategory and 9 binary datasets of cancer gene expression. Additionally, the performance of the proposed FRFI-WSA method in designing an FRBMS was compared with existing methods for gene selection and optimization such as genetic algorithm (GA, particle swarm optimization (PSO, and artificial bee colony algorithm (ABC on all the datasets. In the global cancer map with repeated measurements (GCM_RM dataset, the FRFI-WSA showed the smallest number of 16 most relevant genes associated with cancer using a minimal number of 26 compact rules with the highest classification accuracy (96.45%. In addition, the statistical validation used in this study revealed that the biological relevance of the most relevant genes associated with cancer and their linguistics detected by the proposed FRFI-WSA approach are better than those in the other methods. The simple interpretable rules with most relevant genes and effectively

  2. Spectrophotometric, colorimetric and visually detection of Pseudomonas aeruginosa ETA gene based gold nanoparticles DNA probe and endonuclease enzyme

    Science.gov (United States)

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

    2018-06-01

    Colorimetric DNA detection is preferred over other methods for clinical molecular diagnosis because it does not require expensive equipment. In the present study, the colorimetric method based on gold nanoparticles (GNPs) and endonuclease enzyme was used for the detection of P. aeruginosa ETA gene. Firstly, the primers and probe for P. aeruginosa exotoxin A (ETA) gene were designed and checked for specificity by the PCR method. Then, GNPs were synthesized using the citrate reduction method and conjugated with the prepared probe to develop the new nano-biosensor. Next, the extracted target DNA of the bacteria was added to GNP-probe complex to check its efficacy for P. aeruginosa ETA gene diagnosis. A decrease in absorbance was seen when GNP-probe-target DNA cleaved into the small fragments of BamHI endonuclease due to the weakened electrostatic interaction between GNPs and the shortened DNA. The right shift of the absorbance peak from 530 to 562 nm occurred after adding the endonuclease. It was measured using a UV-VIS absorption spectroscopy that indicates the existence of the P. aeruginosa ETA gene. Sensitivity was determined in the presence of different concentrations of target DNA of P. aeruginosa. The results obtained from the optimized conditions showed that the absorbance value has linear correlation with concentration of target DNA (R: 0.9850) in the range of 10-50 ng mL-1 with the limit detection of 9.899 ng mL-1. Thus, the specificity of the new method for detection of P. aeruginosa was established in comparison with other bacteria. Additionally, the designed assay was quantitatively applied to detect the P. aeruginosa ETA gene from 103 to 108 CFU mL-1 in real samples with a detection limit of 320 CFU mL-1.

  3. Identification of novel candidate target genes in amplicons of Glioblastoma multiforme tumors detected by expression and CGH microarray profiling

    Directory of Open Access Journals (Sweden)

    Hernández-Moneo Jose-Luis

    2006-09-01

    Full Text Available Abstract Background Conventional cytogenetic and comparative genomic hybridization (CGH studies in brain malignancies have shown that glioblastoma multiforme (GBM is characterized by complex structural and numerical alterations. However, the limited resolution of these techniques has precluded the precise identification of detailed specific gene copy number alterations. Results We performed a genome-wide survey of gene copy number changes in 20 primary GBMs by CGH on cDNA microarrays. A novel amplicon at 4p15, and previously uncharacterized amplicons at 13q32-34 and 1q32 were detected and are analyzed here. These amplicons contained amplified genes not previously reported. Other amplified regions containg well-known oncogenes in GBMs were also detected at 7p12 (EGFR, 7q21 (CDK6, 4q12 (PDGFRA, and 12q13-15 (MDM2 and CDK4. In order to identify the putative target genes of the amplifications, and to determine the changes in gene expression levels associated with copy number change events, we carried out parallel gene expression profiling analyses using the same cDNA microarrays. We detected overexpression of the novel amplified genes SLA/LP and STIM2 (4p15, and TNFSF13B and COL4A2 (13q32-34. Some of the candidate target genes of amplification (EGFR, CDK6, MDM2, CDK4, and TNFSF13B were tested in an independent set of 111 primary GBMs by using FISH and immunohistological assays. The novel candidate 13q-amplification target TNFSF13B was amplified in 8% of the tumors, and showed protein expression in 20% of the GBMs. Conclusion This high-resolution analysis allowed us to propose novel candidate target genes such as STIM2 at 4p15, and TNFSF13B or COL4A2 at 13q32-34 that could potentially contribute to the pathogenesis of these tumors and which would require futher investigations. We showed that overexpression of the amplified genes could be attributable to gene dosage and speculate that deregulation of those genes could be important in the development

  4. Integrative analysis of gene expression and DNA methylation using unsupervised feature extraction for detecting candidate cancer biomarkers.

    Science.gov (United States)

    Moon, Myungjin; Nakai, Kenta

    2018-04-01

    Currently, cancer biomarker discovery is one of the important research topics worldwide. In particular, detecting significant genes related to cancer is an important task for early diagnosis and treatment of cancer. Conventional studies mostly focus on genes that are differentially expressed in different states of cancer; however, noise in gene expression datasets and insufficient information in limited datasets impede precise analysis of novel candidate biomarkers. In this study, we propose an integrative analysis of gene expression and DNA methylation using normalization and unsupervised feature extractions to identify candidate biomarkers of cancer using renal cell carcinoma RNA-seq datasets. Gene expression and DNA methylation datasets are normalized by Box-Cox transformation and integrated into a one-dimensional dataset that retains the major characteristics of the original datasets by unsupervised feature extraction methods, and differentially expressed genes are selected from the integrated dataset. Use of the integrated dataset demonstrated improved performance as compared with conventional approaches that utilize gene expression or DNA methylation datasets alone. Validation based on the literature showed that a considerable number of top-ranked genes from the integrated dataset have known relationships with cancer, implying that novel candidate biomarkers can also be acquired from the proposed analysis method. Furthermore, we expect that the proposed method can be expanded for applications involving various types of multi-omics datasets.

  5. Detection of mismatch repair gene germline mutation carrier among Chinese population with colorectal cancer

    International Nuclear Information System (INIS)

    Jin, Hei-Ying; Zhao, Ronghua; Liu, Xiufang; Li, Vicky Ka Ming; Ding, Yijiang; Yang, Bolin; Geng, Jianxiang; Lai, Rensheng; Ding, Shuqing; Ni, Min

    2008-01-01

    Hereditary nonpolyposis colorectal cancer (HNPCC) is an autosomal dominant syndrome. The National Cancer Institute (NCI) has recommended the Revised Bethesda guidelines for screening HNPCC. There has been a great deal of research on the value of these tests in other countries. However, literature about the Chinese population is scarce. Our objective is to detect and study microsatellite instability (MSI) and mismatch repair (MMR) gene germline mutation carriers among a Chinese population with colorectal cancer. In 146 prospectively recruited consecutive patients with clinically proven colorectal cancer, MSI carriers were identified by analysis of tumor tissue using multiplex fluorescence polymerase chain reaction (PCR) using the NCI recommended panel and classified into microsatellite instability-low (MSI-L), microsatellite instability-high (MSI-H) and microsatellite stable (MSS) groups. Immunohistochemical staining for MSH2, MSH6 and MLH1 on tissue microarrays (TMAs) was performed, and methylation of the MLH1 promoter was analyzed by quantitative methylation specific PCR (MSP). Germline mutation analysis of blood samples was performed for MSH2, MSH6 and MLH1 genes. Thirty-four out of the 146 colorectal cancers (CRCs, 23.2%) were MSI, including 19 MSI-H CRCs and 15 MSI-L CRCS. Negative staining for MSH2 was found in 8 CRCs, negative staining for MSH6 was found in 6 CRCs. One MSI-H CRC was negative for both MSH6 and MSH2. Seventeen CRCs stained negatively for MLH1. MLH1 promoter methylation was determined in 34 MSI CRCs. Hypermethylation of the MLH1 promoter occurred in 14 (73.7%) out of 19 MSI-H CRCs and 5 (33.3%) out of 15 MSI-L CRCs. Among the 34 MSI carriers and one MSS CRC with MLH1 negative staining, 8 had a MMR gene germline mutation, which accounted for 23.5% of all MSI colorectal cancers and 5.5% of all the colorectal cancers. Five patients harbored MSH2 germline mutations, and three patients harbored MSH6 germline mutations. None of the patients had an MLH

  6. Evaluation of molecular detection of extrapulmonary tuberculosis and resistance to rifampicin with GeneXpert® MTB/RIF.

    Science.gov (United States)

    Marouane, C; Smaoui, S; Kammoun, S; Slim, L; Messadi-Akrout, F

    2016-02-01

    We aimed to evaluate the GeneXpert® MTB/RIF test for the diagnosis of extrapulmonary tuberculosis. The test simultaneously detects Mycobacterium tuberculosis complex and resistance to rifampicin. We analyzed 153 clinical samples collected in a tertiary hospital in Sfax, Tunisia, between 2013 and 2014. We performed the GeneXpert® test, a Ziehl-Neelsen and auramine-rhodamine staining, conventional culture on MGIT 960 and LJ media, and we tested the resistance to anti-tuberculosis drugs on MGIT 960 and LJ media for each sample. Diagnosis was based on clinical, radiological, microbiological, pathological, and therapeutic data. We considered that 59 patients out of 153 presented with tuberculosis. PCR was positive in 50 samples and all of these samples were susceptible to rifampicin. Sensitivity, specificity, positive predictive value, and negative predictive value of the GeneXpert® test were 84.7%, 96.8%, 94.3%, and 91%, respectively, compared with diagnosis. We observed a statistically significant difference between the direct test and the GeneXpert® test, and between culture and the GeneXpert® test. No statistically significant difference was observed between pathological results and the GeneXpert® test. Sensitivity of the GeneXpert® test was 87.5% in biopsies, 80% in pus and abscesses, and 66.7% in biological fluids. All strains were susceptible to rifampicin with culture and GeneXpert® test. The GeneXpert® test helped detect a higher proportion of M. tuberculosis complex. It does not replace conventional diagnostic methods but it is a useful addition to achieve better sensitivity and obtain rapid results. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  7. Group spike-and-slab lasso generalized linear models for disease prediction and associated genes detection by incorporating pathway information.

    Science.gov (United States)

    Tang, Zaixiang; Shen, Yueping; Li, Yan; Zhang, Xinyan; Wen, Jia; Qian, Chen'ao; Zhuang, Wenzhuo; Shi, Xinghua; Yi, Nengjun

    2018-03-15

    Large-scale molecular data have been increasingly used as an important resource for prognostic prediction of diseases and detection of associated genes. However, standard approaches for omics data analysis ignore the group structure among genes encoded in functional relationships or pathway information. We propose new Bayesian hierarchical generalized linear models, called group spike-and-slab lasso GLMs, for predicting disease outcomes and detecting associated genes by incorporating large-scale molecular data and group structures. The proposed model employs a mixture double-exponential prior for coefficients that induces self-adaptive shrinkage amount on different coefficients. The group information is incorporated into the model by setting group-specific parameters. We have developed a fast and stable deterministic algorithm to fit the proposed hierarchal GLMs, which can perform variable selection within groups. We assess the performance of the proposed method on several simulated scenarios, by varying the overlap among groups, group size, number of non-null groups, and the correlation within group. Compared with existing methods, the proposed method provides not only more accurate estimates of the parameters but also better prediction. We further demonstrate the application of the proposed procedure on three cancer datasets by utilizing pathway structures of genes. Our results show that the proposed method generates powerful models for predicting disease outcomes and detecting associated genes. The methods have been implemented in a freely available R package BhGLM (http://www.ssg.uab.edu/bhglm/). nyi@uab.edu. Supplementary data are available at Bioinformatics online.

  8. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    Science.gov (United States)

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  9. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    International Nuclear Information System (INIS)

    Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

    2010-01-01

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  10. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    Energy Technology Data Exchange (ETDEWEB)

    Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

    2010-06-15

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  11. Molecular detection and analysis of a novel metalloprotease gene of entomopathogenic Serratia marcescens strains in infected Galleria mellonella.

    Science.gov (United States)

    Tambong, J T; Xu, R; Sadiku, A; Chen, Q; Badiss, A; Yu, Q

    2014-04-01

    Serratia marcescens strains isolated from entomopathogenic nematodes (Rhabditis sp.) were examined for their pathogenicity and establishment in wax moth (Galleria mellonella) larvae. All the Serratia strains were potently pathogenic to G. mellonella larvae, leading to death within 48 h. The strains were shown to possess a metalloprotease gene encoding for a novel serralysin-like protein. Rapid establishment of the bacteria in infected larvae was confirmed by specific polymerase chain reaction (PCR) detection of a DNA fragment encoding for this protein. Detection of the viable Serratia strains in infected larvae was validated using the SYBR Green reverse transcriptase real-time PCR assay targeting the metalloprotease gene. Nucleotide sequences of the metalloprotease gene obtained in our study showed 72 single nucleotide polymorphisms (SNP) and 3 insertions compared with the metalloprotease gene of S. marcescens E-15. The metalloprotease gene had 60 synonymous and 8 nonsynonymous substitutions relative to the closest GenBank entry, S. marcescens E-15. A comparison of the amino acid composition of the new serralysin-like protein with that of the serralysin protein of S. marcescens E-15 revealed differences at 11 positions and a new aspartic acid residue. Analysis of the effect of protein variation suggests that a new aspartic acid residue resulting from nonsynonymous nucleotide mutations in the protein structure could have the most significant effect on its biological function. The new metalloprotease gene and (or) its product could have applications in plant agricultural biotechnology.

  12. A De Novo Whole GCK Gene Deletion Not Detected by Gene Sequencing, in a Boy with Phenotypic GCK Insufficiency

    Directory of Open Access Journals (Sweden)

    N. H. Birkebæk

    2011-01-01

    Full Text Available We report on a boy with diabetes mellitus and a phenotype indicating glucokinase (GCK insufficiency, but a normal GCK gene examination applying direct gene sequencing. The boy was referred for diabetes mellitus at 7.5 years old. His father, grandfather and great grandfather suffered type 2 DM. Several blood glucose profiles showed (BG of 6.5–10 mmol/L L. After three years on neutral insulin Hagedorn (NPH in a dose of 0.3 IU/kg/day haemoglobin A1c (HbA1c was 6.8%. Treatment was changed to sulphonylurea 750 mg a day, and after 4 years HbA1c was 7%. At that time a multiplex ligation-dependent amplification gene dosage assay (MLPA was done, revealing a whole GCK gene deletion. Medical treatment was ceased, and after one year HbA1c was 6.8%. This case underscores the importance of a MLPA examination if the phenotype of a patient is strongly indicative of GCK insufficiency and no mutation is identified using direct sequencing.

  13. Application of heteroduplex analysis for detecting variation within the growth hormone 2 gene in Salmo trutta L. (brown trout).

    Science.gov (United States)

    Gross, R; Nilsson, J

    1995-03-01

    A new method to detect variation at a single copy nuclear gene in brown trout, Salmo trutta L., is provided. The technique entails (i) selective gene amplification by the polymerase chain reaction (PCR), (ii) digestion of amplification products by restriction endonucleases to obtain fragments of suitable size, (iii) hybridization with heterologous DNA followed by denaturation and reannealing to obtain heteroduplex molecules, and (iv) screening for variation in polyacrylamide gels. Variation was studied within a growth hormone 2 gene 1489 bp segment and polymorphism was detected in two HinfI-digested fragments. Formation of different heteroduplex patterns in experimental mixtures of digested amplification products from brown trout and Atlantic salmon, Salmo salar L., allowed us to determine the genotype of the brown trout. Polymorphism was observed in four out of six studied populations.

  14. Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

    Directory of Open Access Journals (Sweden)

    Jing Cai

    Full Text Available Hulless barley (Hordeum vulgare L. var. nudum. hook. f. has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin, E2 (Ubiquitin conjugating enzyme 2, TUBα (Alpha-tubulin, TUBβ6 (Beta-tubulin 6, GAPDH (Glyceraldehyde 3-phosphate dehydrogenase, EF-1α (Elongation factor 1-alpha, SAMDC (S-adenosylmethionine decarboxylase, PKABA1 (Gene for protein kinase HvPKABA1, PGK (Phosphoglycerate kinase, and HSP90 (Heat shock protein 90-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression

  15. Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

    Science.gov (United States)

    Cai, Jing; Li, Pengfei; Luo, Xiao; Chang, Tianliang; Li, Jiaxing; Zhao, Yuwei; Xu, Yao

    2018-01-01

    Hulless barley (Hordeum vulgare L. var. nudum. hook. f.) has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin), E2 (Ubiquitin conjugating enzyme 2), TUBα (Alpha-tubulin), TUBβ6 (Beta-tubulin 6), GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), EF-1α (Elongation factor 1-alpha), SAMDC (S-adenosylmethionine decarboxylase), PKABA1 (Gene for protein kinase HvPKABA1), PGK (Phosphoglycerate kinase), and HSP90 (Heat shock protein 90)-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression analysis

  16. MimiLook: A Phylogenetic Workflow for Detection of Gene Acquisition in Major Orthologous Groups of Megavirales.

    Science.gov (United States)

    Jain, Sourabh; Panda, Arup; Colson, Philippe; Raoult, Didier; Pontarotti, Pierre

    2017-04-07

    With the inclusion of new members, understanding about evolutionary mechanisms and processes by which members of the proposed order, Megavirales, have evolved has become a key area of interest. The central role of gene acquisition has been shown in previous studies. However, the major drawback in gene acquisition studies is the focus on few MV families or putative families with large variation in their genetic structure. Thus, here we have tried to develop a methodology by which we can detect horizontal gene transfers (HGTs), taking into consideration orthologous groups of distantly related Megavirale families. Here, we report an automated workflow MimiLook, prepared as a Perl command line program, that deduces orthologous groups (OGs) from ORFomes of Megavirales and constructs phylogenetic trees by performing alignment generation, alignment editing and protein-protein BLAST (BLASTP) searching across the National Center for Biotechnology Information (NCBI) non-redundant (nr) protein sequence database. Finally, this tool detects statistically validated events of gene acquisitions with the help of the T-REX algorithm by comparing individual gene tree with NCBI species tree. In between the steps, the workflow decides about handling paralogs, filtering outputs, identifying Megavirale specific OGs, detection of HGTs, along with retrieval of information about those OGs that are monophyletic with organisms from cellular domains of life. By implementing MimiLook, we noticed that nine percent of Megavirale gene families (i.e., OGs) have been acquired by HGT, 80% OGs were Megaviralespecific and eight percent were found to be sharing common ancestry with members of cellular domains (Eukaryote, Bacteria, Archaea, Phages or other viruses) and three percent were ambivalent. The results are briefly discussed to emphasize methodology. Also, MimiLook is relevant for detecting evolutionary scenarios in other targeted phyla with user defined modifications. It can be accessed at

  17. Rapid and sensitive reporter gene assays for detection of antiandrogenic and estrogenic effects of environmental chemicals

    DEFF Research Database (Denmark)

    Vinggaard, Anne; Jørgensen, E.C.B.; Larsen, John Christian

    1999-01-01

    Reports on increasing incidences in developmental abnormalities of the human male reproductive tract and the recent identifications of environmental chemicals with antiandrogenic activity necessitate the screening of a larger number of compounds in order to get an overview of potential antiandrog......Reports on increasing incidences in developmental abnormalities of the human male reproductive tract and the recent identifications of environmental chemicals with antiandrogenic activity necessitate the screening of a larger number of compounds in order to get an overview of potential...... antiandrogenic chemicals present in our environment. Thus, there is a great need for an effective in vitro screening method for (anti)androgenic chemicals. We have developed a rapid, sensitive, and reproducible reporter gene assay for detection of antiandrogenic chemicals. Chinese Hamster Ovary cells were...... calcium phosphate transfection method, this method has the advantage of being more feasible, as the assay can be scaled down to the microtiter plate format. Furthermore, the transfection reagent is noncytotoxic, allowing its addition together with the test compounds thereby reducing the hands...

  18. PCR detection and identification of oral streptococci in saliva samples using gtf genes.

    Science.gov (United States)

    Hoshino, Tomonori; Kawaguchi, Mamoru; Shimizu, Noriko; Hoshino, Naoko; Ooshima, Takashi; Fujiwara, Taku

    2004-03-01

    Oral streptococci are major constituents of dental plaque, and their prevalence is implicated in various pathologies. Therefore, accurate identification of oral streptococci would be valuable for studies of cariogenic plaque and for diagnostic use in infective endocarditis. Many oral streptococci possess glucosyltransferase enzymes that synthesize glucan, which is an obligate component of dental plaque. We established a rapid and precise method to identify oral streptococci by PCR using the species-specific region from the glucosyltransferase gene. With the species-specific primers, Streptococcus mutans, S. sobrinus, S. salivarius, S. sanguinis, S. oralis, and S. gordonii could be successfully distinguished. Further, we developed a simple method to extract the bacterial DNA from saliva. Using the resultant DNA as a template, the proposed PCR detection was performed. Their distribution was in accord with results of conventional biochemical tests. These findings indicate that the present PCR method is useful for the analysis of oral streptococci and can be successfully used in clinical applications to identify pathogenic bacteria associated with oral infectious disease and/or endocarditis.

  19. Diagnosis of mantle cell lymphoma and detection of bcl-1 gene rearrangement

    International Nuclear Information System (INIS)

    Lee, Seung Sook; Cho, Kyung Ja; Lee, Sun Joo

    1996-12-01

    We reclassified a large series of non-Hogkin's lymphoma diagnosed at Korea Cancer Center Hospital from 1991 to 1995, according to REAL classification, and compared the efficacy of immunohistochemical study for cyclin D1 protein and PCR for bcl-1 gene rearrangement to diagnose mantle cell lymphoma (MCL). By REAL classification, 7 %, diffuse large B-cell lymphoma was the most common type (51.8%) and was followed by peripheral T-cell lymphoma-unspecified (10%) and angiocentric lymphoma (7.5%). The most reliable histologic finding was mitosis to make a differential diagnosis. Mitoses of MCL were 17/10 HPF in average and all the cases showed more than 10/10 HPF. Immunophenotypic study alone cannot lead to a differential diagnosis between MCL and SLL, and the overexpression of cyclin D1 was the most important for diagnosis of MCL . Both immunohistochemistry for cyclin D1 and PCR for bcl-1 were specific for MCL and immunohistochemistry was more sensitive than PCR. Statistical analysis showed a different survival rate between MCL and the other low-grade B-cell lymphomas (SLL + MALT + LPL) and a difference between MCL and SLL. Immunohistochemical detection of cyclin D1 has a practical usefulness in making routine diagnosis of MCL. The initial accurate diagnosis of MCL will help clinicians make a proper management. (author). 27 refs., 6 tabs., 4 figs

  20. Diagnosis of mantle cell lymphoma and detection of bcl-1 gene rearrangement

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seung Sook; Cho, Kyung Ja; Lee, Sun Joo [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1996-12-01

    We reclassified a large series of non-Hogkin`s lymphoma diagnosed at Korea Cancer Center Hospital from 1991 to 1995, according to REAL classification, and compared the efficacy of immunohistochemical study for cyclin D1 protein and PCR for bcl-1 gene rearrangement to diagnose mantle cell lymphoma (MCL). By REAL classification, 7 %, diffuse large B-cell lymphoma was the most common type (51.8%) and was followed by peripheral T-cell lymphoma-unspecified (10%) and angiocentric lymphoma (7.5%). The most reliable histologic finding was mitosis to make a differential diagnosis. Mitoses of MCL were 17/10 HPF in average and all the cases showed more than 10/10 HPF. Immunophenotypic study alone cannot lead to a differential diagnosis between MCL and SLL, and the overexpression of cyclin D1 was the most important for diagnosis of MCL . Both immunohistochemistry for cyclin D1 and PCR for bcl-1 were specific for MCL and immunohistochemistry was more sensitive than PCR. Statistical analysis showed a different survival rate between MCL and the other low-grade B-cell lymphomas (SLL + MALT + LPL) and a difference between MCL and SLL. Immunohistochemical detection of cyclin D1 has a practical usefulness in making routine diagnosis of MCL. The initial accurate diagnosis of MCL will help clinicians make a proper management. (author). 27 refs., 6 tabs., 4 figs.

  1. Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

    Science.gov (United States)

    Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

    2009-10-23

    We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

  2. Detection of feline coronavirus spike gene mutations as a tool to diagnose feline infectious peritonitis.

    Science.gov (United States)

    Felten, Sandra; Weider, Karola; Doenges, Stephanie; Gruendl, Stefanie; Matiasek, Kaspar; Hermanns, Walter; Mueller, Elisabeth; Matiasek, Lara; Fischer, Andrea; Weber, Karin; Hirschberger, Johannes; Wess, Gerhard; Hartmann, Katrin

    2017-04-01

    Objectives Feline infectious peritonitis (FIP) is an important cause of death in the cat population worldwide. The ante-mortem diagnosis of FIP in clinical cases is still challenging. In cats without effusion, a definitive diagnosis can only be achieved post mortem or with invasive methods. The aim of this study was to evaluate the use of a combined reverse transcriptase nested polymerase chain reaction (RT-nPCR) and sequencing approach in the diagnosis of FIP, detecting mutations at two different nucleotide positions within the spike (S) gene. Methods The study population consisted of 64 cats with confirmed FIP and 63 cats in which FIP was initially suspected due to similar clinical or laboratory signs, but that were definitively diagnosed with another disease. Serum/plasma and/or effusion samples of these cats were examined for feline coronavirus (FCoV) RNA by RT-nPCR and, if positive, PCR products were sequenced for nucleotide transitions within the S gene. Results Specificity of RT-nPCR was 100% in all materials (95% confidence interval [CI] in serum/plasma 83.9-100.0; 95% CI in effusion 93.0-100.0). The specificity of the sequencing step could not be determined as none of the cats of the control group tested positive for FCoV RNA. Sensitivity of the 'combined RT-nPCR and sequencing approach' was 6.5% (95% CI 0.8-21.4) in serum/plasma and 65.3% (95% CI 50.4-78.3) in effusion. Conclusions and relevance A positive result is highly indicative of the presence of FIP, but as none of the control cats tested positive by RT-nPCR, it was not possible to confirm that the FCoV mutant described can only be found in cats with FIP. Further studies are necessary to evaluate the usefulness of the sequencing step including FCoV-RNA-positive cats with and without FIP. A negative result cannot be used to exclude the disease, especially when only serum/plasma samples are available.

  3. Detection of Rickettsia and Ehrlichia spp. in Ticks Associated with Exotic Reptiles and Amphibians Imported into Japan.

    Science.gov (United States)

    Andoh, Masako; Sakata, Akiko; Takano, Ai; Kawabata, Hiroki; Fujita, Hiromi; Une, Yumi; Goka, Koichi; Kishimoto, Toshio; Ando, Shuji

    2015-01-01

    One of the major routes of transmission of rickettsial and ehrlichial diseases is via ticks that infest numerous host species, including humans. Besides mammals, reptiles and amphibians also carry ticks that may harbor Rickettsia and Ehrlichia strains that are pathogenic to humans. Furthermore, reptiles and amphibians are exempt from quarantine in Japan, thus facilitating the entry of parasites and pathogens to the country through import. Accordingly, in the current study, we examined the presence of Rickettsia and Ehrlichia spp. genes in ticks associated with reptiles and amphibians originating from outside Japan. Ninety-three ticks representing nine tick species (genera Amblyomma and Hyalomma) were isolated from at least 28 animals spanning 10 species and originating from 12 countries (Ghana, Jordan, Madagascar, Panama, Russia, Sri Lanka, Sudan, Suriname, Tanzania, Togo, Uzbekistan, and Zambia). None of the nine tick species are indigenous in Japan. The genes encoding the common rickettsial 17-kDa antigen, citrate synthase (gltA), and outer membrane protein A (ompA) were positively detected in 45.2% (42/93), 40.9% (38/93), and 23.7% (22/93) of the ticks, respectively, by polymerase chain reaction (PCR). The genes encoding ehrlichial heat shock protein (groEL) and major outer membrane protein (omp-1) were PCR-positive in 7.5% (7/93) and 2.2% (2/93) of the ticks, respectively. The p44 gene, which encodes the Anaplasma outer membrane protein, was not detected. Phylogenetic analysis showed that several of the rickettsial and ehrlichial sequences isolated in this study were highly similar to human pathogen genes, including agents not previously detected in Japan. These data demonstrate the global transportation of pathogenic Rickettsia and Ehrlichia through reptile- and amphibian-associated ticks. These imported animals have potential to transfer pathogens into human life. These results highlight the need to control the international transportation of known and

  4. Detection of Rickettsia and Ehrlichia spp. in Ticks Associated with Exotic Reptiles and Amphibians Imported into Japan.

    Directory of Open Access Journals (Sweden)

    Masako Andoh

    Full Text Available One of the major routes of transmission of rickettsial and ehrlichial diseases is via ticks that infest numerous host species, including humans. Besides mammals, reptiles and amphibians also carry ticks that may harbor Rickettsia and Ehrlichia strains that are pathogenic to humans. Furthermore, reptiles and amphibians are exempt from quarantine in Japan, thus facilitating the entry of parasites and pathogens to the country through import. Accordingly, in the current study, we examined the presence of Rickettsia and Ehrlichia spp. genes in ticks associated with reptiles and amphibians originating from outside Japan. Ninety-three ticks representing nine tick species (genera Amblyomma and Hyalomma were isolated from at least 28 animals spanning 10 species and originating from 12 countries (Ghana, Jordan, Madagascar, Panama, Russia, Sri Lanka, Sudan, Suriname, Tanzania, Togo, Uzbekistan, and Zambia. None of the nine tick species are indigenous in Japan. The genes encoding the common rickettsial 17-kDa antigen, citrate synthase (gltA, and outer membrane protein A (ompA were positively detected in 45.2% (42/93, 40.9% (38/93, and 23.7% (22/93 of the ticks, respectively, by polymerase chain reaction (PCR. The genes encoding ehrlichial heat shock protein (groEL and major outer membrane protein (omp-1 were PCR-positive in 7.5% (7/93 and 2.2% (2/93 of the ticks, respectively. The p44 gene, which encodes the Anaplasma outer membrane protein, was not detected. Phylogenetic analysis showed that several of the rickettsial and ehrlichial sequences isolated in this study were highly similar to human pathogen genes, including agents not previously detected in Japan. These data demonstrate the global transportation of pathogenic Rickettsia and Ehrlichia through reptile- and amphibian-associated ticks. These imported animals have potential to transfer pathogens into human life. These results highlight the need to control the international transportation of known

  5. Detection and linkage to mobile genetic elements of tetracycline resistance gene tet(M) in Escherichia coli isolates from pigs

    DEFF Research Database (Denmark)

    Jurado-Rabadan, Sonia; de la Fuente, Ricardo; Ruiz-Santa-Quiteria, Jose A.

    2014-01-01

    Background: In Escherichia coli the genes involved in the acquisition of tetracycline resistance are mainly tet(A) and tet(B). In addition, tet(M) is the most common tetracycline resistance determinant in enterococci and it is associated with conjugative transposons and plasmids. Although tet......(M) has been identified in E. coli, to our knowledge, there are no previous reports studying the linkage of the tet(M) gene in E. coli to different mobile genetic elements. The aim of this study was to determine the occurrence of tet(A), tet(B), and tet(M) genes in doxycycline-resistant E. coli isolates...... from pigs, as well as the detection of mobile genetic elements linked to tet(M) in E. coli and its possible transfer from enterococci. Results: tet(A) was the most frequently detected gene (87.9%) in doxycycline-resistant isolates. tet(M) was found in 13.1% E. coli isolates. The tet(M) gene...

  6. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  7. Molecular detection of β-lactamase and integron genes in clinical strains of Klebsiella pneumoniae by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mansour Sedighi

    Full Text Available Abstract INTRODUCTION: Infections caused by β-lactamase-producing gram-negative bacteria, such as Klebsiella pneumoniae, are increasing globally with high morbidity and mortality. The aim of the current study was to determine antimicrobial susceptibility patterns and the prevalence of antibiotic resistance genes (β-lactamase and integron genes using multiplex PCR. METHODS One-hundred K. pneumoniae isolates were collected from different clinical samples. Antibiotic susceptibility testing was performed with thirteen different antibiotics. Multiplex-PCR was used to detect β-lactamase (bla TEM, bla CTX-M, bla SHV , bla VEB, bla PER, bla GES, bla VIM, bla IMP, bla OXA, and bla KPC and integron genes (int I, int II, and int III. RESULTS: The highest and lowest rate of resistance was exhibited against amikacin (93% and imipenem (8%, respectively. The frequency of β-lactamase-positive K. pneumoniae was 37%, and the prevalence of the bla TEM, bla CTX-M, bla SHV , bla VEB, bla PER, bla GES, bla VIM, bla IMP, bla OXA, and bla KPC genes was 38%, 24%, 19%, 12%, 6%, 11%, 33%, 0%, 28%, and 23%, respectively. Of the 100 isolates, eight (8% were positive for class I integrons; however, class II and III integrons were not detected in any of the strains. CONCLUSIONS: These results indicate co-carriage of a number of β-lactamase genes and antibiotic resistance integrons on the same plasmids harboring multi-drug resistance genes. It seems that these properties help to decrease treatment complications due to resistant bacterial infections by rapid detection, infection-control programs and prevention of transmission of drug resistance.

  8. PCR detection of oxytetracycline resistance genes otr(A) and otr(B) in tetracycline-resistant streptomycete isolates from diverse habitats

    NARCIS (Netherlands)

    Nikolakopoulou, T; Egan, S; van Overbeek, L; Guillaume, G; Heuer, H; Wellington, EMH; van Elsas, JD; Collard, JM; Smalla, K; Karagouni, A

    2005-01-01

    A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (Tc-R) streptomycete isolates from

  9. Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

    Science.gov (United States)

    Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

    2014-10-29

    Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

  10. Sensitivity and Frequencies of Dystrophin Gene Mutations in Thai DMD/BMD Patients As Detected by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Thanyachai Sura

    2008-01-01

    Full Text Available Background: Duchenne muscular dystrophy (DMD, a lethal X-linked disease affecting 1 in 3500 male births, and its more benign variant, Becker muscular dystrophy (BMD, are caused by mutations in the dystrophin gene. Because of its large size, analysing the whole gene is impractical. Methods have been developed to detect the commonest mutations i.e. the deletions of the exons. Although these tests are highly specific, their sensitivity is inherently limited by the prevalence of deletions, which differs among different populations.

  11. DETECTING PRESENCE OF C/T POLYMORPHISM AT POSITION 34 SECOND INTRON OF THE MYOSTATIN GENE IN RABBITS

    Directory of Open Access Journals (Sweden)

    Agnieszka MARKOWSKA

    2011-01-01

    Full Text Available Myostatin gene is a negative regulator of skeletal muscles growth. It is responsible for normal development of skeletal muscles. The objective of the research was to detect variation of C/T at position 34 of the second intron of the MNST gene in rabbits. The research included 114 rabbits: 54 of them Polish Rabbits, and 60 of them White Flemish Giants, examined by means of the PCR-RFLP method using AluI restriction enzyme. We found allele C with a frequency of 0.6184 of the examined rabbit population, and allele T with a frequency of 0.3816 of the examined rabbits.

  12. Candidate genes detected in transcriptome studies are strongly dependent on genetic background.

    Directory of Open Access Journals (Sweden)

    Pernille Sarup

    2011-01-01

    Full Text Available Whole genome transcriptomic studies can point to potential candidate genes for organismal traits. However, the importance of potential candidates is rarely followed up through functional studies and/or by comparing results across independent studies. We have analysed the overlap of candidate genes identified from studies of gene expression in Drosophila melanogaster using similar technical platforms. We found little overlap across studies between putative candidate genes for the same traits in the same sex. Instead there was a high degree of overlap between different traits and sexes within the same genetic backgrounds. Putative candidates found using transcriptomics therefore appear very sensitive to genetic background and this can mask or override effects of treatments. The functional importance of putative candidate genes emerging from transcriptome studies needs to be validated through additional experiments and in future studies we suggest a focus on the genes, networks and pathways affecting traits in a consistent manner across backgrounds.

  13. Synthetic medical studies on atomic bomb survivors exposed in short distances, 15. Detection of transforming gene(s)

    Energy Technology Data Exchange (ETDEWEB)

    Kamada, Nanao; Tanaka, Kimio; Kontani, Nobuko; Yokoro, Kenjiro; Takimoto, Yasuo; Kuramoto, Atsushi; Munaka, Masaki; Kurihara, Minoru; Hattori, Takao

    1988-03-01

    In an effort to search for biological significance of chromosome aberration observed in bone marrow cells and peripheral lymphocytes, the presence of transforming genes in the DNA of bone marrow cells was examined in four healthy A-bomb survivors (Group I), three with preleukemia (Group II), and nine with leukemia (Group III). In Group I exposed at 300 - 500 m from the hypocenter, estimated radiation doses ranged from 565 to 667 cGy; and randomly abnormal karyotypes ranged from 30.7 % to 48.3 %. In Group II exposed at 800 m, in which estimated radiation doses were 300 - 600 cGy, one survivor had a complicated karyotype abnormality; and in the two others, abnormal clones were partly observed. Group III, which was exposed at 800 - 2,000 m and had estimated doses of 20 - 200 cGy, consisted of acute lymphoid leukemia (one), acute myeloid leukemia (five), and chronic myeloid leukemia (three). The patient with acute lymphoid leukemia had a complicated karyotype abnormality. N-ras genes were observed not only in seven acute or chronic leukemic patients but also in three healthy survivors. This may have important implications for the mechanism of leukemic transformation. (Namekawa, K.).

  14. Detection of catabolic genes in indigenous microbial consortia isolated from a diesel-contaminated soil

    International Nuclear Information System (INIS)

    Milcic-Terzic, J.; Saval, S.; Lopez-Vidal, Y.; Vrvic, M.M.

    2001-01-01

    Bioremediation is often used for in situ remediation of petroleum-contaminated sites. The primary focus of this study was on understanding the indigenous microbial community which can survive in contaminated environment and is responsible for the degradation. Diesel, toluene and naphthalene-degrading microbial consortia were isolated from diesel-contaminated soil by growing on selective hydrocarbon substrates. The presence and frequency of the catabolic genes responsible for aromatic hydrocarbon biodegradation (xylE, ndoB) within the isolated consortia were screened using polymerase chain reaction PCR and DNA-DNA colony hybridization. The diesel DNA-extract possessed both the xylE catabolic gene for toluene, and the nah catabolic gene for polynuclear aromatic hydrocarbon degradation. The toluene DNA-extract possessed only the xylE catabolic gene, while the naphthalene DNA-extract only the ndoB gene. Restriction enzyme analysis with HaeIII indicated similar restriction patterns for the xylE gene fragment between toluene DNA-extract and a type strain, Pseudomonas putida ATCC 23973. A substantial proportion (74%) of the colonies from the diesel-consortium possessed the xylE gene, and the ndoB gene (78%), while a minority (29%) of the toluene-consortium harbored the xylE gene. 59% of the colonies from the naphthalene-consortium had the ndoB gene, and did not have the xylE gene. These results indicate that the microbial population has been naturally enriched in organisms carrying genes for aromatic hydrocarbon degradation and that significant aromatic biodegradative potential exists at the site. Characterization of the population genotype constitutes a molecular diagnosis which permits the determination of the catabolic potential of the site to degrade the contaminant present. (author)

  15. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  16. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  17. Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Vladimir Pyatov

    2017-01-01

    Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

  18. Characterization and detection of a widely distributed gene cluster that predicts anaerobic choline utilization by human gut bacteria.

    Science.gov (United States)

    Martínez-del Campo, Ana; Bodea, Smaranda; Hamer, Hilary A; Marks, Jonathan A; Haiser, Henry J; Turnbaugh, Peter J; Balskus, Emily P

    2015-04-14

    Elucidation of the molecular mechanisms underlying the human gut microbiota's effects on health and disease has been complicated by difficulties in linking metabolic functions associated with the gut community as a whole to individual microorganisms and activities. Anaerobic microbial choline metabolism, a disease-associated metabolic pathway, exemplifies this challenge, as the specific human gut microorganisms responsible for this transformation have not yet been clearly identified. In this study, we established the link between a bacterial gene cluster, the choline utilization (cut) cluster, and anaerobic choline metabolism in human gut isolates by combining transcriptional, biochemical, bioinformatic, and cultivation-based approaches. Quantitative reverse transcription-PCR analysis and in vitro biochemical characterization of two cut gene products linked the entire cluster to growth on choline and supported a model for this pathway. Analyses of sequenced bacterial genomes revealed that the cut cluster is present in many human gut bacteria, is predictive of choline utilization in sequenced isolates, and is widely but discontinuously distributed across multiple bacterial phyla. Given that bacterial phylogeny is a poor marker for choline utilization, we were prompted to develop a degenerate PCR-based method for detecting the key functional gene choline TMA-lyase (cutC) in genomic and metagenomic DNA. Using this tool, we found that new choline-metabolizing gut isolates universally possessed cutC. We also demonstrated that this gene is widespread in stool metagenomic data sets. Overall, this work represents a crucial step toward understanding anaerobic choline metabolism in the human gut microbiota and underscores the importance of examining this microbial community from a function-oriented perspective. Anaerobic choline utilization is a bacterial metabolic activity that occurs in the human gut and is linked to multiple diseases. While bacterial genes responsible for

  19. FUNDAMENTAL STUDY OF DETECTION OF MUSCLE HYPERTROPHY-ORIENTED GENE DOPING BY MYOSTATIN KNOCK DOWN USING RNA INTERFERENCE

    Directory of Open Access Journals (Sweden)

    Tohru Takemasa

    2012-06-01

    Full Text Available To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control

  20. Construction of a gene bank and use of the chromosome walking technique for the detection of new putative agrocin genes in Agrobacterium tumefaciens strain D286

    International Nuclear Information System (INIS)

    Herrera, G.

    1987-02-01

    A gene bank of Agrobacterium tumefaciens D286 wt has been constructed by cloning D286 wt DNA partially digested with EcoRI in the cosmid vector pLAFRI. The library; composed of 1750 members with a 27.7 kb average insert size was probed with pCDTn5-3, a cosmid vector carrying a D286:: Tn5 insert from the strain D286:: Tn5 Ag-. One recombinant cosmid of the library, pCDO932, was detected. The insert DNA of pCDO932 has sequences homologous to the D286:: Tn5 insert of pCDTn5-3, therefore it carries putative wt agrocin D286 genes. The insert DNA of pCDO932 was isolated and used to probe the D286 wt gene library. Chromosome walking resulted in the detection of pCD2375. EcoRI restriction digestions and DNA homology studies of pCDO932 and pCD2375 showed that their D286 wt inserts are both composed of 4 EcoRI DNA sub-fragments totalling 21.8 and 24.8 kb respectively, with an overlapping sequence extending 3.5 kb. In order to overcome the failure to detect A. tumefaciens cells transformed with pCDO932. Vectors pSUP204-1 was constructed. Such vector has been derived from pSUP204 which were slightly altered by cloning into it a 700 bp λ DNA SalI fragmet. This resulted in insertion inactivation of the Tc r gene, allows the use of pSUP204-1 as a subcloning vector in conjugations and transformations involving pCDO932 or pCD2375 and strains D286:: Tn5 Ag- and C58 C1G. Two recombinant cosmids bearing D286 wt DNA inserts, at least one of which (pCDO932) contains DNA sequences putatively affecting agrocin D286 production, are now available for further genetic manipulations. pSUP204-1 should prove useful as a subcloning vector for transformations and conjugations involving recombinant cosmids from the D286 wt gene bank and Agrobacterium strains. Future work on the molecular biology of agrocin D286 production is discussed. The DNA probe used in this study was labelled with phosphorus 32

  1. Age-Specific Gene Expression Profiles of Rhesus Monkey Ovaries Detected by Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Hengxi Wei

    2015-01-01

    Full Text Available The biological function of human ovaries declines with age. To identify the potential molecular changes in ovarian aging, we performed genome-wide gene expression analysis by microarray of ovaries from young, middle-aged, and old rhesus monkeys. Microarray data was validated by quantitative real-time PCR. Results showed that a total of 503 (60 upregulated, 443 downregulated and 84 (downregulated genes were differentially expressed in old ovaries compared to young and middle-aged groups, respectively. No difference in gene expression was found between middle-aged and young groups. Differentially expressed genes were mainly enriched in cell and organelle, cellular and physiological process, binding, and catalytic activity. These genes were primarily associated with KEGG pathways of cell cycle, DNA replication and repair, oocyte meiosis and maturation, MAPK, TGF-beta, and p53 signaling pathway. Genes upregulated were involved in aging, defense response, oxidation reduction, and negative regulation of cellular process; genes downregulated have functions in reproduction, cell cycle, DNA and RNA process, macromolecular complex assembly, and positive regulation of macromolecule metabolic process. These findings show that monkey ovary undergoes substantial change in global transcription with age. Gene expression profiles are useful in understanding the mechanisms underlying ovarian aging and age-associated infertility in primates.

  2. Candidate Genes Detected in Transcriptome Studies are Strongly Dependent on Genetic Background

    DEFF Research Database (Denmark)

    Sarup, Pernille Merete; Sørensen, Jesper Givskov; Kristensen, Torsten Nygård

    2011-01-01

    identified from studies of gene expression in Drosophila melanogaster using similar technical platforms. We found little overlap across studies between putative candidate genes for the same traits in the same sex. Instead there was a high degree of overlap between different traits and sexes within the same...

  3. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  4. Detection of OXA-Type Carbapenemase Genes in Acinetobacter baumannii Isolates from Nosocomial Infections in Isfahan Hospitals, Iran

    OpenAIRE

    Vajihe Karbasizade; Leila Heidari; Reyhaneh Jafari

    2016-01-01

    "> Background: Acinetobacter baumannii as one of the causes of nosocomial infections has becomeresistant to almost all antimicrobial agents. The emergence of resistance to carbapenems, one ofthe last drugs on the shelf, is the major concern about A. baumannii antimicrobial resistance.Resistance to carbapenems is mediated by production of class B and D carbapenemases. The aimof this study was to detect the resistance genes including blaOXA-23, 24, 51, and 58 in A. baumanniiisolates from nos...

  5. Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

    Science.gov (United States)

    Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

    2018-06-29

    The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Diversity of Archaea and detection of crenarchaeotal amoA genes in the rivers Rhine and Têt

    OpenAIRE

    Herfort, L.; Kim, J.H.; Coolen, M.J.L.; Abbas, B.; Schouten, S.; Herndl, G.J.; Sinninghe Damste, J.S.

    2009-01-01

    Pelagic archaeal phylogenetic diversity and the potential for crenarchaeotal nitrification of Group 1.1a were determined in the rivers Rhine and Têt by 16S rRNA sequencing, catalyzed reported deposition-fluorescence in situ hybridization (CARD–FISH) and quantification of 16S rRNA and functional genes. Euryarchaeota were, for the first time, detected in temperate river water even though a net predominance of crenarchaeotal phylotypes was found. Differences in phylogenic distribution were obser...

  7. Detection of retinoblastoma gene deletions in spontaneous and radiation-induced mouse lung adenocarcinomas by polymerase chain reaction

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-01-01

    A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma gene using histological sections from radiation-induced and spontaneous tumors as the DNA source. Six mouse Rb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mouse Rb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (5.69 Gy 60 Co γ rays or 0.6 Gy JANUS neutrons, which have been found to have approximately equal radiobiological effectiveness) were analyzed for mouse Rb deletions. Tumors in 6 neutron-irradiated mice had no mouse Rb deletions. However, 1 of 6 tumors from γ-irradiated mice (17%) and 6 of 18 spontaneous tumors from unirradiated mice (33%) showed a deletion in one or both mouse Rb alleles. All deletions detected were in the 5' region of the mouse Rb gene. 36 refs., 2 figs., 2 tabs

  8. Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

    Science.gov (United States)

    Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

    1995-06-01

    For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

  9. Detection of OXA-Type Carbapenemase Genes in Acinetobacter baumannii Isolates from Nosocomial Infections in Isfahan Hospitals, Iran

    Directory of Open Access Journals (Sweden)

    Vajihe Karbasizade

    2016-02-01

    Full Text Available "> Background: Acinetobacter baumannii as one of the causes of nosocomial infections has becomeresistant to almost all antimicrobial agents. The emergence of resistance to carbapenems, one ofthe last drugs on the shelf, is the major concern about A. baumannii antimicrobial resistance.Resistance to carbapenems is mediated by production of class B and D carbapenemases. The aimof this study was to detect the resistance genes including blaOXA-23, 24, 51, and 58 in A. baumanniiisolates from nosocomial infections in Isfahan hospitals.Methods: A total number of 456 clinical specimens were collected from nosocomial infections andevaluated in order to isolate A. baumannii strains. After identification of the isolates, the antibioticsensitivity to carbapenems was assessed using disk diffusion method. The resistance genes of blaOXA-23, 24, 51, and 58 were detected by multiplex PCR method.Results: Fifty A. baumannii isolates were isolated from clinical specimens. Fifty two percent ofthe isolates showed phenotypic resistance to the carbapenems (imipenem and meropenem.According to PCR results, 88% of resistant isolates had ≥1 blaOXA gene. The frequency of resistantisolates bearing blaOXA-23, blaOXA-24 and blaOXA-58 were 77%, 38% and 15% respectively.Conclusions: This study showed the high frequency of carbapenem resistance genes among A.baumannii isolates. Therefore, adopting an appropriate strategy to confine the spreading of thesestrains and also implementing new treatment regimens are necessary.

  10. The combination of heteroduplex analysis and protein truncation test for exact detection of the APC gene mutations

    International Nuclear Information System (INIS)

    Tomka, M.; Kirchhoff, T.; Stefurkova, V.; Zajac, V.; Kulcsar, L.

    1998-01-01

    Familial adenomatous polyposis (FAP) is usually associated with mutation in the adenomatous polyposis coli (APC) gene. To examine the occurrence of these mutations in the number of FAP suspected families from the whole Slovakia effectively, we have applied heteroduplex analysis (HDA) and protein truncation test (PTT) for the analyses of 2-5 base pair deletions and point mutations of the APC gene. In the analyzed exon 15 of the APC gene determined by the primers 15Efor-15Grev for HDA and 15ET7-15J3 for PTT more than 70% of mutations should be deletions [3, 12], which are detectable by HDA. In our collection of 5 FAP families mutations in the APC gene were found in families 10, 27 and 41 using HDA. By PTT test the formation of truncated APC protein in FAP families 2, 10, 16 and 27 were revealed. The necessity of combination of at least HDA and PTT techniques for exact detection of APC mutations in analyzed APC region is discussed. (authors)

  11. [Prokaryotic expression of vp3 gene of Muscovy duck parvovirus, and its antiserum preparation for detection of virus multiplication].

    Science.gov (United States)

    Huang, Yu; Zhu, Yumin; Dong, Shijuan; Yu, Ruisong; Zhang, Yuanshu; Li, Zhen

    2015-01-01

    New epidemic broke out in recent year which was suspected to be caused by variant Muscovy duck parvovirus (MDPV). For this reason, new MDPV detection methods are needed for the new virus strains. In this study, a pair of primers were designed according to the full-length genome of MDPV strain SAAS-SHNH, which were identified in 2012, and were used to amplify the vp3 gene of MDPV by polymerase chain reaction. After being sequenced, the vp3 gene was subcloned into the prokaryotic expression vector PET28a. The recombinant plasmid was transformed into E. coli BL21 and induced with IPTG. SDS-PAGE and Western blotting analysis showed the MDPV vp3 gene was successfully expressed. After being purified by Ni2+ affinity chromatography system, the recombinant protein was used as antigen to immunize rabbits to obtain antiserum. Western blotting analysis showed that the acquired antiserum could react specifically with VP3 protein of J3D6 strain and MDPV vaccine strain. The antiserum could also be used for detection of cultured MDPV from primary duck embryo fibroblasts by immune fluorescence assay (IFA). It could be concluded that the VP3 protein and its antibody prepared in the research could be used for detection of VP3 antiserum and antigen respectively.

  12. Establishment of a universal and rational gene detection strategy through three-way junction-based remote transduction.

    Science.gov (United States)

    Tang, Yidan; Lu, Baiyang; Zhu, Zhentong; Li, Bingling

    2018-01-21

    The polymerase chain reaction and many isothermal amplifications are able to achieve super gene amplification. Unfortunately, most commonly-used transduction methods, such as dye staining and Taqman-like probing, still suffer from shortcomings including false signals or difficult probe design, or are incompatible with multi-analysis. Here a universal and rational gene detection strategy has been established by translating isothermal amplicons to enzyme-free strand displacement circuits via three-way junction-based remote transduction. An assistant transduction probe was imported to form a partial hybrid with the target single-stranded nucleic acid. After systematic optimization the hybrid could serve as an associative trigger to activate a downstream circuit detector via a strand displacement reaction across the three-way junction. By doing so, the detection selectivity can be double-guaranteed through both amplicon-transducer recognition and the amplicon-circuit reaction. A well-optimized circuit can be immediately applied to a new target detection through simply displacing only 10-12 nt on only one component, according to the target. More importantly, this property for the first time enables multi-analysis and logic-analysis in a single reaction, sharing a single fluorescence reporter. In an applicable model, trace amounts of Cronobacter and Enterobacteria genes have been clearly distinguished from samples with no bacteria or one bacterium, with ultra-high sensitivity and selectivity.

  13. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Science.gov (United States)

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. [Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

    Science.gov (United States)

    Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

    2017-08-10

    To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

  15. Phylogenomic detection and functional prediction of genes potentially important for plant meiosis.

    Science.gov (United States)

    Zhang, Luoyan; Kong, Hongzhi; Ma, Hong; Yang, Ji

    2018-02-15

    Meiosis is a specialized type of cell division necessary for sexual reproduction in eukaryotes. A better understanding of the cytological procedures of meiosis has been achieved by comprehensive cytogenetic studies in plants, while the genetic mechanisms regulating meiotic progression remain incompletely understood. The increasing accumulation of complete genome sequences and large-scale gene expression datasets has provided a powerful resource for phylogenomic inference and unsupervised identification of genes involved in plant meiosis. By integrating sequence homology and expression data, 164, 131, 124 and 162 genes potentially important for meiosis were identified in the genomes of Arabidopsis thaliana, Oryza sativa, Selaginella moellendorffii and Pogonatum aloides, respectively. The predicted genes were assigned to 45 meiotic GO terms, and their functions were related to different processes occurring during meiosis in various organisms. Most of the predicted meiotic genes underwent lineage-specific duplication events during plant evolution, with about 30% of the predicted genes retaining only a single copy in higher plant genomes. The results of this study provided clues to design experiments for better functional characterization of meiotic genes in plants, promoting the phylogenomic approach to the evolutionary dynamics of the plant meiotic machineries. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Ki Young Yoo

    2010-03-01

    Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

  17. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  18. Detection of enteric Adenoviruses in South-African waters using gene probes

    CSIR Research Space (South Africa)

    Genthe, Bettina

    1995-01-01

    Full Text Available Gene probes developed locally for both enteric Adenoviruses 40 and 41 were used to determine whether these viruses were present in both raw and treated waters. Approximately sixty water samples were concentrated by ultra filtration and analysed...

  19. Detection of luciferase gene sequences in nonluminescent bacteria from the Chesapeake Bay

    Digital Repository Service at National Institute of Oceanography (India)

    Ramaiah, N.; Chun, J.; Ravel, J.; Straube, W.L.; Hill, R.T.; Colwell, R.R.

    in all cases were confirmed by PCR of DNA extracts and Southern hybridization analyses, using an internal probe for confirmation of luxA amplification products. Sequence analysis of luxA genes from three nonluminescent bacteria isolated from...

  20. Spectral Analysis on Time-Course Expression Data: Detecting Periodic Genes Using a Real-Valued Iterative Adaptive Approach

    Directory of Open Access Journals (Sweden)

    Kwadwo S. Agyepong

    2013-01-01

    Full Text Available Time-course expression profiles and methods for spectrum analysis have been applied for detecting transcriptional periodicities, which are valuable patterns to unravel genes associated with cell cycle and circadian rhythm regulation. However, most of the proposed methods suffer from restrictions and large false positives to a certain extent. Additionally, in some experiments, arbitrarily irregular sampling times as well as the presence of high noise and small sample sizes make accurate detection a challenging task. A novel scheme for detecting periodicities in time-course expression data is proposed, in which a real-valued iterative adaptive approach (RIAA, originally proposed for signal processing, is applied for periodogram estimation. The inferred spectrum is then analyzed using Fisher’s hypothesis test. With a proper -value threshold, periodic genes can be detected. A periodic signal, two nonperiodic signals, and four sampling strategies were considered in the simulations, including both bursts and drops. In addition, two yeast real datasets were applied for validation. The simulations and real data analysis reveal that RIAA can perform competitively with the existing algorithms. The advantage of RIAA is manifested when the expression data are highly irregularly sampled, and when the number of cycles covered by the sampling time points is very reduced.

  1. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  2. Differential gene expression in liver and small intestine from lactating rats compared to age-matched virgin controls detects increased mRNA of cholesterol biosynthetic genes

    Directory of Open Access Journals (Sweden)

    Jungsuwadee Paiboon

    2011-02-01

    Full Text Available Abstract Background Lactation increases energy demands four- to five-fold, leading to a two- to three-fold increase in food consumption, requiring a proportional adjustment in the ability of the lactating dam to absorb nutrients and to synthesize critical biomolecules, such as cholesterol, to meet the dietary needs of both the offspring and the dam. The size and hydrophobicity of the bile acid pool increases during lactation, implying an increased absorption and disposition of lipids, sterols, nutrients, and xenobiotics. In order to investigate changes at the transcriptomics level, we utilized an exon array and calculated expression levels to investigate changes in gene expression in the liver, duodenum, jejunum, and ileum of lactating dams when compared against age-matched virgin controls. Results A two-way mixed models ANOVA was applied to detect differentially expressed genes. Significance calls were defined as a p Cyp7a1, which catalyzes the rate limiting step in the bile acid biosynthetic pathway, was also significantly increased in liver. In addition, decreased levels of mRNA associated with T-cell signaling were found in the jejunum and ileum. Several members of the Solute Carrier (SLC and Adenosine Triphosphate Binding Cassette (ABC superfamilies of membrane transporters were found to be differentially expressed; these genes may play a role in differences in nutrient and xenobiotic absorption and disposition. mRNA expression of SLC39a4_predicted, a zinc transporter, was increased in all tissues, suggesting that it is involved in increased zinc uptake during lactation. Microarray data are available through GEO under GSE19175. Conclusions We detected differential expression of mRNA from several pathways in lactating dams, including upregulation of the cholesterol biosynthetic pathway in liver and intestine, consistent with Srebp activation. Differential T-Cell signaling in the two most distal regions of the small intestine (ileum and

  3. Loop-Mediated Isothermal Amplification Assay Targeting the MOMP Gene for Rapid Detection of Chlamydia psittaci Abortus Strain

    Directory of Open Access Journals (Sweden)

    Guo-Zhen Lin, Fu-Ying Zheng, Ji-Zhang Zhou, Guang-Hua Wang, Xiao-An Cao, Xiao-Wei Gong and Chang-Qing Qiu*

    2012-05-01

    Full Text Available For rapid detection of the Chlamydia psittaci abortus strain, a loop-mediated isothermal amplification (LAMP assay was developed and evaluated in this study. The primers for the LAMP assay were designed on the basis of the main outer membrane protein (MOMP gene sequence of C. psittaci. Analysis showed that the assay could detect the abortus strain of C. psittaci with adequate specificity. The sensitivity of the test was the same as that of the nested-conventional PCR and higher than that of chick embryo isolation. Testing of 153 samples indicated that the LAMP assay could detect the genome of the C. psittaci abortus strain effectively in clinical samples. This assay is a useful tool for rapid diagnosis of C. psittaci infection in sheep, swine and cattle.

  4. High Resolution Melting Analysis for Detecting p53 Gene Mutations in Patients with Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Zhihong CHEN

    2011-10-01

    Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.

  5. Comparison of in-house and commercial real time-PCR based carbapenemase gene detection methods in Enterobacteriaceae and non-fermenting gram-negative bacterial isolates.

    Science.gov (United States)

    Smiljanic, M; Kaase, M; Ahmad-Nejad, P; Ghebremedhin, B

    2017-07-10

    Carbapenemase-producing gram-negative bacteria are increasing globally and have been associated with outbreaks in hospital settings. Thus, the accurate detection of these bacteria in infections is mandatory for administering the adequate therapy and infection control measures. This study aimed to establish and evaluate a multiplex real-time PCR assay for the simultaneous detection of carbapenemase gene variants in gram-negative rods and to compare the performance with a commercial RT-PCR assay (Check-Direct CPE). 116 carbapenem-resistant Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii isolates were genotyped for carbapenemase genes by PCR and sequencing. The defined isolates were used for the validation of the in-house RT-PCR by use of designed primer pairs and probes. Among the carbapenem-resistant isolates the genes bla KPC , bla VIM , bla NDM or bla OXA were detected. Both RT-PCR assays detected all bla KPC , bla VIM and bla NDM in the isolates. The in-house RT-PCR detected 53 of 67 (79.0%) whereas the commercial assay detected only 29 (43.3%) of the OXA genes. The in-house sufficiently distinguished the most prevalent OXA types (23-like and 48-like) in the melting curve analysis and direct detection of the genes from positive blood culture vials. The Check-Direct CPE and the in-house RT-PCR assay detected the carbapenem resistance from solid culture isolates. Moreover, the in-house assay enabled the identification of carbapenemase genes directly from positive blood-culture vials. However, we observed insufficient detection of various OXA genes in both assays. Nevertheless, the in-house RT-PCR detected the majority of the OXA type genes in Enterobacteriaceae and A. baumannii.

  6. Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

    Science.gov (United States)

    Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

    2013-12-01

    The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

  7. Phylogenetic detection of horizontal gene transfer during the step-wise genesis of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Turenne Christine

    2009-08-01

    Full Text Available Abstract Background In the past decade, the availability of complete genome sequence data has greatly facilitated comparative genomic research aimed at addressing genetic variability within species. More recently, analysis across species has become feasible, especially in genera where genome sequencing projects of multiple species have been initiated. To understand the genesis of the pathogen Mycobacterium tuberculosis within a genus where the majority of species are harmless environmental organisms, we have used genome sequence data from 16 mycobacteria to look for evidence of horizontal gene transfer (HGT associated with the emergence of pathogenesis. First, using multi-locus sequence analysis (MLSA of 20 housekeeping genes across these species, we derived a phylogeny that serves as the basis for HGT assignments. Next, we performed alignment searches for the 3989 proteins of M. tuberculosis H37Rv against 15 other mycobacterial genomes, generating a matrix of 59835 comparisons, to look for genetic elements that were uniquely found in M. tuberculosis and closely-related pathogenic mycobacteria. To assign when foreign genes were likely acquired, we designed a bioinformatic program called mycoHIT (mycobacterial homologue investigation tool to analyze these data in conjunction with the MLSA-based phylogeny. Results The bioinformatic screen predicted that 137 genes had been acquired by HGT at different phylogenetic strata; these included genes coding for metabolic functions and modification of mycobacterial lipids. For the majority of these genes, corroborating evidence of HGT was obtained, such as presence of phage or plasmid, and an aberrant GC%. Conclusion M. tuberculosis emerged through vertical inheritance along with the step-wise addition of genes acquired via HGT events, a process that may more generally describe the evolution of other pathogens.

  8. Unexpected detection of porcine rotavirus C strains carrying human origin VP6 gene.

    Science.gov (United States)

    Kattoor, Jobin Jose; Saurabh, Sharad; Malik, Yashpal Singh; Sircar, Shubhankar; Dhama, Kuldeep; Ghosh, Souvik; Bányai, Krisztián; Kobayashi, Nobumichi; Singh, Raj Kumar

    2017-12-01

    Rotavirus C (RVC), a known etiological agent of diarrheal outbreaks, mainly inflicts swine population globally with sporadic incidence in human, cattle, ferret, mink and dog. To demonstrate the presence of RVC in Indian swine population and characterization of its selected structural (VP6) and non-structural (NSP4 and NSP5) genes. A total of 108 diarrheic samples from different regions of India were used. Isolated RNA was loaded onto polyacrylamide gel to screen for the presence of RVs through the identification of specific electrophoretic genomic migration pattern. To characterize the RVC strains, VP6 gene and NSP4 and NSP5 genes were amplified, sequenced and analyzed. Based on VP6 gene specific diagnostic RT-PCR, the presence of RVC was confirmed in 12.0% (13/108) piglet fecal specimens. The nucleotide sequence analysis of VP6 gene, encoding inner capsid protein, from selected porcine RVC (PoRVC) strains revealed more than 93% homologies to human RVC strains (HuRVC) of Eurasian origin. These strains were distant from hitherto reported PoRVCs and clustered with HuRVCs, owning I2 genotype. However, the two non-structural genes, i.e. NSP4 and NSP5, of these strains were found to be of swine type, signifying a re-assortment event that has occurred in the Indian swine population. The findings indicate the presence of human-like RVC in Indian pigs and division of RVC clade with I2 genotype into further sub-clades. To the best of our knowledge, this appears to be the first report of RVC in Indian swine population. Incidence of human-like RVC VP6 gene in swine supports its subsequent zoonotic prospective.

  9. [Identification and detection of trag: a new infection-related gene expressed in vivo from isolates of Streptococcus suis].

    Science.gov (United States)

    Zhu, Haodan; Gu, Hongwei; Lu, Chengping

    2008-12-01

    The trag (transfer gene G) was one of the novel infection-related factors identified by in vivo-induced antigen technology (IVIAT) from Streptococcus suis type 2 expression libraries with swine convalesecent sera in our former research. We detected the distribution of trag in different Streptococcus suis isolates and identify the differential expression of the new infection-related factor between in vivo and in vitro condition. According to the sequence of trag of North American strain 89/1591, a pair of primers were designed to detect the distribution of trag in total 43 SS isolates. Another pair of primers were designed to amplify the ORF of trag of 5 SS representive strains (ZY05719, HA9801, 98012, SH040805, SH040917). Partial gene of trag was cloned and inserted into expression vector pET28a(+), and induced by IPTG to express recombinant TRAG. The recombinant protein was probed with swine convalescent sera and immune sera respectively. The trag was detected in the most of SS2 isolates (30/32), in SS9 isolates (4/6), and 1 isolate of SS7, while it was not found in SS2 European strain ATCC43765, avirulent strain SS2 T15, 1 isolates of SS1, 1 isolates of SS1/2 and 2 isolates of group C streptococcal strains from pigs. Comparisons between the sequences of TRAG of 5 isolates with that of SS isolates, showed a high homology (>97%) with North American strain 89/1589 and China strains 98HAH33, 05ZYH33. The immunoreactivity was only presented with convalescent sera. The trag was detected from virulent SS isolates but not from avirulent strain, which suggested that this gene may be related to the pathogenicity of SS. The special reactivity was only present with convalescent sera, and it indicated that TRAG might play a role during SS2 invasive course.

  10. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    Science.gov (United States)

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  11. Molecular detection of aminoglycoside-modifying enzyme genes in Acinetobacter baumannii clinical isolates.

    Science.gov (United States)

    Heidary, Mohsen; Salimi Chirani, Alireza; Khoshnood, Saeed; Eslami, Gita; Atyabi, Seyyed Mohammad; Nazem, Habibollah; Fazilati, Mohammad; Hashemi, Ali; Soleimani, Saleh

    2017-06-01

    Acinetobacter baumannii is a major opportunistic pathogen in healthcare settings worldwide. In Iran, there are only few reports on the prevalence of aminoglycoside resistance genes among A. baumannii isolates. The aim of this study was to investigate the existence of aminoglycoside-modifying enzyme (AME) genes from A. baumannii strains collected at a university teaching hospital in Iran. One hundred A. baumannii strains were collected between 2014 and 2015 from hospitalized patients at Loghman Hakim Hospital, Tehran, Iran. Antimicrobial susceptibility was determined by disk diffusion method according to the Clinical and Laboratory Standards Institute recommendations. The DNA was extracted using a kit obtained from Bioneer Co. (Korea) and was used as a template for polymerase chain reaction. The most active antimicrobial agent against these strains was colistin. The rate of extended-spectrum cephalosporin resistance was 97%. The aadA1, aadB, aac(6')-Ib, and aac(3)-IIa genes were found in 85%, 77%, 72%, and 68% of A. baumannii isolates, respectively. This study showed a high prevalence rate of AME genes in A. baumannii. This prevalence rate has explained that further aminoglycoside resistance genes may have role in the resistance of clinical isolates of A. baumannii. Therefore, control and treatment of serious infections caused by this opportunistic pathogen should be given more consideration.

  12. A random variance model for detection of differential gene expression in small microarray experiments.

    Science.gov (United States)

    Wright, George W; Simon, Richard M

    2003-12-12

    Microarray techniques provide a valuable way of characterizing the molecular nature of disease. Unfortunately expense and limited specimen availability often lead to studies with small sample sizes. This makes accurate estimation of variability difficult, since variance estimates made on a gene by gene basis will have few degrees of freedom, and the assumption that all genes share equal variance is unlikely to be true. We propose a model by which the within gene variances are drawn from an inverse gamma distribution, whose parameters are estimated across all genes. This results in a test statistic that is a minor variation of those used in standard linear models. We demonstrate that the model assumptions are valid on experimental data, and that the model has more power than standard tests to pick up large changes in expression, while not increasing the rate of false positives. This method is incorporated into BRB-ArrayTools version 3.0 (http://linus.nci.nih.gov/BRB-ArrayTools.html). ftp://linus.nci.nih.gov/pub/techreport/RVM_supplement.pdf

  13. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

    Science.gov (United States)

    Rowe, Will; Baker, Kate S; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J; Maskell, Duncan; Pearce, Gareth

    2015-01-01

    Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we show that SEAR

  14. Multiplex PCR assay for detection of recombinant genes encoding fatty acid desaturases fused with lichenase reporter protein in GM plants.

    Science.gov (United States)

    Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V

    2010-07-01

    Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.

  15. Detection of cell surface hydrophobicity, biofilm and fimbirae genes in salmonella isolated from tunisian clinical and poultry meat.

    Science.gov (United States)

    Ben Abdallah, Fethi; Lagha, Rihab; Said, Khaled; Kallel, Héla; Gharbi, Jawhar

    2014-04-01

    The aim of this study was to evaluate the ability of 15 serotypes of Salmonella to form biofilm on polystyrene, polyvinyl chloride (PVC) and glass surfaces. . Initially slime production was assessed on CRA agar and hydrophobicity of 20 Salmonella strains isolated from poultry and human and two Salmonella enterica serovar Typhimurium references strains was achieved by microbial adhesion to n-hexadecane. In addition, biofilm formation on polystyrene, PVC and glass surfaces was also investigated by using MTT and XTT colorimetric assay. Further, distribution of Salmonella enterotoxin (stn), Salmonella Enteritidis fimbrial (sef) and plasmid encoded fimbrial (pef) genes among tested strains was achieved by PCR. Salmonella strains developed red and white colonies on CRA and they are considered as hydrophilic with affinity values to n-hexadecane ranged between 0.29% and 29.55%. Quantitative biofilm assays showed that bacteria are able to form biofilm on polystyrene with different degrees and 54.54% of strains produce a strong biofilm on glass. In addition, all the strains form only a moderate (54.54%) and weak (40.91%) biofilm on PVC. PCR detection showed that only S. Enteritidis harbour Sef gene, whereas Pef and stn genes were detected in S. Kentucky, S. Amsterdam, S. Hadar, S. Enteritidis and S. Typhimurium. Salmonella serotypes are able to form biofilm on hydrophobic and hydrophilic industrial surfaces. Biofilm formation of Salmonella on these surfaces has an increased potential to compromise food safety and potentiate public health risk.

  16. Extending the scope of diagnostic chromosome analysis: detection of single gene defects using high-resolution SNP microarrays.

    Science.gov (United States)

    Bruno, Damien L; Stark, Zornitza; Amor, David J; Burgess, Trent; Butler, Kathy; Corrie, Sylvea; Francis, David; Ganesamoorthy, Devika; Hills, Louise; James, Paul A; O'Rielly, Darren; Oertel, Ralph; Savarirayan, Ravi; Prabhakara, Krishnamurthy; Salce, Nicholas; Slater, Howard R

    2011-12-01

    Microarray analysis has provided significant advances in the diagnosis of conditions resulting from submicroscopic chromosome abnormalities. It has been recommended that array testing should be a "first tier" test in the evaluation of individuals with intellectual disability, developmental delay, congenital anomalies, and autism. The availability of arrays with increasingly high probe coverage and resolution has increased the detection of decreasingly small copy number changes (CNCs) down to the intragenic or even exon level. Importantly, arrays that genotype SNPs also detect extended regions of homozygosity. We describe 14 examples of single gene disorders caused by intragenic changes from a consecutive set of 6,500 tests using high-resolution SNP microarrays. These cases illustrate the increased scope of cytogenetic testing beyond dominant chromosome rearrangements that typically contain many genes. Nine of the cases confirmed the clinical diagnosis, that is, followed a "phenotype to genotype" approach. Five were diagnosed by the laboratory analysis in the absence of a specific clinical diagnosis, that is, followed a "genotype to phenotype" approach. Two were clinically significant, incidental findings. The importance of astute clinical assessment and laboratory-clinician consultation is emphasized to optimize the value of microarrays in the diagnosis of disorders caused by single gene copy number and sequence mutations. © 2011 Wiley-Liss, Inc.

  17. NF2 tumor suppressor gene: a comprehensive and efficient detection of somatic mutations by denaturing HPLC and microarray-CGH.

    Science.gov (United States)

    Szijan, Irene; Rochefort, Daniel; Bruder, Carl; Surace, Ezequiel; Machiavelli, Gloria; Dalamon, Viviana; Cotignola, Javier; Ferreiro, Veronica; Campero, Alvaro; Basso, Armando; Dumanski, Jan P; Rouleau, Guy A

    2003-01-01

    The NF2 tumor suppressor gene, located in chromosome 22q12, is involved in the development of multiple tumors of the nervous system, either associated with neurofibromatosis 2 or sporadic ones, mainly schwannomas and meningiomas. In order to evaluate the role of the NF2 gene in sporadic central nervous system (CNS) tumors, we analyzed NF2 mutations in 26 specimens: 14 meningiomas, 4 schwannomas, 4 metastases, and 4 other histopathological types of neoplasms. Denaturing high performance liquid chromatography (denaturing HPLC) and comparative genomic hybridization on a DNA microarray (microarray- CGH) were used as scanning methods for small mutations and gross rearrangements respectively. Small mutations were identified in six out of seventeen meningiomas and schwannomas, one mutation was novel. Large deletions were detected in six meningiomas. All mutations were predicted to result in truncated protein or in the absence of a large protein domain. No NF2 mutations were found in other histopathological types of CNS tumors. These results provide additional evidence that mutations in the NF2 gene play an important role in the development of sporadic meningiomas and schwannomas. Denaturing HPLC analysis of small mutations and microarray-CGH of large deletions are complementary, fast, and efficient methods for the detection of mutations in tumor tissues.

  18. Evaluation of an expanded microarray for detecting antibiotic resistance genes in a broad range of gram-negative bacterial pathogens.

    Science.gov (United States)

    Card, Roderick; Zhang, Jiancheng; Das, Priya; Cook, Charlotte; Woodford, Neil; Anjum, Muna F

    2013-01-01

    A microarray capable of detecting genes for resistance to 75 clinically relevant antibiotics encompassing 19 different antimicrobial classes was tested on 132 Gram-negative bacteria. Microarray-positive results correlated >91% with antimicrobial resistance phenotypes, assessed using British Society for Antimicrobial Chemotherapy clinical breakpoints; the overall test specificity was >83%. Microarray-positive results without a corresponding resistance phenotype matched 94% with PCR results, indicating accurate detection of genes present in the respective bacteria by microarray when expression was low or absent and, hence, undetectable by susceptibility testing. The low sensitivity and negative predictive values of the microarray results for identifying resistance to some antimicrobial resistance classes are likely due to the limited number of resistance genes present on the current microarray for those antimicrobial agents or to mutation-based resistance mechanisms. With regular updates, this microarray can be used for clinical diagnostics to help accurate therapeutic options to be taken following infection with multiple-antibiotic-resistant Gram-negative bacteria and prevent treatment failure.

  19. The complete chloroplast genome sequence of an endemic monotypic genus Hagenia (Rosaceae: structural comparative analysis, gene content and microsatellite detection

    Directory of Open Access Journals (Sweden)

    Andrew W. Gichira

    2017-01-01

    Full Text Available Hagenia is an endangered monotypic genus endemic to the topical mountains of Africa. The only species, Hagenia abyssinica (Bruce J.F. Gmel, is an important medicinal plant producing bioactive compounds that have been traditionally used by African communities as a remedy for gastrointestinal ailments in both humans and animals. Complete chloroplast genomes have been applied in resolving phylogenetic relationships within plant families. We employed high-throughput sequencing technologies to determine the complete chloroplast genome sequence of H. abyssinica. The genome is a circular molecule of 154,961 base pairs (bp, with a pair of Inverted Repeats (IR 25,971 bp each, separated by two single copies; a large (LSC, 84,320 bp and a small single copy (SSC, 18,696. H. abyssinica’s chloroplast genome has a 37.1% GC content and encodes 112 unique genes, 78 of which code for proteins, 30 are tRNA genes and four are rRNA genes. A comparative analysis with twenty other species, sequenced to-date from the family Rosaceae, revealed similarities in structural organization, gene content and arrangement. The observed size differences are attributed to the contraction/expansion of the inverted repeats. The translational initiation factor gene (infA which had been previously reported in other chloroplast genomes was conspicuously missing in H. abyssinica. A total of 172 microsatellites and 49 large repeat sequences were detected in the chloroplast genome. A Maximum Likelihood analyses of 71 protein-coding genes placed Hagenia in Rosoideae. The availability of a complete chloroplast genome, the first in the Sanguisorbeae tribe, is beneficial for further molecular studies on taxonomic and phylogenomic resolution within the Rosaceae family.

  20. The complete chloroplast genome sequence of an endemic monotypic genus Hagenia (Rosaceae): structural comparative analysis, gene content and microsatellite detection.

    Science.gov (United States)

    Gichira, Andrew W; Li, Zhizhong; Saina, Josphat K; Long, Zhicheng; Hu, Guangwan; Gituru, Robert W; Wang, Qingfeng; Chen, Jinming

    2017-01-01

    Hagenia is an endangered monotypic genus endemic to the topical mountains of Africa. The only species, Hagenia abyssinica (Bruce) J.F. Gmel, is an important medicinal plant producing bioactive compounds that have been traditionally used by African communities as a remedy for gastrointestinal ailments in both humans and animals. Complete chloroplast genomes have been applied in resolving phylogenetic relationships within plant families. We employed high-throughput sequencing technologies to determine the complete chloroplast genome sequence of H. abyssinica. The genome is a circular molecule of 154,961 base pairs (bp), with a pair of Inverted Repeats (IR) 25,971 bp each, separated by two single copies; a large (LSC, 84,320 bp) and a small single copy (SSC, 18,696). H. abyssinica 's chloroplast genome has a 37.1% GC content and encodes 112 unique genes, 78 of which code for proteins, 30 are tRNA genes and four are rRNA genes. A comparative analysis with twenty other species, sequenced to-date from the family Rosaceae, revealed similarities in structural organization, gene content and arrangement. The observed size differences are attributed to the contraction/expansion of the inverted repeats. The translational initiation factor gene ( infA ) which had been previously reported in other chloroplast genomes was conspicuously missing in H. abyssinica . A total of 172 microsatellites and 49 large repeat sequences were detected in the chloroplast genome. A Maximum Likelihood analyses of 71 protein-coding genes placed Hagenia in Rosoideae. The availability of a complete chloroplast genome, the first in the Sanguisorbeae tribe, is beneficial for further molecular studies on taxonomic and phylogenomic resolution within the Rosaceae family.

  1. Diversity of 16S rRNA and dioxygenase genes detected in coal-tar-contaminated site undergoing active bioremediation

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, M; Khanna, S [NIIT Univ, Neemrana (India). Dept. of Biotechnology & Bioinformation

    2010-04-15

    In order to develop effective bioremediation strategies for polyaromatic hydrocarbons (PAHs) degradation, the composition and metabolic potential of microbial communities need to be better understood, especially in highly PAH contaminated sites in which little information on the cultivation-independent communities is available. Coal-tar-contaminated soil was collected, which consisted of 122-122.5 mg g{sup -1} total extractable PAH compounds. Biodegradation studies with this soil indicated the presence of microbial community that is capable of degrading the model PAH compounds viz naphthalene, phenanthrene and pyrene at 50 ppm each. PCR clone libraries were established from the DNA of the coal-tar-contaminated soil, targeting the 16S rRNA to characterize (I) the microbial communities, (ii) partial gene fragment encoding the Rieske iron sulfur center {alpha}-subunit) common to all PAH dioxygenase enzymes and (iii) {beta}-subunit of dioxygenase. Phylotypes related to Proteobacteria ({Alpha}-, {Epsilon}- and Gammaproteobacteria), Acidobacteria, Actinobacteria, Firmicutes, Gemmatimonadetes and Deinococci were detected in 16S rRNA derived clone libraries. Many of the gene fragment sequences of alpha-subunit and beta-subunit of dioxygenase obtained from the respective clone libraries fell into clades that are distinct from the reference dioxygenase gene sequences. Presence of consensus sequence of the Rieske type (2Fe2S) cluster binding site suggested that these gene fragments encode for {alpha}-subunit of dioxygenase gene. Sequencing of the cloned libraries representing {alpha}-subunit gene fragments (Rf1) and beta-subunit of dioxygenase showed the presence of hitherto unidentified dioxygenase in coal-tar-contaminated soil.

  2. Constitutional von Hippel-Lindau (VHL) gene deletions detected in VHL families by fluorescence in situ hybridization.

    Science.gov (United States)

    Pack, S D; Zbar, B; Pak, E; Ault, D O; Humphrey, J S; Pham, T; Hurley, K; Weil, R J; Park, W S; Kuzmin, I; Stolle, C; Glenn, G; Liotta, L A; Lerman, M I; Klausner, R D; Linehan, W M; Zhuang, Z

    1999-11-01

    von Hippel-Lindau (VHL) disease is an autosomal dominantly inherited cancer syndrome predisposing to a variety of tumor types that include retinal hemangioblastomas, hemangioblastomas of the central nervous system, renal cell carcinomas, pancreatic cysts and tumors, pheochromocytomas, endolymphatic sac tumors, and epididymal cystadenomas [W. M. Linehan et al., J. Am. Med. Assoc., 273: 564-570, 1995; E. A. Maher and W. G. Kaelin, Jr., Medicine (Baltimore), 76: 381-391, 1997; W. M. Linehan and R. D. Klausner, In: B. Vogelstein and K. Kinzler (eds.), The Genetic Basis of Human Cancer, pp. 455-473, McGraw-Hill, 1998]. The VHL gene was localized to chromosome 3p25-26 and cloned [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. Germline mutations in the VHL gene have been detected in the majority of VHL kindreds. The reported frequency of detection of VHL germline mutations has varied from 39 to 80% (J. M. Whaley et al., Am. J. Hum. Genet., 55: 1092-1102, 1994; Clinical Research Group for Japan, Hum. Mol. Genet., 4: 2233-2237, 1995; F. Chen et al., Hum. Mutat., 5: 66-75, 1995; E. R. Maher et al., J. Med. Genet., 33: 328-332, 1996; B. Zbar, Cancer Surv., 25: 219-232, 1995). Recently a quantitative Southern blotting procedure was found to improve this frequency (C. Stolle et al., Hum. Mutat., 12: 417-423, 1998). In the present study, we report the use of fluorescence in situ hybridization (FISH) as a method to detect and characterize VHL germline deletions. We reexamined a group of VHL patients shown previously by single-strand conformation and sequencing analysis not to harbor point mutations in the VHL locus. We found constitutional deletions in 29 of 30 VHL patients in this group using cosmid and P1 probes that cover the VHL locus. We then tested six phenotypically normal offspring from four of these VHL families: two were found to carry the deletion and the other four were deletion-free. In addition, germline mosaicism of the VHL gene was identified in

  3. A Fast Multiple-Kernel Method With Applications to Detect Gene-Environment Interaction.

    Science.gov (United States)

    Marceau, Rachel; Lu, Wenbin; Holloway, Shannon; Sale, Michèle M; Worrall, Bradford B; Williams, Stephen R; Hsu, Fang-Chi; Tzeng, Jung-Ying

    2015-09-01

    Kernel machine (KM) models are a powerful tool for exploring associations between sets of genetic variants and complex traits. Although most KM methods use a single kernel function to assess the marginal effect of a variable set, KM analyses involving multiple kernels have become increasingly popular. Multikernel analysis allows researchers to study more complex problems, such as assessing gene-gene or gene-environment interactions, incorporating variance-component based methods for population substructure into rare-variant association testing, and assessing the conditional effects of a variable set adjusting for other variable sets. The KM framework is robust, powerful, and provides efficient dimension reduction for multifactor analyses, but requires the estimation of high dimensional nuisance parameters. Traditional estimation techniques, including regularization and the "expectation-maximization (EM)" algorithm, have a large computational cost and are not scalable to large sample sizes needed for rare variant analysis. Therefore, under the context of gene-environment interaction, we propose a computationally efficient and statistically rigorous "fastKM" algorithm for multikernel analysis that is based on a low-rank approximation to the nuisance effect kernel matrices. Our algorithm is applicable to various trait types (e.g., continuous, binary, and survival traits) and can be implemented using any existing single-kernel analysis software. Through extensive simulation studies, we show that our algorithm has similar performance to an EM-based KM approach for quantitative traits while running much faster. We also apply our method to the Vitamin Intervention for Stroke Prevention (VISP) clinical trial, examining gene-by-vitamin effects on recurrent stroke risk and gene-by-age effects on change in homocysteine level. © 2015 WILEY PERIODICALS, INC.

  4. In situ PCR detection and significance of IL-3 gene expression in irradiated hematopoietic cells of mouse bone marrow

    International Nuclear Information System (INIS)

    Peng Ruiyun; Wang Dewen; Xiong Chengqi; Gao Yabing; Li Yanping; Yang Hong; Cui Yufang

    2000-01-01

    Objective: To study the significance of endogenous interleukin 3(IL-3) gene expression in repair of irradiated mouse bone marrow. Methods: Seventy-eight LACA mice were subjected to total body irradiation with 60 Co γ-rays and were sacrificed within 4 weeks after irradiation. The bone marrow histopathological sections were stained with HE, and the expression of endogenous IL-3 gene was detected by means of immunocytochemistry,in situ hybridization(ISH) and in situ reverse transcription PCR(IS RT-PCR). Results: Obvious injury of bone marrow occurred after irradiation and then recovered within 4 weeks. IL-3 protein was obviously increased in the cytoplasm of recovering hematopoietic cells(HCs), especially on day 21 after irradiation, while its mRNA was poorly positive by ISH on days 10-21, especially day 15.IS RT-PCR showed that IL-3 mRNA was strongly positive in recovering HCs cytoplasm, especially on days 10 to 15. Conclusion: In situ RT-PCR can objectively reflect the regulation of IL-3 gene expression in bone marrow after irradiation, and the expression of endogenous IL-3 gene may play an important role in hematopoietic reconstruction of irradiated bone marrow

  5. Detection of clonal immunoglobulin heavy chain gene rearrangements by the polymerase chain reaction and capillary gel electrophoresis.

    Science.gov (United States)

    Fan, Hongxin; Robetorye, Ryan S

    2013-01-01

    Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.

  6. Using Next-Generation Sequencing to Detect Differential Expression Genes in Bradysia odoriphaga after Exposure to Insecticides

    Directory of Open Access Journals (Sweden)

    Haoliang Chen

    2017-11-01

    Full Text Available Bradysia odoriphaga (Diptera: Sciaridae is the most important pest of Chinese chive. Insecticides are used widely and frequently to control B. odoriphaga in China. However, the performance of the insecticides chlorpyrifos and clothianidin in controlling the Chinese chive maggot is quite different. Using next generation sequencing technology, different expression unigenes (DEUs in B. odoriphaga were detected after treatment with chlorpyrifos and clothianidin for 6 and 48 h in comparison with control. The number of DEUs ranged between 703 and 1161 after insecticide treatment. In these DEUs, 370–863 unigenes can be classified into 41–46 categories of gene ontology (GO, and 354–658 DEUs can be mapped into 987–1623 Kyoto Encyclopedia of Genes and Genomes (KEGG pathways. The expressions of DEUs related to insecticide-metabolism-related genes were analyzed. The cytochrome P450-like unigene group was the largest group in DEUs. Most glutathione S-transferase-like unigenes were down-regulated and most sodium channel-like unigenes were up-regulated after insecticide treatment. Finally, 14 insecticide-metabolism-related unigenes were chosen to confirm the relative expression in each treatment by quantitative Real Time Polymerase Chain Reaction (qRT-PCR. The results of qRT-PCR and RNA Sequencing (RNA-Seq are fairly well-established. Our results demonstrate that a next-generation sequencing tool facilitates the identification of insecticide-metabolism-related genes and the illustration of the insecticide mechanisms of chlorpyrifos and clothianidin.

  7. Positive relationship detected between soil bioaccessible organic pollutants and antibiotic resistance genes at dairy farms in Nanjing, Eastern China

    International Nuclear Information System (INIS)

    Sun, Mingming; Ye, Mao; Wu, Jun; Feng, Yanfang; Wan, Jinzhong; Tian, Da; Shen, Fangyuan; Liu, Kuan; Hu, Feng; Li, Huixin; Jiang, Xin; Yang, Linzhang; Kengara, Fredrick Orori

    2015-01-01

    Co-contaminated soils by organic pollutants (OPs), antibiotics and antibiotic resistance genes (ARGs) have been becoming an emerging problem. However, it is unclear if an interaction exists between mixed pollutants and ARG abundance. Therefore, the potential relationship between OP contents and ARG and class 1 integron-integrase gene (intI1) abundance was investigated from seven dairy farms in Nanjing, Eastern China. Phenanthrene, pentachlorophenol, sulfadiazine, roxithromycin, associated ARG genes, and intI1 had the highest detection frequencies. Correlation analysis suggested a stronger positive relationship between the ARG abundance and the bioaccessible OP content than the total OP content. Additionally, the significant correlation between the bioaccessible mixed pollutant contents and ARG/intI1 abundance suggested a direct/indirect impact of the bioaccessible mixed pollutants on soil ARG dissemination. This study provided a preliminary understanding of the interaction between mixed pollutants and ARGs in co-contaminated soils. - Highlights: • Coexistence of OPs, antibiotics, and ARGs in dairy farm soils was ubiquitous. • Bioaccessible pollutants exhibited positive correlation with ARG abundance. • ARGs significantly correlated with intI1. • Bioaccessible pollutants demonstrated strong correlation with intI1. • The intI1 gene might serve as a potential proxy for mixed pollution. - Coexistence of mixed OPs and ARGs in dairy farm soils was ubiquitous; a positive correlation can be found between the bioaccessible OP fractions and ARG/intI1 abundance.

  8. Nasal PCR assay for the detection of Mycobacterium leprae pra gene to study subclinical infection in a community.

    Science.gov (United States)

    Arunagiri, Kamalanathan; Sangeetha, Gopalakrishnan; Sugashini, Padmavathy Krishnan; Balaraman, Sekar; Showkath Ali, M K

    2017-03-01

    Leprosy is a chronic infectious disease caused by Mycobacterium leprae. Identification of Mycobacterium leprae is difficult in part due to the inability of the leprosy bacillus to grow in vitro. A number of diagnostic methods for leprosy diagnosis have been proposed. Both serological tests and molecular probes have shown certain potential for detection and identification of Mycobacterium leprae in patients. In this study, we have investigated whether Mycobacterium leprae DNA from the nasal secretion of healthy household contacts and the non contacts could be detected through PCR amplification as a method to study the sub clinical infection in a community. A total of 200 samples, 100 each from contacts and non contacts representing all age groups and sex were included in this study. The M. leprae specific primer (proline-rich region) of pra gene was selected and PCR was performed using extracted DNA from the sample. A total of 13 samples were found to be positive for nasal PCR for pra gene among the male and female contacts out of which 7% were males and 6% were females. Even though several diagnostic tools are available to detect the cases of leprosy, they lack the specificity and sensitivity. PCR technology has demonstrated the improved diagnostic accuracy for epidemiological studies and requires minimal time. Although nasal PCR studies have been reported from many countries it is not usually recommended due to the high percentage of negative results in the contact. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    Directory of Open Access Journals (Sweden)

    Marcos Lázaro Moreli

    2004-10-01

    Full Text Available We report a nested reverse transcription-polymerase chain reaction (RT-PCR assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity and in all 9 blood samples (100% positivity by nested-PCR. The eight amplicons obtained by RT-PCR (P1, P3-P9, including one obtained by nested-PCR (P-2 and not obtained by RT-PCR, were sequenced and showed high homology (94.8% to 99.1% with the N gene of Araraquara hantavirus. Although the serologic method ELISA is the most appropriate test for HCPS diagnosis, the use of nested RT-PCR for hantavirus in Brazil would contribute to the diagnosis of acute hantavirus disease detecting viral genomes in patient specimens as well as initial genomic characterization of circulating hantaviruses.

  10. Survey and visual detection of Zaire ebolavirus in clinical samples targeting the nucleoprotein gene in Sierra Leone

    Directory of Open Access Journals (Sweden)

    Jing Yuan

    2015-12-01

    Full Text Available Ebola virus (EBOV can lead to severe hemorrhagic fever with a high risk of death in humans and other primates. To guide treatment and prevent spread of the viral infection, a rapid and sensitive detection method is required for clinical samples. Here, we described and evaluated a reverse transcription loop-mediated isothermal amplification (RT-LAMP method to detect Zaire ebolavirus using the nucleoprotein gene (NP as a target sequence. Two different techniques were used, a calcein/Mn2+ complex chromogenic method and real-time turbidity monitoring. The RT-LAMP assay detected the NP target sequence with a limit of 4.56 copies/μL within 45 min under 61°C, a similar even or increase in sensitivity than that of real-time reverse transcription-polymerase chain reaction (RT-PCR. Additionally, all pseudoviral particles or non- Zaire EBOV genomes were negative for LAMP detection, indicating that the assay was highly specific for EBOV. To appraise the availability of the RT-LAMP method for use in clinical diagnosis of EBOV, of 417 blood or swab samples collected from patients with clinically suspected infections in Sierra Leone, 307 were identified for RT-LAMP-based surveillance of EBOV. Therefore, the highly specific and sensitive RT-LAMP method allows the rapid detection of EBOV, and is a suitable tool for clinical screening, diagnosis, and primary quarantine purposes.

  11. Novel real-time polymerase chain reaction assay for simultaneous detection of recurrent fusion genes in acute myeloid leukemia.

    Science.gov (United States)

    Dolz, Sandra; Barragán, Eva; Fuster, Óscar; Llop, Marta; Cervera, José; Such, Esperanza; De Juan, Inmaculada; Palanca, Sarai; Murria, Rosa; Bolufer, Pascual; Luna, Irene; Gómez, Inés; López, María; Ibáñez, Mariam; Sanz, Miguel A

    2013-09-01

    The recent World Health Organization classification recognizes different subtypes of acute myeloid leukemia (AML) according to the presence of several recurrent genetic abnormalities. Detection of these abnormalities and other molecular changes is of increasing interest because it contributes to a refined diagnosis and prognostic assessment in AML and enables monitoring of minimal residual disease. These genetic abnormalities can be detected using single RT-PCR, although the screening is still labor intensive and costly. We have developed a novel real-time RT-PCR assay to simultaneously detect 15 AML-associated rearrangements that is a simple and easily applicable method for use in clinical diagnostic laboratories. This method showed 100% specificity and sensitivity (95% confidence interval, 91% to 100% and 92% to 100%, respectively). The procedure was validated in a series of 105 patients with AML. The method confirmed all translocations detected using standard cytogenetics and fluorescence in situ hybridization and some additional undetected rearrangements. Two patients demonstrated two molecular rearrangements simultaneously, with BCR-ABL1 implicated in both, in addition to RUNX1-MECOM in one patient and PML-RARA in another. In conclusion, this novel real-time RT-PCR assay for simultaneous detection of multiple AML-associated fusion genes is a versatile and sensitive method for reliable screening of recurrent rearrangements in AML. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  12. Detection of estrogenic activity in sediment-associated compounds using in vitro reporter gene assays

    NARCIS (Netherlands)

    Legler, J.; Dennekamp, M.; Vethaak, A.D.; Brouwer, A.; Koeman, J.H.; Burg, van der B.; Murk, A.J.

    2002-01-01

    Sediments may be the ultimate sink for persistent (xeno-) estrogenic compounds released into the aquatic environment. Sediment-associated estrogenic potency was measured with an estrogen receptor-mediated luciferase reporter gene (ER-CALUX) assay and compared with a recombinant yeast screen. The

  13. Genetic diversity detection of the domestic horse (Equus caballus by genes associated with coat color

    Directory of Open Access Journals (Sweden)

    Luz Correa A

    2015-09-01

    Full Text Available Objective. To assess the population structure and genetic diversity in populations of domestic horse (Equus caballus in the municipality Cienaga de Oro-Córdoba (Colombia. Materials and methods. Random sampling were conducted between August and October 2013, in adult animals on farms seven districts, which was carried out phenotypic characterization of each animal, based on autosomal markers encoding morphological Extension (E , Agouti (A, Cream (C, White (W, Gray (G, Tobiano (TO, Overo (O and Roan (RN. Population genetic parameters: allele frequency, genetic diversity, gene flow, Hardy-Weinberg equilibrium and genetic distance were calculated through the program POPGENE 1.31; the genetic structure was assessed using the program FSTAT v. 2.9.3.2. Results. 341 individuals were analyzed in the seven populations studied, where the Extension gene Was the MOST faq frequently as the Overo and Tobiano genes showed the lowest values. Insignificant values of genetic variability and population recorded a global level, likewise, low genetic differentiation among populations, accompanied by a high gene flow was obtained; an excess of heterozygotes at population and global level was observed; to this is added the presence of Hardy-Weinberg equilibrium in all populations relative to the markers studied and low genetic distance values were reported. Conclusions. The populations are highly genetically related, a situation that may result from the existing geographical proximity between them, favoring genetic exchange and the establishment of a metapopulation.

  14. Chromosomal alterations detected by comparative genomic hybridization in subgroups of gene expression-defined Burkitt's lymphoma

    NARCIS (Netherlands)

    Salaverria, Itziar; Zettl, Andreas; Bea, Silvia; Hartmann, Elena M.; Dave, Sandeep S.; Wright, George W.; Boerma, Evert-Jan; Kluin, Philip M.; Ott, German; Chan, Wing C.; Weisenburger, Dennis D.; Lopez-Guillermo, Armando; Gascoyne, Randy D.; Delabie, Jan; Rimsza, Lisa M.; Braziel, Rita M.; Jaffe, Elaine S.; Staudt, Louis M.; Mueller-Hermelink, Hans Konrad; Campo, Elias; Rosenwald, Andreas

    Background Burkitt's lymphoma is an aggressive B-cell lymphoma characterized by typical morph 0 logical, immunophenotypic and molecular features. Gene expression profiling provided a molecular signature of Burkitt's lymphoma, but also demonstrated that a subset of aggressive B-cell lymphomas not

  15. Detection of Legionella pneumophila by real-time PCR for the mip gene.

    Science.gov (United States)

    Wilson, Deborah A; Yen-Lieberman, Belinda; Reischl, Udo; Gordon, Steve M; Procop, Gary W

    2003-07-01

    A real-time PCR assay for the mip gene of Legionella pneumophila was tested with 27 isolates of L. pneumophila, 20 isolates of 14 other Legionella species, and 103 non-Legionella bacteria. Eight culture-positive and 40 culture-negative clinical specimens were tested. This assay was 100% sensitive and 100% specific for L. pneumophila.

  16. Detection of genes regulated by Lmx1b during limb dorsalization.

    Science.gov (United States)

    Feenstra, Jennifer M; Kanaya, Kohei; Pira, Charmaine U; Hoffman, Sarah E; Eppey, Richard J; Oberg, Kerby C

    2012-05-01

    Lmx1b is a homeodomain transcription factor that regulates dorsal identity during limb development. Lmx1b knockout (KO) mice develop distal ventral-ventral limbs. Although induction of Lmx1b is linked to Wnt7a expression in the dorsal limb ectoderm, the downstream targets of Lmx1b that accomplish limb dorsalization are unknown. To identify genes targeted by Lmx1b, we compared gene arrays from Lmx1b KO and wild type mouse limbs during limb dorsalization, i.e., 11.5, 12.5, and 13.5 days post coitum. We identified 54 target genes that were differentially expressed in all three stages. Several skeletal targets, including Emx2, Matrilin1 and Matrilin4, demonstrated a loss of scapular expression in the Lmx1b KO mice, supporting a role for Lmx1b in scapula development. Furthermore, the relative abundance of extracellular matrix-related soft tissue targets regulated by Lmx1b, such as collagens and proteoglycans, suggests a mechanism that includes changes in the extracellular matrix composition to accomplish limb dorsalization. Our study provides the most comprehensive characterization of genes regulated by Lmx1b during limb development to-date and provides targets for further investigation. © 2012 The Authors. Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

  17. Gene probes to detect cross-culture contamination in hormone producing cell lines

    DEFF Research Database (Denmark)

    Matsuba, I; Lernmark, A; Madsen, Ole Dragsbæk

    1988-01-01

    hamster insulin gene. Karyotyping confirmed the absence of human chromosomes in the Clone-16 cells while sizes, centromere indices, and banding patterns were identical to Syrian hamster fibroblasts. We conclude that the insulin-producing Clone-16 cells are of Syrian hamster origin and demonstrate...

  18. Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.

    Science.gov (United States)

    Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C

    2018-06-27

    Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.

  19. Detection of Intracellular Adhesion (ica and Biofilm Formation Genes in Staphylococcus aureus Isolates from Clinical Samples

    Directory of Open Access Journals (Sweden)

    Khadije Rezaie Keikhaie

    2017-02-01

    Full Text Available Introduction: Nosocomial infections that result in the formation of biofilms on the surfaces of biomedical implants are a leading cause of sepsis and are often associated with colonization of the implants by Staphylococcus epidermidis. Biofilm formation is thought to require two sequential steps: adhesion of cells to a solid substrate followed by cell-cell adhesion, creating multiple layers of cells. Intercellular adhesion requires the polysaccharide intercellular adhesion (PIA, which is composed of linear β-1, 6-linked glucosaminylglycans and can be synthesized in vitro from UDP-N-acetylglucosamine by products of the intercellular adhesion (ica locus. We have investigated a variety of Staphylococcus aureus strains and find that all strains tested contain the ica locus and that several can form biofilms in vitro. Material and Method: A total of 31 clinical S. aureus isolates were collected from Zabol, Iran. In vitro biofilm formation ability was determined by microliter tissue culture plates. All clinical isolates were examined for determination the ica locus by using PCR method. Result: The results of this study showed that 40 strains of Staphylococcus aureus, 12 strains carrying the gene Cocos icaA (30% and 8 strains carrying the gene icaD (20% and the number of five strains (12.5% containing both genes ica A and has been ica D. Conclusions:  S. aureus clinical isolates have different ability to form biofilm. This may be caused by the differences in the expression of biofilm related genes, genetic make-up and physiological conditions.

  20. Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2015-01-07

    Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

  1. Identification of the genes involved in odorant reception and detection in the palm weevil Rhynchophorus ferrugineus, an important quarantine pest, by antennal transcriptome analysis

    KAUST Repository

    Antony, Binu; Soffan, Alan; Jakše, Jernej; Abdelazim, Mahmoud M.; Aldosari, Saleh A.; Aldawood, Abdulrahman S.; Pain, Arnab

    2016-01-01

    Our study presents the first comprehensive catalogue of olfactory gene families involved in pheromone and general odorant detection in R. ferrugineus, which are potential novel targets for pest control strategies.

  2. Rapid detection of most frequent Slovenian germ-line mutations in BRCA1 gene using real-time PCR and melting curve analysis

    International Nuclear Information System (INIS)

    Novakovic, S.; Stegel, V.

    2005-01-01

    Background. Detection of inherited mutations in cancer susceptibility genes is of great importance in some types of cancers including the colorectal cancer (mutations of APC gene in familial adenomatous polyposis - FAP, mutations in mismatch repair genes in hereditary nonpolyposis colorectal cancer - HNPCC), malignant melanoma (mutations in CDKN2A and CDK4 genes) and breast cancer (mutations in BRCA1 and BRCA2 genes). Methods. This article presents the technical data for the detection of five mutations in BRCA1 gene in breast cancer patients and their relatives. The mutations - 1806C>T, 300T>G, 300T>A, 310G>A, 5382insC - were determined by the real-time PCR and the melting curve analysis. Results and conclusion. In comparison to direct sequencing, this method proved to be sensitive and rapid enough for the routine daily determination of mutations in DNA isolated from the peripheral blood. (author)

  3. MLPA based detection of mutations in the dystrophin gene of 180 Polish families with Duchenne/Becker muscular dystrophy.

    Science.gov (United States)

    Zimowski, Janusz G; Massalska, Diana; Holding, Mariola; Jadczak, Sylwia; Fidziańska, Elżbieta; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Kamińska, Anna; Zaremba, Jacek

    2014-01-01

    Duchenne/Becker muscular dystrophy (DMD/BMD) is a recessive, X-linked disorder caused by a mutation in the dystrophin gene. Deletions account for approximately 60-65% of mutations, duplications for 5-10%. The remaining cases are mainly point mutations. According to Monaco theory clinical form of the disease depends on maintaining or disrupting the reading frame. The purpose of the study was to determine frequency and location of deletions and duplications in the dystrophin gene, to determine the compliance between maintaining/disrupting the reading frame and clinical form of the disease and to check the effectiveness of MLPA (multiplex ligation-dependent probe amplification) in the detection of these mutations in hemizygous patients and heterozygous female carriers. The material is composed of combined results of molecular diagnosis carried out in years 2009-2012 in 180 unrelated patients referred with the diagnosis of DMD/BMD tested by use of MLPA. We identified 110 deletions, 22 duplication (in one patient two different duplications were detected) and 2 point mutations. Deletions involved mainly exons 45-54 and 3-21, whereas most duplications involved exons 3-18. The compliance with Monaco theory was 95% for deletions and 76% for duplications. Most of mutations in the dystrophin gene were localized in the hot spots - different for deletions and duplications. MLPA enabled their quick identification, exact localization and determination whether or not they maintained or disrupted the reading frame. MLPA was also effective in detection of deletions and duplications in female carriers. Copyright © 2014 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  4. Validation of the Cepheid GeneXpert for Detecting Ebola Virus in Semen.

    Science.gov (United States)

    Loftis, Amy James; Quellie, Saturday; Chason, Kelly; Sumo, Emmanuel; Toukolon, Mason; Otieno, Yonnie; Ellerbrok, Heinzfried; Hobbs, Marcia M; Hoover, David; Dube, Karine; Wohl, David A; Fischer, William A

    2017-02-01

    Ebola virus (EBOV) RNA persistence in semen, reported sexual transmission, and sporadic clusters at the end of the 2013-2016 epidemic have prompted recommendations that male survivors refrain from unprotected sex unless their semen is confirmed to be EBOV free. However, there is no fully validated assay for EBOV detection in fluids other than blood. The Cepheid Xpert Ebola assay for EBOV RNA detection was validated for whole semen and blood using samples obtained from uninfected donors and spiked with inactivated EBOV. The validation procedure incorporated standards from Clinical and Laboratory Standards Institute and Good Clinical Laboratory Practices guidelines for evaluating molecular devices for use in infectious disease testing. The assay produced limits of detection of 1000 copies/mL in semen and 275 copies/mL in blood. Limits of detection for both semen and blood increased with longer intervals between collection and testing, with acceptable results obtained up to 72 hours after specimen collection. The Cepheid Xpert Ebola assay is accurate and precise for detecting EBOV in whole semen. A validated assay for EBOV RNA detection in semen informs the care of male survivors of Ebola, as well as recommendations for public health. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  5. Quail FMO3 gene cloning, tissue expression profiling, polymorphism detection and association analysis with fishy taint in eggs.

    Directory of Open Access Journals (Sweden)

    Fengtao Mo

    Full Text Available Quail eggs comprise a significant and favourable part of table eggs in certain countries. Some quail eggs, however, present fishy off-flavor which directly influences their quality. It is reported that flavin-containing monooxygenase 3 (FMO3 is associated with fish-odour trait in human and animal products. FMO3 is responsible for the degradation of trimethylamine (TMA in vivo. Loss-of-function mutations in FMO3 gene can result in defective TMA N-oxygenation, giving rise to disorder known as "fish-odour syndrome" in human, as well as the fishy off-flavor in cow milk and chicken eggs. In order to reveal the genetic factor of fishy taint in quail eggs, we cloned the cDNA sequence of quail FMO3 gene, investigated FMO3 mRNA expression level in various tissues, detected SNPs in the coding region of the gene and conducted association analysis between a mutation and the TMA content in quail egg yolks. The 1888 bp cDNA sequence of quail FMO3 gene encoding 532 amino acids was obtained and characterized. The phylogenetic analysis revealed quail FMO3 had a closer relationship with chicken FMO3. The FMO3 mRNA was highly expressed in liver and kidney of quail. Nine SNPs were detected in the coding sequence of quail FMO3 gene, including a nonsense mutation (Q319X which was significantly associated with the elevated TMA content in quail egg yolks. Genotype TT at Q319X mutation loci was sensitive to choline. With addition of choline in the feed, the quails with homozygote TT at the Q319X mutation loci laid fish-odour eggs, indicating an interaction between genotype and diet. The results indicated that Q319X mutation was associated with the fishy off-flavor in quail eggs. Identification of the unfavorable allele T of quail FMO3 gene can be applied in future quail breeding to eliminate fishy off-flavor trait in quail eggs.

  6. Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

    Science.gov (United States)

    Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

    2016-10-19

    Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

  7. Detecting differential allelic expression using high-resolution melting curve analysis: application to the breast cancer susceptibility gene CHEK2

    Directory of Open Access Journals (Sweden)

    Sinilnikova Olga

    2011-05-01

    Full Text Available Abstract Background The gene CHEK2 encodes a checkpoint kinase playing a key role in the DNA damage pathway. Though CHEK2 has been identified as an intermediate breast cancer susceptibility gene, only a small proportion of high-risk families have been explained by genetic variants located in its coding region. Alteration in gene expression regulation provides a potential mechanism for generating disease susceptibility. The detection of differential allelic expression (DAE represents a sensitive assay to direct the search for a functional sequence variant within the transcriptional regulatory elements of a candidate gene. We aimed to assess whether CHEK2 was subject to DAE in lymphoblastoid cell lines (LCLs from high-risk breast cancer patients for whom no mutation in BRCA1 or BRCA2 had been identified. Methods We implemented an assay based on high-resolution melting (HRM curve analysis and developed an analysis tool for DAE assessment. Results We observed allelic expression imbalance in 4 of the 41 LCLs examined. All four were carriers of the truncating mutation 1100delC. We confirmed previous findings that this mutation induces non-sense mediated mRNA decay. In our series, we ruled out the possibility of a functional sequence variant located in the promoter region or in a regulatory element of CHEK2 that would lead to DAE in the transcriptional regulatory milieu of freely proliferating LCLs. Conclusions Our results support that HRM is a sensitive and accurate method for DAE assessment. This approach would be of great interest for high-throughput mutation screening projects aiming to identify genes carrying functional regulatory polymorphisms.

  8. First detection of the staphylococcal trimethoprim resistance gene dfrK and the dfrK-carrying transposon Tn559 in enterococci.

    Science.gov (United States)

    López, María; Kadlec, Kristina; Schwarz, Stefan; Torres, Carmen

    2012-02-01

    The trimethoprim resistance gene dfrK has been recently described in Staphylococcus aureus, but so far has not been found in other bacteria. A total of 166 enterococci of different species (E. faecium, E. faecalis, E. hirae, E. durans, E. gallinarum, and E. casseliflavus) and origins (food, clinical diseases in humans, healthy humans or animals, and sewage) were studied for their susceptibility to trimethoprim as determined by agar dilution (European Committee on Antimicrobial Susceptibility Testing) and the presence of (a) the dfrK gene and its genetic environment and (b) other dfr genes. The dfrK gene was detected in 49% of the enterococci (64% and 42% of isolates with minimum inhibitory concentrations of ≥2 mg/L or ≤1 mg/L, respectively). The tet(L)-dfrK linkage was detected in 21% of dfrK-positive enterococci. The chromosomal location of the dfrK gene was identified in one E. faecium isolate in which the dfrK was not linked to tet(L) gene but was part of a Tn559 element, which was integrated in the chromosomal radC gene. This Tn559 element was also found in 14 additional isolates. All combinations of dfr genes were detected among the isolates tested (dfrK, dfrG, dfrF, dfrK+dfrG, dfrK+dfrF, dfrF+dfrG, and dfrF+dfrG+dfrK). The gene dfrK gene was found together with other dfr genes in 58% of the tested enterococci. This study suggested an exchange of the trimethoprim resistance gene dfrK between enterococci and staphylococci, as previously observed for the trimethoprim resistance gene dfrG.

  9. Delineation of the species Haemophilus influenzae by phenotype, multilocus sequence phylogeny, and detection of marker genes

    DEFF Research Database (Denmark)

    Nørskov-Lauritsen, Niels; Overballe, MD; Kilian, Mogens

    2009-01-01

    To obtain more information on the much-debated definition of prokaryotic species, we investigated the borders of Haemophilus influenzae by comparative analysis of H. influenzae reference strains with closely related bacteria including strains assigned to Haemophilus haemolyticus, cryptic genospec......To obtain more information on the much-debated definition of prokaryotic species, we investigated the borders of Haemophilus influenzae by comparative analysis of H. influenzae reference strains with closely related bacteria including strains assigned to Haemophilus haemolyticus, cryptic...... genospecies biotype IV, and the never formally validated species "Haemophilus intermedius". Multilocus sequence phylogeny based on six housekeeping genes separated a cluster encompassing the type and the reference strains of H. influenzae from 31 more distantly related strains. Comparison of 16S rRNA gene...

  10. PAX3 gene deletion detected by microarray analysis in a girl with hearing loss.

    Science.gov (United States)

    Drozniewska, Malgorzata; Haus, Olga

    2014-01-01

    Deletions of the PAX3 gene have been rarely reported in the literature. Mutations of this gene are a common cause of Waardenburg syndrome type 1 and 3. We report a 16 year old female presenting hearing loss and normal intellectual development, without major features of Waardenburg syndrome type 1, and without family history of the syndrome. Her phenotype, however, overlaps with features of craniofacial-deafness-hand syndrome. Microarray analysis showed ~862 kb de novo deletion at 2q36.1 including PAX3. The above findings suggest that the rearrangement found in our patient appeared de novo and with high probability is a cause of her phenotype.

  11. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.

    2006-01-01

    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

  12. Characterization of a microcystin and detection of microcystin synthetase genes from a Brazilian isolate of Nostoc.

    Science.gov (United States)

    Genuário, Diego Bonaldo; Silva-Stenico, Maria Estela; Welker, Martin; Beraldo Moraes, Luiz Alberto; Fiore, Marli Fátima

    2010-04-01

    A nostocalean nitrogen-fixing cyanobacterium isolated from an eutrophic freshwater reservoir located in Piracicaba, São Paulo, Brazil, was evaluated for the production of hepatotoxic cyclic heptapeptides, microcystins. Morphologically this new cyanobacterium strain appears closest to Nostoc, however, in the phylogenetic analysis of 16S rRNA gene it falls into a highly stable cluster distantly only related to the typical Nostoc cluster. Extracts of Nostoc sp. CENA88 cultured cells, investigated using ELISA assay, gave positive results and the microcystin profile revealed by ESI-Q-TOF/MS/MS analysis confirmed the production of [Dha(7)]MCYST-YR. Further, Nostoc sp. CENA88 genomic DNA was analyzed by PCR for sequences of mcyD, mcyE and mcyG genes of microcystin synthetase (mcy) cluster. The result revealed the presence of mcyD, mcyE and mcyG genes with similarities to those from mcy of Nostoc sp. strains 152 and IO-102-I and other cyanobacterial genera. The phylogenetic tree based on concatenated McyG, McyD and McyE amino acids clustered the sequences according to cyanobacterial genera, with exception of the Nostoc sp. CENA88 sequence, which was placed in a clade distantly related from other Nostoc strains, as previously observed also in the 16S rRNA phylogenetic analysis. The present study describes for the first time a Brazilian Nostoc microcystin producer and also the occurrence of demethyl MCYST-YR variant in this genus. The sequenced Nostoc genes involved in the microcystin synthesis can contribute to a better understanding of the toxigenicity and evolution of this cyanotoxin. Copyright 2009 Elsevier Ltd. All rights reserved.

  13. PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk.

    Science.gov (United States)

    Rall, V L M; Vieira, F P; Rall, R; Vieitis, R L; Fernandes, A; Candeias, J M G; Cardoso, K F G; Araújo, J P

    2008-12-10

    Milk is considered a nutritious food because it contains several important nutrients including proteins and vitamins. Conversely, it can be a vehicle for several pathogenic bacteria such as Staphylococcus aureus. This study aimed to analyze the frequency of genes encoding the staphylococcal enterotoxins (SEs) SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI and SEJ in S. aureus strains isolated from raw or pasteurized bovine milk. S. aureus was found in 38 (70.4%) out of 54 raw milk samples at concentrations of up to 8.9 x 10(5) CFU/ml. This microorganism was present in eight samples of pasteurized milk before the expiration date and in 11 samples analyzed on the expiration date. Of the 57 strains studied, 68.4% were positive for one or more genes encoding the enterotoxins, and 12 different genotypes were identified. The gene coding for enterotoxin A, sea, was the most frequent (16 strains, 41%), followed by sec (8 strains, 20.5%), sed (5 strains, 12.8%), seb (3 strains, 7.7%) and see (2 strains, 5.1%). Among the genes encoding the other enterotoxins, seg was the most frequently observed (11 strains, 28.2%), followed by sei (10 strains) and seh and sej (3 strains each). With the recent identification of new SEs, the perceived frequency of enterotoxigenic strains has increased, suggesting that the pathogenic potential of staphylococci may be higher than previously thought; however, further studies are required to assess the expression of these new SEs by S. aureus, and their impact in foodborne disease. The quality of Brazilian milk is still low, and efforts from the government and the entire productive chain are required to attain consumer safety.

  14. Detection and characterisation of genes encoding antibiotic resistance in the cultivable oral microflora.

    OpenAIRE

    Villedieu, A.

    2006-01-01

    The emergence of antibiotic-resistant bacteria has become a major threat to public health. The increased use of antibiotics has selected for the dissemination of antibiotic resistance genes between organisms from different species and different genera. There is a large body of evidence that the indigenous microbiota can act as a reservoir of antibiotic-resistant bacteria. However little is known about the molecular basis for this in bacteria from the oral cavity. Therefore the aim of this wor...

  15. SNP genotyping by DNA photoligation: application to SNP detection of genes from food crops

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, Yoshinaga; Ohtake, Tomoko; Okada, Hajime; Fujimoto, Kenzo [School of Materials Science, Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Ami, Takehiro [Innovation Plaza Ishikawa, Japan Science and Technology Agency, 2-13 Asahidai, Nomi, Ishikawa 923-1211 (Japan); Tsukaguchi, Tadashi, E-mail: kenzo@jaist.ac.j [Faculty of Bioresources and Environmental Sciences, Ishikawa Prefectural University, 1-308 Suematsu, Nonoichi, Ishikawa 921-8836 (Japan)

    2009-06-15

    We describe a simple and inexpensive single-nucleotide polymorphism (SNP) typing method, using DNA photoligation with 5-carboxyvinyl-2'-deoxyuridine and two fluorophores. This SNP-typing method facilitates qualitative determination of genes from indica and japonica rice, and showed a high degree of single nucleotide specificity up to 10 000. This method can be used in the SNP typing of actual genomic DNA samples from food crops.

  16. SNP genotyping by DNA photoligation: application to SNP detection of genes from food crops

    Directory of Open Access Journals (Sweden)

    Yoshinaga Yoshimura, Tomoko Ohtake, Hajime Okada, Takehiro Ami, Tadashi Tsukaguchi and Kenzo Fujimoto

    2009-01-01

    Full Text Available We describe a simple and inexpensive single-nucleotide polymorphism (SNP typing method, using DNA photoligation with 5-carboxyvinyl-2'-deoxyuridine and two fluorophores. This SNP-typing method facilitates qualitative determination of genes from indica and japonica rice, and showed a high degree of single nucleotide specificity up to 10 000. This method can be used in the SNP typing of actual genomic DNA samples from food crops.

  17. Variability of Pasteurella multocida isolated from Icelandic sheep and detection of the toxA gene.

    Science.gov (United States)

    Einarsdottir, Thorbjorg; Gunnarsson, Eggert; Sigurdardottir, Olof G; Jorundsson, Einar; Fridriksdottir, Vala; Thorarinsdottir, Gudridur E; Hjartardottir, Sigridur

    2016-09-01

    Pasteurella multocida can be part of the upper respiratory flora of animals, but under conditions of stress or immunocompromisation, the bacteria can cause severe respiratory symptoms. In this study, we compared 10 P. multocida isolates from Icelandic sheep with respiratory symptoms and 19 isolates from apparently healthy abattoir sheep. We examined capsule type, genetic variability and the presence of the toxA gene in the two groups. Surprisingly, we found that all ovine P. multocida isolates examined in this study carried the toxA gene, which markedly differs from what has been published from other studies. Interestingly, all isolates from abattoir animals were capsule type D, whilst bacteria isolated from animals with clinical respiratory symptoms had capsule type A, D or F. Examination of seven housekeeping genes indicated that the clinical respiratory isolates were significantly more heterogeneous than the abattoir isolates (P<0.05, two-tailed Mann-Whitney U test). The results suggest that there may be at least two groups of P. multocida in sheep - a genetically homogeneous group that resides in the respiratory tract and a genetically heterogeneous group that is the predominant cause of disease.

  18. Functional Analysis of Thyroid Peroxidase Gene Mutations Detected in Patients with Thyroid Dyshormonogenesis

    Directory of Open Access Journals (Sweden)

    Srikanta Guria

    2014-01-01

    Full Text Available Thyroid peroxidase (TPO is the key enzyme in the biosynthesis of thyroid hormones. We aimed to identify the spectrum of mutations in the TPO gene leading to hypothyroidism in the population of West Bengal to establish the genetic etiology of the disease. 200 hypothyroid patients (case and their corresponding sex and age matched 200 normal individuals (control were screened depending on their clinical manifestations. Genomic DNA was isolated from peripheral blood samples and TPO gene (Exon 7 to Exon 14 was amplified by PCR. The PCR products were subjected to sequencing to identify mutations. Single nucleotide changes such as Glu 641 Lys, Asp 668 Asn, Thr 725 Pro, Asp 620 Asn, Ser 398 Thr, and Ala 373 Ser were found. Changes in the TPO were assayed in vitro to compare mutant and wild-type activities. Five mutants were enzymatically inactive in the guaiacol and iodide assays. This is a strong indication that the mutations are present at crucial positions of the TPO gene, resulting in inactivated TPO. The results of this study may help to develop a genetic screening protocol for goiter and hypothyroidism in the population of West Bengal.

  19. Motif-Independent De Novo Detection of Secondary Metabolite Gene Clusters – Towards Identification of Novel Secondary Metabolisms from Filamentous Fungi -

    Directory of Open Access Journals (Sweden)

    Myco eUmemura

    2015-05-01

    Full Text Available Secondary metabolites are produced mostly by clustered genes that are essential to their biosynthesis. The transcriptional expression of these genes is often cooperatively regulated by a transcription factor located inside or close to a cluster. Most of the secondary metabolism biosynthesis (SMB gene clusters identified to date contain so-called core genes with distinctive sequence features, such as polyketide synthase (PKS and non-ribosomal peptide synthetase (NRPS. Recent efforts in sequencing fungal genomes have revealed far more SMB gene clusters than expected based on the number of core genes in the genomes. Several bioinformatics tools have been developed to survey SMB gene clusters using the sequence motif information of the core genes, including SMURF and antiSMASH.More recently, accompanied by the development of sequencing techniques allowing to obtain large-scale genomic and transcriptomic data, motif-independent prediction methods of SMB gene clusters, including MIDDAS-M, have been developed. Most these methods detect the clusters in which the genes are cooperatively regulated at transcriptional levels, thus allowing the identification of novel SMB gene clusters regardless of the presence of the core genes. Another type of the method, MIPS-CG, uses the characteristics of SMB genes, which are highly enriched in non-syntenic blocks (NSBs, enabling the prediction even without transcriptome data although the results have not been evaluated in detail. Considering that large portion of SMB gene clusters might be sufficiently expressed only in limited uncommon conditions, it seems that prediction of SMB gene clusters by bioinformatics and successive experimental validation is an only way to efficiently uncover hidden SMB gene clusters. Here, we describe and discuss possible novel approaches for the determination of SMB gene clusters that have not been identified using conventional methods.

  20. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    Science.gov (United States)

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  1. Use of next-generation sequencing to detect LDLR gene copy number variation in familial hypercholesterolemia[S

    Science.gov (United States)

    Iacocca, Michael A.; Wang, Jian; Dron, Jacqueline S.; Robinson, John F.; McIntyre, Adam D.; Cao, Henian

    2017-01-01

    Familial hypercholesterolemia (FH) is a heritable condition of severely elevated LDL cholesterol, caused predominantly by autosomal codominant mutations in the LDL receptor gene (LDLR). In providing a molecular diagnosis for FH, the current procedure often includes targeted next-generation sequencing (NGS) panels for the detection of small-scale DNA variants, followed by multiplex ligation-dependent probe amplification (MLPA) in LDLR for the detection of whole-exon copy number variants (CNVs). The latter is essential because ∼10% of FH cases are attributed to CNVs in LDLR; accounting for them decreases false negative findings. Here, we determined the potential of replacing MLPA with bioinformatic analysis applied to NGS data, which uses depth-of-coverage analysis as its principal method to identify whole-exon CNV events. In analysis of 388 FH patient samples, there was 100% concordance in LDLR CNV detection between these two methods: 38 reported CNVs identified by MLPA were also successfully detected by our NGS method, while 350 samples negative for CNVs by MLPA were also negative by NGS. This result suggests that MLPA can be removed from the routine diagnostic screening for FH, significantly reducing associated costs, resources, and analysis time, while promoting more widespread assessment of this important class of mutations across diagnostic laboratories. PMID:28874442

  2. Rapid and sensitive detection of Plesiomonas shigelloides by loop-mediated isothermal amplification of the hugA gene.

    Directory of Open Access Journals (Sweden)

    Shuang Meng

    Full Text Available Plesiomonas shigelloides is one of the causative agents of human gastroenteritis, with increasing number of reports describing such infections in recent years. In this study, the hugA gene was chosen as the target to design loop-mediated isothermal amplification (LAMP assays for the rapid, specific, and sensitive detection of P. shigelloides. The performance of the assay with reference plasmids and spiked human stools as samples was evaluated and compared with those of quantitative PCR (qPCR. No false-positive results were observed for the 32 non-P. shigelloides strains used to evaluate assay specificity. The limit of detection for P. shigelloides was approximately 20 copies per reaction in reference plasmids and 5×10(3 CFU per gram in spiked human stool, which were more sensitive than the results of qPCR. When applied in human stool samples spiked with 2 low levels of P. shigelloides, the LAMP assays achieved accurate detection after 6-h enrichment. In conclusion, the LAMP assay developed in this study is a valuable method for rapid, cost-effective, and simple detection of P. shigelloides in basic clinical and field laboratories in the rural areas of China.

  3. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Variations among Japanese of the factor IX gene (F9) detected by PCR-denaturing gradient gel electrophoresis

    Energy Technology Data Exchange (ETDEWEB)

    Satoh, Chiyoko; Takahashi, Norio; Asakawa, Junichi; Hiyama, Keiko; Kodaira, Meiko (Radiation Effects Research Foundation, Hiroshima (Japan))

    1993-01-01

    In the course of feasibility studies to examine the efficiencies and practicalities of various techniques for screening for genetic variations, the human coagulation factor IX (F9) genes of 63 Japanese families were examined by PCR-denaturing gradient gel electrophoresis (PCR-DGGE). Four target sequences with lengths of 983-2,891 bp from the F9 genes of 126 unrelated individuals from Hiroshima and their 100 children were amplified by PCR, digested with restriction enzymes to approximately 500-bp fragments, and examined by DGGE - a total of 6,724 bp being examined per individual. GC-rich sequences (GC-clamps) of 40 bp were attached to both ends of the target sequences, as far as was feasible. Eleven types of new nucleotide substitutions were detected in the population, none of which produced RFLPs or caused hemophilia B. By examining two target sequences in a single lane, approximately 8,000 bp in a diploid individual could be examined. This approach is very effective for the detection of variations in DNA and is applicable to large-scale population studies. 46 refs., 3 figs., 1 tab.

  5. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

    Science.gov (United States)

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

    2014-09-01

    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Detection and quantitation of HER-2/neu gene amplification in human breast cancer archival material using fluorescence in situ hybridization.

    Science.gov (United States)

    Pauletti, G; Godolphin, W; Press, M F; Slamon, D J

    1996-07-04

    Amplification and overexpression of the HER-2/neu gene occurs in 25-30% of human breast cancers. This genetic alteration is associated with a poor clinical prognosis in women with either node negative or node positive breast cancers. The initial studies testing this association were somewhat controversial and this controversy was due in large part to significant heterogeneity in both the methods and/or reagents used in testing archival material for the presence of the alteration. These methods included a number of solid matrix blotting techniques for DNA, RNA and protein as well as immunohistochemistry. Fluorescence in situ hybridization (FISH) represents the newest methodologic approach for testing for this genetic alteration. In this study, FISH is compared to Southern, Northern and Western blot analyses as well as immunohistochemistry in a large cohort of archival human breast cancer specimens. FISH was found to be superior to all other methodologies tested in assessing formalin fixed, paraffin embedded material for HER-2/neu amplification. The results from this study also confirm that overexpression of HER-2/neu rarely occurs in the absence of gene amplification in breast cancer (approximately 3% of cases). This method of analysis is rapid, reproducible and extremely reliable in detecting presence of HER-2/neu gene amplification and should have clinical utility.

  7. Detection of EBV Infection and Gene Expression in Oral Cancer from Patients in Taiwan by Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Ching-Yu Yen

    2009-01-01

    Full Text Available Epstein-Barr virus is known to cause nasopharyngeal carcinoma. Although oral cavity is located close to the nasal pharynx, the pathogenetic role of Epstein-Barr virus (EBV in oral cancers is unclear. This molecular epidemiology study uses EBV genomic microarray (EBV-chip to simultaneously detect the prevalent rate and viral gene expression patterns in 57 oral squamous cell carcinoma biopsies (OSCC collected from patients in Taiwan. The majority of the specimens (82.5% were EBV-positive that probably expressed coincidently the genes for EBNAs, LMP2A and 2B, and certain structural proteins. Importantly, the genes fabricated at the spots 61 (BBRF1, BBRF2, and BBRF3 and 68 (BDLF4 and BDRF1 on EBV-chip were actively expressed in a significantly greater number of OSCC exhibiting exophytic morphology or ulceration than those tissues with deep invasive lesions (P=.0265 and .0141, resp.. The results may thus provide the lead information for understanding the role of EBV in oral cancer pathogenesis.

  8. Detection and phylogenetic analyses of spike genes in porcine epidemic diarrhea virus strains circulating in China in 2016-2017.

    Science.gov (United States)

    Zhang, Qiaoling; Liu, Xinsheng; Fang, Yuzhen; Zhou, Peng; Wang, Yonglu; Zhang, Yongguang

    2017-10-10

    Large-scale outbreaks of porcine epidemic diarrhea (PED) have re-emerged in China in recent years. However, little is known about the genetic diversity and molecular epidemiology of field strains of PED virus (PEDV) in China in 2016-2017. To address this issue, in this study, 116 diarrhea samples were collected from pig farms in 6 Chinese provinces in 2016-2017 and were detected using PCR for main porcine enteric pathogens, including PEDV, porcine deltacoronavirus (PDCoV), porcine transmissible gastroenteritis virus (TGEV) and porcine kobuvirus (PKV). In addition, the complete S genes from 11 representative PEDV strains were sequenced and analyzed. PCR detection showed that 52.6% (61/116) of these samples were positive for PEDV. Furthermore, sequencing results for the spike (S) genes from 11 of the epidemic PEDV strains showed 93-94% nucleotide identity and 92-93% amino acid identity with the classical CV777 strain. Compared with the CV777 vaccine strain, these strains had an insertion (A 133 ), a deletion (G 155 ), and a continuous 4-amino-acid insertion ( 56 NNTN 59 ) in the S1 region. Phylogenetic analysis based on the S gene indicated that the 11 assessed PEDV strains were genetically diverse and clustered into the G2 group. These results demonstrate that the epidemic strains of PEDV in China in 2016-2017 are mainly virulent strains that belong to the G2 group and genetically differ from the vaccine strain. Importantly, this is the first report that the samples collected in Hainan Province were positive for PEDV (59.2%, 25/42). To our knowledge, this article presents the first report of a virulent PEDV strain isolated from Hainan Island, China. The results of this study will contribute to the understanding of the epidemiology and genetic characteristics of PEDV in China.

  9. Detection and characterization of polymorphisms in XRCC DNA repair genes in human population

    International Nuclear Information System (INIS)

    Staynova, A.; Hadjidekova, V.; Savov, A.

    2004-01-01

    Human population is continuously exposed to low levels of ionizing radiation. The main contribution gives the exposure due to medical applications. Nevertheless, most of the damage induced is repaired shortly after exposure by cellular repair systems. The review is focused on the development and application of methods to estimate the character of polymorphisms in repair genes (XRCC1, APE1), involved in single strand breaks repair which is corresponding mainly to the repair of X-ray induced DNA damage. Since, DSB are major factor for chromosomal aberrations formation, the assays described in this review might be useful for the assessment of the radiation risk for human population. (authors)

  10. A Multiplex SYBR Green Real-Time PCR Assay for the Detection of Three Colistin Resistance Genes from Cultured Bacteria, Feces, and Environment Samples

    Directory of Open Access Journals (Sweden)

    Jiyun Li

    2017-10-01

    Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.

  11. Alienness: Rapid Detection of Candidate Horizontal Gene Transfers across the Tree of Life

    Directory of Open Access Journals (Sweden)

    Corinne Rancurel

    2017-09-01

    Full Text Available Horizontal gene transfer (HGT is the transmission of genes between organisms by other means than parental to offspring inheritance. While it is prevalent in prokaryotes, HGT is less frequent in eukaryotes and particularly in Metazoa. Here, we propose Alienness, a taxonomy-aware web application available at http://alienness.sophia.inra.fr. Alienness parses BLAST results against public libraries to rapidly identify candidate HGT in any genome of interest. Alienness takes as input the result of a BLAST of a whole proteome of interest against any National Center for Biotechnology Information (NCBI protein library. The user defines recipient (e.g., Metazoa and donor (e.g., bacteria, fungi branches of interest in the NCBI taxonomy. Based on the best BLAST E-values of candidate donor and recipient taxa, Alienness calculates an Alien Index (AI for each query protein. An AI > 0 indicates a better hit to candidate donor than recipient taxa and a possible HGT. Higher AI represent higher gap of E-values between candidate donor and recipient and a more likely HGT. We confirmed the accuracy of Alienness on phylogenetically confirmed HGT of non-metazoan origin in plant-parasitic nematodes. Alienness scans whole proteomes to rapidly identify possible HGT in any species of interest and thus fosters exploration of HGT more easily and largely across the tree of life.

  12. Bayesian model to detect phenotype-specific genes for copy number data

    Directory of Open Access Journals (Sweden)

    González Juan R

    2012-06-01

    Full Text Available Abstract Background An important question in genetic studies is to determine those genetic variants, in particular CNVs, that are specific to different groups of individuals. This could help in elucidating differences in disease predisposition and response to pharmaceutical treatments. We propose a Bayesian model designed to analyze thousands of copy number variants (CNVs where only few of them are expected to be associated with a specific phenotype. Results The model is illustrated by analyzing three major human groups belonging to HapMap data. We also show how the model can be used to determine specific CNVs related to response to treatment in patients diagnosed with ovarian cancer. The model is also extended to address the problem of how to adjust for confounding covariates (e.g., population stratification. Through a simulation study, we show that the proposed model outperforms other approaches that are typically used to analyze this data when analyzing common copy-number polymorphisms (CNPs or complex CNVs. We have developed an R package, called bayesGen, that implements the model and estimating algorithms. Conclusions Our proposed model is useful to discover specific genetic variants when different subgroups of individuals are analyzed. The model can address studies with or without control group. By integrating all data in a unique model we can obtain a list of genes that are associated with a given phenotype as well as a different list of genes that are shared among the different subtypes of cases.

  13. Detection of transgenerational spermatogenic inheritance of adult male acquired CNS gene expression characteristics using a Drosophila systems model.

    Directory of Open Access Journals (Sweden)

    Abhay Sharma

    Full Text Available Available instances of inheritance of epigenetic transgenerational phenotype are limited to environmental exposures during embryonic and adult gonadal development. Adult exposures can also affect gametogenesis and thereby potentially result in reprogramming of the germline. Although examples of epigenetic effects on gametogenesis exist, it is notable that transgenerational inheritance of environment-induced adult phenotype has not yet been reported. Epigenetic codes are considered to be critical in neural plasticity. A Drosophila systems model of pentylenetetrazole (PTZ induced long-term brain plasticity has recently been described. In this model, chronic PTZ treatment of adult males causes alterations in CNS transcriptome. Here, we describe our search for transgenerational spermatogenic inheritance of PTZ induced gene expression phenotype acquired by adult Drosophila males. We generated CNS transcriptomic profiles of F(1 adults after treating F(0 adult males with PTZ and of F(2 adults resulting from a cross between F(1 males and normal females. Surprisingly, microarray clustering showed F(1 male profile as closest to F(1 female and F(0 male profile closest to F(2 male. Differentially expressed genes in F(1 males, F(1 females and F(2 males showed significant overlap with those caused by PTZ. Interestingly, microarray evidence also led to the identification of upregulated rRNA in F(2 males. Next, we generated microarray expression profiles of adult testis from F(0 and F(1 males. Further surprising, clustering of CNS and testis profiles and matching of differentially expressed genes in them provided evidence of a spermatogenic mechanism in the transgenerational effect observed. To our knowledge, we report for the first time detection of transgenerational spermatogenic inheritance of adult acquired somatic gene expression characteristic. The Drosophila systems model offers an excellent opportunity to understand the epigenetic mechanisms underlying

  14. Detection of transgenerational spermatogenic inheritance of adult male acquired CNS gene expression characteristics using a Drosophila systems model.

    Science.gov (United States)

    Sharma, Abhay; Singh, Priyanka

    2009-06-02

    Available instances of inheritance of epigenetic transgenerational phenotype are limited to environmental exposures during embryonic and adult gonadal development. Adult exposures can also affect gametogenesis and thereby potentially result in reprogramming of the germline. Although examples of epigenetic effects on gametogenesis exist, it is notable that transgenerational inheritance of environment-induced adult phenotype has not yet been reported. Epigenetic codes are considered to be critical in neural plasticity. A Drosophila systems model of pentylenetetrazole (PTZ) induced long-term brain plasticity has recently been described. In this model, chronic PTZ treatment of adult males causes alterations in CNS transcriptome. Here, we describe our search for transgenerational spermatogenic inheritance of PTZ induced gene expression phenotype acquired by adult Drosophila males. We generated CNS transcriptomic profiles of F(1) adults after treating F(0) adult males with PTZ and of F(2) adults resulting from a cross between F(1) males and normal females. Surprisingly, microarray clustering showed F(1) male profile as closest to F(1) female and F(0) male profile closest to F(2) male. Differentially expressed genes in F(1) males, F(1) females and F(2) males showed significant overlap with those caused by PTZ. Interestingly, microarray evidence also led to the identification of upregulated rRNA in F(2) males. Next, we generated microarray expression profiles of adult testis from F(0) and F(1) males. Further surprising, clustering of CNS and testis profiles and matching of differentially expressed genes in them provided evidence of a spermatogenic mechanism in the transgenerational effect observed. To our knowledge, we report for the first time detection of transgenerational spermatogenic inheritance of adult acquired somatic gene expression characteristic. The Drosophila systems model offers an excellent opportunity to understand the epigenetic mechanisms underlying the

  15. A molecular beacon based on DNA-templated silver nanoclusters for the highly sensitive and selective multiplexed detection of virulence genes.

    Science.gov (United States)

    Han, Dan; Wei, Chunying

    2018-05-01

    In this work, we develop a fluorescent molecular beacon based on the DNA-templated silver nanoclusters (DNA-Ag NCs). The skillfully designed molecular beacon can be conveniently used for detection of diverse virulence genes as long as the corresponding recognition sequences are embedded. Importantly, the constructed detection system allows simultaneous detection of multiple nucleic acids, which is attributed to non-overlapping emission spectra of the as-synthesized silver nanoclusters. Based on the target-induced fluorescence enhancement, three infectious disease-related genes HIV, H1N1, and H5N1 are detected, and the corresponding detection limits are 3.53, 0.12 and 3.95nM, respectively. This design allows specific, versatile and simultaneous detection of diverse targets with easy operation and low cost. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Application of DETECTER, an evolutionary genomic tool to analyze genetic variation, to the cystic fibrosis gene family

    Directory of Open Access Journals (Sweden)

    De Kee Danny W

    2006-03-01

    Full Text Available Abstract Background The medical community requires computational tools that distinguish missense genetic differences having phenotypic impact within the vast number of sense mutations that do not. Tools that do this will become increasingly important for those seeking to use human genome sequence data to predict disease, make prognoses, and customize therapy to individual patients. Results An approach, termed DETECTER, is proposed to identify sites in a protein sequence where amino acid replacements are likely to have a significant effect on phenotype, including causing genetic disease. This approach uses a model-dependent tool to estimate the normalized replacement rate at individual sites in a protein sequence, based on a history of those sites extracted from an evolutionary analysis of the corresponding protein family. This tool identifies sites that have higher-than-average, average, or lower-than-average rates of change in the lineage leading to the sequence in the population of interest. The rates are then combined with sequence data to determine the likelihoods that particular amino acids were present at individual sites in the evolutionary history of the gene family. These likelihoods are used to predict whether any specific amino acid replacements, if introduced at the site in a modern human population, would have a significant impact on fitness. The DETECTER tool is used to analyze the cystic fibrosis transmembrane conductance regulator (CFTR gene family. Conclusion In this system, DETECTER retrodicts amino acid replacements associated with the cystic fibrosis disease with greater accuracy than alternative approaches. While this result validates this approach for this particular family of proteins only, the approach may be applicable to the analysis of polymorphisms generally, including SNPs in a human population.

  17. Correlation of phenotypic tests with the presence of the blaZ gene for detection of beta-lactamase.

    Science.gov (United States)

    Ferreira, Adriano Martison; Martins, Katheryne Benini; Silva, Vanessa Rocha da; Mondelli, Alessandro Lia; Cunha, Maria de Lourdes Ribeiro de Souza da

    Staphylococcus aureus and Staphylococcus saprophyticus are the most common and most important staphylococcal species associated with urinary tract infections. The objective of the present study was to compare and to evaluate the accuracy of four phenotypic methods for the detection of beta-lactamase production in Staphylococcus spp. Seventy-three strains produced a halo with a diameter ≤28mm (penicillin resistant) and all of them were positive for the blaZ gene. Among the 28 susceptible strain (halo ≥29mm), 23 carried the blaZ gene and five did not. The zone edge test was the most sensitive (90.3%), followed by MIC determination (85.5%), but the specificity of the former was low (40.0%). The nitrocefin test was the least sensitive (28.9%). However, the nitrocefin test together with the disk diffusion method showed the highest specificity (100%). The present results demonstrated that the zone edge test was the most sensitive phenotypic test for detection of beta-lactamase, although it is still not an ideal test to detect this type of resistance since its specificity was low. However, the inhibition halo diameter of the penicillin disk can be used together with the zone edge test since the same disk is employed in the two tests. Combined analysis of the two tests shows a sensitivity of 90.3% and specificity of 100%, proving better sensitivity, especially for S. saprophyticus. This is a low-cost test of easy application and interpretation that can be used in small and medium-sized laboratories where susceptibility testing is usually performed by the disk diffusion method. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  18. Correlation of phenotypic tests with the presence of the blaZ gene for detection of beta-lactamase

    Directory of Open Access Journals (Sweden)

    Adriano Martison Ferreira

    Full Text Available Abstract Staphylococcus aureus and Staphylococcus saprophyticus are the most common and most important staphylococcal species associated with urinary tract infections. The objective of the present study was to compare and to evaluate the accuracy of four phenotypic methods for the detection of beta-lactamase production in Staphylococcus spp. Seventy-three strains produced a halo with a diameter ≤28 mm (penicillin resistant and all of them were positive for the blaZ gene. Among the 28 susceptible strain (halo ≥29 mm, 23 carried the blaZ gene and five did not. The zone edge test was the most sensitive (90.3%, followed by MIC determination (85.5%, but the specificity of the former was low (40.0%. The nitrocefin test was the least sensitive (28.9%. However, the nitrocefin test together with the disk diffusion method showed the highest specificity (100%. The present results demonstrated that the zone edge test was the most sensitive phenotypic test for detection of beta-lactamase, although it is still not an ideal test to detect this type of resistance since its specificity was low. However, the inhibition halo diameter of the penicillin disk can be used together with the zone edge test since the same disk is employed in the two tests. Combined analysis of the two tests shows a sensitivity of 90.3% and specificity of 100%, proving better sensitivity, especially for S. saprophyticus. This is a low-cost test of easy application and interpretation that can be used in small and medium-sized laboratories where susceptibility testing is usually performed by the disk diffusion method.

  19. Virulence Gene Pool Detected in Bovine Group C Streptococcus dysgalactiae subsp. dysgalactiae Isolates by Use of a Group A S. pyogenes Virulence Microarray ▿

    Science.gov (United States)

    Rato, Márcia G.; Nerlich, Andreas; Bergmann, René; Bexiga, Ricardo; Nunes, Sandro F.; Vilela, Cristina L.; Santos-Sanches, Ilda; Chhatwal, Gursharan S.

    2011-01-01

    A custom-designed microarray containing 220 virulence genes of Streptococcus pyogenes (group A Streptococcus [GAS]) was used to test group C Streptococcus dysgalactiae subsp. dysgalactiae (GCS) field strains causing bovine mastitis and group C or group G Streptococcus dysgalactiae subsp. equisimilis (GCS/GGS) isolates from human infections, with the latter being used for comparative purposes, for the presence of virulence genes. All bovine and all human isolates carried a fraction of the 220 genes (23% and 39%, respectively). The virulence genes encoding streptolysin S, glyceraldehyde-3-phosphate dehydrogenase, the plasminogen-binding M-like protein PAM, and the collagen-like protein SclB were detected in the majority of both bovine and human isolates (94 to 100%). Virulence factors, usually carried by human beta-hemolytic streptococcal pathogens, such as streptokinase, laminin-binding protein, and the C5a peptidase precursor, were detected in all human isolates but not in bovine isolates. Additionally, GAS bacteriophage-associated virulence genes encoding superantigens, DNase, and/or streptodornase were detected in bovine isolates (72%) but not in the human isolates. Determinants located in non-bacteriophage-related mobile elements, such as the gene encoding R28, were detected in all bovine and human isolates. Several virulence genes, including genes of bacteriophage origin, were shown to be expressed by reverse transcriptase PCR (RT-PCR). Phylogenetic analysis of superantigen gene sequences revealed a high level (>98%) of identity among genes of bovine GCS, of the horse pathogen Streptococcus equi subsp. equi, and of the human pathogen GAS. Our findings indicate that alpha-hemolytic bovine GCS, an important mastitis pathogen and considered to be a nonhuman pathogen, carries important virulence factors responsible for virulence and pathogenesis in humans. PMID:21525223

  20. [Identification of an ideal noninvasive method to detect A3243G gene mutation in MELAS syndrome].

    Science.gov (United States)

    Ma, Yi-nan; Fang, Fang; Yang, Yan-ling; Zhang, Ying; Wang, Song-tao; Xu, Yu-feng; Pei, Pei; Yuan, Yun; Bu, Ding-fang; Qi, Yu

    2008-12-16

    To identify a better non-invasive method to detect the carrier of mitochondrial A3243G mutation, a cause of mitochondrial encephalopathy-lactic acidosis-stroke like episode (MELAS) syndrome. DNA was extracted from the peripheral blood, urine, hair follicle, and saliva of 25 MELAS syndrome patients carrying A3243G mutation and their mothers and other maternal relatives, 33 persons in number, and the muscle tissues from 5 patients obtained by biopsy. A3243G mutation was detected by PCR-RFLP method, and the A3243G mutation ratio was identified by measuring the density of each band and calculation with the software AlphaEase 5.0. A3243G mutations were detected in all tissues of the 25 MELAS patients. The A3243G mutation ratio in urine was 62% +/- 9%, significantly higher than that in the blood [(36% +/- 10%), t = -11.13, P < 0.01]. A3243G mutations were detected in at least one tissue of the 28 maternal relatives. The A3243G mutation rates in their urine samples was 33.0% (5.0% - 70.4%), significantly higher than that in their blood samples [8.0% (0 - 33.3%), z = -4.197, P < 0.01]. There was no significant difference in A3243G mutation ratio among the samples of hair follicle, saliva, and blood. The A3243G mutation ratio in urine is significantly higher than those in blood samples of the patients and their maternal relatives. A noninvasive method, A3243G mutation ratio analysis of urine is superior to that in blood.

  1. The cystic fibrosis gene: Medical and social implications for heterozygote detection

    Energy Technology Data Exchange (ETDEWEB)

    Wilfond, B.S.; Fost, N. (Univ. of Wisconsin School of Medicine, Madison (USA))

    1990-05-23

    The primary goal of mass screening programs for cystic fibrosis carriers should be to allow people to make more informed reproductive decisions. However, previous experience with genetic screening programs, including those for phenylketonuria and sickle cell disease, have revealed complex problems including error, confusion, and stigmatization. These problems could be greater with cystic fibrosis, since more than 8 million Americans may be carriers and entrepreneurial interests can be expected to promote screening in what could become a billion-dollar industry. The present frequency of the detectable mutation ({Delta}F{sub 508}), 75%, will complicate the counseling process. The sensitivity of the test to detect at-risk couples would be 56%. The cost of screening could be as much as $2.2 million for each cystic fibrosis birth avoided. Regardless of improvements in the detection rate, implementation of population screening should be delayed until pilot studies that demonstrate its safety and effectiveness are completed. While studies are in progress, preconception testing should be offered to adult relatives of cystic fibrosis patients as part of a comprehensive program following institutional review board approval for compassionate use.

  2. Detection systems for carbapenemase gene identification should include the SME serine carbapenemase.

    Science.gov (United States)

    Bush, Karen; Pannell, Megan; Lock, John L; Queenan, Anne Marie; Jorgensen, James H; Lee, Ryan M; Lewis, James S; Jarrett, Deidre

    2013-01-01

    Carbapenemase detection has become a major problem in hospitals that encounter outbreaks of infections caused by carbapenem-resistant Gram-negative bacteria. Rapid detection systems have been reported using multiplex PCR analyses and DNA microarray assays. Major carbapenemases that are detected by these systems include the KPC and OXA serine carbapenemases, and the IMP, VIM and NDM families of metallo-β-lactamases. However, increasing numbers of the SME serine carbapenemase are being reported from Serratia marcescens, especially from North and South America. These organisms differ from many of the other carbapenemase-producing pathogens in that they are generally susceptible to the expanded-spectrum cephalosporins ceftazidime and cefepime while retaining resistance to almost all other β-lactam antibiotics. Thus, multiplex PCR assays or DNA microarray testing of carbapenem-resistant S. marcescens isolates should include analyses for production of the SME carbapenemase. Confirmation of the presence of this enzyme may provide reassurance that oxyimino-cephalosporins can be considered for treatment of infections caused by these carbapenem-resistant pathogens. Copyright © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  3. Loop-mediated isothermal amplification: Rapid and sensitive detection of the antibiotic resistance gene ISAba1-blaOXA-51-like in Acinetobacter baumannii.

    Science.gov (United States)

    Mu, Xiaoqin; Nakano, Ryuichi; Nakano, Akiyo; Ubagai, Tsuneyuki; Kikuchi-Ueda, Takane; Tansho-Nagakawa, Shigeru; Kikuchi, Hirotoshi; Kamoshida, Go; Endo, Shiro; Yano, Hisakazu; Ono, Yasuo

    2016-02-01

    Carbapenem-resistant Acinetobacter baumannii, which are mainly induced by the production of OXA-type β-lactamases, are among the leading causes of nosocomial infections worldwide. Among the β-lactamase genes, the presence of the OXA-51-like gene carrying the upstream insertion sequence, ISAba1, was found to be one of the most prevalent carbapenem resistance mechanisms utilized by these bacteria. Consequently, it is necessary to develop a rapid detection method for ISAba1-blaOXA-51-like sequence for the timely and appropriate antibiotic treatment of A. baumannii infection. In this study, a loop-mediated isothermal amplification (LAMP) assay was optimized for ISAba1-blaOXA-51-like detection. The LAMP primer set was designed to recognize distinct sequences in the ISAba1-blaOXA-51-like gene and could amplify the gene within 25 min at an isothermal temperature of 60°C. This LAMP assay was able to detect the ISAba1-blaOXA-51-like gene with high specificity; in addition, no cross-reactivity was observed for other types of β-lactamase producers (OXA-23-like, OXA-40-like, OXA-58-like, and IMP-1), as indicated by the absence of false positive or false negative results. The detection limit for this assay was found to be 10(0)CFU per tube which was 100-fold more sensitive than a polymerase chain reaction assay for ISAba1-blaOXA-51-like detection. Furthermore, the LAMP assay provided swift detection of the ISAba1-blaOXA-51-like gene, even directly from clinical specimens. In summary, we have described a new, rapid assay for the detection of the ISAba1-blaOXA-51-like gene from A. baumannii that could be useful in a clinical setting. This method might facilitate epidemiological studies and allow monitoring of the emergence of drug resistant strains. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Intergenomic arms races: detection of a nuclear rescue gene of male-killing in a ladybird.

    Directory of Open Access Journals (Sweden)

    Tamsin M O Majerus

    Full Text Available Many species of arthropod are infected by deleterious inherited micro-organisms. Typically these micro-organisms are inherited maternally. Consequently, some, particularly bacteria of the genus Wolbachia, employ a variety of strategies that favour female over male hosts. These strategies include feminisation, induction of parthenogenesis and male-killing. These strategies result in female biased sex ratios in host populations, which lead to selection for host factors that promote male production. In addition, the intra-genomic conflict produced by the difference in transmission of these cytoplasmic endosymbionts and nuclear factors will impose a pressure favouring nuclear factors that suppress the effects of the symbiont. During investigations of the diversity of male-killing bacteria in ladybirds (Coccinellidae, unexpected patterns of vertical transmission of a newly discovered male-killing taxon were observed in the ladybird Cheilomenes sexmaculata. Initial analysis suggested that the expression of the bacterial male-killing trait varies according to the male(s a female has mated with. By swapping males between females, a male influence on the expression of the male-killing trait was confirmed. Experiments were then performed to determine the nature of the interaction. These studies showed that a single dominant allele, which rescues male progeny of infected females from the pathological effect of the male-killer, exists in this species. The gene shows typical Mendelian autosomal inheritance and is expressed irrespective of the parent from which it is inherited. Presence of the rescue gene in either parent does not significantly affect the inheritance of the symbiont. We conclude that C. sexmaculata is host to a male-killing gamma-proteobacterium. Further, this beetle is polymorphic for a nuclear gene, the dominant allele of which rescues infected males from the pathogenic effects of the male-killing agent. These findings represent the first

  5. Molecular detection of interleukin-1A +4845 G→T gene in aggresive periodontitis patients

    Directory of Open Access Journals (Sweden)

    Chiquita Prahasanti

    2012-12-01

    Full Text Available Background: Abundant researches had been conducted based on the clinical and histopathological pathogenesis of aggresive periodontitis. Nevertheless, there were still few researches which based on molecular biology, and especially related to gene polymorphism. This study was done based on IL-1A +4845G→T gene polymorphism in aggressive periodontitis patients. Purpose: The purpose of this tudy was to characterized the generic variation of IL-1A +4845G→T as a risk factor aggressive periodontitis and chronic periodontitis. Methods: DNA from patients with aggressive periodontitis and chronic periodontitis was taken determination of IL-1A +4845 G→T polimorphism was conducted with PCR-RFLP technique. Results: Homozygous allele TT polymorphism was not found in all samples, only allele GG (wild type and allele GT (heterozygous mutant were not affect aggressive periodontitis and chronic periodontitis. Conclusion: The study showed there was no significant association between IL-1A +4845G→T gene polymorphism and aggressive periodontitis and chronic periodontitis. Latar belakang: Penelitian tentang patogenesa periodontitis agresif berdasar klinis dan histopatologi telah banyak dilakukan, akan tetapi penelitian berdasar biologimolekuler terutama polimorfisme gen masih sangat jarang dilakukan. Penelitian ini dilakukan berdasarkan pada polimorfisme gen IL-1A +4845G→T pada penderita periodontitis agresif. Tujuan: Tujuan dari penelitian ini adalah untuk mengetahui variasi genetik dari IL-1A +4845G→T yang merupakan faktor risiko periodontitis agresif dan periodontitis kronis. Metode: DNA dari penderita periodontitis agresif dan periodontitis kronis diisolasi, selanjutnya dilakukan determinasi dari polimorfisme gen IL-1A +4845G→T dengan menggunakan teknik PCR-RFLP. Hasil: Pada seluruh sampel penelitian ini tidak dijumpai polimorfisme allel TT (homosigot mutan, yang didapat adalah jenis allel GG (wild type dan allel GT (heterosigot mutan yang tidak

  6. Detection of blaCTX-M gene among Pseudomonas aeruginosa isolated from water samples in Baghdad

    Directory of Open Access Journals (Sweden)

    Saba R. Khdair

    2017-11-01

    Full Text Available A total of 50 environmental Pseudomonas aeruginosa isolates were collected from sewage and tap water in Baghdad, Iraq. The MICs of Cefotaxime and Ceftazidime were determined by using agar dilution method, The MIC ranged from 2 to 256 µg/ml.The results of antibiotic sensitivity test showed that among sewage P. aeruginosa isolates, resistance was observed most often to Ticarcillin (92%, Penicillin G (84%, Ceftazidime (12%, (8% for each of Cefotaxime and Ticarcillin. On the other hand, all tap water isolates were sensitive to Ofloxacin and Levofloxacin, Except (5% of isolates were resistant to Cefotaxime (25% to Ceftazidime and (95% to Ticarcillin. All isolates were tested for Extended-Spectrum β-Lactamase (ESBL production. Ten isolates (20% were found to be ESBL producers. All environmental P. aeruginosa isolates were screened for the presence of the blaCTX-M genes by application PCR, Only (30% of them were positive for this test.

  7. Rapid, simple and sensitive detection of Q fever by loop-mediated isothermal amplification of the htpAB gene.

    Directory of Open Access Journals (Sweden)

    Lei Pan

    Full Text Available BACKGROUND: Q fever is the most widespread zoonosis, and domestic animals are the most common sources of transmission. It is not only difficult to distinguish from other febrile diseases because of the lack of specific clinical manifestations in humans, but it is also difficult to identify the disease in C. burnetii-carrying animals because of the lack of identifiable features. Conventional serodiagnosis requires sera from the acute and convalescent stages of infection, which are unavailable at early diagnosis. Nested PCR and real-time PCR require equipment. In this study, we developed a Loop-Mediated Isothermal Amplification (LAMP assay to identify C. burnetii rapidly and sensitively. METHODS: A universal LAMP primer set was designed to detect the repeated sequence IS1111a of the htpAB gene of C. burnetii using PrimerExplorer V4 software. The sensitivity of the LAMP assay was evaluated using known quantities of recombined reference plasmids containing the targeted genes. The specificity of the developed LAMP assay was determined using 26 members of order Rickettsiae and 18 other common pathogens. The utility of the LAMP assay was further compared with real time PCR by the examination 24 blood samples including 6 confirmed and 18 probable Q fever cases, which diagnosed by IFA serological assessment and real time PCR. In addition, 126 animal samples from 4 provinces including 97 goats, 7 cattle, 18 horses, 3 marmots and 1 deer were compared by these two methods. RESULTS: The limits of detection of the LAMP assay for the htpAB gene were 1 copy per reaction. The specificity of the LAMP assay was 100%, and no cross-reaction was observed among the bacteria used in the study. The positive rate of unknown febrile patients was 33.3%(95%CI 30.2%-36.4% for the LAMP assay and 8.3%(95%CI 7.4%-9.2% for the real time PCR(P<0.05. Similarly, the total positive rate of animals was 7.9%(95%CI 7.1%-8.7% for the LAMP assay and 0.8%(95%CI 0.7%-0.9%for the real time

  8. CAFE: an R package for the detection of gross chromosomal abnormalities from gene expression microarray data.

    Science.gov (United States)

    Bollen, Sander; Leddin, Mathias; Andrade-Navarro, Miguel A; Mah, Nancy

    2014-05-15

    The current methods available to detect chromosomal abnormalities from DNA microarray expression data are cumbersome and inflexible. CAFE has been developed to alleviate these issues. It is implemented as an R package that analyzes Affymetrix *.CEL files and comes with flexible plotting functions, easing visualization of chromosomal abnormalities. CAFE is available from https://bitbucket.org/cob87icW6z/cafe/ as both source and compiled packages for Linux and Windows. It is released under the GPL version 3 license. CAFE will also be freely available from Bioconductor. sander.h.bollen@gmail.com or nancy.mah@mdc-berlin.de Supplementary data are available at Bioinformatics online.

  9. Detection of coding genes for enterotoxins in Bacillus cereus by PCR and their products by BCET-RPLA and ELISA Assay

    Directory of Open Access Journals (Sweden)

    Marcela Vyletělová

    2010-01-01

    Full Text Available Determination of enterotoxin production, diarrhoeal and emetic gene identification was studied in 41 Bacillus cereus strains isolated from raw cows’ and raw goats’ milk, pasteurized milk, dairy products during technological processing and from dairy plant equipment. Presence of enterotoxins was detected by BCET-RPLA (HBL and ELISA immunoassay (NHE. Gene identification (nheA, nheB, nheC, hblA, hblC, hblD, bceT, cytK-1, cytK-2, entFM and ces was achieved by means of PCR. Enterotoxin HBL was detected in 32 strains, enterotoxin NHE in all 41 strains. Presence of all three genes nheA, nheB and nheC was confirmed in 40 strains and genes hblA, hblC and hblD in 29 strains. Comparison of used methods was as follow: 1 BCET-RPLA (which detects L2 component and PCR (positive or negative all three hblA, hblC and hblD gene detection were identical in 30 (73%; 2 ELISA (NheA and PCR (all three nheC, nheB and nheA gene expression were identical in 40 (98% cases isolated strains.

  10. Study of mitochondria D-loop gene to detect the heterogeneity of gemak in Turnicidae family

    Science.gov (United States)

    Setiati, N.; Partaya

    2018-03-01

    As a part of life biodiversity, birds in Turnicidae family should be preserved from the extinction and its type heterogeneity decline. One effort for giving the strategic base of plasma nutfah conservation is through genetic heterogeneity study. The aim of the research is to analyze D-loop gen from DNA mitochondria of gemak bird in Turnicidae family molecularly. From the result of the analysis, it may be known the genetic heterogeneity of gemak bird based on the sequence of D-loop gen. The collection of both types of gemak of Turnicidae family is still easy since we can find them in ricefield area after harvest particularly for Gemakloreng (Turnix sylvatica), it means while gemak tegalan (Turnixsusciator) is getting difficult to find. Based on the above DNA quantification standard, the blood sample of Gemak in this research is mostly grouped into pure blood (ranges from 1,63 – 1,90), and it deserves to be used for PCR analysis. The sequencing analysis has not detected the sequence of nucleotide completely. However, it indicates sequence polymorphism of base as the arranger of D-loop gen. D-loop gen may identify genetic heterogeneity of gemak bird of Turnicidae family, but it is necessary to perform further sequencing analysis with PCR-RFLP technique. This complete nucleotide sequence is obtained and easy to detect after being cut restriction enzyme.

  11. Detection of Integrase Gene in E. coli Isolated from Pigs at Different Stages of Production System

    Directory of Open Access Journals (Sweden)

    Eulalia de la Torre

    2014-01-01

    Full Text Available Integrons are one of the genetic elements involved in the acquisition of antibiotic resistance. The aim of the present research is to investigate the presence of integrons in commensal Escherichia coli (E. coli strains, isolated from pigs at different stages of production system and from the environment in an Argentinian farm. Five sows postpartum and five randomly chosen piglets from each litter were sampled by rectal swabs. They were sampled again at day 21 and at day 70. Environmental samples from the farm were also obtained. E. coli containing any integron class or combination of both integrons was detected by polymerase chain reaction in 100% of sows and in piglets at different stages of production: farrowing pen stage 68.1%;, weaning 60%, and growing/finishing 85.8%, showing an increase along the production system. From environmental samples 78.4% of E. coli containing any integron class was detected. We conclude that animals and farm environment can act as reservoirs for potential spread of resistant bacteria by means of mobile genetic elements as integrons, which has a major impact on production of food animals and that can reach man through the food chain, constituting a problem for public health.

  12. Identification of pyrG Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus ostreatus.

    Science.gov (United States)

    Zheng, Shi; Shan, Luying; Zhuang, Yongliang; Shang, Ying

    2018-03-01

    As a well-known edible fungus rich in nutrients, Pleurotus ostreatus has been used as an alternative to expensive wild edible fungi. Specifically, the fact that using P. ostreatus instead of other expensive wild edible fungi has damaged the rights and interests of consumers. Among the existing methods for detection of food adulteration, the amplification of endogenous reference gene is the most accurate method. However, an ideal endogenous reference gene for P. ostreatus has yet to be developed. In this study, a DNA extraction method for P. ostreatus was optimized, and pyrG was selected as a species-specific gene through sequence alignment. This gene was subsequently subjected to qualitative and quantitative Polymerase Chain Reaction (PCR) assays with 3 different P. ostreatus varieties and 7 other species. A low detection limit of 5 pg/μL was obtained by TaqMan quantitative PCR, and no pyrG amplification product was observed in the 7 other species. No allelic variation was detected in P. ostreatus varieties. These experiments confirmed that pyrG was an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus. This method was also suitable for the examination of processed P. ostreatus samples and determination of adulteration in wild mushrooms. The pyrG gene was chosen as an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus, and the detection limit was 5 pg/μL for the quantification. This method is used not only for raw materials but also for processed P. ostreatus products and other processed mushroom foods. © 2018 Institute of Food Technologists®.

  13. Detection of denitrification genes by in situ rolling circle amplification - fluorescence in situ hybridization (in situ RCA-FISH) to link metabolic potential with identity inside bacterial cells

    DEFF Research Database (Denmark)

    Hoshino, Tatsuhiko; Schramm, Andreas

    2010-01-01

    target site. Finally, the RCA product inside the cells was detected by standard fluorescence in situ hybridization (FISH). The optimized protocol showed high specificity and signal-to-noise ratio but low detection frequency (up to 15% for single-copy genes and up to 43% for the multi-copy 16S rRNA gene...... as Candidatus Accumulibacter phosphatis by combining in situ RCA-FISH with 16S rRNA-targeted FISH. While not suitable for quantification because of its low detection frequency, in situ RCA-FISH will allow to link metabolic potential with 16S rRNA (gene)-based identification of single microbial cells.......). Nevertheless, multiple genes (nirS and nosZ; nirS and the 16S rRNA gene) could be detected simultaneously in P. stutzeri. Environmental application of in situ RCA-FISH was demonstrated on activated sludge by the differential detection of two types of nirS-defined denitrifiers; one of them was identified...

  14. Detection of thalassemia genes using smeared blood film or leukocytes adhering to polysthylene fibers.

    Science.gov (United States)

    Tatsumi, N; Yokota, M; Shindoh, K; Funahara, Y; Nathalang, O; Sukpanichnant, S; Bunyaratvej, A; Fucharoen, S

    1997-01-01

    Presently genetic analyses for thalassemia types require relatively large amounts of heparinized blood (5 to 10 ml), and transport as well as degeneration of these sample is a problem in the developing world. We have developed a new method to simplify this procedure and obtain DNAs from small specimens. As experimental materials, thinly smeared blood on a glass slide or blood filtered with and adhered on polysthylene telephtalate (PST) fibers were used. These materials could be safely stored without interfering with DNA extraction for up to 3 months. The slide materials were digested with proteinase K, and DNA was extracted with Tris-EDTA-phenol:chloroform and precipitated with absolute ethanol. The PST specimens were washed with physiologic saline and treated in the same manner as described above. Products were easily amplified by PCR and digested with restriction endonucleases for beta thalassemia typing as well as for HLA-DQA1 gene typing. Results obtained by this method correlated well with previously reported incidences for thalassemia and HLA-DQA1 types in Thailand. This method can be used in the routine laboratory because it allows for stable and biosafe genetic analyses.

  15. Bacteriological water quality in school's drinking fountains and detection antibiotic resistance genes.

    Science.gov (United States)

    Gomes Freitas, Denize; Silva, Rassan Dyego Romão; Bataus, Luis Artur Mendes; Barbosa, Mônica Santiago; da Silva Bitencourt Braga, Carla Afonso; Carneiro, Lilian Carla

    2017-02-08

    The fecal coliform can contaminate water of human consumption causing problems to public health. Many of these microorganisms may contain plasmid and transfer them to other bacteria. This genetic material may confer selective advantages, among them resistance to antibiotics. The objectives of this study were to analyze the presence of fecal coliforms in water and at drinker surface, to identify the existence of plasmid, conducting studies of resistance to antibiotics, plasmid stability and capacity of bacterial conjugation. Were collected microorganisms in water of drinker surface and were used specific culture media and biochemical tests for identification of organisms, tests were performed by checking the resistance to antibiotics (ampicillin 10 μg, tetracycline 30 μg, and ciprofloxacin 5 μg), was performed extraction of plasmid DNA, plasmid stability and bacterial conjugation. Was obtained results of 31% of Salmonella spp. and 51% for other coliforms. Among the samples positive for coliforms, 27 had plasmid stable and with the ability to perform conjugation. The plasmids had similar forms, suggesting that the resistance in some bacteria may be linked to those genes extra chromosomal.

  16. A seminested PCR assay for detection and typing of human papillomavirus based on E1 gene sequences.

    Science.gov (United States)

    Cavalcante, Gustavo Henrique O; de Araújo, Josélio M G; Fernandes, José Veríssimo; Lanza, Daniel C F

    2018-05-01

    HPV infection is considered one of the leading causes of cervical cancer in the world. To date, more than 180 types of HPV have been described and viral typing is critical for defining the prognosis of cancer. In this work, a seminested PCR which allow fast and inexpensively detection and typing of HPV is presented. The system is based on the amplification of a variable length region within the viral gene E1, using three primers that potentially anneal in all HPV genomes. The amplicons produced in the first step can be identified by high resolution electrophoresis or direct sequencing. The seminested step includes nine specific primers which can be used in multiplex or individual reactions to discriminate the main types of HPV by amplicon size differentiation using agarose electrophoresis, reducing the time spent and cost per analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Pathway Detection from Protein Interaction Networks and Gene Expression Data Using Color-Coding Methods and A* Search Algorithms

    Directory of Open Access Journals (Sweden)

    Cheng-Yu Yeh

    2012-01-01

    Full Text Available With the large availability of protein interaction networks and microarray data supported, to identify the linear paths that have biological significance in search of a potential pathway is a challenge issue. We proposed a color-coding method based on the characteristics of biological network topology and applied heuristic search to speed up color-coding method. In the experiments, we tested our methods by applying to two datasets: yeast and human prostate cancer networks and gene expression data set. The comparisons of our method with other existing methods on known yeast MAPK pathways in terms of precision and recall show that we can find maximum number of the proteins and perform comparably well. On the other hand, our method is more efficient than previous ones and detects the paths of length 10 within 40 seconds using CPU Intel 1.73GHz and 1GB main memory running under windows operating system.

  18. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

    Science.gov (United States)

    Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

    2014-08-01

    A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Detection of the E7 transform gene of human papilloma virus type 16 in human oral squamous cell carcinoma.

    Science.gov (United States)

    Wang, J; Li, J; Huang, H; Fu, Y

    1998-12-01

    To determine, with the use of polymerase chain reaction, the prevalence of human papillomavirus (HPV) 16 in 30 patients with primary oral squamous cell carcinoma (OSCC) and 30 healthy control patients. DNA was extracted from freshly frozen tumor tissues of 30 patients with primary oral squamous cell carcinoma and from the oral mucosa of 30 controls. A pair of specific primers of the E7 early gene of HPV 16 were designed. PCR products were run by 1.5% agarose gel and the results of electrophoresis were photographed. HPV 16 was detected in 36.7% (11/30) of oral squamous cell carcinoma patients and 11.1% (4/30) of controls. HPV 16 has a significant association with oral squamous cell carcinoma. However, the role HPV 16 plays in the tumorigenesis of oral cancer and its clinical significance remain to be investigated.

  20. Sensitive detection of proteasomal activation using the Deg-On mammalian synthetic gene circuit.

    Science.gov (United States)

    Zhao, Wenting; Bonem, Matthew; McWhite, Claire; Silberg, Jonathan J; Segatori, Laura

    2014-04-08

    The ubiquitin proteasome system (UPS) has emerged as a drug target for diverse diseases characterized by altered proteostasis, but pharmacological agents that enhance UPS activity have been challenging to establish. Here we report the Deg-On system, a genetic inverter that translates proteasomal degradation of the transcriptional regulator TetR into a fluorescent signal, thereby linking UPS activity to an easily detectable output, which can be tuned using tetracycline. We demonstrate that this circuit responds to modulation of UPS activity in cell culture arising from the inhibitor MG-132 and activator PA28γ. Guided by predictive modelling, we enhanced the circuit's signal sensitivity and dynamic range by introducing a feedback loop that enables self-amplification of TetR. By linking UPS activity to a simple and tunable fluorescence output, these genetic inverters will enable a variety of applications, including screening for UPS activating molecules and selecting for mammalian cells with different levels of proteasome activity.

  1. Detection of macrolide resistance genes in culture-negative specimens from Bangladeshi children with invasive pneumococcal diseases.

    Science.gov (United States)

    Hasanuzzaman, Md; Malaker, Roly; Islam, Maksuda; Baqui, Abdullah H; Darmstadt, Gary L; Whitney, Cynthia G; Saha, Samir K

    2017-03-01

    In recent years, an increasing prevalence of macrolide resistance among pneumococci in Bangladesh has been observed. However, the scenario remains incomplete, as few isolates (80%) are culture-negative. This study optimised a triplex PCR method to detect macrolide resistance genes (MRGs) (mefA and ermB) and cpsA from culture-negative pneumococcal cases to predict the prevalence and level of macrolide resistance. The presence of MRGs among pneumococcal strains (n=153) with a wide range of erythromycin MICs (culture-negative clinical specimens and corresponding isolates. The known impact of the presence of specific MRG(s) on MICs of strains was used to predict the MICs of non-culturable strains based on the presence/absence of MRG(s) in the specimens. None of the erythromycin-susceptible isolates possessed any of the MRGs, and all non-susceptible strains had ≥1 MRG. MICs were 2-16mg/L and ≥256mg/L for 93% of strains with mefA and ermB, respectively, whereas 100% of isolates with both genes had MICs≥256mg/L. PCR for body fluids showed 100% concordance with corresponding isolates when tested for MRG(s) in parallel. Erythromycin MICs can be predicted for non-culturable strains with 93-100% precision based on detection of ermB and/or mefA. This method will be useful for establishing comprehensive surveillance for macrolide resistance among pneumococci, specifically in the population with prior antibiotic use. Copyright © 2017. Published by Elsevier Ltd.

  2. A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.

    Science.gov (United States)

    Sinigaglia, Chiara; Thiel, Daniel; Hejnol, Andreas; Houliston, Evelyn; Leclère, Lucas

    2018-02-01

    In situ hybridization is a widely employed technique allowing spatial visualization of gene expression in fixed specimens. It has greatly advanced our understanding of biological processes, including developmental regulation. In situ protocols are today routinely followed in numerous laboratories, and although details might change, they all include a hybridization step, where specific antisense RNA or DNA probes anneal to the target nucleic acid sequence. This step is generally carried out at high temperatures and in a denaturing solution, called hybridization buffer, commonly containing 50% (v/v) formamide - a hazardous chemical. When applied to the soft-bodied hydrozoan medusa Clytia hemisphaerica, we found that this traditional hybridization approach was not fully satisfactory, causing extensive deterioration of morphology and tissue texture which compromised our observation and interpretation of results. We thus tested alternative solutions for in situ detection of gene expression and, inspired by optimized protocols for Northern and Southern blot analysis, we substituted the 50% formamide with an equal volume of 8M urea solution in the hybridization buffer. Our new protocol not only yielded better morphologies and tissue consistency, but also notably improved the resolution of the signal, allowing more precise localization of gene expression and reducing aspecific staining associated with problematic areas. Given the improved results and reduced manipulation risks, we tested the urea protocol on other metazoans, two brachiopod species (Novocrania anomala and Terebratalia transversa) and the priapulid worm Priapulus caudatus, obtaining a similar reduction of aspecific probe binding. Overall, substitution of formamide by urea during in situ hybridization offers a safer alternative, potentially of widespread use in research, medical and teaching contexts. We encourage other workers to test this approach on their study organisms, and hope that they will also

  3. Detection of the Light Organ Symbiont, Vibrio fischeri, in Hawaiian Seawater by Using lux Gene Probes †

    Science.gov (United States)

    Lee, Kyu-Ho; Ruby, Edward G.

    1992-01-01

    Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both luminous and non-visibly luminous V. fischeri colonies by DNA-DNA hybridization. The probes were specific, hybridizing at least 50 to 100 times more strongly to immobilized DNAs from V. fischeri strains than to those of pure cultures of other related species. Thus, even non-visibly luminous V. fischeri colonies could be identified among colonies obtained from natural seawater samples by their probe-positive reaction. Bacteria in seawater samples, obtained either within or distant from squid habitats, were collected on membrane filters and incubated until colonies appeared. The filters were then observed for visibly luminous V. fischeri colonies and hybridized with the lux gene probes to determine the number of total V. fischeri colonies (both luminous and non-visibly luminous). We detected no significant differences in the abundance of luminous V. fischeri CFU in any of the water samples observed (≤1 to 3 CFU/100 ml). However, probe-positive colonies of V. fischeri (up to 900 CFU/100 ml) were found only in seawater collected from within the natural habitats of the squids. A number of criteria were used to confirm that these probe-positive strains were indistinguishable from symbiotic V. fischeri. Therefore, the luxA and luxR gene probes were species specific and gave a reliable estimate of the number of culturable V. fischeri colonies in natural water samples. Images PMID:16348678

  4. Detection of MYCN Gene Amplification in Neuroblastoma by Fluorescence In Situ Hybridization: A Pediatric Oncology Group Study

    Directory of Open Access Journals (Sweden)

    Prasad Mathew

    2001-01-01

    Full Text Available To assess the utility of fluorescence in situ hybridization (FISH for analysis of MYCN gene amplification in neuroblastoma, we compared this assay with Southern blot analysis using tumor specimens collected from 232 patients with presenting characteristics typical of this disease. The FISH technique identified MYCN amplification in 47 cases, compared with 39 by Southern blotting, thus increasing the total number of positive cases by 21%. The major cause of discordancy was a low fraction of tumor cells (≤30% replacement in clinical specimens, which prevented an accurate estimate of MYCN copy number by Southern blotting. With FISH, by contrast, it was possible to analyze multiple interphase nuclei of tumor cells, regardless of the proportion of normal peripheral blood, bone marrow, or stromal cells in clinical samples. Thus, FISH could be performed accurately with very small numbers of tumor cells from touch preparations of needle biopsies. Moreover, this procedure allowed us to discern the heterogeneous pattern of MYCN amplification that is characteristic of neuroblastoma. We conclude that FISH improves the detection of MYCN gene amplification in childhood neuroblastomas in a clinical setting, thus facilitating therapeutic decisions based on the presence or absence of this prognostically important biologic marker.

  5. Hypermethylated ZNF582 and PAX1 genes in mouth rinse samples as biomarkers for oral dysplasia and oral cancer detection.

    Science.gov (United States)

    Cheng, Shih-Jung; Chang, Chi-Feng; Ko, Hui-Hsin; Lee, Jang-Jaer; Chen, Hsin-Ming; Wang, Huei-Jen; Lin, Hsiao-Shan; Chiang, Chun-Pin

    2018-02-01

    Effective biomarkers for oral cancer screening are important for early diagnosis and treatment of oral cancer. Oral epithelial cell samples collected by mouth rinse were obtained from 65 normal control subjects, 108 patients with oral potentially malignant disorders, and 94 patients with oral squamous cell carcinoma (OSCC). Methylation levels of zinc-finger protein 582 (ZNF582) and paired-box 1 (PAX1) genes were quantified by real-time methylation-specific polymerase chain reaction after bisulfite conversion. An abrupt increase in methylated ZNF582 (ZNF582 m ) and PAX1 (PAX1 m ) levels and positive rates from mild dysplasia to moderate/severe dysplasia, indicating that both ZNF582 m and PAX1 m are effective biomarkers for differentiating moderate dysplasia or worse (MODY+) oral lesions. When ZNF582 m /PAX1 m tests were used for identifying MODY+ oral lesions, the sensitivity, specificity, and odds ratio (OR) were 0.65/0.64, 0.75/0.82, and 5.6/8.0, respectively. Hypermethylated ZNF582 and PAX1 genes in oral epithelial cells collected by mouth rinse are effective biomarkers for the detection of oral dysplasia and oral cancer. © 2017 Wiley Periodicals, Inc.

  6. Detection of Ampicillin Resistance Genes (bla in Clinical Isolates of Escherichia coli with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda

    2014-09-01

    Full Text Available Escherichia coli is a rod negative Gram which could be pathogenic, if its value increases or located in outer gastrointestinal tract. Pathogenic E. coli will produce enterotoxin which will cause diarrhoea or infection in urine tract. Ampicilin was one of particular antibiotics to overcome infection. Ampicilin nowadays is no longer used as primary medicine, because of its resistance case. The aim of this research is to detect the presence of gene which is responsible to ampicilin resistant E. coli. We used isolated midstream urine from cystitis object in Hasan Sadikin Hospital (RSHS as samples. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were done to invenstigate the antibiotic resistency. Based on the result of antibiotic susceptibility testing to ampicillin, E. coli samples were resistant to ampicilin. Elektroforegram products of colony-PCR and DNA-PCR showed that the resistance case of ampicilin caused by bla gene (199 bp. Selective and rational antibiotic treatment is required to prevent ampicillin resistance in patients with symptoms

  7. Quantitative Detection of ID4 Gene Aberrant Methylation in the Differentiation of Myelodysplastic Syndrome from Aplastic Anemia

    Directory of Open Access Journals (Sweden)

    Mian-Yang Li

    2015-01-01

    Full Text Available Background: The diagnosis of myelodysplastic syndrome (MDS, especially hypoplastic MDS, and MDS with low blast counts or normal karyotype may be problematic. This study characterized ID4 gene methylation in patients with MDS and aplastic anemia (AA. Methods: The methylation status of ID4 was analyzed by bisulfite sequencing polymerase chain reaction (PCR and quantitative real-time methylation-specific PCR (MethyLight PCR in 100 patients with MDS and 31 patients with AA. Results: The MDS group had a higher ID4 gene methylation positivity rate (22.22% and higher methylation levels (0.21 [0-3.79] than the AA group (P < 0.05. Furthermore, there were significant differences between the hypoplastic MDS and AA groups, the MDS with low blast count and the AA groups, and the MDS with normal karyotype and the AA groups. The combination of genetic and epigenetic markers was used in much more patients with MDS (62.5% [35/56] than the use of genetic markers only (51.79% [29/56]. Conclusions: These results showed that the detection of ID4 methylation positivity rates and levels could be a useful biomarker for MDS diagnosis.

  8. Assessment of a six gene panel for the molecular detection of circulating tumor cells in the blood of female cancer patients

    International Nuclear Information System (INIS)

    Obermayr, Eva; Heinze, Georg; Tong, Dan; Zeillinger, Robert; Sanchez-Cabo, Fatima; Tea, Muy-Kheng M; Singer, Christian F; Krainer, Michael; Fischer, Michael B; Sehouli, Jalid; Reinthaller, Alexander; Horvat, Reinhard

    2010-01-01

    The presence of circulating tumor cells (CTC) in the peripheral blood of cancer patients has been described for various solid tumors and their clinical relevance has been shown. CTC detection based on the analysis of epithelial antigens might be hampered by the genetic heterogeneity of the primary tumor and loss of epithelial antigens. Therefore, we aimed to identify new gene markers for the PCR-based detection of CTC in female cancer patients. Gene expression of 38 cancer cell lines (breast, ovarian, cervical and endometrial) and of 10 peripheral blood mononuclear cell (PBMC) samples from healthy female donors was measured using microarray technology (Applied Biosystems). Differentially expressed genes were identified using the maxT test and the 50% one-sided trimmed maxT-test. Confirmatory RT-qPCR was performed for 380 gene targets using the AB TaqMan ® Low Density Arrays. Then, 93 gene targets were analyzed using the same RT-qPCR platform in tumor tissues of 126 patients with primary breast, ovarian or endometrial cancer. Finally, blood samples from 26 healthy women and from 125 patients (primary breast, ovarian, cervical, or endometrial cancer, and advanced breast cancer) were analyzed following OncoQuick enrichment and RNA pre-amplification. Likewise, hMAM and EpCAM gene expression was analyzed in the blood of breast and ovarian cancer patients. For each gene, a cut-off threshold value was set at three standard deviations from the mean expression level of the healthy controls to identify potential markers for CTC detection. Six genes were over-expressed in blood samples from 81% of patients with advanced and 29% of patients with primary breast cancer. EpCAM gene expression was detected in 19% and 5% of patients, respectively, whereas hMAM gene expression was observed in the advanced group (39%) only. Multimarker analysis using the new six gene panel positively identified 44% of the cervical, 64% of the endometrial and 19% of the ovarian cancer patients. The

  9. Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

    Science.gov (United States)

    Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

    2010-01-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

  10. Development of a Real-Time Resistance Measurement for Vibrio parahaemolyticus Detection by the Lecithin-Dependent Hemolysin Gene

    Science.gov (United States)

    Xiang, Guiming; Pu, Xiaoyun; Jiang, Dongneng; Liu, Linlin; Liu, Chang; Liu, Xiaobo

    2013-01-01

    The marine bacterium Vibrio parahaemolyticus (V. parahaemolyticus) causes gastroenteritis in humans via the ingestion of raw or undercooked contaminated seafood, and early diagnosis and prompt treatment are important for the prevention of V. parahaemolyticus-related diseases. In this study, a real-time resistance measurement based on loop-mediated isothermal amplification (LAMP), electrochemical ion bonding (Crystal violet and Mg2+), real-time monitoring, and derivative analysis was developed. V. parahaemolyticus DNA was first amplified by LAMP, and the products (DNA and pyrophosphate) represented two types of negative ions that could combine with a positive dye (Crystal violet) and positive ions (Mg2+) to increase the resistance of the reaction liquid. This resistance was measured in real-time using a specially designed resistance electrode, thus permitting the quantitative detection of V. parahaemolyticus. The results were obtained in 1–2 hours, with a minimum bacterial density of 10 CFU.mL−1 and high levels of accuracy (97%), sensitivity (96.08%), and specificity (97.96%) when compared to cultivation methods. Therefore, this simple and rapid method has a potential application in the detection of V. parahaemolyticus on a gene chip or in point-of-care testing. PMID:23991096

  11. KRAS mutation detection in colorectal cancer by a commercially available gene chip array compares well with Sanger sequencing.

    Science.gov (United States)

    French, Deborah; Smith, Andrew; Powers, Martin P; Wu, Alan H B

    2011-08-17

    Binding of a ligand to the epidermal growth factor receptor (EGFR) stimulates various intracellular signaling pathways resulting in cell cycle progression, proliferation, angiogenesis and apoptosis inhibition. KRAS is involved in signaling pathways including RAF/MAPK and PI3K and mutations in this gene result in constitutive activation of these pathways, independent of EGFR activation. Seven mutations in codons 12 and 13 of KRAS comprise around 95% of the observed human mutations, rendering monoclonal antibodies against EGFR (e.g. cetuximab and panitumumab) useless in treatment of colorectal cancer. KRAS mutation testing by two different methodologies was compared; Sanger sequencing and AutoGenomics INFINITI® assay, on DNA extracted from colorectal cancers. Out of 29 colorectal tumor samples tested, 28 were concordant between the two methodologies for the KRAS mutations that were detected in both assays with the INFINITI® assay detecting a mutation in one sample that was indeterminate by Sanger sequencing and a third methodology; single nucleotide primer extension. This study indicates the utility of the AutoGenomics INFINITI® methodology in a clinical laboratory setting where technical expertise or access to equipment for DNA sequencing does not exist. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Optical and electrochemical detection of a verotoxigenic E. coli gene using DNAzyme-labeled stem-loops

    Directory of Open Access Journals (Sweden)

    Gloria Longinotti

    2017-12-01

    Full Text Available The activity of a peroxidase-mimicking DNAzyme was optimized to be used as a catalytic label in a stem-loop genosensor construction for quantifying the gene sequence Shiga-like toxin I of verotoxigenic E. coli. Experimental conditions such as pH, buffer composition, potassium ion concentration, and hemin-to-oligonucleotides ratio, were analyzed to maximize optical and electrochemical responses using microvolumes. Different stem-loop constructions were evaluated to obtain the optimum response against the target concentration. Linear ranges of 0.05-0.5 µM and limits of detection of 174 nM and 144 nM were estimated for the optical and electrochemical measurements, respectively. Selectivity was proved by assaying other verotoxigenic, enterotoxigenic and enteroinvasive sequences. The results show that, if a combination of small-volume electrochemical cells and low-cost untreated screen-printed electrodes with a relatively high geometric area is used, electrochemical measurements present similar sensitivity and limits of detection to the more usual optical ones, allowing the development of low-cost electrochemical biosensors based on the use of soluble DNAzymes as labels.

  13. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  14. The utility of optical detection system (qPCR) and bioinformatics methods in reference gene expression analysis

    Science.gov (United States)

    Skarzyńska, Agnieszka; Pawełkowicz, Magdalena; PlÄ der, Wojciech; Przybecki, Zbigniew

    2016-09-01

    Real-time quantitative polymerase chain reaction is consider as the most reliable method for gene expression studies. However, the expression of target gene could be misinterpreted due to improper normalization. Therefore, the crucial step for analysing of qPCR data is selection of suitable reference genes, which should be validated experimentally. In order to choice the gene with stable expression in the designed experiment, we performed reference gene expression analysis. In this study genes described in the literature and novel genes predicted as control genes, based on the in silico analysis of transcriptome data were used. Analysis with geNorm and NormFinder algorithms allow to create the ranking of candidate genes and indicate the best reference for flower morphogenesis study. According to the results, genes CACS and CYCL were characterised the most stable expression, but the least suitable genes were TUA and EF.

  15. Multiplex real-time PCR assay for the detection of extended-spectrum β-lactamase and carbapenemase genes using melting curve analysis.

    Science.gov (United States)

    Singh, Prashant; Pfeifer, Yvonne; Mustapha, Azlin

    2016-05-01

    Real-time PCR melt curve assays for the detection of β-lactamase, extended-spectrum β-lactamase and carbapenemase genes in Gram-negative bacteria were developed. Two multiplex real-time PCR melt curve assays were developed for the detection of ten common β-lactamase genes: blaKPC-like, blaOXA-48-like, blaNDM-like, blaVIM-like, blaIMP-like, blaCTX-M-1+2-group, blaCMY-like, blaACC-like, blaSHV-like and blaTEM-like. The assays were evaluated using 25 bacterial strains and 31 DNA samples (total n=56) comprising different Enterobacteriaceae genera and Pseudomonas spp. These strains were previously characterized at five research institutes. Each resistance gene targeted in this study generated a non-overlapping and distinct melt curve peak. The assay worked effectively and detected the presence of additional resistance genes in 23 samples. The assays developed in this study offer a simple, low cost method for the detection of prevalent β-lactamase, ESBL and carbapenemase genes among Gram-negative pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Phenotypic and molecular detection of BLACTX-M gene extended-spectrum beta-lactamases in escherichia coli and klebsiella pneumoniae of north sumatera isolates

    Science.gov (United States)

    Hasibuan, Mirzan; Suryanto, Dwi; Lia Kusumawati, R.

    2018-03-01

    The application of antibiotics expanded-spectrum third-generation cephalosporin for the treatment of infectious diseases in hospitals is known contribute to increasing resistance due to the presence of the blaCTX-M gene in the bacteria producing ESBLs. This study was aimed to detect ESBLs, isolate phenotype and blaCTX-M genes on Escherichia coli and Klebsiella pneumoniae collected from H. Adam Malik Central Hospital. Phenotypes of the bacterial were detection using Vitek two compact, while the blaCTX-M genes were detection using polymerase chain reaction technique. The results showed that 85 (100%) isolates were ESBLs consisted of 41(48%) of Escherichia coli, and 44 (52%) of Klebsiella pneumoniae, respectively. blaCTX-M genes were detection in 62 (72.94%) of the isolates which 31 (36.47%) were Escherichia coli, and 31 (36.47%) of the isolates were Klebsiella pneumoniae, respectively. This study indicates the high prevalence of blaCTX-M genes in Escherichia coli and Klebsiella pneumoniea causing bacterial antibiotic resistance.

  17. Analytical Performance Characteristics of the Cepheid GeneXpert Ebola Assay for the Detection of Ebola Virus

    Science.gov (United States)

    Pinsky, Benjamin A.; Sahoo, Malaya K.; Sandlund, Johanna; Kleman, Marika; Kulkarni, Medha; Grufman, Per; Nygren, Malin; Kwiatkowski, Robert; Baron, Ellen Jo; Tenover, Fred; Denison, Blake; Higuchi, Russell; Van Atta, Reuel; Beer, Neil Reginald; Carrillo, Alda Celena; Naraghi-Arani, Pejman; Mire, Chad E.; Ranadheera, Charlene; Grolla, Allen; Lagerqvist, Nina; Persing, David H.

    2015-01-01

    Background The recently developed Xpert® Ebola Assay is a novel nucleic acid amplification test for simplified detection of Ebola virus (EBOV) in whole blood and buccal swab samples. The assay targets sequences in two EBOV genes, lowering the risk for new variants to escape detection in the test. The objective of this report is to present analytical characteristics of the Xpert® Ebola Assay on whole blood samples. Methods and Findings This study evaluated the assay’s analytical sensitivity, analytical specificity, inclusivity and exclusivity performance in whole blood specimens. EBOV RNA, inactivated EBOV, and infectious EBOV were used as targets. The dynamic range of the assay, the inactivation of virus, and specimen stability were also evaluated. The lower limit of detection (LoD) for the assay using inactivated virus was estimated to be 73 copies/mL (95% CI: 51–97 copies/mL). The LoD for infectious virus was estimated to be 1 plaque-forming unit/mL, and for RNA to be 232 copies/mL (95% CI 163–302 copies/mL). The assay correctly identified five different Ebola viruses, Yambuku-Mayinga, Makona-C07, Yambuku-Ecran, Gabon-Ilembe, and Kikwit-956210, and correctly excluded all non-EBOV isolates tested. The conditions used by Xpert® Ebola for inactivation of infectious virus reduced EBOV titer by ≥6 logs. Conclusion In summary, we found the Xpert® Ebola Assay to have high analytical sensitivity and specificity for the detection of EBOV in whole blood. It offers ease of use, fast turnaround time, and remote monitoring. The test has an efficient viral inactivation protocol, fulfills inclusivity and exclusivity criteria, and has specimen stability characteristics consistent with the need for decentralized testing. The simplicity of the assay should enable testing in a wide variety of laboratory settings, including remote laboratories that are not capable of performing highly complex nucleic acid amplification tests, and during outbreaks where time to detection

  18. Development of RNA-FISH Assay for Detection of Oncogenic FGFR3-TACC3 Fusion Genes in FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Masahiro Kurobe

    Full Text Available Oncogenic FGFR3-TACC3 fusions and FGFR3 mutations are target candidates for small molecule inhibitors in bladder cancer (BC. Because FGFR3 and TACC3 genes are located very closely on chromosome 4p16.3, detection of the fusion by DNA-FISH (fluorescent in situ hybridization is not a feasible option. In this study, we developed a novel RNA-FISH assay using branched DNA probe to detect FGFR3-TACC3 fusions in formaldehyde-fixed paraffin-embedded (FFPE human BC samples.The RNA-FISH assay was developed and validated using a mouse xenograft model with human BC cell lines. Next, we assessed the consistency of the RNA-FISH assay using 104 human BC samples. In this study, primary BC tissues were stored as frozen and FFPE tissues. FGFR3-TACC3 fusions were independently detected in FFPE sections by the RNA-FISH assay and in frozen tissues by RT-PCR. We also analyzed the presence of FGFR3 mutations by targeted sequencing of genomic DNA extracted from deparaffinized FFPE sections.FGFR3-TACC3 fusion transcripts were identified by RNA-FISH and RT-PCR in mouse xenograft FFPE tissues using the human BC cell lines RT112 and RT4. These cell lines have been reported to be fusion-positive. Signals for FGFR3-TACC3 fusions by RNA-FISH were positive in 2/60 (3% of non-muscle-invasive BC (NMIBC and 2/44 (5% muscle-invasive BC (MIBC patients. The results of RT-PCR of all 104 patients were identical to those of RNA-FISH. FGFR3 mutations were detected in 27/60 (45% NMIBC and 8/44 (18% MIBC patients. Except for one NMIBC patient, FGFR3 mutation and FGFR3-TACC3 fusion were mutually exclusive.We developed an RNA-FISH assay for detection of the FGFR3-TACC3 fusion in FFPE samples of human BC tissues. Screening for not only FGFR3 mutations, but also for FGFR3-TACC3 fusion transcripts has the potential to identify additional patients that can be treated with FGFR inhibitors.

  19. Rapid detection of SNP (c.309T>G in the MDM2 gene by the Duplex SmartAmp method.

    Directory of Open Access Journals (Sweden)

    Yasuaki Enokida

    Full Text Available BACKGROUND: Genetic polymorphisms in the human MDM2 gene are suggested to be a tumor susceptibility marker and a prognostic factor for cancer. It has been reported that a single nucleotide polymorphism (SNP c.309T>G in the MDM2 gene attenuates the tumor suppressor activity of p53 and accelerates tumor formation in humans. METHODOLOGY: In this study, to detect the SNP c.309T>G in the MDM2 gene, we have developed a new SNP detection method, named "Duplex SmartAmp," which enabled us to simultaneously detect both 309T and 309G alleles in one tube. To develop this new method, we introduced new primers i.e., nBP and oBPs, as well as two different fluorescent dyes that separately detect those genetic polymorphisms. RESULTS AND CONCLUSIONS: By the Duplex SmartAmp method, the genetic polymorphisms of the MDM2 gene were detected directly from a small amount of genomic DNA or blood samples. We used 96 genomic DNA and 24 blood samples to validate the Duplex SmartAmp by comparison with results of the conventional PCR-RFLP method; consequently, the Duplex SmartAmp results agreed totally with those of the PCR-RFLP method. Thus, the new SNP detection method is considered useful for detecting the SNP c.309T>G in the MDM2 gene so as to judge cancer susceptibility against some cellular stress in the clinical setting, and also to handle a large number of samples and enable rapid clinical diagnosis.

  20. Zucchini yellow mosaic virus: biological properties, detection procedures and comparison of coat protein gene sequences.

    Science.gov (United States)

    Coutts, B A; Kehoe, M A; Webster, C G; Wylie, S J; Jones, R A C

    2011-12-01

    -II induced chlorotic symptoms in inoculated leaves of Chenopodium quinoa, but an isolate from A-II caused symptomless infection. One of three commercial ZYMV-specific antibodies did not detect all Australian isolates reliably by ELISA. A multiplex real-time PCR using dual-labelled probes was developed, which distinguished between Australian ZYMV isolates belonging to phylogenetic groups A-I, A-II and B-II.

  1. Novel RNA hybridization method for the in situ detection of ETV1, ETV4, and ETV5 gene fusions in prostate cancer.

    Science.gov (United States)

    Kunju, Lakshmi P; Carskadon, Shannon; Siddiqui, Javed; Tomlins, Scott A; Chinnaiyan, Arul M; Palanisamy, Nallasivam

    2014-09-01

    The genetic basis of 50% to 60% of prostate cancer (PCa) is attributable to rearrangements in E26 transformation-specific (ETS) (ERG, ETV1, ETV4, and ETV5), BRAF, and RAF1 genes and overexpression of SPINK1. The development and validation of reliable detection methods are warranted to classify various molecular subtypes of PCa for diagnostic and prognostic purposes. ETS gene rearrangements are typically detected by fluorescence in situ hybridization and reverse-transcription polymerase chain reaction methods. Recently, monoclonal antibodies against ERG have been developed that detect the truncated ERG protein in immunohistochemical assays where staining levels are strongly correlated with ERG rearrangement status by fluorescence in situ hybridization. However, specific antibodies for ETV1, ETV4, and ETV5 are unavailable, challenging their clinical use. We developed a novel RNA in situ hybridization-based assay for the in situ detection of ETV1, ETV4, and ETV5 in formalin-fixed paraffin-embedded tissues from prostate needle biopsies, prostatectomy, and metastatic PCa specimens using RNA probes. Further, with combined RNA in situ hybridization and immunohistochemistry we identified a rare subset of PCa with dual ETS gene rearrangements in collisions of independent tumor foci. The high specificity and sensitivity of RNA in situ hybridization provides an alternate method enabling bright-field in situ detection of ETS gene aberrations in routine clinically available PCa specimens.

  2. Detection of high frequency of mutations in a breast and/or ovarian cancer cohort: implications of embracing a multi-gene panel in molecular diagnosis in India.

    Science.gov (United States)

    Mannan, Ashraf U; Singh, Jaya; Lakshmikeshava, Ravikiran; Thota, Nishita; Singh, Suhasini; Sowmya, T S; Mishra, Avshesh; Sinha, Aditi; Deshwal, Shivani; Soni, Megha R; Chandrasekar, Anbukayalvizhi; Ramesh, Bhargavi; Ramamurthy, Bharat; Padhi, Shila; Manek, Payal; Ramalingam, Ravi; Kapoor, Suman; Ghosh, Mithua; Sankaran, Satish; Ghosh, Arunabha; Veeramachaneni, Vamsi; Ramamoorthy, Preveen; Hariharan, Ramesh; Subramanian, Kalyanasundaram

    2016-06-01

    Breast and/or ovarian cancer (BOC) are among the most frequently diagnosed forms of hereditary cancers and leading cause of death in India. This emphasizes on the need for a cost-effective method for early detection of these cancers. We sequenced 141 unrelated patients and families with BOC using the TruSight Cancer panel, which includes 13 genes strongly associated with risk of inherited BOC. Multi-gene sequencing was done on the Illumina MiSeq platform. Genetic variations were identified using the Strand NGS software and interpreted using the StrandOmics platform. We were able to detect pathogenic mutations in 51 (36.2%) cases, out of which 19 were novel mutations. When we considered familial breast cancer cases only, the detection rate increased to 52%. When cases were stratified based on age of diagnosis into three categories, ⩽40 years, 40-50 years and >50 years, the detection rates were higher in the first two categories (44.4% and 53.4%, respectively) as compared with the third category, in which it was 26.9%. Our study suggests that next-generation sequencing-based multi-gene panels increase the sensitivity of mutation detection and help in identifying patients with a high risk of developing cancer as compared with sequential tests of individual genes.

  3. Cryptic intragenic deletion of the SHOX gene in a family with Léri-Weill dyschondrosteosis detected by Multiplex Ligation-Dependent Probe Amplification (MLPA).

    Science.gov (United States)

    Funari, Mariana F A; Jorge, Alexander A L; Pinto, Emilia M; Arnhold, Ivo J P; Mendonca, Berenice B; Nishi, Mirian Y

    2008-11-01

    LWD is associated to SHOX haploinsufficiency, in most cases, due to gene deletion. Generally FISH and microsatellite analysis are used to identify SHOX deletion. MLPA is a new method of detecting gene copy variation, allowing simultaneous analysis of several regions. Here we describe the presence of a SHOX intragenic deletion in a family with LWD, analyzed through different methodologies. Genomic DNA of 11 subjects from one family were studied by microsatellite analysis, direct sequencing and MLPA. FISH was performed in two affected individuals. Microsatellite analysis showed that all affected members shared the same haplotype suggesting the involvement of SHOX. MLPA detected an intragenic deletion involving exons IV-VIa, which was not detected by FISH and microsatellite analysis. In conclusion, the MLPA technique was proved to be the best solution on detecting this small deletion, it has the advantage of being less laborious also allowing the analysis of several regions simultaneously.

  4. Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing

    OpenAIRE

    Wang, Huiping; Kong, Fanrong; Sorrell, Tania C; Wang, Bin; McNicholas, Paul; Pantarat, Namfon; Ellis, David; Xiao, Meng; Widmer, Fred; Chen, Sharon CA

    2009-01-01

    Abstract Background Amino acid substitutions in the target enzyme Erg11p of azole antifungals contribute to clinically-relevant azole resistance in Candida albicans. A simple molecular method for rapid detection of ERG11 gene mutations would be an advantage as a screening tool to identify potentially-resistant strains and to track their movement. To complement DNA sequencing, we developed a padlock probe and rolling circle amplification (RCA)-based method to detect a series of mutations in th...

  5. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Directory of Open Access Journals (Sweden)

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  6. Detection of Microbial 16S rRNA Gene in the Blood of Patients With Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Yiwei Qian

    2018-05-01

    Full Text Available Emerging evidence suggests that the microbiota present in feces plays a role in Parkinson’s disease (PD. However, the alterations of the microbiome in the blood of PD patients remain unknown. To test this hypothesis, we conducted this case-control study to explore the microbiota compositions in the blood of Chinese PD patients. Microbiota communities in the blood of 45 patients and their healthy spouses were investigated using high-throughput Illumina HiSeq sequencing targeting the V3-V4 region of 16S ribosomal RNA (rRNA gene. The relationships between the microbiota in the blood and PD clinical characteristics were analyzed. No difference was detected in the structure and richness between PD patients and healthy controls. The following genera were enriched in the blood of PD patients: Isoptericola, Cloacibacterium, Enhydrobacter and Microbacterium; whereas genus Limnobacter was enriched in the healthy controls after adjusting for age, gender, body mass index (BMI and constipation. Additionally, the findings regarding these genera were validated in another independent group of 58 PD patients and 57 healthy controls using real-time PCR targeting genus-specific 16S rRNA genes. Furthermore, not only the genera Cloacibacterium and Isoptericola (which were identified as enriched in PD patients but also the genera Paludibacter and Saccharofermentans were positively associated with disease duration. Some specific genera in the blood were related to mood disorders. We believe this is the first report to provide direct evidence to support the hypothesis that the identified microbiota in the blood are associated with PD. Additionally, some microbiota in the blood are closely associated with the clinical characteristics of PD. Elucidating these differences in blood microbiomes will provide a foundation to improve our understanding of the role of microbiota in the pathogenesis of PD.

  7. Comparison of two DNA microarrays for detection of plasmid-mediated antimicrobial resistance and virulence factor genes in clinical isolates of Enterobacteriaceae and non-Enterobacteriaceae.

    LENUS (Irish Health Repository)

    Walsh, Fiona

    2010-06-01

    A DNA microarray was developed to detect plasmid-mediated antimicrobial resistance (AR) and virulence factor (VF) genes in clinical isolates of Enterobacteriaceae and non-Enterobacteriaceae. The array was validated with the following bacterial species: Escherichiacoli (n=17); Klebsiellapneumoniae (n=3); Enterobacter spp. (n=6); Acinetobacter genospecies 3 (n=1); Acinetobacterbaumannii (n=1); Pseudomonasaeruginosa (n=2); and Stenotrophomonasmaltophilia (n=2). The AR gene profiles of these isolates were identified by polymerase chain reaction (PCR). The DNA microarray consisted of 155 and 133 AR and VF gene probes, respectively. Results were compared with the commercially available Identibac AMR-ve Array Tube. Hybridisation results indicated that there was excellent correlation between PCR and array results for AR and VF genes. Genes conferring resistance to each antibiotic class were identified by the DNA array. Unusual resistance genes were also identified, such as bla(SHV-5) in a bla(OXA-23)-positive carbapenem-resistant A. baumannii. The phylogenetic group of each E. coli isolate was verified by the array. These data demonstrate that it is possible to screen simultaneously for all important classes of mobile AR and VF genes in Enterobacteriaceae and non-Enterobacteriaceae whilst also assigning a correct phylogenetic group to E. coli isolates. Therefore, it is feasible to test clinical Gram-negative bacteria for all known AR genes and to provide important information regarding pathogenicity simultaneously.

  8. The detection of K88, K99 fimbrial antigen and enterotoxin genes of Escherichia coli isolated from piglets and calves with diarrhoea in Indonesia

    Directory of Open Access Journals (Sweden)

    Supar

    1996-03-01

    Full Text Available Enterotoxigenic Escherichia coli (ETEC strains cause diarrhoeal disease in piglets and calves in Indonesia. These strains possess two virulence factors namely attachment and enterotoxin antigens . These factors could be detected phenotypically and genetically. Haemolytic Escherichia coli (E coli isolates possessing K88 fimbrial antigen associated with 0-group 108 and 149. They were positive for K88 gene and demonstrated their ability to produce heat labile enterotoxin (LT and genetically were all positive for LT gene . Seventeen isolates ofE coli K88 which associated with 0-group 149 were positive forSTb gene, other O-serotypes were negative . Ten isolates of Ecoli K88 which associated with 0-group 108 possessed K88, K99, LT and STa genes, but negative for STb gene . However, phenotypically the K99 antigen and STa toxin were not expressed under laboratory conditions, the reason was not well understood . E. coli K99 strains isolated from calves wit h diarrhoea were all associated with 0-group 9 and produced STa toxin when tested by suckling mousse bioassay. The E. coli K99 calf isolates were all hybridized with K99 and STa gene only . It is likely that K99 gene is associated with STa gene . The DNA hybridization technique is more convenience to be used for confirmation diagnosis of colibacillosis, however, not all veterinary laboratories could perform these tests .

  9. Significance of combined detection of JAK2V617F, MPL and CALR gene mutations in patients with essential thrombocythemia.

    Science.gov (United States)

    Ji, Liying; Qian, Mengyao; Wu, Nana; Wu, Jianmin

    2017-03-01

    The aim of this study was to analyze the mutation rate of JAK2V617F, MPLW515L/K and CALR genes in adult patients with essential thrombocythemia (ET) and the accuracy of the combined detection by the receiver operating curve. Three hundred and forty-two cases with high-platelets (≥300×10 9 /l) were consecutively selected. The patients were analyzed for routine blood examination, bone marrow biopsy and genetic testing. One hundred and fifty-four cases (45.03%) were diagnosed with ET and 188 cases of secondary thrombocythemia according to the hematopoietic and lymphoid tissue tumor classification standards of 2008. It was found that the mutant type of three genes showed three bands, whereas only one band for wild-type. The JAK2V617F and MPL mutations did not cause a change in the open reading frame and the CALR mutation resulted in its change. The mutation rate of JAK2V617F and CALR in ET group was significantly higher than that in the secondary thrombocythemia group (p<0.05). The positive mutation rate of MPL was only 4.55%. JAK2V617F-positive mutation alone was used to diagnose with ET. The area under the curve (AUC) was 0.721. The sensitivity was 72.4%, the specificity was 79.5% and the cut-off value was 0.25. When CALR-positive mutation alone was used to diagnose ET, the AUC, sensitivity, specificity and cut-off value were 0.664, 68.4, 82.4 and 0.09%, respectively. JAK2V617F combined with CALR mutation were used for diagnosis of ET. The AUC was 0.862, the sensitivity was 85.9%, the specificity was 87.8%, and the cut-off values were 0.21 and 0.07. In conclusion, the positive mutation rate of JAK2V617F and CALR in ET was higher, and the sensitivity, specificity and accuracy of the diagnosis of ET were significantly improved using the detection of JAK2V617F and CALR.

  10. Automated brightfield dual-color in situ hybridization for detection of mouse double minute 2 gene amplification in sarcomas.

    Science.gov (United States)

    Zhang, Wenjun; McElhinny, Abigail; Nielsen, Alma; Wang, Maria; Miller, Melanie; Singh, Shalini; Rueger, Ruediger; Rubin, Brian P; Wang, Zhen; Tubbs, Raymond R; Nagle, Raymond B; Roche, Pat; Wu, Ping; Pestic-Dragovich, Lidija

    2011-01-01

    The human homolog of the mouse double minute 2 (MDM2) oncogene is amplified in about 20% of sarcomas. The measurement of the MDM2 amplification can aid in classification and may provide a predictive value for recently formulated therapies targeting MDM2. We have developed and validated an automated bright field dual-color in situ hybridization application to detect MDM2 gene amplification. A repeat-depleted MDM2 probe was constructed to target the MDM2 gene region at 12q15. A chromosome 12-specific probe (CHR12) was generated from a pα12H8 plasmid. The in situ hybridization assay was developed by using a dinitrophenyl-labeled MDM2 probe and a digoxigenin-labeled CHR12 probe on the Ventana Medical Systems' automated slide-staining platforms. The specificity of the MDM2 and CHR12 probes was shown on metaphase spreads and further validated against controls, including normal human tonsil and known MDM2-amplified samples. The assay performance was evaluated on a cohort of 100 formalin-fixed, paraffin-embedded specimens by using a conventional bright field microscope. Simultaneous hybridization and signal detection for MDM2 and CHR12 showed that both DNA targets were present in the same cells. One hundred soft tissue specimens were stained for MDM2 and CHR12. Although 26 of 29 lipomas were nonamplified and eusomic, MDM2 amplification was noted in 78% of atypical lipomatous tumors or well-differentiated liposarcomas. Five of 6 dedifferentiated liposarcoma cases were amplified for MDM2. MDM2 amplification was observed in 1 of 8 osteosarcomas; 3 showed CHR12 aneusomy. MDM2 amplification was present in 1 of 4 chondrosarcomas. Nine of 10 synovial sarcomas displayed no evidence of MDM2 amplification in most tumor cells. In pleomorphic sarcoma, not otherwise specified (pleomorphic malignant fibrous histiocytoma), MDM2 was amplified in 38% of cases, whereas 92% were aneusomic for CHR12. One alveolar rhabdomyosarcoma and 2 embryonal rhabdomyosarcomas displayed low-level aneusomy

  11. Application of microarray and functional-based screening methods for the detection of antimicrobial resistance genes in the microbiomes of healthy humans.

    Directory of Open Access Journals (Sweden)

    Roderick M Card

    Full Text Available The aim of this study was to screen for the presence of antimicrobial resistance genes within the saliva and faecal microbiomes of healthy adult human volunteers from five European countries. Two non-culture based approaches were employed to obviate potential bias associated with difficult to culture members of the microbiota. In a gene target-based approach, a microarray was employed to screen for the presence of over 70 clinically important resistance genes in the saliva and faecal microbiomes. A total of 14 different resistance genes were detected encoding resistances to six antibiotic classes (aminoglycosides, β-lactams, macrolides, sulphonamides, tetracyclines and trimethoprim. The most commonly detected genes were erm(B, blaTEM, and sul2. In a functional-based approach, DNA prepared from pooled saliva samples was cloned into Escherichia coli and screened for expression of resistance to ampicillin or sulphonamide, two of the most common resistances found by array. The functional ampicillin resistance screen recovered genes encoding components of a predicted AcrRAB efflux pump. In the functional sulphonamide resistance screen, folP genes were recovered encoding mutant dihydropteroate synthase, the target of sulphonamide action. The genes recovered from the functional screens were from the chromosomes of commensal species that are opportunistically pathogenic and capable of exchanging DNA with related pathogenic species. Genes identified by microarray were not recovered in the activity-based screen, indicating that these two methods can be complementary in facilitating the identification of a range of resistance mechanisms present within the human microbiome. It also provides further evidence of the diverse reservoir of resistance mechanisms present in bacterial populations in the human gut and saliva. In future the methods described in this study can be used to monitor changes in the resistome in response to antibiotic therapy.

  12. The detection and differentiation of methicillin-resistant and methicillin-susceptible Staphylococcus aureus endocarditis by using the BD GeneOhm StaphSR Assay.

    Science.gov (United States)

    Frey, Amy B; Wilson, Deborah A; LaSalvia, Margaret M; Tan, Carmela D; Rodriguez, E Rene; Shrestha, Nabin K; Hall, Gerri S; Procop, Gary W

    2011-11-01

    We use the BD GeneOhm StaphSR Assay (BD Diagnostics, Oakville, Canada) to screen for Staphylococcus aureus nasal colonization and sought to evaluate this assay for the assessment of valve specimens from patients with endocarditis. We examined 23 paired fresh and formalin-fixed, paraffin-embedded cardiac valve tissue samples, 12 of which had S aureus endocarditis, using the BD GeneOhm StaphSR Assay for the detection and differentiation of methicillin-susceptible and methicillin-resistant S aureus. This assay appropriately characterized all specimens with respect to the presence or absence of S aureus. There was an 87.5% correlation between the presence or absence of the mecA gene and the oxacillin susceptibility results for the S aureus isolates studied. The GeneOhm StaphSR assay accurately detected S aureus in cardiac valve tissue samples. Rare discordances were observed between oxacillin susceptibility status and mecA gene detection by this assay.

  13. Molecular identification of fungi trichothecens producing in seeds madder and detection of their nivalenol gene synthesis using PCR

    Directory of Open Access Journals (Sweden)

    Seyyed Alireza Esmailzadeh Hosseini

    2018-01-01

    Full Text Available Madder is one of the most important crops that used for medical and industrial applications and is widely cultivated in Yazd province. During 2012, sampling was done form seeds madder in important areas planted in Yazd province, including Bafq and Ardakan. After culturing and purification of fungal isolates in PDA and CLA media, additional identification was performed by PCR with specific primers for each species. Detection of fungi mycotoxins producing potential such as Nivalenol (NIV using Tri13 primers was done. High-performance liquid chromatography (HPLC was used to confirm the produce NIV mycotoxins potential in Fusarium species. 249 fungal strains were isolated from madder seed belonging to 6 genera of fungi including Fusarium spp., Aspergillus spp., Penicillium spp., Alternaria spp., Rhizoctonia solani and Rhizpous spp., that Fusarium isolates with 71 percent was the most frequency among fungi isolated. Among Fusarium fungi isolated, F. solani (55 isolates and F. oxysporum (41 isolates were the most frequency. F. poae, F. semitectum and F. equiseti ability to produce mycotoxins such as Nivalenol (NIV that are harmful to human health and animals as well as effect on the quantity and quality of madder color production. Tri13 gene involved in production NIV was detected in three Fusarium species that all isolates produce NIV. The results of HPLC showed that all studied Fusarium fungi, have the potential to produce NIV mycotoxins. The results of this study showed that fungi associated with seeds madder are able to produce trichothecene mycotoxins that they can be dangerous for consumers. Given that, this is the first report of fungi mycotoxins producing on seeds madder in Yazd province, thus should be measures to control and reduce fungal agents in these products.

  14. Evaluation and optimisation of indel detection workflows for ion torrent sequencing of the BRCA1 and BRCA2 genes.

    Science.gov (United States)

    Yeo, Zhen Xuan; Wong, Joshua Chee Leong; Rozen, Steven G; Lee, Ann Siew Gek

    2014-06-24

    The Ion Torrent PGM is a popular benchtop sequencer that shows promise in replacing conventional Sanger sequencing as the gold standard for mutation detection. Despite the PGM's reported high accuracy in calling single nucleotide variations, it tends to generate many false positive calls in detecting insertions and deletions (indels), which may hinder its utility for clinical genetic testing. Recently, the proprietary analytical workflow for the Ion Torrent sequencer, Torrent Suite (TS), underwent a series of upgrades. We evaluated three major upgrades of TS by calling indels in the BRCA1 and BRCA2 genes. Our analysis revealed that false negative indels could be generated by TS under both default calling parameters and parameters adjusted for maximum sensitivity. However, indel calling with the same data using the open source variant callers, GATK and SAMtools showed that false negatives could be minimised with the use of appropriate bioinformatics analysis. Furthermore, we identified two variant calling measures, Quality-by-Depth (QD) and VARiation of the Width of gaps and inserts (VARW), which substantially reduced false positive indels, including non-homopolymer associated errors without compromising sensitivity. In our best case scenario that involved the TMAP aligner and SAMtools, we achieved 100% sensitivity, 99.99% specificity and 29% False Discovery Rate (FDR) in indel calling from all 23 samples, which is a good performance for mutation screening using PGM. New versions of TS, BWA and GATK have shown improvements in indel calling sensitivity and specificity over their older counterpart. However, the variant caller of TS exhibits a lower sensitivity than GATK and SAMtools. Our findings demonstrate that although indel calling from PGM sequences may appear to be noisy at first glance, proper computational indel calling analysis is able to maximize both the sensitivity and specificity at the single base level, paving the way for the usage of this technology

  15. Identification of active methanotrophs in a landfill cover soil through detection of expression of 16S rRNA and functional genes.

    Science.gov (United States)

    Chen, Yin; Dumont, Marc G; Cébron, Aurélie; Murrell, J Colin

    2007-11-01

    Active methanotrophs in a landfill soil were revealed by detecting the 16S rRNA of methanotrophs and the mRNA transcripts of key genes involved in methane oxidation. New 16S rRNA primers targeting type I and type II methanotrophs were designed and optimized for analysis by denaturing gradient gel electrophoresis. Direct extraction of RNA from soil enabled the analysis of the expression of the functional genes: mmoX, pmoA and mxaF, which encode subunits of soluble methane monooxygenase, particulate methane monooxygenase and methanol dehydrogenase respectively. The 16S rRNA polymerase chain reaction (PCR) primers for type I methanotrophs detected Methylomonas, Methylosarcina and Methylobacter sequences from both soil DNA and cDNA which was generated from RNA extracted directly from the landfill cover soil. The 16S rRNA primers for type II methanotrophs detected primarily Methylocella and some Methylocystis 16S rRNA genes. Phylogenetic analysis of mRNA recovered from the soil indicated that Methylobacter, Methylosarcina, Methylomonas, Methylocystis and Methylocella were actively expressing genes involved in methane and methanol oxidation. Transcripts of pmoA but not mmoX were readily detected by reverse transcription polymerase chain reaction (RT-PCR), indicating that particulate methane monooxygenase may be largely responsible for methane oxidation in situ.

  16. Evaluation of the geneXpert MTB/RIF assay for early diagnosis of tuberculosis and detection of rifampicin resistance in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Ali Albay

    2016-09-01

    Conclusion: GeneXpert MTB / RIF test is an effectual automated molecular diagnostic technique with its successful and reliable performance in early diagnosis of tuberculosis and detecting multi-drug resistant strains. [Cukurova Med J 2016; 41(3.000: 548-553

  17. Multiplex real-time PCR for detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL genes from selective enrichments from animals and retail meat.

    Directory of Open Access Journals (Sweden)

    Valeria Velasco

    Full Text Available The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat. The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus, mecA (associated with methicillin resistance and PVL (virulence factor, and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement and 0.29-0.77 (from fair to substantial agreement for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA

  18. Multiplex Real-Time PCR for Detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) Genes from Selective Enrichments from Animals and Retail Meat

    Science.gov (United States)

    Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.

    2014-01-01

    The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using

  19. Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    International Nuclear Information System (INIS)

    Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

    2004-01-01

    The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

  20. On the use of permutation in and the performance of a class of nonparametric methods to detect differential gene expression.

    Science.gov (United States)

    Pan, Wei

    2003-07-22

    Recently a class of nonparametric statistical methods, including the empirical Bayes (EB) method, the significance analysis of microarray (SAM) method and the mixture model method (MMM), have been proposed to detect differential gene expression for replicated microarray experiments conducted under two conditions. All the methods depend on constructing a test statistic Z and a so-called null statistic z. The null statistic z is used to provide some reference distribution for Z such that statistical inference can be accomplished. A common way of constructing z is to apply Z to randomly permuted data. Here we point our that the distribution of z may not approximate the null distribution of Z well, leading to possibly too conservative inference. This observation may apply to other permutation-based nonparametric methods. We propose a new method of constructing a null statistic that aims to estimate the null distribution of a test statistic directly. Using simulated data and real data, we assess and compare the performance of the existing method and our new method when applied in EB, SAM and MMM. Some interesting findings on operating characteristics of EB, SAM and MMM are also reported. Finally, by combining the idea of SAM and MMM, we outline a simple nonparametric method based on the direct use of a test statistic and a null statistic.

  1. DETECTION OF MENDELIAN AND GENOTYPE FREQUENCY OF GROWTH HORMONE GENE IN ONGOLE CROSSBRED CATTLE MATED BY THE ARTIFICIAL INSEMINATION TECHNIQUE

    Directory of Open Access Journals (Sweden)

    U. Paputungan

    2012-06-01

    Full Text Available The objectives of this study were to detect the Mendelian mode inheritance of growth hormone (GH and to establish genotype frequency of GH gene in Ongole-crossbred cattle mated by the artificial insemination (AI technique. Total of 76 blood samples were collected from Ongole-crossbred cows and bulls (G0, and their progenies (G1 at the Tumaratas AI service center in North Sulawesi province, Indonesia. All blood samples were screened for the presence of GH locus using a PCR-RFLP method involving restricted enzyme Msp1 on 1.2 % of agarose gel. Data were analyzed using statistical program function in Excel XP. The results showed that GH locus using alleles of Msp1+ and Msp1- enzyme restriction in Ongole-crossbred cows and bulls was inherited to their Ongole-crossbred progenies following the Mendelian mode inheritance. This Mendelian inheritance generated by AI technique was not under genetic equilibrium for the Msp1 genotype frequencies in groups of G0 and G1. The breeding program using genotypes of bulls and cows (G0 for generating the genotype of GH Msp1 enzyme restriction by AI technique should be maintained to increase these various allele dispersion rates for breeding under genetic equilibrium of the Ongole-crossbred cattle population.

  2. 16S rRNA gene-based detection of tetrachloroethene-dechlorinating Desulfuromonas and Dehalococcoides species

    Energy Technology Data Exchange (ETDEWEB)

    Loeffler, F.E.; Sun, Q.; Li, J.; Tiedje, J.M.

    2000-03-01

    Members of the genera Desulfuromonas and Dehalococcoides reductively dechlorinate tetrachloroethene (PCE) and trichloroethene. Two primer pairs specific to hypervariable regions of the 16S rRNA genes of the Dehalococcoides group (comprising Dehalococcoides ethenogenes and Dehalococcoides sp. strain FL2) and the acetate-oxidizing, PCE-dechlorinating Desulfuromonas group (comprising Desulfuromonas sp. strain BB1 and Desulfuromonas chloroethenica) were designed. The detection threshold of a nested PCR approach using universal bacterial primers followed by a second PCR with the Desulfuromonas dechlorinator-targeted primer pair was 1 x 10{sup 3} BB1 cells added per gram (wet weight) of sandy aquifer material. Total community DNA isolated from sediments of three Michigan rivers and six different chloroethene-contaminated aquifer samples was used as template in nested PCR. All river sediment samples yielded positive signals with the BB1- and the Dehalococcoides-targeted primers. One chloroethene-contaminated aquifer tested positive with the Dehalococcoides-targeted primers, and another contaminated aquifer tested positive with the Desulfuromonas dechlorinator-targeted primer pair. Restriction fragment analysis of the amplicons could discriminate strain BB1 from other known Desulfuromonas species. Microcosm studies confirmed the presence of PCE-dechlorinating, acetate-oxidizing Desulfuromonas and hydrogenotrophic Dehalococcoides species in samples yielding positive PCR signals with the specific primers.

  3. Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

    Directory of Open Access Journals (Sweden)

    Nayereh Nouri

    2014-01-01

    Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

  4. Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

    Directory of Open Access Journals (Sweden)

    Lin Li

    2015-12-01

    Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

  5. Virulence Factors and Antibiotic Susceptibility of Staphylococcus aureus Isolates in Ready-to-Eat Foods: Detection of S. aureus Contamination and a High Prevalence of Virulence Genes

    Directory of Open Access Journals (Sweden)

    Suat Moi Puah

    2016-02-01

    Full Text Available Staphylococcus aureus is one of the leading causes of food poisoning. Its pathogenicity results from the possession of virulence genes that produce different toxins which result in self-limiting to severe illness often requiring hospitalization. In this study of 200 sushi and sashimi samples, S. aureus contamination was confirmed in 26% of the food samples. The S. aureus isolates were further characterized for virulence genes and antibiotic susceptibility. A high incidence of virulence genes was identified in 96.2% of the isolates and 20 different virulence gene profiles were confirmed. DNA amplification showed that 30.8% (16/52 of the S. aureus carried at least one SE gene which causes staphylococcal food poisoning. The most common enterotoxin gene was seg (11.5% and the egc cluster was detected in 5.8% of the isolates. A combination of hla and hld was the most prevalent coexistence virulence genes and accounted for 59.6% of all isolates. Antibiotic resistance studies showed tetracycline resistance to be the most common at 28.8% while multi-drug resistance was found to be low at 3.8%. In conclusion, the high rate of S. aureus in the sampled sushi and sashimi indicates the need for food safety guidelines.

  6. Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

    Science.gov (United States)

    Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

    2008-01-01

    Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

  7. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  8. Clinical significance of fluorescence in situ hybridization for detection of hTERC gene amplification in cervical cancer and precancerous tissues cases

    Directory of Open Access Journals (Sweden)

    Shuang LIU

    2012-06-01

    Full Text Available Objective  To detect the human telomerase RNA gene (hTERC amplification in cervical lesions, and explore its clinical significance. Methods  The tissues of the cervical lesions were collected from 195 patients, including 33 of chronic cervicitis, 34 of CINⅠ, 37 of CIN Ⅱ-Ⅲ, 30 of cervical squamous cell carcinoma, and 61 of cervica1 adenocarcinoma, and abnormal hTERC was detected with amplification of fluorescence in situhybridization (FISH. The relationship between hTERC gene amplification and clinicopathological parameters was analyzed. Results  Among the 195 patients, the positive rate of hTERC gene amplification was 3.03% (1/33, 29.41% (10/34, 72.97% (27/37, 100% (30/30, 91.8% (56/61 in chronic cervicitis, CINⅠ, CIN Ⅱ-Ⅲ, cervical squamous cell carcinoma and cervica1 adenocarcinoma respectively, and the results showed that hTERC amplification rate was significantly higher in group CIN Ⅱ-Ⅲthan in group CINⅠ(P 0.05. Conclusion  Detection of gene amplification by FISH technology can be used as a means for accurate diagnosis and prediction of the histologically difficult-to-diagnose lesion and for risk assessment after treatment of cervical precancerous lesions.

  9. Real-time polymerase chain reaction assay for endogenous reference gene for specific detection and quantification of common wheat-derived DNA (Triticum aestivum L.).

    Science.gov (United States)

    Vautrin, Sonia; Zhang, David

    2007-01-01

    A species-specific endogenous reference gene system was developed for polymerase chain reaction (PCR)-based analysis in common wheat (Triticum aestivum L.) by targeting the ALMT1 gene, an aluminium-activated malate transporter. The primers and probe were elaborated for real-time PCR-based qualitative and quantitative assay. The size of amplified product is 95 base pairs. The specificity was assessed on 17 monocot and dicot plant species. The established real-time PCR assay amplified only T. aestivum-derived DNA; no amplification occurred on other phylogenetically related species, including durum wheat (T. durum). The robustness of the system was tested on the DNA of 15 common wheat cultivars using 20 000 genomic copies per PCR the mean cycle threshold (Ct) values of 24.02 +/- 0.251 were obtained. The absolute limits of detection and quantification of the real-time PCR assay were estimated to 2 and 20 haploid genome copies of common wheat, respectively. The linearity was experimentally validated on 2-fold serial dilutions of DNA from 650 to 20 000 haploid genome copies. All these results show that the real-time PCR assay developed on the ALMT1 gene is suitable to be used as an endogenous reference gene for PCR-based specific detection and quantification of T. aestivum-derived DNA in various applications, in particular for the detection and quantification of genetically modified materials in common wheat.

  10. Development and Application of Loop-Mediated Isothermal Amplification Assays for Rapid Visual Detection of cry2Ab and cry3A Genes in Genetically-Modified Crops

    Directory of Open Access Journals (Sweden)

    Feiwu Li

    2014-08-01

    Full Text Available The cry2Ab and cry3A genes are two of the most important insect-resistant exogenous genes and had been widely used in genetically-modified crops. To develop more effective alternatives for the quick identification of genetically-modified organisms (GMOs containing these genes, a rapid and visual loop-mediated isothermal amplification (LAMP method to detect the cry2Ab and cry3A genes is described in this study. The LAMP assay can be finished within 60 min at an isothermal condition of 63 °C. The derived LAMP products can be obtained by a real-time turbidimeter via monitoring the white turbidity or directly observed by the naked eye through adding SYBR Green I dye. The specificity of the LAMP assay was determined by analyzing thirteen insect-resistant genetically-modified (GM crop events with different Bt genes. Furthermore, the sensitivity of the LAMP assay was evaluated by diluting the template genomic DNA. Results showed that the limit of detection of the established LAMP assays was approximately five copies of haploid genomic DNA, about five-fold greater than that of conventional PCR assays. All of the results indicated that this established rapid and visual LAMP assay was quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale test purposes in the field.

  11. Development and application of loop-mediated isothermal amplification assays for rapid visual detection of cry2Ab and cry3A genes in genetically-modified crops.

    Science.gov (United States)

    Li, Feiwu; Yan, Wei; Long, Likun; Qi, Xing; Li, Congcong; Zhang, Shihong

    2014-08-27

    The cry2Ab and cry3A genes are two of the most important insect-resistant exogenous genes and had been widely used in genetically-modified crops. To develop more effective alternatives for the quick identification of genetically-modified organisms (GMOs) containing these genes, a rapid and visual loop-mediated isothermal amplification (LAMP) method to detect the cry2Ab and cry3A genes is described in this study. The LAMP assay can be finished within 60 min at an isothermal condition of 63 °C. The derived LAMP products can be obtained by a real-time turbidimeter via monitoring the white turbidity or directly observed by the naked eye through adding SYBR Green I dye. The specificity of the LAMP assay was determined by analyzing thirteen insect-resistant genetically-modified (GM) crop events with different Bt genes. Furthermore, the sensitivity of the LAMP assay was evaluated by diluting the template genomic DNA. Results showed that the limit of detection of the established LAMP assays was approximately five copies of haploid genomic DNA, about five-fold greater than that of conventional PCR assays. All of the results indicated that this established rapid and visual LAMP assay was quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale test purposes in the field.

  12. A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH

    DEFF Research Database (Denmark)

    Becher, Naja; Gjørup, Vibike; Christensen, Rikke

    2012-01-01

    A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH......A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH...

  13. Comparative evaluation of PCR amplification of RLEP, 16S rRNA, rpoT and Sod A gene targets for detection of M. leprae DNA from clinical and environmental samples

    Directory of Open Access Journals (Sweden)

    Ravindra P Turankar

    2015-01-01

    Conclusion: Amongst all the gene targets used in this study, PCR positivity using RLEP gene target was the highest in all the clinical and environmental samples. Further, the RLEP gene target was able to detect 53% of blood samples as positive in BI-negative leprosy cases indicating its future standardization and use for diagnostic purposes.

  14. Detection of clonal B cells in microdissected reactive lymphoproliferations: possible diagnostic pitfalls in PCR analysis of immunoglobulin heavy chain gene rearrangement

    DEFF Research Database (Denmark)

    Zhou, X.G.; Sandvej, K.; Gregersen, Niels

    1999-01-01

    Aims-To evaluate the specificity of standard and fluorescence based (GENESCAN) polymerase chain reaction (PCR) immunoglobulin heavy chain (IgH) gene rearrangement analysis in complete and microdissected paraffin wax embedded sections from lymphoid proliferations. Methods-PCR IgH gene rearrangement...... because of preferential priming or detection of local B cell clones. Data from clonal analysis of small, microdissected or lymphocyte poor samples must be evaluated critically. It is recommended that analyses should be run in parallel on at least two tissue specimens. Only reproducible bands present...

  15. Detection of linezolid resistance due to the optrA gene in Enterococcus faecalis from poultry meat from the American continent (Colombia)

    DEFF Research Database (Denmark)

    Cavaco, Lina; Bernal, J F; Zankari, Ea

    2017-01-01

    Three Enterococcus isolates obtained from retail chicken collected in 2010-11 as part of the Colombian Integrated Program for Antimicrobial Resistance Surveillance (COIPARS) showed reduced susceptibility towards linezolid (MIC 8 mg/L). This study aimed at characterizing the isolates resistant......A gene encoding resistance to linezolid and phenicols. Additional screening of 37 enterococci strains from the same study did not detect any further positives. Typing showed that two of the isolates belong to ST59, while the last belongs to ST489. All isolates carry genes encoding resistance to macrolide...

  16. A sensitive, support-vector-machine method for the detection of horizontal gene transfers in viral, archaeal and bacterial genomes.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In earlier work, we introduced and discussed a generalized computational framework for identifying horizontal transfers. This framework relied on a gene's nucleotide composition, obviated the need for knowledge of codon boundaries and database searches, and was shown to perform very well across a wide range of archaeal and bacterial genomes when compared with previously published approaches, such as Codon Adaptation Index and C + G content. Nonetheless, two considerations remained outstanding: we wanted to further increase the sensitivity of detecting horizontal transfers and also to be able to apply the method to increasingly smaller genomes. In the discussion that follows, we present such a method, Wn-SVM, and show that it exhibits a very significant improvement in sensitivity compared with earlier approaches. Wn-SVM uses a one-class support-vector machine and can learn using rather small training sets. This property makes Wn-SVM particularly suitable for studying small-size genomes, similar to those of viruses, as well as the typically larger archaeal and bacterial genomes. We show experimentally that the new method results in a superior performance across a wide range of organisms and that it improves even upon our own earlier method by an average of 10% across all examined genomes. As a small-genome case study, we analyze the genome of the human cytomegalovirus and demonstrate that Wn-SVM correctly identifies regions that are known to be conserved and prototypical of all beta-herpesvirinae, regions that are known to have been acquired horizontally from the human host and, finally, regions that had not up to now been suspected to be horizontally transferred. Atypical region predictions for many eukaryotic viruses, including the alpha-, beta- and gamma-herpesvirinae, and 123 archaeal and bacterial genomes, have been made available online at http://cbcsrv.watson.ibm.com/HGT_SVM/.

  17. Virulence Characterization of Salmonella enterica by a New Microarray: Detection and Evaluation of the Cytolethal Distending Toxin Gene Activity in the Unusual Host S. Typhimurium.

    Directory of Open Access Journals (Sweden)

    Rui Figueiredo

    Full Text Available Salmonella enterica is a zoonotic foodborne pathogen that causes acute gastroenteritis in humans. We assessed the virulence potential of one-hundred and six Salmonella strains isolated from food animals and products. A high through-put virulence genes microarray demonstrated Salmonella Pathogenicity Islands (SPI and adherence genes were highly conserved, while prophages and virulence plasmid genes were variably present. Isolates were grouped by serotype, and virulence plasmids separated S. Typhimurium in two clusters. Atypical microarray results lead to whole genome sequencing (WGS of S. Infantis Sal147, which identified deletion of thirty-eight SPI-1 genes. Sal147 was unable to invade HeLa cells and showed reduced mortality in Galleria mellonella infection model, in comparison to a SPI-1 harbouring S. Infantis. Microarray and WGS of S. Typhimurium Sal199, established for the first time in S. Typhimurium presence of cdtB and other Typhi-related genes. Characterization of Sal199 showed cdtB genes were upstream of transposase IS911, and co-expressed with other Typhi-related genes. Cell cycle arrest, cytoplasmic distension, and nuclear enlargement were detected in HeLa cells infected by Sal199, but not with S. Typhimurium LT2. Increased mortality of Galleria was detected on infection with Sal199 compared to LT2. Thus, Salmonella isolates were rapidly characterized using a high through-put microarray; helping to identify unusual virulence features which were corroborated by further characterisation. This work demonstrates that the use of suitable screening methods for Salmonella virulence can help assess the potential risk associated with certain Salmonella to humans. Incorporation of such methodology into surveillance could help reduce the risk of emergence of epidemic Salmonella strains.

  18. Detection of Class 1 and 2 Integrons, β-Lactamase Genes and Molecular Characterization of Sulfonamide Resistance in Escherichia coli Isolates Recovered from Poultry in China

    Directory of Open Access Journals (Sweden)

    Jam Kashif§, Rehana Buriro§, Javed Memon, Muhammad Yaqoob, Jamila Soomro§, Diao Dongxue, Huang Jinhu and Wang Liping*

    2013-07-01

    Full Text Available This study aimed to detect integrons, β-lactamase genes and to characterize sulfonamide resistant E. coli isolates recovered from poultry. All the isolates (n=38 were investigated for the presence of integrons, Sul1, Sul2, Sul3 genes by PCR. Class 1 and class 2 integron were present in 79 and 16%, respectively. Additional resistance gene cassette embedded in class 1 and 2 integrons was aadA1, aadA5, dfrA17 and aadA22, dfrA, respectively. Sul1 and Sul2 genes were detected in 42.1 and 60.5% isolates, respectively. Both the Sul1 and Sul2 were present in 23% isolates. However, Sul3 gene was not present. Co-existence of Sul1 and Sul2 with class 1 integrons was found in 28.9 and 60.5% of class 1 integron positive isolates, respectively. Whereas, a less percentage of isolates showed a low level of resistance to β-lactams and no blaCTX-M, blaSHV and blaTEM was found. The MIC results showed resistance to sulfadiazine and sulfamethoxazole-trimethoprim in 88 and 84% isolates, resistance to penicillin, ampicillin, amoxicillin was 52, 52 and 44%, respectively. Chloramphenicol, florfenicol, tetracycline and gentamycin resistance was found in 51, 5, 42 and 67% isolates, respectively. This study revealed high frequency of class 1 integrons, Sul genes among poultry E. coli isolates, therefore further spread of Sul genes and integrons is predictable.

  19. Systematic identification and validation of candidate genes for detection of circulating tumor cells in peripheral blood specimens of colorectal cancer patients.

    Science.gov (United States)

    Findeisen, Peter; Röckel, Matthias; Nees, Matthias; Röder, Christian; Kienle, Peter; Von Knebel Doeberitz, Magnus; Kalthoff, Holger; Neumaier, Michael

    2008-11-01

    The presence of tumor cells in peripheral blood is being regarded increasingly as a clinically relevant prognostic factor for colorectal cancer patients. Current molecular methods are very sensitive but due to low specificity their diagnostic value is limited. This study was undertaken in order to systematically identify and validate new colorectal cancer (CRC) marker genes for improved detection of minimal residual disease in peripheral blood mononuclear cells of colorectal cancer patients. Marker genes with upregulated gene expression in colorectal cancer tissue and cell lines were identified using microarray experiments and publicly available gene expression data. A systematic iterative approach was used to reduce a set of 346 candidate genes, reportedly associated with CRC to a selection of candidate genes that were then further validated by relative quantitative real-time RT-PCR. Analytical sensitivity of RT-PCR assays was determined by spiking experiments with CRC cells. Diagnostic sensitivity as well as specificity was tested on a control group consisting of 18 CRC patients compared to 12 individuals without malignant disease. From a total of 346-screened genes only serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5 (SERPINB5) showed significantly elevated transcript levels in peripheral venous blood specimens of tumor patients when compared to the nonmalignant control group. These results were confirmed by analysis of an enlarged collective consisting of 63 CRC patients and 36 control individuals without malignant disease. In conclusion SERPINB5 seems to be a promising marker for detection of circulating tumor cells in peripheral blood of colorectal cancer patients.

  20. A locked nucleic acid (LNA-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

    Directory of Open Access Journals (Sweden)

    Lingxiang Zhu

    Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

  1. Multiplex PCR detection of GSTM1, GSTT1, and GSTP1 gene variants: simultaneously detecting GSTM1 and GSTT1 gene copy number and the allelic status of the GSTP1 Ile105Val genetic variant

    DEFF Research Database (Denmark)

    Buchard, Anders; Sanchez Sanchez, Juan Jose; Dalhoff, Kim

    2007-01-01

    , the enzyme activity of GSTM1 and GSTT1 is absent in approximately 50 and 15% of the population, respectively, due to deletions of both chromosomal copies of the genes. A trimodal phenotype pattern exists in which individuals with two, one, or no functional genes are fast, intermediate, or slow "conjugators...

  2. Detection of clonal T-cell receptor beta and gamma chain gene rearrangement by polymerase chain reaction and capillary gel electrophoresis.

    Science.gov (United States)

    Fan, Hongxin; Robetorye, Ryan S

    2013-01-01

    Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.

  3. Detecting lineage-specific adaptive evolution of brain-expressed genes in human using rhesus macaque as outgroup

    DEFF Research Database (Denmark)

    Yu, Xiao-Jing; Zheng, Hong-Kun; Wang, Jun

    2006-01-01

    related species as outgroup, it is difficult to identify human-lineage-specific changes, which is critical in delineating the biological uniqueness of humans. In this study, we conducted phylogeny-based analyses of 2633 human brain-expressed genes using rhesus macaque as the outgroup. We identified 47...... candidate genes showing strong evidence of positive selection in the human lineage. Genes with maximal expression in the brain showed a higher evolutionary rate in human than in chimpanzee. We observed that many immune-defense-related genes were under strong positive selection, and this trend was more...

  4. Superiority of fluorescent in situ hybridization over immunohistochemistry in detection of HER2 gene in carcinoma of the urinary bladder associated with and without schistosomiasis.

    Science.gov (United States)

    Hammam, Olfat; Wishahi, Mohamed; Hindawi, All; Mosaad, Maha; Akl, Maha; Khalil, Heba; Al Ganzoury, Hossam; Badawy, Mohamed; Elesaily, Khaled

    2014-12-01

    HER2 is an oncogene encoding a type 1 tyrosine kinase growth factor receptor and the role of HER2 in the development of numerous types of human cancer is still understood and correlates with clinical outcome, poor prognosis, it is a predictor factor for poor response to chemotherapy. HER2 overexpression is associated with reduced disease free and overall survival. Patients who have HER2 negative expression have a poor prognosis. The aim of the present study is to explore the accuracy of detection of expression of HER2 protein by two different techniques of immunohistochemistry (IHC) and gene amplification by fluorescent in situ hybridization (FISH). The two techniques were applied to sixty two patients that included different cell types of carcinoma of the bladder, benign bilharzial lesions and control. Characteristics of the 62 patients are: 10 chronic cystitis, 19 squamous cell carcinoma (SCC) with schistosomiasis, 33 urothelial carcinoma (UC) schistosomal and non-schistosomal, ten healthy individuals without schistosomiasis served as controls. Gene amplification of HER2 was done using FISH and protein expression of HER2 by IHC. The study was applied on archival data of formalin-fixed paraffin embedded tissues and patient clinical data and follow up for 5 years. Overexpression of HER2 protein was found in 30/52 (57.7%). Fourteen cases had score of 2+, and sixteen cases had score of 3+. Using FISH technique it showed more accurate detection of HER2 gene as those fourteen cases who had score of 2+ had been found to be 5 out of 14 were positive for gene over expression, the other sixteen who had score of 3+ all were positive for gene amplification. HER2 protein and gene was found to be significantly overexpressed in carcinoma of the bladder in both cell types SCC and UC with or without schistosomiasis compared to the benign lesions and control groups (P <0.01) by both techniques. There is significant increase in expression of HER2 protein and gene in SCC compared to

  5. Duplex detection of the Mycobacterium tuberculosis complex and medically important non-tuberculosis mycobacteria by real-time PCR based on the rnpB gene.

    Science.gov (United States)

    Abdeldaim, Guma; Svensson, Erik; Blomberg, Jonas; Herrmann, Björn

    2016-11-01

    A duplex real-time PCR based on the rnpB gene was developed for Mycobacterium spp. The assay was specific for the Mycobacterium tuberculosis complex (MTB) and also detected all 19 tested species of non-tuberculous mycobacteria (NTM). The assay was evaluated on 404 clinical samples: 290 respiratory samples and 114 from tissue and other non-respiratory body sites. M. tuberculosis was detected by culture in 40 samples and in 30 samples by the assay. The MTB assay showed a sensitivity similar to Roche Cobas Amplicor MTB-PCR (Roche Molecular Systems, Pleasanton, CA, USA). There were only nine samples with non-tuberculous mycobacteria detected by culture. Six of them were detected by the PCR assay. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  6. Preparation of oligonucleotide microarray for radiation-associated gene expression detection and its application in lung cancer cell lines

    International Nuclear Information System (INIS)

    Guo Wanfeng; Lin Ruxian; Huang Jian; Guo Guozhen; Wang Shengqi

    2005-01-01

    Objective: The response of tumor cell to radiation is accompanied by complex change in patterns of gene expression. It is highly probable that a better understanding of molecular and genetic changes can help to sensitize the radioresistant tumor cells. Methods: Oligonucleotide microarray provides a powerful tool for high-throughput identifying a wider range of genes involved in the radioresistance. Therefore, the authors designed one oligonucleotide microarray according to the biological effect of IR. By using different radiosensitive lung cancer cell lines, the authors identified genes showing altered expression in lung cancer cell lines. To provide independent confirmation of microarray data, semi-quantitative RT-PCR was performed on a selection of genes. Results: In radioresistant A549 cell lines, a total of 18 genes were selected as having significant fold-changes compared to NCI-H446, 8 genes were up-regulated and 10 genes were down-regulated. Subsequently, A549 and NCI-H446 cells were delivered by ionizing radiation. In A549 cell line, we found 22 (19 up-regulated and 3 down-regulated) and 26 (8 up-regulated and 18 down-regulated) differentially expressed genes at 6h and 24h after ionizing radiation. In NCI-H446 cell line, we identified 17 (9 up-regulated and 8 down-regulated) and 18 (6 up-regulated and 12 down-regulated) differentially expressed genes at 6 h and 24 h after ionizing radiation. The authors tested seven genes (MDM2, p53, XRCC5, Bcl-2, PIM2, NFKBIA and Cyclin B1) for RT-PCR, and found that the results were in good agreement with those from the microarray data except for NFKBIA gene, even though the value for each mRNA level might be different between the two measurements. In present study, the authors identified some genes with cell proliferation and anti-apoptosis, such as MdM2, BCL-2, PKCz and PIM2 expression levels increased in A549 cells and decreased in NCI-H446 cells after radiation, and other genes with DNA repair, such as XRCC5, ERCC5

  7. Evaluation of Antibiotic Resistance and Detection of papC and papG genes in Escherichia coli Strains Isolated from Patients with Urinary Tract Infection

    Directory of Open Access Journals (Sweden)

    Mitra Alishah

    2016-11-01

    Full Text Available Abstract Background and Objectives: Escherichia coli is the most common etiologic factor of urinary tract infection, which its most important virulence factor is P fimbriae. Uropathogenic E. coli expresses various types of adhesins, such as pili adhesins (pyelonephritis-associated pili, Pap that mediates binding to the surface of epithelial cells of the urinary tract. This study aims to identify papC and papG genes and to evaluate antibiotic resistance level in the isolated E. coli samples. Methods: In this descriptive cross-sectional study, 50 samples were collected from patients with urinary tract infection and after isolation of bacteria and DNA extraction, antibiotic susceptibility tests was performed by disc diffusion method using related antibiotics. Presence of papG and papC genes (class I, II, and III was assessed by multiplex PCR method. Statistical data were analyzed using descriptive t-test. Results: The isolated E. coli samples were susceptible to amikacin (100% and cefepime (72% and resistant to ampicillin (100% and nitrofurantoin (94%. Eighteen samples (32.7% had papG gene, of which 17 (30.9% samples had papGII gene and 1 sample (1.8% had papGIII gene; papGI gene was not detected in any of the samples. Conclusion: The results of the present study showed that papC and papGI genes are the most common Pap fimbriae adhesion-encoding genes in E. coli isolated from urinary tract infection. The difference between the results of this study with those of other studies is due to geographic diversity. Keywords: Escherichia coli; Adhesion pap, Disk diffusion antimicrobial tests; Multiplex polymerase chain reaction.

  8. Identification of a 251 gene expression signature that can accurately detect M. tuberculosis in patients with and without HIV co-infection.

    Directory of Open Access Journals (Sweden)

    Noor Dawany

    Full Text Available BACKGROUND: Co-infection with tuberculosis (TB is the leading cause of death in HIV-infected individuals. However, diagnosis of TB, especially in the presence of an HIV co-infection, can be limiting due to the high inaccuracy associated with the use of conventional diagnostic methods. Here we report a gene signature that can identify a tuberculosis infection in patients co-infected with HIV as well as in the absence of HIV. METHODS: We analyzed global gene expression data from peripheral blood mononuclear cell (PBMC samples of patients that were either mono-infected with HIV or co-infected with HIV/TB and used support vector machines to identify a gene signature that can distinguish between the two classes. We then validated our results using publically available gene expression data from patients mono-infected with TB. RESULTS: Our analysis successfully identified a 251-gene signature that accurately distinguishes patients co-infected with HIV/TB from those infected with HIV only, with an overall accuracy of 81.4% (sensitivity = 76.2%, specificity = 86.4%. Furthermore, we show that our 251-gene signature can also accurately distinguish patients with active TB in the absence of an HIV infection from both patients with a latent TB infection and healthy controls (88.9-94.7% accuracy; 69.2-90% sensitivity and 90.3-100% specificity. We also demonstrate that the expression levels of the 251-gene signature diminish as a correlate of the length of TB treatment. CONCLUSIONS: A 251-gene signature is described to (a detect TB in the presence or absence of an HIV co-infection, and (b assess response to treatment following anti-TB therapy.

  9. [The progress and prospect of application of genetic testing technology-based gene detection technology in the diagnosis and treatment of hereditary cancer].

    Science.gov (United States)

    He, J X; Jiang, Y F

    2017-08-06

    Hereditary cancer is caused by specific pathogenic gene mutations. Early detection and early intervention are the most effective ways to prevent and control hereditary cancer. High-throughput sequencing based genetic testing technology (NGS) breaks through the restrictions of pedigree analysis, provide a convenient and efficient method to detect and diagnose hereditary cancer. Here, we introduce the mechanism of hereditary cancer, summarize, discuss and prospect the application of NGS and other genetic tests in the diagnosis of hereditary retinoblastoma, hereditary breast and ovarian cancer syndrome, hereditary colorectal cancer and other complex and rare hereditary tumors.

  10. Detection of a putative virulence cadF gene of Campylobacter jejuni obtained from different sources using a microfabricated PCR chip

    DEFF Research Database (Denmark)

    Poulsen, Claus Riber; El-Ali, Jamil; Perch-Nielsen, Ivan R.

    2005-01-01

    A microfabricated polymerase chain reaction (PCR) chip made of epoxy-based photoresist (SU-8) was recently designed and developed. In this study, we tested whether the PCR chip could be used for rapid detection of a potential virulence determinant, the cadF gene of Campylobacter jejuni. PCR...... was performed using published PCR conditions and primers for the C. jejuni cadF gene. DNA isolated from a C. jejuni reference strain CCUG 11284, C. jejuni isolates obtained from different sources (chicken and human), and Campylobacter whole cells were used as templates in the PCR tests. Conventional PCR in tube...... was used as the control. After optimization of the PCR chip, PCR positives on the chip were obtained from 91.0% (10/11) of the tested chips. A fast transition time was achieved with the PCR chip, and therefore a faster cycling time and a shorter PCR program were obtained. Using the PCR chip, the cadF gene...

  11. Gene protein detection platform--a comparison of a new human epidermal growth factor receptor 2 assay with conventional immunohistochemistry and fluorescence in situ hybridization platforms.

    Science.gov (United States)

    Stålhammar, Gustav; Farrajota, Pedro; Olsson, Ann; Silva, Cristina; Hartman, Johan; Elmberger, Göran

    2015-08-01

    Human epidermal growth factor receptor 2 (HER2) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) are widely used semiquantitative assays for selecting breast cancer patients for HER2 antibody therapy. However, both techniques have been shown to have disadvantages. Our aim was to test a recent automated technique of combined IHC and brightfield dual in situ hybridization-gene protein detection platform (GPDP)-in breast cancer HER2 protein, gene, and chromosome 17 centromere status evaluations, comparing the results in accordance to the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from both 2007 and 2013. The GPDP technique performance was evaluated on 52 consecutive whole slide invasive breast cancer cases with HER2 IHC 2/3+ scoring results. Applying in turns the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from 2007 and 2013 to both FISH and GPDP DISH assays, the HER2 gene amplification results showed 100% concordance among amplified/nonamplified cases, but there was a shift in 4 cases toward positive from equivocal results and toward equivocal from negative results. This might be related to the emphasis on the average HER2 copy number in the 2013 criteria. HER2 expression by IVD market IHC kit (Pathway®) has a strong correlation with GPDP HER2 protein, including a full concordance for all cases scored as 3+ and a reduction from 2+ to 1+ in 7 cases corresponding to nonamplified cases. Gene protein detection platform HER2 protein "solo" could have spared the need for 7 FISH studies. In addition, the platform offered advantages on interpretation reassurance including selecting areas for counting gene signals paralleled with protein IHC expression, on heterogeneity detection, interpretation time, technical time, and tissue expense. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. First Detection of FOX-1 AmpC -lactamase Gene Expression Among Escherichia coli Isolated from Abattoir Samples in Abakaliki, Nigeria

    Directory of Open Access Journals (Sweden)

    Ejikeugwu Chika

    2018-05-01

    Full Text Available Objectives: Gram-negative bacteria represent the most relevant reservoir of resistance to antibiotics in the environment. The natural selection of resistant clones of bacteria in the environment by antimicrobial selective pressure is a relevant mechanism for spreading antibiotic resistance traits in both the community and hospital environment. This is in scenarios where antimicrobials are used irrationally, and even in the propagation of livestock, poultry birds, and for other veterinary purposes. This study sought to detect the prevalence of FOX-1 AmpC -lactamase genes from abattoir samples. Methods: The isolation of Escherichia coli, antimicrobial susceptibility testing, and -lactamase characterization was carried out using standard microbiology techniques. The production of AmpC -lactamase was phenotypically carried out using the cefoxitin-cloxacillin double-disk synergy test (CC-DDST, and FOX-1 AmpC genes was detected in the E. coli isolates using multiplex polymerase chain reaction. Results: Forty-eight E. coli isolates were recovered from the anal swabs of cows and 35 (72.9% isolates were positive for the production of -lactamase. Notably, high percentages of resistance to cefoxitin (91.7%, ceftriaxone (83.3%, imipenem (85.4%, ceftazidime (87.5%, ofloxacin (81.3%, and gentamicin (85.4% were found. FOX-1 genes were detected in three (6.3% of the 48 E. coli isolates phenotypically screened for AmpC enzyme production. Conclusions: Abattoirs could represent a major reservoir of resistance genes especially AmpC -lactamase, and this could serve as a route for the dissemination of multidrug-resistant bacteria in the community. Thus, the molecular identification of drug-resistant genes is vital for a reliable epidemiological investigation and the forestalling of the emergence and spread of these organisms through the food chain in this region.

  13. Application of oligonucleotide array CGH to the simultaneous detection of a deletion in the nuclear TK2 gene and mtDNA depletion.

    Science.gov (United States)

    Zhang, Shulin; Li, Fang-Yuan; Bass, Harold N; Pursley, Amber; Schmitt, Eric S; Brown, Blaire L; Brundage, Ellen K; Mardach, Rebecca; Wong, Lee-Jun

    2010-01-01

    Thymidine kinase 2 (TK2), encoded by the TK2 gene on chromosome 16q22, is one of the deoxyribonucleoside kinases responsible for the maintenance of mitochondrial deoxyribonucleotide pools. Defects in TK2 mainly cause a myopathic form of the mitochondrial DNA depletion syndrome (MDDS). Currently, only point mutations and small insertions and deletions have been reported in TK2 gene; gross rearrangements of TK2 gene and possible hepatic involvement in patients with TK2 mutations have not been described. We report a non-consanguineous Jordanian family with three deceased siblings due to mtDNA depletion. Sequence analysis of the father detected a heterozygous c.761T>A (p.I254N) mutation in his TK2 gene; however, point mutations in the mother were not detected. Subsequent gene dosage analysis using oligonucleotide array CGH identified an intragenic approximately 5.8-kb deletion encompassing the 5'UTR to intron 2 of her TK2 gene. Sequence analysis confirmed that the deletion spans c.1-495 to c.283-2899 of the TK2 gene (nucleotide 65,136,256-65,142,086 of chromosome 16). Analysis of liver and muscle specimens from one of the deceased infants in this family revealed compound heterozygosity for the paternal point mutation and maternal intragenic deletion. In addition, a significant reduction of the mtDNA content in liver and muscle was detected (10% and 20% of age- and tissue-matched controls, respectively). Prenatal diagnosis was performed in the third pregnancy. The fetus was found to carry both the point mutation and the deletion. This child died 6months after birth due to myopathy. A serum specimen demonstrated elevated liver transaminases in two of the infants from whom results were available. This report expands the mutation spectrum associated with TK2 deficiency. While the myopathic form of MDDS appears to be the main phenotype of TK2 mutations, liver dysfunction may also be a part of the mitochondrial depletion syndrome caused by TK2 gene defects.

  14. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    Science.gov (United States)

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  15. Detection of the enterotoxigenic genes (sei,sej) in Staphylococcus aureus isolates from bovine mastitis milk in the West Azerbaijan of Iran.

    Science.gov (United States)

    Ahmady, Malahat; Kazemi, Sahar

    2013-07-01

    Staphylococcus aureus is a major causative pathogen of clinical and subclinical mastitis of dairy domestic ruminants. This organism produces a variety of extracellular toxins and virulence factors such as enterotoxin SEI and SEJ that contribute to its pathogenic potential. In this study 25 S. aureus isolates obtained from four dairy herds of Urmia region which is located in West Azerbaijan province in Iran. The tested isolates were identified on the basis of the cultural and biochemical properties, as well as amplification of the aroA gene which is specific for S. aureus . All isolates were also analyzed for the presence of the SEI ( sei ) and SEJ ( sej ) encoding genes using polymerase chain reaction (PCR). Seven positive isolates were detected for sei , but sej gene was not detected in any of the total number of 25 isolates. The present study revealed that the PCR amplification of the aroA gene could be used as a powerful tool for identification of S. aureus from the cases of bovine mastitis. Results of the present study also showed that the strains of S. aureus which cause mastitis can potentially produce enterotoxin SEI. Overall, our results suggest that it is of special importance to follow the presence of enterotoxin-producing S. aureus in other dairy products, especially for protecting the consumers from staphylococcal food poisoning.

  16. The Identification of Novel Diagnostic Marker Genes for the Detection of Beer Spoiling Pediococcus damnosus Strains Using the BlAst Diagnostic Gene findEr.

    Directory of Open Access Journals (Sweden)

    Jürgen Behr

    Full Text Available As the number of bacterial genomes increases dramatically, the demand for easy to use tools with transparent functionality and comprehensible output for applied comparative genomics grows as well. We present BlAst Diagnostic Gene findEr (BADGE, a tool for the rapid prediction of diagnostic marker genes (DMGs for the differentiation of bacterial groups (e.g. pathogenic / nonpathogenic. DMG identification settings can be modified easily and installing and running BADGE does not require specific bioinformatics skills. During the BADGE run the user is informed step by step about the DMG finding process, thus making it easy to evaluate the impact of chosen settings and options. On the basis of an example with relevance for beer brewing, being one of the oldest biotechnological processes known, we show a straightforward procedure, from phenotyping, genome sequencing, assembly and annotation, up to a discriminant marker gene PCR assay, making comparative genomics a means to an end. The value and the functionality of BADGE were thoroughly examined, resulting in the successful identification and validation of an outstanding novel DMG (fabZ for the discrimination of harmless and harmful contaminations of Pediococcus damnosus, which can be applied for spoilage risk determination in breweries. Concomitantly, we present and compare five complete P. damnosus genomes sequenced in this study, finding that the ability to produce the unwanted, spoilage associated off-flavor diacetyl is a plasmid encoded trait in this important beer spoiling species.

  17. The Identification of Novel Diagnostic Marker Genes for the Detection of Beer Spoiling Pediococcus damnosus Strains Using the BlAst Diagnostic Gene findEr.

    Science.gov (United States)

    Behr, Jürgen; Geissler, Andreas J; Schmid, Jonas; Zehe, Anja; Vogel, Rudi F

    2016-01-01

    As the number of bacterial genomes increases dramatically, the demand for easy to use tools with transparent functionality and comprehensible output for applied comparative genomics grows as well. We present BlAst Diagnostic Gene findEr (BADGE), a tool for the rapid prediction of diagnostic marker genes (DMGs) for the differentiation of bacterial groups (e.g. pathogenic / nonpathogenic). DMG identification settings can be modified easily and installing and running BADGE does not require specific bioinformatics skills. During the BADGE run the user is informed step by step about the DMG finding process, thus making it easy to evaluate the impact of chosen settings and options. On the basis of an example with relevance for beer brewing, being one of the oldest biotechnological processes known, we show a straightforward procedure, from phenotyping, genome sequencing, assembly and annotation, up to a discriminant marker gene PCR assay, making comparative genomics a means to an end. The value and the functionality of BADGE were thoroughly examined, resulting in the successful identification and validation of an outstanding novel DMG (fabZ) for the discrimination of harmless and harmful contaminations of Pediococcus damnosus, which can be applied for spoilage risk determination in breweries. Concomitantly, we present and compare five complete P. damnosus genomes sequenced in this study, finding that the ability to produce the unwanted, spoilage associated off-flavor diacetyl is a plasmid encoded trait in this important beer spoiling species.