WorldWideScience

Sample records for oligoribonucleotides

  1. Synthesis of Aminoglycoside-2′-O-Methyl Oligoribonucleotide Fusions

    Directory of Open Access Journals (Sweden)

    Lotta Granqvist

    2017-05-01

    Full Text Available Phosphoramidite building blocks of ribostamycin (3 and 4, that may be incorporated at any position of the oligonucleotide sequence, were synthesized. The building blocks, together with a previously described neomycin-modified solid support, were applied for the preparation of aminoglycoside-2′-O-methyl oligoribonucleotide fusions. The fusions were used to clamp a single strand DNA sequence (a purine-rich strand of c-Myc promoter 1 to form triple helical 2′-O-methyl RNA/DNA-hybrid constructs. The potential of the aminoglycoside moieties to stabilize the triple helical constructs were studied by UV-melting profile analysis.

  2. Solution phase synthesis of short oligoribonucleotides on a precipitative tetrapodal support

    Directory of Open Access Journals (Sweden)

    Alejandro Gimenez Molina

    2014-09-01

    Full Text Available An effective method for the synthesis of short oligoribonucleotides in solution has been elaborated. Novel 2'-O-(2-cyanoethyl-5'-O-(1-methoxy-1-methylethyl protected ribonucleoside 3'-phosphoramidites have been prepared and their usefulness as building blocks in RNA synthesis on a soluble support has been demonstrated. As a proof of concept, a pentameric oligoribonucleotide, 3'-UUGCA-5', has been prepared on a precipitative tetrapodal tetrakis(4-azidomethylphenylpentaerythritol support. The 3'-terminal nucleoside was coupled to the support as a 3'-O-(4-pentynoyl derivative by Cu(I promoted 1,3-dipolar cycloaddition. Couplings were carried out with 1.5 equiv of the building block. In each coupling cycle, the small molecular reagents and byproducts were removed by two quantitative precipitations from MeOH, one after oxidation and the second after the 5'-deprotection. After completion of the chain assembly, treatment with triethylamine, ammonia and TBAF released the pentamer in high yields.

  3. Solution phase synthesis of short oligoribonucleotides on a precipitative tetrapodal support

    Science.gov (United States)

    Gimenez Molina, Alejandro; Jabgunde, Amit M; Virta, Pasi

    2014-01-01

    Summary An effective method for the synthesis of short oligoribonucleotides in solution has been elaborated. Novel 2'-O-(2-cyanoethyl)-5'-O-(1-methoxy-1-methylethyl) protected ribonucleoside 3'-phosphoramidites have been prepared and their usefulness as building blocks in RNA synthesis on a soluble support has been demonstrated. As a proof of concept, a pentameric oligoribonucleotide, 3'-UUGCA-5', has been prepared on a precipitative tetrapodal tetrakis(4-azidomethylphenyl)pentaerythritol support. The 3'-terminal nucleoside was coupled to the support as a 3'-O-(4-pentynoyl) derivative by Cu(I) promoted 1,3-dipolar cycloaddition. Couplings were carried out with 1.5 equiv of the building block. In each coupling cycle, the small molecular reagents and byproducts were removed by two quantitative precipitations from MeOH, one after oxidation and the second after the 5'-deprotection. After completion of the chain assembly, treatment with triethylamine, ammonia and TBAF released the pentamer in high yields. PMID:25298795

  4. Metal free, “click and click–click” conjugation of ribonucleosides and 2′-OMe oligoribonucleotides on the solid phase

    OpenAIRE

    Singh, Ishwar; Heaney, Frances

    2010-01-01

    A fast and practical metal free conjugation of ribonucleosides and 2¢-OMe 4-mer oligoribonucleotides has been accomplished by a nitrile oxide alkyne click cycloaddition reaction on the solid-phase, the methodology is suited to modification at either, or both, the 3¢- or the 5¢-terminus of the oligoribonucleotide substrate.

  5. Thermodynamic contribution and nearest-neighbor parameters of pseudouridine-adenosine base pairs in oligoribonucleotides.

    Science.gov (United States)

    Hudson, Graham A; Bloomingdale, Richard J; Znosko, Brent M

    2013-11-01

    Pseudouridine (Ψ) is the most common noncanonical nucleotide present in naturally occurring RNA and serves a variety of roles in the cell, typically appearing where structural stability is crucial to function. Ψ residues are isomerized from native uridine residues by a class of highly conserved enzymes known as pseudouridine synthases. In order to quantify the thermodynamic impact of pseudouridylation on U-A base pairs, 24 oligoribonucleotides, 16 internal and eight terminal Ψ-A oligoribonucleotides, were thermodynamically characterized via optical melting experiments. The thermodynamic parameters derived from two-state fits were used to generate linearly independent parameters for use in secondary structure prediction algorithms using the nearest-neighbor model. On average, internally pseudouridylated duplexes were 1.7 kcal/mol more stable than their U-A counterparts, and terminally pseudouridylated duplexes were 1.0 kcal/mol more stable than their U-A equivalents. Due to the fact that Ψ-A pairs maintain the same Watson-Crick hydrogen bonding capabilities as the parent U-A pair in A-form RNA, the difference in stability due to pseudouridylation was attributed to two possible sources: the novel hydrogen bonding capabilities of the newly relocated imino group as well as the novel stacking interactions afforded by the electronic configuration of the Ψ residue. The newly derived nearest-neighbor parameters for Ψ-A base pairs may be used in conjunction with other nearest-neighbor parameters for accurately predicting the most likely secondary structure of A-form RNA containing Ψ-A base pairs.

  6. Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs

    OpenAIRE

    Naoki Tanigawa; Toshitsugu Fujita; Hodaka Fujii

    2014-01-01

    Polymerase chain reaction (PCR) amplification of multiple templates using common primers is used in a wide variety of molecular biological techniques. However, abundant templates sometimes obscure the amplification of minor species containing the same primer sequences. To overcome this challenge, we used oligoribonucleotides (ORNs) to inhibit amplification of undesired template sequences without affecting amplification of control sequences lacking complementarity to the ORNs. ORNs were effect...

  7. Short loop-targeting oligoribonucleotides antagonize Lin28 and enable pre-let-7 processing and suppression of cell growth in let-7-deficient cancer cells.

    Science.gov (United States)

    Roos, Martina; Rebhan, Mario A E; Lucic, Matije; Pavlicek, David; Pradere, Ugo; Towbin, Harry; Civenni, Gianluca; Catapano, Carlo V; Hall, Jonathan

    2015-01-01

    MicroRNAs (miRNAs) originate from stem-loop-containing precursors (pre-miRNAs, pri-miRNAs) and mature by means of the Drosha and Dicer endonucleases and their associated factors. The let-7 miRNAs have prominent roles in developmental differentiation and in regulating cell proliferation. In cancer, the tumor suppressor function of let-7 is abrogated by overexpression of Lin28, one of several RNA-binding proteins that regulate let-7 biogenesis by interacting with conserved motifs in let-7 precursors close to the Dicer cleavage site. Using in vitro assays, we have identified a binding site for short modified oligoribonucleotides ('looptomirs') overlapping that of Lin28 in pre-let-7a-2. These looptomirs selectively antagonize the docking of Lin28, but still permit processing of pre-let-7a-2 by Dicer. Looptomirs restored synthesis of mature let-7 and inhibited growth and clonogenic potential in Lin28 overexpressing hepatocarcinoma cells, thereby demonstrating a promising new means to rescue defective miRNA biogenesis in Lin28-dependent cancers. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides.

    Science.gov (United States)

    Cieślak, Jacek; Grajkowski, Andrzej; Kauffman, Jon S; Duff, Robert J; Beaucage, Serge L

    2008-04-04

    Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.

  9. 大规模合成长链RNA的简易低成本工艺%A Simple and Cost Effective Process for Large-scale Production of Long Oligoribonucleotides

    Institute of Scientific and Technical Information of China (English)

    张平静; 李铁军; 周宋峰; 朱远源; 陈建新; 陆毅祥; 文锋

    2013-01-01

    由于现有技术所限,RNA分子长度和二级结构往往成为RNA合成困难的主要原因.提供了一种简单低成本大规模制备和纯化长链RNA药物的新工艺,尤其针对具有稳定二级结构的长链RNA药物.采用引物延伸方法替代PCR和线性质粒DNA方法制备线性DNA模板可减少步骤及降低污染,然后用T7 RNA聚合酶转录制备的甲氧基修饰的线性DNA模板获得高均一度的长链RNA,转录粗产物直接用source 15Q阴离子HPLC分离T7 RNA聚合酶、rNTP、转录中断产物、内毒素和模板DNA等,从而获得高纯度RNA终产物.该工艺无需繁琐的酚/氯仿抽提和RNA变性,尤其适用于RNA的大量制备.%The length and stable secondary structure of RNA molecule are general obstacles in RNA synthesis because of current technological bottlenecks. A simple and cost effective process for large-scale preparation and purification of long oligoribonucleotides with stable secondary structure was presented. High homogeneous RNAs are transcribed in vitro with T7 RNA polymerase using linear 2'-0me modified DNA templates, which were prepared by primer extension instead of PCR amplification or linearized plasmid DNA transcription to reduce contamination. The crude transcripts are then directly subjected to an anion-exchange HPLC using source 15Q to separate T7 RNA polymerase, unincorporated rNTPs, small abortive transcripts, endotoxin and DNA templates from pure RNA products. The novel process does neither require tedious phenol/ chloroform extraction nor denaturation of RNA, which is especially useful for larger RNAs preparations.

  10. Thermodynamic and kinetic characterization of duplex formation between 2'-O, 4'-C-methylene-modified oligoribonucleotides, DNA and RNA

    DEFF Research Database (Denmark)

    Christensen, Ulla

    2007-01-01

    2'-O,4'-C-methylene-linked ribonucleotide derivatives, named LNA (locked nucleic acid) and BNA (bridged nucleic acid) are nucleic acid analogoues that have shown high-affinity recognition of DNA and RNA, and the employment of LNA oligomers for antisense activity, gene regulation and nucleic acid...... the strength of duplexes formed with the complementary DNA and RNA....

  11. An apparent deletion of an oligonucleotide detected by RNA fingerprint in the nondiabetogenic B variant of encephalomyocarditis virus is caused by a point mutation.

    OpenAIRE

    Yoon, J W; Wong, A K; Bae, Y. S.; Eun, H. M.

    1988-01-01

    The diabetogenic D variant of encephalomyocarditis virus (EMC-D) was previously shown to be different from the nondiabetogenic B variant of encephalomyocarditis virus (EMC-B) by a single spot in an oligonucleotide fingerprint after RNase T1 digestion of their genomic RNAs. An oligoribonucleotide was missing from EMC-B but was present in EMC-D. The oligoribonucleotide specific to EMC-D was isolated from a two-dimensional polyacrylamide gel and sequenced as 5'-ACAAUCUCACUUUUCCAACAACAG-3'. Molec...

  12. A microenvironment-sensitive fluorescent pyrimidine ribonucleoside analogue: synthesis, enzymatic incorporation, and fluorescence detection of a DNA abasic site.

    Science.gov (United States)

    Tanpure, Arun A; Srivatsan, Seergazhi G

    2011-11-04

    Base-modified fluorescent ribonucleoside-analogue probes are valuable tools in monitoring RNA structure and function because they closely resemble the structure of natural nucleobases. Especially, 2-aminopurine, a highly environment-sensitive adenosine analogue, is the most extensively utilized fluorescent nucleoside analogue. However, only a few isosteric pyrimidine ribonucleoside analogues that are suitable for probing the structure and recognition properties of RNA molecules are available. Herein, we describe the synthesis and photophysical characterization of a small series of base-modified pyrimidine ribonucleoside analogues derived from tagging indole, N-methylindole, and benzofuran onto the 5-position of uracil. One of the analogues, based on a 5-(benzofuran-2-yl)pyrimidine core, shows emission in the visible region with a reasonable quantum yield and, importantly, displays excellent solvatochromism. The corresponding triphosphate substrate is effectively incorporated into oligoribonucleotides by T7 RNA polymerase to produce fluorescent oligoribonucleotide constructs. Steady-state and time-resolved spectroscopic studies with fluorescent oligoribonucleotide constructs demonstrate that the fluorescent ribonucleoside photophysically responds to subtle changes in its environment brought about by the interaction of the chromophore with neighboring bases. In particular, the emissive ribonucleoside, if incorporated into an oligoribonucleotide, positively reports the presence of a DNA abasic site with an appreciable enhancement in fluorescence intensity. The straightforward synthesis, amicability to enzymatic incorporation, and sensitivity to changes in the microenvironment highlight the potential of the benzofuran-conjugated pyrimidine ribonucleoside as an efficient fluorescent probe to investigate nucleic acid structure, dynamics, and recognition events.

  13. Small RNA-directed epigenetic programming of embryonic stem cell cardiac differentiation

    Science.gov (United States)

    Ghanbarian, Hossein; Wagner, Nicole; Michiels, Jean-François; Cuzin, François; Wagner, Kay-Dietrich; Rassoulzadegan, Minoo

    2017-01-01

    Microinjection of small noncoding RNAs in one-cell embryos was reported in several instances to result in transcriptional activation of target genes. To determine the molecular mechanisms involved and to explore whether such epigenetic regulations could play a role in early development, we used a cell culture system as close as possible to the embryonic state. We report efficient cardiac differentiation of embryonic stem (ES) cells induced by small non-coding RNAs with sequences of Cdk9, a key player in cardiomyocyte differentiation. Transfer of oligoribonucleotides representing parts of the Cdk9 mRNA into ES and mouse embryo fibroblast cultures resulted in upregulation of transcription. Dependency on Argonaute proteins and endogenous antisense transcripts indicated that the inducer oligoribonucleotides were processed by the RNAi machinery. Upregulation of Cdk9 expression resulted in increased efficiency of cardiac differentiation suggesting a potential tool for stem cell-based regenerative medicine. PMID:28165496

  14. Gel electrophoresis in a polyvinylalcohol coated fused silica capillary for purity assessment of modified and secondary-structured oligo- and polyribonucleotides.

    Science.gov (United States)

    Barciszewska, Martyna; Sucha, Agnieszka; Bałabańska, Sandra; Chmielewski, Marcin K

    2016-01-18

    Application of a polyvinylalcohol-coated (PVA-coated) capillary in capillary gel electrophoresis (CGE) enables the selective separation of oligoribonucleotides and their modifications at high resolution. Quality assessment of shorter oligomers of small interfering RNA (siRNA) is of key importance for ribonucleic acid (RNA) technology which is increasingly being applied in medical applications. CGE is a technique of choice for calculation of chemically synthesized RNAs and their modifications which are frequently obtained as a mixture including shorter oligoribonucleotides. The use of CGE with a PVA-coated capillary to analyze siRNA mixtures presents an alternative to conventionally employed techniques. Here, we present study on identification of the length and purity of RNA mixture ingredients by using PVA-coated capillaries. Also, we demonstrate the use of PVA-coated capillaries to identify and separate phosphorylated siRNAs and secondary structures (e.g. siRNA duplexes).

  15. The Cellular Processing Capacity Limits the Amounts of Chimeric U7 snRNA Available for Antisense Delivery

    OpenAIRE

    2012-01-01

    Many genetic diseases are induced by mutations disturbing the maturation of pre-mRNAs, often affecting splicing. Antisense oligoribonucleotides (AONs) have been used to modulate splicing thereby circumventing the deleterious effects of mutations. Stable delivery of antisense sequences is achieved by linking them to small nuclear RNA (snRNAs) delivered by viral vectors, as illustrated by studies where therapeutic exon skipping was obtained in animal models of Duchenne muscular dystrophy (DMD)....

  16. Induction of ribosomal subunits misassembly by antisense RNAs to control cell growth.

    Science.gov (United States)

    Mangiarotti, G

    2000-08-25

    The assembly of ribosomal subunits starting from free ribosomal RNA and protein of Dictyostelium discoideum was induced in vitro in the presence of several oligoribonucleotides complementary to defined sequences of ribosomal RNA. The reconstituted particles had a full complement of ribosomal proteins, but did not function in an in vitro protein synthesis system and were disassembled following interaction with mRNA. The same result was obtained in vivo by fusing the oligodeossiribonucleotides coding for the selected oligoribonucleotides to the promoter of the gene coding for contact site A protein. This gene is expressed only in the first part of development. Transfected growing cells, transferred in developing buffer in the presence of pulses of cAMP, accumulated significant amounts of the oligoribonucleotides. When retransferred to the growth medium, they grew progressively more slowly, until their doubling time doubled, apparently due to the availability of a limiting amount of functional ribosomes. To avoid disassembly of misassembled subunits (G. Mangiarotti et al., 1997, J. Biol. Chem. 272, 27818-27822), two oligoribonucleotides complementary to sequences present at the 5' ends of pre-17S and pre-26S RNAs were also induced to accumulate during early development with the same technique. When transfected cells were retransferred to the growth medium, their rate of growth declined rapidly to zero and cells died, apparently because they were unable to disassemble misassembled ribosomal subunits and avoid their entry into polyribosomes. This technique to perturb protein synthesis, arrest cell growth, and cause cell suicide will be tested in abnormally growing animal cells.

  17. Hybridization Properties of RNA Containing 8-Methoxyguanosine and 8-Benzyloxyguanosine.

    Directory of Open Access Journals (Sweden)

    Daniel Sylwester Baranowski

    Full Text Available Modified nucleobase analogues can serve as powerful tools for changing physicochemical and biological properties of DNA or RNA. Guanosine derivatives containing bulky substituents at 8 position are known to adopt syn conformation of N-glycoside bond. On the contrary, in RNA the anti conformation is predominant in Watson-Crick base pairing. In this paper two 8-substituted guanosine derivatives, 8-methoxyguanosine and 8-benzyloxyguanosine, were synthesized and incorporated into oligoribonucleotides to investigate their influence on the thermodynamic stability of RNA duplexes. The methoxy and benzyloxy substituents are electron-donating groups, decreasing the rate of depurination in the monomers, as confirmed by N-glycoside bond stability assessments. Thermodynamic stability studies indicated that substitution of guanosine by 8-methoxy- or 8-benzyloxyguanosine significantly decreased the thermodynamic stability of RNA duplexes. Moreover, the presence of 8-substituted guanosine derivatives decreased mismatch discrimination. Circular dichroism spectra of modified RNA duplexes exhibited patterns typical for A-RNA geometry.

  18. Effect of 2'-O-methyl/thiophosphonoacetate-modified antisense oligonucleotides on huntingtin expression in patient-derived cells.

    Science.gov (United States)

    Matsui, Masayuki; Threlfall, Richard N; Caruthers, Marvin H; Corey, David R

    2014-12-15

    Optimizing oligonucleotides as therapeutics will require exploring how chemistry can be used to enhance their effects inside cells. To achieve this goal it will be necessary to fully explore chemical space around the native DNA/RNA framework to define the potential of diverse chemical modifications. In this report we examine the potential of thiophosphonoacetate (thioPACE)-modified 2'-O-methyl oligoribonucleotides as inhibitors of human huntingtin (HTT) expression. Inhibition occurred, but was less than with analogous locked nucleic acid (LNA)-substituted oligomers lacking the thioPACE modification. These data suggest that thioPACE oligonucleotides have the potential to control gene expression inside cells. However, advantages relative to other modifications were not demonstrated. Additional modifications are likely to be necessary to fully explore any potential advantages of thioPACE substitutions.

  19. Biophysical and RNA Interference Inhibitory Properties of Oligonucleotides Carrying Tetrathiafulvalene Groups at Terminal Positions

    Directory of Open Access Journals (Sweden)

    Sónia Pérez-Rentero

    2013-01-01

    Full Text Available Oligonucleotide conjugates carrying a single functionalized tetrathiafulvalene (TTF unit linked through a threoninol molecule to the 3′ or 5′ ends were synthesized together with their complementary oligonucleotides carrying a TTF, pyrene, or pentafluorophenyl group. TTF-oligonucleotide conjugates formed duplexes with higher thermal stability than the corresponding unmodified oligonucleotides and pyrene- and pentafluorophenyl-modified oligonucleotides. TTF-modified oligonucleotides are able to bind to citrate-stabilized gold nanoparticles (AuNPs and produce stable gold AuNPs functionalized with oligonucleotides. Finally, TTF-oligoribonucleotides have been synthesized to produce siRNA duplexes carrying TTF units. The presence of the TTF molecule is compatible with the RNA interference mechanism for gene inhibition.

  20. A ribonucleotide Origin for Life - Fluctuation and Near-ideal Reactions

    Science.gov (United States)

    Yarus, Michael

    2013-02-01

    Oligoribonucleotides are potentially capable of Darwinian evolution - they may replicate and can express an independent chemical phenotype, as embodied in modern enzymatic cofactors. Using quantitative chemical kinetics on a sporadically fed ribonucleotide pool, unreliable supplies of unstable activated ribonucleotides A and B at low concentrations recurrently yield a replicating AB polymer with a potential chemical phenotype. Self-complementary replication in the pool occurs during a minority (here ≈ 35 %) of synthetic episodes that exploit coincidental overlaps between 4, 5 or 6 spikes of arbitrarily arriving substrates. Such uniquely productive synthetic episodes, in which near-ideal reaction sequences recur at random, account for most AB oligonucleotide synthesis, and therefore underlie the emergence of net replication under realistic primordial conditions. Because overlapping substrate spikes are unexpectedly frequent, and in addition, complex spike sequences appear disproportionately, a sporadically fed pool can host unexpectedly complex syntheses. Thus, primordial substrate fluctuations are not necessarily a barrier to Darwinism, but instead can facilitate early evolution.

  1. Affinity of dinucleotide cap analogues for human decapping scavenger (hDcpS).

    Science.gov (United States)

    Darzynkiewicz, Zbigniew M; Bojarska, Elzbieta; Stepinski, Janusz; Jemielity, Jacek; Jankowska-Anyszka, Marzena; Davis, Richard E; Darzynkiewicz, Edward

    2007-01-01

    Eukaryotic cells utilize scavenger decapping enzymes to degrade cap structure following 3'-5' mRNA decay. Human DcpS recently has been described as a highly specific hydrolase (a member of the HIT family) that catalyses the cleavage of m(7)GpppG and short capped oligoribonucleotides. We have demonstrated here that cap-1 (m(7)GpppGm) is a preferred substrate among several investigated dinucleotide cap analogues m(7)Gp(n)N (n = 3-5, N is a purine or pyrimidine base) and m(7)GMP is always one of the reaction product. Cap analogues containing pyrimidine base instead of guanine or diphosphate chain are resistant to hydrolysis catalyzed by human scavenger. Contrary to the other enzymes of HIT family, hDcpS activity is not stimulated by Mg(2+).

  2. Structural analysis of human 2'-O-ribose methyltransferases involved in mRNA cap structure formation

    Science.gov (United States)

    Smietanski, Miroslaw; Werner, Maria; Purta, Elzbieta; Kaminska, Katarzyna H.; Stepinski, Janusz; Darzynkiewicz, Edward; Nowotny, Marcin; Bujnicki, Janusz M.

    2014-01-01

    The 5' cap of human messenger RNA contains 2'-O-methylation of the first and often second transcribed nucleotide that is important for its processing, translation and stability. Human enzymes that methylate these nucleotides, termed CMTr1 and CMTr2, respectively, have recently been identified. However, the structures of these enzymes and their mechanisms of action remain unknown. In the present study, we solve the crystal structures of the active CMTr1 catalytic domain in complex with a methyl group donor and a capped oligoribonucleotide, thereby revealing the mechanism of specific recognition of capped RNA. This mechanism differs significantly from viral enzymes, thus providing a framework for their specific targeting. Based on the crystal structure of CMTr1, a comparative model of the CMTr2 catalytic domain is generated. This model, together with mutational analysis, leads to the identification of residues involved in RNA and methyl group donor binding.

  3. Solid-phase synthesis of siRNA oligonucleotides.

    Science.gov (United States)

    Beaucage, Serge L

    2008-03-01

    Since the discovery of RNA interference (RNAi) as a means to silence the expression of specific genes, small interfering RNA (siRNA) oligonucleotides have been recognized as powerful tools for targeting therapeutically important mRNAs and eliciting their destruction. This discovery has created a high demand for synthetic oligoribonucleotides as potential therapeutics and has spurred a renaissance in the development of rapid, efficient methods for solid-phase RNA synthesis. The design and implementation of 2'-hydroxyl protecting groups that provide ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites are key to the production of RNA oligonucleotides in sufficient quantity and purity for pharmaceutical applications. In this context, various siRNAs were chemically modified to identify the biophysical and biochemical parameters necessary for effective and stable RNAi-mediated gene-silencing activities.

  4. [Affinity modification of Escherichia coli ribosomes with photoactivated analogs of mRNA].

    Science.gov (United States)

    Gimautdinova, O I; Zenkova, M A; Karpova, G G; Podust, L M

    1984-01-01

    Oligoribonucleotide derivatives containing the photoactivated arylazidogroup at 5'-end of the oligonucleotide fragment [2-(N-2,4-dinitro-5-azidophenyl) aminoethyl] phosphamides of the oligoribonucleotides, azido-NH (CH2)2NHpN (pN) n-1, were prepared. It was demonstrated that azido-NH(CH2)2NHpA(pA)4 and azido-NH (CH2)2NHpU (pU)3 stimulate the binding of the codonspecific aminoacyl-tRNA with ribosome. After irradiation of the ternary complex ribosome-azido-NH (CH2)2NHpU (pU) n-1 X tRNA with UV-light (lambda greater than 350 nm) covalent binding of the reagent to ribosome occurs. Up to 10% of the reagent, bound in the ternary complex with ribosome, is cross-linked with the ribosomal proteins of 30S and 50S subunits. The ribosomal RNA are not modified by azido-NH (CH2)2NHpU (pU) n-1. The proteins of 30S and 50S subunits, modified with azido-NH (CH2)2NHpU (pU) n-1 with n = 4,7 and 8, were identified. It is shown that proteins of 30S subunits S3, S4, S9, S11, S12, S14, S17, S19, S20 undergo modification. The proteins of 50S subunits L2, L13, L16, L27, L32, L33 are modified. The set of the modified proteins essentially depends on the length of the oligonucleotide part of the reagent and on occupancy of ribosome A-site by a molecule of tRNA.

  5. Potential inhibition of HIV-1 encapsidation by oligoribonucleotide–dendrimer nanoparticle complexes

    Science.gov (United States)

    Parboosing, Raveen; Chonco, Louis; de la Mata, Francisco Javier; Govender, Thavendran; Maguire, Glenn EM; Kruger, Hendrik G

    2017-01-01

    Background Encapsidation, the process during which the genomic RNA of HIV is packaged into viral particles, is an attractive target for antiviral therapy. This study explores a novel nanotechnology-based strategy to inhibit HIV encapsidation by an RNA decoy mechanism. The design of the 16-mer oligoribonucleotide (RNA) decoy is based on the sequence of stem loop 3 (SL3) of the HIV packaging signal (Ψ). Recognition of the packaging signal is essential to the encapsidation process. It is theorized that the decoy RNA, by mimicking the packaging signal, will disrupt HIV packaging if efficiently delivered into lymphocytes by complexation with a carbosilane dendrimer. The aim of the study is to measure the uptake, toxicity, and antiviral activity of the dendrimer–RNA nanocomplex. Materials and methods A dendriplex was formed between cationic carbosilane dendrimers and the RNA decoy. Uptake of the fluorescein-labeled RNA into MT4 lymphocytes was determined by flow cytometry and confocal microscopy. The cytoprotective effect (50% effective concentration [EC50]) and the effect on HIV replication were determined in vitro by the methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay and viral load measurements, respectively. Results Flow cytometry and confocal imaging demonstrated efficient transfection of lymphocytes. The dendriplex containing the Ψ decoy showed some activity (EC50 =3.20 µM, selectivity index =8.4). However, there was no significant suppression of HIV viral load. Conclusion Oligoribonucleotide decoys containing SL3 of the packaging sequence are efficiently delivered into lymphocytes by carbosilane dendrimers where they exhibit a modest cytoprotective effect against HIV infection. PMID:28115849

  6. Design of RNA enzymes distinguishing a single base mutation in RNA.

    Science.gov (United States)

    Koizumi, M; Hayase, Y; Iwai, S; Kamiya, H; Inoue, H; Ohtsuka, E

    1989-09-12

    RNA enzymes (ribozymes) which can cleave RNA by recognizing sequences of 9-15 bases are described. Substrates must contain UX (X = U, C or A). A ribozyme consisting of two oligoribonucleotides (19 mer and 15 mer) was shown to cleave a ribo 11 mer catalytically with Km and kcat values of 0.53 microM and 0.03 min-1, respectively. A non-cleavable substrate-ribozyme complex containing 2'-O-methylnucleoside was prepared and CD spectra were compared at different temperature. In order to obtain an efficient ribozyme, a one-strand RNA with a chain length of 37 was prepared. The ribozyme was shown to distinguish a single base mutation in mRNA's which were prepared by transcription of two synthetic DNA duplexes coding for positions 7-26 of c-Ha-ras protein. The mutant (Val-12) mRNA which had GUU was cleaved but the wild type mRNA which contained GGU was not changed, when treated by the ribozymes in the presence of Mg2+.

  7. General Approach for Introduction of Various Chemical Labels in Specific RNA Locations Based on Insertion of Amino Linkers

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2013-11-01

    Full Text Available Introduction of reporter groups at designed RNA sites is a widely accepted approach to gain information about the molecular environment of RNAs in their complexes with other biopolymers formed during various cellular processes. A general approach to obtain RNAs bearing diverse reporter groups at designed locations is based on site-specific insertion of groups containing primary aliphatic amine functions (amino linkers with their subsequent selective derivatization by appropriate chemicals. This article is a brief review on methods for site-specific introduction of amino linkers in different RNAs. These methods comprise: (i incorporation of a nucleoside carrying an amino-linker or a function that can be substituted with it into oligoribonucleotides in the course of their chemical synthesis; (ii assembly of amino linker-containing RNAs from short synthetic fragments via their ligation; (iii synthesis of amino linker-modified RNAs using T7 RNA polymerase; (iv insertion of amino linkers into unmodified RNAs at functional groups of a certain type such as the 5'-phosphates and N7 of guanosine residues and (v introduction of an amino linker into long highly structured RNAs exploiting an approach based on sequence-specific modification of nucleic acids. Particular reporter groups used for derivatization of amino linker-containing RNAs together with types of RNA derivatives obtained and fields of their application are presented.

  8. A modified group I intron can function as both a ribozyme and a 5' exon in a trans-exon ligation reaction.

    Science.gov (United States)

    Tasiouka, K I; Burke, J M

    1994-06-24

    Here, we show that a single RNA molecule derived from a group-I intron can provide the catalytic activity, the substrate recognition domain and the attacking nucleophile in a reaction that mimics the exon ligation step of splicing. To accomplish this reaction, we have linked a 5' exon sequence to the 3' end of an attenuated form of the self-splicing Tetrahymena rRNA intron. The ribozyme (I-E1) attacks an oligoribonucleotide analog of the 3' splice site (I'-E2) to generate a product containing ligated exons (I-E1-E2) and a small intron fragment (I'). Two modified introns were constructed and tested for activity. A construct designed to interact with the 3' splice site through intermolecular P9.0 and P10 helices was found to be inactive due to failure to form a stable ribozyme-substrate complex. A second modified intron and substrate combination was engineered, in which the complex was further stabilized by an intermolecular P9.2 helix. In this case, stable complexes and reaction products were identified. The reaction efficiency was low compared to splicing of the unmodified intron-containing precursor, and will be optimized in future experiments. Following optimization, we believe that this system may be exploited to examine the functional consequences of a wide variety of 3' splice-site modifications, and may provide the basis for development of highly selective trans-acting ribozymes.

  9. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo

    2010-03-28

    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical interactions of the primase with the DNA template to explain the basis of specificity have not been demonstrated. Using a combination of surface plasmon resonance and biochemical assays, we show that T7 DNA primase has only a slightly higher affinity for DNA containing the primase recognition sequence (5\\'-TGGTC-3\\') than for DNA lacking the recognition site. However, this binding is drastically enhanced by the presence of the cognate Nucleoside triphosphates (NTPs), Adenosine triphosphate (ATP) and Cytosine triphosphate (CTP) that are incorporated into the primer, pppACCA. Formation of the dimer, pppAC, the initial step of sequence-specific primer synthesis, is not sufficient for the stable binding. Preformed primers exhibit significantly less selective binding than that observed with ATP and CTP. Alterations in subdomains of the primase result in loss of selective DNA binding. We present a model in which conformational changes induced during primer synthesis facilitate contact between the zinc-binding domain and the polymerase domain. The Author(s) 2010. Published by Oxford University Press.

  10. Restoration of correct splicing in IVSI-110 mutation of β-globin gene with antisense oligonucleotides: implications and applications in functional assay development

    Directory of Open Access Journals (Sweden)

    Sima Mansoori Derakhshan

    2017-06-01

    Full Text Available Objective(s: The use of antisense oligonucleotides (AOs to restore normal splicing by blocking the recognition of aberrant splice sites by the spliceosome represents an innovative means of potentially controlling certain inherited disorders affected by aberrant splicing. Selection of the appropriate target site is essential in the success of an AO therapy. In this study, in search for a splice model system to facilitate the evaluation of AOs to redirect defective splicing of IVSI-110 β-globin intron, an EGFP-based IVSI-110 specific cellular reporter assay system has been developed and a number of AOs were tested in this cellular splicing assay. Materials and Methods: A recombinant plasmid (pEGFP/I-110 carrying the EGFP gene interrupted by a mutated human β-globin intron 1 (IVSI-110 was developed and transfected into K562 cells. A number of AOs with a 2’-O-methyl oligoribonucleotide (2’-O-Me backbone system were systematically tested in this cellular splicing assay. Results: The mutation in the intron causes aberrant splicing of EGFP pre-mRNA, preventing translation of EGFP; however, treatment of the cells with specific concentration of a sequence specific 2’-O-Me AO targeted to the aberrant splice site induced correct splicing and resulted in restoring of EGFP activity. Conclusion: This cellular splicing assay provides a novel functional assay system in assessing the cellular delivery efficiency of AOs and therapeutic effect of AOs in restoration of aberrant splicing.

  11. Rescue of cardiomyopathy through U7snRNA-mediated exon skipping in Mybpc3-targeted knock-in mice.

    Science.gov (United States)

    Gedicke-Hornung, Christina; Behrens-Gawlik, Verena; Reischmann, Silke; Geertz, Birgit; Stimpel, Doreen; Weinberger, Florian; Schlossarek, Saskia; Précigout, Guillaume; Braren, Ingke; Eschenhagen, Thomas; Mearini, Giulia; Lorain, Stéphanie; Voit, Thomas; Dreyfus, Patrick A; Garcia, Luis; Carrier, Lucie

    2013-07-01

    Exon skipping mediated by antisense oligoribonucleotides (AON) is a promising therapeutic approach for genetic disorders, but has not yet been evaluated for cardiac diseases. We investigated the feasibility and efficacy of viral-mediated AON transfer in a Mybpc3-targeted knock-in (KI) mouse model of hypertrophic cardiomyopathy (HCM). KI mice carry a homozygous G>A transition in exon 6, which results in three different aberrant mRNAs. We identified an alternative variant (Var-4) deleted of exons 5-6 in wild-type and KI mice. To enhance its expression and suppress aberrant mRNAs we designed AON-5 and AON-6 that mask splicing enhancer motifs in exons 5 and 6. AONs were inserted into modified U7 small nuclear RNA and packaged in adeno-associated virus (AAV-U7-AON-5+6). Transduction of cardiac myocytes or systemic administration of AAV-U7-AON-5+6 increased Var-4 mRNA/protein levels and reduced aberrant mRNAs. Injection of newborn KI mice abolished cardiac dysfunction and prevented left ventricular hypertrophy. Although the therapeutic effect was transient and therefore requires optimization to be maintained over an extended period, this proof-of-concept study paves the way towards a causal therapy of HCM.

  12. The Cellular Processing Capacity Limits the Amounts of Chimeric U7 snRNA Available for Antisense Delivery.

    Science.gov (United States)

    Eckenfelder, Agathe; Tordo, Julie; Babbs, Arran; Davies, Kay E; Goyenvalle, Aurélie; Danos, Olivier

    2012-06-26

    Many genetic diseases are induced by mutations disturbing the maturation of pre-mRNAs, often affecting splicing. Antisense oligoribonucleotides (AONs) have been used to modulate splicing thereby circumventing the deleterious effects of mutations. Stable delivery of antisense sequences is achieved by linking them to small nuclear RNA (snRNAs) delivered by viral vectors, as illustrated by studies where therapeutic exon skipping was obtained in animal models of Duchenne muscular dystrophy (DMD). Yet, clinical translation of these approaches is limited by the amounts of vector to be administered. In this respect, maximizing the amount of snRNA antisense shuttle delivered by the vector is essential. Here, we have used a muscle- and heart-specific enhancer (MHCK) to drive the expression of U7 snRNA shuttles carrying antisense sequences against the human or murine DMD pre-mRNAs. Although antisense delivery and subsequent exon skipping were improved both in tissue culture and in vivo, we observed the formation of additional U7 snRNA by-products following gene transfer. These included aberrantly 3' processed as well as unprocessed species that may arise because of the saturation of the cellular processing capacity. Future efforts to increase the amounts of functional U7 shuttles delivered into a cell will have to take this limitation into account.

  13. A triple helix within a pseudoknot is a conserved and essential element of telomerase RNA.

    Science.gov (United States)

    Shefer, Kinneret; Brown, Yogev; Gorkovoy, Valentin; Nussbaum, Tamar; Ulyanov, Nikolai B; Tzfati, Yehuda

    2007-03-01

    Telomerase copies a short template within its integral telomerase RNA onto eukaryotic chromosome ends, compensating for incomplete replication and degradation. Telomerase action extends the proliferative potential of cells, and thus it is implicated in cancer and aging. Nontemplate regions of telomerase RNA are also crucial for telomerase function. However, they are highly divergent in sequence among species, and their roles are largely unclear. Using in silico three-dimensional modeling, constrained by mutational analysis, we propose a three-dimensional model for a pseudoknot in telomerase RNA of the budding yeast Kluyveromyces lactis. Interestingly, this structure includes a U-A.U major-groove triple helix. We confirmed the triple-helix formation in vitro using oligoribonucleotides and showed that it is essential for telomerase function in vivo. While triplex-disrupting mutations abolished telomerase function, triple compensatory mutations that formed pH-dependent G-C.C(+) triples restored the pseudoknot structure in a pH-dependent manner and partly restored telomerase function in vivo. In addition, we identified a novel type of triple helix that is formed by G-C.U triples, which also partly restored the pseudoknot structure and function. We propose that this unusual structure, so far found only in telomerase RNA, provides an essential and conserved telomerase-specific function.

  14. Synthesis of Specifically Modified Oligonucleotides for Application in Structural and Functional Analysis of RNA

    Directory of Open Access Journals (Sweden)

    Nico Rublack

    2011-01-01

    Full Text Available Nowadays, RNA synthesis has become an essential tool not only in the field of molecular biology and medicine, but also in areas like molecular diagnostics and material sciences. Beyond synthetic RNAs for antisense, aptamer, ribozyme, and siRNA technologies, oligoribonucleotides carrying site-specific modifications for structure and function studies are needed. This often requires labeling of the RNA with a suitable spectroscopic reporter group. Herein, we describe the synthesis of functionalized monomer building blocks that upon incorporation in RNA allow for selective reaction with a specific reporter or functional entity. In particular, we report on the synthesis of 5′-O-dimethoxytrityl-2′-O-tert-butyldimethylsilyl protected 3′-O-phosphoramidites of nucleosides that carry amino linkers of different lengths and flexibility at the heterocyclic base, their incorporation in a variety of RNAs, and postsynthetic conjugation with fluorescent dyes and nitroxide spin labels. Further, we show the synthesis of a flavine mononucleotide-N-hydroxy-succinimidyl ester and its conjugation to amino functionalized RNA.

  15. Oligoarginine peptides slow strand annealing and assist non-enzymatic RNA replication

    Science.gov (United States)

    Jia, Tony Z.; Fahrenbach, Albert C.; Kamat, Neha P.; Adamala, Katarzyna P.; Szostak, Jack W.

    2016-10-01

    The non-enzymatic replication of RNA is thought to have been a critical process required for the origin of life. One unsolved difficulty with non-enzymatic RNA replication is that template-directed copying of RNA results in a double-stranded product. After strand separation, rapid strand reannealing outcompetes slow non-enzymatic template copying, which renders multiple rounds of RNA replication impossible. Here we show that oligoarginine peptides slow the annealing of complementary oligoribonucleotides by up to several thousand-fold; however, short primers and activated monomers can still bind to template strands, and template-directed primer extension can still occur, all within a phase-separated condensed state, or coacervate. Furthermore, we show that within this phase, partial template copying occurs even in the presence of full-length complementary strands. This method to enable further rounds of replication suggests one mechanism by which short non-coded peptides could have enhanced early cellular fitness, and potentially explains how longer coded peptides, that is, proteins, came to prominence in modern biology.

  16. Inhibition of cell division induced by external guide sequences (EGS Technology targeting ftsZ.

    Directory of Open Access Journals (Sweden)

    Carol Davies Sala

    Full Text Available EGS (external guide sequence technology is a promising approach to designing new antibiotics. EGSs are short antisense oligoribonucleotides that induce RNase P-mediated cleavage of a target RNA by forming a precursor tRNA-like complex. The ftsZ mRNA secondary structure was modeled and EGSs complementary to two regions with high probability of being suitable targets were designed. In vitro reactions showed that EGSs targeting these regions bound ftsZ mRNA and elicited RNase P-mediated cleavage of ftsZ mRNA. A recombinant plasmid, pEGSb1, coding for an EGS that targets region "b" under the control of the T7 promoter was generated. Upon introduction of this plasmid into Escherichia coli BL21(DE3(pLysS the transformant strain formed filaments when expression of the EGS was induced. Concomitantly, E. coli harboring pEGSb1 showed a modest but significant inhibition of growth when synthesis of the EGSb1 was induced. Our results indicate that EGS technology could be a viable strategy to generate new antimicrobials targeting ftsZ.

  17. Synthesis and properties of ApA analogues with shortened phosphonate internucleotide linkage.

    Science.gov (United States)

    Králíková, Sárka; Buděšínský, Miloš; Barvík, Ivan; Masojídková, Milena; Točík, Zdeněk; Rosenberg, Ivan

    2011-01-01

    A complete series of the 2 '-5 ' and 3 '-5 ' regioisomeric types of r(ApA) and 2 '-d(ApA) analogues with the α-hydroxy-phosphonate C3 '-O-P-CH(OH)-C4 ″ internucleotide linkage, isopolar but non-isosteric with the phosphodiester one, were synthesized and their hybridization properties with polyU studied. Due to the chirality on the 5 '-carbon atom of the modified internucleotide linkage bearing phosphorus and hydroxy moieties, each regioisomeric type of ApA dimer is split into epimeric pairs. To examine the role of the 5 '-hydroxyl of the α-hydroxy-phosphonate moiety during hybridization, the appropriate r(ApA) analogues with 3 '(2 ')-O-P-CH(2)-C4 ″ linkage lacking the 5 '-hydroxyl were synthesized. Nuclear magnetic resonance (NMR) spectroscopy study on the conformation of the modified sugar-phosphate backbone, along with the hybridization measurements, revealed remarkable differences in the stability of complexes with polyU, depending on the 5 '-carbon atom configuration. Potential usefulness of the α-hydroxy-phosphonate linkage in modified oligoribonucleotides is discussed.

  18. Stereodifferentiation--the effect of P chirality of oligo(nucleoside phosphorothioates) on the activity of bacterial RNase H.

    Science.gov (United States)

    Koziolkiewicz, M; Krakowiak, A; Kwinkowski, M; Boczkowska, M; Stec, W J

    1995-01-01

    P stereoregular phosphorothioate analogs of pentadecamer 5'-d(AGATGTTTGAGCTCT)-3' were synthesized by the oxathiaphospholane method. Their diastereomeric purity was assigned by means of enzymatic degradation with nuclease P1 and, independently, with snake venom phosphodiesterase. DNA-RNA hybrids formed by phosphorothioate oligonucleotides (PS-oligos) with the corresponding complementary pentadecaribonucleotide were treated with bacterial RNase H. The DNA-RNA complex containing the PS-oligo of [all-RP] configuration was found to be more susceptible to RNase H-dependent degradation of the pentadecaribonucleotide compared with hybrids containing either the [all-SP] counterpart or the so called 'random mixture of diastereomers' of the pentadeca(nucleoside phosphorothioate). This stereodependence of RNase H action was also observed for a polyribonucleotide (475 nt) hybridized with these phosphorothioate oligonucleotides. The results of melting studies of PS-oligo-RNA hybrids allowed a rationalization of the observed stereodifferentiation in terms of the higher stability of heterodimers formed between oligoribonucleotides and [all-RP]-oligo(nucleoside phosphorothioates), compared with the less stable heterodimers formed with [all-SP]-oligo(nucleoside phosphorothioates) or the random mixture of diastereomers. Images PMID:8559657

  19. Modulation of RNase E activity by alternative RNA binding sites.

    Directory of Open Access Journals (Sweden)

    Daeyoung Kim

    Full Text Available Endoribonuclease E (RNase E affects the composition and balance of the RNA population in Escherichia coli via degradation and processing of RNAs. In this study, we investigated the regulatory effects of an RNA binding site between amino acid residues 25 and 36 (24LYDLDIESPGHEQK37 of RNase E. Tandem mass spectrometry analysis of the N-terminal catalytic domain of RNase E (N-Rne that was UV crosslinked with a 5'-32P-end-labeled, 13-nt oligoribonucleotide (p-BR13 containing the RNase E cleavage site of RNA I revealed that two amino acid residues, Y25 and Q36, were bound to the cytosine and adenine of BR13, respectively. Based on these results, the Y25A N-Rne mutant was constructed, and was found to be hypoactive in comparison to wild-type and hyperactive Q36R mutant proteins. Mass spectrometry analysis showed that Y25A and Q36R mutations abolished the RNA binding to the uncompetitive inhibition site of RNase E. The Y25A mutation increased the RNA binding to the multimer formation interface between amino acid residues 427 and 433 (427LIEEEALK433, whereas the Q36R mutation enhanced the RNA binding to the catalytic site of the enzyme (65HGFLPL*K71. Electrophoretic mobility shift assays showed that the stable RNA-protein complex formation was positively correlated with the extent of RNA binding to the catalytic site and ribonucleolytic activity of the N-Rne proteins. These mutations exerted similar effects on the ribonucleolytic activity of the full-length RNase E in vivo. Our findings indicate that RNase E has two alternative RNA binding sites for modulating RNA binding to the catalytic site and the formation of a functional catalytic unit.

  20. Alterations in tumorigenicity of embryonal carcinoma cells by IGF-I triple-helix induced changes in immunogenicity and apoptosis.

    Science.gov (United States)

    Ly, A; Francois, J C; Upegui-Gonzalez, L C; Swiercz, B; Bedel, C; Duc, H T; Bout, D; Trojan, J

    2000-12-08

    IGF-I antisense gene therapy has been applied successfully to animal models of glioma, hepatoma and teratocarcinoma. The antisense strategy has shown that tumor cells transfected with vectors encoding IGF-I antisense RNA lose tumorigenicity, become immunogenic and are associated with tumor specific immune response involving CD8+ lymphocytes. An IGF-I triple helix approach to gene therapy for glioma was recently described. The approach we have taken is to establish parameters of change using the IGF-I triple helix strategy. PCC-3 embryonal carcinoma cells derived from murine teratocarcinoma which express IGF-I were used as a model. The cells were transfected with vector which encodes an oligoribonucleotide that forms RNA-IGF-I DNA triple-helix structure. The triple-helix stops the production of IGF-I. Cells transfected in this manner underwent changes in phenotype and an increase in MHC-I and B-7 cell surface molecules. They also showed enhancement in the production of apoptotic cells (60-70%). The "triple helix" transfected cells lost the ability to induce tumor when injected subcutaneously in syngeneic 129 Sv mice. When co-transfected in vitro with expression vectors encoding both MHC-I and B-7 cDNA in antisense orientation, the "triple-helix" transfected cells were down-regulated in expression of MHC-I and B-7 and the number of apoptotic cells was significantly decreased. Injection of the doubly co-transfected cells into 129 Sv mice was associated with induction of teratocarcinoma. Comparison between antisense and triple-helix transfected cells strategies showed similar immunogenic and apoptotic changes. The findings suggest that triple-helix technology may offer a new clinical approach to treatement of tumors expressing IGF-I.

  1. Stabilization of RNA stacking by pseudouridine.

    Science.gov (United States)

    Davis, D R

    1995-01-01

    The effect of the modified nucleoside pseudouridine (psi) on RNA structure was compared with uridine. The extent of base stacking in model RNA oligonucleotides was measured by 1H NMR, UV, and CD spectroscopy. The UV and CD results indicate that the model single-stranded oligoribonucleotides AAUA and AA psi A form stacked structures in solution and the CD results for AA psi A are consistent with a general A-form helical conformation. The AA psi A oligomer exhibits a greater degree of UV hypochromicity over the temperature range 5-55 degrees C, consistent with a better stacked, more A-form structure compared with AAUA. The extent of stacking for each nucleotide residue was inferred from the percent 3'-endo sugar conformation as indicated by the H1'-H2' NMR scalar coupling. This indirect indication of stacking was confirmed by sequential NOE experiments. NMR measurements as a function of temperature indicate that pseudouridine forms a more stable base stacking arrangement than uridine, an effect that is propagated throughout the helix to stabilize stacking of neighboring purine nucleosides. The N1-H imino proton in AA psi A exchanges slowly with solvent, suggesting a role for the extra imino proton in stabilizing the conformation of pseudouridine. These results show that the conformational stabilization is an intrinsic property of pseudouridine occurring at the nucleotide level. The characteristics of pseudouridine in these models are consistent with earlier studies on intact rRNA, indicating that pseudouridine probably performs the same stabilizing function in most structural contexts. PMID:8559660

  2. Generation of Guanine – Thymidine Cross-links in DNA by Peroxynitrite/Carbon Dioxide

    Science.gov (United States)

    Yun, Byeong Hwa; Geacintov, Nicholas E.; Shafirovich, Vladimir

    2011-01-01

    Nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite, is an important chemical mediator of inflammation. In aqueous solutions, it rapidly decomposes to the reactive species CO3•− and •NO2 radicals that are known to initiate the selective oxidation and nitration of guanine in DNA. We have previously demonstrated that the reactions of carbonate radical anions with guanine in 2′-deoxyoligoribonucleotides generate a previously unknown intrastrand cross-linked guanine-thymine product G*-T* with a covalent bond between the C8 (G*) and thymine N3 (T*) atoms (Crean et al., Nucleic Acids Res., 2008, 36, 742–755). In this work we demonstrate that G*-T* cross-linked products are also formed when peroxynitrite (0.1 mM) reacts with native DNA in aqueous solutions (pH 7.5–7.7) containing 25 mM carbon dioxide/bicarbonate, in addition to the well known nitration/oxidation products of guanine such as 8-nitroguanine (8-nitroG), 5-guanidino-4-nitroimidazole (NIm), 8-oxo-7,8-dehydroguanine (8-oxoG) and spiroiminodihydantoin (Sp). The yields of these products, after enzymatic digestion with P1 nuclease and alkaline phosphatase to the nucleotide level, and reversed phase HPLC separation, were compared with those obtained with the uniformly, isotopically labeled 15N,13C-labeled 2′-deoxy oligoribonucleotides 5′-dGpT and 5′-dGpCpT. The d(G*pT*) and d(G*-T*) cross-linked products derived from the di- and tri-oligonucleotides, respectively, were used as standards for identifying the analogous lesions in calf thymus DNA by isotope dilution LC-MS/MS methods in the selected reaction-monitoring mode. The Nim and 8nitroG are the major products formed (~ 0.05% each), and lesser amounts of 8-oxoG (~ 0.02%), and d(G*pT*) and d(G*-T*) enzymatic digestion products (~ 0.002% each) were found. It is shown that the formation of d(G*pT*) enzyme digestion product can arise only from intrastrand cross-links, whereas d(G*-T*) can arise from both

  3. Generation of guanine-thymidine cross-links in DNA by peroxynitrite/carbon dioxide.

    Science.gov (United States)

    Yun, Byeong Hwa; Geacintov, Nicholas E; Shafirovich, Vladimir

    2011-07-18

    Nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite is an important chemical mediator of inflammation. In aqueous solutions, it rapidly decomposes to the reactive species CO(3)(•-) and (•)NO(2) radicals that are known to initiate the selective oxidation and nitration of guanine in DNA. We have previously demonstrated that the reactions of carbonate radical anions with guanine in 2'-deoxyoligoribonucleotides generate a previously unknown intrastrand cross-linked guanine-thymine product G*-T* with a covalent bond between the C8 (G*) and the thymine N3 (T*) atoms (Crean Nucleic Acids Res. 2008, 36, 742-755). In this work, we demonstrate that G*-T* cross-linked products are also formed when peroxynitrite (0.1 mM) reacts with native DNA in aqueous solutions (pH 7.5-7.7) containing 25 mM carbon dioxide/bicarbonate, in addition to the well-known nitration/oxidation products of guanine such as 8-nitroguanine (8-nitro-G), 5-guanidino-4-nitroimidazole (NIm), 8-oxo-7,8-dehydroguanine (8-oxo-G), and spiroiminodihydantoin (Sp). The yields of these products, after enzymatic digestion with P1 nuclease and alkaline phosphatase to the nucleotide level and reversed phase HPLC separation, were compared with those obtained with the uniformly, isotopically labeled (15)N,(13)C-labeled 2'-deoxy oligoribonucleotides 5'-dGpT and 5'-dGpCpT. The d(G*pT*) and d(G*-T*) cross-linked products derived from the di- and trioligonucleotides, respectively, were used as standards for identifying the analogous lesions in calf thymus DNA by isotope dilution LC-MS/MS methods in the selected reaction monitoring mode. The NIm and 8-nitro-G are the major products formed (∼0.05% each), and lesser amounts of 8-oxo-G (∼0.02%) and d(G*pT*) and d(G*-T*) enzymatic digestion products (∼0.002% each) were found. It is shown that the formation of d(G*pT*) enzyme digestion product can arise only from intrastrand cross-links, whereas d(G*-T*) can arise from both interstrand

  4. The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Jinzhi Tan

    2009-05-01

    Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins